Anda di halaman 1dari 10

MATERI BIOLOGI M.

LEPRAE

Pemahaman tentang materi biologi M.Leprae datang dari penelitian yang sudah dilakukan
menggunakan kaki mencit.

Pertumbuhan Bakteri dan perkembangan Sel

Pertumbuhan

Meskipun terjadi kegagalan berulang-ulang dalam membudidayakan M.Leprae oleh


berbagai ilmuan selama 125 tahun terakhir, banyak peneliti terus berupaya melanjutkan riset
mereka dalam membudidayakan M.Leprae secara invitro. Banyak dari upaya tersebut
dilaporkan dari India. Beberapa dari mereka melaporkan isolasi dari cocoids dan L-phase
isolasi berulang nocardia seperti organisme dari lesi kusta. Menariknya diantara upaya
invitro, organisme milik MAIS kompleks juga diisolasi. Kemungkinan pada pasien kusta bisa
disebabkan oleh organisme jenis ini. Namun M.Leprae belum pernah tumbuh pada media
axenic dengan metabolisme stabil dalam beberapa minggu.

Akibatnya propagasi M.Leprae dibatasi untuk model hewan, termasuk armadillo dan
athymic normal gen tikus. Sistem ini telah memberikan bahan dasar untuk studi genetik,
metabolisme dan antigenik dari basil. Pertumbuhan M.Leprae di bantalan kaki tikus juga
dapat dipakai sebagai alat untuk menilai persiapan kelangsungan hidup bakteri dan menguji
isolat klinis kerentanan terhadap obat.

Waktu generasi

Ini adalah waktu yang dibutuhkan oleh bakteri untuk membelah jadi dua sel. Dalam
kasus M.Leprae waktu generasi selama multipikasi logaritmik dihitung menjadi 11-13 hari.
Dengan demikian M.Leprae memiliki tingkat pembelahan lambat. Berbeda dengan
M.Tuberculosis dan mikrobakteria lain yang membutuhkan waktu generasi 20 jam. Ini
mungkin menjadi alasan mengapa kusta butuh periode inkubasi yang lama. Evolusi untuk
pembentukan gen dan genom, perampungan semua proses dapat dijelaskan dalam tiap waktu
generasi yang panjang dalam proses budaya kusta bacillus.

Suhu optimum dalam pertumbuhan

M.Leprae memiliki prefensi suhu kurang dari 37 derajat celcius untuk dapat tumbuh
optimal. Banyak penelitian menunjukkan pertumbuhan optimum dari M.Leprae diperkirakan
27-30 derajat celcius. Bukti klinis juga menunjukkan bahwa kusta terutama menyelinap pada
kulit, mukosa hidung, saraf perifer dimana suhu lebih rendah dari suhu tubuh.

M.Leprae menyebabkan infeksi sistemik pada sembilan armadillo (Dasypus


novemanus) dimana suhu inti tubuh adalah 33-34 derajat celcius obligat patogen ini telah
terbukti mempertahankan akivitas metabolik pada media axenic murni dan untuk budaya
makrofag manusia pada sel schwan tikus utama untuk beberapa minggu 33 derajat celcius,
tapi dengan cepat akan kehilangan aktivitas pada suhu 33 derajat celcius. Sebuah penjelasan
ketidak kemampuan leprae bertahan hidup pada suhu yang tinggi karena tidak ada respon
dalam bertahan.

Dosis infeksi minimum

Kaki tikus yang sudah dicoba terinfeksi pada jumlah bakteri sebanyak 1-10 baketri.

Kelangsungan hidup dan stabilitas

M.Leprae mempertahankan kelangsungan hidupnya pada suhu 4 derajat celcius


dijaringan biopsi selama 7-10 hari. Dalam jaringan hidung yang telah rusak dapat bertahan
hidup selama 7 hari pada suhu 20,6- 43,7 derajat celcius pada daerah lembab.

Mereka bisa tetap tertidur dalam jaringan inang. M.Leprae di kulit armadillo mati
diamati dan dapat hidup sampai 3 minggu, di tanah bahkan bisa sampai 5 minggu. M. Leprae
tetap bertahan hingga 5 bulan kususnya di bawah kondisi lembab, bahkan paparan sinar
matahari selama 3 jam dalam 7 hari tidak bisa membunuh bakteri dan 26,7-77,6%
kelembababn, mereka bisa bertahan hidup selama berhari-hari. Jadi, jelas bahwa sejumlah
bakteri hidup dengan kemampuan stabilitas dari luar. Bertindak sebagai potensi lepra dapat
diawetkan di laboratorium dalam nitrogen cair (-190 derajat celcius) untuk waktu tertentu.

Bahkan pada bagian kaki tikus selama bertahun-tahun patogenitas lepra tidak juga
berubah. M.Leprae yang diisolasi dari infeksi disebarkan oleh armadilo atau imunodefisiensi
dan diinokulasi kedalam tikus dewasa yang imunokompremise.

Variasi strain M.Leprae

Kemajuan dalam membaca molekul akan membuat layak/tidak layak untuk dipelajari
mengenai distribusi global dan geografis klons M.Leprae, tetapi juga untuk mengeksplorasi
kolerasi antara M.Leprae dan jenis penyakit. Memberikan wawasan evolusi sejarah dan
filogenik basil genom M.Leprae tersebar baik melalui genom intergenik. Dalam pseudogen
bisa menjadi penanda potensial untuk genotip M.Leprae, tenden (STR) adalah pola dua atau
nukleotida yang diulang dan ditempatkan berdekatan satu sama lain. STR polimorfisme
berdasarkan alat telah digunakan untuk membedakan beberapa organisme sehingga STR ini
bervariasi dalam jumlah copy polimorfisme.

Seluruh sekuensing genom dari M.leprae tandem tersebar melalui genom baik di
intragenik, daerah intergenic dalam pseudogen bisa menjadi penanda potensial untuk genotip
M. leprae. Tandem singkat (STR) adalah pola dua atau lebih nukleotida, yang diulang dalam
genom dan ditempatkan berdekatan satu sama polimorfisme STR berdasarkan lainnya telah
digunakan sebagai alat yang ampuh untuk membedakan jabaran organisme. Ulasan STR ini
bervariasi dalam jumlah copy polimorfisme panjang variabel.

Jumlah variabel pengulangan tandem (VNTR) adalah tandem urutan diulang


beberapa kali, bervariasi dalam jumlah copy polymorfisme panjang variabel menciptakan
strain yang berbeda. Primer mengapit wilayah variabel dapat dirancang untuk amplifikasi dan
sekuensing.
Sebuah single nucleotide polymorphism (SNP) adalah perubahan atau variasi
nukleotida tunggal (A, T. G, C) asam deoksiribonukleat (DNA). Perubahan terjadi selama
SNP replikasi DNA digunakan sebagai pasar evolusi, yang telah mengungkapkan pola global
jenis yang berbeda dari strain M leprae (jenis SNP 1-4), telah diidentifikasi. Monot et dalam
penelitian mereka mengamati frekuensi SNP dari M.Leprae ke clonalnature baik dilestarikan
secara alami dari jenis bakteri. Penjabaran SNP dapat membantu dalam memahami faktor
penting seperti kerentanan penyakit, lokasi nyata banyak lokus dalam bakteri dan
epidemiologi penyakit.

Untuk menentukan kesesuaian VNTRs membedakan lepra, Truman et al.


menjelaskan kegunaan sistem PCR diperiksa untuk memperkuat lima perbedaan VNTR lokus
dan dijelaskan ulasan penerapan mereka untuk menjabarakan molekul menggunakan NI 12
strain berasal dari strain Pasien, juga dari armadillo dan monyet mangabey. Mereka
menemukan keragaman reproduksi di empat VNTR Ioci. Yakni, allels GAA VNTR
jumlahnya copy bervariasi 10-16. Ulasan yang untuk AT bervariasi dalam jumlah copy 10-16,
ulasan untuk GTA bervariasi dalam jumlah copy dari 9-12 dan ulasan untuk TA bervariasi
fram copy nomor 13 20. Sebaliknya, ada variasi yang diamati CGVNTR.

Baru-baru ini, metode yang dapat digunakan untuk menjabarkan isolasi M. leprae
dengan penggunaan VNTR Ioci, dan sedikitnya 10 cells sebagai bahan awal, telah
dikembangkan dan divalidasi, yang sebagian besar memenuhi kebutuhan adalah metode
penjabaran yang murah. Beberapa alasan mengapa VNTR lebih unggul daripada SNP untuk
menjabarkan dan investigasi epidemiologi M.leprae. Pertama, VNTR loci berevolusi lebih
cepat dari SNP, dengan konsekuensi adalah bahwa VNTR menjabarkan heterogenitas jauh
lebih detail tentang genetik dari pemeriksaan jumlah setara SNP. Misalnya, dalam survei
mereka dari 100 strain M.leprae menggunakan situs SNP informatif, Monot et al.,
mengidentifikasi hanya jenis SNP, sedangkan balai diidentifikasi 465 strain, termasuk I17
jenis VNTR kusus. Ketersediaan urutan genom lengkap M.leprae telah diidentifikasi lebih
dari 50 berpotensi berguna VNTR lokus, dari mana panel dari 16 itu ditandai dengan sangat
rinci.

Sampai saat ini, 16 ulasan mereka tentang lokus VNTR telah digunakan dalam
enam penelitian survei independen di Brazil, Cina, Kolombia, India, Filipina dan Thailand.
Namun, karena data yang dilaporkan independen, belum ada analisis hasil secara
keseluruhan, untuk ke depan, Barry dkk berusaha untuk memberikan analisis yang
komprehensif, hubungan antara strain untuk menyelidiki pola migrasi penularan M.leprae.
Sejak analisis filogenetik ditemukan tidak memadai, Barry telah mengembangkan metode
alternatif, yaitu struktur tetangga clustering, yang mana memberikan isolat dengan genotipe
yang paling serupa dengan kelompok yang sama kemudian subkelompok, tanpa
menyimpulkan bagaimana strain keturunan dari nenek moyang yang sama dengan
menggunakan simulasi dan mendeteksi hubungan epidemiologi yang diharapkan dari data
eksperimen.

Hasilnya menunjukkan bahwa sebagian besar strain M.leprae dari cluster negara
tertentu bersama-sama dan bahwa isolat sesekali ditugaskan cluster yang berbeda adalah
konsekuensi dari migrasi. Selanjutnya, tiga Populasi genetik dibedakan antara isolat Filipina,
sebagai sebagai bukti masuknya strain signifikan untuk bangsa dari India. Strain referensi TN
berasal dari Filipina dan bukan dari India, diyakini sebagai bukti lebih lanjut yang diperlukan
untuk ulasan temuan mereka.
Studi tentang penjabaran materi genetik M. Leprae tergantung pada VNTH dan SNP
dari berbagai negara berkesinambungan dengan genotipe yang berbeda di Cina, sebuah
penelitian yang dilakukan di provinsi Guangdong Cina, Byli et al. isolat leprae yang
dikumpulkan dari kedua kasus lokal dan kasus emigran, Menunjukkan bahwa sebagian besar
isolat pasien lokal milik SNP tipe 1 dan tipe SAP 3 isolatts ditemukan di sebagian kecil dari
isolat lokal. Namun, semua emigran milik 10 Jenis SNP 3. Apakah itu SNP, SNP jenis 3 isolat
dari Guangdong protiles lokal ulasan VNTR mereka dekat dan perbedaan utama adalah
dalam alel Mi, 1, IA) 10 dan (GGT) 5. Mereka menyimpulkan bahwa transmisi atau dengan
jenis SNP l adalah terkait dengan Silk Road di Laut dan diperlukan untuk mengkonfirmasi
apakah transmisi pasien dengan SNP jenis tempat di Guangdong adalah dari transmisi secund
dari emigran pasien.

Dalam sebuah penelitian serupa dilakukan di Cina oleh Weng et al dalam diamati
bahwa strain VNIH terkait adalah tipe l Guangdong dan Guangxi di selatan Cina. Subset dari
strain VNRT dibedakan dari 3 jenis ulasan di provinsi ini. Meskipun sebagian besar strain
Guangdong adalah SNP versi jenis SNP dilihat di negara tetangga Liangxi dan Guangxi, SIV
22 strain menyimpang. Ketiga, strain dengan TVNTH allele terdeteksi dan di Korea
ditemukan langsung dan Anhui di Timur dan di Barat Sichuan berbatasan Tibet Keempat,
mengingat keragaman genetik keseluruhan. Strain negara endemik Qiubei, Yunnan: Xing Yi.
Guizhou dan Sichuan di seluruh Southwest berhubungan. Namun, pemeriksaan lebih dekat
menunjukkan strain lokal yang berbeda dan cluster. Para penulis menyimpulkan bahwa
wawasan ini terutama berasal dari VNTR typing mengungkapkan beberapa dan agak
diabaikan jalur bagi penyebaran kusta ke dalam, di dalam dan keluar dari China, dan
perhatian rute maritim bersejarah di Selatan dan Laut Cina Timur.

Di India, Turankar et al melakukan mengetik molekul berbasis SNP dari M.leprae


dari keluarga multicase dan lingkungan mereka untuk memahami penularan kusta,
menggunakan celah smear dan tanah sampel, yang dikumpulkan dari daerah endemis tinggi
Purulia, Benggala Barat, India. SNP menjabarkan leprae dari semua mata pelajaran PCR
positif menunjukkan jenis dan genotip SNP, dari mempelajari celah-smear dan sampel tanah,
subtyping dari sampel menunjukkan subtipe. Penelitian ini mengemukakan bahwa baik
kontak terinfeksi oleh pasien atau keduanya. Pasien dan kontak sama sumber infeksi. Hal ini
juga mengungkapkan bahwa M.Leprae jenis di tanah di mana daerah penduduk tinggal.
Pasien dari jenis yang sama seperti pasien yang ditemukan di Afrika Barat. Busso et al.,
Dilakukan sampel genotip SNP sebagai bagian pengawasan sentinel untuk jaringan resistensi
obat, Dilakukan di Mali dan Benin semua strain dipelajari diklasifikasikan sebagai SNP tipe
4, yang paling umum di Afrika Barat, 33 dari Ulasan Jenis 4 strain ini yang subtyped N (78e),
lima (12x) dan empat (10%) milik P subtipe.

Di nepal, et.al thaps telah melakukan penyelidikan epidemiologi molecularlar pada


220 Pasien di Anandaban Termasuk ditambahkan bersama dengan beberapa novel yang
VNTR lokus didiagnosis epidemiologi molekuler 22 memiliki total dilakukan Nepal. ett array
al., "(TA) Kusta lokus dalam dengan Rumah Sakit Nepal, minisatellites singkat. Baru-baru ini
dikembangkan urutan non-DNA berbasis real-time PCR resolusi tinggi mencair teknik
analisis yang digunakan cepat SNP mengetik (seperti 1, 2, 3 atau 4). di Nepal, jenis SNP
utama adalah 1 dan 2. VNTR jenis ketegangan dengan kombinasi alel baru, tidak terlihat di
tempat lain, diidentifikasi para VNTR jenis galur yang sangat cepat diselesaikan. Meskipun
tiga sub kelompok besar bisa dideteksi. Beberapa lokus, khususnya (GGT) dan 21,3,
memiliki alel karakteristik yang terkait dengan jenis SNP tipe 1 atau 2. Tidak ada hubungan
yang jelas antara proporsi SNP tipe 1 atau 2 dengan kasta atau jenis kelamin atau jenis lokasi
klinis.

Model Hewan Percobaan Untuk M. Leprae

(Untuk rincian lihat Bab 13 pada Eksperimental Kusta ke Kusta Penelitian) Kontribusi dari
Model Hewan dengan nonavailability dari media buatan untuk pertumbuhan in vitro dari M.
leprae, budidaya M.leprae di kaki tikus pada inokulasi dengan armadillo M.leprae masih
memainkan peran penting dalam mempengaruhi sifat biologis. M.leprae berperan ekstensif
dalam mengulas dua model telah membuat banyak kemajuan dalam beberapa tahun terakhir
dalam penelitian kusta.

Tikus
Tikus Imunokompeten

Pada tahun 1960, Arthur C. Shepard menunjukkan bahwa M.leprae berkembangbiak secara
terbatas di bantalan kaki belakang tikus imunologis utuh. Pengamatan pada perkalian Manner
dari M.leprae di bantalan kaki tikus menunjukkan pola karakteristik, diuraikan di bawah ini:

Lag fase: Berlangsung selama 3-6 bulan setelah inokulasi, tidak menunjukkan
perbanyakan leprae.
Logaritiimic: Biasanya dimulai 6 bulan setelah inokulasi, menunjukkan perkalian
aktif M. leprae hingga 10 per kelompok.
Fase stasioner Biasanya 12 bulan, menunjukkan tidak ada perkalian lanjut.

Percobaan menyimpulkan bahwa tikus dewasa yang immunocompeten, ukuran inokulum


kurang dari 10 bisa multiplikasi lebih dari 10, dimulai sebagai imunogen di tikus, Mencegah
perkalian lanjut kusta basil.

Tikus imunodefisiensi artifisial imunosupresi atau alami immunoden tikus efisien, setelah
inokulasi ukuran lebih dari 10 perbanyakan M.leprae bisa mencapai lebih dari 10 dan mereka
juga menunjukkan kelangsungan hidup lama dan klinis inokulasi jelas.

Banyak model hewan imunosupresi / Immunodeficient telah dipelajari. Mereka:

Tikus dewasa iradiasi thymectomized


Hewan pengerat
Hewan lain yang diteliti neonatal thymectomized tikus kongenital athymic tikus.

Hewan Percobaan Lainnya

Armadillo
Sembilan banded armadillo (Dasypus nowemcinctus Linn.) Yang ditemukan di Amerika
Serikat Selatan menunjukkan untuk mengembangkan LL kusta ketika eksperimental
terinfeksi oleh Kirchheimer dan Starrs Pada inokulasi 10 M.Leprae intravena ke armadillo,
berkembang penyakit progressive umum dengan kusta basil / jaringan dalam hati limpa dan
kelenjar getah bening.
Primata non-manusia
Hasil eksperiman memperlihatkan bahwa penyakit ini disebarkan pada simpanse, tangan
putih monyet rhesus. "Monyet mangabey Sooty dikembangkan infiltrasi luas dengan clating
dari jari-jari kaki duriag perjalanan penyakit: lesi dan monyet hijau Afrika dikembangkan
adalah multibacillary (MB) kusta dan lepra polymeuritic dalam waktu 4-6 bulan.

RESISTENSI OBAT

Bukti bakteriologis munculnya resistensi obat strain M.leprae sebagai penyebab


kekambuhan pada pasien yang diobati tergantung pada penerapan teknik pada kaki tikus, ini
melibatkan identifikasi multiplikasi bakteri pada tikus diperlakukan menerima diet yang
mengandung dosis obat lebih dari dosis efektif minimum (MED) untuk obat masing bukti
bakteriologi. Pertama resistensi obat untuk diamino diphenyl sulphone (DDS) ditunjukkan
ketika M leprae dari tiga kambuh LL Pasien yang menerima DDS tidak dihambat dari
mengalikan di DDS diperlakukan tikus di dosis 1.000 kali lipat di atas MED untuk DDS.
Munculnya resistensi obat selama pengobatan (Yang dimaksud dengan resistensi obat
sekunder) terbatas kusta MB. Hal ini disebabkan fakta bahwa frekuensi mutan yang resistan
terhadap obat dalam populasi bakteri tidak pernah lebih besar dari satu per juta bakteri dan
populasi bakteri ukuran ini hanya hadir pada pasien dengan kusta MB. Resistensi utama DDS
Mengacu pada Pasien yang tidak pernah menerima DDS tapi hadir dengan strain DDS-tahan
dari M. leprae. Kasus pertama perlawanan primer DDS itu dilaporkan dari Ethiopia.
Dilaporkan telah dari banyak negara di seluruh dunia, di mana resistensi DDS sekunder
adalah umum.

Rifampisin, Meskipun obat yang sangat bakterisida dan digunakan pada kusta sejak
tahun 1970, dua mutan resisten rifampisin telah dilansir Kemudian, resistensi Rifampicni itu
dilaporkan antara 39 kambuh oleh Grosset al. pada tahun 1989. M.leprae tahan rifampicin
muncul satu langkah mutan pada pasien sebelumnya telah menerima monoterapi dengan
Rifampicin. Meskipun resistensi DDS bersama resistensi Rifampicin, telah laporan di tempat
lain. Resistensi rifampisin antara Pasien yang menerima terapi obat multi (MDT) baru-baru
ini dilaporkan dari India. Namun, laporan dari Southern India menunjukkan 19% dari leprae
isolat dari sampel dibiopsi kusta Pasien resisten terhadap Dapson, Rifampicin, atau strain
Clofazimir resisten. Dilaporkan dalam penelitian ini memiliki resistansi rifampisin rendah
(terhadap 0,003% dari rifampisin dalam diet). Perlawanan terhadap clofazimine melaporkan
telah beberapa studi. Perlawanan terhadap Ofloxacin juga telah dilaporkan pada tahun 1996.

Mekanisme molekuler resistensi obat

(Lihat Bab 40 tentang Resistance Obat leprasy)

Dapson adalah sulfon sintetis, struktural dan fungsional yang terkait dengan sulfonamide obat
dan target dihydropreroale synthase, enzim kunci dalam folat binsynthesis jalur akting
sebagai inhibitor kompetitif bakteri, dapson asam p-aminobenzoic juga telah ditunjukkan
untuk target folat biosintesis jalur M leprae.

Mutasi spesifik dalam asam mengikat situs p-aminobenzoat sangat kekal dari Escherichia coli
synthase, gen folp dikodekan mengakibatkan perkembangan resistensi dapson. "Bukti baru
dari M.leprae dalam sekuensing genom telah menunjukkan sumber daya M.leprae memiliki
dua homolog (folp UolPI dan folp2). Melalui studi genetik pengganti dengan smegmuti.
Hubungan antara resistensi dapson dan synthase dihidropteroat dari leprae telah ditetapkan
mutasi rasa Mis dalam kodon 53 dan resistance sulfon Menentukan Tegi dari folpi,
mengakibatkan pengembangan resistensi dapson tingkat tinggi di M.leprae pengamatan
serupa juga telah dilaporkan dari India.

Rifampisin adalah komponen kunci dari semua bakterisida yang direkomendasikan. Regimen
kemoterapi anti-lepra untuk rifampisin dalam panggilan mycobacteria E adalah subunit B
dari polimerase RNA dikodekan oleh pola perbandingan struktur primer menyimpulkan
protein subunit dari beberapa 11 saham menunjukkan bahwa regians fungsional sangat kekal
umum untuk enzim ini di mycobacteria.

Resistensi mikobakteri untuk Rifampicun berkorelasi dengan struktur changesinthe mahkota


B- dari RNA polimerase DNA-dependent, terutama karena merasakan mutasi dalam kodon
dari wilayah yang sangat lestari dari gen prob, Disebut sebagai resistance Rifampicin
Menentukan daerah. "Perlawanan Rifampicin di M.Leprae juga berkorelasi dengan mutasi
rasa mis dalam rpoB wilayah ini. Substitusi dalam kodon Ser 425 telah terbukti menjadi
mutasi yang paling sering dikaitkan dengan perkembangan fenotip rifampisin tahan di leprae.

Ciofazimine diganti iminophenazine aktivitas antimycobacterial untuk yang mekanisme telah


sepenuhnya clofazimine mencapai tingkat intraselular tinggi di sel fagosit mononuklear,
eliminasi metabolik adalah memiliki efek anti-inflamasi dan lambat, kejadian resistensi untuk
itu di M leprae rendah. Hal ini sangat dan Muncul untuk mengikat secara istimewa untuk
DNA mikobakteri, obat untuk DNA Muncul terjadi terutama di urutan basa mengandung
guanin. Thus menjelaskan preferensi untuk G + C yang kaya genom mycobacteria lebih
Lysophospholipids DNA manusia Muncul untuk menengahi aktivitas beberapa bakteri Gram
positif. "Namun, tidak jelas apakah mekanisme ini tindakan adalah operasional di leprae.
Sejak clofazimine dapat bertindak melalui mekanisme yang berbeda, itu tidak sulit, untuk
memahami mengapa hanya beberapa kasus kusta clofazimine tahan telah dilaporkan selama
bertahun-tahun.

Diagnosis laborat untuk leprosy

Sejak sebagian besar kasus kusta yang PH juga di alam dan M. leprae tidak diolah, diagnosis
laboratorium kusta dan penentuan kelayakan M leprae selalu menjadi tantangan. Selama
bertahun-tahun, dengan perkembangan teknologi, banyak usaha yang dibuat seadanya salah
satu teknik laboratorium selama Ulasan ini termasuk metode mikroskopis pewarnaan, tes
metabolik, teknik radiolabeled, metode molekuler, dll.

Slit smear skin

Pemeriksaan laboratorium untuk diagnosis pasien kusta, klasifikasi dan pemantauan


kemoterapi tradisional telah dependingon pemeriksaan smear celah-kulit. pemeriksaan smear
kulit Dilakukan oleh teknik. Situs kulit yang dipilih dibersihkan dengan kapas yang dibasahi
semangat dan dibiarkan kering. Selanjutnya, kulit dicubit sampai ke kali lipat antara jari
telunjuk dan ibu jari, melakukan tekanan cukup untuk menghentikan atau meminimalkan
pendarahan. Sebuah potongan bersih, sekitar mm panjang dan cukup dalam (3 mm), untuk
masuk ke lapisan menyusup dari dermis, dibuat dengan pisau bedah steril. Kemudian pisau
scalpel dihidupkan melalui 90 "dan menggunakan ujung tumpul dari pisau sisi dipotong
dikerok dua atau tiga kali Cukup, Mendapatkan bubur jaringan dari bawah epidermis. Bahan
ini kemudian ditransfer dari ujung pisau bedah pisau ke kaca mikroskopis geser menyebar
ratakan dengan gerakan melingkar dengan datar pisau untuk menghasilkan seragam dan
smear cukup tebal di atas lahan seluas 5,7 mm. Dua sampai empat UKM dapat ditempatkan
pada satu slide dan hati-hati berlabel Kemudian thi ternoda oleh pewarnaan cepat asam, suhu
kamar sebaiknya undemaken The smear yang mikroskopis Diperiksa untuk mengukur timbal
dalam bentuk index (Bl) mriheud ini membantu dalam estimasi dari total jumlah ofAf leprae
thi layak dan mati, menyajikan jaringan sampel adalah frit tanggal estimasi proporsi yang
layak st ierinaramonist populasi bakteri dalam penyelidikan adalah requites kurang sensitif
minimal 10 iti AFB ml.
Pewarnaan Fluoresco diasetat etidium bromida

Sel hidup dapat diwarnai fluorescein diasetat (FDA) untuk berpendar sementara sel-sel mati
merah ethidium bromide LEB hijau noda. Proporsi sel diwarnai hijau dengan metode
pewarnaan ini telah diamati berkorelasi dengan pupulations layak dan beberapa sel eukariotik
prokaryatic. Ulasan teknik ini telah distandarkan untuk mycobacteria, Termasuk leprae M
untuk specimens langsung, serta menilai pertumbuhan viabiliry jauh di makrofag. Mereka
aplikasi LL kusta Pasien menunjukkan bahwa ini guod parameter untuk monituring tren
tanggapan kemoterapi SIRST teknik bisa, karena itu, digunakan untuk mengkonfirmasi
kambuh, Asalkan sampel berurutan dipelajari dan batas statistik didefinisikan periistence dari
pewarnaan hijau sinyal beberapa waktu setelah kematian dan kurangnya dari penerapan untuk
Pasien dengan PB leprosy adalah keterbatasan utama metode ini.

Penentuan biomasa basiler Adenosine triphosphate ATP

Estimasi kandungan ATP telah establ sebagai parameter penting untuk penentuan biomassa
yang layak dari mamalia yang berbeda, spesies bakteri eukariotik lainnya. Technik untuk tes
ATP mycobacteria, M. Termasuk Ieprae, telah dikembangkan mengoptimalkan teknik untuk
kondisi ekstraksi dan uji, uji ATP telah diamati untuk mendeteksi teknik sel mikobakteri
bahkan serendah 100 layak telah berhasil diterapkan untuk memantau tren tanggapan
terhadap kemoterapi, serta untuk menunjukkan persisters.

Tes menggunakan substrat radiolabeled Beberapa metode vitro berdasarkan penggabungan /


pemanfaatan berbagai substrat dalam kondisi media yang bebas sel telah diterbitkan. Ulasan
tes ini didasarkan pada penyerapan dopamin berlabel (DOPA) timidin penggabungan INC
asam palmitat atau glikolipid fenolik dari M leprae. Oksidasi pengukuran "asam palmitat C-
ke Uco, M.leprae dilakukan dengan menggunakan jenis Buddemeyer dari sistem
penghitungan atau BACTEC 400 sistem. Ulasan tes ini telah dilaporkan untuk menjadi drus
berguna untuk skrining sensitivitas menggunakan basil Panen dari Pasien dan hewan
percobaan.

Identifikasi molekuler dengan Polymerase Chain Reaction

Tes molekuler yang cepat untuk mendeteksi M. leprae Langsung dari spesimen pasien
menggunakan data genetik yang tersedia M leprae telah dikembangkan. Ulasan tes ini telah
didasarkan pada amplifikasi M. leprae fragmen DNA yang spesifik. Banyak dari M. leprae
gen dan urutan seperti hsp18, ag36, groEL. 16s ribonukleat RNA (rRNA), RLEP, dll, telah
ditargetkan dalam pengembangan polymerase chain reaction (PCR). Ulasan teknik ini telah
diterapkan tidak hanya dalam sampel biopsi kulit, tetapi juga Beberapa spesimen yang
berbeda, seperti smear kulit, smear hidung, parafin-embedded sampel biopsi kulit, darah, lesi
saraf, lesi mata, dll analisis RNA menggunakan 16S rRNA dan sebaliknya transkripsi PCR
telah ditambahkan benefitof kelangsungan hidup juga. Ulasan berbasis teknik PCR PCR
berbasis dan reverse transkripsi ini telah menunjukkan spesifisitas 100% dan sensitivitas
berkisar 34-80% di kusta dan lebih besar dari 90% di MB bentuk kusta.

Metode untuk Pengujian Viabilitas

Baru-baru ini, menggunakan metode komersial langsung / mati dengan bact Light
flowcytometry, Guerrero et al., '' Di Kolombia telah berusaha untuk menilai kelayakan dari M
leprae dalam sampel dari MB Pasien yang diobati dengan MDT mendapatkan potongan
pemadam populasi versusviable nonviable. Populasi bakteri yang layak diamati untuk
berbeda antara Ulasan mereka yang dirawat dengan 12 dosis dan 24 dosis, pengobatan
mendukung 24 bulan. Selanjutnya, 56,7% Pasien setelah 24 bulan pengobatan dengan MDT
WHO memiliki basil yang layak.

Didasarkan pada prinsip bahwa real-time PCR (RT-PCR) telah potensi mendeteksi RNA,
yang yang secara tidak langsung menunjukkan status kelangsungan hidup organisme,
Turankar et al., Berusaha mendeteksi basil yang layak dari sampel lingkungan di daerah
penduduk kusta aktif kasus, di saku endemik Purulia, Benggala Barat, India. RT-PCR untuk
16S rRNA gen dilakukan untuk mendeteksi layak M. leprae, dari sampel positif untuk
wilayah RLEP dari M leprae DNA. 48,6% dari sampel tanah dan 16,5% air positif untuk M.
leprae DNA Menunjukkan kehadiran layak basil lingkungan Moist memiliki kehadiran yang
lebih tinggi dari basil yang layak, dibandingkan dengan mengeringkan lingkungan,
Menunjukkan leprae yang lebih baik di tempat-tempat lembab. sampel lanjut dikumpulkan
dari area kontrol, di mana tidak ada kasus aktif tidak menunjukkan kusta basil yang layak.
Penulis menyimpulkan bahwa kusta pasien debit atau gudang ke layak ulasan leprae
lingkungan sekitar mereka (tanah dan Wate which mungkin leprae sebagai reservoir potensial
yang mungkin memainkan peran fokus dalam penularan penyakit.

Mikrobakterium leprosis

Pada tahun 2008, Han et al, melaporkan isolasi dari spesies Mycobacterium baru dari dua
pasien Meksiko yang meninggal di Phoenix, Arizona, Amerika Serikat (AS) dengan kusta
diffuse lepromatous (DLL) dan lesi kulit necrotizing luas. Menunjukkan vasculitiswith biopsi
dari lesi baik BTA di makrofag. Diagnosis dalam kedua kasus itu kompatibel dengan reaksi
Lucio. Han et al. mengusulkan lepromatosis nama M.leprae untuk agen penyebab penyakit
karena hubungan dekat genetik untuk M.leprae dan asosiasi jelas dengan AFB (strain F1924)
dari kasus pertama diidentifikasi amplifikasi gen 16S rRNA dengan PCR, kloning dan
sekuensing. Tiga gen lain yang diperkuat dan sequencing langsung tanpa cloning menjaga
gen hsp65 (65 kDa heat shock protein), rpoB (untuk RNA polimerase p subunit) untuk
analisis filogenetik lebih lanjut dan gen rpot (untuk RNA polimerase faktor) untuk analisis
mengulangi tandem. Dalam kasus 2, blok jaringan paraffin-embedded, dikirim laboratorium
untuk analisis genetik. Setiap spesies memiliki penandatangan gen 16S rRNA dan bahwa
urutan perbedaan Sekitar 3% antara spesies yang paling dekat bentuk kriteria utama untuk
definisi spesies. analisis BLAST dari gen 16S rRNA 1504-bp strain F1924 Menunjukkan
bahwa organisme itu terkait erat dengan, tetapi berbeda dari, Mleprae lmatching i 475 dari
1.506 bp (979 'Sebuah pohon filogenetik Menunjukkan bahwa itu turun bersama dengan M
leprae dari nenek moyang yang telah bercabang dari mikobakteri lainnya. Berdasarkan
analisis genetik komparatif mereka, para penulis menyimpulkan bahwa perbedaan genetik
yang cukup signifikan untuk mengusulkan spesies baru. analisis lebih lanjut dari gen lainnya
antara strain M. leprae, por telah terbukti mengandung tiga atau empat mengulangi tandem
dari urutan GACATC. The rpor dari F1924, sementara pencocokan 88% (449/510) secara
keseluruhan dengan M leprae, juga terdapat empat ulangan tersebut. Selain itu, F1924 rpot
Juga terdapat tiga mengulangi dari urutan CGAGCCACCAATACAGCATCT which Muncul
unik dan absen dalam genom M. Leprae.

Han et al lanjut Analisa urutan dari 20 gen dan pseudogen (22,814). Secara keseluruhan,
tingkat pencocokan Ulasan urutan ini dengan urutan M adalah 90,9%, yang mana dibuktikan
perbedaan spesies-tingkat tingkat cocok untuk gen 16S rRNA dan 14 protein pengkodean gen
yang 98% dan 93,1%, masing-masing, namun tingkat cocok untuk lima PSE hanya 79,1%
pohon filogenetik Kuat dibangun menggunakan keselarasan bersambung dari lima protein-
encoding gen dilestarikan ditempatkan M. lepromatosis dan M leprae dalam cluster ketat
dengan cabang terminal lama, implving bahwa perbedaan itu terjadi lama. Thus Ulasan Hasil
ini menunjukkan bahwa MI dan M leprae menyimpang lepromatosis juta tahun yang lalu.
Selanjutnya, Cabrera et al. "Dilaporkan bahwa selama penelitian surveilans resistensi obat
kusta diarsipkan spesimen biopsi dari Monterrey, Meksiko, diamati bahwa spesimen (MX1
22A) dari DLL Memberi kasus hasil tes negatif untuk POR menargetkan M leprae Juga folPI
dan lokus dan M . sekuens berulang leprae tertentu RLEP mengkonfirmasikan adanya M
leprae DNA, Meskipun th sampel menghasilkan produk ketika primer rpoh digunakan
Setelah analisis urutan sebagai gen rpoB ada w beberapa ketidaksesuaian dengan urutan M
leprae tapi ada identitas 100% dengan urutan yang sesuai dari M. lepromatosis F1924

Selanjutnya, analisis genetik menggunakan primer Dijelaskan oleh Han et al., Bersama-sama
dengan set tambahan primer yang bisa memperkuat urutan sigil dari kedua M. lepr dan
spesies lepromatosis F1924, menyebabkan identifikasi ambigu dari sampel Mx1-22 sebagai
M, lepromatosis. Seperti M. leprae, M. Iepromatosis tidak dapat dibudidayakan pada media
buatan, juga saham fitur lainnya, seperti kandungan GC sangat rendah untuk Mycobacterium
(57,8%), kehadiran pseudogen, AT-kaya sisipan unik di 16SrRNA gen, dan identik tandem
enam basis mengulangi di sig Kasus Mt. Infeksi lepromatosis telah dipamerkan morbiditas
dan bahkan kematian jauh lebih tinggi dari kasus infeksi M. leprae. Namun, dengan
pengecualian sequencing DNA langsung dari daerah resistance Rifampisin Menentukan
(RRDR), tak satu pun dari tes POR saat ini untuk M. leprae dapat mendeteksi M
lepromatosis, yang berarti bahwa kasus infeksi oleh baru Dijelaskan kusta bacillus mungkin
tidak terdeteksi, sehingga membahayakan pemulihan pasien.

KESIMPULAN DAN RENCANA MASA DEPAN

Prospek M.leprae, meskipun menjadi salah satu mikro-organisme yang tertua diidentifikasi,
telah banyak teka-teki yang belum terjawab sekarang, Bakteriologi kusta menjadi lebih jelas
setelah urutan genom dari M. leprae selesai. Mikrobiologi molekuler telah mulai menjelaskan
beberapa faktor intrinsik seperti sifat teliti dari M.leprae dan kecenderungan untuk hidup
intraseluler. Masih ada banyak daerah abu-abu dalam pemahaman biologi M. leprae.
Tantangan dalam diagnosis laboratorium dapat diatasi dengan pengembangan alat molekuler
yang sangat sensitif dan spesifik. Masalah yang melekat dari memakan waktu dan alam
teknik melelahkan dalam penelitian pada kaki Tikus konvensional menentukan kelangsungan
hidup dan pemutaran kerentanan terhadap obat dapat diatasi dengan penyempurnaan lebih
lanjut dari tes molekuler berbasis PCR dalam waktu dekat. Namun, ketidakmampuan
M.leprae untuk tumbuh in vitro masih akan terus menjadi teka-teki bagi ahli bakteri.
Diharapkan setelah sukses memetakan genom M.leprae, pengetahuan yang diperoleh di M
lepraegenomics, proteomik dan bioinformatika dapat terintegrasi untuk lebih memahami dan
memudahkan teka-teki sekitar M. Leprae.