Anda di halaman 1dari 10

TD de biologie molculaire

Exercice 1 :
Le but est la dtermination de la masse molculaire (MM) d'une protine p par chromatographie
d'exclusion. La limite d'exclusion du gel se situe entre 40 000 et 400 000 de MM.
L'talonnage du gel se fait par diverses substances, dont les MM (exprimes en Daltons) et les volumes
d'lution (Ve, exprim en ml) sont indiqus dans le tableau suivant :
MM (Da) Ve (ml)
Dextran 2000000 45
Fibrinogne 340000 60
Catalase 230000 75
Lactoglobuline 19000 132
1 - Rappeler quoi correspond le Dalton.
2 - La protine p montre, quant elle, un volume d'lution Ve = 113 ml. Dterminer sa MM.

Exercice 2 :
Les temps de rtention (tr) de protines, dont la masse molculaire (MM) est connue, sont dtermins
au cours d'une chromatographie sur Sephadex. Le dbit de la colonne est de 5 ml / min) :
MM tr (min)
Aldolase 145000 10,4
Lactate dshydrognase 135000 11,4
Phosphatase alcaline 80000 18,4
Ovalbumine 45000 26,2
Lactoglobuline 37100 28,6
1 - Calculer les volumes d'lution (Ve) correspondants. Porter le log de MM en fonction de Ve - Que
remarquez-vous ?
2 - Pour la glucokinase, le tr est de 21 min. Dterminer sa masse molculaire l'aide du graphique
prcdent. Existe-t-il une autre mthode pour dterminer la MM ?

Exercice 3
Afin de dterminer la squence d'un peptide P, plusieurs expriences sont ralises :
L'hydrolyse chymotrypsique de P a permis d'obtenir 2 fragments (A et B), dont l'hydrolyse acide totale
(HCl 6N pendant 24h) a donn les rsultats suivants :
- A: 1 Ala, 1 Arg, 1 Cys, 1 Leu
- B: 1 Asp, 1 Lys, 1 Tyr
La mthode d'Edman applique sur le fragment A a permis de librer Ala puis Leu et sur le fragment B
a permis de librer Asp.
La carboxypeptidase applique sur le fragment A a permis de librer Cys.
Seuls P et B absorbent la lumire 280nm.
Donner la structure primaire de P.

Exercice 4
Afin de dterminer la squence d'un peptide X, plusieurs expriences sont ralises :
L'hydrolyse trypsique de X a permis d'obtenir 2 fragments (X1 et X2), dont l'hydrolyse acide totale (HCl
6N pendant 24h) a donn les rsultats suivants :
- X1: 1 Val, 1 Arg, 1 Gly, 1 Leu
- X2: 1 Asp, 1 Lys, 1 Ser
La mthode d'Edman applique sur le fragment X1 a permis de librer Val puis Leu et sur le fragment
X2 a permis de librer un acide amin acide puis un acide amin ayant une fonction alcool.
Donner la structure primaire de X.

Exercice 5
Lhydrolyse totale dun peptide donne 3 Ala, 1 Asp, 1 Gly, 1 Leu, 1 Lys, 1 Ser, 1 Tyr et 2 Val.
Lhydrolyse trypsique donne
- Un ttrapeptide basique contenant Leu et donnant PTH-Ser puis PTH-Gly (dgradation
dEdman)
- Un heptapeptide acide qui absorbe dans lUV, et dont lhydrolyse chymotrypsique donne un
ttrapeptide acide, qui absorbe dans lUV, qui donne un DNP-Val par la mthode de Sanger,
et qui soumis laction de la carboxypeptidase libre Tyr puis Ala, et un tripeptide neutre
qui soumis lhydrazinolyse libre Val.

1
Donner la structure primaire de ce peptide.

Exercice 6
Comment dterminer la formule brute dun peptide ?
Ce dcapeptide est compos de 1 Ala, 1 Leu, 1 Arg, 1 Cys, 1 Ile, 1 Tyr, 2 Gly, 1 Val, 1 Asp.
La mthode dEdman donne Gly puis Leu.
La carboxypeptidase libre Ala.
Lhydrolyse trypsique donne un ttrapeptide basique et un hexapeptide acide.
Le trtrapeptide trait par loxyde de plomb en milieu basique donne un prcipit noir.
Lhydrolyse chymotrypsique de lhexapeptide donne
o un dipeptide ragissant avec le ractif de Millon et possdant un acide amin avec
2 carbones asymtriques
o un ttrapeptide donnant un DNP-acide amin acide par la mthode de Sanger.
La thermolysine libre un acide amin (Gly) et 3 peptides : un dipeptide contenant Ala et Val, un
tripeptide contenant Arg, Cys et Leu et un trtrapeptide contenant Asp, Gly, Ile et Tyr.
Quelle est la structure primaire du dcapeptide ?

Exercice 7
Une hydrolyse trypsique libre le fragment N terminal dune protine. Ce peptide aprs hydrolyse totale
donne 1 Lys, 1 Arg, 1 Pro, 2 Thr, 1 Glu, 1 Ser, 2 Val, 1 Leu et 1 Tyr.
La raction de Sanger donne un DNP-Lys.
Lhydrolyse chymotripsique donne C1 et C2 qui sont basiques et ont pour composition :
C1 : 1 Lys, 1 Pro, 1 Thr, 1 Val, 1 Leu, 1 Tyr
C2 : 1 Arg, 1 Thr, 1 Ser, 1 Val, 1 Glu.
Quelle est la position de C1 et C2 par rapport au N terminal ? Pourquoi ?
Lattaque de C1 par la carboxypeptidase donne un acide amin aromatique, puis la leucine, puis un
acide amin neutre 5 atomes de carbone.
Lhydrolyse partielle de C2 donne entre autres trois peptides dont les compositions sont les suivantes :
1 Thr, 1 Glu, 1 Val ; 1 Ser, 1 Thr, 1 Val ; 1 Arg, 1 Ser, 1 Val.
Quelles sont les squences de C1, de C2 et du peptide total ?

Exercice 8 :
La squence dADN du brin sens de 5 vers 3 est :
ACC ATG TTT TCC GAC CGG TAG CTG AAA
a) Quelle est la squence du brin matrice de 5 vers 3 ?
b) Quelle est celle de lARNm correspondant de 5 vers 3 ?
c) Quelle est celle de la protine ?
d) Si une mutation change la 13eme base de G en C, que se passe-t-il ?
e) La 15eme de C en T?
f) La 19eme de T en A?
g) Si un A est insr en position 6?
h) En position 19 ?

Exercice 9 :
Une protine humaine est compose de 302 acides amins. Voici un fragment d'ADN simple brin
contenant le dbut de la phase codante du gne correspondant :
TATGCCTAGCTGCGGAGTTGTTACATCGACTGGTTTGCTGGATCATCGTGG
1. Identifiez le dbut de la phase codante du gne.
Quel est le brin d'ADN porteur de l'information gntique responsable de la formation de la protine?
2. Ecrivez la squence nuclotidique du fragment d'ARNm codant le dbut de la protine.
3. Dduisez le dbut de la squence de la protine.
4. Une protine mutante dans laquelle la premire srine est remplace par une arginine a t isole.
Quelles mutations nuclotidiques rendent compte de ce changement d'acide amin?
5. Dans une pathologie, une forme courte de la protine est retrouve : seuls les trois premiers acides
amins sont prsents. Quelle mutation nuclotidique peut-tre prdite ?

2
Exercice 10
Observer les rsultats de llectrophorse en gel dagarose color au BET et observ sous UV

ADN viral non digr

Marqueur (ADN viral digr Hind III)

ADN gnomique digr Eco R I

Le gnome humain a une taille denviron 3 . 109 pb. Celle du virus utilis, un phage lambda, est de 45
kb.
1- Quelle est la masse dADN contenue dans une cellule humaine et combien de cellules sont
utilises pour lextraction d1 g dADN gnomique ? (masse molaire moyenne dun
nuclotide : 330 g, Constante dAvogadro N = 6,02 x 1023 mol-1)
2- Quelle est la frquence statistique thorique du site de restriction Eco R I (GGATCC : 6 pb)
sur lADN gnomique humain et la taille moyenne des fragments obtenus ?
3- En supposant que la digestion effectue sur lADN gnomique soit totale, pouvez-vous
expliquer la diffrence daspect entre les bandes nettes obtenues pour les fragments de
restriction du marqueur et la tache diffuse (= Smear ) obtenue pour lADN gnomique
digr ?
4- Comment obtenir un rsultat dlectrophorse qui permettrait une tude de restriction prcise
dun gne humain ?

Exercice 11
Quelles amorces de PCR (longues de 10 bases chacune) permettraient lamplification de lADN 1
mais pas de l ADN 2, puis quelles amorces utiliser pour amplifier les 2 fragments d ADN ?
5 ATGCCTAGGTCATTTACCGTAAATACCTGATTGCTAGGTACCAGGGCTATGGCTAGGTCAAAGGT 3
3 TACGGATCCAGTAAATGGCATTTATGGACTAACGATCCATGGTCCCGATACCGATCCAGTTTCCA 5

5 ATACCTAGCACATTTACCGTAAATACCTGATTGCTAGGTACCAGGGCTATGGCTAAATCAAACGT 3
3 TATGGATCGTGTAAATGGCATTTATGGACTAACGATCCATGGTCCCGATACCGATTTAGTTTGCA 5

Exercice 12
Pour cloner vqsR (1254 pb), les auteurs ont ralis une PCR dans 50 l (volume final), en utilisant 50
ng dADN gnomique de Pa (gnome 6,3 x 106 pb) et 0,2 mM de chaque dNTP (MM dun
dsoxyribonuclotide 330 Da ; Constante dAvogadro N = 6,02 x 1023 mol-1).
a) En admettant que le rendement de la PCR est de 100% calculez la quantit damplicons (en
nombre de copies et en g) produite aprs 20 cycles?
b) En admettant que dans la squence amplifier il y a une proportion quivalente de chacun des
nuclotides, la quantit de dNTPs, ajoute dans lchantillon, sera-t-elle suffisante pour aller au bout
des 20 cycles ?

Exercice 13
Un plasmide est digr soit par lenzyme EcoRI, soit par BamHI, soit par un mlange des deux.
Quelle est la taille du plasmide avant digestion ? Justifiez votre rponse.
Combien de sites chaque enzyme possde-t-elle ? Justifiez votre rponse.
Quelle est la carte de restriction du plasmide ? Justifiez votre rponse.

EcoRI BamHI EcoRI et BamHI


Gel dagarose 1650 pb _
1240 pb
1130 pb
950 pb
810 pb
750 pb Sens de migration
700 pb
660 pb
630 pb
540 pb

180 pb
120 pb +
3
Exercice 14
Un plasmide est soumis la digestion par deux enzymes de restriction afin de rechercher les sites de
coupures de ces deux enzymes et de construire les cartes de restriction correspondantes ainsi que la
carte combine.
La digestion termine, chaque lot d'ADN est soumis une lectrophorse en gel dagarose qui spare
les fragments d'ADN selon leur taille.
Le document suivant donne les lectrophorses aprs des digestions simples et multiples.
1) Quel est la taille du plasmide en paires de bases ?
2) Combien possde-t-il de sites de coupure pour l'enzyme EcoRI ?
Pour l'enzyme BamHI?
3) Ordonnez les diffrents fragments obtenus les uns par rapport aux autres.
EcoRI Bam HI EcoRI + Bam HI
- 1700
1675
1515
1320

815

750 750
700
570 570
500

360 360

+ 250

Exercice 15
Mmes questions que les exercices prcdents.
Fragments obtenus par EcoRI en pb : 1820 - 600 - 310
Fragments obtenus par HaeIII en pb : 1350 - 1050 - 330
Fragments obtenus par BamI en pb : 1720 - 1010
Fragments obtenus par la triple digestion en pb : 850 - 570 - 400 - 300 - 210 - 180 120 100

Exercice 16
Mmes questions que les exercices prcdents.
Fragments obtenus par EcoRI en pb : 75 225 450 510 530
Fragments obtenus par BamI en pb : 275 315 390 485 550
Fragments obtenus par la double digestion en pb :
75 100 125 150 180 200 210 240 310 350

Exercice 17
Mmes questions que les exercices prcdents.
Fragments obtenus par EcoRI en pb : 225 260 335 355 375 520 760
Fragments obtenus par BamI en pb : 200 320 425 505 590 790
Fragments obtenus par la double digestion en pb :
75 90 110 150 170 185 200 225 230 260 330 375 430

Exercice 18 : examen mars 2010


Partie 1 (TD/TP)
Voici la squence du gne procaryote Kiawelam :
5' TAT ATT CCT ATG CCC GTA CGT AAA TTT CTA GGT TAT TCC AAG GAC GGC GTA CGA
GGC TAT TCG GCA GAC GAA CAT TGT GGT AAA GTA TAT TTA ATG TAA GTA AGG CTA GGC
TCC AGC CTT 3'

4
1) Ce brin est-il le brin matrice ? Justifiez votre rponse.
2) Quest ce quune PCR ?
3) La Taq polymrase utilise en PCR a-t-elle des spcificits par rapport une ADN polymrase
classique ?
4) Proposez des amorces de PCR pour amplifier cette portion dADN. Indiquez leurs orientations.
5) Quest ce quune ARN polymrase ?
6) Indiquez la squence primaire de la protine Kiawelam. Est-elle forcment exacte ? Justifiez
votre rponse.
7) Quelle(s) mthode(s) permet(tent) de dtecter et/ou quantifier une protine ?

Partie 2 (cours)

1.1.

1.2. Horizontalement 1.3. Verticalement


5. spcifique l'ARN 1. protine pathogne
9. support de l'information gntique 2. insertion dun gne dans un vecteur ou
10. sucre utilis pour faire des gels reproduction dun tre vivant
12. enzyme permettant la synthse du l'identique
dernier fragment d'Okasaki 3. histones et ADN
14. absent chez les procaryotes 4. enzyme ralisant la synthse d'acides
16. gnes rguls ensemble nucliques
18. en face de la thymine 6. systme de dgradation des protines
19. mthode d'amplification d'ADN avec mal conformes
suivi 7. modification du matriel gntique
20. 3 bases lues ensemble 8. sert la traduction
21. apporte l'acide amin 11. petit nom des acides amins
22. lu par les ribosomes 13. produit de la transcription
23. suite d'acides amins 15. un des 20
17. sucre avec 2 OH
18. catalyse la liaison peptidique

5
Exercice 19
Un ADNc de 1,5 kb codant une protine X chez la souris a t clon au site de restriction EcoRI
dans un vecteur pKS (figure 1). Aprs ligation, des bactries comptentes sensibles lampicilline sont
transformes par le produit de cette ligation puis tales sur un milieu complt en ampicilline, X-gal et
IPTG.

Figure 1 : vecteur pKS.

LADN plasmidique de 2 colonies blanches A et B est extrait. Les plasmides de ces deux colonies sont
utiliss comme matrices pour synthtiser 2 sondes ARN marques au 32P.
Sonde 1 : transcription partir du promoteur T7 sur la matrice A linarise par lenzyme de restriction
XhoI (cet ADNc ne contient pas de site XhoI).
Sonde 2 : transcription partir du promoteur T7 sur la matrice B linarise par XhoI.

Une exprience de Northern est effectue sur des ARNm purifis de cellules murines avec chacune
des sondes 1 et 2 (figure 2).

1) Quest ce quun transformant ?

Sondes 1 2
Figure 2 : Rsultats du Northern Blot
2 Kb ralis avec les sondes 1 et 2 sur des
ARNm purifis de cellules murines.

2) Pourquoi des colonies blanches sont choisies pour synthtiser les deux sondes ?
3) Aucune hybridation nest observe pour la sonde 2, proposez une explication.
Un des deux plasmides est donc utilis pour effectuer dans un premier temps de la transcription in
vitro partir du promoteur T7, aprs digestion du plasmide par XhoI. L'analyse de la squence de
l'ADNc du gne X est effectue par mutagense par insertion ou dltion : 4 types de dltions ou
d'insertions ont t testes (figure 3).

6
Figure 3 : Squence de lADNc clon avec la position des insertions et des dltions
qui ont t ralises.

Les ARNs obtenus sont concentrs et marqus au phosphore 32P avant d'tre dposs sur un gel de
polyacrylamide. Les ARNs sont visualiss par autoradiographie (figure 4).
4) Quest ce quun ADNc ?

Figure 4 : ARNs obtenus partir


dun tmoin et des constructions
dADNc 1, 2, 3 et 4.

5) Expliquez pour chacune des constructions les rsultats obtenus sur la figure 4.
Les ARN obtenus dans chacun de ces 5 cas ont t utiliss pour effectuer une traduction in vitro en
prsence de (35S) - mthionine, ainsi que les 19 autres acides amins non radioactifs. Les produits
protiques sont dposs sur un gel de polyacrylamide en prsence de SDS, et rvls par
autoradiographie (figure 5).

Figure 5 : Western blot sur les


produits protiques obtenus
partir du tmoin et des
constructions 1, 2, 3 et 4.

6) Interprtez les rsultats de la figure 5 dans chacun des 5 cas en comparant avec ceux de la
transcription (figure 4).
La mme traduction in vitro a t effectue mais cette fois-ci sans acide amin radioactif partir
des 5 mmes matrices. Les produits protiques ont t dposs sur un gel de polyacrylamide en
prsence de SDS, puis transfrs sur une membrane et dtects par diffrents anticorps coupls un
fluorochrome (anticorps 1 et anticorps 2).
Anticorps n1 : dirig contre la moiti NH2 terminale de la protine X.

7
Anticorps n2 : dirig contre la moiti carboxy terminale de la protine X.

7) Donnez une interprtation pour chacune des 4 constructions.

Figure 6 : westerns blots avec les anticorps 1 et 2 rvls avec le


substrat de lenzyme coupl lanticorps.

Exercice 20
Juin 2011
Au cours de sa thse en biologie, une tudiante souhaite raliser une extraction plasmidique afin
dtudier les effets, sur des levures, de la protine etonil dont le gne a prcdemment t clon chez
E. coli dans le vecteur plasmidique pEXPR-IBA17. Ce vecteur contient les origines de rplication chez
les procaryotes et les eucaryotes, les gnes de rsistance lampicilline AmpRs et la nomycine
NeoR, le MCS (site de clonage multiple), et le promoteur du CMV pour permettre lexpression du gne
etonil en systme eucaryote.
Le clone recombinant est gard -80C en milieu LB additionn de glycrol.

1- Quest ce quune origine de rplication ?


2- A quoi sert le MCS ?
3- Pourquoi raliser le clonage chez E. coli pour une utilisation chez la levure, eucaryote
unicellulaire ?

8
Ltudiante fait pousser son clone d E. coli recombinant en milieu liquide toute la nuit 37C. Le
lendemain, la culture est positive. Lextraction plasmidique est ralise. Le contrle sur gel dagarose
ne montre malheureusement aucun plasmide.
4- A quoi cet chec peut-il tre d ?
Ltudiante dcide alors dutiliser du LB supplment en nomycine. Le lendemain, le milieu est limpide
indiquant que la bactrie ne sest pas dveloppe. Ltudiante pense que la bactrie a perdu le
plasmide, donc la rsistance lantibiotique, et ralise une PCR sur le gne etonil afin den tre sre.
5- Quest ce quune PCR ?
La PCR est positive, le gne etonil est bien prsent dans le clone conserv -80C. Ltudiante dcide
alors de faire pousser son clone en LB supplment en ampicilline. Le lendemain, la culture est positive
et lextraction aussi.
6- Pourquoi lampicilline a-t-elle permis de raliser lexprience et non la nomycine ?
7- Quelle conclusion personnelle pouvez-vous tirer de ces checs ?

Exercice 21
Une quipe veut tudier le gne Schumeucurt et la protine correspondante. Ce gne se trouve chez
une souche de levure implique dans la fermentation du chou pour la production de choucroute. Ils
commencent leurs analyses par une RT-qPCR ciblant ARN messager Schumeucurt dans deux
chantillons contenant la levure, un de choucroute et un de fromage.

1- Quest-ce quune RT-qPCR (principes, tapes, contrles) ? Quelles informations sont


obtenues ?
LARNm est bien prsent en quantit importante dans la choucroute mais absent du fromage. Le produit
de ce gne semble donc ncessaire pour la fermentation du chou. Les auteurs isolent la souche de
levure et veulent cloner lADNc correspondant dans un vecteur dexpression.

2- Quest-ce quun ADNc ? Pourquoi ne pas cloner directement le gne ?

3- Quelles sont les tapes permettant ce clonage (en quelques phrases avec ventuellement un
schma) ?

Voici le dbut de la phase codante du gne.

5 ATG TTT CCA GCC GCC AAA GCT TCA CCA ATT GCC GGG AGG 3
3 TAC AAA GGT CGG CGG TTT CGA AGT GGT TAA CAA CCC TCC 5

Voici la fin de la phase codante.

5 TTT TGC ACC TCG TTA TAA 3


3 AAA ACG TGG AGC AAT ATT 5

4- Proposez deux amorces de PCR (de 5 en 3, de 10 bases chacune) pour amplifier lensemble
de la phase codante.

Afin de cloner ce produit de PCR dans un vecteur par digestion enzymatique, le site sacI est ajout
lamorce sens et le site salI lamorce anti-sens.

5- Pourquoi les auteurs ont-ils utilis deux enzymes diffrentes ?


Aprs PCR, digestion, ligature et transformation, 55 clones blancs sont obtenus. Une extraction
plasmidique est ralise sur un clone blanc. Il est soumis la digestion par EcoRI ou par BamHI ou par
les deux enzymes de restriction afin de construire la carte de restriction combine.

La digestion termine, chaque lot d'ADN est soumis une lectrophorse en gel dagarose qui spare
les fragments d'ADN selon leur taille.

6- Quel est le principe dune lectrophorse en gel dagarose ?

9
Voici les rsultats de llectrophorse (taille indique en paires de bases) :

EcoRI BamHI Double digestion

2020 2520 1590

1660 2210 1410

70 680 860

800

430

250

70

7- Quelle est la taille du plasmide en paires de bases ?


8- Combien de sites de coupure pour l'enzyme EcoRI le plasmide possde-t-il?
9- Et pour l'enzyme BamHI?
10- Ordonnez les diffrents fragments obtenus les uns par rapport aux autres.

11- Sachant quun site EcoRI trouve dans le site de clonage multiple avant sacI et un site BamHI
trouve dans le site de clonage multiple aprs salI, que lADNc mesure 1650 paires de bases et
que seul un site Eco RI est prsent dans lADNc en position 60, pensez-vous que le clonage
sest bien pass ? Justifiez votre rponse.
Les auteurs utilisent ce plasmide pour exprimer la protine chez E.coli.

12- La structure primaire sera-t-elle la mme chez E. coli et chez la levure ? Et les structures
secondaires, tertiaires et quaternaires ? Justifiez votre rponse.

13- Proposez une suite ces expriences.

10