Anda di halaman 1dari 7

RisalahSemmarIlmiah Peneli/iandonPengembangan

Aplikasi ls%p daDRadiasi,2004

UJI PCR (POLYMERASE CHAIN REACTION) UNTUK DETEKSI


VIRUS HEPATITIS C.
Lina, M,R,., BudimanBela.., dan DadangS,.
.Puslitbang Teknologi Isotop dan Radiasi, BATAN, Jakarta,
..Bagian Mikrobiologi, Fakultas Kedokteran, Universitas Indonesia, Jakarta.

ABSTRAK

UJI PCR {POLYMERASE CHAIN REACTION}UNTUK DETEKSI VIRUS HEPATITIS


C. Telah dilakukan penelitian uji teknik PCR untuk mendeteksi adanya virus hepatitis C dalam
serum darah. Jumlah sampel serum darah yang digunakan adalah 50 buah berasal dari
laboratorium rumah sakit RSCM clan laboratorium PMI. Perlakuan awal sampel untuk
mengekstraksi RNA virus dilaksanakan dengan metoda BOOM yaitu menggunakan guanidin
tiosianat untuk lisis sel virus clan diatom untuk mengikat RNA virus. Proses reversetranscription
untuk mensintesis cDNA yang berasal dari RNA virus basil ekstraksi serum darah, dilakukan
dengan menggunakan enzim reverse transcriptase clan RNA-se inhibitor. Amplifikasi cDNA
dilaksanakan dengan teknik PCR (nested PCR) yaitu dilakukan 2 kali proses PCR untuk tiap
sampel dengan menggunakan 2 pasang primer oligonukleotida. Hasil amplifikasi dari proses PCR
dideteksi dengan teknik elektroforesis gel agarosa clan pewarnaan etidium bromida, selanjutnya
divisualisasi menggunakan UV transilluminator. Dari 50 buah sampel serum darah yang diteliti,
menunjukkan adanya virus hepatitis C dalam 13 sampel serum yang dinyatakan dengan adanya
pita DNA spesifik pada gel agarosa.

ABSTRACT

POLYMERASE CHAIN REACTION (PCR) ASSAY TO DETECT HEPATITIS C


VIRUS. Research on the detection of hepatitis C virus in blood serum using PCR technique has
been carried out. Amount of 50 blood serum from laboratory of Indonesia Red Cross (Palang
Merah Indonesia -PMI! and RSCM hospital as samples, were used in this research. Lysis of
virus cell and extraction of RNA virus as a preliminary treatment of the sample, was done with
BOOM method using guanidine thiocyanate and diatomaceous earth, respectively. Syntesis of
cDNA from RNA as an extraction product mentioned above, was carried out by means of
reverse-transciptase and RNA-se inhibitor. Amplication of cDNA was done with nested PCR
technique that was performed with two times PCR processes using two pairs of oligonucleotide
primers for each process. The amplified DNA was detected by agarose gel electhrophoresis and
ethidium bromide staining. Subsequently, the DNA was visualized with UV transilluminator.
Result shows that of 50 blood serum samples, 13 serum were positive for RNA HCV that were
performed with the present of spesific DNA band on agarose gel.

PENDAHULUAN keterkaitan infeksi HCV dengan kanker hati.


Daya penularan penyakit ini sangat tinggi
Virus hepatitis C (HCV) ditemukan pada terutama di negara berkembang clan padat
tahun 1989 dan merupakan penyebab utama penduduknya termasuk Indonesia. Saat ini
hepatitis non A non B pasca transfusi (1, 2). prevalensi hepatitis C diantara donor darah
Virus ini dapat menyebabkan penyakit liver akut, bervariasi antara 0,1 -0,3% di Eropa Barat clan
kronik, sirosis hati yang berpotensi menjadi Amerika Utara sedangkan di Jepang sampai
kanker hati I(hepatocellular carcinoma /HCC) (3, 4, 1,2%. Hal ini dikemukakan oleh ALTER dalam
51. Pada umumnya infeksi HCV menunjukkan WIDJAJA (7), sedangkan menurut
gejala ringan bahkan ada pengidap yang tidak BUDIHUSODO dkk. (9), prevalensi di Indonesia
menunjukkan gejala, meskipun demikian 50% 0,5 -3,4% (9). Salah satu faktor penularan HCV
daTi individu yang terinfeksi terlihat berkembang antara lain adalah daTi organ maupun jaringan
menjadi hepatitis kronik, dan 20% menjadi yang terinfeksi HCV yang ditransplantasikan
sirosis 16). Menurut COLOMBO dkk, NISHIOKA (10, 11,12) Hasil penelitian PEREIRA dkk (10)
dkk, dan KHAN dkk yang dikutip oleh WIDJAJA menyatakan prevalensi anti HCV dalam donor
(7) dan BRUIX 18), mengemukakan adanya darahjenazah adalah 1,8% (13 daTi 716 donor).
Risalah Seminar I/miah Peoelitian daD Pengembangan Aplikasi [salop daD Radilsi 2004

Pada transplantasi jaringan biologi, faktor- aseton. Pelet dikeringkan dalam waterbath pada
faktor penyebab penyakit setelah transplantasi suhu 56C 10 menit, kemudian ditambah larutan
antara lain karena infeksi kuman clan virus. TE, divortex clan diinkubasi pada suhu clan
Oleh karenanya, jaringan biologi tersebut yang waktu yang sarna, kemudian disentrifugasi pada
berasal daTi donor hidup maupun jenazah, harus 12.000 rpm. Supernatan yang mengandung RNA
bebas daTi kuman penyakit clan virus seperti HCV dipisahkan yang selanjutnya akan
HBV, HCV, clan HIV. digunakan pada proses reverse transkripsi untuk
Oalam perkembangan Bank ]aringan di pembuatan cDNA.
Indonesia khususnya Bank ]aringan Riset Batan, Proses Reverse Transkripsi. RNA yang
sangat diperlukan penelitian sehubungan dengan diperoleh diinkubasi pada 56C selama 10 menit
penyediaan jaringan biologi berkualitas tinggi lalu secepatnya dimasukkan ke dalam es. Dari
(13) Penelitian yang sangat perlu dilaksanakan larutan tersebut diatas diambil 5~1 dimasukkan
adalah deteksi ageD penyebab penyakit ke dalam 20 ~l campuran pereaksi untuk proses
khususnya virus (HBV, HCV, HIVI daTi donor reverse transkripsi yang terdiri daTi Ix larutan
organ maupun jaringan melalui pemeriksaan bufer, 200 unit Moloney Murine Leukemia Virus
darahnya. Oeteksi yang biasa dilakukan untuk ReverseTranscriptase (MMLV-R7'), 30 unit RNA -
mengetahui adanya infeksi virus adalah dengan se inhibitor, 80 pmol random primer, 0.5 mM
penanda serologi. Pada infeksi HCV, diagnosis masing-masing dNTP, 10 mM larutan
didasarkan pada adanya anti HCV dalam serum ditiothreitol clan air DEPC. Sintesis cDNA
darah, menggunakan teknik ELISA (Enzyme dilakukan dengan menginkubasi campuran
Linked Immunosorbent Assay) yang dapat tersebut di atas pada suhu 3~C selama satu jam
dilanjutkan dengan teknik RIBA (Recombinant clan kemudian dipanaskan pada air mendidih
Immunoblot Assay) untuk meningkatkan selama satu menit.
spesifikasi (3, 14) Cara deteksi yang lebih sensitif Proses Amplifikasi DNA. Proses Amplifikasi
clan spesifik adalah dengan mendeteksi RN A dilakukan dengan metode nested PCR
HCV dengan teknik RT -PCR (Reverse menggunakan 2 pasang primer yang didesain daTi
Transcriptase Polymerase Chain Reaction) (6, 10, 5' Non Coding Region (NCR). Campuran pereaksi
14, 15, 16). Metode ini sangat penting terutama PCR pertama terdiri daTi 5 ~l larutan cDNA, 50
pada window period, peri ode dimana telah terjadi pmol masing-msing primer dengan sekwens yang
infeksi HCV tetapi antibodi belum telah dipublikasi oleh HOUGHTON yang dikutip
terbentuk/terdeteksi. Oleh karenanya PCR oleh WIDJAJA (7) (5'
merupakan metode diagnostik standar untuk CCACCATAGATCTCTCCCCTGT) clan (5'
infeksi HCV kronik maupun akut misalnya pada ATACTCGAGGT GCACGGTCTACGA), 0.2 mM
pasien yang immunosupressed seperti resipien masing-masing dNTP, 3 unit Taq polymerase, Ix
transplantasi ginjal. bufer PCR , 2,5 mM MgClz clan 0,01 % gelatin.
Jumlah siklus yang dipakai adalah 35 siklus
dengan tahap denaturasi 96C 30 detik, annealing
BAHAN DAN METODE 48C 45 detik, extension noc 60 detik clan
extended extension noc 6 menit. Proses PCR
Ekstraksi RNA HCV daTi Serum Darah. yang kedua dilakukan dengan mencampur 2 ~l
Serum darah yang digunakan berjumlah 50 basil PCR yang pertama dengan campuran
terdiri daTi 25 serum darah daTi laboratorium pereaksi seperti pada proses PCR pertama. Primer
rumah sakit Rumah Sakit Cipto Mangunkusumo oligonukleotida yang digunakan
(RSCMj yang telah dideteksi dengan basil RNA (5'AGATCTrCACGAAGAAAAGCGT) clan
positif secara kuantitatif. Dua puluh lima serum (5'CACTCTCGAGCACCCTATCAGGCAGT).
darah yang lain berasal daTi laboratorium Palang Jumlah siklus yang dipakai 30 siklus dengan
Merah Indonesia terdiri daTi 20 serum positif clan kondisi PCR sarna dengan proses PCR pertama.
5 serum negatif HCV berdasarkan basil deteksi Deteksi DNA Hasil Amplifikasi. Fragmen
secara serologi menggunakan teknik ELISA. DNA basil proses PCR setelah ditambah dengan
Metode yang digunakan untuk ekstraksi RNA loading bufer dianalisis dengan teknik
serum tersebut di atas adalah metode BOOM elektroforesis gel agarosa dengan konsentrasi
menggunakan bUreTlisis yang terdiri daTi larutan agarosa sebesar 1,5% (b/v). Proses elektroforesis
guanidin tiosianat, Tris -HCI, EDTA clan triton dilakukan dalam bufer TBE (Tris-Borat-EDTAj
X 100 (bufer lisis L6 clan bUreT pencuci L2j. dengan voltase konstan (100V). Visualisasi DNA
Sampel darah ditambah dengan bUreTlisis L6 clan yang telah dielektroforesis, dilakukan dengan
larutan diatom kemudian divorteks, digoyang mewarnai gel dengan larutan etidium bromida
clan diinkubasi kemudian disentrifugasi 12.000 clan memaparkan gel di bawah UV
rpm. Selanjutnya dicuci dengan bUreT pencuci transilluminator. Penentuan ukuran berat
L2 clan diendapkan dengan etanol 70% clan
RisalahSeminarIlmiah Penelitiandon Pengembangan
Aplikasi lsotopdon Radiasi 2{XJ4

molekul fragmen DNA basil amplifikasi sampel serum. Faktor lain yang lebih penting
dilakukan dengan menggunakanpenanda berat adalah desain primer sangat mempengaruhi
molekul (marker! Hae III 0X174. efisiensi proses amplifikasi PCR. Dalam
penelitiannya dinyatakan beberapa sampel serum
yang positif HCV dengan menggunakan primer
HASIL DAN PEMBAHASAN yang dirancang daTi daerah 5-UT hasilnya negatif
dengan pasangan primer lain. Menurut HOSODA
Hasil proses PCR clan deteksinya (15), yang mengemukakan juga bahwa seleksi
menggunakan elektroforesis gel agarosa (PCR lokasi primer sangat penting untuk deteksi HCV
kualitatif), menunjukkan hanya 5 sampel yang dengan PCR Berdasarkan basil penelitiannya
positif HCV daTi 25 serum darah yang diperoleh menggunakan primer daTi nonstructural region
daTi laboratorium RSCM (Tabel 1). Sampel genom HCV untuk proses PCR, RNA HCV yang
tersebut telah dideteksi sebelumnya dengan basil terdeteksi pacta pasien dengan DonA nonB
RNA HCV positif secara kuantitatif menggunakan hepatitis kronik hanya 60%, sedangkan dengan
kit komersial. Hal ini mungkin disebabkan menggunakan primer daTi noncoding region, RNA
proses ekstraksi RNA, primer oligonukleotida clan HCV yang terdeteksi -95%. Kemungkinan lain
cara deteksi produk PCR yang digunakan daTi basil tersebut di atas, sampel serum tersebut
laboratorium tersebut sensitivitasnya lebih tinggi telah lama disimpan dalam suhu atau temp at
daripada yang digunakan dalam penelitian ini. yang tidak sesuai sehingga mempengaruhi virus
CHA e.t aI. (17), menyatakan banyak faktor di dalamnya terutama RNA virus. Dalam uji RT-
berperan dalam proses RT-PCR, seperti misalnya PCR secara kualitatif seperti yang digunakan
integritas RNA selama proses isolasi/ekstraksi dalam penelitian ini, hal penting yang perlu
tergantung pada efisiensi inhibitor RNAse dalam diperhatikan adalah penyimpanan spesimen ,
penanganan spesimen, daD inhibitor dalam proses
Tabell. Hasil deteksi HCV dari sampeldarah PCR (18).
berasal dari Rumah Sakit Cipto Dari 20 sampel serum yang diperoleh daTi
Mangunkusumo laboratorium PMI dengan anti HCV positif secara
serologi menggunakan teknik ELISA (Enzyme
Kade Deteksi Deteksi Linked Immunosorbent Assay) menunjukkan
Sampel dengan
PCR denganPCR hanya 7 sampel yang positif HCV dengan teknik
Kuantitatif Kualitatif yang digunakan dalam penelitian ini (Tabel 2).
Untuk kasus seperti ini dapat berarti adanya
Positif Positif suatu infeksi di masa lamp au atau
2. Positif Negatif kemungkinan adanya intermitten virenia daD juga
3. Positif Negatif karena adanya pola awal viremia yang terlambat
4. Positif Negatif (14, 19). Tabel 2 juga menunjukkan basil positif
5. Positif Negatif HCV untuk 1 sampel dengan metode PCR
6. Positif Negatif kualitatif yang dilakukan dalam penelitian ini.
7. Positif Negatif Sampel tersebut adalah salah satu sampel
8. Positif Negatif diantara 5 buah sampel serum yang negatif HCV
9. Positif Positif secara serologi digunakan sebagai pembanding
10. Positif Negatif yang berasal daTi laboratorium PMI.
11. Positif Kasus seperti ini telah ditemukan pacta
Negatif
12. Positif Negatif penderita-penderita dengan hepatitis menahun
13. Positif daD donor darah (post transfusional hepatitis)(14).
Negatif
14. Positif Viremia dapat terdeteksi dengan adanya anti
Negatif
15. Positif HCVI antibodi spesifik dengan metode serologi.
Negatif
16. Positif Positif Namun, antibodi tersebut terbentuk dalam
17. Positif Positif periode waktu tertentu setelah terjadi infeksi.,
tergantung daTi respon immune daTi pasien (7).
18. Positif Positif
Menurut CHIEN .e.t al yang dikutip oleh
19. Positif Negatif HOUGHTON (4!, serokonversi anti HCV setelah
20. Positif Negatif infeksi adalah 7 sampai 31 minggu. .Periode
21. Positif Negatif waktu antara terdeteksinya antibodi dengan
22. Positif Negatif infeksi HCV adalah 12 minggu (3), daD 15
23. Positif Negatif minggu (201. Hasil penelitian GARSON -e.1 al
24. Positif Negatif (19}, menunjukkan antibodi HCV tidak terdeteksi
25. Positif Negatif sampai 18 minggu dengan protein C100 HCV,
tetapi RNA HCV dengan teknik PCR dapat
Risa/ah Seminar I/miah Penelilian dan Pengembangan Aplikasi lsalop dan Radia~ 2tXJ4

dideteksi dalam 4 minggu. Periode dimana sella penggunaan pelacak DNA berlabel
antibodi belum terbentuk atau belum cukup radioaktif.untuk proses hibridisasi basil PCR.
untuk dideteksi dengan teknik yang tersedia,
akan tetapi sudah terjadi infeksi virus dikenal
dengan window phase/period .Kasus semacam ini KESIMPULAN
juga dapat terjadi pada pengidap karier HCV
yang tidak mempunyai gejala (211. Dari data Nested RT-PCR kualitatif RNA HCV dengan
tersebut dapat dijelaskan hepatitis C dapat
menggunakan primer yang dirancang dari
ditransmisi dari donor dengan anti HCV negatif. NCR region yang digunakan dalam penelitian
ini, dapat mendeteksi RNA HCV dalam 5
sampel serum darah dari 25 sampel positif
Tabel2. Hasil deteksi HCV dari sampeldarah
RNA HCV kuantitatif .Teknik ini dapat juga
berasal dari laboratorium Palang
mendeteksi RNA HCV dalam 7 sampel serum
Merah Indonesia
dari 20 sampel positif anti HCV clan dalam 1
sampel dari 5 sampel negatif anti HCV
secara serologi yang diperoleh dari
laboratorium PMI
Peningkatan sensitivitas deteksi HCV
berdasarkan basil penelitian ini, dapat
dilaksanakan antara lain dengan
menggunakan primer yang didisain dari
daerah genom HCV yang lebih conserved,
cara deteksi yang lebih sensitif misalnya
dengan menggunakan primer berlabel
radioaktif , clan penggunaan pelacak DNA
berlabel radioaktif untuk proses hibridisasi
produk RT-PCR

UCAPAN TERIMA KASIH

Penulis mengucapkan terima kasih kepada


Sdr. Almaida clan Sdr. Rika Heryani atas bantuan
yan!~ diberikan sehingga penelitian ini dapat
berjialan dengan baik clan lancar.

DAFTAR PUSTAKA

1. CHOO, Q.L., KUO, G., WEINER, A.J.,


OVERBY, L.R., BRADLEY, D.W., and
HOUGHTON, M. Isolation of cDNA
clone derived from a blood borne non A,
non B viral hepatitis genome. Science 2.4.4
359 -362 (19891.
Hasil RT-PCR dari sample serum darah 2. KUO, G., CHOO, Q.L., ALTER, H.J., GITNICK,
clan deteksinya dengan teknik elektroforesis G.L., REDEKER, A.G. PURCELL, R.H.,
gel agarosa, dapat dilihat pada Gambar 1, Hasil MIY AMURA, T., DIENSTAG, J.L.,
positif HCV diperlihatkan dengan adanya pita ALTER, M.J., STEVEN, C.E., TEGTMEIER,
DNA spesifik dengan ukuran berkisar 255 bp" G.E., BONINO, F., COLOMBO, M., LEE,
terlihat pada lajur 2 yang merupakan sampel W.S., KUO, C., BERGER, K., SHUSTER,
positif HCV dari RSCM , clan lajur 10, 11, 12 J.R., OVERBY, L.R., BRADLEY, D.W., and
merupakan sampel positif HCV yang berasal dari HOUGHTON, M. An assay for circulating
laboratorium PMI, Ukuran pita DNA ditentukan antibodiesto a major etiologic virus of human
dengan marker 0X174 Hae III (Lajur 1), non A, non B hepatitis. ScienceM.4. 362-
Berdasarkan basil penelitian yang 364(1989).
diperoleh, sensitivitas uji PCR perIn ditingkatkan
yaitu dengan menggunakan primer yang lebih
sensitif, cara deteksi basil PCR secara radioaktif,
RisalahSeminarllmiah Penelitiandan Pengembangan
Aplikasi lsotop dIn Radias2004

3. Van der POEL, C.I., CUYPERS, H.T., and 12. CONRAD, E.U., GRETCH, D.R.,
REESINK, H. W. Hepatitis C six years on. OBERMEYER, K.R., MOOGK,M.S.,
The Lancet ~ 1475 -1479 (19941. SAYERS, M., WILSON, J.J., and
4. HOUGHTON, M. Hepatitis C virus. In STRONG, D.M. Transmission of
Fields Virologi vol. 1. Fields, B.N., hepatitis C virus by tissue
Knipe, D.M., Howley, P.M., Chanock, transplantation. The Journal of Bone
R.M., Melnick, J.L., and Straus, S.E. and Joint Surgery. ZZ:A 2 214 -224
/eds.I, 3 rd edition, Lippincott-Raven
(1995).
Publisher, Philadelphia -New York 13. NAZLY HILMY. Perkembangan bank
/19961. jaringan di Indonesia. Bulletin Batan
5. DALIMARTHA, S. Ramuan tradisional untuk (1999).
pengobatan hepatitis. Penerbit P.T. 14. LUSIDA, I., SOEMARTO, dan SOETJIPTO.
Penebar Swadaya, edisi ke dua, Jakarta Reaksi rantai polimerase untuk diagnosis
(19981 virus hepatitis C.. Medika 2 127 -129
6. WILBER, J.C., JOHNSON, P.J., and URDEA, (1997).
M.S. Reverse Transcriptase- PCR for 15. HOSODA, K., OMATA, M., YOKOSUKA,
hepatitis C virus RNA. In Diagnostic 0., KATO, N., and OHTO, M. Non A,
Molecular Microbiology. Principles and Non B chronic hepatitis is chronic
Applications. Persing, D.H., Smith, T.F., hepatitis C: A sensitive assay for
Tenover, F.C., and White, T.J. (eds.I, detection of hepatitis C virus RNA in
American Society for Microbiology, liver. Hepatologi. 15 5 777 -781
Washington D.C. (19931. (1992).
7. WIDJAJA, S. Epidemiology of hepatitis B 16. HU, K.Q., YU, C.H., and VIERLING, J.M. One
and hepatitis C virus infection in an step RNA polymerase chain reaction for
urban area in Jakarta, Indonesia: A detection of hepatitis C virus RNA.
hospital and population based study. Hepatology.~ 270-274 (1993)
Thesis for the degree of Doctor in de 17. CHA, T.A., BEALL, E., IRVINE, B., KOLBERG,
Medische Wetenschappen, Leuven J., CHIEN, D., KUO, G., and URDEA,M.S.
At leastfive related, but distinct, hepatitisC
/19961.
8. BRUIX, J., BARRERA, J.M., CALVET, X., viral genotypesExist.Proc. Natl. Acad. Sci.
USA. 89 7144 -7148 (1992).
COSTA, J., VENTURA, M., BRUGUERA,
17. SIMON, S. Diagnostic tests for hepatitis C.
M., CASTILLO, R., ERCILLA, G.,
Seminar Nasional : Quality Assurance
SANCHEZ-TAPIAS, J., VALL, M., BRU,
C., and RODES, J. Prevalence of Programme for Molecular-Based
antibodies to hepatitis C virus in Spanish Diagnostis of Hepatitis C and
patients with hepatocellular carcinoma Tuberculosis. Catholic University of
and hepatic cirrhosis. Lancet ii 1004- Atma Jaya, 19 Juni 2003, di Jakarta.
1006 (19891. 18. GARSON, J.A., TUKE, P.W., MAKRIS, M.,
9. BUDIHUSODO, U., SULAIMAN, H.A., BRIGGS, M., MACHIN, S.J., PRESTON,
AKBAR, H.N.-.eLal Seroepidemiology of F.E., and TEDDER, R.S. Demonstration
HBVand HCV infection in Jakarta, of viraemia patterns in haemophiliacs
Indonesia. Gastroenterology 26 196- treated with hepatitis C virus-
201 (19911. contaminated factor VIII concentrates.
10. PEREIRA, B.J.G., MILFORD, E.L., The Lancet 21. 1022 -1025 (1990).
KIRKMAN, R.L., and LEVEY, A.S. 19. BHANDARI, B.N., and WRIGHT, T.L.
Transmission of hepatitis C virus by Hepatitis C : An overview. Annu. Rev.
organ transplantation. The New England Med. .46-309-317 (1995).
Journal of Medicine 325 7 454 -460 20. ZANETTI, A.R., TANZI, E., ZEHENDER, G.,
MAGNI, E., INCARBONE, C., ZONARO,
/19911.
11. POTERUCHA, J.J., RAKE LA, J., LUM,ENG, A., PRIMI, A., CARIANI, E. Hepatitis C
L., LEE, C.H., TASWELL, H.F., and virus RNA in Symptomless donors
WIESNER, R.H. Diagnosis of chronic implicated in post-transfusion non A, non
hepatitis C after liver transplantation by B hepatitis. The Lancet. 448 -449
the detection of viral sequences with August 18 (1990).
polymerase chain reaction. Hepatology
15 142 -45 /19921.
RisaJahSeminarIlmiah Peoeli/iandaDPeogembaogan
Aplikasi Is%p daDRadiasi,2004

12345678910 112 13

255 bp

Gambar1. FragmenDNA basil elektrooresis


RT-
PCR-HCYdarisample
serumdarah

Lajur 1 Marker0X17 HaeIII


Lajur2,3,4,5,6,7 SampelserumdarahdaTiRSCM
Lajur 8,9,10,11,12 SampeldarahdaTiPMI
Lajur 13 Kontrol negatif
RisalahSeminarIlmiah Peneli/iandan Pengembangan
Aplikasi ls%p danRadiasi,2004

DISKUSI :

NELLY IIPBI SOBRIZAL

Secara umum metode skrining yang Bagaimana Ibu mendapatkan 2 pasang


digunakan saat ini dibanding PCR, mana yang primer yang digunakan daD berapa besar
lebih spesifik, murah daD mudah ? produknya.
MARIA LINA R MARIA LINA R

Metode yang umum digunakan adalah Primer yang dipakai dalam penelitian ini
secara serologi dengan metode Elisa. Metode PCR sesuai dengan primer yang digunakan peneliti
lebih sensitif clan spesifik terutama jika terdahulu. Namun, dapat dirancang sendiri
menggunakan primer yang di desain daTi genom menggunakan program atau software khusus
HCV yang lebih conserved atau dengan primer sehingga dapat ditentukan daerah yang lebih
yang dilabel dengan radioaktif ataupun dengan conserveddari genom HCV. Besar prod uk PCR :
pelacak DNA berlabel radioaktif. Saat ini teknik 255 bp (dengan inner primer! 322 bp (dengan
PCR lebih mahal dibanding dengan teknik Elisa. outerprimer!

NAZLY HILMY DARMAWAN DARWIS

Apakah sampel darah yang digunakan, Mohon dijelaskan mekanisme reaksi PCR
telah diuji dengan teknik Elisa dengan basil dalam menentukanvirus pada darah.
negatif. Mengingat tujuan pemakaian untuk
mengatasi masalah window period? Kalau benar MARIA UNA R,
sudah diuji berapa persen yang positif PCR,
negatif dengan Elisa? Hepatitis C dapat menjadi Mekanismenya :
penyebab kanker hati. .Lisis sel virus dalam darah.
.Ekstraksi RNA virus.
MARIA UNA R .Proses reverse -transkripsi dari RNA menjadi
cDNA.
Sampel darah yang digunakan yang .Proses amplifikasi c DNA hasil proses reverse
diambil dari laboratorium PMI semuanya sudah -transkripsi dengan teknik PCR.
diuji secara serologi dengan teknik Elisa. Dari 25 .Deteksi hasil PCR dengan teknik
sampel yang diambil, 5 sampel negatif HCV. elektroforesis gel agarosa.
Dengan teknik PCR (nestedPCRI yang digunakan
dalam penelitian ternyata dari 5 sampel negatif
HCV tersebut, 1 sampel positif (20 %1. Namun
angka tersebut perlu dievaluasi lagi
menggunakan jumlah sampel negatif HCV yang
lebih besar. Hepatitis C kronik akan
berkelanjutan menjadi sirosis clan kanker hati
apabila virus sudah terintegrasi ke dalam set hati.