Anda di halaman 1dari 15

INSIDEN ofHPV Infeksi pada sel oralSquamouS

carcInomaand ItSaSSocIatIon Dengan hadirnya P53 &


c-myc Mutasi:
acaSe controlStudyIn Muwardi HoSPItalSurakarta

Translated version of 44-164-1-PB (1).pdf


Page 1
INA J Dent RES, Vol. 17 No.2 September 2010: 48-52
Pendahuluan: tingkat insiden tahunan untuk kanker mulut dan faring diperkirakan
mencapai 25 kasus per 100.000 dalam mengembangkan
negara. Human papilloma virus (HPV) yang terlibat dalam patogenesis kanker. Mutasi
dari p53 dan c-myc
ditemukan 50% pada kanker obyektif:. Tujuan dari penelitian ini adalah untuk
mengetahui kejadian OSSC pasien yang menyadari
Infeksi HPV tanpa p53 dan c-myc mutasi gen bahan dan metode:. Biopsi jaringan
bagian beku yang
diambil dari Bosc (jinak Oral sel skuamosa) dan OSCC (Karsinoma sel skuamosa
oral) pasien dikumpulkan dari
Oral dan Gigi Departemen dr Muwardi Hospital Distric di Surakarta dari Januari 2007
sampai Januari 2008. Untuk
memperkuat gen L1-HPV untuk tetap stressor HPV. Untuk memperkuat p53 dan c-
myc gen, dilanjutkan dengan SSCP (Single
Strand konformasi Polymorphisme) analisis dan diikuti dengan pengukuran
menggunakan densitometer, untuk melihat mutasi
eksistensi. Data yang terkumpul dianalisis dengan Chi Square, hasil:. Bosc pasien
diidentifikasi 23% dengan infeksi HPV
dan OSCC pasien diidentifikasi 73% dengan infeksi HPV. Seratus persen pasien Bosc
dengan infeksi HPV tanpa
mutasi pada gen p53 dan gen c-myc, pasien OSCC 81% dengan infeksi HPV tanpa
mutasi pada gen p53 dan 91%
Pasien OSCC dengan infeksi HPV tanpa mutasi pada gen c-myc. Analisis Chi Square
menunjukkan perbedaan yang signifikan
antara Bosc dan OSCC pasien dengan infeksi HPV tanpa mutasi p53 dan gen c-
myc kesimpulan:. HPV adalah
faktor untuk patogenesis OSCC.
abstrak
PENDAHULUAN: insidensi Infeksi HPV PADA karsinoma skuamosa Sel lisan
Dan Hubungannya Artikel Baru Mutasi
p53 dan c-myc:. PENELITIAN kasus terangkan PADA Rumah Sakit
Muwardi Rata-rata Angka Kejadian Kanker Rongga
Mulut Dan pharyng di Negara Berkembang per Tahun diperkirakan PADA Kisaran 25
kasus per 100.000 penduduk. SAAT
Suami patogenesis Kanker telah diketahui berhubungan Artikel Baru virus Human
papilloma (HPV) Catatan berbaring Mutasi bahwa.
PADA gena p53 dan c-myc PADA ditemukan 50% Bahasa Dari seluruh Kejadian
Kanker tujuan:. Tujuan PENELITIAN Suami adalah
untuk mengetahui Kejadian pasien Kanker Sel Skuamous Rongga Mulut (KSSRM)
Artikel Baru infeksi HPV Tanpa Mutasi
. gena p53 dan c-myc Bahan Dan Cara: Jaringan biopsi bagian beku DARI pasien
Sel Skuamous Rongga Mulut Jinak
(SSRMJ) Dan Kanker Sel Skuamous Rongga Mulut (KSSRM) Yang dikumpulkan
Bahasa Dari Bagian tidak Penyakit Gigi Dan Mulut
RSUD dr Muwardi Surakarta MULAI Januari 2007 hingga Januari 2008. Amplifikasi
gena l1-HPV mengetahui untuk
keberadaan stressor HPV. Amplifikasi gena-gena p53 dan c-myc, dilanjutkan
Analisis Tunggal Strand Comformational
polymorphisme (SSCP) Dan diikuti pengukuran menggunakan densitometer untuk
melihat keberadaan Mutasi. Data
. Yang terkumpul dianalisa menggunakan Uji Chi Square, Hasil: Pasien SSRMJ
teridentifikasi 23% terinfeksi HPV Dan
pasien KSSRM teridentifikasi 73% terinfeksi HPV. Seratus persen khususnya pasien
SSRMJ Yang terinfeksi HPV tercatat Tanpa
Mutasi PADA gena p53 dan c-myc, 81% pasien terinfeksi HPV KSSRM Yang tercatat
Tanpa Mutasi gena p53 Dan 91%
pasien terinfeksi HPV KSSRM Yang tercatat Tanpa Mutasi gena c-myc. Analisis
RAHIM, IRWAN Chi Square, menunjukkan perbedaan
Yang signifikan ANTARA pasien SSRMJ Dan KSSRM PADA infeksi HPV Tanpa
Mutasi gena p53 dan c-myc menipis.:
HPV merupakan Faktor untuk Kejadian KSSRM.
Kata kunci: Negara-negara berkembang; HPV, patogenesis; OSCC
48
INDONESIA JURNAL DENTISTRY.indd 48
22/06/2012 01:33:54

Page 2
49
INA J Dent RES, Vol. 17 No.2 September 2010: 48-52
Pengantar
Update peneliti menemukan bahwa kanker secara luas dianggap
sebagai sekelompok heterogen gangguan dengan berbeda
sifat biologis, disebabkan oleh serangkaian klonal
perubahan genetik yang dipilih dalam gen supresor tumor dan
onkogen.
1,2
Namun, data terakhir menunjukkan bahwa kanker
memiliki dasar umum yang didasarkan pada sebuah poliklonal
gangguan epigenetik sel progenitor, dimediasi oleh
gen tumor-progenitor. Heterogenitas sel Tumor adalah
sebagian karena variasi epigenetik dalam sel progenitor
dan plastisitas epigenetik bersama-sama dengan lesi genetik
mendorong perkembangan tumor. Peran awal ini penting untuk
perubahan epigenetik pada kanker ini selain epigenetik
perubahan yang dapat menggantikan variasi genetik kemudian
dalam perkembangan tumor.
2,3
Oleh karena itu, non-neoplastik tetapi
epigenetically terganggu mungkin menjadi sasaran penting bagi
manajemen risiko kanker.
Causeofcancercandivideintotwogroups: lingkungan
penyebab dan penyebab genetik keturunan. Kanker terutama
penyakit lingkungan, meskipun genetika mempengaruhi
risiko beberapa jenis kanker. Faktor lingkungan meliputi:
polusi lingkungan, diet dan obesitas, tembakau,
infeksi, radiasi, dan kurangnya aktivitas fisik. Ini
faktor lingkungan menyebabkan atau meningkatkan kelainan
dalam genetik sel.
3
Prevalensi kanker mulut
adalah peningkatan di Afrika. Tingkat insiden tahunan untuk oral
dan kanker faring berada pada 25 kasus per 100.000 di
negara-negara berkembang. Urbanisasi dan meningkatkan
akses ke, dan penggunaan tembakau dalam berbagai bentuk
serta alkohol, adalah peningkatan kejadian
kanker mulut.
4
Epidemiologi kanker oral squamous
sel merupakan 90% dari tumor rongga mulut, kejadian
itu meningkat dengan usia (mewakili 3% dari kanker pada pria
dan 2% dari kanker pada wanita).
5
Faktor yang terlibat sebagai
ayam potensial dan atau kanker promotor adalah tembakau,
alkohol, radiasi matahari terbit, radiasi ionisasi,
karsinogen yang terkait pekerjaan, polutan lingkungan,
obat-obatan, nutrisi dan agen infeksi. Lain
stressor adalah hidup di desa, faktor sosial-ekonomi, usia,
jenis kelamin dan respon mekanisme kekebalan tubuh. Diikuti
Faktor adalah penyakit periodontal kronis, tempat tidur kebersihan mulut,
penyakit gigi, tajam set gigi, electrogalvanism
dan edentulism. Peneliti lain menemukan bahwa manusia
papilloma virus (HPV), terlibat dalam Oral skuamosa
Karsinoma sel (OSCC) patogenesis.
3,6,7
Oleh karena itu,
jika patogenesis OSCC tidak bisa dijelaskan sehingga
morbiditas dan mortalitas dapat meningkat dan menyebabkan penurunan
sumber daya manusia.
Peran HPV, ekspresi E6 dan E7 protein virus,
ekspresi p53 dan c-myc protein host dapat menjelaskan
dengan pemeriksaan Pathobiology
8,9
dalam persepsi sel dan
Konsep respon sel. Pengikatan protein E6 dari
HPV dengan protein p53 menyebabkan penurunan apoptosis tersebut.
Sisi lain yang mengikat protein E7 dengan protein pRb
memimpin untuk mengaktifkan ekspresi protein c-myc jadi dampak
dalam menurunkan proliferasi. Mutasi dari p53 dan
c-myc tidak ditemukan.
10,11,12
Konsep ini memberi kesempatan
untuk menjelaskan OSCC meningkat.
Dalam penyakit HPV risiko tinggi infeksi menjelaskan
genom virus terintegrasi ke dalam genom inang yang
acara yang diperlukan untuk keabadian keratinosit.
Selama proses ini integrasi bentuk melingkar
genom virus istirahat di tingkat E1 dan E2 daerah.
Studi yang berbeda telah menunjukkan bahwa bagian terpadu dari
genom sesuai dengan E1, E6 dan E7. Hilangnya E2
selama proses ini integrasi menghasilkan hilangnya E6
dan kontrol E7. Oleh karena itu, urutan E6 dan E7 adalah
terlibat langsung dalam siklus sel dengan menghambat
fungsi normal p53 dan pRb. P53 dapat memprovokasi
penangkapan divisi seluler dan menjamin waktu yang diperlukan
untuk perbaikan DNA. Jika kerusakan tidak dapat diperbaiki, p53 mampu
untuk menginduksi apoptosis dan mencegah penyebaran
Kerusakan DNA pada generasi berikutnya sel. Dalam
kasus jenis lain dari tumor, p53 biasanya bermutasi dan
bertindak sebagai onkogen nyata. Dalam kasus infeksi HPV, E6
suppressesthepropertiesofp53geneproductachievingthe
setara fungsional dari dua hits yang diperlukan untuk melumpuhkan
kedua alel dari mutasi tumor supresor gene.The dari
p53 biasanya tidak ditemukan. The E7 protein berinteraksi dengan
protein retinoblastoma (pRb), yang merupakan faktor penting
untuk kontrol siklus sel. Interaksi ini menyebabkan
rilis dari transkripsi faktor E2F, yang sekarang bebas
untuk bertindak dan dapat merangsang pembelahan sel. E6 dan E7
dapat bekerja sama dengan oncoproteins seluler seperti ras dan myc
yang memungkinkan virus untuk bertindak pada tingkat faktor pertumbuhan
dan metabolisme sel dan nuklir memproduksi onkogenik
sel. E6 dan E7 dapat memprovokasi langsung mutasi DNA
sel inang. Ini berarti bahwa beberapa jenis HPV yang
mampu menyebabkan lesi ganas bahkan tanpa tindakan
kofaktor lainnya.
13
bahan dan metode
Empat puluh bagian beku Bosc jaringan dan fiveteen beku
pasien jaringan bagian OSCC yang dikumpulkan dari Oral dan
Gigi Klinik dr Muwardi Hospital Distric di Surakarta
dari Januari 2007 sampai Januari 2008. Blok Parrafin yang
terbuat dari pemotongan I, yang kemudian noda
dengan Haematoxyline Eosine (HE) untuk memastikan jenis
neoplasma.
Cutting II menjadi sasaran Asam deoksiribonukleat
(DNA) isolasi dibuat dengan metode Henk Schmits dengan
beberapa modifikasi. Potong hingga 25 mgr jaringan menjadi kecil
potongan, tempatkan dalam 1,5 ml volume tabung microfuge, dan menambahkan
200 ul dari DNAextraction penyangga. Tambahkan 20 ul dari Proteinase
INDONESIA JURNAL DENTISTRY.indd 49
22/06/2012 01:33:54

Page 3
INA J Dent RES, Vol. 17 No.2 September 2010: 48-52
50
K larutan stok, mix oleh vortexing, dan inkubasi pada 55
0
C semalam.
14
Hasil isolasi DNA menjadi sasaran Polymerase
Chains Reaction (PCR) untuk memperkuat L1-HPV untuk tetap
Stressor HPV. Infeksi HPV mendiagnosa terkait dibuat
oleh Henk Schmits dan / atau Nigel McMillan dan Nina Fowler
PCR-metode dengan beberapa modifikasi.
14,15
Dua puluh lima
microfuge tabung ml Ready To Go PCR Bead (Amersham
Pharmacia Biotech) dicampur dengan 2 ml HPV konsensus
primer (MY09: 5'GC
(A / C)
CAGGG
(A / T)
CATAA
(C / T)
AATGC3 '
dan MY11: 5'CGTCC
(A / C)
A
(A / G) (A / G)
GGA
(A / T)
ACTATC3 ')
(CYBERGENEAB) and2lDNAtemplate.PCRprotocol
untuk kedua amplifikasi adalah 94
0
C selama 50 detik, 59
0
C
selama 50 detik, 72
0
C selama 50 detik dan 4
0
C rendam. Itu
Amplifikasi HPV-L-1 gen menghasilkan 450 bp lama.
Hasil isolasi DNA lainnya menjadi sasaran Polymerase
Chains Reaction (PCR) untuk memperkuat p53 dan gen c-myc dan
terus Tunggal Strand konformasi Polimorfisme
(SSCP) analisis dan diikuti dengan pengukuran menggunakan
densitometer untuk melihat keberadaan mutasi. Untuk memperkuat p53
dan c-myc yang dibuat oleh Henk Schmits dan / atau Nigel McMillan
andNinaFowlerPCR-methodwithsomemodifications.
14,15
Dua puluh lima ml microfuge tabung Siap Untuk Pergi PCR Bead
(AmershamPharmaciaBiotech) mixedwith2l p53primer
(Forward primer 5'TATCCTGAGTAGTGGTAATC3 'dan
mundur primer 3'AAGTGAATCTGAGGCATAAC ')
(Cybergene AB) dan 2 ml sampel DNA (template).
Sisi lain duapuluh lima tabung microfuge ml Ready
To Go PCR Bead (Amersham Pharmacia Biotech)
dicampur dengan 2 ml c-myc primer (forward primer
5'CCGTCCCTGGCTCCCCTCCTG3 'dan mundur
3'GTATCGTCGCCCGCCCGTTGAAAC5 primer ')
(Cybergene AB) dan 2 ml sampel DNA (template). PCR
protokol untuk kedua amplifikasi adalah 94
0
C selama 50 detik,
59
0
C selama 50 detik, 72
0
C selama 50 detik dan 4
0
C rendam.
TheAmplification gen p53 diproduksi 216 bp dan c-myc
gen menghasilkan 347 bp. Strand tunggal konformasi
Polimorfisme (SSCP) analysisfollowedwithmeasurement
menggunakan densitometer (Shimadzu CS 930, Dual Gelombang Panjang
Cromato Scanner) untuk melihat keberadaan mutasi.
Hasil
Hasil penelitian ini menunjukkan bahwa sembilan pasien dari
40 Bosc pasien diidentifikasi memiliki infeksi HPV (9/40 =
23%). Sebelas pasien dari 15 pasien OSCC diidentifikasi
memiliki infeksi HPV (15/11 = 73%) (Gambar 1)
Angka 1 Polymerase Chains Reaction (PCR) L1 -. HPV
gen, diperkuat 450 bp panjang.
Hasil lain dari penelitian ini menunjukkan bahwa sembilan pasien
tanpa mutasi pada gen p53 (9/9 = 100%) dan 9 pasien
tanpa mutasi pada gen c-myc (9/9 = 100%) setelah
Analisis SSCP yang mengkonfirmasi dengan densitometer terhadap sembilan
Bosc pasien dengan infeksi HPV. Sisi lain, sembilan
pasien tanpa mutasi pada gen p53 (9/11 = 81%) dan
10 pasien tanpa mutasi pada gen c-myc (10/11 = 91%)
setelah SSCPanalysis yang konfirmasikan dengan densitometer terhadap
sebelas OSCC pasien dengan infeksi HPV (Gambar 2A, 2B,
2C dan Gambar 3A, 3B, 3C)
Angka 2a. Polymerase Chains Reaction (PCR) dari p53
gen, diperkuat 216 bp panjang.
Angka 2B. Tunggal Strand konformasi Polimorfisme
(SSCP) Analisis gen p53
Pengukuran angka 2c. menggunakan densitometri untuk melihat
mutasi keberadaan dari Strand konformasi
Polimorfisme (SSCP) Analisis gen p53 (memiliki 2
pick - panah)
Angka 3a Polymerase Chains Reaction. (PCR) c-myc
gen, diperkuat 347 bp panjang.
Angka 3B. Tunggal Strand konformasi Polimorfisme
(SSCP) Analisis gen c-myc
INDONESIA JURNAL DENTISTRY.indd 50
22/06/2012 01:33:54

Page 4
51
INA J Dent RES, Vol. 17 No.2 September 2010: 48-52
Pengukuran Angka 3c. menggunakan densitometri untuk
melihat adanya mutasi dari Strand konformasi
Polimorfisme (SSCP) Analisis gen c-myc (memiliki 2
pick - panah).
Chi Square, menganalisis menunjukkan memiliki perbedaan yang signifikan
antara Bosc dan OSCC pasien dengan infeksi HPV
tanpa mutasi p53 dan gen c-myc (Tabel 1, 2, 3, 4)
Tabel 1. Hasil percobaan dalam tabel 2X2 p53
protein.
tidak
mutasi p53
ya
mutasi
p53
total
OSCC dengan
Infeksi HPV
9 (81%)
2 (19%)
11
Bosc dengan
Infeksi HPV
9 (100%)
0
9
18
2
20
Tabel 2. analisis data chi Square tabel 1.
kb
o
e
(Oe)
(Oe)
2
(Oe)
2
e
k.1.b.1 9
9.9
-0.9
0.81
0.08
k.2.b.1 2
1.1
0.9
0.81
0.73
k.1.b.2 9
8.1
0.9
0.81
0.1
k.2.b.2 0
0.9
-0.9
0.81
0.9
X
2
1.81
X
t
(Df = 1, p <0,01)
6.63
Tabel 3. Hasil percobaan dalam tabel 2X2 dari cMyc
protein.
tidak
mutasi
cMyc
ya
mutasi
cMyc
total
OSCC dengan
Infeksi HPV
10 (91%)
1 (19%)
11
Bosc dengan
Infeksi HPV
9 (100%)
0
9
19
1
20
Tabel 4. analisis data chi Square tabel 3.
kb
o
e
(Oe)
(Oe)
2
(Oe)
2
e
k.1.b.1 10
10.45
-0.45
0.2
0.01
k.2.b.1 1
0.55
0.45
0.2
0.36
k.1.b.2 9
8.55
0.45
0.2
0.02
k.2.b.2 0
0.45
-0.45
0.2
0.44
X
2
0.83
X
t
(Df = 1, p <0,01)
6.63
diskusi
Karies gigi dan penyakit periodontal umumnya
dianggap sebagai masalah kesehatan utama di seluruh mulut
dunia. Di negara-negara berkembang di Afrika, ini
tampak tidak seperti biasa atau dari urutan yang sama
keparahan seperti di negara maju. Sebuah epidemiologi
deskripsi masalah kesehatan yang diberikan biasanya meliputi
prevalensi, tingkat keparahan (morbiditas, mortalitas) dan usia-
distribusi disesuaikan dalam populasi. Penyakit mulut
diketahui ada di setiap komunitas harus dinilai dalam
cara ini untuk mengembangkan program-program yang tepat untuk
kebutuhan masyarakat. Berdasarkan bentuk analisis,
paling menonjol masalah kesehatan gigi dan mulut di Afrika antara
masyarakat sosio-ekonomi rendah termasuk Noma,
ANUG (Akut Necrotising Ulcerative Gingivitis), lisan
kanker, manifestasi oral HIV dan AIDS, oro-
trauma wajah, dan karies gigi. Penelitian telah menunjukkan
bahwa manifestasi oral HIV / AIDS yang umum.
Infeksi Candida, necrotizing gingivitis dan oral hairy
leukoplakia adalah yang paling common.The prevalensi lisan
kanker juga pada peningkatan kejadian inAfrica.Annual
tarif untuk kanker mulut dan faring diperkirakan mencapai 25
kasus per 100.000 di negara-negara berkembang. Pesatnya
urbanisasi dan peningkatan akses dan pemanfaatan
tembakau dalam berbagai bentuk serta alkohol, memimpin
untuk.
16
Jadi faktor risiko utama adalah tembakau penyalahgunaan, perokok
mewakili 90% dari pasien kanker mulut. Risiko lain yang
dalam penelitian adalah infeksi virus seperti HSVand HPV.
5,6,17,18
P53 adalah gen yang mengkode protein yang mengatur
siklus sel dan karenanya berfungsi sebagai penekanan tumor. Itu
sangat penting bagi sel-sel dalam organisme multisel untuk
menekan kanker. P53 telah digambarkan sebagai wali
genom, mengacu pada perannya dalam melestarikan stabilitas
dengan mencegah mutasi genom. Nama ini disebabkan
massa molekul: itu adalah dalam fraksi 53 kilodalton
protein sel. Gen p53 manusia terletak di
kromosom ketujuh belas (17p13.1). Hal ini memainkan penting
peran dalam kontrol siklus sel dan apoptosis. P53 rusak
INDONESIA JURNAL DENTISTRY.indd 51
22/06/2012 01:33:55

Page 5
INA J Dent RES, Vol. 17 No.2 September 2010: 48-52
52
Jenis / kepala dan leher. Dikutip 16/05/2012.
7. Morimoto RI. Peraturan dari heat shock
transcriptionalresponse: crosstalkbetweenafamilyof
heatshockfactors, molecularchaperones, andnegative
regulator. Gen dan Dev. 1998; 12:3788-96.
8. Colin RY dan Welsh CJ. Stres Kesehatan dan Penyakit.
http://www.cellscience.com/journal/journal.index.asp.
Dikutip 26/10/2005.
9. Vogel EH, Castro ME, Solar PA dan Soto FA.
Peningkatan Pavlov dikondisikan
imunosupresi pada tikus. Acta Neurobiol Exp.
2007; 67:71-81.
10. RayPK.StressGenesandSpeciesSurvival.Moleculer
andCellularBiochemistry.SpringerNetherlands.1999;
196:117-23.
11. Putra ST. Psikoneuroimunologi. Graha Masyarakat
Ilmiah Kedokteran (GRAMIK) Fakultas Kedokteran
UNAIR Surabaya. 2005; p.1-15
12. Elizabeth Crown. Stres sel Protein Terkait dengan Payudara
Kanker. e-crown@northwestern.edu. Dikutip 2007.
13. MA Gonzlez Intxaurraga, R. Stankovic, R.
Sorli, G. Trevisan. HPV dan karsinogenesis. Acta
Dermatovenerologica. 2002; 11 (3).
14. Schmits HL. Spesies Diagnostik Protokol: PCR dan
Lainnya Nucleic Acid Metode. In: Clapp Humana JP,
Editor. Metode dalam Biologi Molekuler. Vol. 50. Pers
Inc, Totowa, NJ. 1996; hal.109-126
15. Nigel MM, Nina F. Mengetik HPV isolat dengan PCR:
Pendekatan Molekuler terhadap pengembangan vaksin
untuk infeksi virus. ICRO-Unesco Training Course, At
Inter University Center for Biotecnology, Gajah Mada
University, Yogyakarta, Indonesia, 1998; hal.18-28.
16. Robert A. Ord, Nikolaos G. Nikitakis, dan John J.
Sauk. Skrining Risiko Non-High Kanker Mulut
Pasien-Part1.http :/ / oralcancerfoundation.org / gigi /
why_screening_works.htm. Dikutip 19/05/2012
17. WHO / AFRO. Oral Epidemiologi Kesehatan. 2008.
18. Mehrotra R, Yadav S. karsinoma sel skuamosa oral:
Etiologi, patogenesis dan nilai prognostik
perubahan genom. Indian Journal of Cancer. 2006;
43:60-66.
19. Baca, AP, Strachan, T. Cancer Genetics. Manusia
genetika molekuler 2. New York: Wiley; 1999.
Chept.18.
20. Anand P, Kunnumakkara AB, AB Kunnumakara.
Kanker adalah penyakit yang dapat dicegah yang memerlukan besar
perubahan gaya hidup. Pharm. Res. 2008; 25 (9) :2097-116.
Cotterman R, Jin VX, Krig SR, Lemen JM, Wey
A, Farnham PJ, Knoepfler PS. N-Myc Menagatur
program euchromatic luas di manusia
genom sebagian independen perannya sebagai klasik
faktor transkripsi. Kanker Res. 2008; 68 (23): 9654 -
62.
dapat memungkinkan sel-sel abnormal untuk berkembang biak, sehingga
kanker. Sebanyak 50% dari semua tumor manusia mengandung p53
mutan.
18
Dan kode c-myc untuk protein yang mengikat ke
DNAof gen lain dan karena itu merupakan faktor transkripsi.
Ketika gen seperti myc diubah untuk menyebabkan kanker, yang
versi kanker gen disebut onkogen. Itu
versi sehat gen yang berasal dari disebut
proto-onkogen. Gen Myc terletak pada kromosom
8 pada manusia dan mengkode faktor transkripsi yang
diyakini mengatur ekspresi dari 15% dari semua gen.
19,20
Ini berarti bahwa di samping perannya sebagai klasik
faktor transkripsi. Myc juga mengatur kromatin global yang
struktur dengan mengatur asetilasi histon baik dalam gen-
daerah yang kaya dan di lokasi jauh dari gen yang dikenal.
21
kesimpulan
Virus Humanpapilloma (HPV) isafactorforpathogenesis
Oral Karsinoma sel skuamosa (OSCC).
pengakuan
Kami berterima kasih untuk mengakui Inter University Center
(IUC) Bioteknologi Universitas Gadjah Mada
Yogyakarta, Universitas Airlangga Surabaya dan Muwardi
Distric Hospital Surakarta fasilitas laboratoriumnya.
Dan Prof Jos Verssimo Fernandes dari federal
University of Rio Grande do Norte, Natal - Brasil
koreksi dan saran.
Referensi
1. Samer AB, Michael AH, dan Geza T. skuamosa sel
karsinoma jaringan mulut: Ulasan acomprehensive
bagi penyedia layanan kesehatan oral. Contemp. Penyok. Prac.
2005; 15:1-16.
2. Andrew PF, Rolf O, dan Steven H. epigenetik The
progenitor asal kanker manusia. Ulasan Alam
Genetics. 2006; 7:21-33.
3. Kinzler, Kenneth W, Vogelstein, Bert. 'Introduction'.
InThegeneticbasisofhumancancer.Reviseded.New
York: McGraw-Hill, Medis Pub. Divisi; 2002.
4. Elizabeth A, Tara NR, Frannie RK, Chaterine H,
dan Edward SP. Pengetahuan kanker mulut, sikap
dan praktek: Sebuah survei dari dokter gigi dan perawatan primer
dokter di massachusetts.Am. Dent.Assoc. 2009;
140:461-7.
5. CancerResearchUK.Oralcancer-riskfactors. http://
info.cancerresearchuk.org / cancerstats / tipe / lisan /
riskfactors / index.htm. Dikutip 4/9/2009.
6. National Cancer Institute. Kanker Kepala dan Leher.
http://www.cancer.gov/cancertopics/factsheet/Sites-
INDONESIA JURNAL DENTISTRY.indd 52
22/06/2012 01:33:55