Mycopathologia (2013) 176:225232
DOI 10.1007/s11046-013-9646-z
Fusarium falciforme Infection of Foot in a Patient with Type
2 Diabetes Mellitus: A Case Report and Review of the
Literature
Pinaki Dutta A. Premkumar Arunaloke Chakrabarti
Viral N. Shah Arnanshu Behera Deepankar De
Shivaprakash M. Rudramurthy Anil Bhansali
Received: 23 August 2012 / Accepted: 2 April 2013 / Published online: 30 June 2013
Springer Science+Business Media Dordrecht 2013
Abstract Fungal infections of foot in patients with
diabetes are not uncommon; however, foot infection
due to Fusarium species has been rarely reported. We
report here a case of a 50-year-old male with type 2
diabetes who developed multiple spontaneous nodular
lesions on right foot without any systemic symptoms
and signs for 6 months. The lesions were unresponsive
to broad-spectrum antibacterial treatment. Fine needle
aspiration cytology of nodular lesions revealed the
presence of fungal hyphae, and Fusarium species was
isolated from the same sample which was identified as
Fusarium solani species complex: Fusarium falci-
forme. Radiological investigations and blood culture
ruled out any dissemination of the disease. The lesions
healed after voriconazole therapy for 3 months. No
P. Dutta (&)
A. Premkumar
V. N. Shah
A. Bhansali
Department of Endocrinology, Postgraduate Institute of
Medical Education and Research, Chandigarh 160012,
India
e-mail: pinaki_dutta@hotmail.com
A. Chakrabarti
S. M. Rudramurthy
Department of Medical Microbiology, Postgraduate
Institute of Medical Education and Research, Chandigarh,
India
A. Behera
Department of Surgery, Postgraduate Institute of Medical
Education and Research, Chandigarh, India
D. De
Department of Dermatology, Postgraduate Institute of
Medical Education and Research, Chandigarh, India
relapse was noted at the end of the next 6-month
follow-up. All reported cases of Fusarium infection of
foot in patients with diabetes in English and non-
English literature since 1970 have been reviewed.
Keywords Diabetes mellitus
Foot
Fusarium
falciforme
Fusarium solani
Introduction
Patients with type 2 diabetes (T2DM) are susceptible
to foot infection due to sensorimotor neuropathy, loss
of protective sensation, peripheral vascular disease,
and virulence of microbial flora colonizing the skin.
Though fungal infections were considered rare, in
recent years, it is increasingly being recognized in
patients with T2DM. A study from south India
reported positive fungal culture in 27 % of diabetic
patients having lower limb wounds [1]. Most common
fungal agents implicated in patients with diabetes are
dermatophytes affecting nails followed by Candida
species [2].
Fusarium species are ubiquitous in the environment
and may cause serious infections in immunocompro-
mised individuals [3]. Among Fusarium spp., majority
cases are reported due to Fusarium solani, Fusarium
oxysporum, and Fusarium moniliforme. Based on
multilocus sequencing typing (MLST), F. solani is
now considered as F. solani species complex (FSSC)
which accounts for majority of Fusarium infections
123
226
and Fusarium falciforme appears to be the most
common species within FSSC implicated in human
infections [4]. The risk factors for fusariosis are
malignancy, neutropenia, solid organ transplantation,
graft versus host disease, corticosteroid exposure, and
rarely diabetes [4]. We report here an unusual case of
multiple abscess of right foot due to F. falciforme in a
patient with T2DM. As the disease is still rare, we
reviewed all cases of Fusarium infections of the foot in
patients with diabetes reported mainly in English
literature to describe the mode of presentations,
investigations and treatment modalities, and outcome
in such cases.
Case Report
A 50-year-old male, with history of poorly controlled
diabetes and hypertension for 2 years, presented with
multiple nodular lesions on the dorsal surface of right
foot developed over 6 months. The lesions appeared
spontaneously, gradually increasing in size and num-
ber, and were not associated with fever, redness, or
pain. Before presenting at our center, he underwent
incision and drainage of those nodular lesions multiple
times at other centers and received several courses of
antimicrobial regimen without any response. He gave
no history of trauma, thorn prick, or boil at the site.
However, he was a farmer and used to work in the field
barefoot. Therefore, the possibility of unnoticed trivial
trauma could not be ruled out. He was on treatment
with prednisolone 5 mg daily for the past 2 years for
his airborne contact dermatitis. He was also receiving
oral hypoglycemic agents for the management of
T2DM. On examination, he was afebrile, had dry
excoriated skin suggestive of airborne contact derma-
titis. He had a healed corneal ulcer in left eye and
dystrophic nails in toes suggestive of onychomycosis.
Local examination revealed multiple, nodular lesions
over dorsum of right foot each measuring 34 cm with
solid cystic consistency without any redness, warmth,
induration, local tenderness or draining sinuses, and
nodules were not fixed to underlying structure
(Fig. 1a). There was no local callosity, lymphangitis,
or inguinal lymphadenopathy. Both anterior tibial and
posterior tibial pulsations were normal. Neurological
examination revealed bilateral sensory neuropathy
with loss of protective reflexes. Laboratory investiga-
tions revealed normal hemogram, total and differential
123
Mycopathologia (2013) 176:225232
leukocyte counts, renal and liver functions. He had
poor glycemic control with HbA1c of 11 %. The plain
X-ray of right foot demonstrated soft tissue edema
without any evidence of osteomyelitis. MRI right foot
revealed variable-sized collections in dorsum and
anteromedial aspect in soft tissue of right foot with
post-contract enhancement and largest collection size
measuring 3.8 9 1.8 cm overlying second metatarsal
bone (Fig. 1b). He underwent needle aspiration of
nodule, which yielded purulent material. Gram stain
and bacterial culture were negative. Fungal smear
showed septate hyaline hyphae with acute-angled
branching suggesting hyalohyphomycosis. Culture of
the purulent material on Sabouraud dextrose agar
yielded aerial white mycelia colonies with vinaceous
color reverse in some cases. Microscopic examination
of the colony showed undifferentiated long conidio-
phores bearing monophialides. Macroconidia were
falcate with 14 septa (2534 9 34 lm), whereas
microconidia were ellipsoidal often curved with 01
septa (513 9 24 lm). Based upon these morpho-
logical features, the isolate was identified as FSSC.
The identification of the correct species was done by
sequencing of the ITS region of ribosomal DNA and
partial region of translation elongation factor 1 alpha
gene (tef-1a, Sigma-Aldrich, Bengaluru, India). ITS
region was amplified using primer pairs ITS1 (TCCG
TAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTT
ATTGATATGC), whereas tef-1a gene was amplified
with TEF-f (GGTATCGACAAGCGAACCAT) and
TEF-r (TAGTAGCGGGGAGTCTCGAA).
Consensus sequences were obtained using the
Bionumerics software (version 6.6, Applied Maths,
Ghent, Belgium). Polyphasic identification using multi-
ple sequence alignment in the Fusarium MLST database
(http://www.cbs.knaw.nl/fusarium/BioloMICS.aspx)
showed that our isolate belonged to F. solani species
complex (FSSC clade 3), F. falciforme, MLST type
3?4-ddd with 99.3 % similarity with CBS 101427
strain. The nucleotide sequence of ITS region and tef-
1a was deposited in the GenBank with accession
numbers JX624109 and (HF937435, F. falciforme
partial tef-1a gene for translation elongation factor 1
alpha, isolated MLST 3?4dd, European Nucleotide
Archive), respectively. The scarping from onych-
omycotic foot nails yielded growth of mold which was
identified as Emericella corrugata on internal tran-
scribed spacer (ITS) sequence of rDNA. His fungal
serology for Aspergillus and Histoplasma precipitins
Mycopathologia (2013) 176:225232
Fig. 1 a Multiple nodular lesions in dorsum of right foot
(before treatment). b Lesions showing regression 3 months
after debridement and voriconazole treatment. c Pretreatment
was negative. A diagnosis of localized subcutaneous
fusariosis was made. The patient underwent debride-
ment and was treated with loading dose of voriconazole
6 mg/kg intravenously 2 doses followed by oral voric-
onazole 200 mg twice daily for the next 3 months.
Prednisolone was changed to equivalent doses of
hydrocortisone, and strict glycemic control was main-
tained with multiple subcutaneous insulin (MSI) regi-
men. On follow-up at 3 months, the lesions regressed
completely. Voriconazole was stopped and no relapse
was noticed at 6-month follow-up (Fig. 1c, d).
Discussion
The present case describes an unusual subcutaneous
abscess of the right foot due to F. falciforme in a
227
MRI showing multiple abscesses in medial aspect of foot.
d Post-treatment MRI of same patient shows small residual
abscess in medial aspect of foot (arrow)
patient with poorly controlled diabetes. All cases of
foot infection due to Fusarium species reported in the
literature in last 4 decades are also reviewed.
Infection in foot is the most common complication
causing considerable morbidity and mortality in
diabetic patients. Uncontrolled and long-standing
diabetes is associated with decreased neutrophil
adherence, chemotaxis, opsonization, and intracellular
killing of microorganisms [2]. Reduced cell-mediated
immunity and abnormally delayed T cell hypersensi-
tivity are also responsible for increased susceptibility
to opportunistic fungal infections [2]. Furthermore,
combination of peripheral vascular disease causing
poor circulation to the legs and feet and neuropathy
results in impaired sensation leading to unnoticed
trauma which ultimately may predispose diabetics to
foot infections. Most of the infections in the diabetic
123
228
foot are polymicrobial in nature with predominance of
gram-negative organisms [5]. Mycotic infections of
the diabetic foot can be superficial in nature involving
skin and nail or subcutaneous [6]. The fungi involved
in the subcutaneous infections are mainly Candida
spp. or Fusarium spp. [6, 7].
Fusarium spp. are a ubiquitous fungi, are being
increasingly reported from human infections in recent
years. Fusarium is a saprobic mold with panglobal
distribution. Although the members of this genus rarely
cause opportunistic infections in human, at least 69
Fusarium spp. have been implicated in human and other
animal mycosis [8, 9]. Fusarium solani species accounts
for the majority of human infection. This species was
purposed only based on morphology, is actually a
diverse complex of over 45 phylogenetical and/or
biological species and collectively they are termed as
F. solani complex (FSC). Within the FSC, F. falciforme
appears to be the most common species [8, 10]. It is
difficult to identify them just based on the morphology,
and hence, multilocus sequence typing is recommended
to identify and characterize this species. These fungi
may produce mycotoxins, suppress immunity, adhere to
prosthetic materials, and cause tissue breakdown with
proteases and collagenases [3]. The portal of entry is
usually paranasal sinuses, lung, and skin; however, it
can also enter following surgery, use of indwelling
catheter, peritoneal dialysis, and in intravenous drug
abuser. In our present case, the patients possibly
acquired the infection through skin while working bare
foot in the field. Therefore, the possibility of unnoticed
trivial trauma could not be ruled out. Contact dermatitis
in this patient might have additionally increased the
chance of breach in skin and acquisition of the agent
from environment. Fusarium spp. cause wide spectrum
of infection in humans including locally invasive in
immunocompetent subjects to disseminated infection in
immunocompromised subjects [11]. The risk factors for
fusariosis are malignancy, neutropenia, solid organ
transplantation, graft versus host disease, corticosteroid
exposure, and rarely diabetes [11]. Localized infection
includes onychomycosis, nodulo-ulcerative lesion, cel-
lulitis, mycetoma, ecthyma gangrenous like lesions,
abscess, keratitis, endophthalmitis, osteomyelitis, septic
arthritis, cystitis, peritonitis, and brain abscess [11].
Cutaneous lesions usually present as ecthyma like target
lesion surrounded by erythema and subcutaneous pain-
ful nodule. The present case had multiple painless
subcutaneous nodules.
123
Mycopathologia (2013) 176:225232
Our extensive literature search for Fusarium infec-
tion (using the term Fusarium/Fusariosis/Acremo-
nium falciforme AND diabetes, leg infection, foot
infection in PubMed) from 1970 to April 2012
revealed 27 cases out of which 17 cases were in
patients with diabetes mellitus (16 were type 2
diabetics and one was having secondary diabetes),
one patient developed diabetes on follow-up [1226].
Eight patients were non-diabetics and in one patient,
diabetic status was unknown. Out of the total 27 cases,
18 were having leg/foot involvement (abscess in 4,
mycetoma in 6, fungal nail, cellulitis, nodule, ulcer in
8). Three of those four cases (75 %) were due to F.
solani. Out of the total 27 cases, 5 had systemic signs
[19, 22] and 13 had comorbidities other than diabetes
mellitus, 9 had no comorbidities or it was unknown.
All the four cases with foot abscess had local signs and
symptoms. In almost all the cases, infections begin
with either unrecognized skin or nail infections and
invaded into deep tissue gradually.
Of the 17 cases with diabetes, two were having
endophthalmitis following cataract surgery [12], one
lung infection by F. oxysporum [13], one peritonitis
[14], one breast abscess [15], one vertebral osteomy-
elitis [16], two leg ulcer [17], and nine foot lesions [7,
1822]. Review of salient features of 18 patients with
foot involvement of which 4 manifesting as foot
abscess in diabetic patients are presented in Tables 1,
2 respectively.
Out of 27 reported cases of human fusariosis, 11
cases were due to F. solani, eightF. falciforme, five
casesspecies identification was not done, twoF.
oxysporum, and oneFusarium acutatum. Out of all
patients with F. falciforme infection, only the present
case had coexistent diabetes, and in the another case of
mycetoma due to A. falciforme, patient developed
diabetes during the course of follow-up [27]. Those
patients with diabetes and Fusarium infections of foot
presented at mean age of 58.3 years, and there was no
gender predisposition.
Treatment regime in Fusarium infections varied.
Out of the 27 patients, 16 were treated with systemic
antifungals (Azoles 13, AMB 3), and in two patients,
local azoles were used. Primary surgical treatment
without antifungal was offered to four patients (one
received systemic amphotericin B after amputation).
Treatment details were unknown/or no treatment was
offered to three patients. Out of 16 patients receiving
systemic antifungal treatment, four required surgical
 Table 1 Clinical and treatment details of 27 patients of Fusarium infection
Sl. Age/sex First author Comorbidity other Site of the lesion(s) Systemic Species Treatment Duration of treatment/
no. [reference than diabetes signs and improvement
no.] symptoms

1 69/M Sierra- Sarcoidosis on Ulcer and osteomyelitis right ? Fusarium spp. Voriconazole 3 weeks/improved
Hoffman prednisolone, 4th toe after multiple surgery
et al. [19] HTN, PVD and and amputation
CKD
2 62/F Cakir et al. Cataract surgery Endophthalmitis (L) - Fusarium spp. Voriconazole ? vitrectomy Corneal opacity
[12]
Mycopathologia (2013) 176:225232

3 49/M Cakir et al. Cataract surgery Endophthalmitis (L) - Fusarium spp. Itraconazole Evisceration
[12] voriconazole ? vitrectomy
4 56/F Garbino Renal transplant, Peritonitis (L) ? Fusarium spp. Voriconazole for 3 months Improved
et al. [25], peritoneal
dialysis
5 53/M Bader et al. CKD, on Foot ulcer, toe osteomyelitis - Fusarium solani Voriconazole for 1 month, Below knee
[7] hemodialysis (L) poor response amputation
6 14/M Moschovi Nil Vertebral osteomyelitis (L) ? Fusarium spp. AMB for 4 weeks Bacterial
et al. [16] superinfection
7 68/M Taj-Aldeen Peripheral Gangrenous ulcer (L) - Fusarium acutatum Debridement Improved
et al. [20] vascular disease
8 92/F Wu et al. CKD Onychomycosis, ulcer (L) ? Fusarium solani Itraconazole Bacterial super
[22] infection,
osteomyelitis
9 65/M Pai et al. Malnutrition, Left leg and foot - Fusarium solani Operated Above knee
[23] HTN amputation followed
by AMB for 2 weeks,
improved
10 51/F Torres- Nil Onychomycosis, cellulitis - Fusarium solani 40 % urea ? bifonazole and Recovered in
Rodriguez (bilateral) ciclopirox olamine 12 months
[18]
11 NA Girardi et al. Renal transplant Foot abscess (L) - Fusarium solani AMB for 3 months Debridement
[26] recovered
12 55/F Anandi et al. Nil Breast abscess (L) - Fusarium solani NA NA
[15]
13 68/F Perez-Perez HTN, NHL Anterior aspect of left leg, 2 - Fusarium solani Improved Itraconozole, duration
et al. [24] ulcers with necrotic center not mentioned
and erythematous border
14 69/F van Dijk Nil Leg ulcer (L) - Fusarium solani Local miconazole Improved
et al. [17]
229

123
 Table 1 continued
230

Sl. Age/sex First author Comorbidity other Site of the lesion(s) Systemic Species Treatment Duration of treatment/
no. [reference than diabetes signs and improvement

123
no.] symptoms

15 67/F Pereiro et al. Nil Ulcero-nodular lesion (L) - Fusarium oxysporum Fluconazole for 3 months Improved
[21]
16 37/M Halde et al. Non-diabetic Right foot mid-tarsal area - A. falciforme Symes amputation 10-year follow-up,
[27] following trauma improved
17 45/F Muller et al. Short bowel Catheter-related sepsis with ? Fusarium oxysporum Voriconazole for 35 days Improved
[13] syndrome, pulmonary infiltrates (D)
asplenia,
secondary DM
18 55/F Halde et al. Diabetes during Right great toe - A. falciforme Nil Disease static
[27] the course of
illness,
hyperuricemia
19 47/M Halde et al. Non-diabetic Right ring finger, - A. falciforme Multiple excision Protracted course,
[27] following ulceronodular region static disease
trauma
20 64/M Milburn Non-diabetic, No Left foot mycetoma like - A. falciforme No, refused treatment No
et al. [29] other lesion for years
comorbidities
21 Not McCormac Non-diabetic, no 25 years of mycetoma Unknown A. falciforme Unknown Unknown
known et al. [30]
22 Not Negroni Unknown Lower limb mycetoma, site - A. falciforme (2), Ketoconazole/itraconazole Improved
known et al. [31] not specified Fusarium solani
(2) out of 86
mycetoma
23 62/F Garbino Minor trauma, Right foot - Fusarium solani AMBcumulative dose of Recovered
et al. [25] non-diabetic 2g
24 50/M Our case Airborne contact Right foot nodular lesions - Fusarium falciforme Voriconazole and surgical 3 months/improved
dermatitis debridement
CKD chronic kidney disease, AMB amphotericin B, HTN hypertension, NHL non-Hodgkin lymphoma, A. Falciforme Acremonium Falciforme
Mycopathologia (2013) 176:225232
Mycopathologia (2013) 176:225232
Table 2 Clinical and treatment details of patients with T2DM and subcutaneous abscess of the foot due to F. solani/F. falciforme
S. Reference Species Comorbidity
no
1 Leu et al. [32] Fusarium solani Minor trauma
2 Girardi et al. Fusarium solani Post-renal transplant
[26]
3 Anandi et al. Fusarium solani Diabetes
[15]
4 Index case Fusarium Diabetes,
falciforme corticosteroids
debriment later. Voriconazole was the predominant
azole used in current era with good outcome (Table 1).
Our patient presented with nodular lesion on the foot
in fifth decade and is the only one who was diabetic
with F. falciforme as the causative organism having
foot abscess of all described cases till date. The extent
and characteristics of the lesion was well delineated by
MRI for the first time. He responded well to vorico-
nazole and through debridement and re-emphasizing
that combined treatment modalities have better
outcome.
Diagnosis of Fusarium infections requires high
index of suspicion and isolation of the fungus. Direct
microscopic examination of the sample from the
lesion may not reveal fungal hyphae due to low
density. Microscopically, the hyphae of Fusarium in
tissue resemble those of Aspergillus species; however,
the hyphae of Fusarium species are usually thin. In
systemic infection, blood culture may help in isolating
Fusarium species and may help in performing in vitro
susceptibility testing for optimization of therapy in
resistant cases. Proper identification of species often
requires genetic diagnosis based on multilocus
sequencing typing. Fusarium falciforme was previ-
ously classified as A. falciforme/Cephalosporium;
however, after the availability of gene-based diagno-
sis, it is renamed under FSSC. Infections due to
Fusarium species are difficult to treat, since the agents
are resistant to echinocandins and are variably
susceptible to amphotericin, voriconazole, and posa-
conazole. For localized cutaneous lesions, surgical
excision and/or systemic antimycotics yield good
outcome. High-dose amphotericin B was the treatment
for choice in patients with disseminated disease before
the introduction of voriconazole and posaconazole
[28]. Voriconazole at a dose of 6 mg/kg twice daily on
231
Treatment Outcome Systemic
signs
AMBcumulative dose of 2 g Recovered Nil
Debridement and AMB for Persistent Nil
3 months disease
NA NA Nil
Voriconazole for 3 months Recovered Nil
day one and then 4 mg/kg twice daily might be an
alternative therapy for patients who are unresponsive
to amphotericin B. In the patients of diabetes with
localized lesions, debridement should be performed in
all cases. However, the optimal duration of antifungal
therapy is not known.
Our case is the fourth case of subcutaneous foot
abscess due to Fusarium species in patients with
T2DM and first case due to F. falciforme. In previous
reports of F. falciforme/A. falciforme, the diagnosis
was based on morphological criteria and reports of
pure culture. However, in our study, the isolate was
characterized by DNA sequencing and identified as F.
falciforme within FSSC. MRI also helps to know the
extent of the lesion. Absence of discharging sinus or
bulls eye lesion on MRI, the characteristic features of
mycetoma, was not present in our patient.
In conclusion, this case highlights the need of
increased suspicion for fungal infection in patients
with diabetes. Fusarium infections in diabetics in
general and that of foot abscess in particular are
relatively rare. It is difficult to diagnose and charac-
terize the species based on fine needle aspiration
cytology and histopathology. Heightened awareness,
deep tissue culture along with morphology color of the
granules and genetic analysis is required for proper
identification of the species which helps in choosing
optimal therapy in early diagnosis of such rare
infection and in choosing optimal therapy.
Acknowledgments We acknowledge the Indian council of
Medical Research for supporting the NCCPF where the
molecular identification was done. We are grateful to
Department of Photography (Mr. Brij Lal and Mr. Abhijeet)
for the taking patients photographs. We also thank Mr.
Prakamya Gupta, Ms. Shallu, Ms. Pooja, and Mr. Parveen
Garg for manuscript editing.
123
232
Conflict of interest None.
ReferencesQuery
1. Chellan G, Shivaprakash S, Karimassery Ramaiyar S,
Varma AK, Varma N, Thekkeparambil Sukumaran M, et al.
Spectrum and prevalence of fungi infecting deep tissues of
lower-limb wounds in patients with type 2 diabetes. J Clin
Microbiol. 2010;48:2097102.
2. Dogra S, Kumar B, Bhansali A, Chakrabarty A. Epidemi-
ology of onychomycosis in patients with diabetes mellitus in
India. Int J Dermatol. 2002;41:64751.
3. Nelson PE, Dignani MC, Anaissie EJ. Taxonomy, biology,
and clinical aspects of Fusarium species. Clin Microbiol
Rev. 1994;7:479504.
4. ODonnell K, Sutton DA, Fothergill A, McCarthy D, Ri-
naldi MG, Brandt ME, et al. Molecular phylogenetic
diversity, multilocus haplotype nomenclature, and in vitro
antifungal resistance within the Fusarium solani species
complex. J Clin Microbiol. 2008;46:247790.
5. Parvez N, Dutta P, Ray P, Shah VN, Prakash M, Khandelwal
N, et al. Microbial profile and utility of soft tissue, pus, and
bone cultures in diagnosing diabetic foot infections. Dia-
betes Technol Ther. 2012;14:66974.
6. Heald AH, OHalloran DJ, Richards K, Webb F, Jenkins S,
Hollis S, et al. Fungal infection of the diabetic foot: two
distinct syndromes. Diabet Med. 2001;18:56772.
7. Bader M, Jafri AK, Krueger T, Kumar V. Fusarium osteo-
myelitis of the foot in a patient with diabetes mellitus. Scand
J Infect Dis. 2003;35:8956.
8. Nucci M, Anaissie E. Fusarium infections in immuno-
compromised patients. Clin Microbiol Rev. 2007;20:
695704.
9. ODonnell K, Sutton DA, Rinaldi MG, Sarver BA, Balajee
SA, Schroers HJ, et al. Internet-accessible DNA sequence
database for identifying fusaria from human and animal
infections. J Clin Microbiol. 2010;48:370818.
10. Zhang N, ODonnell K, Sutton DA, Nalim FA, Summerbell
RC, Padhye AA, et al. Members of the Fusarium solani
species complex that cause infections in both humans and
plants are common in the environment. J Clin Microbiol.
2006;44:218690.
11. Nucci M, Anaissie E. Cutaneous infection by Fusarium
species in healthy and immunocompromised hosts: impli-
cations for diagnosis and management. Clin Infect Dis.
2002;35:90920.
12. Cakir M, Imamoglu S, Cekic O, Bozkurt E, Alagoz N,
Oksuz L, et al. An outbreak of early-onset endophthalmitis
caused by Fusarium species following cataract surgery.
Curr Eye Res. 2009;34:98895.
13. Muller C, Schumacher U, Gregor M, Lamprecht G. How
immunocompromised are short bowel patients receiving
home parenteral nutrition? Apropos a case of disseminated
Fusarium oxysporum sepsis. J Parenter Enteral Nutr. 2009;
33:71720.
14. Garcia-Martos P, Gil de Sola F, Marin P, Garcia-Agudo L,
Garcia-Agudo R, Tejuca F, et al. Fungal peritonitis in
ambulatory continuous peritoneal dialysis: description of 10
cases. Nefrologia. 2009;29:5349.
123
Mycopathologia (2013) 176:225232
15. Anandi V, Vishwanathan P, Sasikala S, Rangarajan M,
Subramaniyan CS, Chidambaram N. Fusarium solani breast
abscess. Indian J Med Microbiol. 2005;23:1989.
16. Moschovi M, Trimis G, Anastasopoulos J, Kanariou M,
Raftopoulou A, Tzortzatou-Stathopoulou F. Subacute ver-
tebral osteomyelitis in a child with diabetes mellitus asso-
ciated with Fusarium. Pediatr Int. 2004;46:7402.
17. van Dijk E, van den Berg WH, Landwehr AJ. Fusarium
solani infection of a hypertensive leg ulcer in a diabetic.
Mykosen. 1980;23:6036.
18. Torres-Rodriguez JM, Sellart-Altisent M. Bilateral proxi-
mal cellulitis and onychomycosis in both big toes due to
Fusarium solani. Rev Iberoam Micol. 2006;23:2414.
19. Sierra-Hoffman M, Paltiyevich-Gibson S, Carpenter JL,
Hurley DL. Fusarium osteomyelitis: case report and review
of the literature. Scand J Infect Dis. 2005;37:23740.
20. Taj-Aldeen SJ, Gene J, Al Bozom I, Buzina W, Cano JF,
Guarro J. Gangrenous necrosis of the diabetic foot caused
by Fusarium acutatum. Med Mycol. 2006;44:54752.
21. Pereiro M Jr, Abalde MT, Zulaica A, Caeiro JL, Florez A,
Peteiro C, et al. Chronic infection due to Fusarium oxy-
sporum mimicking lupus vulgaris: case report and review of
cutaneous involvement in fusariosis. Acta Derm Venereol.
2001;81:513.
22. Wu CY, Chen GS, Lan CC. Onychomycosis caused by
Fusarium solani in a woman with diabetes. Clin Exp Der-
matol. 2009;34:e7724.
23. Pai R, Boloor R, Shreevidya K, Shenoy D. Fusarium solani:
an emerging fungus in chronic diabetic ulcer. J Lab Physi-
cians. 2010;2:379.
24. Perez-Perez L, Pereiro M Jr, Sanchez-Aquilar D, Toribio J.
Ulcerous lesions disclosing cutaneous infection with
Fusarium solani. Acta Derm Venereol. 2007;87:4224.
25. Garbino J, Uckay I, Rohner P, Lew D, Van Del C, et al.
Fusarium peritonitis concomitant to kidney transplantation
successfully managed with voriconazole: case report and
review of the literature. Transpl Int. 2005;18:6138.
26. Girardi M, Glusac EJ, Imaeda S. Subcutaneous Fusarium
foot abscess in a renal transplant patient. Cutis. 1999;
63:26770.
27. Halde C, Padhye AA, Haley LD, Rinaldi MG, Kay D,
Leeper R. Acremonium falciforme as a cause of mycetoma
in California. Sabouraudia. 1976;14:31926.
28. Chen SC, Playford EG, Sorrell TC. Antifungal therapy in
invasive fungal infections. Curr Opin Pharmacol. 2010;10:
52230.
29. Milburn PB, Papayanopulos DM, Pomerantz BM. Myce-
toma due to Acremonium falciforme. Int J Dermatol. 1988;
27:40810.
30. McCormack JG, McIntyre PB, Tilse MH, Ellis DH.
Mycetoma associated with Acremonium falciforme infec-
tion. Med J Aust. 1987;147(4):1878.
31. Negroni R, Lopez Daneri G, Arechavala A, Bianchi MH,
Robles AM. Clinical and microbiological study of my-
cetomas at the Muniz hospital of Buenos Aires between
1989 and 2004. Rev Argent Microbiol. 2006;38:138.
32. Leu HS, Lee AY, Kuo TT. Recurrence of Fusarium solani
abscess formation in an otherwise healthy patient. Infection.
1995;23:3035.