Anda di halaman 1dari 7

Hasil primaclade.


Generated primers for kel1fas.fas:





++++++++++++++TTGAGATTWCCCATCATCCMC start pos=68 approx Tm=59.74 approx
%gc=42.86 length=21 rev comp=GKGGATGATGGGWAATCTCAA
+++++++++++++++++AGATTWCCCATCATCCMCTGAC start pos=71 approx Tm=60.20 approx
%gc=45.45 length=22 rev comp=GTCAGKGGATGATGGGWAATCT
+++++++++++++++++++ATTWCCCATCATCCMCTGACA start pos=73 approx Tm=60.19
approx %gc=42.86 length=21 rev comp=TGTCAGKGGATGATGGGWAAT
++++++++++++++++++++TTWCCCATCATCCMCTGACA start pos=74 approx Tm=59.89
approx %gc=45.00 length=20 rev comp=TGTCAGKGGATGATGGGWAA
+++++++++++++++++++++++++++++++RGCACTGRATTCAGAGATGAA start pos=163 approx
Tm=60.21 approx %gc=47.62 length=21 rev comp=TTCATCTCTGAATYCAGTGCY
+++++++++++++++++++GACGRSGAGAAGAGGAGCTTAGT start pos=307 approx Tm=59.69
approx %gc=52.17 length=23 rev comp=ACTAAGCTCCTCTTCTCSYCGTC
+++++++++++++++++++GACGRSGAGAAGAGGAGCTTAGTT start pos=307 approx Tm=60.87
approx %gc=50.00 length=24 rev comp=AACTAAGCTCCTCTTCTCSYCGTC
+CTCCAYGCAGTGAYGCTG start pos=352 approx Tm=60.14 approx %gc=61.11
length=18 rev comp=CAGCRTCACTGCRTGGAG
+DGGGCAGAACTGTGGCTCT start pos=440 approx Tm=60.00 approx %gc=57.89
length=19 rev comp=AGAGCCACAGTTCTGCCCH

start pos=448 approx Tm=59.78 approx %gc=61.11 length=18 rev
+CCAACCTTRCATCTGGAGR start pos=517 approx Tm=59.77 approx %gc=52.63
length=19 rev comp=YCTCCAGATGYAAGGTTGG
+CRRACAGCGACATGGTGC start pos=584 approx Tm=59.98 approx %gc=61.11
length=18 rev comp=GCACCATGTCGCTGTYYG
+CGACATGGTGCGRTTTCTC start pos=591 approx Tm=60.22 approx %gc=52.63
length=19 rev comp=GAGAAAYCGCACCATGTCG
+GACATGGTGCGRTTTCTCTT start pos=592 approx Tm=60.12 approx %gc=50.00
+ACATGGTGCGRTTTCTCTTCTAC start pos=593 approx Tm=59.67 approx %gc=43.48
+TGGTGCGRTTTCTCTTCTACAR start pos=596 approx Tm=59.88 approx %gc=40.91
+++++++++++++++++++++++++++++++++++++RTCASCACCCTCATGTCTGTC start pos=637
approx Tm=59.83 approx %gc=52.38 length=21 rev comp=GACAGACATGAGGGTGSTGAY
++++++++++++++++++++++++++++++++++++++++ASCACCCTCATGTCTGTCG start pos=640
approx Tm=59.84 approx %gc=57.89 length=19 rev comp=CGACAGACATGAGGGTGST
+CTGGTWCATCWGCACAGCAGA start pos=669 approx Tm=60.06 approx %gc=52.38
---End of Primer List---

Quick Output Key:

Lines with ---- have 0 degenerate bases

Lines with ++++ have 1 to 2 degenerate bases
Lines with **** have 3 or more degenerate bases

Degenerate Primer

Primer pair 1
Self Self 3'
Sequence (5'->3') Length Tm GC%
complementarity complementarity
TTGAGATTTCCCATCATCCCC 21 57.40 47.62 4.00 0.00
Reverse TCTGCTGTGCTGATGTACCAG 21 60.07 52.38 4.00 4.00
Products on target templates

>XM_010782319.1 PREDICTED: Notothenia coriiceps interleukin 1, beta (il1b), mRNA

product length = 586
Template 120 ........A............ 140


Template 705 ..................... 685

>XM_008288666.1 PREDICTED: Stegastes partitus interleukin-1 beta-like (LOC103362339),

transcript variant X2, mRNA
product length = 598
Template 154 .G........A........T. 174


Template 751 .GC.................. 731

>XM_008288665.1 PREDICTED: Stegastes partitus interleukin-1 beta-like (LOC103362339),

transcript variant X1, mRNA
product length = 598
Template 294 .G........A........T. 314


Template 891 .GC.................. 871

>XM_007575693.2 PREDICTED: Poecilia formosa interleukin-1 beta-like (LOC103154418), mRNA

product length = 598
Template 618 .G..............G.... 638


Template 1215 GTG..G............... 1195

>XM_015023254.1 PREDICTED: Poecilia latipinna interleukin-1 beta-like (LOC106940496), mRNA

product length = 598
Template 602 .G..............G.... 622


Template 1199 GTG..G............... 1179

>XM_014973512.1 PREDICTED: Poecilia mexicana interleukin-1 beta-like (LOC106907688), mRNA

product length = 598
Template 596 .G..............G.... 616


Template 1193 GTG..G............... 1173
Nested Test

Primer pair 1
Self Self 3'
Sequence (5'->3') Length Tm GC%
complementarity complementarity
GACGACGAGAAGAGGAGCTTAGTT 24 61.92 50.00 4.00 3.00
GAGAAACCGCACCATGTCG 19 59.21 57.89 4.00 2.00
Products on target templates

>XM_010782319.1 PREDICTED: Notothenia coriiceps interleukin 1, beta (il1b), mRNA

product length = 282
Template 344 .....A.................. 367


Template 625 ......T............ 607

>XM_008288666.1 PREDICTED: Stegastes partitus interleukin-1 beta-like (LOC103362339),

transcript variant X2, mRNA
product length = 288
Template 384 ...TC.C................. 407


Template 671 ......T........C... 653

>XM_008288665.1 PREDICTED: Stegastes partitus interleukin-1 beta-like (LOC103362339),

transcript variant X1, mRNA
product length = 288
Template 524 ...TC.C................. 547


Template 811 ......T........C... 793


1. Pembuatan primer menggunakan program bioedit harus mengambil basa

nitrogen dari family yang sama agar mendapatkan hasil yang baik dan design
primer yang lebih beragam
2. Dalam menentukan primer yang akan di BLAST harus mendapatkan data GC
dan Tm yang mirip dan untuk Tm diatas 60.00 agar mendapatkan hasil
primer yang baik.