Gene 580 (2016) 4757

Contents lists available at ScienceDirect

Gene

journal homepage: www.elsevier.com/locate/gene

Research paper

Molecular cloning, characterization and tissue specicity of the

expression of the ovine CSRP2 and CSRP3 genes from Small-tail Han
sheep (Ovis aries)
Guanqing Liu, Chunlan Zhang, Guizhi Wang, Zhibin Ji, Zhaohua Liu, Tianle Chao, Saisai Zhang, Jianmin Wang
Shandong Provincial Key Laboratory of Animal Biotechnology and Disease Control and Prevention, College of Animal Science and Veterinary Medicine, Shandong Agricultural University, Taian,
Shandong Province, PR China

a r t i c l e i n f o a b s t r a c t

Article history: Two genes, cysteine- and glycine-rich protein 2 (CSRP2) and cysteine- and glycine-rich protein 3 (CSRP3), play
Received 7 January 2015 important roles in tissue-specic cell growth and development. However, few CSRP2 and CSRP3 genes have
Received in revised form 22 December 2015 been functionally characterized in sheep. In this study, the full-length cDNAs of the CSRP2 and CSRP3 genes
Accepted 4 January 2016
were cloned from Small-tail Han sheep by rapid amplication of cDNA ends-PCR. The GenBank accession num-
Available online 15 January 2016
bers of the full-length CSRP2 and CSRP3 cDNA sequences are KJ743957 and KJ743958, respectively. The full-
Keywords:
length cDNA of ovine CSRP2 was 917 bp, with a 582-bp open reading frame encoding 193 amino acids. The com-
Small-tail Han sheep plete ovine CSRP3 cDNA was 917 bp, with a 585-bp open reading frame encoding 194 amino acids. Alignment and
Cysteine- and glycine-rich protein 2 phylogenetic analyses revealed that their amino acid sequences are highly similar to those of other vertebrates,
Cysteine- and glycine-rich protein 3 all of which contain two conserved LIM-only domains and a relatively conserved nuclear targeting sequence. To
Cloning and sequence analysis further validate the functions of the two genes, their mRNA expression patterns were evaluated in various Small-
Tissue-specic expression tail Han and Dorper sheep tissues using qRT-PCR analyses. CSRP2 was mainly detected in the aorta, whereas
CSRP3 was highly concentrated in the heart and the muscle. CSRP3 was expressed to a higher level in the hearts
of Small-tail Han sheep than in Dorper sheep (P b 0.05). However, the opposite was found in the muscle (the
longissimus dorsi and biceps femoris); CSRP3 was expressed to a higher level in Dorper sheep than in Small-
tail Han sheep (P b 0.05). We quantied the CRP3 protein (coded by the CSRP3 gene) levels in different tissues
in Small-tail Han and Dorper sheep. We also detected a putative isoform of the CRP3 protein in sheep, which
was signicantly different in the heart tissue of the two breeds (P b 0.05). The expression patterns of the two
genes' mRNAs and CRP3 protein showed clear tissue specicity in both sheep breeds.
2016 Elsevier B.V. All rights reserved.

1. Introduction
Two proteins, cysteine-rich protein 2 (CRP2) and cysteine-rich pro-
tein 3 (CRP3, also known as MLP), belong to the cysteine-rich protein
(CRP) family (Weiskirchen et al., 1995). The family also includes CRP1
and TLP (Weiskirchen et al., 1995; Kirchner et al., 2001). Members of
the CRP family are found both in the nucleus and along cytoskeletal el-
ements in the cytoplasm (Arber et al., 1994; Arber and Caroni, 1996; Jain
Abbreviations: CSRP2, cysteine- and glycine-rich protein 2; CSRP3, cysteine- and
glycine-rich protein 3; CRP2, cysteine-rich protein 2; CRP3, cysteine-rich protein 3; SH,
Small-tail Han sheep; DP, Dorper sheep; LD, longissimus dorsi; BF, biceps femoris;
GAPDH, glyceraldehyde-6-phosphate dehydrogenase; ORF, open reading frame; qRT-
PCR, quantitative reverse transcription polymerase chain reaction; RACE, rapid amplica-
tion of cDNA ends; SE, standard error; TGF, transforming growth factor; UTR, untranslated
region; bp, base pair(s); cDNA, DNA complementary to RNA; pI, isoelectric point; KDa,
kiloDalton(s); L, microliter.
Corresponding author at: College of Animal Science and Veterinary Medicine,
Shandong Agricultural University, Daizong Road No. 61, Taian 271018, Shandong
Province, PR China.
E-mail address: wangjm@sdau.edu.cn (J. Wang).
et al., 1996; Louis et al., 1997; Pomies et al., 1997; Weiskirchen et al.,
2001; Kadrmas and Beckerle, 2004). These proteins have tandem func-
tional LIM zinc-nger domains, each followed by a glycine-rich domain
(Louis et al., 1997; Harper et al., 2000), and they regulate gene tran-
scription by binding to specic transcription factors (Weiskirchen
et al., 1995; Kirchner et al., 2001). Since the initial identication of
CRP2, which was found in a screen looking for genes whose expression
patterns were altered in transformed broblasts (Weiskirchen and
Bister, 1993), and CRP3 in rats (Arber et al., 1994), these proteins have
been identied in shes, birds, mammals and other animals, indicating
that CRP2 (Weiskirchen et al., 1995, 1997; Jain et al., 1996; Delalande
and Rescan, 1998; Henderson et al., 2002) and CRP3 (Arber et al.,
1994; Fung et al., 1995; Harrod et al., 1996) are extensively distributed
in eukaryotes.
CRP2 protein is encoded by the cysteine- and glycine-rich protein 2
(CSRP2) gene, which plays an important role in the growth and differen-
tiation of smooth muscle. CSRP2 is widely expressed, but it is more
abundant in aortic (compared to venous) smooth muscle cells (Jain
et al., 1996; Wei et al., 2005). CRP2 serves as a bridging molecule that

http://dx.doi.org/10.1016/j.gene.2016.01.021
0378-1119/ 2016 Elsevier B.V. All rights reserved.
48 G. Liu et al. / Gene 580 (2016) 4757

associates with the serum response factor (SRF) and GATA proteins dorsi, biceps femoris and subcutaneous fat, were immediately collected
(Chang et al., 2003). In the nucleus, CRP2 acts as a co-adaptor that re- and frozen in liquid nitrogen until RNA isolation.
models silent cardiac myocyte chromatin and directs SRF-related
smooth muscle gene activity (Chang et al., 2007). Transforming growth 2.2. RNA extraction and cDNA synthesis
factor (TGF)- induces CRP2 expression in vascular smooth muscle cells
(VSMCs), and TGF- treatment reduces wild-type, but not CSRP2- Total RNA was extracted from the SH biceps femoris using RNAiso
decient VSMC migration, demonstrating the functional importance of Plus Reagent (TaKaRa, Japan) according to the manufacturer's instruc-
CRP2 induction by TGF- in regulating VSMC migration (Lin et al., tions. The quality of the total RNA was checked by electrophoresis on
2008). Recent studies have found that divergent signaling pathways co- a 1% agarose gel. The nal RNA concentration was determined using a
operatively regulate TGF- induction of CSRP2 in VSMCs (Wu et al., protein and nucleic acid spectrophotometer (Eppendorf, Germany) at
2014). 260 and 280 nm wavelengths. Then, total RNA was reverse transcribed
CRP3 is encoded by the cysteine- and glycine-rich protein 3 (CSRP3) to cDNA using a PrimeScript RT Reagent Kit (TaKaRa, Japan) according
gene, which is most highly expressed in striated muscle (skeletal mus- to the manufacturer's instructions. The cDNA was used as the template
cle and cardiac muscle) (Arber et al., 1994) and plays an essential role to amplify CSRP2 and CSRP3 and was stored at 20 C.
in the proliferation and differentiation of striated muscle cells (Arber
et al., 1994; Barash et al., 2005; Knoll et al., 2010). CRP3 is a positive reg- 2.3. Amplication and cloning of full-length CSRP2 and CSRP3 cDNAs
ulator of myogenesis (Arber et al., 1994; Arber and Caroni, 1996). In the
cell nucleus, CRP3 acts as a highly specic cofactor for myogenic basic All forward and reverse primers used in this study (listed in Table 1)
helix-loop-helix (bHLH) proteins (MyoD, myogenin, MRF4, etc.) by en- were designed with Primer Premier 5.0 software (Premier, Canada)
hancing their interplay in the control of regulatory pathways that pro- using fragments for amplication based on the Bos taurus CSRP2
mote myogenesis and differentiation (Arber et al., 1994, 1997). (NM_001038183.1) and CSRP3 (NM_001024689.3) mRNA sequences
However, in the cytoplasm, CRP3 serves as a scaffold protein that inter- in GenBank. The PCR procedures are shown in Table 2.
acts with a number of structural proteins (telethonin, -actinin, colin-
2, Z-disk, N-RAP, -spectin, etc.) and maintains the actin-based
Table 1
cytoarchitecture of myocytes (Arber and Caroni, 1996; Kong et al., Sequences of PCR primers.
1997; Konrat et al., 1997; Kontaxis et al., 1998; Prassler et al., 1998;
Abbreviation Sequence (53) Usage
Kirchner et al., 2001). CRP3 is down-regulated in adult skeletal muscle
and is re-induced by denervation. CSRP3 gene mutations that result in F1 GCCGACAACAAATCCAAAC Internal conserved sequence
abnormal CRP3 expression have been identied in skeletal myopathies forward primer 1 of CSRP2
R1 TCAGCCAGCCTATCCAAGT Internal conserved sequence
(Winokur et al., 2003; von der Hagen et al., 2005; Sanoudou et al., 2006). reverse primer 1 of CSRP2
Recent studies have discovered an alternative splice variant of CSRP3 F2 TTGAGATGCCTGTCTGGG Internal conserved sequence
gene; the resulting novel CRP3 protein isoform acts as a negative regu- forward primer 2 of CSRP2
lator of myotube formation, has a distinct expression pattern in neuro- R2 CTTTCTCGGTTCTGGGTTT Internal conserved sequence
reverse primer 2 of CSRP2
muscular disease and has direct roles in muscle differentiation (Felkin
F3 AATACGGAGCCTGCGAGAA Internal conserved sequence
et al., 2011; Guo et al., 2012; Vaadaki et al., 2014). forward primer of CSRP3
Although CSRP2 and CSRP3 are indispensable for cell growth and dif- R3 CCCCAAACCCAATACCTGTC Internal conserved sequence
ferentiation, very little is known about the CSRP2 and CSRP3 gene se- reverse primer of CSRP3
quences in sheep or their expression patterns in certain tissues. In 5 GSP1 GTGTTTGGATTTGTTGTCGG 5-RACE reverse outer primer of
CSRP2
Small-tail Han sheep (designated SH) or Dorper sheep (designated 5 NGSP1 CCGTACTTCTTTCCGTAGC 5-RACE reverse inner primer of
DP), this information would be potentially useful for animal breeding. CSRP2
DP is a world-famous, meat-producing foreign breed with a white 5 GSP2 AACTTGGAAGGGTTGCTG 5-RACE reverse outer primer of
head; short, thin, black limbs; a at back; a wide waist and a rapid CSRP3
5 NGSP2 TGCTTTGGGGACTGTTGG 5-RACE reverse inner primer of
muscle growth rate. SH is a dual-purpose, indigenous Chinese breed.
CSRP3
Importantly, it has a high reproductive rate; long, strong limbs and an 5 OUP CATGGCTACATGCTGACAGC 5-RACE forward outer universal
elliptical, fan-shaped tail. However, SH grows more slowly than DP. CTA primer
Recently, high-throughput Illumina RNA-seq analysis of ovine biceps 5 IUP CGCGGATCCACAGCCTACTG 5-RACE forward inner universal
femoris identied a total of 1300 differentially expressed genes ATGATCAGTCGATG primer
3 GSP1 GTTTCCGATGTGCTAAGTG 3-RACE forward outer primer of
between SH and DP (Zhang et al., 2013). Interestingly, in DP, CSRP2 CSRP2
mRNA expression was up-regulated, whereas CSRP3 mRNA expression 3 NGSP1 ATAGGTAATCTAACACTCAAC 3-RACE forward inner primer of
was down-regulated. CSRP2
To investigate the functions of the ovine CSRP2 and CSRP3 genes, we 3 GSP2 TTGGAGCATCGGAGAAGTG 3-RACE forward outer primer of
CSRP3
cloned the full-length CSRP2 and CSRP3 cDNA sequences from the SH bi-
3 NGSP2 TGAGAAGGTGATGGGCGGTG 3-RACE forward inner primer of
ceps femoris, determined their cDNA and amino acid sequences and GT CSRP3
their potential structures, performed functional analyses using bioinfor- 3 UP GACTCGAGTCGATCGA 3-RACE reverse universal primer
matics and phylogenetic and assessed their expression levels in various F4 CCGCTGCTGTTTCTGTGA Full-length cDNA forward primer
SH and DP tissues. of CSRP2
R4 ACCCAAATCAAGCTGAAGTT Full-length cDNA reverse primer of
CSRP2
2. Materials and methods F5 AAAGCTGAGCCGACAGA Full-length cDNA forward primer
of CSRP3
2.1. Sheep sample collection and tissue preparation R5 GTTTTGGACTTGAGTGT Full-length cDNA reverse primer of
CSRP3
F6 GCCGACAACAAATCCAAAC qRT-PCR forward primer of CSRP2
Three SH and three DP sheep were obtained from two purebred R6 CACTTAGCACATCGGAAAC qRT-PCR reverse primer of CSRP2
herds at a local livestock farm in Wei-fang, Shandong Province, China. F7 TGCGGAAGAAATCCAGTG qRT-PCR forward primer of CSRP3
Six healthy ewes (11 months old with body weights of 43.6 1.9 kg) R7 AGCCAGCACCTTGTCCATAC qRT-PCR reverse primer of CSRP3
were randomly selected. For cloning and expression analysis, various F8 AGAAGGTGGTGAAGCAGG qRT-PCR forward primer of GAPDH
R8 GTCGTACCAGGAAATGAGC qRT-PCR reverse primer of GAPDH
tissue samples, including the heart, liver, lung, ovary, aorta, longissimus
 G. Liu et al. / Gene 580 (2016) 4757 49

Table 2
PCR procedures and length of amplication fragments.

Primer pairs PCR Programs Length

(bp)

F1 + R1 5 min at 94 C; 30 s at 94 C, 30 s at 55 C, 30 s at 72 C for 35 cycles; 10 min at 72 C 426

F2 + R2 5 min at 94 C; 30 s at 94 C, 30 s at 56 C, 35 s at 72 C for 35 cycles; 10 min at 72 C 612
F3 + R3 5 min at 94 C; 30 s at 94 C, 30 s at 56 C, 30 s at 72 C for 35 cycles; 10 min at 72 C 528
5 GSP1 + 5 OUP 5 min at 95 C; 10 s at 98 C, 15 s at 56 C, 20 s at 72 C for 20 cycles; 10 min at 72 C 273
5 NGSP1 + 5 IUP 5 min at 95 C; 10 s at 98 C, 15 s at 56 C, 20 s at 72 C for 35 cycles; 10 min at 72 C
5 GSP2 + 5 OUP 5 min at 95 C; 10 s at 98 C, 15 s at 55 C, 30 s at 72 C for 20 cycles; 10 min at 72 C 355
5 NGSP2 + 5 IUP 5 min at 95 C; 10 s at 98 C, 15 s at 55 C, 30 s at 72 C for 35 cycles; 10 min at 72 C
3 GSP1 + 3 UP/ 98 C 30 s; (98 C 10 s, 70 C 30 s, 72 C 20 s) 3 cycles; (98 C 10 s, 68 C 30 s, 72 C 20 s) 4 cycles; (98 C 10 s, 66 C 30 s, 72 C 20 s) 5 cycles; 206
3 NGSP1 + 3 UP (98 C 10 s, 64 C 30 s, 72 C 20 s) 6 cycles; (98 C 10 s, 62 C 30 s, 72 C 20 s) 8 cycles; (98 C 10 s, 60 C 30 s, 72 C 20 s) 10 cycles; 72 C 10 min
3 GSP2 + 3 UP/ 98 C 30 s; (98 C 10 s, 70 C 30 s, 72 C 30 s) 3 cycles; (98 C 10 s, 68 C 30 s, 72 C 30 s) 4 cycles; (98 C 10 s, 66 C 30 s, 72 C 30 s) 5 cycles; 449
3 NGSP2 + 3 UP (98 C 10 s, 64 C 30 s, 72 C 30 s) 6 cycles; (98 C 10 s, 62 C 30 s, 72 C 30 s) 8 cycles; (98 C 10 s, 60 C 30 s, 72 C 30 s) 10 cycles; 72 C 10 min
F4 + R4 5 min at 94 C; 30 s at 94 C, 30 s at 58 C, 1 min at 72 C for 35 cycles; 10 min at 72 C 880
F5 + R5 5 min at 94 C; 30 s at 94 C, 30 s at 58 C, 1 min at 72 C for 35 cycles; 10 min at 72 C 899
F6 + R6 10 min at 95 C; 40 cycles (95 C 5 s, 60 C 30 s); 1 cycles (95 C 1 min, 60 C 30 s, 95 C 30 s) 150
F7 + R7 10 min at 95 C; 40 cycles (95 C 5 s, 60 C 30 s); 1 cycles (95 C 1 min, 60 C 30 s, 95 C 30 s) 179
F8 + R8 10 min at 95 C; 40 cycles (95 C 5 s, 60 C 30 s); 1 cycles (95 C 1 min, 60 C 30 s, 95 C 30 s) 117

Table 3
Accession numbers for exonic structure analysis.

Name Amino acid sequence numbers Chromosome name Accession numbers

Ovis aries CSRP3 KJ743958 O. aries breed Texel chromosome 21, Oar_v3.1 NC_019478.1
Bos taurus CSRP3 NM_001024689.3 B. taurus breed Hereford chromosome 29, Bos_taurus_UMD_3.1 AC_000186.1
Homo sapiens CSRP3 NM_003476.4 H. sapiens chromosome 11, GRCh38 primary assembly NC_000011.10
Mus musculus CSRP3 NM_013808.4 & NM_001198841.1 M. musculus strain C57BL/6J chromosome 7, GRCm38.p2 C57BL/6J NC_000073.6
O. aries CSRP2 KJ743957 O. aries breed Texel chromosome 3, Oar_v3.1 NC_019460.1
B. taurus CSRP2 NM_001038183.1 B. taurus breed Hereford chromosome 5, Bos_taurus_UMD_3.1 AC_000162.1
H. sapiens CSRP2 NM_001321.2 & NM_001300965.1 H. sapiens chromosome 12, GRCh38 primary assembly NC_000012.12
M. musculus CSRP2 NM_007792.4 M. musculus strain C57BL/6J chromosome 10, GRCm38.p2 C57BL/6J NC_000076.6

To obtain the full-length cDNA sequences of the two genes, 3- and tools (http://bioinf.cs.ucl.ac.uk/psipred/psiform.html and http://www.
5-rapid amplication of cDNA ends (designated RACE) PCR were per- predictprotein.org/). The tertiary structures of the CRP2 and CRP3 pro-
formed. The sequences at the 5-ends of the CSRP2 and CSRP3 cDNAs teins were predicted using the Protein Data Bank (http://www.pdb.
were amplied using a 5-Full RACE Kit (TaKaRa, Japan), following the org/) and Protein Data Bank in Europe (http://www.ebi.ac.uk/pdbe/).
manufacturer's instructions. The sequences at the 3-end were ampli- Protein O-glycosylation sites were predicted using online tools (http://
ed using nested PCR in combination with touchdown PCR with www.cbs.dtu.dk/services/NetOGlyc/). Protein N-glycosylation sites
PrimeSTAR HS DNA Polymerase (TaKaRa, Dalian, China). Subsequent- were predicted using online tools (http://www.cbs.dtu.dk/services/
ly, end-to-end PCR was used to amplify the full-length sequences of NetNGlyc/). Signal peptides were predicted using SignalP 4.1 (http://
CSRP2 and CSRP3. Following 1.2% agarose electrophoresis, all PCR prod- www.cbs.dtu.dk/services/SignalP). Protein phosphorylation sites were
ucts from the two genes were isolated and puried using an Agarose Gel predicted with NetPhos 2.0 (http://www.cbs.dtu.dk/services/NetPhos/).
DNA Purication Kit ver. 2.0 (TaKaRa, Japan). The puried, internally
conserved cDNA PCR products were ligated into the pEASY-T1 Simple
vector (TransGen Biotech, Beijing, China). The 3- and 5-RACE PCR Table 4
GenBank accession numbers of CRP2 and CRP3 amino acid sequences from various
products were ligated into the pJET1.2 vector using a CloneJET PCR
species.
Cloning Kit (Thermo Scientic-Fermentas, United States). Then, the
adapter-ligated fragments were transformed into DH5-alpha compe- Latin name CRP2 CRP3
tent cells according to the manufacturer's instructions. Colonies with in- Ovis aries KJ743957 KJ743958
serts were selected using bluewhite screening and colony PCR, Bos taurus NP_001033272.1 NP_001019860.1
followed by sequencing by Sangon Biotech Co., Ltd., Shanghai, China. Capra hircus XP_005679798.1 XP_005699577.1
Sus scrofa XP_003481816.1 NP_001165839.1
Camelus ferus EQB78906.1 XP_006195166.1
2.4. Bioinformatic analyses of CSRP2 and CSRP3 Homo sapiens NP_001312.1 NP_003467.1
Mus musculus NP_031818.3 NP_038836.1
The full-length cDNA sequences of CSRP2 and CSRP3 were assembled Rattus norvegicus NP_803174.2 NP_476485.1
Gallus gallus NP_990539.1 NP_001186415.1
using DNAMAN 6.0 software (version 5.0, Lynnon Biosoft, Quebec, Xenopus laevis NP_001087669.1 NP_001079213.1
Canada). The full-length cDNA sequences of CSRP2 and CSRP3 from Danio rerio NP_001006026.1 NP_001006026.1
four species compare to their genomic sequences (accession numbers Tyto alba XP_009970554.1 KFV60081.1
shown in Table 3) used to exonic sequences structure analysis. BLAST Aptenodytes forsteri XP_009277207.1 KFM01527.1
Ophiophagus hannah ETE60703.1 ETE67781.1
software (http://www.ncbi.nlm.nih.gov) was used to obtain the CSRP2
Tarsius syrichta XP_008065330.1 XP_008069129.1
and CSRP3 exonic structures. Open reading frames (ORFs) were predict- Myotis davidii ELK33231.1 XP_006754044.1
ed using GENSCAN (http://genes.mit.edu/GENSCAN.html). The basic Coturnix japonica Q05158.2
physical and chemical properties of CRP2 and CRP3 were predicted Taeniopygia guttata ACH45008.1 XP_012429810.1
using ProtParam (http://www.expasy.org/tools/protparam.html). The Salmo salar NP_001134645.1 NP_001134957.1
Oncorhynchus mykiss NP_001118197.1 CDQ55920.1
secondary structures of CRP2 and CRP3 were predicted using online
50 G. Liu et al. / Gene 580 (2016) 4757

Fig. 1. The nucleotide sequence and amino acid sequence of ovine CSRP2 and CSRP3 cloned from Small-tail Han Sheep. The nucleotide sequences are in black font. The amino acid sequences
are in blue font.

For multiple alignments and phylogenetic analysis with other species,
the amino acid sequences (accession numbers shown in Table 4) were
obtained from GenBank. The alignments were performed using
DNAMAN 6.0. The phylogenetic tree constructed from the alignment
was generated with the neighbor-joining method using Molecular Evo-
lutionary Genetic Analysis (MEGA) software version 5.2 (http://www.
megasoftware.net/), followed by phylogeny tests with 1000 bootstrap
replicates.
2.5. CSRP2 and CSRP3 mRNA expression in various SH and DP tissues
Total RNA was extracted from eight types of tissue from three SH
and three DP sheep as described above. Quantitative reverse transcrip-
tion PCR (qRT-PCR) analysis was performed on a Stratagene MxPro
3000P real-time detection apparatus (Agilent Technologies, Santa
Clara, CA) with SYBR Premix Ex Taq (Tli RNaseH Plus) (TaKaRa, Da-
lian, China) following the product's manual. Gene-specic PCR primers

Fig. 2. Exonic structures of human (H), murine (M), bovine (B) and ovine (O) CSRP2 and CSRP3. Amino acid sequences and genomic sequences are provided under Table 3. The gray and
white bars denote exons and introns, respectively. Only the exons are drawn to scale.
 G. Liu et al. / Gene 580 (2016) 4757
Fig. 3. Predicted glycosylation and phosphorylation sites of CRP2 and CRP3 proteins. (a) CRP2 protein had an N-glycosylation site. (b) CRP3 protein had two N-glycosylation sites. (c) CRP2
protein had three O-glycosylation sites. (d) CRP3 protein had an O-glycosylation site. (e) CRP2 protein had thirteen phosphorylation sites. (f) CRP3 protein had thirteen phosphorylation
sites.
were designed based on the full-length cDNA sequences of CSRP2 and
CSRP3. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was se-
lected as an internal control (Pinheiro et al., 2011). Each PCR reaction
consisted of 7.5 L 2 SYBR Premix Ex Taq, 0.3 L forward primer,
0.3 L reverse primer, 0.3 L 50 ROX Reference Dye II, 1.5 L cDNA tem-
plate and 5.1 L ddH2O. Experiments were repeated three times, and the
comparative cycle threshold method (2 CT method) (Livak and
Schmittgen, 2001) was used to analyze the relative CSRP2 and CSRP3
mRNA expression levels in various tissues from the two breeds. Three
individual samples were prepared from each tissue sample, and all sam-
ples were repeated in triplicate.
2.6. CRP3 protein extraction and western blot analysis
Total protein was extracted from various SH and DP tissues. All sam-
ples were homogenized in Radioimmunoprecipitation Assay (RIPA)
lysis buffer (Beyotime, China), adding phenylmethanesulfonyl uoride
(PMSF) as a protease inhibitor. The nal total protein concentrations
were determined with a BCA Protein Assay Kit (Beyotime, China). Sub-
sequently, 60 g of total protein from each sample was diluted with
SDS-PAGE Sample Loading Buffer (Beyotime, China). The mixtures
were boiled for 5 min. The proteins were separated by SDS gel electro-
phoresis at 80 V for 1 h and 120 V for 1 h. Then, the proteins were
electrophoretically transferred to a polyvinylidene diuoride (PVDF)
membrane at 250 mA for 2 h. The PVDF membrane was blocked in
blocking buffer (Beyotime, China) for 2 h at room temperature.
51
GAPDH was selected as an internal control protein. Preimmune rabbit
serum served as a negative control. The primary antibodies used for
blotting were anti-CSRP3 [EPR12615 (B)] (Abcam, Shanghai, China)
and anti-GAPDH Mouse Monoclonal Antibody (2B5) (Abbkine, Red-
lands, CA USA), and the secondary antibodies were donkey anti-rabbit
IgG-horseradish peroxidase (HRP; SC-2313) and donkey anti-mouse
IgG-HRP (SC-2314), respectively (Santa Cruz Biotechnology, Santa
Cruz, CA USA). The membrane was incubated at 4 C overnight in prima-
ry antibody diluted 1:2000. Next, the membrane was washed 3 times
for 10 min with Wash Buffer (Beyotime, China), incubated at room tem-
perature for 2 h with secondary antibody diluted 1:2000, and then
washed again 3 times for 10 min with Wash Buffer. Proteins on the
membrane were visualized using the BeyoECL Plus chemiluminescence
detection kit (Beyotime, China) with an exposure time of 110 min.
2.7. Statistical analyses
For the comparison of relative CSRP2 and CSRP3 mRNA expression
levels, the data were analyzed using multiple analysis of variance
(ANOVA) comparisons. Means were analyzed with Duncan's Multiple
Range test and are presented as the means standard errors (SEs),
with a signicant difference level of P b 0.05 and a highly signicant dif-
ference level of P b 0.01. All statistical analyses were performed using
Statistics Analysis System (SAS) software version 9.2 (SAS Institute
Inc., Cary, NC, USA).
52 G. Liu et al. / Gene 580 (2016) 4757

Fig. 4. Predicted secondary structures of ovine CRP2 and CRP3 proteins.

For the comparison of relative CRP3 protein expression levels, the repeated three times, and the gray value of the differences between
grayscale values of the bands were measured using ImageJ software the three groups was statistically analyzed by t-test, and GAPDH protein
(National Institutes of Health, Bethesda, MD). Experiments were levels were used to normalize the results.

Fig. 5. The tertiary structures of CRP family members. The Protein Data Bank was used to build the tertiary structure model, and the 2 conserved LIM domains are clearly shown in (a).
Protein Data Bank in Europe was used to build the LIM1 and LIM2 domain models shown in (b) and (c), each model contains two individual zinc ngers (each consists of two orthogonally
arranged antiparallel beta-sheets), and the carboxyl-terminal module ends with an alpha-helix.
 G. Liu et al. / Gene 580 (2016) 4757 53

Table 5 antiparallel beta-sheets, packed together via a hydrophobic core

Ovine CRP2 and CRP3 amino acid sequence identity comparison with other species. Com- region.
parison of CRP2 and CRP3 amino acid sequence identities in the same species.

Latin name CRP2 CRP3 Identity between the

3.2. Multiple sequence alignment and phylogenetic analysis
(%) (%) two proteins (%)

Ovis aries 65.13

The similarity between CRP2 and CRP3 protein in sh, amphibians
Bos taurus 100.00 99.48 65.13
Capra hircus 99.48 100.00 64.62
and reptiles is higher than that in mammals. That means the two pro-
Sus scrofa 98.96 96.92 65.46 teins are more similar among the lower vertebrates. In addition, the
Camelus ferus 96.95 97.44 63.64 similarity of CRP2 protein sequence among detected species is higher
Homo sapiens 100.00 96.41 65.46 (minimum at 87.05%). Compared with that, the similarity of CRP3 pro-
Mus musculus 98.96 95.90 64.43
tein sequence among detected species is lower (minimum at 73.85%).
Rattus norvegicus 99.48 94.87 64.95
Tarsius syrichta 99.48 96.92 65.98 Compared with the other species, the similarity trends of ovine CRP2
Myotis davidii 89.15 94.36 58.69 and CRP3 protein sequences are as follows: The ovine CRP2 sequence
Gallus gallus 95.88 87.24 66.15 similarity to the mammals is the highest while the lowest to the sh.
Tyto alba 95.88 87.24 65.13
That's the same trend for the ovine CRP3 (Table 5).
Aptenodytes forsteri 95.88 87.76 66.15
Coturnix japonica 95.88
Multiple sequence alignments have shown that ovine CRP2 and
Taeniopygia guttata 94.33 84.77 65.82 CRP3 amino acid sequences contain two LIM domains at amino acid res-
Ophiophagus hannah 93.26 83.76 69.04 idues (1061 and 119170) and a conserved nuclear targeting sequence
Xenopus laevis 87.56 76.92 67.18 at amino acid residues 6469 (Fig. 6).
Danio rerio 87.05 73.85 67.01
Phylogenetic tree analysis has shown signicant divergence separat-
Salmo salar 88.08 74.49 67.53
Oncorhynchus mykiss 87.05 73.85 67.53 ing as two distinct groupings and ovine CRP2 and CRP3 cluster with
their mammalian homologs distinct from groupings of amphibian bird
and sh orthologous and revealed that ovine CRP2 and CRP3 were
most closely related to proteins from B. taurus and Capra hircus, respec-
3. Results tively (Fig. 7).

3.1. Analysis of ovine CSRP2 and CSRP3 sequence characteristics

In this study, full-length CSRP2 and CSRP3 cDNA sequences were
obtained using 3- and 5-RACE. The sequences were submitted to
GenBank and assigned accession numbers KJ743957 (CSRP2) and
KJ743958 (CSRP3) (Fig. 1). The complete ovine CSRP2 cDNA is 917 bp
long and is composed of an ORF of 582 bp (encoding 193 amino
acids), a 73-bp 5-untranslated region (UTR) and a 262-bp 3-UTR that
includes a poly (A) tail. The complete ovine CSRP3 cDNA is 917 bp
long and is composed of an ORF of 585 bp (encoding 194 amino
acids), a 61-bp 5-UTR and a 271-bp 3-UTR that includes a poly (A) tail.
The ovine CSRP2 gene includes 6 exons and 5 introns (Fig. 2) share a
similar exon structure with that of other mammals. The ovine CSRP3
gene includes 6 exons and 5 introns, which differs from the CSRP3
genes from humans (7 exons and 6 introns) and cattle (5 exons and 4
introns).
The molecular masses of the CRP2 and CRP3 proteins were esti-
mated to be 20.9538 and 20.9548 kDa, respectively, and the isoelec-
tric points (pIs) were estimated at 8.95 and 8.99, respectively. CRP2
was predicted to contain an N-glycosylation site (Asn105, Fig. 3a),
and three O-glycosylation sites (Thr101, 102,106, Fig. 3c), whereas
CRP3 contained two N-glycosylation sites (Asn107, 158, Fig. 3b), and
an O-glycosylation site (Thr 103, Fig. 3d). CRP2 was predicted to
have thirteen phosphorylation sites (Ser46,94,107,125,152,155 ,
Thr101,102,159, Tyr 57,62,166,171 , Fig. 3e), and CRP3 was predicted to
have thirteen phosphorylation sites (Ser46,95,101,105,109,117,126,153,156,
Thr104, Tyr18,57,167, Fig. 3f) too. The secondary structure (Fig. 4) of
CRP2 was 4.15% alpha-helix (H), 14.51% beta-sheet (E) and 81.35%
random coil (C), which was highly similar to that of CRP3 (4.64% H,
13.92% E and 81.44% C).
The results of ovine CRP2 and CRP3 tertiary structures shared the
closest similarity with the structure of the chicken cysteine-rich pro-
tein, CRP1 protein (PDB code: 1B8T). The predicted tertiary struc-
tures (Fig. 5) of both proteins showed that they consist of a
polypeptide chain with two highly similar LIM domains that were as-
sociated with glycine-rich repeats and were connected end-to-end
by numerous amino acid residues without any tertiary structure.
Each LIM domain was formed by two zinc-binding modules, and
followed by the carboxyl-terminal module ends with an alpha-
helix. Each zinc nger module consists of two orthogonally arranged,
3.3. Expression analysis of ovine CSRP2 and CSRP3 mRNA
qRT-PCR was performed to investigate the accumulation of CSRP2
and CSRP3 transcripts in different SH and DP tissues. CSRP2 was maxi-
mally expressed in the aorta; less expression was observed in the
heart, longissimus dorsi and kidney; and extremely low levels were ob-
served in other tissues (Fig. 8a). The expression levels in the aorta were
signicantly different from those in the other tissues (P b 0.05). Further-
more, in the aorta, the expression level of CSRP2 in DP was signicantly
higher than that in SH (P b 0.05). Overall, CSRP2 was expressed in all ex-
amined tissues.
In SH, CSRP3 expression was highest in the heart (P b 0.05), followed
by the longissimus dorsi and biceps femoris (Fig. 8b). In the remaining
tissues (aorta, fat, liver, ovary and kidney), the expression levels of
CSRP3 mRNA were lower (P b 0.05). In DP, CSRP3 was highly expressed
in the heart and longissimus dorsi and was moderately expressed in the
biceps femoris. The expression of CSRP3 in the other tissues (aorta, fat,
liver, ovary, and kidney) was similar between DP and SH. The expres-
sion of CSRP3 in the heart was signicantly higher in SH than in DP
(P b 0.05). In the longissimus dorsi and biceps femoris, CSRP3 expression
was signicantly higher in DP than in SH (P b 0.05). Overall, both breeds
expressed CSRP3 in all tissues examined, except the lung.
3.4. Western blot analysis of ovine CRP3 protein in various tissues
Western blotting revealed that, among the examined tissues (heart,
aorta, longissimus dorsi and biceps femoris), the CRP3 protein was only
expressed in the heart, longissimus dorsi and biceps femoris. The CRP3
protein was most highly expressed in the heart, followed by the
longissimus dorsi and the biceps femoris (Fig. 9a). Additionally, a poten-
tially new isoform of the CRP3 protein, which we designated as CRP3-b,
was discovered in the heart. The molecular weight of the putative CRP3-
b protein was approximately 1617 kDa. The relative expression levels
of the 2 isoforms proteins in all examined tissues were shown in Fig. 9b.
Interestingly, in the heart, the expression of CRP3-b was signicantly
higher in SH than in DP (P b 0.05). Conversely, the expression of the
CRP3 protein in the heart was higher in DP than in SH (P b 0.05). The ex-
pression levels in the longissimus dorsi were higher in SH than in DP
(P b 0.05).
54 G. Liu et al. / Gene 580 (2016) 4757

Fig. 6. Multiple amino acid sequence alignment of ovine CRP2 and CRP3 proteins with other various species. The species names and GenBank accession numbers were shown in Table 3.
Completely identical amino acids were marked in dark blue. LIM domains sequences were surrounded by yellow outlines. Nuclear targeting sequences were surrounded by a red outline.

4. Discussion adhesion and motility and cytoskeletal organization (Schmeichel and

This study described the cloning and characterization of the novel
ovine candidate genes CSRP2 and CSRP3 and their relative mRNA and
CRP3 expression levels in various SH and DP tissues and organs.
Phosphorylation is an important post-translational modication of
proteins. Protein phosphorylation affects various biological processes,
such as enzyme-activity regulation, signal transduction, and cell divi-
sion, among others. In this study, the ovine CRP2 and CRP3 proteins
were predicted to contain the same phosphorylation sites. The
secondary structure analyses suggest that the two genes primarily
encode coils and loops, which are compatible with the proteins
serving as adapters or linkers.
The tertiary structure of the LIM domains were double zinc-nger
structures that mediate proteinprotein interactions and the assembly
of multimeric protein complexes. LIM domain was linked to diverse func-
tional roles, including transcriptional regulation, signal transduction, cell
Beckerle, 1997; Chang et al., 2003; Kadrmas and Beckerle, 2004).
The amino acid sequences of the CRP2 and CRP3 proteins were high-
ly conserved with the other selected species. This result is consistent
with a previous study showing that CRP sequences were the most high-
ly conserved across mammals (Xu et al., 2010). Multiple sequence align-
ments clearly identied the positions of the LIM domains, suggesting
evolutionary conservation of their functional properties. Each LIM do-
main contains conserved sequences (CX2CX17HX2CX2CX2
CX17CX2C) (Weiskirchen and Gnther, 2003), except the second
LIM domain sequences of Ophiophagus hannah CSRP3 (CX2CX17
HX2CX2CX2CX17CX4C). In addition, the CRP2 protein con-
tains a completely conserved nuclear targeting sequence (KKYGPK) at
amino acid residues 6469, which implies that this protein has various
functions in both the nucleus and the cytoplasm (Arber et al., 1994;
Weiskirchen and Gnther, 2003; Grubinger and Gimona, 2004). In
CRP3, amino acid residues 6465 are either an arginine or a lysine
 G. Liu et al. / Gene 580 (2016) 4757 55

Fig. 7. Phylogenetic analysis of CRP2 and CRP3 proteins. Numbers at each branch indicate the bootstrap percentage. The sequences of the various species were listed in Table 3. Mammals
were shown by red threads. Birds were shown by green threads. Amphibians were shown by black threads. Fish were shown by blue threads. Reptiles were shown by rosy threads.

Fig. 8. Relative mRNA expression levels of CSRP2 and CSRP3 in various tissues from Small-tail Han and Dorper sheep. The expression levels were normalized to GAPDH and measured using
the 2(Ct) method. The results were averaged from three independent replicates. Error bars represent SE (n = 3). Signicant differences in gene expression were determined by ANOVA.
Means with the same letter were not signicantly different (P b 0.05). LD and BF are the abbreviation of longissimus dorsi and biceps femoris, respectively. (a) CSRP2 expression levels in
eight tissues. In the aorta, the CSRP2 mRNA expression was higher in Dorper than in Small-tail Han sheep. (b) CSRP2 expression levels in nine tissues. In the heart, the CSRP3 mRNA
expression was lower in Dorper than that in Small-tail Han sheep. In LD and BF, the CSRP3 mRNA expression was higher in Dorper than that in Small-tail Han sheep.
56 G. Liu et al. / Gene 580 (2016) 4757
Fig. 9. Analysis of ovine CRP3 protein levels in different tissues from Small-tail Han and
Dorper sheep. Numbers 1, 3, 5 and 7 represent tissues from the longissimus dorsi (LD),
biceps femoris (BF), heart and aorta, respectively, in Dorper sheep. Numbers 2, 4, 6 and
8 represent tissues from the LD, BF, heart and aorta in Small-tail Han sheep. (a) Western
blot results for CRP3 in protein extracts from 11-month-old Small-tail Han and Dorper
sheep. (b) Quantication of relative protein levels in the samples. Heart-b represents the
level of CRP3-b protein in the heart tissue samples. Each experimental group contained
three replicates. The same letter used between or among the groups indicates no
signicant difference (P b 0.05).
(Fig. 6). The sh CRP3 nuclear targeting sequences were identical to
CRP2 sequence. Interestingly, an arginine was found at amino acid res-
idue 65 in all mammals except rats, which possess a lysine. However,
the lysine was conserved in shes, birds, reptiles and amphibians. The
result is consistent with the fact that the homology analysis between
CRP2 and CRP3 sequences shared higher similarity in lower vertebrates
(reptiles, sh and amphibians) than in higher vertebrates (birds and
mammals). The chemically conservative substitution of an arginine for
a lysine at position 6465 in MLP/CRP3 is different from what is ob-
served in other CRP family members (Weiskirchen et al., 1995).
Phylogenetic analysis showed that ovine CRP2 and CRP3 shared high
sequence identity with mammalian orthologs. This is in agree'ment
with a phylogenetic analysis that included CRPs from mice and pigs
(Weiskirchen and Gnther, 2003; Xu et al., 2010). Additionally, phylo-
genetic analysis indicated that mammalian CRP2 or CRP3 have clearly
recognizable orthologs in lower vertebrates, suggesting that certain
CRP2 and CRP3 have been evolved before species divergence.
CSRP2 mRNA showed remarkably tissue-specic expression in the
blood vessels, which is consistent with the pattern in mice (Gnther
et al., 2003) and pigs (Xu et al., 2010). CSRP2 mRNA expression in the
aorta was greater in DP than in SH (P b 0.05). The expression of CSRP2
may have a vital function in the aorta and may be associated with the
response to blood vessel injury repair and blood vessel capacity (Jain
et al., 1996; Chang et al., 2003).
CSRP3 mRNA was expressed at the highest levels in the heart, follow-
ed by muscle, which conrmed CSRP3 mRNA's tissue-specic
expression in striated muscle. This result is consistent with previous
studies in mouse (Arber et al., 1994) and in pig (Xu et al., 2010). How-
ever, it is inconsistent with the patterns reported in various tissues in
30-month-old cattle (He et al., 2014). The CSRP3 gene expression level
in various Qinchuan cattle tissues showed that bovine CSRP3 was
expressed most highly in the longissimus dorsi, followed by the heart
(He et al., 2014). One possible reason for this difference is that CSRP3
mRNA may be differentially expressed in various sheep and cattle tis-
sues during different developmental stages.
CSRP3 expression in the heart was greater in SH than in DP
(P b 0.05). However, the opposite pattern was observed in muscles
(longissimus dorsi and biceps femoris); the CSRP3 mRNA levels were
greater in DP than in SH (P b 0.05). The differential expression of
CSRP3 in SH and DP in different tissues may be associated with the reg-
ulation of the development of muscle cells (Arber et al., 1994; Arber and
Caroni, 1996; Jain et al., 1996; Louis et al., 1997; Pomies et al., 1997;
Weiskirchen et al., 2001; Kadrmas and Beckerle, 2004).
To better understand the expression pattern of the CRP3 protein,
four tissues with different mRNA abundance levels, as shown by qRT-
PCR (heart, longissimus dorsi, biceps femoris and aorta), were selected
in SH and DP. We found that CRP3 protein abundance was maximal in
the heart, followed by the muscle tissues, but that the protein was not
detected in the aorta, suggesting a role across different types of striated
muscle. It was of interest that in the heart (also in the muscle tissues
after extended exposure) a protein band (approximately 1617 kDa)
slightly smaller than CRP3 protein (approximately 21 kDa) was discov-
ered. It was consistent with previous studies in mice (Vaadaki et al.,
2014), so the protein band could be a putative ovine CRP3 isoform. In-
terestingly, in the heart, the CRP3-b protein expression level in relative-
ly slow-growing SH was signicantly higher than in DP (P b 0.05).
However, the CRP3 protein expression level in the heart was higher in
DP than in SH (P b 0.05). In both breeds, the CRP3 protein expression
level was signicantly higher than that of CRP3-b (P b 0.05). The expres-
sion in the longissimus dorsi was higher in SH than in Dorper (P b 0.05).
We cloned one full-length cDNA each from CSRP3. However, it is in-
teresting that putative CRP3 isoform could be identied by western blot
analysis. One possible reason is that this new isoform may be the prod-
uct of alternative splicing of the full-length CSRP3 mRNA by skipping
exons 3 and 4 (Vaadaki et al., 2014). Splice variants and protein iso-
form should be identied and determined by the further studies.
CRP3 and CRP3-b may play opposing roles in muscle cell growth and
differentiation in different developmental stages. We speculated that
higher CRP3-b levels may be involved in the slow growth of indigenous
Chinese sheep breeds. The different regulation of CRP3 and CRP3-b re-
quires further investigation.
Considering both the qRT-PCR and western blot results from SH and
DP, a notable feature is that the results from the qRT-PCR analysis were
inconsistent with the western blot results. To ensure reliable results,
both the qRT-PCR and western blots were performed under precise con-
ditions. Various regulatory mechanisms acting on both the mRNA and
the protein, including synthesis and degradation rates, may differential-
ly affect the amounts of these products. The relatively low correlation
between CSRP3 mRNA and protein levels can be interpreted as the result
of complex post-transcriptional, translational, and post-translational
modications, which are regulated by RNA processing, the ribosome
and the proteasome, respectively (Greenbaum et al., 2003; Pascal
et al., 2008; Cui et al., 2014).
5. Conclusion
In this study, we cloned the full-length CSRP2 and CSRP3 cDNA se-
quences from SH muscle, determined their cDNA and amino acid se-
quences, and performed structural and functional analyses using
bioinformatics and phylogenetics and assessed their relative mRNA
and protein expression levels in various SH and DP tissues. Phylogenetic
analysis indicated that mammalian CRP2 or CRP3 have clearly recogniz-
able orthologs in lower vertebrates, suggesting that certain CRP2 and
CRP3 have been evolved before species divergence. Putative isoforms
of CRP3 protein maybe present in sheep. But splice variants should be
identied and determined by the further studies. The result about
 G. Liu et al. / Gene 580 (2016) 4757
qRT-PCR and western blot indicated that transcription of CRP3 might be
related to the growth of ovine skeletal muscles. Additionally, we found
that CRP2 and both isoforms of CRP3 are expressed to varying degrees
in different tissues from SH and DP. Our ndings would be helpful for
further understanding the functions of the ovine CSRP2 and CSRP3
genes. Detailed studies should be performed in the future to clarify the
functions of CSRP2 and CSRP3.
Conict of interest
The authors declare that there are no conicts of interest.
Acknowledgments
We thank Prof. Jianming Wang for revising the language and for pro-
viding valuable comments on the manuscript. This work was nancially
supported by Shandong Provincial Modern Agriculture Industry Tech-
nology System (no. SDAIT-0901101). We thank the Shandong LuLiang
Mutton Sheep Science and Technology Demonstration Co., LTD, for pro-
viding the experimental sheep and assisting in sample collection.
References
Arber, S., Caroni, P., 1996. Specicity of single LIM motifs in targeting and LIM/LIM inter-
actions in situ. Genes Dev. 10, 289300.
Arber, S., Halder, G., Caroni, P., 1994. Muscle LIM protein, a novel essential regulator of
myogenesis, promotes myogenic differentiation. Cell 79, 221231.
Arber, S., Hunter, J.J., Ross, J.J., Hongo, M., Sansig, G., Borg, J., Perriard, J.C., Chien, K.R.,
Caroni, P., 1997. MLP-decient mice exhibit a disruption of cardiac cytoarchitectural
organization, dilated cardiomyopathy, and heart failure. Cell 88, 393403.
Barash, I.A., Mathew, L., Lahey, M., Greaser, M.L., Lieber, R.L., 2005. Muscle LIM protein
plays both structural and functional roles in skeletal muscle. Am. J. Physiol. Cell Phys-
iol. 289 (5), C1312C1320.
Chang, D.F., Belaguli, N.S., Iyer, D., Roberts, W.B., Wu, S.P., Dong, X.R., Marx, J.G., Moore,
M.S., Beckerle, M.C., Majesky, M.W., Schwartz, R.J., 2003. Cysteine-rich LIM-only pro-
teins CRP1 and CRP2 are potent smooth muscle differentiation cofactors. Dev. Cell 4,
107118.
Chang, D.F., Belaguli, N.S., Chang, J., Schwartz, R.J., 2007. LIM-only protein, CRP2, switched on
smooth muscle gene activity in adult cardiac myocytes. Proc. Natl. Acad. Sci. U. S. A. 104,
157162.
Cui, K., Yang, Z., Darwish, H., Zhang, Y., Ge, Y., Zhang, X., Li, R., Deng, X., 2014. Molecular
cloning and characterization of the -catenin gene from ne-wool sheep. Gene 546,
277282.
Delalande, J.M., Rescan, P.Y., 1998. Expression of a cysteine-rich protein (CRP) encoding
gene during early development of the trout. Mech. Dev. 76, 179183.
Felkin, L.E., Narita, T., Germack, R., Shintani, Y., Takahashi, K., Sarathchandra, P., Lpez-
Olaeta, M.M., Gmez-Salinero, J.M., Suzuki, K., Barton, P.J., Rosenthal, N., Lara-Pezzi,
E., 2011. Calcineurin splicing variant calcineurin A1 improves cardiac function after
myocardial infarction without inducing hypertrophy. Circulation 123, 28382847.
Fung, Y.W., Wang, R.X., Heng, H.H., Liew, C.C., 1995. Mapping of a human LIM protein
(CLP) to human chromosome 11p15.1 by uorescence in situ hybridization. Geno-
mics 28, 602603.
Greenbaum, D., Colangelo, C., Williams, K., Gerstein, M., 2003. Comparing protein abun-
dance and mRNA expression levels on a genomic scale. Genome Biol. 4, 117.
Grubinger, M., Gimona, M., 2004. CRP2 is an autonomous actin-binding protein. FEBS Lett.
557 (13), 8892.
Gnther, K., Stoll, D., Jakse, G., Gressner, A.M., Weiskirchen, R., 2003. Rapid detection of
CSRP2 mRNA in mouse, rat, and human using LightCycler-based quantitative real-
time polymerase chain reaction. Anal. Biochem. 314, 144148.
Guo, W., Schafer, S., Greaser, M.L., Radke, M.H., Liss, M., Govindarajan, T., Maatz, H., Schulz,
H., Li, S., Parrish, A.M., Dauksaite, V., Vakeel, P., Klaassen, S., Gerull, B., Thierfelder, L.,
Regitz-Zagrosek, V., Hacker, T.A., Saupe, K.W., Dec, G.W., Ellinor, P.T., MacRae, C.A.,
Spallek, B., Fischer, R., Perrot, A., zcelik, C., Saar, K., Hubner, N., Gotthardt, M.,
2012. RBM20, a gene for hereditary cardiomyopathy, regulates titin splicing. Nat.
Med. 18, 766773.
Harper, B.D., Beckerle, M.C., Pomies, P., 2000. Fine mapping of the alpha-actinin binding
site within cysteine-rich protein. Biochem. J. 350, 269274.
Harrod, G.V., Kettunen, P.J., Jowett, A.K., 1996. Murine MLP: cloning and expression in the
embryonic head. J. Craniofac. Genet. Dev. Biol. 16, 6573.
He, H., Zhang, H., Li, Z., Liu, Y., Liu, X., 2014. Expression, SNV identication, linkage dis-
equilibrium, and combined genotype association analysis of the muscle-specic
gene CSRP3 in Chinese cattle. Gene 535, 1723.
Henderson, J.R., Brown, D., Richardson, J.A., Olson, E.N., Beckerle, M.C., 2002. Expression of
the gene encoding the LIM protein CRP2: a developmental prole. J. Histochem.
Cytochem. 50, 107111.
Jain, M.K., Fujita, K.P., Hsieh, C.M., Endege, W.O., Sibinga, N.E., Yet, S.F., Kashiki, S., Lee,
W.S., Perrella, M.A., Haber, E., Lee, M.E., 1996. Molecular cloning and characterization
of SmLIM, a developmentally regulated LIM protein preferentially expressed in aortic
57
smooth muscle cells. J. Biol. Chem. 271, 1019410199.
Kadrmas, J.L., Beckerle, M.C., 2004. The LIM domain: from the cytoskeleton to the nucleus.
Nat. Rev. Mol. Cell Biol. 5, 920931.
Kirchner, J., Forbush, K.A., Bevan, M.J., 2001. Identication and characterization of thymus
LIM protein: targeted disruption reduces thymus cellularity. Mol. Cell. Biol. 21,
85928604.
Knoll, R., Kostin, S., Klede, S., Savvatis, K., Klinge, L., Stehle, I., Gunkel, S., Kotter, S., Babicz,
K., Sohns, M., Miocic, S., Didie, M., Knoll, G., Zimmermann, W.H., Thelen, P.,
Bickeboller, H., Maier, L.S., Schaper, W., Schaper, J., Kraft, T., Tschope, C., Linke, W.A.,
Chien, K.R., 2010. A common MLP (muscle LIM protein) variant is associated with car-
diomyopathy. Circ. Res. 106, 695704.
Kong, Y., Flick, M.J., Kudla, A.J., Konieczny, S.F., 1997. Muscle LIM protein promotes
myogenesis by enhancing the activity of MyoD. Mol. Cell. Biol. 17, 47504760.
Konrat, R., Weiskirchen, R., Krautler, B., Bister, K., 1997. Solution structure of the
carboxyl-terminal LIM domain from quail cysteine-rich protein CRP2. J. Biol.
Chem. 272, 1200112007.
Kontaxis, G., Konrat, R., Krautler, B., Weiskirchen, R., Bister, K., 1998. Structure and
intramodular dynamics of the amino-terminal LIM domain from quail cysteine- and
glycine-rich protein CRP2. Biochemistry 37, 71277134.
Lin, D.W., Chang, I.C., Tseng, A., Wu, M.L., Chen, C.H., Patenaude, C.A., Layne, M.D., Yet, S.F.,
2008. Transforming growth factor beta up-regulates cysteine-rich protein 2 in vascu-
lar smooth muscle cells via activating transcription factor 2. J. Biol. Chem. 283,
1500315014.
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-
time quantitative PCR and the 2(delta delta C(T)) method. Methods 25, 402408.
Louis, H.A., Pino, J.D., Schmeichel, K.L., Pomies, P., Beckerle, M.C., 1997. Comparison of
three members of the cysteine-rich protein family reveals functional conservation
and divergent patterns of gene expression. J. Biol. Chem. 272, 2748427491.
Pascal, L.E., True, L.D., Campbell, D.S., Deutsch, E.W., Risk, M., Coleman, I.M., Eichner, L.J.,
Nelson, P.S., Liu, A.Y., 2008. Correlation of mRNA and protein levels: cell type-
specic gene expression of cluster designation antigens in the prostate. BMC Geno-
mics 9, 246.
Pinheiro, T.T., Litholdo, C.J., Sereno, M.L., Leal, G.J., Albuquerque, P.S., Figueira, A., 2011. Es-
tablishing references for gene expression analyses by RT-qPCR in Theobroma cacao
tissues. Genet. Mol. Res. 10, 32913305.
Pomies, P., Louis, H.A., Beckerle, M.C., 1997. CRP1, a LIM domain protein implicated in
muscle differentiation, interacts with alpha-actinin. J. Cell Biol. 139, 157168.
Prassler, J., Murr, A., Stocker, S., Faix, J., Murphy, J., Marriott, G., 1998. DdLIM is a
cytoskeleton-associated protein involved in the protrusion of lamellipodia in
Dictyostelium. Mol. Biol. Cell 9 (3), 545559.
Sanoudou, D., Corbett, M.A., Han, M., Ghoddusi, M., Nguyen, M.A., Vlahovich, N.,
Hardeman, E.C., Beggs, A.H., 2006. Skeletal muscle repair in a mouse model of
nemaline myopathy. Hum. Mol. Genet. 15, 26032612.
Schmeichel, K.L., Beckerle, M.C., 1997. Molecular dissection of a LIM domain. Mol. Biol.
Cell 8 (2), 219230.
Vaadaki, E., Arvanitis, D.A., Papalouka, V., Terzis, G., Roumeliotis, T.I., Spengos, K., Garbis,
S.D., Manta, P., Kranias, E.G., Sanoudou, D., 2014. Muscle lim protein isoform negatively
regulates striated muscle actin dynamics and differentiation. FEBS J. 281, 32613279.
von der Hagen, M., Laval, S.H., Cree, L.M., Haldane, F., Pocock, M., Wappler, I., Peters, H.,
Reitsamer, H.A., Hoger, H., Wiedner, M., Oberndorfer, F., Anderson, L.V., Straub, V.,
Bittner, R.E., Bushby, K.M., 2005. The differential gene expression proles of proximal
and distal muscle groups are altered in pre-pathological dysferlin-decient mice.
Neuromuscul. Disord. 15 (12), 863877.
Wei, J., Gorman, T.E., Liu, X., Ith, B., Tseng, A., Chen, Z., Simon, D.I., Layne, M.D., Yet, S.F.,
2005. Increased neointima formation in cysteine-rich protein 2-decient mice in re-
sponse to vascular injury. Circ. Res. 97, 13231331.
Weiskirchen, R., Bister, K., 1993. Suppression in transformed avian broblasts of a gene
(crp) encoding a cysteine-rich protein containing LIM domains. Oncogene 8,
23172324.
Weiskirchen, R., Gnther, K., 2003. The CRP/MLP/TLP family of LIM domain proteins: act-
ing by connecting. BioEssays 25, 152162.
Weiskirchen, R., Pino, J.D., Macalma, T., Bister, K., Beckerle, M.C., 1995. The cysteine-rich pro-
tein family of highly related LIM domain proteins. J. Biol. Chem. 270, 2894628954.
Weiskirchen, R., Erdel, M., Utermann, G., Bister, K., 1997. Cloning, structural analysis, and
chromosomal localization of the human CSRP2 gene encoding the LIM domain pro-
tein CRP2. Genomics 44, 8393.
Weiskirchen, R., Moser, M., Weiskirchen, S., Erdel, M., Dahmen, S., Buettner, R., Gressner,
A.M., 2001. LIM-domain protein cysteine- and glycine-rich protein 2 (CRP2) is a novel
marker of hepatic stellate cells and binding partner of the protein inhibitor of activat-
ed STAT1. Biochem. J. 359, 485496.
Winokur, S.T., Chen, Y.W., Masny, P.S., Martin, J.H., Ehmsen, J.T., Tapscott, S.J., van der
Maarel, S.M., Hayashi, Y., Flanigan, K.M., 2003. Expression proling of FSHD muscle
supports a defect in specic stages of myogenic differentiation. Hum. Mol. Genet.
12, 28952907.
Wu, M., Chen, C., Lin, Y., Jheng, Y., Ho, Y., Yang, L.C.L., Layne, M.D., Yet, S.F., 2014. Divergent
signaling pathways cooperatively regulate TGF induction of cysteine-rich protein 2
in vascular smooth muscle cells. Cell Commun. Signal. 12, 22.
Xu, X., Qiu, H., Du, Z., Fan, B., Rothschild, M.F., Yuan, F., Liu, B., 2010. Porcine CSRP3: poly-
morphism and association analyses with meat quality traits and comparative analy-
ses with CSRP1 and CSRP2. Mol. Biol. Rep. 37 (1), 451459.
Zhang, C., Wang, G., Wang, J., Ji, Z., Liu, Z., Pi, X., Chen, C., 2013. Characterization and com-
parative analyses of muscle transcriptomes in Dorper and small-tailed Han sheep
using RNA-Seq technique. PLoS One 8, e72686.