PRTTEl
CD
BOOH
I BOOH
BOOK
FRACTALS,
A r T A I C ART,
FRACTALS. ADT
ART, and NATURE
and NATURE zyxwvutsrqponmlkjihgfe
zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQP
zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA
This page is intentionally left blank
POTTER! BOOH
FRACTALS, ART, and NATURE
Editor
CliffordflPichover zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONML
IBM Thomas J. Watson Research Center
LibraryofCongressCataloginginPublication Data
ThePatternBook :fractals, art,andnature/editor,Clifford A.Pickover.
p. cm.
Includesindex.
ISBN 981021426X
1. Computergraphics. 1. Pickover,Clifford A.
T385.P376
745.4dc20 9447114
CIP
Firstpublished 1995
Reprinted 1997,2000
For photocopying of material in this volume, please pay a copying fee through the Copyright
Clearance Center, Inc.,222Rosewood Drive,Danvers,MA01923,USA.Inthiscasepermission to
photocopy isnotrequired from the publisher.
Introduction
This book will allow you to travel through time and space. To facilitate
yourjourney, Ihavescoured the four cornersoftheearth inaquest for unusual
peopleandtheir fascinating patterns. FromMozambique, toAsia,tomany Eu
ropean countries, the contributors to The Pattern Book include worldfamous
cancer researchers, littleknown artists, and eclectic computer programmers.
Some ofthe patterns are ultramodern, whileothers are centuries old. Manyof
the patterns are drawn from the universe ofmathematics. Tostart you on the
journey, I will first provide some relevant background material on computers,
pattern, science, and art.
The line between science and art is a fuzzy one; the two are fraternal
philosophies formalized by ancient Greeks like Pythagoreas and Ictinus. To
day, computer graphics is one method through which scientists and artists
reunite these philosophies by providing scientific ways to represent natural
and artistic objects. In fact many of this book's patterns were generated on
small computers using simple algorithms. Other (equally interesting) patterns
weregenerated byhuman hands, and these patterns often illustrate ornaments
of both modern and ancient civilizations. Sometimes these patterns consist of
V
vi C. A. Pickover
symmetrical and repeating designs, for example, Moorish, Persian, and other
motifs in tiled floors and cloths.
This book serves as an introductory catalog to some ofthe many facets of
geometrical patterns, and you are urged to explore the ideas in greater depth
than can bepresented inthiscompendium. Perhaps Ishould attempt to define
"pattern" before proceeding. You can find many definitions when consulting
a dictionary, for example, "an artistic or mechanical design" or "a natural or
chance configuration". The patterns in this book have such a great diver
sity that colleagues have debated whether the shapes should really be called
"patterns" at all. However, I take the broad view, and include visually inter
esting shapes and themes from all areas ofhuman, natural, and mathematical
realms. Although the emphasisisoncomputergenerated patterns, the book is
informal, and the intended audience spans several fields. This book might be
used by students, graphic artists, illustrators, and craftspeople in search ofvi
sually intriguing designs, or anyone fascinated by optically provocative art. In
addition, the book may be used by scientists, artists, laypeople, programmers
and students. In the same spirit as Gardner's book, Mathematical Circus, or
Pappas' book, The Joy of Mathematics, The Pattern Book combines old and
new ideas with emphasis on the fun that the true pattern lover finds in
doing, rather than in reading about the doing! The book is organized into
three main parts: Representing Nature (for those patterns which describe
orshow realphysical phenomena, e.g., visualizations ofprotein motion, sealil
lies,etc.), Mathematics and Symmetry (for those patterns which describe
or show mathematical behavior, e.g., fractals), and Human Art (for those
patterns which are artistic works of humans and made without the aid of a
computer, e.g., Moslem tilingpatterns). Iprovide acomprehensive glossary to
help ease readers into technical or unfamiliar waters.
When deciding howto arrange material within the three parts of The Pat
tern Book, many divisions came to mind computer and noncomputer gen
erated forms, science and art, nature and mathematics. However, the line
between allofthesecategoriesbecomesindistinct orartificial, andIhavethere
fore randomly arranged thepatterns within each part ofthe book toretain the
playful spirit of the book and to give the reader unexpected pleasures. Some
patterns could easilybeplaced ineither ofthe three main sectionsofthe book.
The reader is forewarned that some of the presented material in this
book's catalog of shapes involves sophisticated concepts (e.g., "The
Reversible GreensbergHastings Cellular Automaton" by Drs. P. Tamayo and
The Pattern Book: Fractals, Art, and Nature vii
and avariety ofpopular art decodesigns. Also "controlled accident" has found
its place in many areas of the modern arts (O'Brien, 1968). For example,
Dadaist and Surrealist painters such as Miro, Masson, and Arp capitalized on
the elements of chance, and the works they created provide challenges for the
mind as well as the eye. In the area of science, researchers are intrigued by
the way nature often expresses itself in terms of repeating symmetries and
the cross section of plants, phase transitions, standing waves on metal plates,
muscle striations, snow crystals, and dendritic ice are just a few examples.
viii C. A. Pickover
From the branching of rivers and blood vessels, to the highly convoluted sur
face of brains and bark, the physical world contains intricate patterns formed
from simple shapes through the repeated application of dynamic procedures.
Questions about the fundamental rules underlying the variety of nature have
led to the search to identify, measure, and define these patterns in precise
scientific terms.
One final observation on patterns in nature. Our physical world around us
often seemschaotic,exhibiting alimitlessand complexarray ofpatterns. How
ever, you should note that our world is also actually highly structured. From
an evolutionary standpoint, biological themes, structures, and "solutions" are
repeated whenpossible,andinanimateformssuchasmountainsand snowflakes
are constrained by physical laws to a finite class of patterns. The apparently
intricate fabric of nature and the universe is produced from a limited variety
ofthreads which are,inturn, organized into amultitude ofcombinations. You
will see some of these threads throughout this book.
as the weather, are so sensitive to even small local fluctuations that we will
never be able to accurately predict what they will do in the future. For certain
mathematical systems, if you change a parameter ever-so-slightly, the results
can be very different. Although chaos seems totally "random", it often obeys
strict mathematical rules derived from equations that can be formulated and
studied. One important research tool to aid the study of chaos is computer
graphics. From chaotic toys with randomly blinking lights to wisps and ed-
dies of cigarette smoke, chaotic behavior is irregular and disorderly. Other
examples include certain neurological and cardiac activity, the stock market,
and some electrical networks of computers. Chaos theory has also often been
applied to a wide range of visual art.
So extensive is the interest in fractals and chaos that keeping up with
the literature on the subject is rapidly becoming a full-time task. In 1989, the
world's scientific journals published about 1,200 articles with the words "chaos"
or "fractal(s)" in the title. The figure here shows the number of papers with zyxwv
F i g u r e 1. Chaos and fractal article explosion. A review of the world scientific literature
between 1973 and 1990 shows the number of chaos and fractal articles rising dramatically
between the years 1982 and 1990. (Figure from Computers and the Imagination by C. Pick-
over, 1991 St. Martin's Press. All rights reserved.)
x C. A. Pickover
upwards out ofa chaotic sea likevigorous fish, growing and uncurling like fern
fronds reaching forthelight." Ofthesealilies,anotherjudgenoted that "these
beautifully intricate forms owe as much to the artist's eyes as they do to the
natural shapes ofthe organisms themselves; this istypical ofthe precision and
artistry found in much 19thcentury illustration".
The remaining prizes go to Stefan Muller, Theo Plesser, and Benno Hess
of Germany for their patterns on "Rotating Spiral Waves in the Belousov
Zhabotinskii Reaction", A. K. Dewdney of Canada for his "Informal Tessela
tion ofCats", John MacManusofCanada for his "Jungle Canopy", and Henrik
Bohr and Soren Brunak of Denmark for their "Patterns of Protein Conforma
tions". Of the rotating spiral wave patterns, one judge noted: "Ever since
I first heard of and then actually demonstrated for myself the existence of
oscillating chemical reactions, Ihave found both thechemistry and the mathe
matics ofthese patterns irresistible. The spirals have wonderfully complicated
symmetries." Another judge remarked:
"I'm sure I won't be the first or the last to pick this one. I admire
Dr. Dewdney's unspoken point: if you are going to tile a plane
with a species, by all means choose one that is naturally graceful,
flexible, and incapable of uncomfortable angularities."
xii C. A. Pickover
"Some people can read a musical score and in their minds hear
the music ... Others cansee, in their mind's eye, great beauty and
structure in certain mathematical functions ... Lesserfolk, like me,
need to hear music played and see numbers rendered to appreciate
their structures."
As you will see in many patterns from this book, mathematical formulas
can sometimes be used to simulate natural forms. For example, computer
graphics provides a way to represent biological objects. For an excellent book
on techniques for simulating nature, see Rivlin (1986). Researchers have ex
plored the useofrules based onthe lawsofnature, such as logarithmic spirals
for sea shells (Kawaguchi, 1982) or tree branching patterns determined from
the study ofliving specimens (Aono, 1984). Other papers describe the genera
tion ofplant leaf vein patterns (Kolata, 1987) and woodgrains (Yessios, 1979).
Bloomenthal (1985) describes methods for simulating tree bark, leaves, and
limbs. Other sophisticated approaches to botanical structure generation exist,
for example, beautiful "particle systems" consisting of trajectories of particles
influenced bythe pullofgravity (Reeves, 1985). Seealso (Viennot et al., 1989;
Prusinkiewicz et al., 1988). For references on symmetry in historical orna
ments, seeAudsley (1968) and Rozsa (1986). Audsley's book includes illustra
tions of ancient Egyptian patterns from the painted ceiling of various tombs,
interlaced Celtic designs typical of those used to illuminate manuscripts, and
various Japanese ornaments. For a fascinating collection of Persian designs
and motifs, see Dowlatshahi (1979). Symmetrical ornaments, such as those
presented in The Pattern Book, have persisted from ancient to modern times.
The different kindsofsymmetries havebeen most fully explored inArabic and
Moorish design. The later Islamic artists were forbidden by religion to repre
sent the human form, sothey naturally turned to elaborate geometric themes.
To explore the full range ofsymmetry in historic ornaments, you may wish to
study the work of Gombrich who discusses the psychology of decorative art
and presents several additional examples of fivefold symmetry.
The following reference list includes books and papers describing patterns
in a range of scientific and artistic fields.
The Pattern Book: Fractals, Art, and Nature xiii
Museum of Art and Hunter College of the City University of New York.
pp. 155.
O'Brien, J. (1968) How to Design byAccident. Dover: New York.
Pappas,T. (1990) The Joy ofMathematics. WideWorldPublishing: California.
Peachey, D. (1985) "Solid texturing of complex surfaces", Computer Graphics
(ACM SIGGRAPH) 19(3): 279286.
Perlin, K. (1985) "An image synthesizer", Computer Graphics (ACM
SIGGRAPH) 19(3): 287296.
Postle, D. (1976) The Fabric of the Universe. Crown Publishers Inc.: New
York.
Rozsa, E. (1986) "Symmetry in Muslim arts", Computers and Mathematics
with Applications 12B:725750.
Viennot, X., Eyrolles, G., Janey, N. and Arques, D. (1989) "Combinatorial
analysis of ramified patterns and computer imagery of trees", Computer
Graphics (ACMSIGGRAPH) 23(3): 3140.
Zvilna, J. (1986) "Colored symmetries in spacetime", Computers and Mathe
matics with Applications 12B:895911.
Acknowledgments
Some of the figures in the book come from the Dover Pictorial Archive
of modern and ancient art. This series constitutes a collection of the world's
greatest designers from Ancient Egypt to Art Deco designs. For more infor
mation, write to Dover Publications, 31 East 2nd Street, Mineola, New York
11501.
The opening quotation by Sven G. Carlson on art and science appeared in
his letter to Science News (Vol. 132, 1987,p. 382).
This page is intentionally left blank
Contents
Wood Pattern 24
P. Brodatz
Moire P attern 26
H. Giger
XVll
xviii Contents
Haeckel's SeaLilies 38
C. A. Pickover
Lattice Design 1 52
/. 0. Angell
Goldbach's Comet 55
H. F. Fliegeland D. S. Robertson
Carpet (13Iterations) 58
G. Jagoda
Con ten ts xix
3D-Cubes 60
G. Jagoda
The-End 62
G. Jagoda
Star-NLPI-5m 66
J . Rangel-Mondragon and S. J . Abas
Whirlpools 68
I. Astrahan
Magic Tessaract 72
J . R . Hendricks
Pinwheels 79
C. W . Hend erson
Circlefest 81
C. W. Hend erson
XOR Size 83
C. W . Henderson
Trig Gem 85
C. W. Hend erson
xx Contents
Locked Links 87
G. Ricard
Exponential Tunnel 90
G.Ricard
Star Trails 99
K. J. Hooper
Mosaics 108
R. Telgdrsky
Lizards 176
N. Chourot and V. Wright
Swirl 197
P. D. Bourke
Contents xxiii
Intertwined 242
E. F. Glynn
Stripes 260
W. J. Jones
Parquet 264
W. J. Jones
Tetrahedron 283
W. Li
TriHadamards 288
R. G. Lauzzana and S. de Vos
xxvi Contents
Logistic 3 302
L. K. Mitchell
2D Feigenbaum 311
J. Peinke, J. Parisi, M. Klein and 0. E. Rossler
Rotation 353
F. G. Szabo
Op Art 1 376
J. Larcher
Horoscope 388
E. Schoen
Clowns 400
S. Kreuzer
W. Tait
Glossary 413
Index 425
Reference
1. G. Daniel, A Voyage to the World of Cartesius (Thomas Bennett, 1694)
(translated byTaylor, T.).
3
Stefan C. Miiller, Theo Plesser and Benno Hess
Rotating Spiral Waves in the
BelousovZhabotinskii Reaction
References
1. R. J. Field and M. Burger, eds., Oscillationsand TravellingWavesinChemical
Systems (John Wiley,1986).
2. J. Ross, S. C. Miiller and C. Vidal, "Chemical waves", Science 240 (1988)
460465.
3. S. C. Miiller, Th. Plesser and B. Hess, "Twodimensional spectrophotometry of
spiralwavepropagationintheBelousovZhabotinskiireaction.I.Experimentsand
digital data representation", PhysicaD 24 (1987) 7186.
4
Rotating Spiral Waves in the BelousovZhabotinskii Reaction 5
Figure 1. (A) Snapshot of a spiral wave pattern in the BelousovZhabotinskii reaction. (B)
Digital overlay of six consecutive images covering one revolution of the spirals of image (A).
(C) Threedimensional perspective representation of the composite image (B) seen from a
view point located below the upper edge of (B).
Henrik Bohr and S0ren Brunak
P a t t e r n s of Protein Conformations
6
7
R e f e r e n c e s
1. S. Wolfram, "Complexity engineering", Physica 22D (1986) 385.
2. A. Ansani et al, "Protein states and protein quakes", Proc. Natl. Sci. 82 (1985)
5000.
3. H.Bohr and S.Brunak, "Atravellingsalesman approachtoprotein conformation",
Complex Systems 3 (1989) 9.
4. I. Glover et al, "Conformational flexibility in a small globular hormone: Xray
analysis of avian pancreatic polypeptide at 0.98 angstroms resolution", Biopoly
mers 22 (1983) 293.
Richard Dawkins
Blind Watchmaker Biomorphs
procedure Tree(i, y, length, dir: integer; dx, dy: array [0..7] of integer);
{Tree is called with the arrays dx and dy specifying the form of the tree, and
the starting value of length. Thereafter, tree calls itself recursively
with a progressively decreasing value of length};
var xnew,ynew: integer;
begin if dir < 0 then dir:=dir + 8; if dir > = 8 then dir:=dir 8;
xnew:=i + length *dx[dir]\ ynew:=y + length * dy[dir]\
MoveTo(x, y); LineTo(xnew, ynew);
if length > 0 then {now follow the two recursive calls, drawing to left
and right respectively}
begin
tree(xnew, ynew, length 1, dir 1) {this initiates a series of inner calls}
tree(xnew, ynew, length 1, dir + 1)
end
end {tree};
9
10 R. Dawkins
of my book, The Blind Watchmaker. As well as the nine genes of the original
version, the later version has additional genes controlling "segmentation" and
symmetry in various planes [3].
References
1. This extended program, called The Blind Watchmaker is available for the Apple
Macintosh computer, from W W Norton and Co., 500 Fifth Avenue, New York
10110, USA. The unextended version is available for the IBM PC from the same
address. In the UK, both versions can be obtained from Software Production
Associates, P.O. Box 59, Leamington Spa CV31 3QA, UK.
2. R. Dawkins, The Blind Watchmaker (W W Norton 1986).
3. R. Dawkins, "The evolution of evolvability", Artificial Life, ed. C. Langton
(Addison Wesley 1989) pp. 201220.
&
Reference
1. P.Brodatz, Wood and WoodGrains(Dover,1971).
12
13
14
Spring Tiles the Planes of Sunlight . . . 15
(a)
(b)
Figure 1.
17
(a)
(b)
Figure 2.
Peter Desain and Henkjan Honing
Trajectories of a Neural Network
Quantizer in R h y t h m Space
18
Trajectories of a Neural Network Quantizer in Rhythm Space 19
R e f e r e n c e s
1. P. Desain and H. Honing, "Quantization of musical time: A connectionist
approach", Computer Music Journal 13,3(1989) 5666.
2. P.Desain, H.Honing andK.deRijk, "Aconnectionist quantizer", Proc. 1989Int.
Computer Music Conf.,SanFrancisco, California (Computer Music Association,
1989) pp.8085.
3. R.B.Dannenberg andB.MontReynaud, "Anonline algorithm forrealtimeac
companiment", Proc. 1987Int. Computer Music Conf.,SanFrancisco, California
(Computer Music Association, 1987)pp.241248.
4. J. Chowning et a/., "Intelligent systems for the analysis of digitized acoustical
signals", CCRMA Report No.STANM15, Stanford, California (1984).
5. H.C.LonguetHiggins, Mental Processes (MITPress, 1987).
6. E.Clarke "Levelsofstructure intheorganization ofmusical time", Contemporary
Music Review 2 (1987) 212238.
20
22
An Internally Mechanistic Nucleon 23
R e f e r e n c e s
1. J. Boivin, The Heart Single Field Theory: Some Speculations on the Essential
Unity of the Universe (selfpublished). Reprinted in Speculations in Science and
Technology 3 , 2 (1980) 185204.
2. J. Boivin, Hearts Not Quarks (Tentativ e title) (to a p p e a r ) .
Reference
1. P.Brodatz, Wood and Wood Grains(Dover, 1971).
24
25
The three effects are demonstrated with the map of the landscape given by
cylindrical coordinates z(r, ip)= r tp,0 < r, 0< <p< 2n. (Figs. 1, 2, 3).
Moire 1) direction ip= 0, resembles the sourcefield of an electrical charge;
Moire 2) turning point r = 0, is the contour map of the surface of a circular
cone;
Moire 3) fixed pointr = 0,reproducesthecontour mapofthegiven landscape.
26
Moire" Pattern 27
References
1. J. Harthong, "Le Moire", Advances in Applied Mathematics 2 (1981) 2475.
2. H. Giger, "Moires", Comp. &Maths, with AppL, 12B, 1& 2 (1986) 329361.
Dawn Friedman
Fractal Phyllotactic Spirals:
Broccoli "Minaret"
2S
Johnny's Selected Seeds.
Broccoli Minaret is reproduced here by written permission ofzyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONML
to
Photograph: Johhny's Selected Seeds. zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA CD
Ulrich Melcher
Puppy Representation of
DNA Nucleotide Sequences
30
Puppy Representation of DNA Nucleotide Sequenceszyxwvutsrq
31
References
1. U. Melcher "A readable and space-efficient DNA sequence representation: Appli-
cation to caulimoviral DNAs", Comput. Appl. Biosci. 4 (1988) 93-96.
2. A. Pranck et al., "Nucleotide sequence of cauliflower mosaic virus", Cell 21 (1980)
285-294. zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA
V aa'", ^^\ T
Va'"ii
V
, ,
.""J , ,
J_ " ___" r
i au 1
*. ^T n""Li""".""iu
aD~ ~ . '.~~Bi u, B
'~, " ,
~/i
/ i" ~:r,i~
*rr,
_^_i."ij."~.~
i _ "
v i"j u
. ", ~*. ~ ,
~. r* _^_ ij j^r"
j_i" r
a~r.
a~ ,1
ji \"JBjYo a B,,V
i_\B"u'Y m .. ,,, ,o ,,r , v r
^B /i^i^ V a , ., .""j
__Vn ^ j ^ i,,Y
"i"i
x~Y, ,
. V i, ii ,"
j _ V_ i i r L,,iLij"u
B"Lj j"u
tt*ijj.*i**.B.Tj.
ijiji.'X.a.Tj.
t"jj.'ir.o.*i*j. I
il jj T
T
Tiut. ..^
.n
vnI..1..
. !i. T
T III *xi_
*x
* x ii _
_ mSUTm
M
M.. I TP II '' M
M ..
B
a" ..
"
" zyxwvutsrqponmlkjihgfedcbaZYXWVUT
.. ..'..tPn
i Iir
i1r**i '.. .. .*'* PI*MVU
" M
"
" _ .t. in
n *i*_*.'u
p rpra
t r ar*
PI*MVU * I
i* n_ iiiiii
'w *' m
. *u
*.Ml. i xlli.
A
jj iiT t*_
,,T *j_j. .p
rr...V
.A A
.A. *._.*_
__*jrj||T
_Tijjil.rrB..*B_'1J_Jul t_
Jl ar
Pp_J ......pr
J rJ_J ___ . ..**J_JJ_J.
rJJ_J lllP
r ,.
MBBII._.B __
B.U
U"Ii' i
i '*.'.|'**.'
ii..**__
. *to. . |-i*_
* _ _ Ji J
_V %
MV
'V _ 1^
Vt1
V<"
-P
^ i i*r"
Pr :_
iIu_J.//'V
u
L VIiI***xJ_J"4xX!*"V
L ** V "" ^^"_j_\,*.' ,j",r.,i.., "
'i ^ ,r
*Y
,* iYi"Y / // /
.. __iY
.Y
Y VI.i*^^. ."^
V. i.V^ .^Y
*. Y
* ._JY
Y B
_ JB
u.*uB"_.^j"~*jJi*V
.t"*,P
, rTTrr T
T
' * ^ ^.."""".."""" *I _ J ^ ''
_ II ^
B..,,^
B ^JJ''''
rr
BBV %"" i i' '__""VV, ,jj^^''. .hh__ ^^uu""___rr"".., ,, ,rrrr.. '' ii
Vjjii%
r , , r r
"""v.^/,'
B
B *"J J
I*"
" "*J"i
."H
"" .. .^
V |j. t' .^ ""j_i.^N^*'"_v.
^JjI"" _
^ r ,
J Jj jl*. \. A
f *t^^
^^. ."" ,T W
Jj ^ w
."vV:. Y ' .*'.v.Lv::B.
f tI ^ .^
\'.U
^ ^.V
V*p
. YLT .
^.J^ _
t_ %^_..VY^uVB.^v.
*U^
. 7 ' ^A" tVt "^ B. jj ._ _^J.:<~.-*
B^u _* . .
i j _
.Vj >
. : .<
~
,
~ . ->* r , , , r r
^.^
r
. .^
\^ ^ \r*aV
^ B\ .^
a
aB
..V
\. *
^x_
;_^
. ^
./^A
. \. ^
y ._
Y^
_
u^ju*
^.jV J ..T.Tv_..\T|^^
*J ..Y
Y J^^^
.Vl_^^l'._.^^.*^^
_*tn..P.....B..M...
_Tl rPvV
. T
. T
p. .*..
* ..B
a . .............
.****B..*I
BB
a....1iI1ii.. . * . . * . p
I Pp*
* *.
**.
l>.
b *ai
*BltT*.*T.
tf a liw
T
r*
f .y
.*
* r
T
*p.. i
I
~ t.
T
r ... Iii a
B
BT*
inrT** * p*.*
tP*.*
v *n*._i.*
MB*.*.*i
MB*.*.*
j r . x iI *' r
* T *.
.
*
*
TT
*r.
. ..
*
*M*
**
M
***** lI
. .. r
v
** 1y"*
*l **
i ***"!
*****
1*1
*P*| * I*| **
I1
*l
M .""Bt**!*
.*ap*|*
.*BP*|*fr*"*
^*
y* *
**
** *
fb|
*i**ff i**
**|**ff | PPP
IP T iI *a*n
1*1* *B**l**l
* B * n *^
*BT*I *^ JP*
JP* ** IB**l*
B**P
B*T
T ^^
*
^**. * *
* J
J
_ P **IP
B* **!***P
**!.T_
**U***I* JPI
JPI _
M*
M*** ml
.******J
M _l .i
..11
1
m , T, ~rB
, T,', T T
,
V iA *
*""
""*
"' V
B'_ _^m^..r'*
, , ,w* * r *_V
m, , m r i _ ^ ~ i . ' r" " "m" . " " * JrB
VlA*"*V_^^l.BBtB.r.'uTIp^B.JB_**"U""|*U*".""^J.*'
V _
u__"_''"^
j BJn_B r*n"
| IuuuI"_'"^"ir
"u
, i V, " .n" "
, Tr*
" .. bJ*. *., h
* * "Y
i _"\ IJ
aJ""
_._'J
>*r
_r "."'',
''.*,"
~r . ^r.r*_,*B'
B_' T^B B u'Bl*.ri_rit
".B"B_i ^
~
. I".* . ,'' ^u" '.""*%"""j'*.**l
U, , ' . " " H i. " " J * \ . " IrX V
. ti A
* irt n
8 ' *. . ."'", J" "m 'r_u.'f iV
u_u"~
^ l'"'li '., .'^
"^ *^^~ .J. "B"_^ .u"''^ .*/ ~"l"j**JX.'
"^ H . 1 *.^^ "B BU."*l. ^. _" '^^% "^"X "*x_*"_I"Xi x""**
tjr_"_r"j J~~
^ *^.V'^A. , 'i"^iju^r.^*.ri,a*/.^^
1"^
B . *
1^.V ". iB
.. V
V '. ^
.. ".iA
B. _j . ._j. ' ,*.'**
iP "" ^
1
jPjiI. r_j Jjuu. ^
I^r
. r_..
U1j^
.i P**.B.rr
i ^ia,A
fa**
^. /**.xV
.^
* r^
^.\*^* ^jJ. i^i
J^ta* B
. *
j ^*. > rB, ^' _^"Bi *' h_
j *x. . .^* ** i _u"na > u *
u j .
* *p
i* M
Pl * * t* .
wlI *. lI IiI ** *!**_..
I *p*l....*B*_
*>*%.. .*B
.*B *__
*M#**W Ii_
I _ **i_
!*****!_
TV* IiI M Hit
BB*B_
***B. uU
**. U *.*.| | *MM **JPI
JPI U
*M** *JPI uU II III *B*
**B*
B*MMM |.a. BM.
M . i.
B***w. ***!.
1. MM BM.
"* I U ..**1.
Bfcw
.***!.
i.w *w*Vtt
va
_**.*tt
* B_P*
B r *..
BMP* T
T . t. T
*r.t* MV* " B . .B "
*B.
*"B. . .. H
'.**.. B T
nPr
PTff 111
lI . |. ..*ri
1 * 1 ..** X
x .. * r
PT * 1*
1 r PB
r a T
r nI PJBP
P rjar* * P
r .**..*
..'_ 1nP
r U*B P
VU V B * r
P*.*B
I.*B P . .. M ITTT... "
' X **
m
,!>PT* . Ty* , '
fl|B^r*i**
u''"* 11*** l f i ' | P*|P**l|P .*B*PT*M ,, P* XI.t^X^B^XVa***".U'l'^PTT
|**** *B*I**** | i**i******i|i* ."BT****i**
MBM|"*I"","^I'I'P'*VJ"'' xyt
'V t j^^ lltx*
t j^
m
iJ_BPi_**MBM|.1|,"8*P**I*J.T*1|PJ*B*PIi_*_|H|"i_|*.***_'i*****'i***_||vwjujTWfg'j ^TP t j^' m vvvjijTWfg'j
l B* l xyB*B'*ii'i'
tv^^^ww M
ll T*I**I*a IB*_*
a 'v^''jrvr m*l*
I**B**a 'v^''jrvr
*. 111
i**.** 111 11
nv^Vfgjfrxrffl11' i1mu
' tI'MIIII
nv^Vfgjfrxrffl
'f t 'f mu
j^'' _B
B *.*#
j^'' " **
Iuuu "
l_BBT "dB'B*_
B T **V_BB.B*fr,*^*"
*_ **fVrI,
*fp,*^*",
* .f,lj.'.tB".*
^ ~^I !lj.'.tB.*
fM ,*
_\. I' *. ", ".*AUu_uV
|_' I_
,* pp
V l<<*
rlBM ***Va*
BB \*
jin
"* ", I^UJ"L. i"jrx
"jPT*
I B*BB " x f*cia^^*r^_r^^
^LA^jrx r
*^^,,~xrr.,J
a^^*f*^_p.*ijp B .*^^
TTTT ,, , r
.**r.*l*
^
*..Y
^.__r Y.Y
Yl^. ..
.
""^^
B hhVV "*^ T
*iTV .V^..^
.'^BhVB"iV.*^i*".'*x.V*A*iV.<i_**uB
aaB
Yy u
u B
BB iiiV
V ...'''\x
^i^'iii.'''" x\\.^
px .V
*V
^A ^Y
A YBBVV^^ | . ,B
u i r^riri*^_^
r^i _ "^**r i ^
^>__H".^ ^
nn , r r , , ,l m 8 r , nn ,n ,m
m ,
_ ** ..pr Tf '*"iiV
JS~^~t\K\^t^L'V
_*.r"iV.*."
i*i***
r
i* p r ,, ,, ,,pp
M*"l*i*i*B*^l"^li*^^iiilW*^i*i*i|
V . * .. "i r*-Ja'' p
i i' T ' *i .'.'J^u\'u.
'i. ._ tB *m
i t m"
__ , ,r
"WS~'Jm'J'J
.Yj"'B'
p j. "
.V
|t^i*ni*il*"*
B
, ,M
* '. i*i *_',.*B. i ./, j"*
,
, i*m
.ilWt*il\i^^**yii
l*,B Bj " * a W
jm '."^l
*a'j'J_j|*l%iii**H*i****li**1
' JY .~^
_
J '^i .Y.
' tYt
~^J'i'tt^\'^ ^ \.a'**lt*
^^"
Y ^^ m"^uV*'t
~BV*Y tu V
V* ' *lt..'
^t*iTi*f* ^~
~ iW"
iii* W. ^^p ."*j
_-JA^.^i'~'^
,
- J_AT*T*I*******
i^ p p
i.' ~j r"T "r'*' it'*. ''Vj."~.*.
'*"*"* ", r
ji ..*~~~*T. V
'i.'i.~~*.Vt-'M~
r
j i ~' rrT r
tu- 'L.'.B"
M
i,i\_*'.*.*.j
*^
* J .. Ii .ji*j P
_^ *""W._.V_
* ,p ^
_l _. iV. V
_ * .. V
l j P'rX r , * _ j l / j ,| . , X
i ' >i . " j . " r i , ^T^Tyy .ji**j| V
iiY._x."_*VYV"*^^ j V. ^
. *"l ., r, u
PY^*
~ > A1"A j V
j ^. ^ % B i ' ^ ^ ^ Y " i i " , ^ ^ . ~ i B . a , p " . l r . r * , , " r
vrt^l"l^V'.^.v.^>.^_.l_l.^uJ^^^
V t ""\ ..*rriY
V rIr tY i^ TT
"^ * rTrI'*
\V.V*
. ".V"
. '.."
~..~V
V ., "
V. .V
^. ^
"^ .V.. V
V.
..i*\"Iu./"
,,
^' i*, l i I' l\ .^r^
T Tp
^' |i . V * _Jj , ^
. Vi jl J ^ j^J " a " Y ^ ^
rr p rpp
i ^ V_'**
" li V ^B^B^rrB
^^^^B rB 'ii_i___V.V
BB .V
V iiB
iB
BJB
r, ,r r
j"j"^j",r"" _"l'_"iji"
" . ".' .
* .""
""
""
".a"
B B , ,,
a. .","* "~ ~jtj/T
o~ //^^
^
'....^^^
^j_jjam
aaVV
V tJJJAA
Yi ii'''tt*
rr
'A. r, .H
mm
..'''J.JJ, ,m. '''^^~\\\^
j^ V
VVV
V~~
i.iiV
~ ~V
VijjY
jAA
nn vv rr r r rrr r
A xn v, uwuui n.''~
~~S
~Saa
S a'aM
M
M
B~ \"'' .1,1i'^"
J^i\V
^ r
\ 'i''~. '"r ~
'i " tM S'
uu
r, r ,, r,
A H' *
n ,n
" * '""~.tJ
A'*'*~.\\V
.A'**~.\\V
r
." *J.\'^'~.'^V^\^t
tJ a
. "J.\'^'~.'^V^\^/hJ^~l'^ . ' , . " r , il * \ ' ^rrV
. l."" r ,ilx *r Jj^J^~l'^aJu^V. \ ^ t, a ^ J Jr~l'p^
aJLUMV.
^~l'tt' f ' l ~ ',r r a J L U M V . r ~ l ' t t ' , "' ' h*Ii, i'i.Y*.%.'i__Y*B'aj"
" ,
"_*i_' I_'i_.IY. Y*VJ^.Vu
n
*YB '* B
,
*. . BVI . **I*__Y_t.'t'Mjj~'.'~'u'^TV"Ajt.
J "' .~n."_B"^*"t*
l,
B . u.''
* j. ~^, .I ~. "^_" _ B ^ ~ t B.."" .~
*""
"jjJ"
l""V *~"
l l" "j.j"tBj ,/^
rm rr r, ,
m ".\'l.V
..H .V
"".j.V"j M
'M .j~*
,r r
~ B.**,"'B,pr^
.^ 'l.'.', J
''*.^*
Y ",*~ 'r, r', lL
''l.li'* _ r T r ,
. 'I' "
L
"L _.'\
|_B"*"
% .
*BI*B
W lr
B.. *'*^^. *^
r ,
*\I^
*X l*'*_V
Vj_^
lU lV , , , l ,, r
Yjll'Y
V Yj" j' ' B
^"Bj B n 'B' "
" 4' B ^ , 1_
lftcB " .BV. 'VlH,'l*
"*. B ,, , , , , ^ ,
U
lIIJ
JJX ', ~*l X
'i aJij 'j " T 1 1
* J. '"j l' " B u V B " L V l , .
^ X .
AV.**nu\W.Y*^*._*.Y^VYW.s^
il.v."B^/.Y
*W
. V.. '"V
i 'BV \. W
AV."i*nu\*B/.Y^ B "/ /. .V
YW ^
irri.*U.Y" Y ^V, H
* 'J.,W^ .*B^_W.,".VfcVi*^
. ..*_Vl^vrl.B^_w.".VfcVl^^
'*V
i . t Y V Y W
r i ^
*_.VB
^
^uIi_
jjiPT
i^^
IaB
r a",_,*1
,
B *, a
*B^
* ,,*.*B"
,,f
^ i,*,,
I!1,1
*B B"
^*,
Il B"
|iB
*| ,*M
I I, uI
t l l- **"..ilIff'Ucu
UV ** B
B'
W ^ . " "
II . u lI" |.^^^
BB'|^ |I\.
.P
rP J * I
*
j *^
"l 'Bf~ iT
cB*^ "PMP~Vh. m
'
^ 'S
r r
^tT\ ' ^i t ia^wB
j '^' V
^V n B
i ju .S' i~. V
rr ,
' ^f1'j/" r
'**' .i l ,i " W \ U i i V . " .
rH_*_t*_,*A.*"_"'"ta^ " " ^^
BB
r
*rp*i
"^'cui"j' _4^".y
T T _ **llBB_B
I***\.__."__'4^ T,T~^.*i."mY
^**l l**r*.* B*It*
r
l. t*tBtI"mYP."'PP'*^'A*i|*^^
**.,^.*i."mY*\ ^1r,_*^ViV^
_I*TI,V
T, .TB._B*."'" h'A^^j"j^fr_; BJJjj**jj**TTXf r_xv*
* |l l , * l ,I**B
f_^"."_^
fB*XP^^". . " j *
Pj*Pn.V*_ti"l*.B*X_i"Bi_ti_.*iB.* Tr, *_Bnj.^l.*l_m*l*J^*.* r, r tr r
*.V"l^_lYl , M xl_*l r Ll'". r l'
i j| J*
*^^* Tij".^
j '^" . " ll.|*^ljW.*
r r r ,1 , l,n , d , ,n , , , f n
rp
pJjJ'**in/
* ji "
" /.1V
n. V ,j,*
1 BB
*V B r^ \ *
.nv.* T*irj'^nHiY*B'^**
/ i# B jX*j%
' aj.^H
ih
1jj '
*iV
, * "BiB
*Y^"* ^
B "1.'".
n >*^ ,^'A 'nnj v'~*
pArw^B j. *x. ,
J B
, n".'..mmV
* fjmpV
c *' "j"^^
B
jf 'c r Bj *'^^
. \f P
\" J ^ w
^
,
tp~
T rT
" P^Tj~ 4l jj,*.B.B^*x,*^i
J ,
x l,xw |/j*p/,ajj*rT
r w B ^.pr
' i" 1J jJ j, "' B i^,*t,/
*^T '* 't_ |j "| 'i^*^^ r J.r t^
J j Ja/jV
i , .\*". B
.. .'^
B^V
^W*i XA, * A
A .* W
_ U
~ .j "J ^ .Y i ^* ^
x*u*/J*T/,aJj*rTBB^_prt^,*t,V
' j ^ ' ^
.BV.V"*V,*"n,*W^
. * B V .V \.*^ ,
* ^^\V
.BV.V"* , V , , "n , *i*^
" .. ,*B
'_ " l**,V *m a _BB^". *^ p
B^
BlWlr^V.*rTTllB"BVJ^^
, , , ,
,, ,** Bi
B I ..*
BI ..*
B T B * . MiI.i ., .*
BTB*.*J.
Bnr.M. * ,1
ii.... .. ..*
.. .* . .*... i.n.i...T.*iB*B*_._vai_,i.j
..*ll.l1.T..*P.m_*BI_._*.*l_A
. . * . . . ..*ii.ii.T..*p.Br_*Bi_._*.*i_x jJ,.iI,.iL
.n .i.Liy.'.Ti,.r.i.
n,,v
' ,,'i,T ^
* . .v, V . , iJ. *
. i . I' _ J.
_ ii.
. . i
ul .'.i.
/,,.
, , * . B I .* .* B T B . J . I V l . . . . * . . . * . . . . I . I . I 1 . T . . * P . B r _ * B I _ . _ * . * 1 _ X J , l , l . n , V , 1 m . . V . I . ' _ l . * _ l . . u . V .
.^*^. B
*. B
^__Bji\Vji V ^
\B n \/ _
V ^JB| T ^
T J.,r *
_n . ^^*. *T. ^
*aju^j\ \TTi ..B_ .*i A
/ ^. ^B^T , * 1 r T x 1 . B . B
J_*.*'.*ABriY^ir *.r i B . T H i ^
^_B.B.B\V.BT.*Jfc'j*\TJ_W^^
BV*...B^,t~SjfJ?*iJir&mtF^r*n?fTmF^a^t*BwJtMma*m*FJ^'T.^'.V\Vu*VLVA."^l^*'^VBB,Btt.V.*i."*.*,BfcB*.i'*B",*r**.**ji
vr>m>/u..
Y ..*%
t BBBA
l
.
Kazunori Miyata
Stone Wall Pattern
Bump data are used for the shading process, and attribute data are used
to change the color ofeach stone, its optical features, and so on. An example
of a generated stone wall pattern is shown in Fig. 5. Highly realistic images
of walls, pavements, and steps can be obtained by mapping the generated
patterns (Fig. 6). More details are given in [4].
32
Stone Wall Patternzyxwvutsrqp
33
References
1. C. I. Yessios, "Computer drafting of stones, wood, plant and ground materials",
Computers and Graphics 3, 2 (1979) 190-198.
2. B. B. Mandelbrot, Fractals Form, Chance, and Dimension (Freemann, 1977).
3. A. Fournier, D. Fussell and L. Carpenter, "Computer rendering of stochastic mod-
els", Commun. ACM 25, 6 (1982) 371-384.
4. K. Miyata, "A method of generating stone wall patterns", Computer Graphics 24,
4 (1990) 387-394. zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFED
Figure 3.zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONM
Example of a basic joint pattern.
^c>
References
1. R. Cogan, NewImagesofMusicalSound (Harvard University Press,1984).
2. C. Roades, "Research in music and artificial intelligence", ACM Comput. Surv.
17 (1985) 163190.
3. D.Starr, "Computer chorus", OmniMagazine(May 1984)41.
4. C. Pickover, "Representation of melody patterns using topographic spectral
distribution functions", ComputerMusicJournal 10,3(1986) 7278.
5. J. Pierce, TheScienceofMusicalSound (Scientific American Library, 1983).
36
37
Clifford A. Pickover
Haeckel's SeaLilies
Reference
1. E.Haeckel, Art FormsinNature(Dover,1974).
38
39
Daniel Platt
Diffusion Limited Aggregation
R e f e r e n c e s
1. T. Witten and L. Sander, "Diffusion limited aggregation: A kinetic critical
phenomenon", Phys. Rev. Lett. 47 (1981) 1400.
2. M.Batty "Fractals geometry between dimensions", New Scientist (April 1985)
3140.
3. E. Stanley and P. Meakin, "Multifractal phenomena in physics and chemistry",
Nature 335 (September 1988) 404409.
4. F. Family and D. Landau, eds., Kinetics of Aggregation and Gelation (North
Holland, 1984).
5. H.Stanley and N.Ostrowsky, eds., On Growth and Form (MartinusNijhof, 1985).
6. J. Feder, Fractals (Plenum Press, 1988).
40
41
Mels Sluyser and Erik L. L. Sonnhammer
R N A Structure Based
on Prime Number Sequence
This display represents the secondary structure ofan RNA sequence based
on the first 2000 prime numbers.
The relationship between prime numbers has previously been investigated
by a large number ofmethods [1]. Here, wedescribe a new approach in which
we designate pairs of primes by the symbols A, G, C or U, depending on the
property of that prime pair as described below. These symbols were chosen
because they are commonly used to designate nucleotide bases in RNA. The
computer program FOLD has been designed to investigate the properties of
ribonucleic acid sequences [2, 3]; here we implement this program to analyze
the series of primes.
Tocalculate theparity ofprimenumbers they wereexpressed inthe binary
system. If the sum of the coefficients (Sc) is odd, the parity {Pa) of the
prime is assigned 1 (example: prime 7= 1x 2+ 1x 2 1+ 1x 2 2 ; 5C(7) = 3;
Pa(7) = 1). IfSc iseven, theparity oftheprime isassigned 0(example: prime
3= l x 2 + l x 2 1 ; Sc(3) = 2;Pa{3) = 0). Successive prime numbers (P) were
coupled pairwise: [2, 3], [5, 7], [11, 13], [17, 19], [23, 29]. . . . and expressed
as parities. This yields Pa(P): [1,0], [0, 1], [1, 1], [0, 1], [0, 0] . . . . Parity
pairs [1,1], [0,0], [1,0]and [0, 1]were assigned the symbols A, U, C and G,
respectively. The first fifty letters ofthe sequence are thus:
CGAGUACCACAUCACACGCAAAGAAAAUGUCCCCUUCCGGAAAGGUACGGG
42
RNA Structure Based on Prime Number Sequence 43
R e f e r e n c e s
1. P. R i b e n b o i m , The Book of Prime Number Records, 2nd ed. (SpringerVerlag,
1989).
2. M. Zuker a n d P. Stiegler, " O p t i m a l c o m p u t e r folding of large R N A sequences using
t h e r m o d y n a m i c s a n d auxiliary information", Nucl. Acids Res. 9 (1981) 133148.
3. J. Devereux, P. Haeberli a n d O. Smithies, "A comprehensive set of sequence anal
ysis p r o g r a m s for t h e V A X " , Nucl. Acids Res. 12 (1984) 387395.
4. S. M. Freier et al., "Improved freeenergy p a r a m e t e r s for predictions of R N A
duplex s t a b i l i t y " , Proc. Natl. Acad. Sci. U.S.A. 8 3 (1986) 93739377.
Duplex display of a pseudo RNA structure obtained from the first 1000 prime pairs. This
SQUIGGLES display was obtained by analysis with the FOLD program. A biological RNA
molecule with this sequence is predicted to have a free energy of 256.9 kcal/mole.
Thomas D. Schneider
Genetic P a t t e r n s as shown
by Sequence Logos
The two patterns shown here represent two different views of a control
switch in the genetic material of a virus called T7. Like many other viruses,
T7 is made of proteins that coat and protect its genetic material DNA (de
oxyribonucleic acid). The virus looks likea lunarlander landing on the moon.
When a T7 particle contacts the surface of the bacterium Escherichia coli,it
sticks there. Once it has landed, it injects its DNA into the cell, much like
a hypodermic needle does. The DNA contains instructions for taking over
the bacterial cell. The cellular machinery unwittingly copiesthese instructions
into RNA. The RNA isthen used to make proteins that stop the normal cell
mechanisms. Other instructions tell the cell to make copies of the viral DNA
and to make the proteins of the viral coat. These are assembled to produce
perhaps a hundred new T7 particles. The final instruction causes the cell to
burst open, just as in the movie "Alien".
T7's strategy for taking over the cell is to replace the bacteria's RNA
makingmachinewithanewone. Thisnew "RNA polymerase" bindsto certain
spotsontheviral DNA,and then makestheRNA molecules. Other machinery
then translates these RNAs into the proteins that make up the virus.
The entire genetic material of T7 consists of exactly 39,936 chemical "let
ters" named A, C, G and T. There are 17 places on this string of letters to
which the RNA polymerase binds. Their sequences are:
221111111111 ++++++
1098765432109876543210123456
1 ttattaatacaactcactataaggagag
2 aaatcaatacgactcactatagagggac
3 cggttaatacgactcactataggagaac
4 gaagtaatacgactcagtatagggacaa
5 ctggtaatacgactcactaaaggaggta
6 cgcttaatacgactcactaaaggagaca
44
Genetic Patterns as shown by Sequence Logos 45
7 gaagtaatacgactcactattagggaag
8 taattaattgaactcactaaagggagac
9 gagacaatccgactcactaaagagagag
10 attctaatacgactcactaaaggagaca
11 aatactattcgactcactataggagata
12 aaattaatacgactcactatagggagat
13 aatttaatacgactcactatagggagac
14aaattaatacgactcactatagggagac
15 aaattaatacgactcactatagggagaa
16gaaataatacgactcactatagggagag
17 aaattaatacgactcactatagggagag
References
1. T.D.Schneider,G.D.Stormo,L.GoldandA.Ehrenfeucht, "Information content
ofbinding siteson nucleotidesequences", J. Mol.Biol. 188 (1986) 415431.
2. T. D. Schneider, "Information and entropy of patterns in genetic switches",
MaximumEntropy andBayesianMethodsinScienceandEngineering,Vol.2,eds.
G.J.Erickson and C.R.Smith (KluwerAcademicPublishers, 1988)pp.147154.
46zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA
T. D. Schneider
49
50 S. Schiller
/fracmap{
gsave
1010translate
728muldupscale
0setlinewidth
1setlinecap
/maxDexchdef
/maxDsqrdmaxDdupmuldef
01maxD{
/b.reexchdef
01maxDneg{
/b.imexchdef
/denomb.redupmulb.imdupmuladddef
denommaxDsqrdgt{exit}if
denom0gt{doDenum}if
}for
}for
grestore
}def
/doDenum{
01maxD{
/a.reexchdef
01maxDneg{/a.imexchdefdoFrac{exit}if}for
11maxD{/a.imexchdefdoFrac{exit}if}for
}for
}def
/doFrac{
/rea.reb.remula.imb.immuladddef
/ima.imb.remula.reb.immulsubdef
/size0.5denomsqrtmaxDmuldivdef
/xredenomdivdef
/yimdenomdivdef
Dot
x0Itx1gtory0Ity1gtoror '/.returntrueifoutofrange
}def
/Dot{xysize0360arcfill}def
25fracmap
showpage
Ian O. Angell
Lattice Design 1
Reference
1. I.Angell, ComputerGeometricArt (Dover,1985).
12
53
54
Henry F. Fliegel and Douglas S. Robertson
Goldbach's Comet
Shown here is the number of prime pairs G(E) which can be found to
sum to a given even number E, plotted as a function of E. (For example,
for E 10, G(E) is 2, since 10 can be expressed by just two prime pairs
as 3 + 7 or as 5 + 5.) This pattern is connected with the famous Goldbach
Conjecture, named after the Russian mathematician, Christian Goldbach, who
speculated in a letter to Leonhard Euler that every even number greater than
4 can be expressed in at least one way as the sum of two odd primes. Yes
at least. J. J. Sylvester was apparently the first to show that "irregularities"
should appear inthe function G(E) because, ifE isdivisible by distinct prime
factors p i , p2,p3, ..., then G(E) will be increased by the multiplier
( p i I ) ( p 2 l ) ( p 3 ! )
( p l 2 ) ( p 2 2 ) ( p 3 2 )
over even numbers which have no such prime factors. That multiplier splits
G(E) intobands, corresponding tovaluesofE divisible by3,5,7,3 *5,3 *7,
etc. What wecall G(E) was analyzed extensively by Hardy and Littleton [1].
Nevertheless, to this day, there is no strict proof from basic axioms of what
appears so clearly in the graph shown here that Goldbach was right.
References
1. G.H.Hardy and J. E.Littlewood, "Someproblemsof'Partitio Numerorum', III:
Ontheexpressionofanumber asasumofprimes", Ada Mathematica44 (1922)
170.
2. H. F. Fliegel and D. S. Robertson, "Goldbach's Comet: The numbers related to
Goldbach's conjecture", J. Recreational Mathematics 21,1(1989) 17.
55
01
en zyxwv
zyxwv
OJ
UJ zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA
m
i
i
in
e
3
a
L
'8
OJ
e
L
a.
4;
0
L
OJ
JD
6
3
Z
Georg Jagoda
JCurve (OLFRAC) (14 Iterations)
Described here isa pattern showing a curve that I call Jcurve. Increasing
the recursion depth by one looks like adding a second Jcurve to the first one,
rotated at an angle of 90.
The pattern is created with OLFRAC by Ton Hospel from LISTSERV at
BLEKULL11.
Datafile contains:
axiom: F
numberofrules:1
1strule:F +FF+
angle:1 4 \TT *1/4=45
recursiondepth:14
57
Georg Jagoda
Carpet (13 Iterations)
axiom: F++F++F++F
numberofrules:1
1strule:F +FF+
angle: 1 4 \ TT * 1/4 = 45
r e c u r s i o n depth: 13
58
59
Georg Jagoda
3DCubes
Descr ibed her e is a pattern showin g 3 cubes . The three cubes are the
pattern 3D-CUBE. The 180 "+" perform s the rotation of 180 * 7r * 97 0 / 360 0 =
180 * 180 0 * 97 0 / 360 0 = 180 * 48.50 = 8730 0 = 90 0 + 24 * 360 0 The digits
in t he axiom select the color: 1 (blue), 2 (red), 4 (green).
The pattern is create d with OLFRAC by Ton Hosp el from LISTSERV at
BLEKULll.
Datafile contains:
axiom : +++ + +++ +++++++++ + +++++++++++++ ++++++++++++ \
+ + + + + + + + + + + + + + + + + + ++++++ + + + + + + +++++ + + + + + + + \
++++ ++ + ++++++++ +++++++++++++++ ++++++++ + ++ + \
+++++++++++ +++++++ +++++ ++ ++++++ + ++ + ++ + ++++ \
++ ++ +++++ +++4 c+ds l+dd l l c l dd 12 c
number o f rule s : 20
1st rul e: c IA+ IB+ IC I- -
2n d rul e : 5 sd sds
rul e,3rd 1 ldd ldd l
rul e,4th d e
ru le,5th e f
6th
rul e , A FFV++ FFH I--F FV++ffh[ - -
rul e,7t h B FW I -FF I+FW I -ffi +
r ule,8th C FFXI- FJ+ FFX I- f j +
9th
ru le , H HFFH[ 1-- f f v+ +FFHI - - f f vl f f v ++f f h ] FFH
l Oth
rule , h hffh [ 1-- f f v ++FFHI --ffvl f f v ++f f h] f f h
11th
rule, V VFFVI++ffhl- -FFV++ffh lf fhl -- ffv ) FFV
12th
rule, v v ffv [++ffh l - -FFV++ffh lffh l --ffv ] ffv
1 3th
rule, I I FF I[+fw l -FF I+fw lfw l -f f i ]FFI
14th
rule, i iffi[+fw l-FFI+fw lfwl -ffi ]ffi
15 th
rule , W WFW [ l- f f i +F WI - ff il f f i +fw) FW
16th
rul e , w wfw[ [ -ffi+FW I-ff ilffi+fw )fw
1 7th
rule , J J FJ [ +f f x l - FJ + f f x l f f x l - f j ] FJ
1 8th
rule , j j fj [+ff xl -FJ+ffx lffxl-fj ]f j
19th
r ule , X XFFX[ l - f j +FFXI -f j I fj+ f f x ] FFX
rule ,
20 t h x xffxl l -f j+FFX I-fj I f j+ f f x] ff x
ang le, 97 360 \ * 97 /360 : 48 .5
re cu rsion depth: 6
sid es A B C
DRAW hor izont a l H I J
d on't draw horizon tal h i j
DRAW vertica l V W X
d o n' t draw vert ical v w x
+ +
/ C / I
+ -- - -- - + I
I I BI
I A I +
I 1/
+ +
liU
61
Georg Jagoda
The-End
62
63
Clifford A. Pickover
The Ikeda Attractor
j = x *scale + xoft;
k = y *scale + j/off;
)
61
The Ikeda Attractor 65
R e f e r e n c e s
1. K. Ikeda, "Multiplevalued s t a t i o n a r y s t a t e a n d its instability of t h e t r a n s m i t t e d
light by a ring cavity s y s t e m " , Opt. Commun. 3 0 (1979) 257.
2. I. S t e w a r t , " T h e n a t u r e of stability", Speculations in Science and Tech. 1 0 , 4
(1987) 3 1 0 3 2 4 .
3. R. A b r a h a m a n d C. Shaw, Dynamics The Geometry of Behavior, Part 3: Global
Behavior (Aerial Press 1985).*
'Actually, the entire book collection of Aerial Press, including the Visual Math Series, is an
educational wonderland.
J. RangelMondragon and S. J. Abas
StarNLPl5m
R e f e r e n c e s
1. M. Gardner, "Extraordinary nonperiodic tiling that enriches the theory of tiles",
Scientific American (January 1977) 110121.
2. B. Grunbaum and W. H. Shepherd, Tilings and Patterns (Freeman & Co., 1987).
3. P. J. Steinhardt, "Quasicrystals, definition and structure", Physical Review 34, 2
(1986) 596616.
4. S. J. Abas, J. RangelMondragon, and M.W. Evans, "Quasicrystals and penrose
tiles", J. Molecular Liquids 39 (1988) 153169.
5. J. RangelMondragon and S. J. Abas, "Computer generation of penrose tilings",
Computer Graphics Forum 7 (1988) 2937.
06
67
Val:fa3(x,y,0)
FA: (al*al+a2*a2)>l?fa3(.5*(a2frac(al~2+a2~2)),.5*al+.5*a2,
a3+l):a3+al
Reference
1. B. B. Mandelbrot, The FractalGeometry of Nature (W. H. Freeman and Co.,
1977).
GS
Whirlpools OS
Ilene Astrahan
FernWolf (Filicinae Lupus)
References
1. B. B. Mandelbrot, The FractalGeometryof Nature (W. H. Freeman and Co.,
1977)p.43.
2. W. A. KcWorter and A. Tazelaar, "Creating fractals", Byte Magazine (August
1981)125.
7C
71
Figure 1.
Figure 2.
John Robert Hendricks
Magic Tessaract
References
1. J. R. Hendricks, "Thefiveand sixdimensional magic hypercubes of Order 3",
CanadianMathematicalBulletin 52 (May 1962) 171189.
2. J. R. Hendricks, "The magic tessaracts ofOrder 3complete", Journal ofRecre
ationalMathematics22, 1(1990) 1526.
72
73
50 12 61
16 59 48
57 52 14
72 31 20
29 y\ 27 / 674
22 65 / 36
80 42
78 37
44 73
64 35 24
33 19 71
26 69
75 43
79 41
39 77
54 13 56
11 63 49
47
76
74 45
40
46 / 17 60
' 15 / 55 53
62 51 10
68 / 30 25
34 / 23 V
66
21 70 32
Pablo Tamayo and Hyman Hartman
The Reversible GreenbergHastings
Cellular Automaton
The patterns shown in the figure are snapshots from the time evolut ion
of the reversible Greenberg-Hastings cellular automaton . The original (non-
reversible) Greenberg -Hastings cellul ar automaton was studied by Greenberg
and co-workers [1] as a dis crete model for reaction-diffusion in excitable media.
Each cell can take on e of three st ates: resting or quiescent (0), act ive (1 ), and
refractory (2). A cell remains in the resting state until it is activated by an
active neighbor. Onc e active , it will bec ome refractory a t the next time st ep
ind ependent of the neighborhood. Once refractory, it will become resting at the
next time step independent of the neighborhood. The model attempts to model
diffusion in an excit able medium composed of dis crete chemical oscillators. It
produces rotating spirals reminiscent of the Belousov-Zhabotinsky reaction [2].
In the two-dimensional von Neumann neighborhood, the rule can be described
as :
t+l _ F( ) _ {a LJ + 1 mod 3 , if aLJ -=I- 0; (1)
a i ,j - t - A n erg. , 'f t - 0 .,
1 a i ,]
,) = F()
a tt+l t - a t-
l
1,,)
mo d 3 . (3)
In this way the rule be comes reversible and displays a different behavior from
the original non-reversible rule. It has a rich phenomenology which includes
soliton-like structures and chemical turbulence [3] . Depending on the initial
conditions it develops into three differ ent regimes: (i) regular regime with short
recurrence times , (ii ) che mical-t urbulen t regime, and (iii) disordered random
regime. The most interesting one is the che mical-t urbulent regime, examples
14
75
Figure 1. Patterns from the time evolution of the reversible GreenbergHastings model
in the twodimensional hexagonal lattice. Only active (black) and resting (white) cells are
shown. The sequence shown in lefttoright, toptobottom order correspond to times: t =
343, t = 500, t = 735, t = 1004, t = 2043, t = 15064. The skewness is due to the fact that
the hexagonal lattice was simulated using 6 neighbors in the square lattice.
76 P. Tamayo & H. Hartman
R e f e r e n c e s
1. J. M. Greenberg and S. P. Hastings, Siam J. Appl. Math. 34 (1978) 515; J. M.
Greenberg, B. D. Hassard, and S. P. Hastings, Bull, of the Am. Math. Soc. 84
(1978) 1296. See also: A. Winfree, Physica 17D (1985) 109.
2. H. Meinhardt, Models of Biological Pattern Formation (Academic Press, 1982).
3. Y. Kuramoto, Chemical Oscillations, Waves and Turbulence (SpringerVerlag,
1984).
4. T. Toffoli and N. Margolus, Cellular Automata Machines (MIT Press, 1987).
5. P. Tamayo and H. Hartman, "Reversible cellular automata and chemical turbu
lence", Physica D 45 (1990) 293.
Ilene Astrahan
Cybernetic Rapids
Val: fa3(x,y,0)*10
FA: a3<1000?fb4(al*al,a2*a2,2*al*a2,a3+l)*(ala2)+l : 0
FB: al+a2<4?fa3(ala2+x,a3+y,a4):0
Reference
1. B. B. Mandelbrot, The FractalGeometry of Nature (W. H. Freeman and Co.,
1977).
77
78
P.
J3
>>
O
C. William Henderson
Pinwheels
79
80
Pinwheels
C. William Henderson
Circlefest
81
82
Circlefest
C. William Henderson
X O R Size
S3
84
XOR Size
C. William Henderson
Trig Gem
8b
86
Trig Gem
Gary Ricard zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCB
Locked Links
87
88 G. Ricard
the boundary ofthe figure. The effect iscertainly caused bythe positioning of
the locked links relative to one another. The mind wants to force the center
ofthe locked links to be on a 45degree line even ifthe straight diagonal must
be bent to do it!
Figure 1.
89
Figure 2.
Gary Ricard
Exponential Tunnel
1) x = exp(.012s) cos(1.24s)
y= exp(.012s)sin(1.24s)
PROGRAM scrspiral;
USES graph;
VAR m, b, phase: REAL;
grdriver, grmode: INTEGER;
90
Exponential Tunnel 91
BEGIN
m:=239.5;
b:=m;
initgraph(grdriver, grmode, 'C:\PASCAL\GRAPHICS');
setwritemode(xorput);
setbkcolor(lightgray);
setcolor(blue);
spiral(0.0,l);
setcolor(red);
spiral(0.5235987756,l);
readln;
closegraph
END.
92 zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA
Exponential Tunnel
Hiroshi Okumura
A Generalization of t h e Regular Tiling (4 4 )
(1) For any two circles, one of the centers of similitude (two intersections of
internal common tangents and external common tangents) lies on the line XY.
(2) If we denote the curvature (reciprocal of t h e radius) of the circle touching
Xi, xi+1, y^ yj+i by [i,j] then
provided we make the convention t h a t we regard the circles below the line XY
as having negative radii.
(3) For any integers i, j , k, the quadrangle determined by Xi, Xi+k, yj, yj+k
has an incircle (Rigby [2], Theorem 4.5).
R e f e r e n c e s
1. H. Okumura, "Configurations arising from the threecircle theorem", Mathematics
Magazine 63, 2 (1990) 116121.
2. J. F. Rigby, "Cycles and tangent rays, circles and tangent lines", Mathematics
Magazine 64, 3 (1991) 155167.
93
94
Figure 1.
95
Figure 2.
Hiroshi Okumura
A P a t t e r n by Fujita Configurations
References
1. S.Fujita, SeiyoSampo3(1781).
2. H.Okumura, "Four circlesin aparallelogram", J. Recreational Mathematics 19,
3 (1987) 224226.
3. H. Okumura, "Fujita configurations", J. Recreational Mathematics 21,1(1989)
2934.
96
97
Figure 1.zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHG
a + c = b + d.
Figure 2.
98
Figure 3.
Figure 4.
Kenneth J. Hooper
Star Trails
x = x y +a and y = 2xy + b.
Variables a and 6typically range in value from 2to 2. Initially, x and y are
set to zero but subsequently take on the values from the previous calculation.
Each xy pair defines the position of a point on a complex plane and every
repetition of the calculations yields a new position. If a starting location
inside the Mandelbrot Set ischosen, the xy points remain bounded within a
small region, sometimes tracing a path that repeats itself. Figures 1 and 2
were generated by counting the number of repetitions it took to trace a path
before it repeats.
An algorithm for counting the number ofrepetitions makes useofthe ratio
y/x. Each ratio is then stored for later comparison with the first y/x value
to determine when the sequence repeats. The following pseudocode for an
inner loopdetails this method (theouter loopssupply valuesfor a,b,and pixel
column and row):
x < 0, y < 0
for i < 0to 15
xx<x*xy*y + a
yy<2*x*y +b
tan(i) < yy / (xx + .000001) Note: Prevents divide by zero.
X < XX
y < yy
endloop
for j < 1to 15
error < tan(0) tan(j)
99
100 K. J. Hooper
References
1. C.A.Pickover, "InsidetheMandelbrot Set", Algorithm 1, 1(1989) 912.
2. B.B.Mandelbrot, TheFractalGeometryofNature (W.H.Freeman, 1983).
3. A.K.Dewdney, "Computer recreations", ScientificAmerican (September, 1986).
2
Figure 1. Star patterns within the Mandelbrot Set seem pulled toward the boundary. zyxwvutsrqponmlkjihgfe
2
Figure 2. A familiar "flame" structure from traditional Mandelbrot Set images is instead
suggested from the star patterns. zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA
David Scruton
An Iteration Map
Shown here isan image derived from complex dynamics. In particular, the
figure represents acomplex variablerecursion produced byiterating z = z3 +/i
forty times. ^ is a complex constant. Diverging points whose magnitude is
between 2and 3 are plotted. The picture wascomputed on a microVAX and
plotted on a Talaris laser printer.
103
Mieczyslaw Szyszkowicz
A SelfSimilar Structure Generated by
a BrokenLinear Function
which maps
/ ( * , r) :[0, 1] [0, 1] .
Figure 1shows the behavior ofthe sequences {xn} and {yn} produced by this
transformation used iteratively with r = 1
The iterative process is realized with the stopping criterion (xn+i xn) +
(j/n+i yn)2 <T, where r isthe assumed threshold. Starting with the initial
point (XQ, J/O) ^ [0, 1]x [0, 1],the sequenceofthe points (xn, yn) is generated.
If the stopping criterion is satisfied, then the iterative process is stopped and
the number of executed iterations modulo 2 is mapped on the point (XQ,yo)
Figure 1represents a black (0) and white (1) selfsimilar pattern constructed
by the above algorithm.
104
105
Figure 1. Self-similar struct ur e generated by the fun ction f(x , r) = r(l - [z - 0.51) with
r=l.
Mieczyslaw Szyszkowicz
Roots of Algebraic Polynomials
f(z) = Y<akzh>
fc=0
zn+1=zn n = 0, 1, 2 , . . . ,
/ {Zn)
and if |z n +i zn\ < r (r is a fixed threshold), then the iterative process is
stopped and the number of executed iterations M is mapped to the point ZQ.
Figure 1shows the result of this map as a black and white pattern: (black =
0, white = 1),where 0and 1are obtained by the rule, M modulo 2.
106
107
Described here are patterns derived from the chessboard, where black and
whitesquaresbecomerectangles, andtheir uniform colorsarereplacedby other
patterns.
Each mosaic is a repetition, in an M by N matrix, of a mosaic element.
This element isgenerated by asinglevector, whosecoordinates are increasing.
I have used arithmetic, geometric, Fibonacci, and also random generated se
quences to control the rate ofgrowth, regularity, etc. The mosaic element has
four axes of symmetry. The drawing of each rectangle is repeated four times,
except for the middle cross, where the number of repetitions istwo one at
the nodes ofthe cross, and one at the middle ofthe cross.
The following fragment of C code describes a mosaic element which is
repeated M by N times:
for (i = 0; i < m 1; i+ + )
for (j = 0;j < m 1;j + + ) {
fc = ((i +j) %t) + l+w;
pat(sel, a+v[i], b+v\j], a +v[i + 1] 1, b+ v\j + 1] 1, k);
if (i!= m2)
pat(sel, a + sm v[i + 1]+ 1, b+ v\j], a + sm v[i], b+ v[j + 1] 1,fc);
if (j!= m 2)
pat(sel, a + v[i], b+ sm. v\j + 1]+ 1, a + v[i + 1] 1, b+ sm v\j], fc);
if (i + j \ = 2 * m 4 )
pat(sel, a + sm v[i + 1]+ 1, b+ sm v\j + 1]+ 1, a+ sm v[i\, b+ sm v\j], fc);
}
where k isthe color, sel isthe selected pattern pat (such as drawing two lines
between some of the four points), v is the control vector of dimension m (for
example,representing anarithmeticsequence,likev[0]= 0,v[l] = 3,for (i = 2;
i <m;i+ +)v[i] =v[i1]+ i+ 1, sm = v[m 2] +v[m 1] 1), and (a,b)
are coordinates of the left top of the mosaic element.
Further modifications are obtained by using a random increment in the
definition of the control vector. Different mosaic patterns that result from
warping onto curved surfaces, and carefully projected onto a view plane, for
example, are achieved by using Painters Algorithm. Finally, color mosaics,
displayed on a high resolution screen, are a real feast for the eyes.
108
109
F i g u r e 2. Mosaic based on arithmetic sequence and two alternating patterns: two diagonal
line segments and a recursive box.
110 zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA
Figure 3. Mosaic based on Fibonacci sequence and two alternating patterns: two diagonal
line segments and a recursive box.
Figure 5. Mosaic based on exponential sequence and two alternating patterns: two diagonal
line segments and a recursive box.
zn+1 = $ ( z n ) , n = 0, 1, 2 , . . . ,
dx/dt = sin(y),
dy/dt = sin(x),
with the initial values XQ, yo and xo, yoG[5,5]. The problem is to find the
function x{t) and y(t). t is an independent variable. One of the simplest nu
mericalmethodsabletosolvethisproblem isEuler'smethod. Inthis situation,
Euler's formula generates the following recurrence processes
xn+i = xn + hsm(yn),
2/n+i = yn + hsm(xn),
112
113
2 n + l = Zn , 71= 0, 1, 2, . . . ,
In
_ f\zn + (^nfn) ~ In
In p^ 7 i
^njn
c
7fcl
where ZQis given and fn = f{zn). This method was proposed for use in
the complex plane. Presented here is a pattern showing the behavior of the
sequence {zn} generated bytheaboveiterativeprocess. The sensitivity of {zn}
to the initial values ZQis displayed. Figure 1shows the number of executed
iterations (modulo 2) by alternating colors. The equation f(z) = zA 1= 0
is solved in the complex domain. This equation has four roots, which are
1, 1, % and i,i = \/T. Co = l/f'(z0). The stopping criterion of this
selfaccelerating algorithm isas follows: IF |z n +i zn\ < r THEN stop, where
T isa constant number (r = 10 6 ). Initial values are between 1.5and 1.5 in
the real and imaginary directions.
Reference
1. J.F.Traub,IterativeMethodsfor theSolutionofEquations(PrenticeHall,1964).
114
115
References
1. F. P. Preparata and M. I. Shamos, Computational Geometry (SpringerVerlag,
1985).
2. K.Shirriff, "GeneratingfractalsfromVoronoidiagrams",ComputersandGraphics
17, 2(1993) 165167.
116
117
Mieczyslaw Szyszkowicz
The Logistic Map in the Plane
Here, r isa constant value. Figure 1was generated with r = 0.45. T h e number
of executed iterations modulo 2 is represented.
R e f e r e n c e
1. R. May, "Simple mathematical models with very complicated dynamics", Nature
261 (1976) 359467.
118
119
(S2wo*afa
F i g u r e 1. Pattern generated by the logistic parabola / ( x ) = r x ( l x).
Mieczyslaw Szyszkowicz
Modified Logistic Map in the Plane
120
121
/ ( z ) = 2 4 C = 0.
Reference
1. H.O.PeitgenandD.Saupe,eds., TheScienceofFractalImages(SpringerVerlag,
1988).
122
123
Figure 1. Newton's method applied to the equation f(z) = z 4 c = 0, with the initial
value 1+ i, and c from the region [0.5, 20.5] x [15.0, 15.0].
Mieczyslaw Szyszkowicz
Iterations with a Limited N u m b e r
of Executions
Iterative processes are used very often to create computer graphics arts.
T h e classic example is the iteration realized in t h e complex plane
where zo = 0 and c is varied over the complex plane. This iteration is the
basis for the construction of the Mandelbrot set [1,3]. In t h e above iterative
process, the number of executions is controlled by t h e value of t h e norm z,
i.e., \z\ = y/x2 + y2 where z = x + iy. These numbers are often displayed
as color patterns. Another approach is t o realize t h e iterative process for a
fixed number of times and to show the obtained value for t h e sequence. As an
example, consider the iteration generated by the logistic m a p [2, 4]
R e f e r e n c e s
1. A. Dewdney, Computer Recreation (Scientific American, 1985).
2. B.L. Hao, Chaos (World Scientific, 1984).
3. B. Mandelbrot, The Fractal Geometry of Nature (W. H. Freeman and Co., 1983).
4. R. May, "Simple mathematical models with very complicated dynamics", Nature
261 (1976) 359467.
121
125
f(z) = Atan(z)
126
127 zyxwvu
Figure 1. The Starry Night Iterates of Tan(z). A bifurcation diagram for the family of
dynamical systemszyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA
f(z) = A tan(z).
128 S. D. Casey
References
1. P. Blanchard, "Complex analytic dynamics", Bull. Amer. Math. Soc. (N.S.) 11,
1 (1986) 85141.
2. S.D.Casey, "Formulating fractals", ComputerLanguage 4,4(1987)2840.
3. R.L.Devaney, "Julia setsand bifurcation diagramsfor exponential maps", Bull.
Amer. Math.Soc.(N.S.) 11,1(1986) 167171.
4. A. K. Dewdney, "Computer recreations", Scientific American 253, 2 (1985)
1624.
Stephen D. Casey
From Asymmetry to Symmetry
Iterates of Exp(z) and Exp(^ 2 )
h{z) = \e\
while Fig. 2was generated by the function
f2(z) = \e*2,
inAorparameter space. Ateachpixelposition (x, y) = x+iy = A,theorbit of
theinitial value0wascalculated, i.e.,forj = 1, 2, zn+\ = fj(zn), z0 = 0. This
procedure was repeated until either 5ft(zn) was greater than or equal to 100,
which guarantees that zn diverges to oo, or the number of iterates exceeded
256. (Since |e 2 | = e^z and e 2 isentire, iterates of Ae z goto infinity with the
growth of %l{zn).) In the picture, the black regions correspond to points Afor
which 9?(z256) < 100, while the bands in the other regions correspond to the
number of iterates (modulo 2) needed for 5R(^n) > 100.
Devaney [4]gives us aprecise mathematical interpretation ofthe patterns.
They are bifurcation diagrams for the families ofdynamical systems generated
by fi{z) = A exp(z) and f2(z) = A exp(2 2 ). From the pictures, we can see
that neither exp(z) norexp(z2) isstructurally stable (asdefined in [4]),because
a slight variation in Acan produce a wide variation in the behavior of the
iterates. Devaney also shows that those values of Afor which zn diverges
correspond todynamical systemswith dynamics / i , f2 havingaJuliaset equal
to the entire complex plane. It isalso of interest to note that the distribution
ofthe divergent points forms afractal pattern, which isseen byobserving that
the larger "bends" generate smaller ones in a quasiselfsimilar pattern.
129
130
References
1. P.Blanchard, "Complex analytic dynamics", Bull. Amer. Math. Soc. (N.S.) 11,
1 (1986) 85141.
2. S.D.Casey, "Formulating fractals", ComputerLanguage 4,4(1987) 2840.
3. S.D.Casey, "Fractalimages:procedureandtheory",HDLTechnicalReportHDL
TR2119 (1987) p.42.
4. R.L.Devaney, "Juliasetsand bifurcation diagrams for exponential maps", Bull.
Amer. Math. Soc. (N.S.) 11,1(1986) 167171.
5. A. K. Dewdney, "Computer recreations", Scientific American 253, 2 (1985)
1624.
Stephen D. Casey and Nicholas F. Reingold
A Variation on a Curve of Mandelbrot
a
See [4],plates 31 and 146 for the former, and plates 46, 47, and 70 for the latter.
132
133
Figure 1. Pattern generated by using the "monkey's tree" as a seed with the Gosper curve
as a base.
134 S. D. Casey & N. F. Reingold
R e f e r e n c e s
1. H. Abelson and A. diSessa, Turtle Geometry: The Computer as a Medium for
Exploring Mathematics (The MIT Press, 1980).
2. S. D. Casey, "Analysis of fractal and ParetoLevy sets: theory and application",
Proceedings of EFTF (1990) 205211.
3. S.D. Casey and N. F. Reingold, "Selfsimilar fractal sets: theory and procedure",
IEEE Computer Graphics and Applications 14, 3 (1994) 7382.
4. B. B. Mandelbrot, The Fractal Geometry of Nature (W. H. Freeman, 1983).
5. H.O.Peitgen and D.Saupe,eds. The Science ofFractal Images (SpringerVerlag,
1988).
Stephen D. Casey and Nicholas F. Reingold
An Asymmetric Sierpinski Carpet
135
136
Figure 1.zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA
An original design generated by the pattern rewriting system.
An Asymmetric Sierpinski Carpet 137
R e f e r e n c e s
1. H. Abelson and A. diSessa, Turtle Geometry: The Computer as a Medium for
Exploring Mathematics (The MIT Press, 1980).
2. S. D. Casey, "Analysis of fractal and ParetoLevy sets: theory and application",
Proceedings of EFTF (1990) 205211.
3. S. D. Casey and N. F. Reingold, "Selfsimilar fractal sets: theory and procedure",
IEEE Computer Graphics and Applications 14, 3 (1994) 7382.
4. B. B. Mandelbrot, The Fractal Geometry of Nature (W. H. Freeman, 1983).
5. H.O. Peitgen and D. Saupe,eds., The Science ofFractal Images (SpringerVerlag,
1988).
Stephen D. Casey
The "Computer Bug" as Artist Opus 3
References
1. S.D.CaseyandN.F.Reingold, "Selfsimilar fractal sets:theoryand procedure",
IEEE ComputerGraphics andApplications14,3(1994)7382.
2. B.B.Mandelbrot, TheFractalGeometryofNature(W.H.Freeman, 1983).
L3S
139
bO
3
9
Edward M. Richards
The Last Word in Fractals
140
TheLast Wordin Fractals 141
References
1. J. Feder, Fractals (Plenum Press, 1988).
2. C. A. Pickover, Computers, Pattern, Chaos, and Beauty Graphics From an
Unseen World (St. Martin's Press, 1990).
3. C. A. Pickover, "Personal programs: growing your own fonts", Algorithm 1, 5
(1990) 1112.
Edward M. Richards
TopsyTurvy Fractal Growth
References
1. J. Feder, Fractals (Plenum Press, 1988).
2. C.A.Pickover, Computers,Pattern, ChaosandBeauty(St.Martin'sPress,1990).
142
143
e
William K. Mason
Symmetrized DotPatterns and
Cellular A u t o m a t a
References
1. C.Pickover, "Snowflakes from sound", in Computers,Pattern, ChaosandBeauty
(St. Martin's Press, 1990) Chapter 4.
2. C.Pickover, "Unseenworlds", Algorithm2,2(1991).
3. A. K. Dewdney, "Wallpaper for the mind", The Armchair Universe (W. H.
Freeman &Co.,1988).
4. I. Peterson, "Written in the sky", in Islands of Truth (W. H. Freeman &Co.,
1990).
144
145
: t J
^
Snowflake Algorithm.
VARIABLESsflake,nxtflakeare2dimensional arrays,100x100forexample
sum
atypeis1fortype1algorithm,2fortype2algorithm
Loadsymmetrizeddot_patternintoarraysflake(x.y)sothat
sflake(x,y)=l ifpoint (x,y)isadotinthepattern
sflake(x,y)=0ifpoint (x,y)isnotinthepattern
UNTILkeypressed
forx=1to100
fory=1to100
sum=sflake(x+l,y+l)+
sflake(x+l,yl)+
sflake(xl,y+l)+
sflake(xl,yl)+
sflake(x+2,y)+
sflake(x2,y)
IFatype=1THEN
IFsum=1THEN
nxtflake(x,y)=l
ELSE
nxtflake(x,y)=0
ENDIF
[endforatype=1]
IFatype=2THEN
IFsumisoddTHEN
nxtflake(x,y)=l
ELSE
nxtflake(x,y)=0
ENDIF
tendforatype=2]
[endfory]
[endforx]
forx=1to100
fory=1to100
IFatype=1THEN
IFnxtflake(x,y)=lTHEN sflake(x,y)=l
IFatype=2THEN
sflake(x,y)= nxtflake(x,y)
[endfory]
[endforx]
Plotallpoints (x,y)forwhich sflake(x,y)=l
Eraseallpoints (x,y)forwhich sflake(x,y)=0
Ian D. Entwistle
"Carpet of Chaos":
Mapping t h e Bilateral Symmetric
zz + c in t h e Complex z and c Planes
The patterns Figs. 1and 2 are respectively the Mandelbrot and modified
Julia sets for the function z zz +c.
For iteration of polynomials zn +cwhere n isan integer, the "Mandelbrot
set" (M) consists of those complex numbers z such that the sequence 2 = 0,
Zi = z, z2 = z2, z3 = (z2 + z)2,... , never satisfies \z\ > 2. A number of
algorithms for carrying out this iterative process have been widely used to
generate the M set mappings of many functions which were not polynomials
[1]. Complex functions which are analytic and continuous would be expected
to generate Julia sets on iteration. Those mapped from zz + c are rather
unattractive. The M set for a function can also be defined as the collection
of points for which the Julia set of fc is connected. Julia sets derived from
points c close to the origin would then be expected to have outlines close to
the shape ofthe lemniscate controlled bythe escape test. In the caseof zz +c,
very few points in the plane are bounded for values of c close to 0+ Oi. The
Julia sets derived from such points are therefore not of interest. A reflection
perhaps ofthe less attractive properties of the Mset. Alternative escape tests
[2]dohowever yield mappings from the iteration, which arevisuallyexiting [3]
such as Fig. 2. Figure 1was first obtained by the standard Level Set Method
[1] applied to zz + c using lines to plot the divergent set points only where
adjacent points differ in divergence rate. Selection of the point c (0.09+Oi)
allowed the speed of mapping to be halved as the pattern is symmetrical.
Even using a language such as Fortran, which supports complex variables, the
iteration processismuchslowerthan that for simplepolynomial iteration. The
Pseudo codeutilized islisted. This utilizes the "square" escape test previously
discussed [2]and an additional test to control the point plotting. The data for
producing both figures is appended.
147
148
Figure 1.
149
Figure 2.
150 I . D . Entwistle
Appendix
nx , ny, xmin , xmax, ymin , ymax, itermax, c, es, ss
Fig. l. 2400, 2400 -2.0 2.2 -2.0 2.0 25 0.09 + Oi 30 35
Fig. 2. 1920 1840 -3.1 1.1 -2.2 2.2 100
References
1. H.-O. Peitgen and D. Saupe, The Science of Fractal Images (Springer-Verlag,
1986).
2. 1. D. Entwistle, "Julia set art and fractals in the complex plane" , Computers and
Graphics 13, 3 (1989) 389--392.
3. 1. D. Entwistle, " ' Ent rapped Lepidoptera': An alternative mapping of a Julia Set
for the function z - Z4 - Z + c", in The Pattern Book: Fractals, Art, and Nature,
ed . C . A. Pickover (World Scientific, 1995).
4. C. A. Pickover, Computers, Pattern, Chaos , and Beauty - Graphics From an
Unseen World (St. Martis Press, 1990) .
Ian D. Entwistle
"Spidermorphs": Mappings from Recursion of
t h e Function z ^ zz +z*z+c
The twopatterns Figs. 1and 2result from studying the Julia set mappings
ofthe dynamic f(z) = zz +z4 z+cand identifying areas ofthe maps which
have disconnected fractal geometry resembling biological forms.
Two types of computergenerated geometries have introduced the term
"Biomorph". Firstly, inthebrilliant discourseonevolution, "TheBlind Watch
maker",the spidery line graphical images generated by recursion oflines were
used to represent evolution of biological forms [1]. At the same time, a col
lection ofcurious fractal patterns resembling loworder biological forms result
ing from iteration of algebraic equations in the complex plane were classed
as "Biomorphs" [2]. For the purpose of describing Figs. 1 and 2, the term
"Biomorph" encompasses organismic morphologies created by small changes
to traditional Julia set calculations [3]. Of particular interest for such pattern
generation are the escape radius tests utilized, as well as additional tests for
determining which points to plot in the complex plane [4]. Among the many
reported examples [2,3]ofbiomorphs, thosederivedfrom iterationof dynamics
containing the bilateral symmetric zz appear to most closely resemble known
biological shapes [3]. The patterns were generated using tests previously de
scribed [4, 5] and are outlined in the Pseudo code listed. This utilizes the
magnitude of the side of a square lemniscate rather than the radius of the
escape circle. In addition, a limit is put on the points to be plotted by fixing
the maximum reached by zreal or zimag. Figure 1issymmetrical as its origin
point in the cplane ofthe function lieson the imaginary axis about which the
c plane mapping is symmetrical. Figure 2 can be observed if the window is
extended to 5,5,5,5. Data for generation of both patterns is appended.
Parameters
151
152
Figure 1.
153
Figure 2
154 I. D. Entwistle
Pseudo code
Variables:Integer SX, sy, iter Real TZ, i z, x, y Complex c, z
DO sy =1 to nx
DO sx =1 to ny
y=ymin+sy*(ymax-ymin) / n y
x=xmin+sx*( xmax-xmin) /nx
z= cplx (x, y)
DO iter=1 to itermax
z=z z + Z 4 - Z + c
T z= real(z):iz= imag(z )
References
1. R. Dawkins, The Blind Watchmaker (Longmans, 1986).
2. C. A. Pickover, "Biomorphs: Computer displays of biological forms generated from
mathematical feedback loops" , Compo Graphic Forum 5 (1986) 313-316.
3. C. A. Pickover, Computers, Pattern, Chaos, and Beauty - Graphics From an
Unseen World (St. Martis Press, 1990) .
4. 1. D. Entwistle, "Julia set art and fractals in the complex plane", Computers and
Graphics 13, 3 (1989) 389-392.
5. 1. D. Entwistle, " 'Entrapped Lepidoptera': An alternative mapping of a Julia Set
for the fun ction z - Z4 - Z + c" , The Pattern Book: Fractals, Art, and Nature, ed.
C. A. Pickover (World Scientific, 1994).
Ian D. Entwistle
"Fractal Turtle" and "Elephant Star":
Multiple Decomposition Mappings of
f(z) :z z5+ c in t h e Complex Plane
15:>
156
Figure 1.
157
Figure 2.
158 I. D. Entwistle
of black and white are then related to the integer angle number associated with
each divergent point. Note t h a t the ratio zimag/zreal uses the d a t a generated
in the iteration loop. To obtain the pattern displayed by the bounded points,
the minimum value of \z\ reached at maximum iteration is converted to an
absolute integer using equation (4). Values of 0 and 1 are then assigned to
these integers for printing. T h e d a t a for generating the patterns is appended.
Note t h a t the "turtle" shape of Fig. 1was achieved by elongating the imaginary
axis.
A p p e n d i x
Equations (1) zreal = x5 10*x3*y2 + 5*x4*y + creal
(2) zimag = y 5 W*y3'x2 + 5*x*y4 + cimag
(3) Integer angle = INT(ABS(ARCTAN(zimag/2real))) MOD 40
(4) Integer \z\ = INT(Min|z|*120)
Data Pixels zmin, imax, J/min, t/max, Iterations, creal, cimag
Fig. 1. 2400*3300 1 . 5 1.5 1 . 5 1.5 50 0.4 0.68
Fig. 2. 2400*2400 1 . 5 1.5 1 . 5 1.5 50 0.55 0 . 6
R e f e r e n c e s
1. C. A. Pickover, Computers, Pattern, Chaos, and Beauty Graphics From an
Unseen World (St. Martins Press, 1990).
2. H.O. Peitgen and D. Richter, The Beauty of Fractals (SpringerVerlag, 1986).
3. I. D. Entwistle, "Julia set art and fractals in the complex plane", Computers and
Graphics 13, 3 (1989) 389392.
4. I.D. Entwistle, "Julia sets:Alternative mapping ofpolynomial Julia sets", Fractal
Report 15 (1991) 26.
5. [2],pp. 4044, 6476.
6. J. D. Jones, "Three unconventional representations ofthe Mandelbrot set", Com
puters and Graphics 14, 1(1990) 127, 129.
7. H.O. Peitgen and D. Saupe, The Science of Fractal Images (SpringerVerlag,
1988).
8. F. J. Flanagan, Complex Variables: Harmonic and Analytical Functions (Dover
Publications, 1972).
Ian D. Entwistle
"Floral Table": A Mapping of the Function
z> z4z+ c in t h e Complex z Plane
159
160
Figure 1.
161
Figure 2.
162 I. D. Entwistle
A p p e n d i x
nx = ny, xmin, xmax, t/min, (/max, itermax
Fig. 1. 2400 1 . 2 1.2 1 . 2 1.2 150
Fig. 2. 2400 . 6 8 6 . 6 6 5 .3313 .356 150
R e f e r e n c e s
1. P. Fisher and W. Smith, eds., Chaos, Fractals, and Dynamics (Marcel Dekker,
1985).
2. I. D.Entwistle, "Methods ofdisplaying the behaviour ofthe mapping z > c 2+c",
Computers and Graphics 13, 4 (1989) 549551.
3. C. A. Pickover, Computers, Pattern, Chaos, and Beauty Graphics From an
Unseen World (St. Martins Press, 1989).
4. M. Barnsley, Fractals Everywhere (Academic Press, 1988).
5. H.O. Peitgen and D. Saupe, The Science of Fractal Images (SpringerVerlag,
1988).
Ian D. Entwistle
" E n t r a p p e d Lepidoptera": An Alternative
Mapping of a Julia Set for the Function
z > zi z + c
Appendix
nx = ny, xmin, imax, J/min, ymax, es, ss, itermax, ex, cy
2400 1.52 1.52 1.52 1.52 20 25 25 .78 0
163
164
Figure 1
"Entrapped Lepidoptera": An Alternative Mapping of . . . 165
END LOOP
SUBROUTINE
IF x 2 < ss or y2 < s s THEN PRINT
END ROUTINE
References
1. H.-O. Peitgen and P. H. Richter , Th e Beauty of Fractals (Springer-Verlag, 1986) .
2. R. T . Stevens, Fractal Programming in C (M&T Books , 1989) .
3. C . A. Pickover , "Chaotic behaviour of the transcendental mapping (z ->
Cosh(z)+/L) , The Visual Computer 4 (1988) 243-246.
4. 1. D. Entwistle, "Julia set, art and fractals in the complex plane" , Computers and
Graphics 13, 3 (1989) 389-392.
5. C. A. Pickover, "Biornorphs: Computer displays of biological forms gen erated from
mathematical feedback loops" , Comp o Graph ics Forum 5 (1986) 313-316.
6. M. Barnsley, Fractals Everywhere (Academic Press , 1988).
S. Dean Calahan and Jim Flanagan
SelfMapping of Mandelbrot Sets
by Preiteration
The Figures
Figures 2and 3show sequences ofpreiteration maps for z2 +cand z3 +c.
Figure 3 depicts the topmost bud of Fig. 1 : M20 at higher magnification
(corners at 0.4+ 1.14i, 0.14+0.61i). Figure 4enlarges the entire map shown
in Fig. 1 : Mw.
Commentary
An apparent feature of these sequences is that as the number of preitera
tions growslarger, themaps lookmoreand morelikeM 0 . At eachstep, groups
ofbuds vanish, replaced by "ghosts" ofthe original, apparently a kind of dust
suggesting the outline of the original bud in M0 (note especially Fig. 1: M20
166
167
F i g u r e 1.
F i g u r e 2.
Figure 3. F i g u r e 4.
168 S. D. Calahan & J. Flanagan
and M30,and Fig. 3). Asthe process described essentially throws away points
ofthe original set which escape quickly, this is perhaps not surprising.
Suggestions for further study of this phenomenon immediately suggest
themselves:
Acknowledgments
A SPARCstation 2 running software under development by coauthor
Flanagan produced these images.
S. Dean Calahan
Unrolling t h e Mandelbrot Set
The Figures
Figures 24 showgraphsofmeasurements performed onabinary decompo
sition of the level set with escape time 7, which consists of 128 cells. Only 64
cells are depicted due to the mirror symmetry of M. The figures are centered
onan axisasthey look prettier that way, and the nature ofthe patterns seems
more apparent. Thus, the measurements discussed below refer to the upper
half of level set 7. In each case, the leftmost component of the graph repre
sents the tine crossing level set 7 at the leftmost tip of M (almost touching
the leftmost tip of M), the rightmost component represents the tine crossing
the level set at the rightmost portion of the set (entering the main cardioid),
and the longest measurement corresponds to the portion ofthe level set in the
169
170
C o m m e n t a r y
A c k n o w l e d g m e n t s
T h e d a t a for Figs. 24 was generated by "BudOriented Zooming" software
under development in the author's alleged spare time.
R e f e r e n c e
1. H.O. Peitgen and P. H. Richter, The Beauty of Fractals (SpringerVerlag, 1986).
S. Dean Calahan
Parameter Space of Mandelbrot Sets
from Variation of Coefficients
The images described here show how Mandelbrot sets of the form z =
cz4+bz3+az2 changewithchangesintheratiosa :b,b :c,and a :c. Assuming
an appropriate escape radius, preserving the coefficient ratios preserves the
shape of the set: the magnification required to resolve the main body to a
particular sizevaries inversely with the length of the coefficient vector.
The Cartesian coordinates of vectors defining a spherical triangular grid
on the unit sphere in the positive octant afford the parameters of the present
maps. Figure 1 presents a broad overview of this parameter space; Fig. 2
magnifies the corner of image 11,the canonical Mandelbrot set.
Theimageparameters emphasize onlythemainbodyofeachset, normaliz
ingthe height ofeach to approximately 225pixels (.75 inch at 300dpi). These
maps ignore the seemingly disconnected islands emerging some distance from
the main bodies of many of the sets. Attempting to encompass them reduces
the image size unacceptably. Escapetime or potential mappings enhance the
islands' appearance, but in many cases they appear to be isolated regions of
high potential rather than attracting set material.
Figure 1
The images numbered 1, 11, and 15 represent Mandelbrot sets for the
polynomials z 4 + k, z1 + k, and z3 + k respectively. Along the lines between
them only two powers of z contribute; all three powers of z contribute to the
interior images. Notice that the corner at image 11apparently depends more
strongly on small parameter variations than do the other corners.
Figure 2
This mapexpandsthe corner at image 11,sharing with it images 7, 11,and
12. The extraordinary length of image 28 prevents the alignment of adjacent
images to the triangular grid, dramatically emphasizing the apparent higher
variability in this region.
172
173
Figure 1.
174 zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA
Figure 2.
Parameter Space of Mandelbrot Sets from Variation of Coefficients 175
C o m m e n t a r y
A c k n o w l e d g m e n t s
Reference
1. C.H.MacGillavry, FantasyandSymmetry: ThePeriodicDrawingsofM. C.Es
cher(Harry Abrams, 1976)pp.7677.
176
177
Koji Miyazaki and Manabu Shiozaki
FourDimensional Space Flowers
178
179
Istvan Lengyel, Irving R. Epstein,
and Helena Rubinstein
The Dolphin Head Bifurcation Diagram
one another; in particular, the components that activate the reaction should
diffuse less rapidly than the inhibiting species. The kinetic equations in this
2-variable coupled model system are:
dXI XIYI
-d = b -
t
Xl -
1+
2
qX I
+ D xC(X2 - xd
dX2 X2Y2
-d = b - X2 -
t
2
1 + qX 2
+ DxC(XI - X2)
dYI XIYI
-----;}1 = a - 1 + qxi + D yC(Y2 - YI)
dY2 X2Y2
-dt = a- 1
+ qX 22 + DyC(YI - Y2)
180
The dolphin head bifurcation diagram. Parameters of the differential equation system: (a,zyxwvutsrqponmlkjihgfedcbaZYX
Figure 1.zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA b, q, Dx, Dy)
(8.951, 11.0, 0.5, 1 0 " 5 , 10~ 3 ). zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA 2
182 /. Lengyel, I. R. Epstein &H. Rubinstein
R e f e r e n c e s
1. A. M. Turing, "The chemical basis for morphogenesis", Phil. Trans. Roy. Soc.
B237 (1952) 3772.
2. I.Lengyel andI.R. Epstein, "Diffusion induced instability inchemically reacting
systems: Steadystate multiplicity, oscillation, andchaos", Chaos 1 (1991) 6976.
3. V.Fairen and M.G. Velarde, "Dissipative structures ina nonlinear reaction dif
fusion model with inhibition forward", Prog. Theor. Phys. 61 (1978) 801814.
Bob Brill
Embellished Lissajous Figures
To generate one of these curves, the user supplies values for the param
eters (capitalized variables above). Lissajous figures are well behaved, being
continuous at every point, forming elegant, sweeping curves t h a t reveal their
derivation from the sine function, closing seamlessly upon themselves, and fit
ting neatly into any desired rectangle (whose sides are 2 * A a m p l i t u d e by 2
* ^ a m p l i t u d e ) . T h e closure function returns true when the current coordi
nates and heading are the same as the starting coordinates and heading.
Although such plots are handsome, they are much more interesting when
embellished, as shown in the figures. Instead of plotting each point, as above,
I have drawn a pair of arcs, each of which begins at the calculated point.
Each arch is determined by three usersupplied parameters t h a t specify the
angle offset from the current heading, the degree of curvature (e.g., 360 is a
circle, 90 a quarter circle, 1a straight line), and the length of the straight line
segments composing the arc. One arc is drawn counterclockwise and is offset
to the left of the current heading, while the other is drawn clockwise and is
offset to the right.
Many interesting figures can be drawn by varying the Lissajous parameters
and t h e embellishment parameters, as described, but many other variations
are also possible by altering the Lissajous equations or by changing the nature
of the embellishment.
183
184 B. Brill
One fruitful idea was to change the heading before drawing the arcs. As
each point is calculated, the heading is determined to lie in the direction of
the undrawn line connecting the previously calculated point to the newly cal
culated point. Thus the embellishment follows the path of the curve. We
can make the embellishment rotate in various ways by changing the heading
after each recalculation as follows: heading = 360 heading or heading =
360 * |sin(t)|heading or heading = 360 * |sin(i)| or even heading =
|sin()|. This by no means exhausts the possibilities. The embellishment
parameters can also take |sin(t)| or 1 |sin(t)| as multipliers, causing the off
set angles, curvature or line lengths to vary periodically between 0 and their
specified values. Any of these modifications may be in effect separately or in
combination.
Why stop at drawing two arcs? I have also drawn polygons, parameter
ized for a number of sides and side lengths. These also have been modified
to cause the polygons to expand and contract in size. As for changing the
Lissajous equations, there are many possibilities. Ilikethe onewhere after the
calculation of x, I add the line:
x * = sin(t).
Space does not permit a complete description of everything I have tried. The
interested reader isencouraged to explore new variations.
185
i86
I
187
2
(Landscape)zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA
189
190
191
192
193
c
a
3
S. J. Abas
Islamic Pattern
Unlike the arts of other cultures, Islamic art sets out deliberately to shun
anthropomorphic forms and concepts. It was led to concentrate on the explo
ration of symmetry in geometrical patterns, an enterprise which resulted in
an extraordinarily large, complex and elegant collection of patterns [1, 2, 3,
4]. Apart from their aesthetic merit, these patterns offer a treasure house of
symmetry which make them of great interest to a large number of scientists
and educators [5,6].
The most sophisticated Islamicpatterns relyontheuseofconcealed polyg
onal grids and the pattern depicted here is of this construction. It is rather
an unusual example, for it manages to combine sevenrayed stars with squares
and octagons. It is also a deceptive one, in that at a cursory glance it seems
to contain trilobed symmetric regions (such as the two on the opposite sides
ofthe center point) which on careful examination turn out not to be so.
We give below an algorithm for its construction which issimpler than the
one published previously by Hankin [7].
1. Draw a grid of heptagons as shown in Fig. 1(a). This gives rise to a series
ofsmall squares si.
2. Refer toFig. 1(a) again. Centered oneachofthesquaressi, draw acircle cl
circumscribing si and asquares2ofsided, whered isthe smallest distance
between two of the nodes on the grid. From the nodes surrounding the
squares, draw lines 11and 12 to the vertices of the heptagon which lie on
the edge forming the squares si.
3. Refer to Fig. 1(b). Usecl to draw the octagon shown then discard cl. Use
11 and 12 to cut off s2. Replace the two lines with the circle c2. From
a point on the circumference of c2, draw line 13to a vertex of si. The
intersection of 13,with line14joining twoofthe nodes, defines the radiusof
the circlec3.
4. Figure 1(c) shows how the pattern emerges by symmetrically performing
the above steps in the region surrounding one of the squares si.
5. Figure 1(d) shows the same when the same operations are continued on a
larger region ofthe grid.
194
195
(a) (b)
(c) (d)
Figure 1. An unusual Islamic pattern containing sevenrayed stars, octagons and squares.
196 S. J.Abas
References
1. J. Burgoin, Arabic Geometrical Pattern and Design (FirminDidot, 1879 and
Dover, 1973).
2. K. Critchlow, Islamic Patterns: An Analytical and Cosmological Approach
(Thames and Hudson, 1976).
3. I. ElSaid and A. Parman, Geometrical Concepts in Islamic Art (World of Islam
Festival Publ. Co., 1976).
4. D. Wade, Pattern in Islamic Art (Cassell & Collier Macmillan, 1976).
5. J. Niman and J. Norman, "Mathematics and Islamic art", Amer. Math. Monthly
85 (1978).
6. E. Makovicky and M. Makovicky, "Arabic geometrical patterns a treasury for
crystallographic teaching", Jahrbook fur Mineralogie Monatshefte 2 (1977).
7. E. H. Hankin, "Some difficult saracenic designs", Math. Gazette 18 (1934)
165168.
Paul D. Bourke
Swirl
a n a i 2 <*21 0.22
1 2 . 7 0 0 . 0 8 0.86 2 . 2 0
2 2 . 2 4 +0.43 0 . 6 5 2 . 4 3
3 +2.00 1 . 0 0 1 . 0 0 2 . 0 0
4 +0.44 1.22 +2.50 1 . 5 0
It should be noted that the vast majority ofvalues for a n , ai2, 021,to022
do not yield interesting images, in such cases the attractor consists of only a
few isolated areas.
Acknowledgments
Attributed to Peter de Jong, Leden, Holland by A. K. Kewdney in Com
puter Recreations, Scientific American.
Software called FRACTAL togenerate theseimagesand many other fractal
and chaotic systems is available from the author for the Macintosh II family
of computers.
197
198
Swirl
Craig Cassin
Circlegraph 7.11
199
Craig Cassin zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDC
Flow 2.8
200
John D. Corbit
Botanical Biomorph Arising from the
Iteration of z * z3+ \i
The pattern described here isa biomorph image ofthe type first described
by Pickover [1,2, 3]. The pattern arises from the iteration of a very simple
expression, namely, z z3+fi, where//and zarecomplexnumbers. The image
was rendered with the aid of a Julia set algorithm and the special convergence
criterion required to reveal biomorphic forms [1]. According to this criterion,
z is taken to be convergent and a point is plotted if either the real or the
imaginary part of z issmall after many iterations.
Figure 1 shows a map resulting from the iteration of z z3 + /j,in a
region of the complex plane centered at real.z = 0.685426, imaginary.,? =
0.175747, and with real and imaginary side lengths being real.side = imagi
nary.side = 0.04. The real and imaginary parts ofn were 0.5 and 0.0, respec
tively, and the number of iterations was 100.
Qualitatively, the pattern has a plantlike character. Overall, there is a
central upheaval of frondlike foliage flanked by two botanic spirals of infinite
depth. The leafy fronds are seen by perceiving the white areas as figure and
the black areas as ground. Alternatively, spiky hairlike forms are prominent
when one perceives black as figure and white as ground.
The computations wereperformed ona Macintosh II usingFractal 2.4 soft
warewritten by Paul Bourke ofAuckland University, Auckland, New Zealand.
Four450x450pixelquadrants oftheimagewerecomputed separately and then
assembled in a graphics package giving a final image resolution of 900 x 900
pixels.
References
1. C.A.Pickover, "Biomorphs:Computerdisplaysofbiologicalformsgenerated from
mathematical feedback loops", Computer Graphics Forum5 (1986)313316.
2. A. K. Dewdney, "Computer recreations", Scientific American (July 1989)
110113.
3. C. A. Pickover, Computers, Pattern, Chaos, and Beauty GraphicsFroman
UnseenWorld(St. Martin's Press,1990).
201
202
Figure 1. A zoom on a region of the map for Z >Z3 + fi. Note frondlike forms in the
central area and the two spirals at the sides. See text for more information.
W. H. Cozad
Transient Microstructure
203
204
Transient microstructure
Douglas A. Engel
Engel Curves
The patterns described here show how Engel curves are generated and
some interesting computergenerated Engel curve circuits. These curves were
published in the February 1983 American Mathematical Monthly. In Fig. 1,
a curve is generated by first creating a grid of m rows of n points, m and n
coprime and only oneofm and n even. Figure 1has a2x3rectangular gridof
6points, the grid then beingdivided into3pairsofpoints, each pair connected
by a single line to form a net of valence 1. This pattern is then repeated 6
times in 3 x 2 array. The same array is then replicated, turned 90 degrees
and superposed over itself to form a net of valence 2 composed of 1or more
closed curves. Patterns that form a hamilton cycle,a single closed curve using
every point of the net like this one are not very common as the m xn pattern
increases. Several investigators showed that only 42 of them exist for 3 x 4
nets, none symmetrical. In what follows, the m x n net is called the efactor
and the final pattern the eproduct.
Engelcurvesequencescannowbedescribed asshowninFig.2. The infinite
sequences of efactors shown here produce only hamilton cycles. Two distinct
curve networks can be achieved by multiplying an assymetrical efactor with
itself in 2 ways. If one allows the efactors to be turned over then 2 different
assymetrical efactors can be multiplied to get 4 different eproducts. Several
investigators have attempted todescribethesecurvesand elucidate their prop
erties in terms of sequences, knots, topology, number of curves produced, and
so on.
Properties that can be investigated include the simulation of Brownian
motion as a random ecurve that is traced by a plotter, the circuit properties
of intertwined ecurves, 3and higherdimensional Engel curve products where
3 or more edges meet at each vertex, the generation of fractallike circuits as
a sequence approaches infinity, and many other properties too numerous to
mention here.
The final figures shows a 28 x 9 inverse frame curve (it is called an in
verse frame curve if m is larger than n) surrounding a 10 x 11perfect frame
curve. This shows how two efactors made according to the same rule produce
wildly different eproduct curves. The 10x 11frame curve isthe first member
2U5
206 D. A. Engel
Fig. 2.
Fig. 1. Fig. 3 .
Fig. 4 .
Figures 14 show the generation ofEngel curves, curvesequences, and an inverse frame curve
surrounding a perfect frame curve.
Ian D. Entwistle
"Spinning Chaos": An Inverse Mapping of
the Mandelbrot Set
208
209
210 I. D. Entwistle
P s e u d o C o d e for M o d i f i e d Level S e t M e t h o d
BEGIN
F O R sy = 1 T O ny
cy = ymm\sy * (ymax.ymin)/ny
F O R sx = 1 T O nx
ex = xmin+sa; * (xmaxxmm)/nx
bxy = l/(cx2 + cy2) :x 0 :y = 0 :xy = 0 :x2 = 0 :y2 = 0 :ci = 25
F O R i t e r = l T O itermax
x = x2 y2 + ex/bxy :y = xy + xy + cy/bxy
x2 = x * x : y2 = y * y :cs = x2 + y2 : xy = x * y
I F y2 < ci T H E N ci=x2
I F cs > 4 T H E N exit L O O P and S E L E C T C O L O R
E N D L O O P
d = I N T ( c i * I N T E G E R F A C T O R )
T E S T ci AND P R I N T
S E L E C T C O L O R ON BASIS O F iter VALUE
END L O O P : E N D L O O P
A p p e n d i x
nx=1080, ny=2250, a;min=5,6, a;max=4.1, ?/min=3.6, y m a x = 1 . 8 ,
itermax=120, I N T E G E R F A C T O R = 1 0 0
R e f e r e n c e s
1. R. Dixon, Mathographics (Basil Blackwell Ltd., 1987).
2. F. J. Flanigan, Complex Variables: Harmonic and Analytical Functions (Dover
Publications Inc., 1972).
3. H.O. Peitgen and D. Saupe, The Science of Fractal Images (SpringerVerlag,
1988).
Ian D. Entwistle
"Wings of Chaos": Mappings of t h e Function
sinh(z) + cin t h e Complex Plane
211
212 zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA
I zyxwvut
I
I
!
I
I
H
to zyxwvu
Complex z plane map of sinh(z) + c using minimum values of |z|) 2 -zyxwvutsrqponmlkjihgfedcbaZY
Figure 2.zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA
CO
214 /. D. Entwistle
point was printed black or white. T h e minimum value of {\z\)2 reached during
iteration was similarly used to control the printing of t h e stable set of points in
Fig. 2. Of particular note when computing the values of z is the symmetrical
shape ofthe stable set. This allows the mapping to be achieved with calculation
for only one quarter of the total pixel count. To allow classification of the
minimum values on a size basis the real numbers were converted to integer
equivalents by an integer factor (IFF). In b o t h mappings, groups of (zreal) 2
or (\z\)2 values were printed alternately in black and white. D a t a to allow
generation of the patterns is appended.
A p p e n d i x
IFF Max. Iteration Escape radius Minr, Maxr Mini, Maxi
Fig. 1. 80 200 10 1.6 1.6 3.2 3.2
Fig. 2. 50 200 10 1.55 1.55 3.2 3.2
R e f e r e n c e s
1. H.O. Peitgen and D. Richter, The Beauty of Fractals (SpringerVerlag, 1986).
2. C. A. Pickover, "Chaotic behaviour of the transcendental mapping(z
cosh(z) + u)", The Visual Computer 4 (1988) 243246.
3. C. A. Pickover, Computers, Pattern, Chaos, and Beauty Graphics From an
Unseen World (St. Martins Press, 1990).
4. F. J. Flanagan, Complex Variables: Harmonic and Analytical Functions (Dover
Publications Inc., 1972).
5. H.O. Peitgen and D. Saupe, The Science of Fractal Images (SpringerVerlag,
1988).
Ian D. Entwistle
"Islands Among Chaos": Mappings of t h e
Transcendental Function cosh(z) + c
in t h e Complex Plane
215
216 /. D. Entwistle
jendix
Figure Max. iteration Escape radius Mini Maxi Minr Maxr
1 250 1000 0.002 0.002 3.4005 3.3985
2 300 1000 1.187 0.976 3 . 9 3.695
3 400 1000 1.325 1.475 0.704 0.854
4 200 1000 1.35 1.85 1.5 2.0
References
1. C. A. Pickover, "Chaotic behavior of the transcendental mapping (z>
cosh(z)+ //)", The VisualComputer4 (1988) 243246.
2. A.DouadyandJ.H.Hubbard, "Iterationdespolynomesquadratiquecomplexes",
CRAS Paris 294 (1982) 123126.
3. H.O. Peitgen and D. Saupe, The Science of FractalImages (SpringerVerlag,
1988).
217
>* i
221
222 /. D. Entwistle
A p p e n d i x
Minr,Maxr Mini,Maxi Max. iterations Pixels x, y
Fig. 1. 2.0, 1.0 1.5,1.5 1024 1280,1960
Fig. 2. 1.786623,1.785227 0.00095,0.00095 1024 1280,2600
R e f e r e n c e s
1. B. B. Mandelbrot, The Fractal Geometry of Nature (W. H. Freeman, 1983).
2. H.O. Peitgen and D. Richter, The Beauty of Fractals (SpringerVerlag, 1986).
3. A. K. Dewdney, "Acomputer microscope zoomsinfor alook at the most complex
object in mathematics", Scientific American 255, 8 (1985) 812.
4. C. A. Pickover, Computers, Pattern, Chaos, and Beauty Graphics From an
Unseen World (St. Martin's Press, 1990).
5. I. D. Entwistle, "Julia set art and fractals in the complex plane", Computers and
Graphics 13, 3 (1989) 389392.
6. I.D.Entwistle, "Methods ofdisplaying thebehaviour ofthe mapping z > z 2 +u",
Computers and Graphics 13, 4 (1989) 549551.
7. H.O. Peitgen and D. Saupe, The Science of Fractal Images (SpringerVerlag,
1988).
8. M. Barnsley, Fractals Everywhere (Academic Press, 1988).
9. R. Silver, "Mariani's algorithm", Amygdala 4 (1987) 35.
223
i
73
a
a
a.
a.
o
<v
tc
'S
ho
S3
4)
U
a
be
Ian D. Entwistle
"Serpents and Dragons": A Mapping
of f(z) > sinh(2;)+ c in t h e Complex Plane
22!)
226
Figure 1. "Serpents and Dragons": A Julia set map of the function z > sinh(z) + c.
"Serpents and Dragons": A Mapping of ... 227
P s e u d o C o d e : M o d i f i e d Level S e t M e t h o d
Arguments: nx,ny, xmin, xmax, ymin, j/max, itermax, ex, cy.
Variables: real x,y,cr, cs,ess,csi integer sy,sx.
BEGIN FOR sy = 1T O ny
FOR sx = 1T O nx
y = ymin+sj/ *(j/maxymin)/ny :x = xmin+sx *(xmaxxmin)/rtx :
csi = 25
FOR i t e r = l to itermax
x = 0.5 *(ex e~x) *cos(y) + ex :y = 0.5*(e x e _ I ) *sin(y) + c
cr = x * x\ci = y *y : ess = cr + ci
IF ess < csi THEN csi = ess
IF ess > 1000 THEN EXIT LOOP TO TEST
END LOOP
csi=INT(csi *110):REM ASSIGN COLOR VALUES TO csi
IF ABS(x) < 100 OR ABS(y) < 100 THEN ASSIGN COLOR VALUE
END LOOP:END LOOP
A p p e n d i x
R e f e r e n c e s
1. C.A.Pickover, "Chaoticbehavior ofthe transcendental mapping (z cosh(z)+u",
The Visual Computer 4 (1988) 243246.
2. C. A. Pickover, Computers, Pattern, Chaos, and Beauty Graphics From an
Unseen World (St. Martins Press, 1990).
3. F. J. Flanagan, Complex Variables: Harmonic and Analytical Functions (Dover
Publications Inc., 1972).
4. I. D. Entwistle, "Julia set art and fractals in the complex plane", Computers and
Graphics 13, 3 (1989) 389392.
5. H.O. Peitgen and D. Saupe, The Science of Fractal Images (SpringerVerlag,
1988).
Ian D. Entwistle
"Star of Chaos": A Multiple Decomposition
Mapping of f(z) :z * z7+ c in the
Complex Plane
The pattern illustrates an elaborated Julia set fractal obtained from itera
tion of the function z7 + cin the complex plane.
Iterative complex plane maps of the function z2 +c have been widely ex
plored by graphical methods because of the fascinating fractals that can be
generated [1]. The striking beauty ofthese maps and the relationship of their
geometry to the corresponding z plane mappings has prompted the study of
the similar behavior of higher polynomial functions. On iteration, such func
tions generate z(n) values approaching infinity within a few iterations (n)
and very few of the points in the complex plane are part of the "bounded
set" if the value of c is in the main cardoid of the corresponding Mandelbrot
set. The resulting Julia sets fractals have outlines which are quasicircles, i.e.,
they are homomorphic to a circle. The maps are not visually so appealing
as those obtained for z2 + c since there is no complex fractal behavior close
to the boundary between the divergent and bounded points. Most points are
mapped to only a few distinct quasicircles. Variations in the escape values
employed or control of the point mapping positions on the basis of the z(n)
value have been utilized to produce visually exciting maps for the functions
zp + c (p= 3,4, 5) [4]. Other variations related to the pattern have also been
studied [5]. In order to generate the complex pattern evident in the figure,
secondary data isgenerated from the values of z(n) after completion of itera
tion for each point. This newvalue controls the printing color ofthepoint and
results in the transformation to treelike patterns which radiate to the pat
tern edges. This isachieved using a modification ofthe Binary Decomposition
Method for Julia Sets (BDM/J) [6] derived from the mathematics of binary
decomposition [7]. A simplified description has been reported which allows
multiple decomposition maps to be generated [8]. Application of BDM/J to
the function z7 + c can be simplified for computation using languages which
do not support complex variables. Substitution of z7 + c by z = x + i *y
using standard complex algebra [9] leads to the two equations (1 and 2)
228
229
230 /. D. Entwistle
A p p e n d i x
Iterations Min(r), Max(r) Min(i), Max(i), c(r), c(i)
30 1 . 5 , 1.5 1 . 5 , 1.5 0 . 3 , 0.7
Pixelation 1280 x 1780
(r = real, r = imaginary)
R e f e r e n c e s
1. H.O. Peitgen and D. Richter, The Beauty of Fractals (SpringerVerlag, 1986).
2. C. A. Pickover, Computers, Pattern, Chaos, and Beauty Graphics From an
Unseen World (St. Martins Press Inc., 1990).
3. I. D. Entwistle,"Julia set art and fractals in the complex plane", Computers and
Graphics 13, 3 (1989) 389392.
4. C.A.Pickover and E.Khorasani, "Computer graphicsgenerated from the iteration
of algebraic transformations in the complex plane", Computers and Graphics 9
(1985) 147151.
5. I. D. Entwistle, "'Fractal Turtle' and 'Elephant Star': Multiple decomposition
mappings of f(z) : z z5 + c in the complex plane", in The Pattern Book:
Fractals, Art, and Nature, ed. C. A. Pickover (World Scientific, 1995) p. 155.
6. H.O. Peitgen and D. Saupe, The Science of Fractal Images (SpringerVerlag,
1988).
7. [1],pp. 4044, 6476.
8. J. D. Jones, "Decomposition: They went that away Another way of viewing
the object", Amygdala 13 (1988) 23.
9. F. J. Flanagan, Complex Variables: Harmonic and Analytical Functions (Dover
Publications Inc., 1972).
Michael Frame and Adam Robucci
Complex Branchings
References
1. M.Barnsely, Fractals Everywhere(Academic Press, 1988).
2. B. Branner, "The Mandelbrot set", in Chaos and Fractals:The Mathematics
Behind the ComputerGraphics, eds.R. Devaney and L.Keen (American Mathe
matical Society: Providence, 1989).
231
232
Figure 1. Part ofthe Mandelbrot set, cen Figure 2. Part of a Julia set for z 2 + CQ.
tered at co
Shown here are two images showing fractal features. In other words, the
patterns are quite intricate and show selfsimilar edges. I call these patterns
Nevada sets. You may write to me for more details on how I created these
pictures.
*>Mbwd&
Figure 1.
233
234
m
u
3
Ira Glickstein
" H a n d m a d e " Patch Quilt Generated
by LSystem
A
B * AB+B+B +
"B > Bx
x > { F + F } > { + F } > { + F + f }
iterations: 20
Machinemade Handmade
theta angle: 90.0 90.002
initial angle: 0.0 4.000
235
236 /. Glickstetn
F i g u r e 1. Machinemade.
237
Figure 2. Handmade.
Earl F. Glynn
Spiraling Tree/Biomorphic Cells
zx =rx(cosx6 + is\nx6),
References
1. H.O.Peitgen and P.H.Richter, TheBeautyofFractals (SpringerVerlag, 1986)
2. H.O.PeitgenandD.Saupe,eds. TheScienceofFractalsImages(SpringerVerlag,
1988).
238
239
240
241
F i g u r e 2. Fractal hurricane.
Earl F. Glynn zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFED
Intertwined
Pictured here are two views of a Julia-like set computed using the complex
sine function.
Figure 1 shows "arms" from the top and bottom reaching out for each
other but never touching. Figure 2 shows an enlargement of the tips of the
arms. While the arms from the sin(z) Julia-like sets are "shy", the arms from
the cos(z) Julia-like sets are very direct and unite quickly as the Julia set
parameter is varied in a similar way. zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPO
Figure 1. Macroscopic view of Julia-like set for iteration z > sin(z) + (3.70 + 0.6i).
242
243
Figure 2. 2.5X magnification of Julialike set for iteration z sin(z) + (3.65+ 0.6i).
Earl F. Glynn
Mandelbrot Iteration z * 2
+c
2
Figure 1. Mandelbrot iteration z + c; ModulusMax = 2.
211
245
Pictured here are two different views of the Julia set iteration z > 2~ 2+c
(related to the previous article, Mandelbrot Iteration z *z~ 2 + c, Fig. 2).
Both ofthe parameters cfor the Julia set calculations shown here were chosen
from along the real axis in the corresponding Mandelbrot set. The "movie" of
the transformation of Fig. 1into Fig. 2isquite interesting.
246
247 zyxwvu
Shown here are two views of Julia sets formed from the J0 Bessel func
tion. Figure 1 shows "fireworks", while Fig. 2 shows an interesting fractal
"parallelogram".
248
249
z^(z)'2 + c,
where,
z
isthe complex conjugate of z.
F i g u r e 1. Fractal "Moon"
250
Branko Griinbaum
Isogonal Decagons
251
252
2.7 4.9
7.8 3,4
2.5 6.9
Reference
1. J. Jacobson, "Analytic computer art", Proc.2ndSyrup.Small Computersinthe
Arts (1982) pp.4760.
251
255
25(5
257
6002 Z06
258
259
260
261
William J. Jones
Outer Space
262
263
William J. Jones
Parquet
201
265
William J. Jones
TESS Patterns
266
267
Figure 1. Figure 2.
Figure 3. Figure 4.
William J. Jones
Skew Squares
268
Huw Jones
Fractal Gaskets
where trunc(x) is the truncated integer part of the real value x, determines
how many sides of a small polygon are projected onto the portion cut out of
the side of the larger polygon. Let us say that the cut out length isgiven by
k
2 s ^ c o s ( 3 6 0 i / n ) = 2sc.
269
270 H. Jones
f = s/S=l/{2(l + c)}.
P' = {lf)V + fP
References
1. D. Saupe, "A unified approach to fractal curves and plants", in The Science of
Fractal Images, eds. H.O. Peitgen and D. Saupe (SpringerVerlag, 1988).
2. M. F. Barnsley, Fractals Everywhere (Academic Press, 1988).
3. H. Jones, "Diirer, gaskets and the chaos game", Computer Graphics Forum 9, 4
(1990).
4. A. Diirer, The Painter's Manual (Abaris Books, 1977) (translated by W. L.
Strauss).
5. R. F. Voss, "Fractals in nature: From characterisation to simulation", in The
Science of Fractal Images, eds. H.O. Peitgen and D. Saupe (SpringerVerlag,
1988).
Huw Jones
An Octahedral Fractal
D = log(4)/log(2)=2,
273
274
.
Figure 3. An octahedral fractal after 3 subdivision.
An Octahedral Fractal 275
D = log(6)/log(2) = 2.585,
Reference
1. R. F. Voss, "Fractals in nature: From characterisation to simulation", in The
Science of FractalImages, eds. H.O. Peitgen and D. Saupe (SpringerVerlag,
1988).
Haresh Lalvani and Neil Katz
A Packing with Icosahedral Symmetry 1
Reference
1. H.Lalvani, Patterns inHyperSpaces (Lalvani, 1982)p.24.
276
277
Haresh Lalvani
Hard Lines, Soft Circles
References
1. R.Penrose, "Pentaplexity", Math.Intelligencer2 (1979)3237.
2. N.DeBruijn, Personal communication (August 1985).
3. H.Lalvani, "Morphologicalaspectsofspacestructures",inStudiesofSpaceStruc
tures,ed.H.Nooshin (MultiScience Publishers) (inpress) Figs.240248.
4. D.LevineandP.Steinhardt, "Quasicrystals 1:Definition andstructure", Depart
ment ofPhysics, University ofPennsylvania, USA (August 1985) (preprint).
278
279
Haresh Lalvani
Tesspoly 3, into Tesspoly and Sectus
2;::0
Tesspoly 3, into Tesspoly and Sectus 281
R e f e r e n c e s
1. H.Lalvani, "Multidimensional periodic arrangements oftransforming spacestruc
tures", Ph.D. Thesis, University of Pennsylvania (University Microfilms, Ann
Arbor, 1982).
2. H. Lalvani, Structures on HyperStructures (Lalvani, 1982).
Figure 1. Tesspoly 3
282
Figure 3. Sectus
Wentian Li
Tetrahedron
11000011101111001110001110010000,
in which each bit represents the function / ( ) with a particular input. For
example, the first bit (on the left) represents / ( l l l l l ) , the second represents
/(11110),... ,and the last bit represents /(00000).
The spatialtemporal pattern produced by this rule (x axis is space, y
axis is time with the time arrow pointing down) is packed with seemingly
threedimensional tetrahedrons with different sizes, arranged in a fractallike
hierarchical structure. What isinteresting about thisrule isnot onlyits highly
symmetrical spatialtemporal pattern, but alsothe fact that thispattern isthe
attractor ofthedynamics. Inother words,ifonestarts from adifferent random
initial condition, the pattern produced isstill the same! What elsecan weask
for from a dynamical system which naturally produces a pretty picture?
References
1. S. Wolfram, Theory and Application of CellularAutomata (World Scientific,
1986).
2. W.T. Li, "Complex patterns generated by next nearest neighbors cellular
automata", Computersand Graphics13,4 (1989)531537.
283
284
Tetrahedron
Siebe de Vos and Raymond Guido Lauzzana
Binary Matrix Symmetry
The pattern described here illustrates binary matrix symmetry. Black sig
nifies +1 and white 1, while gray indicates that a cell may be either +1
or 1. The upper pattern contains all of the possible 3 x 3 matrices of this
type. The lowerpattern illustrates the symmetry groups, Sgroups, for the up
per pattern. The members of an Sgroup are equivalent under kw/2 rotation:
r, reflection: p, and complement: \ Our interest in this problem developed
when wediscovered that there are fiftyone unique TriHadamards as described
in the illustration entitled THHadamards. Since then, we have been looking
for an analytic solution to the number of iVHadamards.
A3x3matrixcanbepartitioned intothreeparts,thecenter: ,thecorners:
P, and the sidemiddles: n.a. The upper pattern illustrates that the set of
3 x 3 binary matrices is the Cartesian product of this partition:
g g x c f r x n .
The vertical axis contains all of the possible corner configurations, the hori
zontal axis contains all of the sidemiddle variations, and the two center pos
sibilities are indicated using the color gray. The ordering along the axes was
chosen to highlight the Sgroups. The origin is considered to be in the upper
lefthand corner and the population of black cells increases from left to right
and top to bottom.
One important characteristic ofthis partitioning isthat the cells contained
in each partition are equidistant from the center. All three of the transfor
mations, r,p,x, preserve this distance, and therefore, the sets defined by the
partitioning are closed under these transformations. This makes it possible to
analyze each of the sets independent of their combination. This partitioning
defines four and only four possible types ofsubsets. The three types described
above plus afourth type,HID,only occur in matrices ofsizegreater than three.
We have also found a calculus for analyzing Sgroups ofthe four types and
their relationship to the Sgroups of an N x N matrix. An example of an
expression using this calculus is:
285
286
" Bi Bi Bl U'~ B
Binary Matrix Symmetry 287
2 " ^ c O 2 g S
# H ^ a
ss ss2a(2ssa)
2 r ^ Q ( 2 c ^ Q ) < Q =
2 ^ ^ [ H 6 ^ i 6 " 2 H 8 [ J .
We are inthe process offormalizing this calculus and identifying its opera
tions, rules, and theorems. We have identified several basic equivalencies that
can be expressed using this calculus, such as:
d^ d^ = 2 c ^ i CI
288
TriHadamards 289
and reflection. There are fiftyone unique kernels. We have only recently
discovered TriHadamards and have begun to investigate their properties. Some
oft h e symmetries associated with the kernels are described with the illustration
entitled Binary Matrix Symmetry.
R e f e r e n c e s
1. J. Hadamard "Resolution d'une question relative aux determinants", Bull. Sci.
Math. 17, I (1993).
2. S. Agaian, Hadamard Matrices and Their Applications (SpringerVerlag, 1980).
James Elliott Loyless
Fractal Limit A Fractal P a t t e r n
Emulating M. C. Escher
Described here is a pattern showing a simple Julia set seeded near zero
with the interior features revealed as a level set. It demonstrates a haunting
similarity to the CircleLimit seriesofworks bythe Dutch artist, M. C. Escher
[1,2].
Figure 1 shows the set. This Julia set is generated by iterations of the
formula
z * z2 c
where ZQ = x +yi isthe plane of the figure, centered on zero, and c= a+bi
isthe seed point 0.05.
The interior features are generated as a levelset of equaldynamic distance
using a technique described by Peitgen and Richter [3]. The minimum value
of z is recorded during the iteration cycle for each point tested, and used to
describe the color assignment. The side dimension is 1.0, alternation goes to
the iteration limit of 250, and the minimum z value is multiplied by a factor
of 250 to provide a reasonable count range for coloring the interior.
To create his Circle Limit woodcuts, Escher inscribed arcs within a circle
with increasingly shorter radii as they approached the limiting edge. Within
this framework he created the interlocking patterns for which he is famous.
The effect yielded larger figures at the center and then smaller and smaller
figures as they moved toward the edge, approaching an infinitesimally small
size[1].
It should not be surprising to find similarities between Escher and fractal
geometry, since Escher was a student of higher geometry and mathematics.
Through illustrations by the geometer, H. S. M. Coxeter, he discovered the
hyperbolic model which Jules Henri Poincaxe used to show the whole of an
infinite flat plane inside a finite circle [2]. This Coxeter illustration bears a
striking resemblance to the Julia set shown in Fig. 1.
290
FractalLimit A FractalPattern Emulating M. C.Escher 291
R e f e r e n c e s
1. J. L. Locher, The World of M. C. Escher (Abrams, 1972) pp. 1516, 142143.
2. B. Ernst, The Magic Mirror of M. C. Escher (Random House, 1976) pp. 102111.
3. H.O. Peitgen and P. H. Richter, The Beauty of Fractals (SpringerVerlag, 1986)
pp. 6062.
z z c
292
293
R e f e r e n c e s
1. B.Ernst, The Magic Mirror ofM. C. Escher (Random House, 1976) pp. 102111.
2. H.O. Peitgen and P. H. Richter, The Beauty of Fractals (SpringerVerlag, 1986)
pp. 6062.
John MacManus
Jungle Canopy
References
1. B.B.Mandelbrot, TheFractalGeometryofNature (W.H.Freeman, 1982).
2. A.K.Dewdney "Computer recreations",ScientificAmerican255,9(1986) 1423
and 255, 12(1986) 1418.
3. K. H. Becker and M. Dorfler, Dynamical Systems and Fractals (Cambridge
University Press, 1989).
4. C.A.Pickover, "Insidethe Mandelbrot set", Algorithm 1, 1(1989) 912.
295
296
>. zyxw
a zyxwv
o
c zyxwvu
u
"ho zyxwv
C zyxwvu
' j
St
o
^c
a
p
BO
C
13
o
0
i3
9
3
M
fa
Tom Marlow
A " Y " Hexomino Tiling
References
1. S.W. Golomb, Polyominoes(Scribner, 1965).
2. M.Gardner, MathematicalMagicShow (Allen &Unwin, 1977).
297
298
(:)(::)(:K:H'2
These maps are constrained so that
299
300 zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA
Figure 1.zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIH
Families of single-valued functions.
Beauty in Functions 301
The bottom diagram consists of the interpolation points {(0, 2), (200, 0),
(400, 1.5),(600,0.5), (800,0)},and theaddressintervalsassociated with each
map were the same: {(400, 1.5), (800, 0)}. (Other address intervals could
have been usedjust aswell.) Foreach graph, the contraction factor was varied
from 0.55to 0.55 inten uniform steps, and the valueofeach was negated for
the oddnumbered maps for each curve, e.g., di = 0.55,d,2 = 0.55,dz = 0.55,
di = 0.55for the first curve.
Reference
1. M.F. Barnsley, Fractals Everywhere(Academic Press, 1988).
L. Kerry Mitchell
Logistic 3
References
1. I.Peterson, TheMathematicalTourist(Freeman, 1988).
2. E.Rietman, Exploringthe GeometryofNature(Windcrest Books,1989).
302
303
L. Kerry Mitchell
Inflation Rules 3
References
1. M.Gardner, PenroseTilesto Trapdoor Ciphers(Freeman, 1989).
2. I.Peterson, TheMathematicalTourist(Freeman, 1988).
301
305
The starting point of the drawing shown her ewith is a fourth- ord er magic
square which Durer judged worthy to present in his fam ous engraving "Die
Melancholie", among other obj ects of geometrical signifi cance. The magic
square, whi ch fascinated so many minds for so long , is a grid square filled in
apparent disorder , with consecutive whol e numbers. A more thorough exam-
ination rev eals the repetition of the same total in the main directions of the
gird. (Horizontals, verticals, and diagonals.) The square chosen by Durer has
another particularity as well: the two middle consecut ive numbers of the fourth
line 1514, correspond to the year this masterpiece was created .
The simple idea em erging from the curiosity of people interested in images,
consist ed of transforming this grid, the matrix, to an oriented diagram , con-
necting the numbers in order from 1 to 16. This graph obtained in 1948, is a
Hamiltonian graph. In fact, each summit is visited but only once . This much
for the mathematicians. For the painter or for the aesthete, it is a beautiful
drawing. (Left matrix.) In any case, to disappoint the theoreticians, it has
to be mentioned that this drawing's beauty cannot be attributed to the magic
square, since other drawings originat ing from other magic squares of the same
order are undeniably less beautiful. (Right matrix.)
1 12 7 14
8 13 2 5
10 3 16 11
15 6 9 4
Since the beauty of the drawing is ind ependent of the magic square, we
tried to connect the 16 ap exes of the matrix at random . Among the patterns
obtained , there are some whi ch ar e comparable to the beauty of the original
pattern. The pattern obtained in this way maintains a certain regularity and a
cert ain order. According to Birkhoff's well-known formula (which as a matter
of fact should be verified), the measure M of beauty is expressed as follows:
307
308 V. Molnar & F. Molnar
M = 0/C
whereOsignifies order and Ccomplexity. Itseemednecessarytousto increase
the complexity of the pattern. Therefore, we have displaced the apex of the
graph on the off chance. Thus, weadded 5%noise to the drawing.
With this pattern weconstructed a table of 16 x 16variations. These 256
patterns constitute a sample obtained by chance among the more than 10 13
possible permutations. The image reproduced isa detail of this work.
Douglas H. Moore
T h e Center of Dewdney's Radiolarian
50SCREEN 9 : CLS
75INPUT "A,B", A,B
100INPUT "RC,IC", RC, IC
200 FOR J = 0TO A :FOR K = 0TO A
300 X = B + 2 * B / A * J : y=B+2*B/A*K
400 N = l
500 X1=X*X*X3*X*Y*Y :Yl = 3*X*X*YY*Y*Y
600 X1=X1+RC :Yl = Y l + I C
700X2=ABS(X1) : Y2 = ABS(Yl)
800 Y3=X1*X1+Y1*Y1 : N=N+1 : IF N>10 THEN GOTO 1000
850 X=X1 : Y = Yl
900 IF Y3>100 THEN GOTO 1000 ELSE GOTO 500
309
310 D. H. Moore
Reference
1. A. K. Dewdney, "Computer recreations", Scientific American 261, 1 (1989)
110113.
AjB 408,1.6
RCIC . 5 , 0
References
1. C. Kahlert and O. E. Rossler, "Instability of Mandelbrot set", Z. Naturforsch.
42a (1987)324.
2. J. Peinke etal.,"Smooth decomposition ofgeneralized Fatousetexplainssmooth
structure in generalized Mandelbrot set", Z. Naturforsch. 42a (1987) 263; Z.
Naturforsch.43a (1988) 14;Z. Naturforsch.43a (1988)287.
an
312
2D Feigenbaum
David Stuedell
Biomorphic Mitosis
Acknowledgements
I thank J. Harper for the useful ideas and encouragement.
References
1. C. Pickover, "Biomorphs: Computer displays ofbiological forms generated from
mathematical feedback loops", Computer Graphics Forum5,4(1987) 313316.
2. A.Dewdney, "Computer recreations", ScientificAmerican (July 1989)110113.
3. B.Mandelbrot, TheFractalGeometryofNature (Freeman, 1982).
313
314
Reference
1. M.L.Stein, S.M.Ulamand M.B.Wells, "Avisual displayofsomepropertiesof
the distribution ofprimes", Math.Monthly71,5(1964) 516520.
315
316
Figure 1.
Figure 2.
Thomas V. Papathomas
Bistable Tiling P a t t e r n s with
Converging/Diverging Arrows
317
318 T. V. Papathomas
References
1. T . V. Papathomas, S. C. Kitsopoulos and J. 1. Helfman, "Arrows-anchors: Figure-
ground reversals" , Perception 18, 5 (1989) 689.
2. F . Attneave, "Multi st ability in perception", Scientific American 225 , 6 (1971)
63-71.
*
Tessellations of the plane with bistable ambiguous micropatterns: triangular (t op), square
(middle) and hexagonal (bottom) .
Thomas V. Papathomas
Vivid Depth Percepts from Simple
GrayLevel Line P a t t e r n s
Described here are two patterns, formed by white and black lines of either
horizontal or vertical orientation against a gray background. It is remarkable
that these images unexpectedly give rise to vivid threedimensional (3D) per
cepts, asifthey arerenderings ofanaglyph terrains. Both imagesare members
of a class of stimuli conceived by the authors [1],for studying the interaction
of visual attributes (color, luminance, orientation, spatial frequency, etc.) in
motion and texture perception. The two attributes employed inthis figure are
orientation (horizontal and vertical lines) and luminance polarity, or simpler,
polarity (black and white lines) on a gray background). These patterns were
generated on a computer by the algorithm described in [1];the algorithm can
produce much more complex patterns, depending on the goal of the visual
experiment, but its details need not concern us here. The top figure shows
a pattern in which only two types of lines exist: white horizontal (WH) and
black vertical (BV). These lines are joined in such a way so as to alternate
and to form staircases. Unexpectedly, however, they give rise to a strong 3D
percept; some observers describe the image as thin cardboard slabs, cut along
staircase contours, stacked one behind the other; others perceive the scene as
rows of seats, much like in an ancient stadium. In the bottom figure, which
alsoappears in [3]inadifferent context, wehaveallfour possible combinations
of lines: WH, BV (as before), plus black horizontal (BH), and white vertical
(WV). These lines form a regular orthogonal grid pattern which, quite unex
pectedly, produces a strong depth percept, in which two types of squares can
be seen, in a checkerboard format, i.e., half ofthe squares seem to pop out (in
depth) in front of the rest.
The best explanation that we can give for these percepts involves the in
herent assumption of the human visual system of a single light source shining
from above (see [2] for a recent reference). Thus, white lines are naturally
interpreted as edges that are lit directly by the source; black lines are inter
preted asedgesthat areoccluded bysomething interposed between themselves
and the source. This explanation accounts for the vivid 3D percept obtained
319
320
Simple patterns of bl ack and white lin es against a gray background that produce vivid d epth
pe rce pts .
Vivid Depth Percepts from Simple GrayLevel Line Patterns 321
References
1. T.V.PapathomasandA.Gorea, "Simultaneousmotionperceptionalongmultiple
attributes: A new class of stimuli", Behav. ResearchMethods,Instruments and
Computers20 (1988) 528536.
2. V. S. Ramachandran, "Perception of shape from shading", Nature 331 (1988)
163166.
3. D.Man, Vision (W. H.Freeman, 1982)p.77.
Kenelm W. Philip
Mandelbrot Set Spiral Tile Mosaics
322
Mandelbrot Set Spiral Tile Mosaics 323
ofeach mosaic the exact composition ofthe basic tile isnot always obvious
from an inspection of the resulting mosaic. The final images were printed on
an Apple LaserWriter. The mosaics have an almost organic quality which is
not always found in computergenerated art, so further experimentation with
this method of generating pattern tiles might be warranted.
The six mosaics (Figs. 27) were generated from the following Mset
structures:
Figure 2. "Lozenge" The first DDS,from the east sideofSeaHorse Valley.
Magnification: 3.75 x 1015 diameters.
Figure 3. "Ripple" ADDSfrom East Valley,neartherealaxisat the right
end oftheMset. Magnification: 4.5x1013 diameters.
Figure 4. "Hexagon" A quad spiral with four attached double spirals, east
SeaHorseValley. Magnification: 3.22xlO 16 diameters.
Figure 5. "Bracket" A DDS from the west side of Sea Horse Valley. Mag
nification: 1.47 x 108 diameters.
Figure 6. "Eyes" Another DDS from east Sea Horse Valley. Magnifica
tion: 2.17 x 108 diameters.
Figure 7. "Trellis" The first DDDS, from east Sea Horse Valley. Magni
fication: 8.42 x 1012 diameters.
324 zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA
F i g u r e 2. Lozenge. zyxwvutsrqponmlkjihgfedcbaZYX
326
Figure 3. Ripple.
327
F i g u r e 4 . Hexagon.
328
Figure 5. Bracket.
329
Figure 6. Eyes.
330
Figure 7. Trellis.
A. G. Davis Philip
Evolution of Spirals in Mandelbrot
and Julia Sets
331
332 A. G. D. Philip
Table 1. (Continued)
The Patterns
Figure 1. Examples ofspiral types.
the series of double spirals (DS) found on the lower edge of the main spiral.
As one goes from left to right, the DS wind up clockwise producing DS with
many turns in the spiral arms. On the upper and lower edges of the spiral
there are series of single spirals. Near the middle of the spiral arm there is
another series of smaller DS. If the spiral arm is magnified, spirals of various
types will be found in great profusion.
Figure lb. ADouble Spiral (DS) in Sea Horse Valley. In the center ofthe DS,
there is a smaller spiral, below the limits of the resolution of this picture. At
the end of each arm can be seen a single spiral.
Figure lc. A Double/Double Spiral (DDS) in Sea Horse Valley. The end of
each spiral arm contains a double spiral.
Figure Id. An Octuple Spiral in Sea Horse Valley. At least 13spiral arms can
be counted in the outer arms. At the very center of the figure a small midget
can be seen.
Figure 2. Spiralswith holes intheir centers. Each ofthe four sections inFig.2
isa Julia Set calculated from a region in Sea Horse Valley.
Figure 2a. A double spiral, somewhat like Fig. lb, but there isno connection
between the two halves.
Figure 2b. Avariation ofthe DDS with an empty region at the very center of
the pattern.
Figure 2c. Another variation of the DDS. The double spirals in the arms are
very small relative to the arms. Again, there isan empty region at the center
of the pattern.
Figure 2d. Another variation of the DDS. The double spirals at the ends of
each arm are larger relative to the spiral arms. But this time the spiral arm
pattern does not go through the center of the pattern.
Figure 3. Spirals of different types. Each of the four sections of Fig. 3 is from
Sea Horse Valley.
334 A. G. D. Philip
Figure 3a. A double spiral with a smaller, wellresolved spiral at its center.
Figure 3d. A very complex spiral object. At the center is a Quad spiral with
single spirals in one pair of arms and double spirals in the other pair of arms.
Figure 4. A Zoom series. This series is taken from Sea Horse Valley.
Figure 4a. A single spiral with a figure eightlike feature in its center.
Figure 4b. T h e very center of Fig. l a magnified 100 times. There are four sets
of arms, inside of which is a single spiral inside of which is a Q u a d Spiral.
Figure 4c. T h e Quad Spiral at the center of Fig. 4b, magnified 10 times. Each
of the four arms of the Quad end in single spirals. T h e center of Fig. 4c is
shown in Fig. 4d.
Figure 4d. A spiral with an empty center. There are two Quad spirals on each
side of the center; each Quad contains a replica of the whole picture. This
picture is a tenfold magnification of Fig. 4c.
R e f e r e n c e s
1. A. G. D. Philip and K. W. Philip, "The taming of the shrew", Amygdala 19
(1990) 16.
2. A.G. D.Philip, "An introduction totheMandelbrot Set", in CCDs in Astronomy,
Vol.II,eds.A. G. D.Philip, D.S.Hayes,and S.J. Adelman (L.DavisPress, 1990)
pp. 275286.
3. C. A. Pickover, Computers, Pattern, Chaos, and Beauty Graphics From an
Unseen World (St. Martin's Press, 1990).
4. A. G. D. Philip, "The evolution ofathreearmed spiral inthe Julia Set and higher
order spirals", in Spiral Symmetry, eds. I. Hargittai and C. A. Pickover (World
Scientific, 1992) pp. 135163.
335
la lb
lc ld
Figure 2.zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHG
Spirals with holes in their centers.
337
4a 4b
4c 4d
Described here are patterns showing tilings of the circle as a model of the
hyperbolic plane. Some ofM. C. Escher's famous wood cuts usesimilar tilings
but beautiful shapesinstead ofour chessboard pattern. Figure 1first appeared
in 1897 in [1].
From the mathematical point of view, these patterns are symmetric with
respect to some reflections. There are both reflections with respect to straight
lines and circles. Our figures can be obtained using these reflections in an
iterated function system with condensation.
All patterns presented here are generated by three reflections. For a given
starting point we calculate its images under these reflections and use these
points as new starting points. A point is drawn ifweapplied an even number
oftransformations countingfrom thestartingpoint. Thisprocedureisrepeated
for all original starting points of a given socalled fundamental region. This
region has the property that its images under iterated transformation willjust
fillthe whole circle.
The Algorithm
The following tree parsing algorithm computes orbits as far as it meets an
alreadydrawn point. Forallpointsofthefundamental region,dothe following:
Step 1. (Initialize). Set evenflag=TRUE and put the point ofthe fundamen
tal region and evenflag on the stack.
Step 2. (End?). Ifthestackisempty,theprocessingoftheconsidered starting
point is finished.
Step 3. (Next). Remove a point and its evenflag from the stack. If even
flag=TRUE then draw the point. Compute all of its images under
the considered reflections.
Step 4. (Test). For every image point check whether it is already drawn. If
not, put in and NOT (evenflag) on the stack.
Step 5. (Loop). Go to Step 2.
Last wepresent the data used to generate the figures.
339
340
Figure 1.
Figure 2. Figure 3.
Hyperbolic Tilings 341
Figure 1. Reflection w.r.t. the straight line through (0, 0) and (1, 0);
reflection w.r.t. the straight line through (0, 0) and (cos(7r/7), sin(7r/7)); re
flection w.r.t. the circleof radius 2*sin(7r/7) around (1,0). Asa fundamental
region, wetake a large black triangle near the center ofthe picture. It has the
angles (?r/2, 7r/3,7r/7).
Figure 2. Reflection w.r.t. the straight linethrough (0,0) and (1,1); reflection
w.r.t. the straight line through (0, 0) and (1,1);reflection w.r.t. the circle
of radius 1/SQR(2) around (1,0). As a fundamental region, we take a large
black triangle near the center of the picture. It has the angles (rr/2, 0, 0).
Figure 3. Reflection w.r.t. the circle of radius SQR(3)/2 around (1,0); reflec
tion w.r.t. the circle of radius SQR(3)/2 around (0.5, SQR(3)/2); reflection
w.r.t. the circle of radius SQR(3)/2 around (0.5, SQR(3)/2). As a funda
mental region, wetake the central triangle. It has the angles (0, 0, 0).
Reference
1. R.PrickeandF.Klein, VorlesungeniiberdieTheoriederAutomorphenFunktionen
I (Teubner, 1897).
Clifford A. Reiter
Products of Three Harmonics
342
343
Described here are patterns that evolve from a single "defect" in bounded,
onedimensional, cellular automata in which the number of cells in the row is
equal to the number of possible states, n.
Each cell's neighborhood consists oftwo adjacent cells,but the cellat each
end of the row lacks one neighbor. The state of each cell in generation g is
coded by an integer from 0to (n 1).
The state numbers are cyclic (0, 1,2 , . . .(n 1), 0, 1, 2,...) because the
state number of each cell in generation (g+ 1) is the sum, modulo n, of the
state numbers in that cell's neighborhood in generation g.
Each automaton thus generates successive rows of integers as in Pascal's
triangle, except that the rows are limited and the sums are modular.
Each cell is displayed on the computer's screen as a pixel with color
number = state number, modulo 16. The state numbers are printed with
zeros shown as blanks to enhance the Pascalian pattern.
Figures 1and 2showexamplesoftherepeating truncatedtriangle patterns
of the state numbers that evolve if and only if (at least in hundreds of tests)
the number ofcellsand states, n, isprime. Ifthe prime isofthe form (4a:1),
then generation 0recursevery2(n1)generations, asinFig. 1. Iftheprime is
ofthe form (4a;+1),then theperiod isstill2(n1) generations, but generation
0never recurs, as in Fig. 2. With any prime valueofn, the same pattern with
a period of 2(n 1) generations evolves from any value of the initial defect.
Figure 3shows the early stages ofthe an example ofthe deterioration into
patternless "debris" that occurs whenever the number of cells and states is
composite, and the defect in generation 0 is state 1. The periods, p, of such
automata alwaysexceed 2(n1)and havenoconsistent relationship to n. For
example, if n = 6, then p = 182; if n = 10,p = 48,422; ifn = 12,p = 1,638;
and if n = 20, p = 7,812. With certain values of the defect greater than 1,
the periods are not only shorter, but even predictable if the composite n is a
power of a prime.
Twodimensional analogs of these cellular automata behave similarly. If
the bounded grid issquare, with n cells on each side, n states, and the initial
defect in the center, then if and only ifn is prime:
311
Pascalian Cellular Automata 345
F i g u r e 2.zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA
Pascalian cellular automaton with 13 cells, 13 states, and defect = 1.
346
Pascalian cellular automaton with 15 cells, 155 states, and defect = 1. zyxwvuts
Figure 3.zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA
Franz G. Szabo
Inverse Mandelbrot Art Prints
X_Step=(Cx_MaxCx_Min)/Pixel_Horizontal
Y_Step=(Cy_MaxCy_Min)/Pixel_Vertical
347
348 F. G.Szabo
x=o
Y = 0
N=0
REPEAT
X_New=X*XY*Y+Cx_New
Y_New=2*X*Y+Cy_New
X=X_New
Y=Y_New
N = N + 1
UNTIL (N=Maxiter) OR ( ( X * X + Y * Y ) > 4 )
IF (N=Maxiter)OR (N MOD 2 < > 0 ) THEN DRAW (l,PixeLVerticalJ)
NEXT J
NEXT I
Reference
1. K.H. Becker and M. Dorfler, Dynamische Systeme und Fraktale (Friedr. Vieweg
&:Sohn Braunschweig, 1988).
4ft _
Described here are art prints which arecreated byusing the representation
of Barry Martin's sets of iteration ofreal numbers.
The algorithm in pseudocode lists as follows:
INPUT num
INPUTa.b.c
x=0
y=0
FOR i = l TO num
LOT(x,y)
x x = y S I G N ( x ) * ( A B S ( b * x c ) ) " ( l / 2 )
y y = a x
x=xx
y=yy
ENDFOR
350
351
Figure 1. Bioart 1.
Figure 2. Bioart 2.
352
Figure 3. Bioart 3.
Figure 4. Bioart 4.
Franz G. Szabo
Rotation
353
Mieczyslaw Szyszkowicz
Wallpaper from G C O N T O U R Procedure
at the point (A, B). 2 is the contour variable. The result of the function
mod(argumentl, argument2) istheremainder whenthe quotient of argumentl
divided by argument2 iscalculated. For example,
References
1. SASInstitute Inc., SAS/GRAPH Guidefor PersonalComputers,Version 6Edi
tion (SASInstitute Inc., 1987)p.534.
2. A.K. Dewdney, TheArmchair Universe(Macmillan, 1988).
351
355
z = A *A XOR B * B.
For the given initial point (A, B), z iscalculated from the above formula and
its value is displayed in this point. XOR means exclusive alternative. Here,
XOR is used to test bits of binary representation of A and B. This logical
operator isdefined as follows:
356
357
z modulo 2 is displayed.
Figure 1. XOR in the plane
$ = x2 +y2 + z2 R2 = 0.
z = f(x, y)
z = \JR2 x2 y2 .
358
359
360
361
362
363 zyxwvuts
Figure 1.zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIH
Squares which do not kiss.
364
Described here are patterns showing some new and interesting manifesta
tions of chaotic behavior arising from parametric equations dynamics of the
form
they represent the seed equations for iterations to generate the wellknown
Mandelbrot Set [1]of the complex dynamical function / :z = z2 +c,where z
and care complex variables.
In this paper, a new family ofobjects (called rectifs) willbedescribed that
uses the Eqs. (5) and (6):
The escape time algorithm [2]isused to generate these patterns. The area
in which the patterns are found in a square area is 2 < x < 2, 2 < y < 2.
This area isdivided into a grid of 1000 x 1000 points.
Iteration begins with the XQ = 2, yo = 2, as = 2, 65 = 2. The
values Xi and y\ are evaluated using Eqs. (5) and (6). The process is repeated
with each subsequent time using the output (xn, yn) as the input for the next
iteration to compute (xn+i, y n +i) The values (as, 65) are kept constant. The
365
366
Eucledian Geometry using IFS 367
References
1. B.B.Mandelbrot, TheFractal GeometryofNature(WHFreemanandCompany,
1982).
2. M.F. Barnsley, Fractals Everywhere(Academic Press,Inc.,1988).
3. C.Pickover, "Chaotic behavior ofthetranscendental mapping 2cosh(,z)+ uf,
The VisualComputer4 (1988) pp.243246.
David Walter
The Galactic Virus Attack
Z = 3 * Z3 - 3 * A 2 *Z +B ,
A=(C*C+l) /3*C ,
B +h A2 + (C - 2)/3 * C.
It is located at X min -1.230040437E - 0002
Xmax -1.229497048E - 0002
Ymin 2.647697323E + 0000
Ymax 2.647701398E + 0000.
The set was computed using software purchased from Sintar Software,
POBox 3746, Bellevue, WA 98009, USA. A 26Mz Beam Technology 286
computer with a color VGA screen was used to compute the set. The maxi-
mum iteration count was 2000.
The colored imag e was printed in black and white on a Hewlett Packard
(HP ) Deskjet Plus having a resolution of 300 dpi . This necessitated the
use of a spe cial GRAPHICS.COM and GRAPHICS .PRO supplied by HP in
Singapore, and which replace files of the same names supplied with DOS 4. The
command line: GRAPHICS DESKJET GRAPHICS.PRO/R enables SHIFT
PRINT SCRN to print the Graphics scre en on the Deskjet, which is a rel-
atively inexpensive, qui et , high resolution black and white printer. The / R
option enables revers e video , which of course causes white on the scre en to
print white.
368
369
*<#*
Wilfried Weber
Sound Ornaments
370
Sound Ornaments 371
R e f e r e n c e zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA
1. H. Courant,zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA
Methoden der Mathematischen Physik (Springer, 1968).
Aclose friend once sighed, "Hownice it would be,on cold winter evenings,
to have a cat blanket."
"What", I asked, "is a cat blanket?"
"It'sablanket ofcatsthat allcomeuponyour bed, hundreds ofcats. They
arrange themselves into ablanket, leaving nospacesbetween them. Then they
all go to sleep, purring through the night". She seemed to purr at the idea.
"What kind of cats?"
"All kinds. Black, white, calico, tabby, Abissynian, marmalade, patches,
gray, all kinds."
The ideawasclearly unworkable but not ifthecats werestuffed. That isto
say,not ifthe cats werefiberfilled cloth replicassewn into ablanket. Inspired,
I set about to design the blanket.
As I worked, I thought of Escher and Bach. (Godel is irrelevant here.)
A strict tesselation, like a strict fugue, involves a basic figure (graphical or
musical) that has to obey somany constraints in matching up with itself over
spaceortime,that thereisalmost noaesthetic freedom left. It isalmost certain
to be ugly. If we ignore the wonderful patterns that Escher and Bach have
made and study the constituent figures instead, wewill find a certain number
of uncomfortable angularities. Isolated, they are not particularly pleasant to
seeor hear.
But the freedom that cats in different sizes and different positions gave me
allowed for more natural elements. I am tempted to have the design stitched
intoablanket, each cat abasrelief inafabric that reflects itsfur. But perhaps
it would bewiser to haveareal artist redesign the blanket, someonewith more
than three hours to spend on the project.
375
Jean Larcher
Op Art 1
Reference
1. J. Larcher, OpArt Coloring Book(Dover, 1975).
376
Paulus Gerdes
Extension(s) of a Reconstructed Tamil
R i n g P a t t e r n
References
1. P.Gerdes, "Reconstruction and extension oflost symmetries:Examples from the
Tamil of South India", Computers and Mathematics with Applications 17, 46
(1989)791813.
2. J. Layard, "Labyrinth ritual inSouth India:Threshold and tattoo designs", Folk
Lore48 (1937) 115182.
377
378
These designs were created for the Leading Part Company of Osaka. De
signs in this series employ lines, circles, dots, squares, and ellipses. Some
patterns seem to recede and shimmer in the manner of "op" art. Hopefully,
designers and graphic artists will find these patterns of interest.
Reference
1. H.Ouchi, JapaneseOptical andGeometricArt (Dover,1977).
380
381
Joachim Frank
Greek Landscape A Visual Diary
References
1. J. Frank, W. Goldfarb, D. Eisenberg, and T. S. Baker, "Reconstruction of glu
taminesynthetase usingcomputer averaging", Ultramicroscopy3(1978)283290.
2. M.VanHeeland J. Prank, "Useofmultivariatestatistics inanalysingtheimages
ofbiological macromolecules", Ultramicroscopy 6 (1981) 187194.
382
383 zyxwvuts
Shown here are Persian wall tiles with metallic colors (from the 13th and
14thcenturies). Foramillennium, Iranian artistshaveattempted tostate their
feelings about the world in terms of harmonious and imaginative patterns,
every sketch and design being an implement for worship, and a reflection of
inner strength.
Reference
1. A.Dowlatshahi, PersianDesignsandMotifs (Dover, 1979).
384
385
Since the earliest times (of, for example, Aristophanes) the ultimate de
mand made by a man, dominant in a social group, for recognition by his
sycophants (the word itself being an obvious euphemism), has been "Kiss my
arse". Almost all European languages have equivalent expressions [1]. The
Gaelic version, "Pogue Mahone", iswidely known as it isused as the nameof
a British pop group.
Pictish/Celtic art ischaracterized bycomplicated interlaced designs deriv
ingfrom theformsofanimalsandrepresentstheextremeWesternendofaband
ofcommon styles extending geographically, via the Scythians, to Siberia. The
Picts themselves were tattooed with symmetric designs, rather than painted
as their name (given by the Romans) suggests. Such tattooed skin has been
recovered from tombsinthepermafrost oftheAltai. Thecharacteristic Pictish
talent for elaborate symmetric designs is seen here (in the figure) in a detail
from one of the stones (Meigle 26) from Meigle, Perthshire, Scotland [2]. It
datesfrom the 78th century AD.Thesymmetry iscombined withsharp social
comment on the Condorcet paradox ofvoting,where Acan quiterationally be
preferred to Band Bto C, but also Cto A.Niemiand Riker [4]have discussed
this paradox inthecontext ofCarter, Ford, and Reagan. Ontheir tombstones,
thePictshad anelaborate graphicsymbolismfor denotingsocialcategories[3].
The human swastika motif (of the figure) occurs on several Irish crosses
and in the Book of Kells [2],the latter being one ofthe masterpieces of Celtic
symmetric design. It isevident that the rotational symmetries oforders 2,3,4,
and 6 are by far the main ones used in Celtic and Pictish artifacts, although
10and 7areveryoccasionally to beseen [5]used rather unhappily. Sincemost
patterns in relief represent interlaced motifs, there are few true mirror planes,
but many designs have approximate mirror planes.
References
1. C.KunitskayaPeterson, InternationalDictionaryofObscenities (ScythianBooks,
1981).
2. S. Cruden, The Early Christian and Pictish Monuments of Scotland (HMSO,
1962).
386
Symmetric Celtic Sycophancy 387
Figure 1. Detail from a Pictish stone relief (Stone No. 26, Meigle, Perthshire). Reproduced
by courtesy of HMSO.
Erhard Schoen
Horoscope
Reference
1. E.Lehner, Symbols,Signs,andSignets(Dover,1969).
388
Carol B. Grafton
Bizarre and Ornamental Alphabets
In the past, decorative letters were used in books, serving as the initial
letters of paragraphs, chapters, and headings. Modern printers and designers
no longer make extensive use of decorative letters. Letters are now generally
employed to create specialeffects inadvertising or striking book cover designs.
Shown here is a sample from an unusual alphabet integrating human body
parts and architectural themes.
Reference
1. C.Grafton, Bizarreand OrnamentalAlphabets(Dover, 1981).
389
390
References
1. R. Shepard, MindSights (Freeman, 1991).
2. D.Hofstadter, Godel,Escher,Bach (Klett, 1985).
3. E. Gombrich, Kunst undIllusion (Belzer, 1986).
4. K.Boff,L.Kaufman and J. Thomas, HandbookofPerceptionandHumanPerfor
mance,Vols. 1and 2(Wiley, 1986).
5. G. Cagliotti, Symmetriebrechnungund Wahrnehmung(Vieweg, 1990).
6. P. Hettich, "The future of ambiguous art", in Visions of the Future,ed. C. A.
Pickover (St. Martin's Press,1992).
391
392
Figure 3 . Hans ( 1991; 60" x 84") . Figure 4. Yellow nud e ( 1990 ; 75" x 110") .
W. and G. Audsley
Japanese Diaper Ornaments
Reference
1. W. Audsley and G. Audsley, Designs and Patterns from Historic Ornament
(Dover,1968).
394
395
Harold J. McWhinnie
Satanic Flowers
396
397
George Bain
How to Create Celtic Anthropomorphic
Ornaments (BeardPullers)
Reference
1. G.Bain, CelticArt: TheMethodsofConstruction(Dover, 1973).
398
399
Hu ma n M ole Fi ure s in Orn a ment from St one at Clan macnois e,an d Boo k of Ke l ls
( r-o v.. at Clol'lmocnQ;se. Irll!.lo"d .
a r"l,bi"q
1\"._ . ._ . . .
.. r7]
r
i
L: __ _..
_.j_ ._......._.__... l.._. .. j_._._..__ .J
5toqfi I
Pla te 14 .
Stephan Kreuzer
Clowns
Reference
1. M.C.Escher, RegelmatigeVlakverdeling (DeRoos,1958).
400
401
Figure 1. Clowns.
F i g u r e 2. A single element Figure 3a. The first Figure 3b. The final form
of the pattern. step of the construction. and the original hexagon.
George Bain
Celtic Plants Emerging from Pots
Reference
1. G. Bain, CelticArt: TheMethodsofConstruction (Dover, 1973).
Plate W
402
Yuzo Nakano
Interactive Patterns Between
Light and Matter
403
404
405
406 Y. Nakano
Art Deco, with its bold color schemes and strong geometrical patterning,
hasrecently been rediscovered with tremendous impact, and isofmajor impor
tance to designers today. Art Deco is the name now generally applied to the
most typical artistic production ofthe 1920sand 1930s. This namecomes from
the large exhibition held in Paris in 1925,called the Exposition Internationale
des Arts Decoratifs et Industriels Modernes. The art ofthese years had many
sources, including turnofthecentury art nouveau and such archeological
interests of the day as ancient Egyptian and Mayan Art.
Reference
1. M.Loeb, Art Deco DesignsandMotifs (Dover,1972).
407
408
4U9
410
411
412
Turtle Moon
Glossary
Abacus
Instrument for performing calculations by sliding beads along rods or grooves.
Abscissa
The horizontal coordinate of a point in a plane rectangular coordinate system
(the x axis).
Acoustics
The study of sound.
Afflne transformation
Loosely speaking, an affine transformation acts by shrinking, enlarging, shift
ing, rotating, or skewing an original pattern, set of points, or object.
Algebraic function
A function containing or using only algebraic symbols and operations such as
2x+ x2 + y/2.
Algebraic operations
Operations of addition, subtraction, multiplication, division, extraction of
roots, and raising to integral or fractional powers.
Amino acid
Basic building block of proteins.
Analogtodigital converter
Electronic device that transforms continuous signals into signals with discrete
values.
Analytic function
Ananalytic function isdifferentiable throughout aneighborhood ofeach point.
413
414 Glossary
Angstrom
A unit of measure corresponding to one tenbillionth of a meter.
Articulation
Movements of the vocal tract to produce speech sounds.
Attractor
Predictable attractors correspond to the behavior to which a system settles
down or is "attracted" (for example, a point or a looping closed cycle). The
structure oftheseattractors issimpleandwellunderstood. Astrange attractor
is represented by an unpredictable trajectory, where a minute difference in
starting positions of two initially adjacent points leads to totally uncorrelated
positions later intimeor inthemathematical iteration. The structure of these
attractors isvery complicated and often not well understood.
Autocorrelation
Fortheacousticapplications inthisbook, theautocorrelation function for data
describes the general dependance ofthe values ofthe data at one time on the
values at another time.
Autonomous
The behavior of an autonomous dynamical system is expressed by an equa
tion which is independent of time. If a timedependent term is added, this
represents an "external influence" which drives the system away from this
equilibrium, for example, by adding or subtracting energy. Systems with a
timedependent term are nonautonomous (an unsteady fluid flow is such a
system).
Bifurcation
Any value of a parameter at which the number and/or stability of steady
states and cycles changes is called a bifurcation point, and the system is said
to undergo a bifurcation.
Glossary 415
Bilateral symmetry
The property ofhaving two similar sides. Each side isa "mirror image" of the
other.
Binomial coefficients
The coefficients in the expansion of (x +y)n. For example, (x + y)2 = x2 +
2xy +y2 so that the binomial coefficients oforder 2are 1,2, and 1.
Catenary
The curve assumed by a uniform, flexible chain hanging freely from its ends.
Its equation is f(z) = cosh(z) = (e2 + e~ 2 )/2.
Cellular automata
Aclassofsimplemathematical systemsthat arebecomingimportant asmodels
for avariety ofphysical processes. Although therulesgoverningthecreationof
cellular automata are simple, the patterns they produce are complicated and
sometimes seem almost random, like a turbulent fluid flow or the output of
a cryptographic system. Cellular automata are characterized by the fact that
they act on a discrete space or grid as opposed to a continuous medium.
Center
See limit and fixed point.
Chaos
Irregular behavior displayingsensitivedependence oninitialconditions. Chaos
has been referred to by some physicists asthe seemingly paradoxical combina
tion of randomness and structure in certain nonperiodic solutions of dynami
cal systems. Chaotic behavior can sometimes be defined by a simple formula.
Someresearchers believethat chaostheoryoffers amathematical framework for
understanding much of the noise and turbulence that is seen in experimental
science.
Chaotic trajectory
A chaotic trajectory exhibits three features:
(1) the trajectory, or motion, stays within a bounded region it does not get
larger and larger without limit, (2) the trajectory never settles into a periodic
pattern, (3) the motion exhibits a sensitivity to initial conditions. See also
Chaos.
416 Glossary
Cilia
Minute hairlike projections.
Complex number
Anumber containing a real and imaginary part, and of the form a+biwhere
i = v / z T.
Converge
To draw near to. Avariable issometimes said to converge to its limit.
Cycle
The cycledescribes predictable periodic motions, likecircular orbits. In phase
plane portraits, the behavior often appears as smooth, closed curves.
Damp
Todiminish progressively in amplitude of oscillation.
Differential equations
Equations often of the form dxi/dt = fi(x) where Xi(t) represents the ith
variable and the function fi(x) gives the time, or spatial, evolution of Xi(t).
Mathematical models in the physical and biological sciences are often formu
lated as differential equations.
Disulfide bond
A strong sulfurtosulfur chemical bond that may crosslink two sections of a
folded polymer or protein.
Glossary 417
Dynamical systems
Models containing the rules describing the way a given quantity undergoes a
change through time or iteration steps. For example, the motion of planets
about the sun can be modeled as a dynamical system in which the planets
move according to Newton's laws. A discrete dynamical system can be repre
sented mathematically as xt+i = f(xt). A continuous dynamical system can
be expressed as dx/dt = f(x, t).
Feedback
The return to the input of a part of the output of a system.
Fibonacci sequence
The sequence 1, 1,2,3,5,8, 1 3 , . . . ,(Fn = Fn_2 +Fni), whichgoverns many
patterns in the plant world. Each term isthe sum of the last two.
Fixed point
Apoint whichisinvariant under amapping (i.e.,Xt= xt+\ fordiscretesystems,
or x = f(x) for continuous systems). A particular kind of fixed point is a
center. For acenter, nearby trajectories neither approach nor diverge from the
fixed point. In contrast to the center, for a hyperbolicfixed point, some nearby
trajectories approach and somediverge from the fixed point. A saddle point is
an example of a hyperbolic fixed point. An unstable fixed point (or repulsive
fixed point or repelling fixed point) x of a function occurs when f'{x) > 0.
A stable fixed point (or attractive fixed point) x of a function occurs when
f'(x) < 0. For cases where f'(x) = 0higher derivatives need to be considered.
Folium of Descartes
A plane curve represented in rectangular coordinates by x3 +y3 = 3axy.
418 Glossary
Fourier analysis
The separation of a complex wave into its sinusoidal components.
Fractals
Objects (or sets of points, or curves, or patterns) which exhibit increasing
detail ("bumpiness") with increasing magnification. Many interesting fractals
are selfsimilar. B. Mandelbrot informally defines fractals as "shapes that are
equally complex in their details as in their overall form. That is, if a piece
of a fractal is suitably magnified to become of the same size as the whole, it
should look like the whole, either exactly, or perhaps only after slight limited
deformation."
Gasket
A piece of material from which sections have been removed. Mathematical
gaskets, such as Sierpinski gaskets, can be generated by removing sections
of a region according to some rule. Usually the process of removal leaves
pieces which are similar to the initial region, thus the gasket may be defined
recursively.
Invariant curve
Generalization ofafixed point to aline (inthis case, a curve isinvariant under
the map or flow).
Helix
A space curve lying on a cylinder (or sphere, or cone) which maintains a
constant distance from a central line (i.e. a "spiral extended in space").
Henon map
The Henon map defines the point (xn+i, yn+i) by the equations xn+i = 1.4 +
Glossaru 419
O.3Yn - Yn+l = Xn. Note that there are various expressions for the Henon
map, including xn+l = 1 + Yn - Yn+l = j3x n.
Homeomorphism
This is best explained by an example. Consider a circle inside a square. Draw
a line from the circle's center out through the circle and square. The line
intersects the circle at point P and the square at P'. The mapping g : P --+ P'
assigns to each point of the circle a point of the square and vice versa. In
addition, two adjacent points on one shape are mapped to two adjacent points
of the other. The mapping g is a homeomorphism. The circle and triangle are
homeomorphic.
Iteration
Repetition of an operation or set of operations. In mathematics, composing
a function with itself, such as in f(f(x)), can represent an iteration. The
computational process of determining Xi+l given Xi is called an iteration.
Julia set
Set of all points which do not converge to a fixed point or finite attracting orbit
under repeated applications of the map. Most Julia sets are fractals, displaying
an endless cascade of repeated detail. An alternate definition: repeated appli-
cations of a function f determine a trajectory of successive locations X, f(x),
f(f(x)), f(f(f(x))) , .. . , visited by a starting point X in the complex plane.
Depending on the starting point, this results in two types of trajectories, those
which go to infinity and those which remain bounded by a fixed radius. The
Julia set of the function f is the boundary curve which separates these regions.
Limit
In general, the ultimate value towards which a variable tends.
Linear transformation
A relation where the output is directly proportional to the input. A function
satisfying two conditions: (1) F(ji + fj) = F(iJ) + F(fj) and (2) F(riJ) = rF(iJ).
Logistic equation
The nonlinear equation x n+ 1 = kX n (1 - x n) is called the logistic equation, and
it has been used in ecology as a model for predicting population growth.
420 Glossary
LotkaVolterra equations
The Hamiltonian system defined by (dx/dt = ax bxy, dy/dt = cy+ dxy),
which was one of the first predatorprey equations which predicted cylic vari
ations in population.
Lorenz attractor
x= lOx+ lOy, y = 40x y xz, z = 8z/3+ xy.
Initially the system starts anywhere in the threedimensional phase space, but
as transients die away, the system is attracted onto a twolobed surface. For
a more general formulation, the Lorenz equations are sometimes written with
variable coefficients.
Lyapunov exponent
Aquantity, sometimes represented bythe Greek letter, A,used to characterize
the divergenceoftrajectories inachaotic flow. For aonedimensional formula,
N
such as the logistic equation, A= lim \/N Y) In \dxn+\/dxn\.
N
^ 71=1
Mandelbrot set
For each complex number fj,let / M (z) denote the polynomial x2 + fjt. The
Mandelbrot set isdefined as the set ofvaluesof\ifor which successive iterates
of 0 under /M do not converge to infinity. An alternate definition: the set
of complex numbers /i for which the Julia set of the iterated mapping z
z2 +/i separates disjoint regionsofattraction. When /xliesoutside thisset, the
corresponding Juliasetisfragmented. Theterm "Mandelbrot Set" isoriginally
associated with this quadratic formula, although the same construction gives
risetoa (generalized) Mandelbrot Set for any iterated function with a complex
parameter.
Markov process
A stochastic process in which the "future" isdetermined by the "present".
Manifold
Curve or surface. The classical attractors are manifolds (they are smooth).
Strange attractors are not manifolds (they are rough and fractal).
Newton's method
Amethod ofapproximating rootsofequations. Supposetheequation isf(x) =
Glossary 421
Nonlinear equation
Equations where the output is not directly proportional to the input. Equa
tions which describe the behavior of most realworld problems. The response
of a nonlinear system can depend crucially upon initial conditions.
Perfect n u m b e r s
An integer which isthe sum of all its divisors excluding itself. For example, 6
is a perfect number since 6 = 1 + 2 + 3.
Period
The time taken for one cycle of vibration of a wave.
Periodic
Recurring at equal intervals of time.
Phase portrait
Theoverallpictureformed byallpossibleinitialconditionsinthe(x, x) planeis
referred to as the phase portrait. Consider a pendulum's motion which comes
to rest due to air resistance. In the abstract twodimensional phase space
(with coordinates x, the displacement, and x the velocity) motions appear as
noncrossing spirals converging asymptotically towards the resting, fixed state.
This focus iscalled apoint attractor which attracts all localtransient motions.
Plosive
A type of consonant sound made by sudden release of air impounded behind
an occlusion of the vocal tract.
Poincare map
APoincare map isestablished bycutting trajectories inaregionofphase space
with a surface one dimension less than the dimension of the phase space.
Polynomial
An algebraic expression of the form a0xn +a\xn~x + ...an_\x + o where n
is the degree of the expression and ao^ 0.
422 Glossary
Quasiperiodicity
Informally defined as a phenomenon with multiple periodicity. One example
is the astronomical position of a point on the surface of the earth, since it
results from the rotation of the earth about its axis and the rotation of the
earth around the sun.
Quadratic mapping
Also known as the logistic map, this famous discrete dynamical system isde
fined by xt+i = cxt(l xt).
Quaternion
Afourdimensional, "hyper" complex number ofthe form Q = ao+a\i +a^j +
a3k.
Rational function
A function which can be expressed as the quotient of two polynomials.
Recursive
Anobject issaid to berecursive ifit partially consists ofor isdefined in terms
of itself. A recursive operation invokes itself as an intermediate operation.
Sierpinski gasket
See gasket.
Steady state
Alsocalled equilibrium point or fixed point. A set of values of the variablesof
a system for which the system does not change as time proceeds.
Strange attractor
See attractor.
Tesselation
A division of a plane into polygons, regular or irregular.
Trajectory
A sequence of points in which each point produces its successor according to
some mathematical function.
Glossary 423
Transfinite number
An infinite cardinal or ordinal number. The smallest transfinite number is
called "alephnought" (written as No) which counts the number of integers.
Tractrix
Aplane curve represented in parametric equations byx a(lncot0/2cos0),
y= a s i n 0 .
Transcendental functions
Functions which are not algebraic, for example, circular, exponential, and log
arithmic functions.
Transformation
The operation of changing (as by rotation or mapping) one configuration or
expression into another in accordance with a mathematical rule.
Witch of Agnesi
A plane curve represented in rectangular coordinates by y = 8a3j(x2 +4a 2 ).
This page is intentionally left blank
Index
425
426 Index
iteration 5763, 99, 103, 104, 106, plants 12, 14,24, 28,70
112, 116, 124, 128,201,299 prime numbers 42, 55, 256, 315
proteins 6
Jcurve 57
Japanese diaper ornaments 394 quilts 235
Jungle Canopy 295
RNA 42
Koch curve 70
rootfinding 106, 114, 122
Lsystems 132,235
lattice 52,93, 176 sealillies 38
leaf veins 116 selfaffinity 299
Lissajous patterns 183193 Serpents and Dragons 225
lizards 176 Sierpinski carpet 135
Sierpinski gaskets 269, 274
Logistic map 118, 120, 203,302
solar vortices 3
magic square 307 sound ornaments 370
magic tessaract 72 space flowers 178
Mandelbrot set 99, 166175,208, Spidermorphs 151
215, 231,295,322, 331,347 spirals 4, 28
matrices 285 spiral waves 4
moires 26 Starry Night 126
mosaics 108,322 stars 66, 194, 251
music 18,36, 370 star trails 99
stone wall 32
neural nets 18 swirls 197
Nevada sets 233 Symmetrized dotpatterns 144
Newton's method 106, 114, 122
nucleons 22 Tamil patterns 377
tan 128
octahedral fractal 273 tangents 93
tessaract 72
particle physics 22 tesselations 317, 375
Penrose tiles 66, 278,304 texture 32
perception 317320 tiling 52,66, 87, 93, 108, 176,178,
Persian designs 384 194, 268, 276, 278,297,304,317,
phyllotaxy 14,28 322, 339, 400
planetary vortices 3 trees 12
Index 427