Eur Food Res Technol (2006) 224:271278
DOI 10.1007/s00217-006-0467-x
ORIGINAL PAPER
Detection of genetically modified rice: a construct-specific
real-time PCR method based on DNA sequences from transgenic
Bt rice
Dietrich Made Christine Degner Lutz Grohmann
Received: 19 June 2006 / Revised: 14 August 2006 / Accepted: 21 August 2006 / Published online: 7 October 2006


C Springer-Verlag 2006
Abstract Genetically modified rice varieties developed in
China are close to approval for agricultural cultivation and
production. However, so far no method has been reported for
specific detection of transgenic varieties of this crop. In the
present study, rice seeds assumed to consist of field-tested Bt
rice (Anti-pest Shanyou 63 and Anti-pest Jinyou 63) were
used as reference material to determine transgenic DNA se-
quences. The transition between the cryIA(b) and cryIA(c)
fusion gene and the nopaline synthase terminator (nos) se-
quence was used to develop a construct-specific real-time
PCR based detection method. This Bt rice specific detection
system was combined with a recently published quantitative
real-time PCR method for the rice-specific (Oryza sativa L.)
reference gene gos9. The complete PCR assay for detection
of transgenic Bt rice was in-house validated and the limit
of quantification was found to be below 0.1% Bt rice rela-
tive to the rice content. Application of the PCR assay should
allow more precise detection of transgenic rice varieties in
imported food products which are so far not approved in the
EU.
Keywords Genetically modified organism . Rice (Oryza
sativa L.) . Bt toxin gene . Reference gene . Real-time
PCR . Detection method
D. Made C. Degner
Landesamt fur Verbraucherschutz Sachsen-Anhalt,
Dezernat 33,
Freiimfelder Str. 66/68,
06112 Halle, Germany
L. Grohmann (
)
Bundesamt fur Verbraucherschutz und Lebensmittelsicherheit,
Abteilung Gentechnik,
Referat 405, Mauerstr. 39-42,
10117 Berlin, Germany
e-mail: lutz.grohmann@bvl.bund.de
Introduction
In the EU, the authorisation and use of genetically modi-
fied (GM) foods and feed is stipulated by the provisions of
regulation (EC) No. 1829/2003 and (EC) No. 1830/2003 [1,
2]. Since the global agricultural use of GM crops constantly
expands, it remains an objective of the national food surveil-
lance of the EU member states to establish ways to control
food and feed entering the EU market that consist, contain
or are produced from genetically modified organisms not
approved according to these provisions.
A major source of new GM crop varieties which are close
to authorisation and soon may be placed on the market
is the plant biotechnology industry in Asia [3]. In China,
rice accounts for more than 20% of the total planted area
and high harvest yields of conventional rice are achieved
through heavy use of herbicides and pesticides. GM rice
varieties conferring resistance to pests or tolerance to herbi-
cides promise to reduce the use of chemicals for crop pro-
tection [3, 4]. Several different transgenic rice varieties are
described in public GMO databases [5, 6]. At least four of
them have been already tested in field and environmental
release trials and are currently in pre-production trials [3].
A transgenic rice line containing the Xa21 gene for resis-
tance to bacterial blight has entered pre-production trials in
2001, but its final approval was reversed by Chinas Min-
istry of Agriculture, because they demanded more detailed
biosafety information. Another GM rice variety, which car-
ries a modified cowpea trypsin inhibitor CpTI gene in order
to confer insect pest resistance, was approved for environ-
mental release trials in 1999, and after being introduced
into hybrid rice, GM II-Youming 86, pre-production trials
started in 2001. Transgenic rice that express the Bt toxin has
been developed and approved for environmental release tri-
als, and at least two Bt rice lines, GM Shanyou 63 and
Springer
272
Kemingdao, have entered pre-production trials in 2001
[7, 8].
Last year the internationally operating environmental
group Greenpeace investigated the current marketing of GM
rice varieties in China [9]. Several rice seed samples were
bought from local seed companies, at agriculture extension
stations and from farmers in Central Chinas Hubei Province.
The collected samples were analysed by a private GMO-
testing laboratory using DNA and protein based tests. In
19 out of 25 samples the presence of transgenic rice could
be shown [10]. Several samples tested positive in the DNA
screening tests and were also positive in a Cry1A(c)-specific
protein test, suggesting that these rice varieties express the
Bt protein.
Analytical methods to detect GMOs and to determine
their content in food or feed are mainly DNA-based using the
polymerase chain reaction (PCR). Due to its high specificity,
ease of use and applicability both as qualitative and as
quantitative method, real-time PCR is the preferred approach
to perform GMO-testing. Most real-time PCR detection
methods are based on the hydrolysis of fluorescence-labelled
oligonucleotide probes (TaqManTM ) during each cycle of the
amplification process [11]. This method is also preferred by
the EU in order to meet the recommended way to determine
the GMO content on the basis of haploid genome copies
[12]. In order to develop detection methods for specific GM
crops, positive test material must be available. However, it
is extremely difficult to obtain authentic reference material
for those GM varieties which are not developed and planted
in the EU or for which no official EU authorisation is
applied.
In an attempt to develop a detection method for GM rice
varieties which are in the process of commercialization in
China but currently not approved in the EU, we used two
rice seed samples of the Greenpeace survey as reference
material. Based on the assumption that the material contains
GM Shanyou 63 rice, parts of the transgenic sequences
were amplified to develop a construct-specific real-time PCR
assay. We here describe a method for detection of Bt rice
varieties which could be also used for quantification of the
content if present in imported food products.
Material and methods
Sample material and DNA extraction
Two GM rice samples, FR0502519 and FR0502520, were
kindly provided by Greenpeace International who collected
the packaged rice seeds in an agriculture extension station in
Wangjiaqiao Town, Songzi City in Hubei Province, China,
in spring 2005 [10]. The samples were labelled as Anti-pest
Shanyou 63 and as Anti-pest Jinyou 63. tional rice and 0.5 g of rice sample FR0502519 resulting
Springer
Eur Food Res Technol (2006) 224:271278
DNA was extracted from ground material using a modified
CTAB nucleic acid extraction method [13]. 1.5 mL CTAB ex-
traction buffer (20 g/L cetyl-trimethyl-ammonium bromide,
1.4 mol/L NaCl, 0.1 mol/L TrisHCl, 0.02 mol/L Na2 EDTA,
pH 8.0) and 10 L Proteinase K solution (20 mg/mL) were
added to 200 mg of the milled rice sample. The samples
were incubated at 60 C under constant agitation overnight
and then centrifuged for 10 min at 13,000 g. The super-
natant was transferred into a new vial, 750 L of chloro-
form was added, vigorously shaken and then centrifuged
at 13,000 g for 5 min. The upper phase was transferred
into a new vial, its volume was determined and mixed with
two volumes of CTAB precipitation buffer (5 g/L cetyl-
trimethyl-ammonium bromide, 40 mmol/L NaCl). After in-
cubation for 60 min at room temperature without agitation,
the samples were centrifuged for 15 min at 13,000 g, the
supernatant was discarded and the pellet was resuspended
in 350 L of a 350 mmol/L NaCl solution. Chloroform
(350 L) was added, the samples were mixed on a Vortex
and centrifuged for 10 min at 13,000 g. The upper phase
was combined with 0.6 volumes of isopropanol for nucleic
acid precipitation and after 20 min incubation at room tem-
perature the samples were centrifuged 10 min at 13,000 g.
The supernatant was discarded, the pellet was washed with
500 L ethanol solution (70% EtOH) and resolved in 200 L
TE buffer (1 mmol/L TrisHCl, 0.1 mmol/L Na2 EDTA,
pH 8.0).
The extracted DNA was quantified in a fluorometric as-
say using the PicoGreen dsDNA binding dye (Invitrogen)
according to the manufacturers instructions. Measurements
were conducted in an ABI PRISM 7900 (Applied Biosys-
tems) at 525 nm. A 100 bp molecular size DNA marker with
a concentration of 0.1 g/L DNA (Fermentas) was used
for calibration.
For specificity tests, DNA was extracted from two com-
mercially available conventional rice brands bought in Ger-
many (Wurzener Parboiled Reis, Lot L 60531E, Wurzen,
Germany and Gut & Gunstig Spitzen-Langkorn-Reis, Lot
07\02\2008, Hamburg, Germany), from GM rice line LL-
RICE62, GM soya line GTS40-3-2 and GM maize lines T25,
Bt11, Bt10, Bt176, MON810, MON863, NK603, TC1507,
GA21 and CBH351.
For sensitivity tests, a serial dilution of DNA extracted
from samples FR0502519 and FR0502520 was prepared by
stepwise fourfold dilution with 0.1 TE buffer. Another
serial dilution also used to test for the sensitivity was pre-
pared in the same way with DNA extracted from sample
FR0502519 and a mixture of genomic DNA from conven-
tional rice (Wurzener Parboiled Reis, 10 g/mL) and maize
(10 g/mL). The mass fraction mixtures with different GMO
contents were prepared using ground conventional rice and
GM rice sample FR0502519. A mixture of 9.5 g conven-
Eur Food Res Technol (2006) 224:271278 273

in a 5% (w/w) sample was used a starting material. 2 g of
this 5% (w/w) mixture was added to 8 g of conventional
rice giving a 1% (w/w) sample. A subsequent 0.5% (w/w)
mixture was prepared using 5 g of the 1% (w/w) sample and
5 g of conventional rice, and a 0.1% (w/w) level was pre-
pared using 8 g conventional rice and 2 g of the 0.5% (w/w)
sample. For subsequent quantitative real-time PCR analyses
DNA was extracted from the 5, 0.5 and 0.1% mass fraction
mixtures.
PCR and DNA sequencing
PCR was performed in a volume of 25 L containing 2.5 L
10 PCR buffer with 15 mmol/L MgCl2 , 0.5 mol/L of
each primer, 0.625 U Taq polymerase (HotStar, Qiagen) and
1 L of template DNA corresponding to 25 ng DNA. For
thermal cycling, an initial denaturation step for 15 min at
95 C was followed by 45 cycles of 30 s at 94 C, 30 s at
60 C and 60 s at 72 C with a final elongation step of 7 min
at 72 C. In conventional PCR and real-time PCR targeting
the CaMV 35S promoter and the nos terminator sequences
protocols described elsewhere were used [1418].
For sequence determination of the transgenic construct
DNA extracted from samples FR0502519 and FR0502520
was used in PCR experiments with primers RiceActin1f (5 -
ccc tct cct ctt tct ttc tcc g-3 ; personal communication N.
Hess) in combination with primer NOS180R (5 -TTg TTT
TCT ATC gCg TAT TAA ATg T-3 ; personal communication
R. Reiting) at reaction conditions as described. Additional
PCR products were generated with oligonucleotides NOS-1
(5 -gAA TCC TgT TgC Cgg TCT Tg-3 ), NOS-3 (5 -TTA
TCC TAg TTT gCg CgC TA-3 ) and CryIA(b)F (5 -ACC
ATC AAC AgC CgC TAC AAC gAC C-3 ) using reaction
conditions described elsewhere [14, 17, 18].
PCR products were purified with a QIAquick PCR purifi-
cation kit (Qiagen) and directly sequenced with the BigDye
Terminator V 1.1 cycle sequencing kit (Applied Biosystems)
in an ABI PRISM 310 instrument (Applied Biosystems). Se-
quencing was done by a primer walking strategy to generate
sequences in overlapping regions of the different construct
elements. Nucleic acid sequence data were first compared
with the Sequence Navigator software (Applied Biosystems)
and then analysed by searches in the GenBank sequence
database using the computer algorithm BLAST 2 [19].
Real-time PCR
Real-time PCR was performed in an ABI PRISM 7900 in-
strument (Applied Biosystems). All reactions were run as
duplicates in 96-well plates. The 25 L reaction mixtures
contained 12.5 L universal master mix (Applied Biosys-
tems), the indicated concentrations of primers and probe
(Table 1) and 5 L of template DNA. The reaction conditions
were as follows: Initiation step for 10 min at 95 C followed
by 45 cycles of 20 s at 95 C and 1 min at 60 C. Primers
T51F and T51R1 and probe T51p (Table 1) were designed
with the Primer Express 2.0 software (Applied Biosystems).
Primer and probe sequences for detection of taxon-specific
rice reference genes were taken from published real-time
PCR assays [20, 21].
Results and discussion
Sequence analysis of GM rice samples
Two rice seed samples taken at local Chinese wholesalers by
Greenpeace in the year 2005 were used for DNA sequence
analysis. These samples, FR0502519 and FR0502520, were
initially investigated with GMO screening tests. Both sam-
ples showed positive reactions in a CryIA(c) immuno-based
Bt-protein test and in a DNA-based test for the nopaline syn-
thase (nos) transcription terminator sequence, whereas only
one sample (FR0502520) was positive for the CaMV 35S
promoter sequence in a 35S DNA-test [10]. Re-investigation
of these results with a 35S promoter-specific real-time PCR

Table 1 Description of the different real-time PCR systems used in the study. The length of the generated PCR product is given in brackets

Final concentration
Method Name Oligonucleotide sequence (5 3 ) in PCR (nmol/L) Reference

Bt rice construct (83 bp) T51F gAC TgC Tgg AgT gAT TAT CgA CAg A 300 This work
T51R AgC TCg gTA CCT CgA CTT ATT CAg 300
T51p FAM-TCg AgT TCA TTC CAg TTA CTg CAA CAC 100
TCg Ag-TAMRA
gos9 rice reference gene (68 bp) org1 TTA gCC TCC CgC TgC AgA 300 [21]
org2 AgA gTC CAC AAg TgC TCC Cg 300
orgp FAM-Cgg CAg TgT ggT Tgg TTT CTT Cgg-Dabcyl 100
sps rice reference gene (81 bp) SPSF TTg CgC CTg AAC ggA TAT 750 [20]
SPSR Cgg TTg ATC TTT TCg ggA Tg 750
SPSP FAM-gAC gCA Cgg ACg gCT Cgg A-Dabcyl 300

Springer
274 Eur Food Res Technol (2006) 224:271278

Fig. 1 Diagram of the construct pFHBT1 inserted in GM Shanyou cated by the arrows. The location of sequences taken for the alignments
63 according to Tu et al. [7]. The positions of the transgenic elements, shown in Fig. 2 and Fig. 3 are indicated by the striped bars. The position
their sizes and the restriction sites are given. Primers used in the present of the construct-specific Bt rice detection method with its primers and
study to generate PCR products suitable for DNA sequencing are indi- probe are also shown below the right striped bar

Fig. 2 Alignment of the FR0502519/20 1 GATCTTTGGCCTTGGTAGTTTGGGTGGGCGAGAGGCGGCTTCGTGCGCGCCCAGATCGGT 60

nucleotide sequences of PCR
products generated with sample
DNAs FR0502519 and
FR0502520 with identical
sequences identified by BLAST
GenBank database searches.
The sequence of AY225220.1
encodes the first intron of the
rice Act 1 gene. Entry Y09787.1
represents a synthetic cryIA(c)
gene sequence. The asterisks
indicate a potential spacer
sequence with similarity to a
fragment of a multiple cloning
site, containing also the HindIII
site as described by [7]
(underlined). The shaded
sequences are identical to
primers Ar and Btf1 which
were used in a study for
characterisation of the
transgenic restorer line TT51
and of its derived-hybrid GM
Shanyou 63 [22]. The potential
ATG start codon of the Bt fusion
gene is also shaded
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
AY225220.1 671 GATCTTTGGCCTTGGTAGTTTGGGTGGGCGAGAGGCGGGTTCGTGCGCGCCCAGATCGGT 730
FR0502519/20 61 GCGCGGGAGGGGCGGGATCTCGCGGCTGGGGCTCTCGCCGGCGTGGATCCGGCCCGGATC 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AY225220.1 731 GCGCGGGAGGGGCGGGATCTCGCGGCTGGGGCTCTCGCCGGCGTGGATCCGGCCCGGATC 790
FR0502519/20 121 TCGCGGGGAATGGGGCTCTCGGATGTAGATCTGCGATCCGCCGTTGTTGGGGGAGATGAT 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AY225220.1 791 TCGCGGGGAATGGGGCTCTCGGATGTAGATCTGCGATCCGCCGTTGTTGGGGGAGATGAT 850
FR0502519/20 181 GGGGGGTTTAAAATTTCCGCCATGCTAAACAAGATCAGGAAGAGGGGAAAAGGGCACTAT 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AY225220.1 851 GGGGGGTTTAAAATTTCCGCCATGCTAAACAAGATCAGGAAGAGGGGAAAAGGGCACTAT 910
FR0502519/20 241 GGTTTATATTTTTATATATTTCTGCTGCTTCGTCAGGCTTAGATGTGCTAGATCTTTCTT 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AY225220.1 911 GGTTTATATTTTTATATATTTCTGCTGCTTCGTCAGGCTTAGATGTGCTAGATCTTTCTT 970
FR0502519/20 301 TCTTCTTTTTGTGGGTAGAATTTGAATCCCTCAGCATTGTTCATCGGTAGTTTTTCTTTT 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AY225220.1 971 TCTTCTTTTTGTGGGTAGAATTTGAATCCCTCAGCATTGTTCATCGGTAGTTTTTCTTTT 1030
<-----primer Ar [22]-- ********
FR0502519/20 361 CATGATTTGTGACAAATGCAGCCTCGTGCGGAGCTTTTTTGTAGGTAGACGATAAGCTTG 420
||||||||||||||||||||||||||||||||||||||||||||
AY225220.1 1031 CATGATTTGTGACAAATGCAGCCTCGTGCGGAGCTTTTTTGTAG---------------- 1074
******************* --primer Btf1 [22]- 1088
FR0502519/20 421 ATATCGAATTCCTGCAGCCCCAATGGACAACTGCAGGCCATACAACTGCTTGAGTAACCC 480
|||||||||||||||||||||||
Y09787.1 34 -------------------------------------CCATACAACTGCTTGAGTAACCC 56
-->
FR0502519/20 481 AGAAGTTGAAGTACTTGGTGGAGAACGCATTGAAACCGGTTACACTCCCATCGACATCTC 540
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Y09787.1 57 AGAAGTTGAAGTACTTGGTGGAGAACGCATTGAAACCGGTTACACTCCCATCGACATCTC 116
FR0502519/20 541 CTTGTCCTTGACACAGTTTCTGCTCAGCGAGTTCGTGCCAGGTGCTGGGTTCGTTCTCGG 600
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Y09787.1 117 CTTGTCCTTGACACAGTTTCTGCTCAGCGAGTTCGTGCCAGGTGCTGGGTTCGTTCTCGG 176
FR0502519/20 601 ACTAGTTGACATCATCTGGGGTATCTTTGGTCCATCTCAATGGGATGCATTCCTGGTGCA 660
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Y09787.1 177 ACTAGTTGACATCATCTGGGGTATCTTTGGTCCATCTCAATGGGATGCATTCCTGGTGCA 236
FR0502519/20 661 AATTGAGCAGTTGATCAACCAGAGGATCGAAGAGTTCGCCAGGAACCAGGCCATCTCTAG 720
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Y09787.1 237 AATTGAGCAGTTGATCAACCAGAGGATCGAAGAGTTCGCCAGGAACCAGGCCATCTCTAG 296
FR0502519/20 721 GTTGGAAGGATTGAGCAATCTCTACCAAATCTATGCAGAGAGCTTCAGAGAGTGGGAAGC 780
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Y09787.1 297 GTTGGAAGGATTGAGCAATCTCTACCAAATCTATGCAGAGAGCTTCAGAGAGTGGGAAGC 356
FR0502519/20 781 CGATCCTACTAACCCAGCTCTCCG 804
||||||||||||||||||||||||
Y09787.1 357 CGATCCTACTAACCCAGCTCTCCG 380

test showed that only a weak 35S reaction with a Ct-value
of 35 is detectable with DNA from FR0502520 when
compared to the Ct-value of 24 obtained in the nos-
specific real-time PCR using the same amount of sample
DNA. We assume that traces of another GMO is present
in sample FR0502520, since the construct in the suspected
GM Shanyou 63 line should not contain the CaMV 35S
promoter and the removal of the 35S promoter-driven hph
marker gene by segregation has been reported for the parental
CMS restorer line Minghui 63 [22].

Springer
Eur Food Res Technol (2006) 224:271278 275

Fig. 3 Alignment of sequences FR0502519/20 1 GTTCTGTCATTTCAGGACCAGGATTCACTGGTGGAGACCTCGTTAGACTCAACAGCAGTG 60

of PCR products amplified with
DNAs extracted from samples
FR0502519 and FR0502520.
The sequence of BD276264.1
represents a patented GeneBank
data base entry encoding the
CryIA(c) gene. The sequence of
AB209952 is taken from a
GenBank entry containing the
nos terminator sequence present
in glyphosate tolerant GM
soybeans. The positions of the
primers and the probe used by
the construct-specific Bt rice
detection method described in
this study are shaded. The SstI
restriction site as described by
[7] is underlined
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
BD276264.1 1550 GTTCTGTCATTTCAGGACCAGGATTCACTGGTGGAGACCTCGTTAGACTCAACAGCAGTG 1609
FR0502519/20 61 GAAACAACATTCAGAATAGAGGGTATATTGAAGTTCCAATTCACTTCCCATCCACATCTA 120
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
BD276264.1 1610 GAAATAACATTCAGAATAGAGGGTATATTGAAGTTCCAATTCACTTCCCATCCACATCTA 1669
FR0502519/20 121 CCAGATATAGAGTTCGTGTGAGGTATGCTTCTGTGACCCCTATTCACCTCAACGTTAATT 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
BD276264.1 1670 CCAGATATAGAGTTCGTGTGAGGTATGCTTCTGTGACCCCTATTCACCTCAACGTTAATT 1729
FR0502519/20 181 GGGGTAATTCATCCATCTTCTCCAATACAGTTCCAGCTACAGCTACCTCCTTGGATAATC 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
BD276264.1 1730 GGGGTAATTCATCCATCTTCTCCAATACAGTTCCAGCTACAGCTACCTCCTTGGATAATC 1789
FR0502519/20 241 TCCAATCCAGCGATTTCGGTTACTTTGAAAGTGCCAATGCTTTTACATCTTCACTCGGTA 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
BD276264.1 1790 TCCAATCCAGCGATTTCGGTTACTTTGAAAGTGCCAATGCTTTTACATCTTCACTCGGTA 1849
-----T51F primer--------> ------
FR0502519/20 301 ACATCGTGGGTGTTAGAAACTTTAGTGGGACTGCTGGAGTGATTATCGACAGATTCGAGT 360
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
BD276264.1 1850 ACATCGTGGGTGTTAGAAACTTTAGTGGGACTGCAGGAGTGATTATCGACAGATTCGAGT 1909
----T51 probe------------> <----T51R primer--------
FR0502519/20 361 TCATTCCAGTTACTGCAACACTCGAGGCTGAATAAGTCGAGGTACCGAGCTCGAATTTCC 420
||||||||||||||||||||||||||||||||| |
BD276264.1 1910 TCATTCCAGTTACTGCAACACTCGAGGCTGAAA--------------------------C 1917
1942 (AB209952)1917

FR0502519/20 421 CCGATCGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTTGCCGGTCTTG 480

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AB209952 1918 CCGATCGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTTGCCGGTCTTG 1977
FR0502519/20 481 CGATGATTATCATATAATTTCTGTTGAATTACGTTAAGCATGTAATAATTAACATGTAAT 540
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AB209952 1978 CGATGATTATCATATAATTTCTGTTGAATTACGTTAAGCATGTAATAATTAACATGTAAT 2037
FR0502519/20 541 GCATGACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCCCGCAAT 588
||||||||||||||||||||||||||||||||||||||||||||||||
AB209952 2038 GCATGACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCCCGCAAT 2085

Several different primer combinations targeting the pre-
sumed transgenic construct inserted in GM Shanyou 63 [7]
were used to generate PCR products suitable for direct DNA
sequencing (Fig. 1). The nucleotide (nt) sequences of these
products were analysed with the BLAST similarity search
engine of the National Center for Biotechnology Informa-
tion (NCBI). The two regions selected for alignments of the
transgenic sequences with identical GenBank sequences are
shown (Figs. 2 and 3). The 5 sequence part of the ampli-
fied fragment shows complete identity to the rice Act1 intron
contained in a plant transformation vector (pPLEX-5013)
over a stretch of 404 nucleotides (Fig. 2). This sequence is
followed by a 38 nt long spacer with fragments of a multiple
cloning site until a potential ATG start codon of the Bt toxin
gene encoding reading frame is found. The next 347 nt long
stretch shows identity to a synthetic CryIA(c) gene (accession
number Y09787). The sequence of the PCR products gen-
erated with DNA from FR0502519 and FR0502520 showed
no differences in this region (data not shown), indicating
that either both samples represent the same GM rice event,
or that both samples derive from transformation events with
the same construct. The identified transgenic construct pre-
sumably corresponds to plasmid pFHBT1 which was used
for production of the GM Shanyou 63 line [7, 22]. Partic-
ularly a short amino-terminal peptide sequence (P-N-I-N-E-
C-I) deleted in the hybrid cryIA(c) gene of pFHBT1 is also
not present in the deduced protein sequence of the identified
reading frame [23].
To further analyse the transgenic sequences in the rice
sample materials under investigation, it was tested whether
the nos terminator is also located behind the Bt cryIA(b) and
cryIA(c) fusion gene as described for the pFHBT1 construct
[7, 22]. Using DNA from FR0502519 and FR0502520 as
template, distinct PCR products were amplified with primers
spanning the region of the 3 part of the cryIA(c) gene and
the nos terminator (see Fig. 1). Sequencing results shows
that in this region no differences are present in the two in-
vestigated rice samples (Fig. 3). The first 393 nucleotides
of the sequence completely match to a GenBank database
entry coding for a synthetic cryIA(c) gene. At the end of
the cryIA(c) sequence homology a 26 nt long spacer with
no similarity to known sequences is located, followed by a
169 nt long sequence identical to the nos terminator derived
from Agrobacterium tumefaciens.
Construct-specific detection of Bt rice varieties
To detect all Bt rice lines transformed with plasmid construct
pFHBT1 which are possibly marketed in China we decided
to develop a construct-specific detection method instead of
an event-specific assay. Based on the sequence data deter-
mined from the two rice samples the transition between the

Springer
276 Eur Food Res Technol (2006) 224:271278

Table 2 Sensitivity and detection range of the construct-specific Bt ing genome copy number was calculated on basis of the mass of the
rice real-time PCR system. Serial dilutions of DNAs from rice samples rice genome of 0,47 pg [25]
FR0502519 and FR0502520 were tested in duplicates, the correspond-
Sample DNA concentration

FR0502519 Amount of DNA (pg) 12,800 3,200 800 200 50 12.5 3.1 0.8
Haploid genome copy number 27,198 6,800 1,700 425 106 27 7 2
Ct-value (mean) 26.6 28.4 31.1 33.3 35.6 38.8 40.2 n.d.
FR0502520 Amount of DNA (pg) 13,200 3,300 825 206 52 13 3.2 0.8
Haploid genome copy number 28,100 7,025 1756 439 110 27 7 2
Ct-value (mean) 26.9 28.8 31.3 33.3 35.8 38.0 39.2 42.6 / n.d.

n. d., not determined.

synthetic cryIA(c) and the nos terminator was used to design
a PCR detection system (Fig. 3). To ensure that only this
83 bp long fragment of the construct will be amplified, one
of the primers is located directly in the spacer sequence. The
specificity of this PCR system was then tested with approx-
imately 10100 ng DNA extracted from several GM plant
reference materials (LL62 rice, GTS40-3-2 soya, T25, Bt11,
Bt10, Bt176, MON810, MON863, NK603, TC1507, GA21
and CBH351 maize) and from conventional rice varieties.
The amplifiability of DNAs was previously checked using
taxon-specifc reference gene detection systems for soya and
maize [16]. None of the conventional and of the GM lines
including the Bt maize varieties reacted positive with the
construct-specific Bt rice PCR system (data not shown).
Sensitivity and detection limit
The detection limit of the Bt rice real-time PCR assay
was then assessed by means of a DNA dilution series until
negative PCR results were obtained (Table 2). Based on the
assumption that one haploid rice genome copy has a molecu-
lar mass of 0.47 pg [24], the detection limit of the construct-
specific Bt rice detection system is seven copies, also in pres-
ence of conventional rice and maize DNA in the test reaction
(data not shown). Using the mean Ct-values of each dilution
step the corresponding regression curve was calculated (Fig.
4). The Ct-values measured with the construct-specific Bt
rice system were also compared with those obtained in the
nos real-time PCR. A dilution series with five steps of four-
fold DNA dilutions of samples FR0502519 and FR0502520
was tested. The Bt rice system showed Ct-values of 29.5
to 37.8 for FR0502519 and of 29.1 to 39.1 for FR0502520,
respectively. Using the nos-specific system, Ct-values ob-
tained with FR0502519 DNA ranged from 29.9 to 37.5 and
from 29.5 to 41.3 with FR0502520 DNA, respectively. The
fluctuation of the Ct-values observed with low DNA copy
numbers at the end of the dilution series can be attributed to
the statistical distribution of DNA target molecules in these

Fig. 4 Amplification plot of

the construct-specific Bt rice
real-time PCR system with a
dilution series of DNA from rice
sample FR0502519 (see
Table 2). The measured
fluorescence Rn values are
plotted against the PCR cycle
numbers, the box shows the
regression curve and
corresponding equation
calculated with the mean Ct
values

Springer
Eur Food Res Technol (2006) 224:271278 277

Table 3 Reproducibility of the PCR assay tested in 4 parallel DNA earlier than the sps system when using the same amount of
extractions from materials containing mixtures with different Bt rice template DNA. A DNA dilution series of sample FR0502520
mass fractions. The gos9 target sequence was used to determine the
amount of rice reference gene copies, the cry1A(c)/nos target sequence tested in the gos9 real-time PCR system yielded Ct-values
represents the construct-specific Bt rice detection system described in ranging from Ct 28.9 to Ct 36.8, whereas the same DNA
the present study. analysed with the sps real-time PCR system showed Ct-
Ct-values measured with Bt rice values ranging from Ct 33.5 to Ct 43.9. Therefore, it was
content (w/w) of decided to select gos9 as rice reference gene target and to use
DNA extraction Gene target 5% 0.5% 0.1% this detection system for quantitative Bt rice real-time PCR
analysis.
1 gos9 24.5 24.8 24.8
The sensitivity of this quantitative Bt rice assay was then
cry1A(c)/nos 29.8 33.8 36.2
2 gos9 23.8 24.0 24.9 tested with different mass fraction mixtures of conventional
cry1A(c)/nos 30.2 33.7 36.5 rice and rice sample FR0502519. Four DNA extractions were
3 gos9 23.8 24.4 23.8 done in parallel from the mixtures containing 5, 0.5 and 0.1%
cry1A(c)/nos 29.7 34.2 37.4 Bt rice FR0502519 and each DNA sample was analysed
4 gos9 23.7 24.1 25.1 in duplicate (Table 3). The results show that low GM rice
cry1A(c)/nos 30.2 34.8 36.3 concentrations of 0.1% could be reproducibly detected
and that the method should allow an estimate of the relative
GM rice content.
samples. The results indicate that the nos- and the Bt-specific
real-time PCR system yield comparable Ct-values with equal Detection of unapproved GM rice varieties
DNA samples, suggesting that FR0502519 and FR0502520
are not mixed with other GM rice seeds and that nos and the Cases of marketing and the use of GM rice varieties apart
Bt construct are presumably present in the same ratio. from deliberate field release trials is increasing in China and
In order to establish a detection assay applicable for rela- the effectiveness of the Chinese legislative and administrative
tive quantification, the construct-specific Bt rice PCR system frame work for surveillance to prevent uncontrolled cultiva-
was combined with a target taxon-specific real-time PCR tion of genetically modified crops is publicly debated [3, 9,
method. Recently, the validation of two different rice ref- 25]. Although the identity of the material used in our study
erence gene-specific real-time PCR methods has been de- is not exactly known, the analysis of the transgenic DNA
scribed [20, 21]. The method for detection of the sps gene sequences suggests that it contains the genetically modified
which codes for the sucrose phosphate synthase amplifies a rice line TT51-1, derived from line Minghui 63, and the
81 bp long fragment of the rice genome (Table 1). Speci- resulting hybrid rice line GM Shanyou 63 [7]. The general
ficity tests with 13 different rice varieties showed that the analytical strategy of the official European GMO control
sps gene contains no allelic variations in the amplified re- laboratories is first to perform DNA screening tests targeting
gion [20]. The detection limit of the sps PCR system was elements which are widely used in GM plants and then in
reported to be 10 DNA copies. The rice reference gene PCR the next analysis step to identify the GMO event. With the
system reported by Hernandez et al. [21] amplifies a 68 bp commonly used CaMV 35S promoter and the nos terminator
long fragment of the root-specific gos9 rice gene with a de- DNA screening methods several GM rice varieties, including
tection limit of three copies. We tested both methods at the GM Shanyou 63, should be detectable (Table 4). Because
cycling conditions of the construct-specific Bt rice method. the construct-specific Bt rice method described in the present
At 60 C as annealing/elongation temperature with a two- study targets DNA sequences that should be only present in
step cycling protocol, the gos9 system was found to be more GM-derived rice, it may help to confirm positive 35S/nos
sensitive when compared to the sps system. The gos9 sys- DNA screening results obtained in routine GMO analyses of
tem showed amplification curves appearing at about five Ct food products that otherwise could not be attributed to any

Table 4 PCR detection

methods and transgenic Transgenic rice line nos 35S Element-specific Construct-specific Event-specific Reference
elements present in GM rice
GM Shanyou 63 + + [3], This work
varieties. (+) indicate positive
detection with the respective LLRice 62 + + (bar) + [6, 26]
detection system, () indicate GM II-Youming 86 + (+ ) + (bar) [3, 27]
negative reactivity or absence of Event T103-10 + [3, 28, 29]
an available PCR test (Xa21-IR72)
Event 11586 + [30]
(Golden Rice)

Springer
278
GM plant. The comparison of the two different rice reference
gene detection methods shows, that the gos9 real-time PCR
system is compatible to a two-step PCR protocol and the cy-
cling conditions used for the Bt rice real-time PCR method.
We therefore suggest that this complete assay is applicable
also to quantitatively detect unauthorised Bt rice varieties in
EU food imports.
Acknowledgements We thank Dr. Janet Cotter (University of Ex-
eter, Exeter, UK) for providing us with the rice sample materials.
We also thank Dr. Joachim Bendiek (Bundesamt fur Verbraucher-
schutz und Lebensmittelsicherheit, Berlin) for critical reading of the
manuscript.
References
1. Regulation (EC) No. 1829/2003 of the European Parliament and
of the Council of 22 September 2003 on genetically modified food
and feed. Off J Eur Commun L268:123
2. Regulation (EC) No. 1830/2003 of the European Parliament and of
the Council of 22 September 2003 concerning the traceability and
labelling of genetically modified organisms and the traceability of
food and feed products produced from genetically modified or-
ganisms and amending Directive 2001/18/EC. Off J Eur Commun
L268:2428
3. Huang J, Hu R, Rozelle S, Pray C (2005) Science 308:688690
4. Bajaj S, Mohanty A (2005) Plant Biotechnol J 3:275307
5. Anonymous (2006) AGBIOS GM database. http://www.agbios.
com/dbase.php
6. Anonymous (2003) GMO-Watch Report. Genetically modified
crops: molecular and regulatory facts. Version 2. http://www.
bats.ch/gmo-watch/GVO-report140703.pdf
7. Tu J, Zhang G, Datta K, Xu C, He Y, Zhang Q, Khush GS, Datta
SK (2000) Nature Biotechnol 18:11011104
8. Pray CE, Ramaswami B, Huang J, Hu R, Bengali P, Zhang H
(2006) Int J Technol Globalisation 2:137157
9. Sze PC, Cotter J (2005) Science 310:232
10. Anonymous (2005) Testing results for GE rice in China.
http://www.greenpeace.org/raw/content/international/press/reports
/RiceatRiskTestResults.pdf
11. Holland PM, Abramson RD, Watson R, Gelfand DH (1991) Proc
Natl Acad Sci USA 88:357362
12. Commission Recommendation 2004/787 (EC) of 4 October 2004
on technical guidance for sampling and detection of genetically
modified organisms and material produced from genetically mod-
ified organisms as or in products in the context of Regulation (EC)
No. 1830/2003
Springer
Eur Food Res Technol (2006) 224:271278
13. ISO 21571:2005 Foodstuffs. Methods of analysis for the detec-
tion of genetically modified organisms and derived products nu-
cleic acid extraction. International Standardization Organisation,
Geneva, Switzerland
14. Official Collection of Test Methods (2001) Screening for detection
of genetically modified DNA sequences in foodstuffs by detec-
tion of DNA sequences which are frequently present in genetically
modified organisms German Federal Foodstuffs Act Food Anal-
ysis, Article 35, L 00.00-31, Beuth-Verlag, Berlin
15. ISO 21569:2005. Foodstuffs methods of analysis for the detection
of genetically modified organisms and derived products quali-
tative nucleic acid based methods. International Standardization
Organisation, Geneva, Switzerland
16. ISO 21570:2006. Foodstuffs methods of analysis for the detection
of genetically modified organisms and derived products quanti-
tative nucleic acid based methods. International Standardization
Organisation, Geneva, Switzerland
17. Pietsch K, Waiblinger HU, Brodmann P, Wurz A (1997) Dtsch
Lebensm Rundsch 93:3538
18. Ehlers B, Strauch E, Goltz M, Kubsch D, Wagner H, Maidhof H,
Bendiek J, Appel B, Buhk HJ (1997) Bundesgesundheitsbl 4:118
121
19. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) J
Mol Biol 215:403410
20. Ding J, Jia J, Yang L, Wen H, Zhang C, Liu W, Zhang D (2004) J
Agric Food Chem 52:33723377
21. Hernandez M, Esteve T, Pla M (2005) J Agric Food Chem 53:7003
7009
22. Tu J, Datta K, Oliva N, Zhang G, Xu C, Khush GS, Zhang Q, Datta
SK (2003) Plant Biotechnol J 1:155165
23. Tu J, Datta K, Alam MF, Fan Y, Khush GS, Datta SK (1998) Plant
Biotechnol 15:195203
24. Arumuganathan K, Earle ED (1991) Plant Mol Biol Rep 9:208
218
25. Huang J, Ruifa H, Scott R, Pray C (2005) Science 310:231233
26. Community Reference Laboratory for GM Food and Feed
(2006) Event-specific method for the quantification of
rice line LLRICE62 using real-time PCR. http://gmo-
crl.jrc.it/summaries/LLRICE62 validated Protocol.pdf
27. Xue Q, Duan X, Xu D, Wu R (1996) Production and testing
of insect-resistant transgenic rice plants. In: Proceedings of the
Third International Rice Genetics Symposium on rice genetics III,
Manila, 1620 October 1995, pp 239246
28. Tu J, Ona I, Zhang Q, Mew TW, Khush GS, Datta SK (1998) Theor
Appl Genet 97:3136
29. Tu J, Datta K, Khush GS, Zhang Q, Datta SK (2000) Theor Appl
Genet 101:1520
30. Paine JA, Shipton CA, Chaggar S, Howells RM, Kennedy MJ,
Vernon G, Wright SY, Hinchliffe E, Adams JL, Silverstone AL,
Drake R (2005) Nat Biotechnol 23:482487