Anda di halaman 1dari 174

Seal externa Gen 1 Cromosomas nucleares

Seal interna
Gen 2

Eliminacin
de intrones
Membrana Gen 3
nuclear
mRNA1

mRNA2 mRNA3

Retculo endoplsmico

mRNA4
Aparato de Golgi
Gen 4

Cromosoma circular del orgnulo

Mitocondria o cloroplasto

Membrana celular

Clave
Tramo de DNA que determina protena Polimerasa de RNA
Tramo que no determina protena Protena secretada

Protenas utilizadas en la clula


Tramo de RNA que determina protena
Protena cifrada en la
Tramo que no determina protena
mitocondria o el cloroplasto

Promotor Cadena de aminocidos

Protenas reguladoras Ribosoma

Figura 1-10. Esquema simplificado de la accin gnica en una clula eucaritica.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Ncleo del melanocito

Alelo Alelo Alelo


cr. 14 normal cr. 14 normal cr. 14 nulo

Alelo Alelo Alelo


cr. 14 normal cr. 14 nulo cr. 14 nulo

Transcritos

Polipptido

Enzima Tyr

Reaccin

Tirosina Melanina Tirosina Melanina Tirosina

Fenotipo del Pigmentado Pigmentado Albino


melanocito

Figura 1-15. Base molecular del albinismo.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
DNA cromosmico Gen P

Fragmento cortado mRNA a Producto proteico P


de DNA a ser detectado ser detectado a ser detectado

Todo el DNA cortado Todo el mRNA Todas las protenas

Electro-
foresis

Separa-
cin

(a) Tcnica Southern (b) Tcnica Northern (c) Tcnica Western

mRNA
Fragmento del
con el Protena
gen P
gen P del
gen P

Filtro de Filtro de Filtro de


transferencia transferencia transferencia
sondeado con sondeado con sondeado con
el gen P (marcado) el gen P (marcado) anticuerpos contra
la protena P
(marcados)

Figura 1-17. Sondeo de mezclas de DNA, RNA y protenas.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Altitud elevada
50

Altitud media
50
Altura (cm)

0
Altitud baja
50

0 1 2 3 4 5 6 7
Planta parental (origen del esqueje)

(b)
Figura 1-23. (b) Normas de reaccin frente a la altitud de siete plantas distintas de Achillea (siete genotipos distintos).

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Puede mutar por
Particularmente grave
Sustitucin de Gen si ocurre en la regin
Encontrada en los
un par de bases del gen que determina el
descendientes de progenitores
heterocigotos para un solo
Debido, a menudo, Muchos de los cuales Determina protenas,
a falta de actividad se necesitan para replicar, algunas de las cuales son
Provoca mutaciones, de un transcribir y traducir un
la mayora de
las cuales son Interacciona
Enzima
con el
Puede regular
Algunos agentes Acta uniendo
la expresin de un
Recesivo ambientales pueden el sustrato a su
producir la
Puede suministrar
Medio sustratos que
ambiente ocupen el Centro activo
Fenotipo
heredado como Personas
autosmico sensibles Debido a la
La mutacin
a la luz del falta de una Varias de ellas
En la que el de uno solo
que actan puede bloquear
componente
sucesivamente por completo
1 corresponde Albino Uno de cuyos constituyen una una
a la proporcin agentes (la luz solar)
de puede incrementar
Si los dos progenitores
son heterocigotos la cantidad de
Ruta
para el alelo albino, la metablica
descendencia mostrar Debido al
una bloqueo de una
Ausente en un
Por ejemplo, aquella
Proporcin 3:1
cuyo producto final
es el compuesto
En la descendencia oscuro
de dos heterocigotos
Melanina
para el albinismo,
proporcin
de individuos
que tienen o no

Figura 1-26. Ejemplo de mapa de conceptos.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Transferencia
de polen
con
escobilla

Eliminacin
de las anteras

P Prpura Blanca

Todas
prpuras
F1

Figura 2-4. Cruzamiento de Mendel de flores prpuras Y flores blancas ".

P Prpura Blanca

F1 Todas
prpuras

Figura 2-5. Cruzamiento de Mendel de flores blancas Y flores prpuras ".

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin

P R/R ; y/y r/r ; Y/Y


(liso, verde) (rugoso, amarillo)

Gametos R;y r;y

F1

R/r ; Y/y
(liso, amarillo)


F1 F1

X Gametos
Figura 2-10a. Diagrama de Punnett, que muestra las constituciones genotpica y fenotpica predichas para la generacin F2
de un cruzamiento dihbrido.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
R;Y R;y r;y r;Y
1 1 1 1
4 4 4 4

R/R ; Y/Y R/R ; Y/y R/r ; Y/y R/r ; Y/Y


1 1 1 1
R;Y 16 16 16 16
1
4

R/R ; Y/y R/R ; y/y R/r ; y/y R/r ; Y/y


Y Gametos

R;y 1 1 1 1
1 16 16 16 16
4

R/r ; Y/y R/r ; y/y r/r ; y/y r/r ; Y/y


r;y 1 1 1 1
1 16 16 16 16
4

R/r ; Y/Y R/r ; Y/y r/r ; Y/y r/r ; Y/Y


r;Y 1 1 1 1
1 16 16 16 16
4

9 :3 :3 :1

liso, amarillo rugoso, amarillo

liso, verde rugoso, verde


Figura 2-10b. Diagrama de Punnett, que muestra las constituciones genotpica y fenotpica predichas para la generacin F2
de un cruzamiento dihbrido.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Primer
cruzamiento
P w+ w+ w

Rojo Y Blanco X

XX XY

X gametos
w
F1 1 1
2 2

w+ w+ w+
Y gametos

w
1 1 1
2 2 2

Rojo Y Rojo X

X gametos

w+
F2 1 1
2 2

w+ w+ w+ w+
1 1 1
2 4 4
Y gametos

Rojo Y Rojo X

w w+ w w
1 1 1
2 4 4

Rojo Y Blanco X

Figura 2-15a. Explicacin de los diferentes resultados que se obtienen en cruzamientos recprocos entre
ejemplares de Drosophila de ojos rojos (en la figura, rojo) y de ojos blancos (en la figura, blanco ).

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Segundo
cruzamiento

P w w w+

Blanco Y Rojo X

XX XY

X gametos
w+
F1 1 1
2 2

w+
Y gametos

w w w
1 1
2 2

Rojo Y Rojo X

X gametos

w
F2 1 1
2 2

w+ w+ w w
1 1 1
2 4 4
Y gametos

Rojo Y Rojo X
w w w w
1 1 1
2 4 4

Rojo Y Rojo X

Figura 2-15b. Explicacin de los diferentes resultados que se obtienen en cruzamientos recprocos entre
ejemplares de Drosophila de ojos rojos (en la figura, rojo) y de ojos blancos (en la figura, blanco ).

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
I
1 2
A/ A/

II
1 2 3 4 5
A/A A/a A/ A/a A/A

III
1 2 3 4 5 6 7
A/ A/ A/ A/ A/a A/a A/

IV
1 2 3 4 5
A/ a/a A/ a/a A/

Figura 2-17. Pedigr de un fenotipo recesivo poco comn determinado por el alelo recesivo a.

I
1 2
A/a a/a

II
1 2 3 4 5 6 7
a/a a/a a/a A/a a/a A/a a/a

III
1 2 3 4 5 6 7 8 9 10 11 12 13
a/a a/a a/a a/a A/a a/a A/a a/a a/a a/a A/a a/a A/a

Figura 2-20. Pedigr de un fenotipo dominante determinado por un alelo dominante A.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
A A

a a

1 1 1
4 2 4

A A a

A a a
Sonda Sonda Sonda
DNA RNA Protena DNA RNA Protena DNA RNA Protena

Southern Northern Western

Sitio de corte de una Mutacin sin sentido que genera


enzima de restriccin una protena pequea

Figura 2-18. Base molecular de la herencia mendeliana en un pedigr.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Cromosoma X de un progenitor Cromosoma X del otro progenitor

Cigoto
A1 A2

Mitosis

Inactivacin de
un cromosoma X
A1 A2 A1 A2

Mitosis

A1 A2 A1 A2 A1 A2 A1 A2

Muchas mitosis
Mosaico adulto

Sector de clulas que expresan slo el alelo A2 Sector de clulas que expresan slo el alelo A1

Figura 2-30. Inactivacin del cromosoma X en los mamferos.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Mitosis
Clulas hijas
Telofase

Interfase Profase Metafase Anafase


2n

2n

2n

Replicacin Segregacin

Figura 3-2a. Representacin simplificada de la mitosis y la meiosis en clulas diploides (2n, diploide; n, haploide).

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Productos de
Telofase 2 la meiosis

n
Profase 2 Metafase 2 Anafase 2
Telofase 1

Anafase 1
n

Segregacin
n

Segregacin

Figura 3-2b. Representacin simplificada de la mitosis y la meiosis en clulas diploides (2n, diploide; n, haploide).

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
B

1 Clula parental

B
A
B
a A

a b

2 Duplicacin cromosmica

a B b A

a B b A

3 Segregacin

B
A

a
b

A
b

a B

4 Clulas hijas

Figura 3-16. Mitosis de una clula diploide de genotipo A/a ; B/b.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
1 Clula parental
A

2 Duplicacin cromosmica

b A

A b

A b

3 Segregacin

b
A

4 Clulas hijas

Figura 3-18. Mitosis en una clula haploide de genotipo


A ; b. Cada gen se encuentra en un cromosoma distinto.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Formacin de cromtidas Replicacin del DNA

Diploide homocigtico b+/b+


b+ G
b + b+
G C
C G
b+
C
G
+
b
G C
C G
b+ b+
b+ C

Diploide homocigtico b+/b


b+ G
b + b+
G C
C G
b+
C
A
+
b
A T
b T A
b
b T

Diploide homocigtico b /b
b A
b b
A
T
T A
b
T
A
b
A T
b T A
b
b T

Haploide b+
b+ G
b + b+
G
C
C G
b+
C

Haploide b
b A
b b
A T
T A
b
T

Figura 3-25. Relacin entre la formacin de cromtidas y la replicacin subyacente del DNA.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Mitosis en una clula diploide a+/a

Replicacin a+
2n premittica Segregacin de las cromtidas
2n

a+
a+ a
a+ a
a+
a a
a+ a
a
a+

2n

Figura 3-26a. Representacin simplificada de la mitosis y la meiosis al nivel del DNA.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Meiosis en una clula diploide a+/a

Segregacin de a+
las cromtidas
n

a+

a+

Replicacin Segregacin de
2n premeitica los cromosomas a+ n

a+
a +
a+

a+
a
a
a Entrecruzamiento
a
a
n

a
n

Figura 3-26b. Representacin simplificada de la mitosis y la meiosis al nivel del DNA.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
(a)

(b)
30 nm

Ncleo octamrico de histonas


DNA
Histona H1
10 nm

DNA
Octmero
de histonas
Histona H1

Nucleosoma

Figura 3-38. (a) Modelo de un nucleosoma que muestra al DNA enrollado dos veces alrededor de un octmero de
histonas. (b) Dos vistas de un modelo del solenoide de 30 nm con los octmeros de histonas representados como discos
de color morado. (Izquierda) Vista lateral parcialmente desenrollada. (Derecha) Vista desde un extremo.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
DNA
Nucleosomas
Esqueleto

Solenoide
de 30 nm

DNA
Nucleosomas

Esqueleto

Solenoide de 30 nm
Figura 3-41. Modelo de la estructura del cromosoma.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
DNA eucaritico

Genes funcionales DNA de secuencia repetida DNA separador


de copia nica

Secuencias sin funcin


Secuencias funcionales
conocida

Familias de genes Repeticiones


Repeticiones Secuencias
que cifran productos Secuencias funcionales presentes en la
en tndem de derivadas de
(y pseudogenes que no cifran producto heterocromatina
nmero variable transposiciones
relacionados) centromrica

Familias Familias de Retrotrans-


de genes genes dispuestos Transposones
posones
dispersos en tndem

Figura 3-44. Clasificacin del DNA eucaritico.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Segmento
Bacteria cromosmico
20 kb
Gen Gen Gen Gen Gen Gen Gen Gen Gen Gen Gen Gen Gen

Levadura
20 kb
Gen Gen Gen Gen Gen Gen Gen Gen Gen Gen Gen

Drosophila
200 kb
Gen Gen Gen Gen Gen Gen Gen Gen

Ser humano
200 kb
Gen Gen Gen

Figura 3-51. Tamaos aproximados de los genes (en kilobases) y regiones intergnicas de varios organismos representativos.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Silvestre

+ +

+ +
w1 w2
Gen Gen

Mutante $ Mutante Mutante

$ + + +

$ + + +
w1 w2 w1 w2 w1 w2
Gen Gen Gen Gen Gen Gen

F1

No
complementacin Complementacin
$ + +

+ +

Enzima 1 Enzima 2
Enzima 2

Precursor Precursor
Precursor Precursor incoloro 1 incoloro 2 Azul
incoloro 1 incoloro 2 Azul

Bloqueo

Figura 4-1. Base molecular de la complementacin gentica.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Gen regulador Gen regulado

r+ a+

(a)
Normal

(b) r a+
Mutacin en
el gen que
cifra
la protena Protena reguladora
reguladora no funcional
(c)
r+ a
Mutacin
en el gen
regulado,
que cifra
una protena
estructural

r a
(d)
Mutacin en
ambos genes

Figura 4-12. Interaccin entre un gen regulador y un gen diana regulado por aqul.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Dihbrido w +/w ; m +/m

Autofecundacin

9 +
16 w / ; m +/ Ambas enzimas activas

w+ m+

Enzima 1 Enzima 2 9

3
16
w +/ ; m /m Bloqueo en la segunda enzima
w+

Enzima 1 3

3 w /w ; m +/ Bloqueo en la primera enzima


16
m+

Enzima 2

Sin sustrato

4
1 w /w ; m /m Bloqueo en la primera enzima
16

Figura 4-13. Mecanismo molecular de la epistasia recesiva.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
m+ s+

Tipo
silvestre Complejo
proteico activo

m s+

Primera
mutacin
Inactivo

Una m s
segunda
mutacin
que acta Complejo
como proteico activo
supresora

m+ s
nicamente
mutacin
supresora Inactivo

Figura 4-15. Un mecanismo molecular de supresin.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
2n 2n

P A/A B/B a/a b/b

Entrada n AB n ab

2n 2n
Diploide
meitico (F1) A/a B/b a/a b/b Individuo
de prueba

Meiosis Meiosis

Gameto n 2n Individuo de
AB ab n A/a B/b
tipo parental tipo parental
Salida
Gameto n 2n Individuo de
ab ab n a/a b/b
tipo parental tipo parental

Gameto n 2n Individuo
Ab ab n A/a b/b
recombinante recombinante

Gameto n 2n Individuo
aB ab n a/a B/b
recombinante recombinante

Figura 5-5. Deteccin de la recombinacin en los organismos diploides.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
A B a b

A B a b
P

A B a b

Gametos
A B a b

a b a b
Diploide meitico (F1) Individuo de prueba

A B
1
4 Tipo parental
a b

a b
1
Tipo parental
4
a b
Descendencia del
cruzamiento de prueba
A b
1
Recombinante
4
a b

a B
1
4 Recombinante
a b

Figura 5-6. La segregacin independiente produce siempre una frecuencia de recombinacin del 50 %.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
A B a b

A B a b
P

A B a b

Gametos
A B a b

a b a b
Diploide meitico (F1) Individuo de prueba

A B
1
[ Tipo parental
4
a b

a b
[1 Tipo parental
4
a b
Descendencia del
cruzamiento de prueba
A b
1
\ Recombinante
4
a b

a B
\1 Recombinante
4
a b

Figura 5-8. Recombinacin por entrecruzamiento.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
A B
Ningn entrecruzamiento
A B
RF =
0
a b 4 =
0%
a b

A B
Un entrecruzamiento
A B
(Puede ocurrir entre RF =
cualquier par de a b 24 =
cromtidas no hermanas) 50%
a b

A B
Dos entrecruzamientos
(Si mantenemos un A B Entrecruza-
entrecruzamiento RF = miento
constante y variamos a b 04 = doble
la posicin del segundo, 0% entre dos
a b cromtidas
se producen cuatro
meiosis igualmente
frecuentes con
A B
entrecruzamientos
dobles) A B Entrecruza-
RF = miento
a b 24 = doble
50% entre tres
a b cromtidas

A B
A B Entrecruza-
RF = miento
2
a b 4 = doble
50% entre tres
a b cromtidas

A B
Entrecruza-
A B miento
RF =
4 doble
a b 4 =
entre
100%
a b cuatro
cromtidas
8
Valor medio de la RF =16 = 50%

Figura 6-3. Demostracin de que en las meiosis en las que el nmero de


entrecruzamientos no es cero, el valor medio de la RF es el 50 %.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
ctada

Ttrada A
Meiocito
A
despus de la
duplicacin A
de las A
cromtidas
A
A A
A

A
a a
a a

a a

a
a a
Primera
divisin
meitica a
Segunda
divisin
meitica Mitosis

Figura 6-7. Si no hay entrecruzamiento entre el centrmero y el locus, los alelos A y a de ste segregan a ncleos distintos
tras la primera divisin meitica.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
A

A
A
a
A

a
a a
A

A
a A
A
a
A A

a
a a
Primera
divisin
Segunda a
divisin
Mitosis

Un patrn de
segregacin
en la segunda
divisin, MII
Figura 6-8. Si hay un entrecruzamiento entre el centrmero y el locus, los alelos
A y a de ste no segregan a ncleos distintos hasta la segunda divisin meitica.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Fenotipo
y sn +
y sn + Sector
amarillo
y sn + Sectores
gemelos
y+ sn
Sector
y+ sn singed
y+ sn

y sn +
y sn + Sector Sector
amarillo individual
y sn
y+ sn +
Normal
y+ sn
y+ sn

Figura 6-18. Un entrecruzamiento mittico puede provocar una segregacin fenotpica.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin

A B

Se mezclan

Algunos
WT descendientes

(a)

A B
met bio thr + leu + thi + Mezcla met + bio + thr leu thi

Se lavan las clulas Se lavan las clulas Se lavan las clulas

Se siembran ~10 8 clulas Se siembran ~10 8 clulas Se siembran ~10 8 clulas

MM MM MM
No crecen met + bio + thr + leu + thi + No crecen
colonias Colonias prottrofas colonias

Figura 7-2. Demostracin de Lederberg y Tatum de la recombinacin gentica entre clulas bacterianas.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Donante Cromosoma
bacteriano

Puente de
conjugacin
Plsmido

Pilus

Receptora
(a) (b)
Figura 7-5. (a) Un pilus une a las dos bacterias durante la conjugacin. (b) Despus se forma un puente (bsicamente un poro) entre las dos clulas. A continuacin,
una cadena de DNA del plsmido pasa a la bacteria receptora, y a partir de cada cadena sencilla se forma una doble.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Frecuencia (%) de caracteres genticos 100

azi r
Hfr entre los exconjugantes str r

80
ton r

60

40 lac +

gal +
20

0 10 20 30 40 50 60
Tiempo (minutos)
(a)

25 min
Hfr str s

Origen

Origen

F str r
(b)

Figura 7-7. Experimentos de conjugacin interrumpida con E. coli.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
(a) O Factor F integrado

lac +
tsx
ton
Cromosoma Hfr
(b)
lac +

tsx
ton

(c) F-lac
+
lac

(d) lac + Clula diploide


lac
F lac +/lac

tsx
ton

Figura 7-14. Formacin y reintegracin de un factor F, en este caso F lac.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Complejo de
DNA libre unin a DNA

Nucletido
Pared celular

Membrana
citoplsmica

Enzima que
DNA libre de degrada el DNA
una bacteria
muerta Bacteria DNA
transformada transferido
Cromosoma

(a) (b)

Figura 7-16. Una bacteria en el proceso de transformacin (a) recoge DNA libre procedente de una clula bacteriana muerta.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Clula
no infectada

Lisis de la clula Adsorcin del


hospedadora fago a la clula
Fagos hospedadora
libres

Ensamblaje
de fagos
dentro Ciclo ltico
de la clula
hospeda-
dora

Entrada del cido


nucleico del fago
cido nucleico
del fago

Protenas
del fago

Se sintetizan las
Cromosoma protenas del fago
hospedador y se replica su
degradado material gentico;
se degrada entonces
el cromosoma
hospedador

Figura 7-21. Ciclo ltico de un bacterifago de transduccin generalizada.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
a+
a+ b +

b+ a+

Bacteria donante b+

b+

Fagos portadores
de genes del donante
a+

a+

a+ a a+

Bacteria transducida Bacteria receptora

Figura 7-26. Mecanismo de transduccin generalizada.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Nucletidos pricos
NH2

Fosfato N 6
7 5 1N
8 Base nitrogenada
9 4 2
N 3 (adenina, A)
O N
N
5
O O O CH2 O
1
4 Azcar
O H H
desoxirribosa
H H
3 2

OH H
5 -fosfato de desoxiadenosina (dAMP)

Nucletidos pirimidnicos

NH2

4
5 3N

6 2
Citosina (C)
1
O N O

O O O CH2 O

O H H
H H

OH H
5 -fosfato de desoxicitidina (dCMP)

Figura 8-4a. Estructura qumica de los cuatro nucletidos (dos con bases pricas y
dos con bases pirimidnicas) que constituyen los componentes fundamentales del DNA.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
O
H
N 6
7 5 1N
8
4 2
Guanina (G)
9
3
O N N NH2

O O O CH2 O

O H H
H H

OH H

5 -fosfato de desoxiguanosina (dGMP)

O
CH2 H
4
5 3N

6 2
Timina (T)
1
N O
O

O O O CH2 O

O H H
H H

OH H
5 -fosfato de desoxitimidina (dTMP)

Figura 8-4b. Estructura qumica de los cuatro nucletidos (dos con bases pricas y
dos con bases pirimidnicas) que constituyen los componentes fundamentales del DNA.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Figura 8-5. Doble hlice de DNA, desenrollada para mostrar los esqueletos
azcar-fosfato (en azul) y los escalones de pares de bases (en rojo).

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Las dos cadenas de la doble
hlice parental se desenrollan,
y cada una determina una nueva
cadena hija mediante las reglas
de emparejamiento de las bases

Vieja

Nueva

Figura 8-10. El modelo de replicacin del DNA propuesto por Watson y Crick est
basado en la especificidad de los puentes de hidrgeno entre los pares de bases.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Polimerasa de DNA III
en cadena adelantada
Cadena adelantada
5

Topoisomerasa

3
3
Molde de la cadena
adelantada Helicasa

Primasa de RNA
5
Molde de la cadena Cebador de RNA DNA parental
retrasada Protenas de unin
a DNA de cadena
5 sencilla
5

Primosoma

Fragmento
de Okazaki
Polimerasa de DNA III
en cadena retrasada

Figura 8-20. Horquilla de replicacin del DNA.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
5@
Cadenas viejas

3@ Cadena retrasada

5@ Cadena adelantada

Avance de 3@
la horquilla

Sntesis de la cadena retrasada

Cadena
(a) Oligonucletidos vieja 5@
de RNA (cebado-
3@ 5@ 3@
res) sobre molde
de DNA 5@ 3@
Cebador de RNA

(b) La polimerasa
de DNA alarga
los cebadores 3@
de RNA con
5@
DNA nuevo
Fragmento de Okazaki
DNA
nuevo

(c) La polimerasa
de DNA elimina
3@
el tramo 5' RNA
al final de cada 5@
fragmento

(d) La ligasa de DNA


une los 3@
fragmentos
Ligacin

Figura 8-30. Esquema general de una horquilla de replicacin (arriba) y pasos


sucesivos de la sntesis de la cadena retrasada.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
(a) Estructura primaria
Extremo carboxilo Extremo amino

(b) Estructura secundaria

Puentes de hidrgeno entre aminocidos localizados


en distintas posiciones de la cadena polipeptdica

(c) Estructura terciaria (d) Estructura cuaternaria

Hemo
b b

Grupo Hemo

Polipptido b a

Figura 9-7. Diferentes niveles de la estructura de las protenas.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
(a) (b)

Figura 9-19. El centro activo de una enzima concreta, la enzima digestiva carboxipeptidasa. (b) La enzima con su sustrato (en dorado) en el sitio correcto.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
(a) Cadena sin sentido Cadena molde
del gen 1 RNA del gen 2
5@
3@ 5@
5@ 3@
DNA
5@
Cadena molde RNA Cadena sin sentido Polimerasa
Polimerasa del gen 1 del gen 2
de RNA de RNA

Gen 1 Gen 2
Figura 10-6a. Transcripcin de dos genes.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
3@
(b) Adicin al extremo 3@ de la cadena en crecimiento
5@
3@ 5@
RNA

Cadena
molde
del DNA 5@ 3@
Figura 10-6b. Transcripcin de dos genes.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Regin promotora
Holoenzima en el DNA
a p a

(a)

b b@
La polimerasa de RNA La polimerasa se une
rastrea la doble hlice al promotor y forma
un complejo cerrado

(b)

La polimerasa desenrrolla
el DNA y forma un complejo
abierto p

(c)

5@
ppp
A p (Np)n NOH

3@
Ncleo central
Comienza la transcripcin

Figura 10-9. Iniciacin de la transcripcin.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
(a) Cadena
sin sentido Polimerasa de RNA
5@
3@ 3@
5@ 5@

Cadena DNA
Transcrito de RNA molde

(b) 5@
3@ 3@
5@
m7 GPPP

Guaniltransferasa

(c) 5@
3@
3@
m7 GPPP
5@

Endonucleasa

(d) m7 GPPP

Sitio de corte

(e) m7 GPPP

Polimerasa de poli(A)

(f) m7 GPPP

Figura 10-15. Procesamiento de un transcrito primario.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Amino
cido

A
C
C

Brazo de unin al aminocido


(7 pares de bases)

Bucle T t C
(7 nucletidos)
Bucle DHU
t (8-12 nucletidos)
C T

Hlice T t C
(5 pares de bases)
Hlice DHU
Brazo extra (3-4 pares de bases)
(longitud variable)
Hlice del anticodn Pirimidinas
(5 pares de bases)

Purina modificada

Base de tambaleo
Anticodn

Bucle del anticodn


(7 nucletidos)
(a)
Figura 10-26a. Estructura del RNA transferente. (a) Regiones funcionales de cualquier molcula de tRNA.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
3@
OH

Sitio de unin
del aminocido

5@ p

UH2

mG

UH2
m2G
UH2

ml

(b) Anticodn
Figura 10-26b. Estructura del RNA transferente. (b) Secuencia especfica del tRNA de la alanina de levadura.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
5@

3@

Extremo
Bucle CCA
TtC

Bucle
DHU

Bucle del
anticodn

(c) Anticodn
Figura 10-26c. Estructura del RNA transferente. (c) Esquema de la estructura tridimensional real del tRNA de la
fenilalanina de levadura.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Segunda letra
Primera letra

Tercera letra

Figura 10-27. El cdigo gentico.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Indica formacin de un
H2 N
nuevo enlace peptdico

tRNA4 Sitio P Sitio A aa7-tRNA7


saliente entrante

5@ 3@
mRNA

Codn Codn Codn Codn Codn Codn Codn Movimiento de los ribosomas
aa1 aa2 aa3 aa4 aa5 aa6 aa7

Figura 10-31. Adicin de un aminocido a la cadena polipeptdica creciente durante la traduccin del mRNA.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Transporte
Transduccin
2% Metabolismo de seales Energa
22% 8% 6%

mt
Trfico
intracelular
2% cp

DNA
Sntesis
proteica
3%

Metabolismo Vacuola RNA


secundario
10% Transporte y
almacenamiento
de protenas 5%

Estructura
Transcripcin
celular
15%
8%
Crecimiento Enfermedad
y divisin y defensa
6% 13%

Patgeno

Figura 10-45. Distribuciones de varias categoras de genes que determinan protenas.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
I P O Z Y A
Polimerasa de RNA Genes estructurales

DNA

mRNA

mRNA
Polipptido
Plegamiento

Protena
represora Lactosa mRNA

Medio

b-Galactosidasa Permeasa Transacetilasa

Figura 11-1. Regulacin del opern lac.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
(a) Glucosa presente (poco AMPc); no hay lactosa; no hay mRNA lac

CAP
P O A
I Z Y

R
Represor

(b) Glucosa presente (poco AMPc); lactosa presente

CAP

I P O A
Z Y

R I R I Muy poco mRNA lac


Lactosa Inductor-
represor

(c) No hay glucosa (mucho AMPc); lactosa presente

AMPc
I P O A
Z Y

R I R I
Lactosa Inductor-
represor Abundante mRNA lac

Figura 11-12a, b, c. Control negativo y positivo del opern lac por el represor Lac y la protena activadora de los
genes catablicos (CAP), respectivamente.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
(d) 90
DNA
35

10

5@
CAP
3@

AMPc

(e)

Figura 11-12d, e. Control negativo y positivo del opern lac por el represor Lac y la protena activadora de los
genes catablicos (CAP), respectivamente.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
(a) Control negativo

Inductor I
Transcripcin

Represor mRNA
inactivo

R P O A B C

R
Represor
No hay
activo
transcripcin

(b) Control positivo


No hay
transcripcin
Factor
inactivo

R P X Y Z
Activacin
por el
inductor
Transcripcin
Factor activo
(activador)
mRNA

Figura 11-13. Comparacin entre control positivo y negativo.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Activadores
Estas protenas se unen
a los genes en sitios conocidos
como intensificadores y aumentan Represores
la tasa de transcripcin Estas protenas se unen
a series de genes especficos
en sitios conocidos como
Intensificador silenciadores, disminuyendo
los niveles de transcripcin.
Si
le
nc
ia
do
r
Represor
or

In
te
cad

Activador ns
ifi
ifi

ca
d
ens

or
Int

Activador
Activador
250
40
30
110 60 Beta H
30
Alfa
80 150 E
F Polimerasa
Protena de B de RNA Regin
A unin a TATA codificante

Coactivadores Secuencia TATA


Promotor mnimo
Estas molculas adaptadoras
integran seales de los
activadores y quizs tambin Factores de transcripcin basal
de los represores. En respuesta a las seales de
los activadores, estos factores
sitan a la polimerasa de RNA
en el sitio de inicio de la
transcripcin e inician
el proceso de la transcripcin.

Figura 11-28. El aparato molecular que controla la transcripcin en las clulas humanas consta de cuatro tipos de
componentes.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Propiedad A de
Drosophila en estudio

Identificacin de mutantes
que carezcan de A.

Cruzamiento silvestre mutante


3
silvestre
F2 4
1
4 mutante

Relacionar el gen de inters A


con el alelo mutante a.

Extraccin Extraccin del


del DNA DNA vector a
de Drosophila partir de bacterias

Digestin del DNA Digestin del vector

Construccin del DNA


recombinante

Introduccin en bacterias para su clonacin

Seleccionar el clon
portador del gen A.

Figura 12-1. La tecnologa del DNA recombinante nos permite insertar fragmentos
individuales de cualquier genoma en molculas de DNA vector tales como plsmidos
y amplificarlas individualmente en bacterias.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Sitios de restriccin

DNA donante

Fragmentos de restriccin
1 2

Vector recombinante
con el inserto 1 2 1 2

Transformacin Genoma bacteriano

1 2

1 2
1 2
Replicacin,
amplificacin
y divisin celular 2

1 2 2
1

1 2
2

1
1

1 2
1
Clon del 2 Clon del
fragmento 1 fragmento
1 2
donante 1 2 donante 2
1

2
1
1 2
1
1 1 2 2
2
1
2

Figura 12-5. As ocurre la amplificacin.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Vector pBR322
EcoRv 185
Nhel 229
Scal 3846 BamHI 375
PvuI 3735 SphI 562
Pst I 3609 SalI 651

Ppal 3435 EagI 939


amp R tet R NruI 972
BspMI 1063

4.4 kb

ori

Digestin del DNA forneo


con, por ejemplo, Sal I

Transformacin bacteriana

Siembra en placas con ampicilina

Amp RTet R Amp RTet S

amp R amp R
tet R

Inserto

Sin Con
inserto inserto
Figura 12-6a. Esquema de la estructura general y los sitios de restriccin de dos
plsmidos diseados para ser empleados como vectores de clonacin de DNA.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Bam HI
Hin dIII

Eco RI
Sph L

Sma I
Vector

Xba l

Kpn I
Sac I
Sal l
Pst I
pUC18

Sitio de clonacin
mltiple

lacZ @
amp R
Promotor lac
2.7 kb

ori

Digestin del DNA forneo


con, por ejemplo, XbaI

Transformacin bacteriana

Siembra en placas con ampicilina y X-Gal

Azul Blanco

Inserto

amp R amp R

Sin Con
inserto inserto

Figura 12-6b. Esquema de la estructura general y los sitios de restriccin de dos


plsmidos diseados para ser empleados como vectores de clonacin de DNA.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Genoma
celular

Extraccin de DNA
Digestin con una enzima
de restriccin

Digestin

Ligacin

DNA recombinante

Fagos hbridos

Bacteria

Infeccin Lisis Halo

Csped
bacteriano

Clon del fago


en la placa

Genoteca de clones del fago

(a)

Figura 12-10a. (a) Se puede construir una genoteca genmica mediante la clonacin de genes en el bacterifago j.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Filtro de
nitrocelulosa

Incubacin
del filtro
con la sonda
Filtro radiactiva

Autorradiografa
para localizar
el clon deseado
Pelcula

Clon
deseado

Infeccin de nuevas
clulas bacterianas

Sntesis del gen


forneo

(b)

Figura 12-10b. (b) Se hace una rplica de los halos sobre un filtro de nitrocelulosa, y se degradan la protenas
virales, dejando slo el DNA recombinante, que se desnaturaliza para facilitar su adsorcin al filtro.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
RNA o DNA La solucin pasa a travs del gel y
del filtro hacia las servilletas de papel
Marcadores Migracin
de tamao Servilletas
radiactivos (32P) de papel
Esponja
+

Electroforesis

Gel

Tampn Filtro de
con sales nitrocelulosa

Gel Filtro

DNA transferido
al filtro
Hibridacin con la sonda

Filtro en una
bolsa sellada

Sonda unida a
Lavado de las secuencias
la sonda complementarias
libre

Exposicin del filtro


a una pelcula
sensible a rayos X

Autorradiograma

Figura 12-18. Electroforesis en gel, transferencia e


hibridacin para identificar genes clonados concretos.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
(a) O O O

O P P P O Base

O O O Nucletidos (didesoxi-)
terminadores de la sntesis
No puede establecer un
enlace fosfodister con
5 Cadena de DNA el dNTP entrante 3

T T A G A C C C G A T A A G C C C G C A
G C G T
Polimerasa I de DNA
+4 dNTP Cebador
+ddATP marcado

T T A G A C C C G A T A A G C C C G C A
+
A T T C G G G C G T
H
H
+
A T C T G G G C T A T T C G G G C G T
H
H
+
A A T C T G G G C T A T T C G G G C G T
H
H

(b) DNA
Cebador
Polimerasa I de DNA
marcado
+4 dNTP+

ddATP ddTTP ddCTP ddGTP

T
T
A
G
A
C
C
C
G
Gel de A
acrilamida T
A
A
G
C
C
C
G
C
A

Secuencia de la cadena
original de DNA

Figura 12-22. El mtodo de secuenciacin con didesoxinucletidos.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Amplificacin de la secuencia diana
La muestra diana original
es DNA de doble cadena
5@ 3@
(a)

Separacin de las cadenas y


unin de los cebadores

5@ 3@
(b) Cebador 2 Cebador 1
3@ 5@

Extensin de los cebadores

(c) 5@ 3@
Complementaria
Complementaria al cebador 1
al cebador 2
3@ 5@

Separacin de las cadenas y


unin de los cebadores

3@ 5@
(d) Cebadores
nuevos
5@ 3@

Extensin de los cebadores

(e)

Cadenas de Cadenas de
longitud variable tamao unidad

Separacin de las cadenas y


unin de los cebadores

(f)
5@ 3@
Complementaria
al cebador 2 Complementaria
3@ 5@
al cebador 1

Extensin de los cebadores

3@ 5@
5@ 3@
(g)
3@ 5@
5@ 3@
Los fragmentos deseados (no se muestran
las cadenas de longitud variable)

Y as sucesivamente
Figura 12-26. La reaccin en cadena de la polimerasa.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
1. Enfermedad de la orina negra

2. Herencia mendeliana recesiva

3. Deficiencia enzimtica propuesta

cido homogentsico
Enzima HGO
cido maleilacetoactico

4. Localizacin del gen AKU

q p
Cromosoma 3
3q2
AKU

5. Gen HGO aislado del hongo Aspergillus

6. El gen HGO de Aspergillus ayuda a encontrar


el cDNA del gen humano

7. Utilizando HGO como sonda, se encuentra el mRNA


en el hgado Gen HGO

Northern mRNA de HGO

Figura 12-31a. El anlisis de la alcaptonuria (enfermedad de la orina negra).

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
8. Utilizando el cDNA, se encuentra el gen en una
genoteca genmica construida en j

Gen HGO (14 exones, 13 intrones)

9. El clon HGO hibrida con 3q2

Casos de hibridacin

HGO-AKU

10. Mediante PCR de los exones 10 y 12 se encuentran


los sitios mutantes
10 Cebador 12

P230S V300G

11. Herencia de las mutaciones

+/P230S +/ V300G

+/+ +/P230S +/+


P230S/ V300G P230S/ V300G
P230S/ V300G +/ V300G

Figura 12-31b. El anlisis de la alcaptonuria (enfermedad de la orina negra).

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
(a) Mutagnesis dirigida utilizando oligonucletidos
(i) Sustitucin de un par de bases
Unin del oligo al ssDNA Polimerizacin Replicacin en la clula
C C C T
Oligo
ssDNA A
A A G
Sitio y
mutante

(ii) Insercin

Inserto
y

(iii) Delecin

Delecin y

Figura 13-1a. Mutagnesis in vitro. (Oligo, oligonucletido; PCR, reaccin en cadena de la polimerasa; RE, enzima de
restriccin; ssDNA, DNA de cadena sencilla.)

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
(b) Intercambio (c) Delecin (d) Conjunto (e) Mutagnesis por PCR
de fragmentos de deleciones 1 PCR para obtener
un cebador largo

Bloqueado Digestin
RE RE qumicamente
con Producto
exonucleasa

2 PCR utilizando
el cebador largo

Sitio Producto
mutante Delecin Delecin

Figura 13-1b, c, d, e. Mutagnesis in vitro. (Oligo, oligonucletido; PCR, reaccin en cadena de la polimerasa; RE, enzima de
restriccin; ssDNA, DNA de cadena sencilla.)

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
RFLP
Morfo 1 Morfo 2
de DNA de DNA

RE RE RE RE RE

Sonda P Sonda P

Southerm
Origen

Homocigoto Homocigoto Heterocigoto


para el morfo 1 para el morfo 2

Ligamiento al locus D
D/d d/d

1 2 3 4 5 6 7 8

d/d D/d D/d d/d d/d D/d D/d D/d

Morfo 1,2 2,2 2,2 1,2 1,2 2,2 2,2 1,2 1,2 2,2

Inferencia
Morfo 1 Morfo 2

D RE RE RE d RE RE

Madre Recombinacin Padre


en el nio 8

d RE RE d RE RE
Morfo 2 Morfo 2

Figura 13-3. Deteccin y transmisin de un polimorfismo en la longitud de los fragmentos de restriccin (RFLP).

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Alelo X +

Entrecruzamiento doble en 1 y 2
Marcador
Plsmido

Alelo X +

Cromosoma 1 2

Alelo X
Entrecruzamiento sencillo en 1

Alelo X + Marcador Alelo X

Figura 13-12. Dos mecanismos posibles para transformar una estirpe de levadura X con un plsmido portador de un alelo funcional (X+).

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Vector Integracin dirigida del vector
integrador por recombinacin homloga

tk Anlogo de
la neomicina Ganciclovir
Vector

Gen
clonado

neo R Cromosoma con la


Exn 2 insercin dirigida
Gen diana en
el cromosoma

Vectores Medio que


contiene estos Clula
Integracin compuestos sin insercin
aleatoria

Exn 1
(regin
estructural Vector
del gen) Gen no
homlogo Clula
en un con insercin Clula
Clulas
cromosoma Cromosoma con una homloga con insercin
a transformar
insercin aleatoria aleatoria
(a)

Clulas con la
mutacin deseada
Sin insercin
(b) (d)

Vector
Cromosoma
Gen no no modificado
homlogo
en un cromosoma
(c)

Figura 13-21. Produccin de clulas que contienen una mutacin en un gen especfico (interrupcin dirigida o knockout).

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
(a) Mutacin
dirigida

M m Macho quimrico recin nacido


(portador de clulas de dos
a/a ; M/M estirpes diferentes)
Cromosoma
normal

Hembra negra
Clulas ES
de un ratn
marrn Madre
a/a ; M/M ms A/A ; M/m
adoptiva
Embrin en estado Embrin alterado
de blastocisto

Embrin

A/A ; M/M

Ratn marrn
Figura 13-22a. Obtencin de un ratn knockout portador de la mutacin dirigida.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
(b)

a/a ; M/M
ms A/A ; M/m a/a ; M/M A/ ; M/

Quimera adulta
A/a ; M/m A/ ; m/m

a/a ; M/M A/a ; M/m A/ ; M/

A/a ; M/M a/a ; M/


Figura 13-22b. Obtencin de un ratn knockout portador de la mutacin dirigida.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Promotor de la Gen de la hormona
metalotionena del crecimiento
de ratn (MP ) de rata (RGH )

Plsmido

Hembra de ratn
pseudopreada

Huevo lit /lit Cra transgnica

Peso 2.3 2.7 2.5 2.3 1.9 2.6 2.4


relativo

Interpretacin 2.4 2.7 2.3 2.3 2.4 2.5 2.6

Transgnico grande Enano


lit lit , = Ratones grandes

, = Ratones lit /lit enanos

MP RGH lit lit

lit lit

1 1
2 2

lit lit
Grande Enano

Figura 13-23. El gen de la hormona del crecimiento de la rata (RGH), bajo el control de un promotor de ratn que
responde a la presencia de metales pesados, se inserta en un plsmido y se utiliza para producir un ratn transgnico.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
(a)

ASIGNACIN DE GENES
A UN CROMOSOMA
Ligamento
Hibridacin in situ
Hbridos celulares
PFGE
Puntos de ruptura de alteraciones
cromosmicas

Marcador Marcador Marcador


molecular 1 Gen molecular 2 molecular 3 CARTOGRAFA CROMOSMICA
Recombinacin
Hbridos irradiados

Marcador
Gen molecular 2 CARTOGRAFA DE RESTRICCIN
Dianas de restriccin infrecuentes ( )
PFGE

Gen Fragmentos CARTOGRAFA FSICA


clonados YAC
Csmidos
Alineamiento de marcadores (I)

Secuenciacin de DNA
TTAGCTTAACGTACTGGTACCGTAGTACCGTGGCTTAT
Figura 14-1a. Resumen de las estrategias generales de la Genmica estructural.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
(b)

Regin
17Q21

Figura 14-1b. Resumen de las estrategias generales de la Genmica estructural.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
(a) Exn 1 Exn 2 Exn 3

Intrn Intrn Gen de la mioglobina

Cuatro repeticiones
en tndem

CTAAAGCTGGAGGTGGGCAGGAAGGACCGAGGT Secuencia de 33 pb

(b) Individuo A Individuo B Individuo C

Cromosomas
VNTR I
homlogos

VNTR II

VNTR III

A B C

Figura 14-4. Obtencin de una huella digital de DNA empleando una sonda de VNTR.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Fenotipo dominante (P)

1 2 3 4 5
Marcador
A

B
C

D
E

G
H

EJEMPLOS DE ANLISIS
FyH Siempre se heredan juntos ligados?
AyB En los descendientes, siempre aparece A B allicos?
AyD Cuatro combinaciones: A y D, A, D o ninguno no ligados?
F, H y E Siempre aparecen F y H o E estrechamente ligados
en trans?
Alelo P Posiblemente ligado a I y C
Figura 14-5. Utilizacin de las bandas de la huella digital de DNA como marcadores moleculares en cartografa.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
p M

P M

p M

p M

Clave
Cebadores de PCR
Repeticiones del microsatlite
P Alelo dominante de la enfermedad
M M Marcadores moleculares

1 2 3 4 5 6

M
M
M

Productos de PCR

Figura 14-6. Utilizacin de las repeticiones de microsatlites como marcadores moleculares en la cartografa.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
A B C

1 2

3 4 5

6 7

Electroforesis de los
Clave productos de la PCR
Posicin y orientacin de los
cebadores de la PCR B
Productos de la amplificacin D
por PCR C RAPD
17 Cromosomas E
A

(a)
Figura 14-8a. (a) El anlisis de DNA amplificado al azar (anlisis de RAPD) proporciona marcadores moleculares cromosmicos.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
DATOS (presencia de STS en los YAC)

STS (sitios marcados por su secuencia)


1 2 3 4 5 6 7 8 9 10 11 12

YAC C

CONTIG 9 18 10 2 11 12 3 47 56
Mapa de STS
E
C
Extensin
de los YAC A
D
B
Orden incierto

Figura 14-15. Utilizacin de sitios marcados por su secuencia (STS) para ordenar clones solapados
(en este ejemplo, YAC) en un contig.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Cromosomas y YAC alineados
I II III
1

IV V VI

958

Posicin
del gen X
III

333
331
332
334
335
958
Serie ordenada Autorradiograma del filtro
de clones YAC transferido e hibridado con
(filtro de politeno) la sonda del gen X

Figura 14-16. Utilizacin de una serie ordenada de YAC para localizar la posicin en el mapa de un nuevo gen clonado de Caenorhabditis elegans.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Lnea pura A Lnea pura B

Cruzamiento
Retrocruzamiento
entre hermanos

Retrocruzamiento
Cruzamientos y cruzamientos
consanguneos consanguneos

Lneas consanguneas recombinantes

Figura 14-20. Obtencin de lneas para la identificacin y cartografa de QTL.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Transporte
2% Transduccin
Metabolismo
de seal 8 % Energa
22 %
6%

mt
Trfico
intracelular
2% cp

DNA
Sntesis
proteica
3%

Metabolismo RNA
secundario Vacuola
10 % Transporte y
almacenamiento
de protenas
5%

Estructura
celular Transcripcin
8% 15 %
Enfermedad
Crecimiento
y defensa
y divisin
13 %
6%
Patgeno

Figura 14-23. Distribuciones de varias categoras de genes que determinan protenas.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
2 k ori 2 k ori
Dominio
de unin Dominio
a DNA de activacin
Cam R de GAL4 amp R de GAL4
(BD) (AD)

Protena Protena
cebo presa

TRP 1 + LEU 2 +

Reunin

Interaccin

Presa Cebo

GAL4 AD GAL4 BD

Transcripcin

Promotor Gen testigo


GAL4 lacZ

Figura 14-24. Sistema del doble hbrido de levadura para la deteccin de interacciones gnicas.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
(a) Mtodo de sntesis de oligonucletidos

Grupo protector

(I) Chip de cristal

Primera
pantalla
(b) Serie ordenada de oligonucletidos

4
(II)

3
2
(III) 1
Segunda
pantalla

(IV)

(c) Hibridacin con


una sonda
(V) 1 2 3 4

Tercera
pantalla

(VI)

(VII)
etc.

Figura 14-27. Mtodo para sintetizar una serie ordenada de muchos oligonucletidos sobre un chip de cristal.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
DNA

Componentes del centro


activo de la protena

Intrn
Promotor
5@ 3@ Silvestre

m1: nula

m2: nula

m3: nula

m4: rezumante

m5: neutra

m6: nula

Exones

= sitio mutante Protena


Centro activo
m2

m4

m5
m3

Figura 15-1. Posibles posiciones de una mutacin y sus consecuencias funcionales.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Alelo silvestre Mutacin de cambio de Mutacin sin sentido Mutacin de cambio de fase Mutacin en regin
sentido (p. ej., GCtAT) (p. ej., CAAtTAA) (p. ej., + A) reguladora

mRNA

Protena

N W N W N W N W N W

= sitio mutante N = Northern W = Western = desplazamiento

Figura 15-2. Efecto de algunos tipos frecuentes de mutaciones sobre el RNA y la protena.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
(a) Mutacin nula de prdida de funcin (m)

+ + m

+ m m

(b) Mutacin rezumante de prdida de funcin (m)

+ + m

+ m m

(c) Mutacin de ganancia de funcin (M )

+ + M

+ M M

Figura 15-12. (a) La mutacin m ha provocado una prdida completa de funcin


(es una mutacin nula). (b) El alelo mutante m mantiene parte de su funcin, pero en
el homocigoto no hay suficiente producto para que el fenotipo sea silvestre. (c) La
mutacin M ha provocado la aparicin de una nueva funcin celular, representada
por el producto gnico de color amarillo.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Mutgeno

Mayora de Proto-
los genes oncogenes

Alteracin Alteracin
en el DNA en el DNA

Genes de
Repara- reparacin Repara-
cin cin

Mutacin Silvestre Silvestre Mutacin

Dominante Recesiva Recesiva Dominante

Segunda Segunda
mutacin mutacin

Clula
Muerte o mal cancerosa
funcionamiento
celular

Tumor

Figura 15-27. Comparacin de las diferentes consecuencias de una mutacin


somtica en un protooncogn o en otro gen cualquiera.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Forma imino rara
de la citosina (C*) Forma enol rara
Adenina de la timina (T*) Guanina

Citosina Timina

Forma imino rara


de la adenina (A*) Forma enol rara
de la guanina (G*)
Figura 16-2. Bases mal emparejadas.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
EMS UV AFB1
(a) GC AT GC AT GC AT
39 38 80 36
30 30 30 27

20 20 20

10 10 10

0 0 0
(b) GC TA GC TA GC TA
20 20 20

10 10 10
Nmero de sucesos

0 0 0
(c) AT TA AT TA AT TA
20 20 20

10 10 10

0 0 0
(d) AT CG AT CG AT CG
20 20 20

10 10 10

0 0 0
(e) GC CG GC CG GC CG
20 20 20

10 10 10

0 100 200 300 0 100 200 300 0 100 200 300


Sitio mbar Sitio mbar Sitio mbar

Figura 16-13. Especificidad de los mutgenos.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Dao en
una base

La glucosilasa
de DNA
elimina
la base

Figura 16-29. Accin de las glucosilasas del DNA.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
La endonucleasa
AP realiza el corte

La exonucleasa de
escisin elimina
un tramo de DNA

La polimerasa
sintetiza
nuevo DNA

La ligasa
sella
la mella

Figura 16-30. Reparacin de sitios AP (apurnicos o apirimidnicos).

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
(a) Por rotura y reunin
Delecin

Prdida
Delecin

Duplicacin

Inversin

Translocacin
recproca
Clave = rotura
= segmentos de DNA repetido
= reunin

= entrecruzamiento
Figura 17-1a. Origen de las reorganizaciones cromosmicas.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
(b) Por entrecruzamiento entre DNA repetitivo

Prdida

Delecin

Delecin

Duplicacin

Inversin

Translocacin
recproca
Clave = rotura
= segmentos de DNA repetido
= reunin

= entrecruzamiento
Figura 17-1b. Origen de las reorganizaciones cromosmicas.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Gc Ac d b

Gc Ac d b

Gc Ac d bd b

Gc Ac db
Anti-Lepore Lepore

Gc Ac d b

Gc Ac d b

Gc Ac d bAc d b

Gc Ac b
Anti-Kenia Kenia

Figura 17-13. Mecanismo propuesto para la formacin de variantes de las subunidades de la hemoglobina humana
por recombinacin asimtrica en la regin gentica c-d-b.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Puntos de ruptura entre genes
Ordenacin normal
A P B C D
5 3
3 5
P P

Rotura en el DNA
A P B C D
5 3 5 3 5 3
3 5 3 5 3 5
P P P

Alineamiento invertido
A P C P B P D
5 3 5 3 5 3
3 5 3 5 3 5
P

La unin de las roturas completa la inversin


A P C P B P D
5 3
3 5
P

Inversin
Figura 17-14a. Efectos de las inversiones en el DNA.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Un punto de ruptura entre genes
Un punto de ruptura en medio del gen C (C interrumpido)
A P C P B P C D
5 3
3 5
P

Inversin

Puntos de ruptura en medio de los genes A y D


Generndose dos fusiones gnicas
A D P C P B P A D
5 3
3 5
P

Inversin
Figura 17-14b. Efectos de las inversiones en el DNA.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
A B C D E
Heterocigoto para una
inversin paracntrica
A D C B E

Emparejamiento

Entrecruzamiento
en el bucle C
B D
C
A B D E

Segregacin

A B C D E A B C D E

A E A
Fragmento
D acntrico B
B (se pierde)
C C
C E
B D
D

A El puente dicntrico
se rompe al azar A

A D C B E A D C B E

A B C D E
Producto normal
A B C D
Producto con delecin

Producto con delecin


A D C B E
Producto con inversin

Figura 17-16. Productos meiticos resultantes de un solo entrecruzamiento dentro


del bucle de una inversin paracntrica.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
A B C D
Heterocigoto para
una inversin
A C B D pericntrica

Emparejamiento

Entrecruzamiento en el bucle
B C

A B C D

Segregacin

Fin de la meiosis I Fin de la meiosis II


A B C D
A B C D Producto normal
A B C A
A B C A Duplicacin de A
y delecin de D
D B C D
D B C D Duplicacin de D
y delecin de A
D B C A
D B C A Producto con
inversin

Figura 17-17. Productos meiticos resultantes de una meiosis con un solo


entrecruzamiento dentro de un bucle de inversin pericntrica.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Heterocigoto para una translocacin

Posicin original de los


segmentos translocados

N1 N2
Normal
T1 T2
Translocado

T1 N2
Configuracin del
emparejamiento
N1 T2

Dos tipos de
segregaciones

Adyacente 1 Productos

Arriba T1 + N2 Duplicacin del segmento prpura


translocado y delecin del naranja A
menudo
Abajo T2 + N1 Duplicacin del segmento naranja inviables
translocado y delecin del prpura
Alternada
Genotipo
Arriba T1 + T2 translocado Ambos
completo completos y
viables
Abajo N1 + N2 Normal

Figura 17-23. Productos meiticos resultantes de los dos tipos ms frecuentes de


segregaciones cromosmicas en un heterocigoto para una translocacin recproca.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Portador de una translocacin
Progenitor normal Robertsoniana

21 Roturas
21
14
14 Prdida

Emparejamiento
meitico

Gametos del
portador de la
translocacin

Gametos del
parental normal

Sndrome de Down Portador Normal Letal


de la translocacin

Figura 17-27. Manifestacin del sndrome de Down en los hijos de un individuo no afectado portador de un tipo especial de translocacin, denominada
translocacin Robertsoniana, en la cual se han fusionado los dos brazos largos de dos cromosomas acrocntricos.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Gametos producidos
Apareamiento por la unin aleatoria
al huso acromtico

Figura 18-7. Consecuencias genticas del apareamiento en forma de bivalentes


en un tetraploide.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
n=9

Gametos

n=9

Raphamus
2n = 18

Parentales
Hbrido F1 estril
n+n=9+9 Raphanobrassica
(2n) = (18)
Brassica Anfidiploide frtil
2n = 18 2n + 2n = 18 + 18
(4n) = (36)

Figura 18-9. Origen del anfidiploide (Raphanobrassica) formado a partir de la col (Brassica) y el rbano (Raphanus).

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
B. oleracea,
2n = 18
Col, coliflor,
brcol, col
rizada, colinabo,
coles de bruselas

n=9 n=9

B. carinata, B. napus,
2n = 34 2n = 38.
Mostaza Nabo
abisinia sueco, colza

n=8
n = 10
n=8 n = 10

B. nigra, B. juncea, B. campestris,


2n = 16 2n = 36 2n = 20
Mostaza Mostaza Col china,
negra en rama nabo, colza

Figura 18-11. Tringulo de especies que muestra la importancia de la anfidiploida en la produccin de nuevas especies de Brassica.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Un trigo silvestre
Cultivado Un trigo silvestre
diploide,
como trigo diploide T.
posiblemente
Einkorn AA monococcum AA
T. seasii BB

AB

(2)

Un trigo silvestre
tetraploide T.
turgidum AA BB

Un trigo silvestre Cultivado como trigo


diploide T. tauschii Emmer 10 000 aos
DD a. de C. AA BB

ABD

(2; hace ~8000 aos)

Trigo hexaploide
T. aestivum
AA BB DD

Figura 18-12. Diagrama del origen propuesto para el trigo hexaploide actual, que implica la produccin de anfidiploides
en dos momentos distintos.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Protoplastos Protoplastos

Suspensin Suspensin
de clulas de clulas

Fusin de
protoplastos
en presencia
de pilietilenglicol

Monoploide Monoploide
amarillento (y) blanquecino
fotosensible (w) fotosensible
Protoplastos Callos hbridos,
sembrados verdes y fotorresis-
tentes (y/y + w/w +)

Planta Planta diploide verde Planta diploide verde


monoploide fotorresistente fotorresistente

Figura 18-13. Construccin de un hbrido a partir de dos lneas monoploides de Nicotiana tabacum por fusin celular.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
No disyucin en Segunda divisin
la primera divisin n+1

n+1

n1

n1

Primera divisin No disyuncin en la


segunda divisin n+1

n1

Figura 18-16. Produccin de gametos aneuploides por falta de disyuncin en la primera o en la segunda divisin meitica.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
1 000 000
de embarazos

850 000 150 000 abortos


nacimientos espontneos

833 000 17 000 muertes 75 000 anomalas


nios perinatales cromosmicas

39 000 trismicos
5165 (3510 trisomas del 21)
anomalas cromosmicas
13 500 XO
1849 aneuploidas para 1427 varones
cromosomas sexuales 422 hembras 12 750 triploides

42 trisomas del 13 4500 tetraploides


1183 trisomas 100 trisomas del 18
para autosomas 5250 otros
1041 trisomas del 21

758 translocaciones
robertsonianas
equilibradas

758 translocaciones
recprocas
equilibradas

117 inversiones

500 aberraciones estructurales


desequilibradas

Figura 18-23. Destino de un milln de cigotos humanos implantados.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
CUADRO 18-2. Nmero y tipo de anomalas cromosmicas
encontradas entre abortos espontneos y nios nacidos vivos
entre 100 000 embarazos

100 000 EMBARAZOS

15 000 abortos 85 000 nacidos


espontneos 7500 vivos 550
cromosmicamente cromosmicamente
anormales anormales

Trisoma
1 0 0
2 159 0
3 53 0
4 95 0
5 0 0
6-12 561 0
13 128 17
14 275 0
15 318 0
16 1229 0
17 10 0
18 223 13
19-20 52 0
21 350 113
22 424 0
Cromosomas sexua-
les
XYY 4 46
XXY 4 44
XO 1350 8
XXX 21 44
Translocaciones
Equilibradas 14 164
No equilibradas 225 52
Poliploida
Triploida 1275 0
Tetraploida 450 0
Otros (mosaicos,
etc.) 280 49
Total: 7500 550

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
(a) A A B
3@ 5@
T
5@ 3@
C
5@ 3@
G
3@ 5@
a b
Cortes de endonucleasa
(b) A A B

G
a b
Intercambio de cadenas
(c) A A B

G
a b
Ligacin
(d) A A B
1
T
2
C
3
G
4
a b
Migracin del punto
de interseccin
(e) A A B
1
T
2
C
3
G
4
a b
Resolucin

(f) A A B A A b
C C
T G
G T
a b a B

Figura 19-9. Mecanismo prototipo para la recombinacin gentica.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
5@
3@
(a) Endonucleasa

(b) Desplazamiento de la cadena

(c) Invasin de la cadena

(d) Eliminacin de la cadena

Migracin
del punto
(e) Ligacin de interseccin

(f) Resolucin

Horizontal

Vertical

Figura 19-13. Modelo heterodplice de Meselson-Radding.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
c d e
3@ 5@
Cromtida a
5@ 3@
c@ d@ e@
C@ D@ E@
5@ 3@
Cromtida a
3@ 5@
C D E

d
3@ 5@
1. Rotura de doble cadena en 5@ 3@
y digestin de los extremos
5' de ambas cadenas cortadas, D@
eliminndose d'

d
3@
2. Invasin de cadena y
formacin de un lazo en
la doble hlice no cortada D@

3. Sntesis de reparacin D@
en una de las cadenas D@

D
Figura 19-14a. Modelo de rotura de doble cadena para la recombinacin meitica en la levadura S. cerevisiae.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
1 3
c d e
4. Sntesis de reparacin
en la otra cadena
c@ D@ e@
C@ 2 2 D@ 4 4 E@
Ligacin y formacin de
las estructuras de Holliday
C D E
1 3
5a. Rotura en 5b. Rotura en
2 y 3 2 y 4

c d E c d e

c D@ E c D@ e@
C D@ e C D@ E@

C D e C D E
Dobles hlices recombinantes Dobles hlices no recombinantes
6. Reparacin del emparejamiento
errneo: escisin de d
y sntesis de D

c D E c D e

c D@ E@ c@ D@ e@
C D@ e@ C@ D@ E@

C D e C D E

Figura 19-14b. Modelo de rotura de doble cadena para la recombinacin meitica en la levadura S. cerevisiae.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Gen 1 Gen 2

Ds
Alelo estable del gen 1
inactivado por Ds
Ds
Ac
Revisin en presencia
de Ac

Ac
Transposicin al gen 2
Ds

Ac
Alelo inestable del gen 1
inactivado por Ac
Ac

Reversin (y transposicin)
de Ac

Figura 20-5. Resumen de los principales efectos de los elementos controladores del maz.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Transposn

Genes del transposn,


que incluyen
la resistencia
a frmacos
IS IS

ABC XYZ C@B@A@

A@B@C@ X@Y@Z@ CBA

(a)

X Y Z

Estructura con
forma de piruleta
C C@
B B@ IR = 2 IS
A A@

(b)
Figura 20-14. Explicacin molecular de la estructura con forma de piruleta. La estructura se denomina transposn.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Tn5 Tn3

kan
R smR su R
amp R
R hg R
cm Tn4 IS1
IS1
10

Segmento determinante de la resistencia


tet R IS
Tn10

0
S1

Segmento para la transferencia de la resistencia


IS2

Figura 20-17. El papel de los elementos transponibles en la evolucin de los plsmidos con resistencia a antibiticos se ilustra con
un mapa esquemtico de un plsmido que contiene muchos genes de resistencia.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
La cpsida entra
Retrovirus en la clula
Sntesis de las hospedadora y
protenas vricas deja las envueltas
necesarias para la en la membrana
construccin de
nuevos virus Cromosoma hospedador

RNA Clula hospedadora


Transcriptasa
inversa
mRNA viral

La cpsida se rompe;
la transcriptasa inversa
El mRNA viral se transcribe a sintetiza un DNA copia a
partir del DNA viral integrado partir del RNA viral

DNA viral DNA


RNA
La transcriptasa inversa
sintetiza la segunda cadena
del DNA copia
El DNA viral de doble
cadena se integra mediante
enzimas desconocidas
en el DNA del cromosoma
hospedador

DNA

Figura 20-29. Ciclo de vida de un retrovirus. El RNA viral se muestra en rojo; el DNA, en azul.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Plsmido con Ty

Regin cifradora
LTR LTR

Elemento Ty

Promotor sensible Intrn de


a la galactosa otro gen

Transcrito primario

mRNA

Las transposiciones del DNA de


Ty carecen del intrn

Figura 20-33. Demostracin de la transposicin a travs de un intermediario de RNA.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
10 kb
1 2 3 4 5 6 7 8 9 10 11 12 13 14

Exones

JoSp Jb Sq Sx Sg Sg Sx Jo Y Alu

SINE
MIR

MER11B
MER11A

MIR

MIR
MIR2

MER5
MER20

MER4
MER4

MIR

MIR
MIR2
MER5

MIR

MIR
LINE
L1PA10
L1PA9

L1

L1PA13
L1PA16
L1PA16

L1MA2
L1PA13
L1
THE1B
MSTB
LTR
MLT1D

THE1C

THE1B
MLT1B

MSTA
MSTA
THE1B
MSTA
MLT1B
(TACC)n

(CA)n

(CT)n

(CCCT)n
(TTCC)n

(GA)n

(CA)n
SSR

D3S4496 D3S4497

Figura 20-36. Elementos repetidos encontrados en el gen humano (HGO) que cifra la dioxigenesa del cido
homogentsico, la enzima cuya falta causa la alcaptonuria.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
*P P
Aguja

ry +
0.5 mm Embrin

ry/ry (M)
Plsmido ry + Plsmido auxiliar

Adulto
Ojos ry
ry ry (M)

(Alelo ry + en algunas
clulas de la lnea
germinal)
(Ojos ry + )

Algunos
descendientes
ry + /ry

Figura 20-38. Transferencia gnica en Drosophila mediada por el elemento BP.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
DNA mitocondrial de levadura (~ 78 kb)

RNA Cys Leu


ribismico Gln Lys
Thr His
grande Arg Gly Asp Arg
Ser
Ala
lle Tyr
ery R
cap R Asn
Protena
asociada a spi R RNA Met
ri
bos
los ribosomas Thr pequemico
o
Ser rib R Oxidasa II del
b o N citocromo c
o gr smA
Subunidad 9 rom an i
de co
mit
toc Phe Phe
de la ATPasa
oli R Ci Pro Val
Leu Val
ND6 Glu Thr
Oxidasa III del
ND1mit citocromo
Citocromo b

lle
ND5 f Met
Gln
mit DNA mitocondrial
humano (~ 17 kb)
ND2
Leu Ala
Ser Asn f Met
Cys Trp Pro
Glu His Tyr Trp
Subunidad
o el

ND4 Arg Ser


om I d

8 de la
c

Gly ATPasa Lys


cr a
to as
ci xid

ND4L
O

Asp par R
oli R ND3 RNA
Ox el
i
citodasa a II d c ribosmico
s o pequeo
cro III d Subunidad 6 ida om
mo el de la ATPasa Ox itocr Trp
c c
mit
Ox
i da
sa I d
e l ci tocromo c

Figura 21-3. Mapa de los mtDNA humano y de levadura.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
H+
ADP ATP

H+ H+ H+

Matriz
SDH
ND1 ND2 ND3
Membrana Cyt b COX I A8 A6
interna ND6 ND4 Cyt c COX II
ND5 ND4L CoQ
COX III
Espacio intermembrana

Subunidades Complejo I Complejo II Complejo III Complejo IV Complejo V


Cifrados en el DNA nuclear 35 4 10 10 12
Cifrados en el DNA mitocondrial 7 0 1 3 2

Figura 21-4. Cadena respiratoria de la mitocondria.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Segunda letra
Primera letra

Tercera letra

Figura 21-5. Cdigo gentico de la mitocondria humana.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
g)
L(Ua

C)*
Traduccin

I(UG
N(

)*
GU

GC
rps Protenas

U)

5S A(U
ribosmicas 30S

23 S
4 .5
S
C)
*
rpl Protenas de la

frx G
UG
A( )

R(
subunidad ribosmica 50S

C )
AU

AC
5S
I(G

4.
trn tRNA (indicados con el

5S
23
A( S )
16 AC cdigo de una letra para

S
*rp I(G UGC V(G
s@1 16 AU )*
)*
SSC ) cada aminocido)
rps 2 V(
S U
A 3 4.5S, 5S,
*nd 7 GA I(C pl2 2 16S, 23S rRNA
h2 r pl
L(CA
C)
IR *r s19 infA Factor de iniciacin

A
rp 22

IR
A)
B
rpl 3 secX Protena ribosmica 50S
rps
l16
C(GC
A) *rp 4
rpoB rpl1
rps8
infA petD* Fotosntesis y transporte
secX petB* de electrones
rps11 psbH
*rpoC1
rpoA psbB rbc carboxilasa de la
*rps1
ribulosa bifosfato
2
rpl2
psa fotosistema 1
rpoC2 PP( 0
U
W(CGG)
psb fotosistema 2
rps18
ps
CA)
rpl33 pet complejo de citocromos blf
rps2 ps bE
atp1
U)
bF atp sintetasa de ATP
H UC )*
atp F R( (UCC frx Protenas hierro-azufre
p Pet
*at A G a
atp ndh oxidorreductasa del
LSC NAD(P)H
at

*V ndsbG
pB
)

(UA h3
R(

at C)
U rb
GC )

pE
C

T(U ps 4
S( UUG cL CG)

p
Q( Transcripcin

GU
fM(CAU)
Y(GUA )
E(UUC )
D(GUC

S(UGA)

r
)

)
psaA
rps 14
psaB

rpo polimerasa de RNA


)
U

M
U

(C
G) A
(U

GU b

AU
*K

Q( ps

F( (UA

)
L
G A
AA )*
S(G

)
mbpX

GA
psbD
psbC

Miscelnea
T(GGU)

G(GCC)

mbpX Permeasa

Figura 21-6. Genoma del cloroplasto de la heptica Marchantia polymorpha.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Sordera inducida
por aminoglucsido Sordera
Miopata
MELAS Deficiencia
MELAS MILS respiratoria
PEO
Miopata 12S F
V PT Miopata
Miocardiopata
Diabetes y 16S Cytb Miopata
sordera
E LHON/Distona
MELAS L
ND6
LHON
ND1 MELAS
mt DNA
PEO I humano
16 569 pb ND5
Miocardiopata Q
M
ND2
Corea W Delecin
MILS A tpica en
N KSS/PEO L
PEO C S Anemia
Encefalopata Y H
COX Miopata
Miopata
ND4L/4 LHON
S
D R LHON/
MERRF COX II ND3 Distona
COX III
K ATPase 8/6 G
Sordera
Ataxia; mioclono
Miocardiopata
Sordera MELAS
Cardiopata MERRF
NARP Mioglobi-
MILS nuria Encefalomiopata
FBSN

Enfermedades:
MERRF Epilepsia mioclnica y enfermedad de las fibras rojas rotas
LHON Neuropata ptica hereditaria de Leber
NARP Debilidad muscular neurognica, ataxia y retinitis pigmentaria
MELAS Encefalopata mitocondrial, acidosis lctica y sntomas similares a golpes
MMC Miopata y cardiopata de herencia materna
PEO Oftalmopleja externa progresiva
KSS Sndrome de Kearns-Sayre
MILS Sndrome de Leigh de herencia materna

Figura 21-8. Mapa del DNA mitocondrial (mtDNA) humano que muestra los loci de las mutaciones que causan citopatas.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Clula somtica

Mutacin

Heteroplasmonte

Supresividad
o deriva

Segregacin
citoplsmica

Progenitor

Progenitor Progenitor

Cigoto

Segregacin Cigoto Cigoto


citoplsmica

Mosaico

Figura 21-11. Destino gentico de una mutacin en el DNA de un orgnulo.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Crecimiento lento (sg) Espora asexual
Marcador nuclear (leu+)

+
Cultivo
Crecimiento normal (sg )
Marcador nuclear (leu)

Heterocarionte Aislamiento
de sg leu

Figura 21-12. La prueba del heterocarionte se emplea para detectar herencia extranuclear en los hongos filamentosos.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
(a) poky (b) normal

(ad + ) (ad )
Poky ad Normal ad

2n 2n

normal Poky ad + poky Normal ad +

(ad ) (ad + )

Figura 21-13. Explicacin de los resultados distintos obtenidos en los cruzamientos recprocos entre una estirpe de Neurospora poky y otra normal.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Clula de
Cigoto de la hembra polen del Constitucin del cigoto (2n)
(n) macho (n)

blanco Cualquier

Blanco

verde
Cualquier

Verde

variegado
Cualquier

vulo Blanco
de tipo 1

vulo
de tipo 2 Verde

vulo
de tipo 3
Divisin
variegado

clulas

Figura 21-15. Modelo basado en la herencia autnoma de los cloroplastos, que explica los resultados de los cruzamientos
en Mirabilis jalapa.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Fusin
a a

(n) (n)
(2n)
a/a
Mitosis

+
a/a
a/a (2n)
Meiosis (2n)

(n) a a (n)
(n) a a (n)

Mitosis Mitosis

(n) a (n) a

Colonia Colonia
o cultivo o cultivo

Figura 21-17. Ciclo de vida de la levadura de panadera (Saccharomyces cerevisiae).

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
(n) (n)

(a) (a)

ery R ery S
(2n)
R
a/a ery
ery S
Heteroplasmonte
diploides
Algunos

(2n) (2n) (2n) (2n) (2n)


ery R ery S ery S ery R ery R

Meiosis Meiosis Meiosis Meiosis Meiosis

ery R a ery S a ery S a ery R a ery R a


ery R a ery S a ery S a ery R a ery R a
ery R a ery S a ery S a ery R a ery R a
ery R a ery S a ery S a ery R a ery R a
Figura 21-18. En las levaduras, ciertos fenotipos de resistencia a frmacos presentan un patrn de herencia especial.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Protena
diana

Unin Unin a
Ciclina ciclina- la protena
CDK diana

CDK

Fosforilacin
de la protena
P P diana

Figura 22-1. Pasos en la fosforilacin de las protenas diana por el complejo ciclina-CDK.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Clula normal

Mitocondria
intacta

DNA
cromosmico
intacto

Ncleo

Se inicia
la apoptosis
Muerte celular
Mitocondria
fragmentada

DNA muy
fragmentado

Clula redondeada
La clula
se disgrega
en pequeos
fragmentos Macrfago

Eliminacin de Cuerpo
los fragmentos apopttico
celulares

Figura 22-6. Secuencia de cambios fenotpicos durante la apoptosis.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Sitio de unin
Ligando del ligando

Unin
Dominio del ligando Autofosforilacin
extracelular de tirosinas
Dimerizacin
Exterior del receptor
Hlice-a
transmembrana

Tirosinas fosforiladas
Citosol
Sitio
ATP ATP P P
cataltico
Dominio de la P P
citoslico quinasa
P P
ADP ADP
P P
Dominio
de amarre
Protena
de amarre
(a)
Figura 22-12a. Cambios en la actividad del RTK y en la cascada de transduccin de seales provocados por la unin de un ligando.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Sitio de unin
Ligando
del ligando

Unin
Dominio del ligando Autofosforilacin
extracelular de tirosinas
Dimerizacin
Exterior del receptor
Hlice-a
transmembrana
Citosol

Tirosinas fosforiladas
Sitio
ATP ATP P P P
cataltico
Dominio de la P
citoslico P P
quinasa
P
P P
ADP ADP
P P

Protena P P P
sustrato

Fosforilacin
de tirosinas
por el RTK
(b) dimerizado
Figura 22-12b. Cambios en la actividad del RTK y en la cascada de transduccin de seales provocados por la unin de un ligando.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Centrmero
mRNA bcr1 normal
Cromosoma 22

Gen bcr1

Cromosoma 9 Gen c-abl

Recombinacin

mRNA hbrido bcr1-abl

Translocacin (9;22)

Protena de fusin Bcr-Abl

Figura 22-21. Reorganizacin cromosomica en la leucemia mieloide crnica (LMC).

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
RETINOBLASTOMA HEREDITARIO

RB/rb RB/RB
Tumores

RB/rb
rb@ rb
Cigoto Segunda
mutacin

RB rb

rb rb
Recombinacin
mittica (a)

RETINOBLASTOMA ESPORDICO

RB/RB RB/RB
Tumores

RB/RB
RB rb Segunda rb@ rb
mutacin
Cigoto Primera
mutacin

RB RB

Primera RB rb Recombinacin rb rb
mutacin mittica

(b)

Figura 22-23. (a) Retinoblastoma, un cncer de la retina. (b) Origen mutacional de los tumores de la retina en el
retinoblastoma hereditario y en el espordico.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
(a)

PE
Sxl Conexin Sxl

Protena
SXL
Exn X
AUG
Bucle de
PL autorregulacin PL
positiva

Protena
SXL Protena SXL
inactiva
AUG
Mantenimiento AUG
UGA
Sxl Sxl
Procesamiento conectado Procesamiento desconectado
especfico femenino por defecto

Figura 23-7a. Conexin y mantenimiento del interruptor Sxl.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
(b)
X : A = 1 (XXAA) X : A = 0.5 (XAA)

Factor de transcripcin X:A activo


Subunidad del
numerador
(NUM)

Subunidad del
denominador (DEM)

Dmeros inactivos

Figura 23-7b. Conexin y mantenimiento del interruptor Sxl.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
(a) Procesamiento alternativo de tra
Transcrito primario tra
1 2 3 mRNA de X y Y

AUG UAG (parada)


mRNA
1 2 3 especfico
de Y
AUG UGA Protena TRA
Protena SXL

(b) Procesamiento alternativo de dsx


3
1 2 5 6 Transcrito primario dsx

AUG UAG mRNA


especficos DSXM
3
1 2 5 6 de X

AUG
3
mRNA DSXF
1 2 4 especficos
de Y
AUG UAG

Protena TRA

Figura 23-8. Procesamiento alternativo de los transcritos tra y dsx.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
0 30 60 90
kb

GMGY3
HFO.2

PO.9
H2.1

E1.3

27A
Telmero Centrmero

Localizacin
de TDF

Lmite Lmite del punto


de ruptura en
varones XX

Puntos de
Lmite ruptura
XXX
5 10 15 20 25 30 35 40 kb

pY53.3 pY53.1 pY53.2


Regin pYNB pY4.1b pYR0.4 pYH8
pseudoautosmica a b c

Especficos de Y + + + + + + + + +
(humano)
Especficos de Y +
(bovino, murino)
Regin TDF ampliada

Figura 23-10. Mapa molecular de la regin distal del brazo corto del cromosoma Y humano.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Lnea media dorsal

Ncleos

Receptor
TOLL

Protena
DL

Membrana
plasmtica Ligando
SPZ

Lquido Membrana
perivitelino Lnea perivitelina
media ventral
(a)
Figura 23-27a. Ruta de sealizacin que dirige la formacin del gradiente de localizacin nuclear frente a la localizacin
citoplsmica de la protena DL.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
SPZ

Receptor Membrana
TOLL plasmtica

TUB

PLL ATP CACT

CACT DL +
Fosforilacin
DL

Ncleo
Importacin

DL

Regulacin de
genes cigticos
de formacin
de patrones

(b)
Figura 23-27b. Ruta de sealizacin que dirige la formacin del gradiente de localizacin nuclear frente a la localizacin
citoplsmica de la protena DL.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
(a) Membrana
celular
(1)
Elemento del
citoesqueleto

(2)

Molculas localizadas
de mRNA de un factor
de transcripcin
(3)

Factor de transcripcin
recin traducido

(4)

Direccin de la difusin
de la protena

(b) Envuelta
celular
(1) (campo de
desarrollo)

Clula secretora
de la seal de
informacin
(2) posicional

Receptor
de la seal

(3)

(4)
Ruta de
transduccin de
seal activada

(5)

Bajo nivel Bajo nivel


de activacin Alto nivel de de activacin
activacin del
factor de
transcripcin

Figura 23-28. Los dos tipos generales de informacin posicional.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Oocito con mRNA
de origen materno Anterior Posterior

bcd nos
mRNA mRNA

Gradientes de protenas cifradas NOS


por mRNA maternos

BCD HB-M

Protenas gap

HB-Z
HB-Z
KR KNI

Protenas de la
regla de los pares SCR

Protenas
H hometicas
RUN

Protenas de
polaridad ANTP UBX ABD-A ABD-B
segmental

WG EN

Figura 23-35. Esquema de la cascada jerrquica que activa los elementos que generan el patrn de segmentacin
A-P de Drosophila.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Direccin de la transcripcin de los genes HOM-C

Genes
hometicos lab pb Dfd Scr Antp Ubx abdA AbdB
de insectos
ANT-C BX-C
ANTERIOR
POSTERIOR

REGIONES 1 2 3 4 5 6 7 8 9 10 11 12 13

Hox A A1 A2 A3 A4 A5 A6 A7 A9 A10 A11 A13

Genes Hox B B1 B2 B3 B4 B5 B6 B7 B8 B9
hometicos de
mamferos Hox C C4 C5 C6 C8 C9 C10 C11 C12 C13

Hox D D1 D3 D4 D8 D9 D10 D11 D12 D13


3@ 5@
Direccin de la transcripcin de los genes Hox
(a)
Figura 23-40a. Comparacin de la estructura y la funcin de los genes hometicos de insectos y de mamferos.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Drosophilla Ratn

Anterior Cabeza

lab
Hox 1
pb Hox 2
Dfd Hox 4
Hox 58

Hox 9
Grupo Antp
(Scr, Antp,
Ubx y abd-A)

Abd-B
Posterior Cola

(b)
Figura 23-40b. Comparacin de la estructura y la funcin de los genes hometicos de insectos y de mamferos.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Estambre
Carpelo

Spalo
Ptalo

(a)

se
ca
pe
st

(b)

Figura 23-44. Desarrollo floral en Arabidopsis thaliana.

B B B B
(a) A A C C C C A A
se pe st ca ca st pe se

Patrn de expresin
(b) de genes florales

A B C Clase de genes

Figura 23-45. Expresin de los genes de identidad de los rganos florales y el


establecimiento del destino de los verticilos.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
1.0

0.9
a/a A/A
0.8

0.7

0.6
A/a
0.5

0.4

0.3

0.2

0.1

0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1.0 p(A)
1.0 0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0 q(a)
Figura 24-5. Curvas que muestran las proporciones de homocigotos A/A (lnea
azul), homocigotos a/a (lnea naranja) y heterocigotos A/a (lnea verde) en poblaciones
con diferentes frecuencias allicas, si las poblaciones estn en equilibrio Hardy-
Weinberg.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
(altura en cm)
Fenotipo

No
rm

de
a

re
ac
c i
n

Ambiente (C)
18 20 22

Figura 25-5. La norma de reaccin de un genotipo convierte la distribucin de


condiciones ambientales del eje horizontal en la distribucin de fenotipos del eje vertical.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Fenotipo a
Fenotipo A

Fenotipo A Genotipo A

Fenotipo a
Genotipo a

Ambiente

Figura 25-6. Dos distribuciones ambientales distintas dan lugar a dos distribuciones fenotpicas diferentes de dos genotipos.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
CIM1 Generacin

M2
X individual de YY de la lnea
la poblacin equilibrada
y marcada
CIM1
F1
CIM1 M2
X individual de YY de la lnea
fenotipo M1 equilibrada
y marcada

F2
CIM1 CIM1
XX de fenotipo M1 YY de fenotipo M1

CIM1
F3
CIM1 CIM1
Homocigotos para un Heterocigotos Mueren antes
cromosoma silvestre de fenotipo M1 de eclosionar

Proporciones
esperadas 0.25 0.50 0.25
entre los 0.333 0.667
adultos
observados

Figura 25-7. Mtodo para llevar autosomas a homocigosis mediante la utilizacin de dos genes marcadores dominantes,
M1 y M2, un supresor de entrecruzamientos, C, y un gen letal, l.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Generacin
parental

Mismo
ambiente

Heredable

No heredable

Figura 25-10. Mtodo estndar para comprobar la heredabilidad en organismos


de experimentacin.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Peso corporal
Longitud de las patas
Tamao y Longitud de la quilla
conformacin Anchura del cuerpo
Anchura y ngulo de
la pechuga

Descendientes viables
Tasa de crecimiento
Produccin Madurez sexual
de huevos Pausas en la puesta
Produccin en granja
Persistencia

Peso del huevo


Incidencia de manchas
de sangre
Calidad Color de la cscara
Peso de la albmina
de los Forma del huevo
huevos Calidad de la albmina
Textura de la cscara
Grosor de la cscara
Peso de la yema

Mortalidad total
Tasa de eclosin
Viabilidad Enfermedades respiratorias
Trastornos reproductivos

Otros Peso de algunos rganos internos


Tasa de plumaje

0 0.5 1.0
Grado de heredabilidad

Figura 25-15. Rango de heredabilidades (h2) publicadas para diversos caracteres


de gallinas. (De I. M. Lenner y W. J. Libby, Heredity, Evolution and Society. Copyright
? 1976, de W. H. Freeman and Company. Fotografa ? Kenneth Thomas/Photo
Researches.)

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
t = N/5
Proporcin de islas

t=N

t = 2N

t = 4N

0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1.0
Frecuencia allica de A
Figura 26-5. Distribucin de las frecuencias allicas en poblaciones isleas tras
varios nmeros de generaciones de aislamiento, donde el nmero de generaciones
transcurridas (t) se representa como mltiplos del tamao de la poblacin (N).

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Ab/Ab AB/AB
1.0

0.9

0.8

0.7 Ab/Ab aB/aB


Frecuencia de A

0.6

0.5 nso
e ab/ab
esc
d (b)
0.4 de
a
ne
L
0.3

0.2

0.1

0.0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1.0
ab/ab Frecuencia de B aB/aB
(a)
Figura 26-6. Un paisaje adaptativo con dos cimas adaptativas (en rojo), dos valles adaptativos (en azul) y un collado topogrfico en el centro del paisaje.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Ab/Ab AB/AB
1.0

0.9

0.8

I
0.7

ta
Ru
II
a
t
Ru

0.6
Frecuencia de A

0.5

0.4

0.3

0.2

0.1

0.0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1.0
ab/ab Frecuencia de B aB/aB

Figura 26-8. La seleccin y la deriva gentica pueden interaccionar y producir


distintos cambios en las frecuencias allicas en un paisaje adaptativo.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
Cromosomas Longitud de los testculos (en micras)
0 25 50 100 200 400 700
2 3 4
X
1

16

15

14

13

12

11

10

9
0 25 50 100 200 400 700
Figura 26-11. Tamao de los testculos en retrocruzamientos con hbridos de
Drosophila pseudoobscura y D. persimilis.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
b de ornitorrinco

b de tiburn
b de gallina
c bovina
b humana

d humana

c humana

e humana
b Rhesus

b bovina
Gen d
Gen c
Gen e

Primates Monotremas

Artiodctilos

Reptiles
Gen c
Placentarios y aves

Mamferos

Peces
cartilaginosos

Peces seos
y
vertebrados
terrestres

Gen b

Figura 26-15. Reconstruccin de la diversificacin de la familia gnica de las


globinas de tipo b a lo largo de la evolucin de los vertebrados.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin
220

Aves/reptiles

Vertebrados/
Mamferos/
Mamferos
Nmero de sustituciones de aminocidos por cada 100 residuos
200

Reptiles/

lamprea

insectos
reptiles

Carpa/
peces
180

160

tidos
opp
A
140

1.1 M
Fibrin
120
na
o bi
l
100 og A
m M
He 5.8

80

60

c Separacin de
40
it oc romo los antepasados
C
MA comunes de
20.0
20 animales
y plantas

0
100 200 300 400 500 600 700 800 900 1000 1100 1200 1300
Millones de aos (MA) desde la divergencia

Figura 26-18. Nmero de sustituciones de aminocidos en la evolucin de los vertebrados en funcin del tiempo transcurrido desde el comienzo de la divergencia.

? 2002 McGraw-Hill Interamericana de Espaa, S. A. U. J. F. Griffiths, et. al. GENTICA, 7.a edicin