Anda di halaman 1dari 344

Sanksi Pelanggaran Pasal 72

Undang-Undang Nomor 19 Tahun 2002


1. Barang siapa dengan sengaja dan tanpa hak melakukan
perbuatan sebagaimana dimaksud dalam pasal 2 ayat (1) atau
pasal 49 ayat (1) dan ayat (2) dipidana penjara paling singkat
1 (satu) bulan dan/atau denda paling sedikit Rp. 1.000.000,00
(satu juta rupiah) atau paling lama 7 (tujuh) tahun dan/atau
denda paling banyak Rp. 5.000.000.000,00 (lima miliar rupiah).
2. Barang siapa dengan sengaja menyiarkan, memamerkan,
mengedarkan, atau menjual kepada umum suatu ciptaan dan
barang hasil pelanggaran hak cipta atau hak terkait, sebagaimana
dimaksud ayat (1) dipidana dengan pidana paling lama 5 (lima)
tahun dan/atau denda paling banyak Rp. 500.000.000,00 (lima
ratus juta rupiah).
DETEKSI DINI STROKE ISKEMIA
dengan Pemeriksaan
ultrasonografi VaskulAr dan
variasi genetika

Yuyun Yueniwati

UB
Press

2014
DETEKSI DINI STROKE ISKEMIA DENGAN PEMERIKSAAN
ULTRASONOGRAFI VASKULAR DAN VARIASI GENETIKA
UB Press

Cetakan Pertama, Desember 2014


Hak Cipta dilindungi Undang-Undang
All Right Reserved

Penulis : Dr. dr. Yuyun Yueniwati P.W., M.Kes. Sp.Rad.


Editor : Ruri Erlangga
Perancang Sampul : Miftahul Farid
Penata Letak : Jerry Katon
Pracetak dan Produksi : Tim UB Press

Penerbit:

UB
Press

Universitas Brawijaya Press (UB Press)


Penerbitan Elektronik Pertama dan Terbesar di Indonesia
Jl. Veteran, Malang 65145 Indonesia
Telp. : 0341-551611 Psw. 376
Fax. : 0341-565420
e-mail : ubpress@gmail.com/ubpress@ub.ac.id
http://www.ubpress.ub.ac.id

ISBN:
xx + 324 hlm, 15,5 cm x 23,5 cm

Dilarang keras memfoto kopi atau memperbanyak sebagian


atau seluruh buku ini tanpa seizin tertulis dari penerbit

iv
Kata Pengantar Ahli

S
ungguh kebanggaan luar biasa
atas ditulisnya buku yang
berjudul Deteksi Dini
Stroke Iskemia dengan Pemeriksaan
Ultrasonografi Vaskular dan Variasi
Genetika. Buku ini ditulis oleh
Dr.dr.Yuyun Yueniwati, M.Kes., Sp.Rad.
berdasarkan hasil penelitian yang mendalam
dan telah dipertahankan dalam sidang terbuka
dengan hasil cumlaude.
Stroke memang menjadi masalah besar yang sering
memberikan kecacatan, bahkan kematian bagi penderitanya.
Baik di Indonesia maupun di luar negeri, stroke masih menjadi
permasalahan yang besar. Penelitian mendalam yang dilakukan
penulis mengupas mengenai biologi molekular stroke juga
mengenai genetika dari suku Jawa. Meskipun demikian, hal ini
menunjukkan bahwa penyakit ini dapat diderita oleh semua etnis,
baik di Indonesia atau di luar negeri.
Pemeriksaan radiologis, terutama ultrasonografi telah
dibuktikan sangat penting guna mendeteksi secara dini. Dengan
demikian, tindakan pencegahan pada penyakit stroke iskemia
dapat dilakukan.
Penghargaan setinggi-tingginya atas kerja keras dan penuh
semangat atas penulisan buku ini. Harapan kami, agar penerbitan
buku ini dapat memberikan manfaat bagi masyarakat, bangsa,
dan negara. Sekali lagi selamat dan sukses kepada Dr. dr. Yuyun
Yueniwati, M.Kes., Sp.Rad.
Surabaya, April 2014
Prof. Dr. dr. Triyono KSP, Sp.Rad.
Guru Besar Radiologi Fakultas Kedokteran
Universitas Airlangga Surabaya

v
Kata Pengantar Ahli

P
uji syukur saya panjatkan
ke hadirat Allah SWT atas
diterbitkannya buku Deteksi
Dini Stroke Iskemia dengan Pemeriksaan
Ultrasonografi Vaskular dan Variasi
Genetika. Buku ini merupakan hasil
penelitian disertasi selama penulis
menjalani pendidikan Doktor di Fakultas
Kedokteran Universitas Airlangga. Penulisan
buku ini merupakan bentuk tanggung jawab sosial penulis untuk
menyebarkan ilmu ke masyarakat dan sekaligus meningkatkan
atmosfir akademik di Fakultas Kedokteran Universitas Brawijaya.
Kecenderungan makin mudanya usia penderita stroke
merupakan masalah besar yang seharusnya diselesaikan secara
komprehensif dan terpadu, antara lain melalui peningkatan deteksi
dan upaya pencegahan sedini mungkin. Penggabungan teknologi
ultrasonografi dan konsep genetika dalam buku ini mudah-
mudahan dapat memberikan kontribusi dalam menyelesaikan
masalah tersebut.
Saya berharap tulisan ini dapat berguna bagi mahasiswa,
peneliti, praktisi, maupun pengampu kebijakan, berkaitan
dengan penatalaksanaan stroke melalui pendekatan promotif dan
preventif.
Malang, April 2014
Prof. Dr. dr. M. Rasjad Indra, M.S.
Guru Besar Ilmu Faal Fakultas Kedokteran
Universitas Brawijaya Malang

vi
Kata Pengantar Penulis

S
troke merupakan penyakit penyebab kematian terbanyak
ketiga di dunia dan penyebab kecacatan utama pada
usia produktif. Di Indonesia, dalam dasawarsa terakhir
menunjukkan kecenderungan peningkatan jumlah penderita stroke usia
muda yang produktif. Lebih dari 87% kasus stroke disebabkan iskemia
yaitu penyempitan/pembuntuan pembuluh darah. Stroke iskemia
merupakan kondisi yang berkaitan dengan aterosklerosis (proses
penebalan dan pengerasan dinding pembuluh darah) dan proses ini
dimulai sejak masa anak. Itulah latar belakang mengapa kami menulis
buku ini.
Melihat betapa perlunya mengatasi kondisi di atas, suatu kewajiban
bagi kami untuk dapat menemukan metode deteksi dini aterosklerosis
yang menjadi penyebab stroke iskemia sehingga angka kejadian stroke
menurun. Pemanfaatan teknologi ultrasonografi untuk melihat ketebalan
intima media arteri karotis dan penelitian peranan faktor genetika
terhadap kejadian aterosklerosis kami harapkan dapat berkontribusi
dalam pencegahan penyakit stroke sejak dini. Besar harapan kami,
buku ini dapat memberikan sumbangsih dalam dunia kedokteran
padaumumnya.
Ucapan terima kasih tak terhingga kepada keluargaku, khususnya
kepada suamiku, dr. Eko Arisetijono, Sp.S.(K) atas waktu, tenaga, dan
pikirannya dan juga kepada anak-anakku yang selalu memberi dukungan
dan kesempatan tak terhingga ini. Terima kasih juga kepada semua
pihak yang telah membantu, khususnya kepada Valentina Yurina,S.Si.,M.
Si., Nurus Sobah,S.Farm., dan Endang Rahayu,S.Farm. Kami ucapkan
terima kasih banyak kepada Mba Ruri dan semua tim redaksi yang telah
membantu memperbaiki buku ini, juga kepada Penerbit UB Press yang
telah memberikan kesempatan kepada saya untuk menerbitkan buku ini.
Semoga apa yang kami suguhkan dalam buku ini dapat membantu
siapa saja yang membaca untuk memperoleh informasi mengenai
penanganan dini dalam mengatasi stroke iskemia.
Malang, Mei 2014
Penulis

vii
Daftar Isi

Kata Pengantar Ahli Prof. Dr. dr. Triyono KSP, Sp.Rad.


Guru Besar Radiologi Fakultas Kedokteran Universitas
Airlangga Surabaya . . . . . . . . . . . . . . . . . . . . . . . . . . . . ............................... v
Kata Pengantar Ahli Prof. Dr. dr. M. Rasjad Indra, M.S.
Guru Besar Ilmu Faal Fakultas Kedokteran Universitas
Brawijaya Malang .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . ................................ vi
Kata Pengantar Penulis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ............................... vii
Daftar Isi ........... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ................................ viii
Daftar Tabel ...... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ............................... xii
Daftar Gambar . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ............................... xv
Daftar Arti Lambang/Singkatan/Istilah . . . . . . ............................... xix

Bab1 Selingkup Penyakit Stroke .......................................... 1

1.1 Epidemiologi Stroke . . . . . . . . . . . . . . . . . . . . . . . . . . ................................ 2


1.2 Klasifikasi Stroke .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ................................ 4
1.3 Tanda dan Gejala Stroke .. . . . . . . . . . . . . . . . . . . . ............................... 4
1.4 Faktor Risiko Stroke . . . . . . . . . . . . . . . . . . . . . . . . . . ................................ 6
1.5 Kerugian Paska Stroke . . . . . . . . . . . . . . . . . . . . . . . ............................... 24
1.6 Outcome Stroke . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ................................ 26
1.7 Prognosis stroke .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ................................ 27
Rangkuman . . .... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ................................ 30

Bab2 Memahami Stroke Iskemia ......................................... 33


2.1 Apakah Stroke Iskemia Itu? . . . . . . . . . . . . . . . ............................... 34
2.2 Klasifikasi Stroke Iskemia . . . . . . . . . . . . . . . . . . ............................... 36
2.3 Patofisiologi Stroke Iskemia . . . . . . . . . . . . . . ............................... 37
2.4 Etiologi Stroke Iskemia . . . . . . . . . . . . . . . . . . . . . ................................ 54
2.5 Gangguan Fungsi Kognitif pada Stroke Iskemia . ............. 54
2.6 Faktor yang Mempengaruhi Fungsi Kognitif Paska
Stroke Iskemia . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ............................... 60
2.7 Faktor yang Berkaitan dengan Stroke Iskemia . ............... 65

viii
2.8 Leukosit Neutrofil pada Stroke Iskemia . ......................... 67
2.9 Peranan Inflamasi pada Stroke Iskemia . .......................... 74
2.10 Peranan Sitokin pada Stroke Iskemia ............................... 76
2.11 Penumbra Iskemia . . . . . . . . . . . . . . . . . . . . . . . ..................................... 77
2.12 Reperfusion Injury . . . . . . . . . . . . . . . . . . . . . . . . . .................................... 78
2.13 Peranan Inflamasi pada Reperfusion Injury ..................... 80
2.14 Peranan Sitokin pada Reperfusion Injury . ........................ 81
Rangkuman .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .................................... 82

Bab3 Anatomi Pembuluh Darah dan Arteri Karotis .. .. 87


3.1 Anatomi Pembuluh Darah .. . . . . . . . . . . . .................................... 88
3.2 Anatomi Arteri Karotis .. . . . . . . . . . . . . . . . . .................................... 89
Rangkuman .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .................................... 91

Bab4 Memahami Aterosklerosis . . ......................................... 93


4.1 Patogenesis Aterosklerosis . . . . . . . . . . . .................................... 94
4.2 Mekanisme Aterosklerosis .. . . . . . . . . . ..................................... 96
4.3 Perkembangan Lesi Aterosklerosis . ................................. 98
4.4 Aterosklerosis Sebagai Reaksi Inflamasi . ......................... 102
4.5 Terbentuknya Aterosklerosis pada Usia Dini ................... 103
4.6 Faktor Risiko Aterosklerosis .. . . . . . . . .................................... 104
Rangkuman .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .................................... 106

Bab5 Menentukan Ketebalan Arteri Karotis .................. 109


5.1 Penebalan Intima Media Arteri Karotis ............................ 110
5.2 Hubungan Aterosklerosis dengan Penebalan Intima
Media Arteri Karotis .. . . . . . . . . . . . . . . . . . . . ..................................... 111
5.3 Ketebalan Intima Media pada Anak dan Remaja . ............ 111
5.4 Pengukuran Ketebalan Intima Media Arteri Karotis . ...... 116
Rangkuman .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .................................... 121

Bab6 Monocyte Chemoattractant Protein-1


(MCP-1) ............................................................................... 123
6.1 Peran MCP-1 pada Terjadinya Aterosklerosis . ................. 124
6.2 Polimorfisme MCP-1 . . . . . . . . . . . . . . . . . . . . ..................................... 126
Rangkuman .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .................................... 126

ix
Bab7 Memahami Osteopontin (OPN) .. .............................. 127
7.1. Fungsi Osteopontin (OPN) . . . . . . . . . . . . . . . ................................ 128
7.2 Peranan Osteopontin pada Kelainan Pembuluh Darah. ... 133
7.3 Hubungan Osteopontin dengan Penebalan Intima
Media Arteri Karotis .. . . . . . . . . . . . . . . . . . . . . . . . . ................................ 134
7.4 Peranan Osteopontin sebagai Neuroprotektif pada
Stroke . . ... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ................................ 135
Rangkuman . . .... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ................................ 136

Bab8 Pengaruh Variasi Genetika pada Stroke


Iskemia ................................................................................. 139
8.1 Variasi Genetika .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ................................ 140
8.2 Polimorfisme . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ................................ 140
8.3 Faktor Genetika Vascular Cognitive Impairment . ............. 144
8.4 Fungsi Neuroprotektif Osteopontin pada Stroke ............. 159
Rangkuman . . .... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ................................ 160

Bab9 Polymerase Chain Reaction (PCR) ............................. 163


9.1 Definisi PCR . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ................................ 164
9.2 Komponen PCR .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ............................... 164
9.3 Tahapan PCR .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ................................ 166
9.4 Aplikasi PCR untuk Deteksi SNP .. . . . . . ................................ 168
9.5 DNA Sekuensing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ............................... 169
Rangkuman . . .... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ................................ 170

Bab10 Mengenal Berbagai Deteksi Stroke ........................ 173


10.1 F-A-S-T Cara Mudah Mendeteksi Stroke . .......................... 175
10.2 Transcranial Doppler (TCD) . . . . . . . . . . . . . . . ............................... 177
10.3 Hubungan Nilai Ankle Brachial Index dengan Stroke
Iskemia .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ............................... 185
10.4 Polimorfisme Gly972Arg Gen IRS-1 dan G2350A Gen
ACE pada Stroke Iskemia . . . . . . . . . . . . . . . . . . ............................... 188
10.5 Peran Polimorfisme -455G/A dan -148C/T Gen
Fibrinogen Terhadap Kejadian Hiperfibrinogen dan
Stroke Iskemia Akut Usia Muda .. . . . . . . ................................ 190
Rangkuman . . .... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ................................ 192

x
Bab11 Deteksi Dini Stroke Iskemia dengan
Pemeriksaan Ultrasonografi Vaskular .................... 195
11.1 Pemeriksaan Fisik dan Laboratorium . ............................. 196
11.2 Pemeriksaan Ketebalan Intima Media ............................. 197
11.3 Hasil Analisis Pemeriksaan Ultrasonografi Vaskular ....... 206
Rangkuman .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .................................... 208

Bab12 Deteksi Dini Stroke Iskemia dengan


Pemeriksaan Variasi Genetika ................................... 211
12.1 Polimorfisme Promotor MCP-1 pada Anak Populasi
Jawa dengan Orang Tua Stroke Iskemia . .......................... 212
12.2 Polimorfisme Gen Pengkode OPN pada Anak Populasi
Jawa dengan Orang Tua Stroke Iskemia . .......................... 230
12.3 Variasi Genetika Promoter OPN T-443C pada Anak
Populasi Jawa dengan Orang Tua Stroke Iskemia ............ 236
12.4 Variasi Genetika Insersi G-156GG Promoter OPN pada
Anak Populasi Jawa dengan Orang Tua Stroke Iskemia. .. 261
Rangkuman .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .................................... 278

Bab13 Kesimpulan . . ....................................................................... 281


Daftar Pustaka . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ..................................... 285
Glosarium ... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .................................... 310
Indeks ......... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .................................... 317
Riwayat Penulis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .................................... 324

xi
Daftar Tabel

Tabel 1.1 Klasifikasi hipertensi berdasarkan tekanan


darah . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ............................... 13
Tabel 1.2 Kadar kesetaraan antara kolesterol total dan
kolesterol LDL . . . . . . . . . . . . . . . . . . . . . . . ............................... 15
Tabel 1.3 Klasifikasi Adult Treatment Panel (ATP III)
terhadap kolesterol LDL, total, dan HDL . ............ 16
Tabel 1.4 Hubungan kadar kolesterol dan risiko
aterosklerosis . . . . . . . . . . . . . . . . . . . . . . . . ............................... 16
Tabel 1.5 Rasio kolesterol total terhadap HDL dan tingkat
risiko . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ................................ 17
Tabel 1.6 Diagnosis DM menurut kadar glukosa darah
sesaat dan puasa dengan metode enzimatik
sebagai patokan penyaring dan diagnosis DM ..... 18
Tabel 1.7 Faktor-faktor yang berhubungan dengan
peningkatan risiko kematian dan jeleknya
outcome sesudah stroke . . . . . . . . ............................... 29
Tabel 2.1 Kondisi yang berhubungan dengan iskemia
fokal serebral .. . . . . . . . . . . . . . . . . . . . . . . . . ............................... 54
Tabel 2.2 Kunci-kunci penting dalam diagnosis subtipe
VCI .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ............................... 57
Tabel 2.3 Faktor risiko yang sama pada penyakit
Alzheimer dan VCI .. . . . . . . . . . . . . . . . . ............................... 61
Tabel 2.4 Granula neutrofil manusia . . . . . ............................... 70
Tabel 3.1 Perbedaan arteri dan vena .. . . . ............................... 89
Tabel 5.1 Kondisi yang berkaitan dengan peningkatan
ketebalan intima media arteri karotis .................. 112
Tabel 5.2 Nilai normal ketebalan intima media arteri
karotis dewasa . . . . . . . . . . . . . . . . . . . . . . . ............................... 114

xii
Tabel 5.3 Nilai normal ketebalan intima media arteri
karotis pada anak dan remaja . ............................. 115
Tabel 5.4 Nilai normal ketebalan intima media arteri
karotis berdasarkan kelompok umur ................... 115
Tabel 8.1 Perbedaan efek ApoE3 dan ApoE4 pada
susunan saraf pusat .. . . . . . . . ..................................... 151
Tabel 8.2 Perbedaan sifat ApoE4 yang diproduksi oleh
astrosit dan neuron . . . . . . . . . . . .................................... 155
Tabel 10.1 Nilai normal mean flow velocity pada TCD ........... 183
Tabel 10.2 Kriteria tingkat penurunan diameter arteri
karotis interna . . . . . . . . . . . . . . . . . . . .................................... 185
Tabel 11.1 Karakteristik sampel pada pemeriksaan fisik . .... 197
Tabel 11.2 Hasil pemeriksaan ultrasonografi . ....................... 200
Tabel 11.3 Komparasi kelompok kasuskontrol anak
perempuan . . . . . . . . . . . . . . . . . . . . . . . . .................................... 204
Tabel 11.4 Komparasi kelompok kasuskontrol anak
laki-laki . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .................................... 205
Tabel 11.5 Analisis korelasi ketebalan rata-rata intima
media arteri karotis .. . . . . . . . ..................................... 206
Tabel 12.1 Deskripsi hasil sekuensing . .................................. 222
Tabel 12.2 Hasil analisis primer OPN . .................................... 232
Tabel 12.3 Optimasi kondisi PCR untuk amplifikasi gen
target OPN menggunakan primer OPN I . ............. 233
Tabel 12.4 Optimasi kondisi PCR untuk amplifikasi gen
target OPN menggunakan primer OPN II ............. 234
Tabel 12.5 Hasil analisis primer OPN . .................................... 238
Tabel 12.6 Optimasi PCR untuk amplifikasi gen target OPN
menggunakan master mix OPN I ........................... 240
Tabel 12.7 Optimasi PCR menggunakan Pfu DNA
polimerase OPN II . . . . . . . . . . . . ..................................... 241
Tabel 12.8 Optimasi PCR menggunakan dNTP baru
OPN III . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .................................... 243

xiii
Tabel 12.9 Optimasi PCR menggunakan master mix
OPN V . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ................................ 245
Tabel 12.10 Hasil pengukuran konsentrasi produk PCR . ........ 246
Tabel 12.11 Data mutasi sampel promoter OPN T-443C
menggunakan program CLC main
workbench 6.0 . . . . . . . . . . . . . . . . . . . . . . . ............................... 248
Tabel 12.12 Data mutasi sampel promoter OPN T-443C
menggunakan program Sequencher 5.1 . .............. 250
Tabel 12.13 Karakteristik sampel penelitian . .......................... 262
Tabel 12.14 Hasil laboratorium . . . . . . . . . . . . . . . . . ............................... 263
Tabel 12.15 Hasil pemeriksaan ultrasonografi . ....................... 264
Tabel 12.16 Komparasi kelompok kontrol kasus anak
perempuan . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ............................... 264
Tabel 12.17 Komparasi kelompok kontrol kasus anak
laki-laki . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ................................ 265
Tabel 12.18 Komparasi ketebalan intima media arteri
karotis dengan faktor pengganggu . ...................... 266

xiv
Daftar Gambar

Gambar 1.1 Tipe stroke .. . . . . . . . . . . . . . . . . . . . ..................................... 5


Gambar 2.1 Gambaran terjadinya stroke iskemia . ............... 35
Gambar 2.2 Mekanisme glutamat dalam meningkatkan
influx kalsium . . . . . . . . . . . . . . . . . .................................... 40
Gambar 2.3 Kaskade terjadinya iskemia serebral . ............... 41
Gambar 2.4 Respon jaringan otak terhadap penurunan
aliran darah otak . . . . . . . . . . . ..................................... 43
Gambar 2.5 Kaskade apoptosis pada stroke iskemia .......... 52
Gambar 2.6 Gambaran diagramatis sel asal sumsum
tulang . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .................................... 68
Gambar 2.7 Dua buah inti batang netrofil dan dua buah
inti segmen neutrofil . . . . . ..................................... 70
Gambar 2.8 Pengerahan leukosit ke jaringan otak . .............. 75
Gambar 3.1 Struktur pembuluh darah . ................................. 88
Gambar 3.2 Penampang arteri dan vena . .............................. 89
Gambar 3.3 Anatomi arteri karotis . . ..................................... 90
Gambar 4.1 Hipotesis respon terhadap injuri berdasarkan
Ross 1999 . . . . . . . . . . . . . . . . . . . . . . . .................................... 95
Gambar 4.2 Mekanisme pembentukan sel busa . .................. 97
Gambar 4.3 Perkembangan lesi aterosklerosis:
(a)pembentukan fatty streak
(b) pembentukan fibrous plaque dan
(c) terjadinya lesi komplikasi . ........................... 99
Gambar 4.4 Mekanisme aterogenesis pada stroke . .............. 102
Gambar 4.5 Umpan balik siklus inflamasi pada stroke . ....... 103
Gambar 5.1 Ketebalan intima media arteri karotis . ............. 118
Gambar 6.1 Peran MCP-1 . . . . . . . . . . . . . . . . . . . .................................... 125
Gambar 7.1 Struktur osteopontin . . . . . .................................... 129
Gambar 7.2 Fungsi biologis OPN . . . . . . ..................................... 131

xv
Gambar 8.1 Gambaran struktural osteopontin ..................... 142
Gambar 9.1 Komponen PCR dan tahapan PCR . .................... 168
Gambar 9.2 Cetakan basa DNA menggunakan Dye-
terminating Sequensing yang dilabel dengan
flourosense . . . . . . . . . . . . . . . . . . . . . . . . . . . ............................... 169
Gambar 10.1 Cara membaca bentuk gelombang pada
pengukuran TCD .. . . . . . . . . . . . . . . ................................ 182
Gambar 10.2 Nilai pulsasity index .. . . . . . . . . . . . ............................... 182
Gambar 10.3 Modifikasi TIBI flow grading system ................. 184
Gambar 10.4 Nilai PSV dan EDV pada stenosis arteri
karotis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ............................... 185
Gambar 11.1 Distribusi sampel berdasar jenis kelamin ......... 197
Gambar 11.2 Cara pemeriksaan ketebalan intima media
arteri karotis dengan sudut pengukuran :
A = transversal ; B = posterolateral;
C = anterolateral . . . . . . . . . . . . . . . . . ................................ 199
Gambar 11.3 Lokasi pemeriksaan ketebalan intima media
arteri karotis, reprinted dari Howard etal. . ...... 200
Gambar 12.1 Hasil isolasi DNA . . . . . . . . . . . . . . . . ................................ 213
Gambar 12.2 Amplifikasi gen pengkode MCP-1
(regio amplifikasi 48055733: 929 bp) . ........... 214
Gambar 12.3 Elektroforegram hasil PCR MCP-1 ..................... 215
Gambar 12.4 Hasil sekuensing dengan primer MCP-1
forward . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ................................ 216
Gambar 12.5 Hasil sekuensing dengan primer MCP-1
reverse .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ................................ 216
Gambar 12.6 Hasil BLAST MCP-1 . . . . . . . . . . . . ................................ 217
Gambar 12.7 Analisis mutasi basa no -2518 pada hasil
sekuensing dengan primer MCP-1 forward . ..... 218
Gambar 12.8 Analisis mutasi basa no -2518 pada hasil
sekuensing dengan primer MCP-1 reverse . ....... 218
Gambar 12.9 Analisis mutasi basa no -2138 pada hasil
sekuensing dengan primer MCP-1 forward . ..... 219

xvi
Gambar 12.10 Analisis mutasi basa no -2138 pada hasil
sekuensing dengan primer MCP-1 reverse . ....... 220
Gambar 12.11 Analisis mutasi basa no -2464 pada hasil
sekuensing dengan primer MCP-1 forward . ..... 221
Gambar 12.12 Analisis mutasi basa no -2464 pada hasil
sekuensing dengan primer MCP-1 reverse . ....... 221
Gambar 12.13 Sekuen Homo sapiens chromosome 4 genomic
contig, GRCh37.p5 Primary Assembly, dengan
SNP OPN T-66G .. . . . . . . . . . . . . ..................................... 231
Gambar 12.14 Elektroforegram hasil PCR OPN . ....................... 231
Gambar 12.15 Hasil sekuensing dengan primer OPN
forward . . . . . . . . . . . . . . . . . . . . . . . . . . . .................................... 235
Gambar 12.16 Hasil sekuensing dengan primer OPN reverse. .. 235
Gambar 12.17 Hasil BLAST OPN . . . . . . . . . . . ..................................... 236
Gambar 12.18 Sekuen Homo sapiens chromosome 4 genomic
contig, GRCh37.p5 Primary Assembly, dengan
SNP OPN T-443C .. . . . . . . . . . . . .................................... 238
Gambar 12.19 Elektroforegram hasil PCR OPN I . ..................... 239
Gambar 12.20 Elektroforegram DNA Template ......................... 240
Gambar 12.21 Elektroforegram hasil PCR OPN V . .................... 244
Gambar 12.22 Hasil sekuensing dengan primer OPN forward . 246
Gambar 12.23 Hasil sekuensing dengan primer OPN reverse. .. 247
Gambar 12.24 Hasil BLAST OPN .. . . . . . . . . . . .................................... 247
Gambar 12.25 Analisis mutasi basa no -443 pada hasil
sekuensing dengan primer OPN forward . ......... 249
Gambar 12.26 Analisis mutasi basa no -443 pada hasil
sekuensing dengan primer OPN reverse . .......... 249
Gambar 12.27 Analisis mutasi basa no -443 pada hasil
sekuensing dengan primer OPN forward . ......... 251
Gambar 12.28 Analisis mutasi basa no -443 pada hasil
sekuensing dengan primer OPN reverse . .......... 251
Gambar 12.29 Distribusi sampel berdasarkan jenis kelamin
pada sampel kasus (kanan: laki- laki, kiri:
perempuan) .. . . . . . . . . . . . . . . . . . . .................................... 263

xvii
Gambar 12.30 Distribusi sampel berdasarkan jenis kelamin
pada sampel kontrol (kanan: laki- laki, kiri:
perempuan) .. . . . . . . . . . . . . . . . . . . . . . . ................................ 263
Gambar 12.31 Sekuen Homo sapiens chromosome 4 genomic
contig, GRCh37.p5 Primery Asslembly, dengan
SNP OPN T-156 GG . . . . . . . . . . . . . . ............................... 267
Gambar 12.32 Elektroforegram hasil PCR OPN . ....................... 268
Gambar 12.33 Hasil sekuensing dengan primer forward . ........ 269
Gambar 12.34 Hasil sekuensing dengan primer reverse . ......... 269
Gambar 12.35 Analisis mutasi basa nomor -156 pada hasil
PCR dengan primer forward . ............................. 270
Gambar 12.36 Analisis mutasi basa no -156 pada hasil
sekuensing dengan primer reverse .................... 271

xviii
Daftar Arti Lambang/
Singkatan/Istilah

ABI : Ankle Brachial Index


ACAPS : Asymptomatic Carotid Progression Study
ARIC : Atheroslerosis Risk In Communities
BLAST : Basic Local Alignment Search Tools
BMI : Body Mass Index
CAD : Coronary Artery Disease
CCA : Common Carotid Artery
ECA : External Carotid Artery
FDA : Food and Drug Administration
FH : Familial Hypercholesterolemia
GENIC study : GENetique de lInfarctus Cerebral study
ICA : Internal Carotid Artery
IFN- : Interferon-
IL-1 : Interleukin-1
IL-8 : Interleukin-8
ILGF : Insulin Like Growth Factor
IMT : Intima Media Thickness
iNOS : Inducible Nitric OxideSynthase
JNC VII : Seventh Report of the Joint National Committee on
the JNC VII Prevention, Detection, Evalution, and
Treatment of High Blood Pressure
LDL : Low Density Lipoprotein
MCP-1 : Monocyte Chemoatractant Protein-1
M-CSF : Monocyte-Colony Stimulating
NINDS : National Institute of Neurological Disorders and
Stroke
OPN : Osteopontin

xix
PCR : Polymerase Chain Reaction
PDAY : Pathological Determinants of Atherosclerosis in
Youth
PDGF : Platelet-Derived Growth Factor
SNP : Single Nucleotide Polymorphism
SOP : Standard Operating Procedure
TCD : Transcranial Doppler
TNF- : Tumour Necrosis Factor
TNF- : Tumour Necrosis Factor
USG : Ultrasonografi
VCAM-1 : Vascular Cell Adhesion Molecule-1
VSMCs : Vascular Smooth Muscle Cells

xx
Bab1

Selingkup
Penyakit Stroke

1
1.1 Epidemiologi Stroke

S
troke merupakan penyebab kematian terbanyak
kedua di dunia dan merupakan penyebab kecacatan
utama pada usia produktif (Roger etal., 2011, Russo
etal., 2011). Di Inggris, stroke merupakan penyebab kematian
terbesar yang menyebabkan sekitar 53.000 kematian setiap tahun
(sekitar 9% dari seluruh kematian) (Scarborough etal., 2009). Pada
anak, kasus stroke terjadi sekitar satu di setiap 4.000 kelahiran.
Risiko stroke sejak kelahiran hingga usia 18 tahun mendekati
angka 11 kasus per 100.000 anak setiap tahun. Diperkirakan
terdapat sekitar 3.000 anak dan dewasa di bawah 20 tahun yang
mengidap stroke di Amerika pada tahun 2004 (Lloyd etal.,2009).
Di Indonesia, stroke merupakan penyebab kematian utama
(Kusuma etal., 2009). Terdapat kurang lebih 500.000 penduduk
Indonesia yang menderita stroke saat ini. Dari jumlah tersebut
sepertiganya bisa pulih kembali, sepertiga lainnya mengalami
gangguan fungsional ringan sampai sedang, dan sepertiga sisanya
mengalami gangguan fungsional berat yang berdampak terhadap
penurunan tingkat produktivitas serta dapat mengakibatkan
terganggunya sosial ekonomi keluarga (YASTROKI, 2009).
Di Indonesia, stroke merupakan penyakit dengan penyebab
kematian terbesar yaitu sekitar 15,4% kematian, disusul
hipertensi, diabetes, kanker, dan penyakit paru obstruktif kronis.
Data Riskesdas 2007, menunjukkan di perkotaan, kematian akibat
stroke pada kelompok usia 45-54 tahun sebesar 15,9%, sedangkan
di pedesaan sebesar 11,5%. Di negara kita, stroke menjadi penyebab
kematian utama di atas usia 5 tahun (Kusuma etal., 2009).
Meningkatnya usia harapan hidup di Indonesia menyebabkan
peningkatan risiko penyakit vaskular termasukstroke.

2 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Usia rata-rata penderita stroke di Indonesia adalah 58,8 tahun.
Insiden stroke meningkat sesuai dengan pertambahan usia dan
risiko terjadinya stroke meningkat dua kali setiap dekade setelah
usia 55 tahun (Kusuma etal., 2009). Data Perhimpunan Dokter
Spesialis Saraf Indonesia (PERDOSSI) menunjukkan adanya
kecenderungan peningkatan jumlah penderita stroke usia muda
yang produktif di Indonesia dalam dasawarsa terakhir (PERDOSSI,
2011). Demikian pula data yang dilaporkan oleh American Heart
Association dalam Heart Disease and Stroke Statistics2011 Update
yaitu penderita stroke usia muda antara 20 45 tahun meningkat
drastis pada tahun-tahun terakhir (Roger etal., 2011). Data rekam
medik di RSUD dr. Saiful Anwar Malang juga menunjukkan rata-
rata usia penderita yang makin muda. Pada tahun 2009 rentang
usia penderita stroke iskemia antara 20-60 tahun, dengan usia
rata-rata 58,8 tahun. Sementara itu, tahun 2010 rentang usia
penderita stroke iskemia antara 24-90 tahun dengan usia rata-rata
48 tahun. Hal ini menunjukkan bahwa baik di Indonesia maupun di
dunia, stroke telah banyak menyerang usia produktif bahkan anak-
anak (Depkes, 2012).
Menurut Riskesdas tahun 2007, prevalensi nasional stroke
adalah 0,8%. Sebanyak 11 provinsi mempunyai prevalensi stroke di
atas prevalensi nasional. Prevalensi stroke di Indonesia sebesar 8,3
persen per 1000 penduduk dan yang telah didiagnosis oleh tenaga
kesehatan yaitu 6 persen per 1000 penduduk. Hal ini menunjukkan
bahwa 72,3% kasus stroke di masyarakat telah didiagnosis oleh
tenaga kesehatan dan 19,1% di antaranya merupakan penduduk
populasi Jawa (Kementerian Kesehatan, 2008).
Stroke adalah gejala klinis yang terjadi secara mendadak
dan cepat akibat gangguan fungsi otak fokal atau global
dengan kelainan yang menetap hingga 24 jam atau lebih, atau
menyebabkan kematian tanpa adanya penyebab kelainan yang
jelas selain pembuluh darah (PERDOSSI, 2011). Stroke termasuk
penyakit serebrovaskular yang ditandai dengan kematian jaringan
otak (infark serebral) yang terjadi karena berkurangnya aliran
darah dan oksigen ke otak. WHO mendefinisikan stroke sebagai
gejala defisit fungsi susunan saraf yang diakibatkan oleh penyakit
pembuluh darah otak dan bukan oleh yang lain (WHO, 2011).

Bab 1 Selingkup Penyakit Stroke 3


1.2 Klasifikasi Stroke
Berdasarkan mekanisme terjadinya, stroke digolongkan
menjadi stroke penyumbatan (iskemia) dan perdarahan
(hemorrhagik). Stroke perdarahan dibagi lagi menjadi perdarahan
subarachnoid, intraserebral, dan hematoma subdural. Perdarahan
subarachnoid terjadi ketika darah masuk ke dalam subarachnoid
akibat adanya trauma, pecahnya pembuluh darah intrakranial
yang mengalami pembengkakan atau pecahnya arteriovenous
malformation (AVM). Sementara itu, pada stroke hemorrhagik
intraserebral perdarahan terjadi akibat pecahnya pembuluh
darah di daerah parenkima otak itu sendiri yang menyebabkan
pembentukan hematoma. Hal ini sering kali disebabkan kondisi
hipertensi yang tidak terkontrol. Adapun hematoma subdural
lebih disebabkan adanya pembekuan darah di daerah dura
yang disebabkan oleh trauma. Meskipun lebih jarang terjadi
dibandingkan stroke iskemia, namun stroke hemorrhagik ini lebih
mematikan (Badjatia, 2005).
Stroke juga bisa terjadi bila terdapat suatu peradangan atau
infeksi yang menyebabkan penyempitan pembuluh darah yang
menuju ke otak. Obat-obatan (misalnya kokain dan amfetamin)
juga bisa menyempitkan pembuluh darah di otak dan menyebabkan
stroke. Penurunan tekanan darah yang tiba-tiba bisa menyebabkan
berkurangnya aliran darah ke otak, yang biasanya menyebabkan
seseorang pingsan. Hal ini terjadi jika seseorang mengalami
kehilangan darah yang banyak karena cedera atau pembedahan,
serangan jantung atau irama jantung yang abnormal (Miscbach
and Kalim, 2011).

1.3 Tanda dan Gejala Stroke


Sebagian besar pasien stroke (95%) merasakan keluhan
pertama mulai sejak di luar rumah sakit. Dengan demikian, hal ini
penting bagi masyarakat luas (termasuk pasien dan orang terdekat
dengan pasien) dan petugas kesehatan profesional (dokter umum
dan resepsionisnya, perawat penerima telpon, atau petugas gawat

4 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Pengurangan
aliran darah

Bekuan
darah

Stroke Iskemia

Stroke Stroke
hemorrhagik hemorrhagik
intraserebral subarachnoid

Tengkorak

Darah di atas
permukaan
otak
Arteri Pecahnya
di otak pembuluh darah
yang bengkak
Arteri di
permukaan otak

Stroke Hemorrhagik

Sumber: ASA, 2011


Gambar 1.1Tipe stroke

darurat) untuk mengenal stroke dan perawatan kedaruratan.


Tenaga medis atau dokter yang terlibat di unit gawat darurat atau
pada fasilitas prahospital harus mengerti tentang gejala stroke
akut dan penanganan pertama yang cepat dan benar. Pendidikan

Bab 1 Selingkup Penyakit Stroke 5


berkesinambungan tentang pengenalan atau deteksi dini stroke
perlu dilakukan terhadap masyarakat (AHA/ASA Guideline, 2007).
Beberapa gejala atau tanda yang mengarah kepada diagnosis
stroke antara lain hemiparesis, ganguan sensorik satu sisi
tubuh, hemianopia atau buta mendadak, diplopia, vertigo, afasia,
disfagia, disatria, ataksia, kejang atau penurunan kesadaran yang
kesemuanya terjadi secara mendadak (AHA/ASA Guideline, 2007).
Berdasarkan lokasinya di tubuh, gejala-gejala stroke dapat
diklasifikasikan sebagai berikut.
1. Bagian sistem saraf pusat
Terjadi gelaja kelemahan otot (hemiplegia), kaku, menurunnya
fungsi sensorik.
2. Bagian batang otak, di mana terdapat 12 saraf kranial
Gejala yang timbul antara lain menurunnya kemampuan
membau, mengecap, mendengar, dan melihat parsial atau
keseluruhan, refleks menurun, ekspresi wajah terganggu,
pernapasan dan detak jantung terganggu, lidah lemah.
3. Bagian korteks serebral
Gejala yang timbul antara lain aphasia, apraxia, daya ingat
menurun, hemineglect, dan kebingungan.
Jika tanda-tanda dan gejala tersebut hilang dalam waktu 24
jam, dinyatakan sebagai Transient Ischemic Attack (TIA), yang
menunjukkan adanya serangan kecil atau serangan awal stroke
(Seri Gaya Hidup Sehat, 2007).

1.4 Faktor Risiko Stroke


Stroke merupakan suatu penyakit yang disebabkan oleh banyak
faktor risiko atau biasa disebut multikausal (Wahjoepramono,
2005). Menurut Janssen (2010) dan Baldwin (2010) faktor risiko
stroke dibagi menjadi dua kelompok yaitu nonmodifiable risk
factors (faktor risiko yang tidak dapat dimodifikasi) dan modifiable
risk factors (faktor risiko yang dapat dimodifikasi).

6 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Nonmodifiable risk factors merupakan kelompok faktor risiko
yang ditentukan secara genetika atau berhubungan dengan fungsi
tubuh yang normal sehingga tidak dapat dimodifikasi. Beberapa
faktor yang termasuk kelompok ini adalah usia, jenis kelamin,
ras, riwayat stroke dalam keluarga dan serangan Transient
Ischemic Attack atau stroke sebelumnya. Kelompok modifiable risk
factors merupakan akibat dari gaya hidup seseorang dan dapat
dimodifikasi. Faktor risiko utama yang termasuk dalam kelompok
ini adalah hipertensi, diabetes mellitus, merokok, hiperlipidemia
dan intoksikasi alkohol (PERDOSSI, 2004; Bounamaeux, etal.,
1999 dalam Rambe, 2006).
Faktor risiko stroke juga dapat dibagi menjadi tiga kelompok,
yaitu faktor risiko yang tidak dapat dimodifikasi, faktor perilaku
(primordial), dan faktor sosial dan ekonomi (Depkes, 2007).
Interaksi antara ketiga faktor tersebut dapat menimbulkan
penyakit-penyakit pendukung atau penyakit yang dapat
memperberat faktor risiko untuk terkena stroke.
Data epidemiologi menyebutkan risiko untuk timbulnya
serangan ulang stroke adalah 30% dan populasi yang pernah
menderita stroke memiliki kemungkinan serangan ulang 9 kali
dibandingkan populasi normal. Untuk mencegah serangan ulang
stroke maka kita perlu mengenal dan mengontrol faktor risiko dan
kalau perlu merubah faktor risiko tersebut (PERDOSSI, 2004).

1.4.1 Faktor risiko yang tidak dapat dimodifikasi


Faktor risiko yang tidak dapat dimodifikasi adalah faktor risiko
yang tidak dapat dilakukan intervensi, karena sudah merupakan
karakteristik dari seseorang dari awal mula kehidupannya. Berikut
ini merupakan faktor risiko stroke yang tidak dapat dimodifikasi.

1.4.1.1 Umur
Umur merupakan faktor risiko stroke. Semakin meningkat
umur seseorang maka risiko untuk terkena stroke juga semakin
meningkat. Menurut hasil penelitian pada Framingham Study
menunjukkan risiko stroke meningkat sebesar 20% pada kelompok

Bab 1 Selingkup Penyakit Stroke 7


umur 45-55 tahun, 32% pada kelompok umur 55-64 tahun, dan
83% pada kelompok umur 65-74 tahun (Wahjoepramono, 2005).
Pada penelitian epidemiologi di 23 rumah sakit di Jerman
dengan 5.017 pasien stroke iskemia yang dilakukan oleh Grau
dkk. (2001) dalam Sjahrir (2003) diketahui sebesar 42,4 % adalah
wanita dengan usia rata-rata 69,8 13,5 dan pria sebesar 56,7%
dengan usia rata-rata 65,1 12,0 . Stroke iskemia yang terjadi
pada usia muda (<45 tahun) biasanya merupakan kombinasi dari
penyebab lain yang belum pasti diketahui, sedangkan pada usia 45-
70 tahun lebih sering dijumpai makroangiopati. Kardioembolisme
sering terjadi pada usia > 70 tahun.
Walaupun stroke identik dengan usia lanjut, satu dari tiga
penderita stroke terjadi pada usia kurang dari 65 tahun (Becker,
2010). Berdasarkan penelitian yang telah dilakukan Janssen, etal.,
(2011) dari 97 pasien yang diteliti, dengan 49 orang penderita
stroke iskemia dan 48 orang lainnya menderita TIA, didapati
rentang usia 17-50 tahun. Ini membuktikan bahwa stroke tidak
hanya menyerang pada usia lanjut tapi juga pada usia di bawah
50tahun.

1.4.1.2 Jenis kelamin


Insidensi stroke iskemia lebih besar terjadi pada pria
dibandingkan wanita, baik dengan adanya riwayat keluarga dan
juga dari kelompok ras tertentu (Sacco, 2005). Akan tetapi, karena
usia harapan hidup wanita lebih tinggi daripada laki-laki maka
tidak jarang pada studi-studi tentang stroke didapatkan pasien
wanita lebih banyak. Menurut SKRT 1995, prevalensi penyakit
stroke pada laki-laki sebesar 0,2% dan pada perempuan sebesar
0,1%. Menurut Ness (1999), stroke iskemia lebih sering terjadi
pada pria daripada wanita dengan persentase 27% pada pria dan
20% pada wanita. Hal ini juga didukung oleh penelitian Grau dkk
(2001) dalam Sjahrir (2003). Persentase stroke iskemia pada pria
56,7% dan 42,4% pada wanita. Prevalensi stroke di 3 wilayah
Jakarta (Monica, 1998 dalam Depkes, 2007) didapatkan bahwa
prevalensi stroke pada laki-laki sebesar 7,1% dan perempuan
sebesar 2,8%.

8 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


1.4.1.3 Riwayat penyakit keluarga
Riwayat pada keluarga yang pernah mengalami serangan
stroke atau penyakit yang berhubungan dengan kejadian stroke
dapat menjadi faktor risiko untuk terserang stroke juga. Hal ini
disebabkan oleh banyak faktor, di antaranya faktor genetika,
pengaruh budaya, dan gaya hidup dalam keluarga, interaksi antara
genetika dan pengaruh lingkungan (Wahjoepramono, 2005).
Beberapa literatur menyatakan genetika merupakan salah
satu faktor risiko stroke iskemia yang tidak dapat dimodifikasi.
Dari penelitian Flomann, etal., systematic review, cohort, dan
case control (2003) kembar monozigot lebih memungkinkan
terjadinya stroke iskemia daripada kembar dizigot. Adanya riwayat
keluarga stroke juga merupakan faktor risiko yang penting untuk
stroke iskemia. Dari penelitian yang menggunakan hewan coba,
stroke iskemia lebih mudah terjadi dengan adanya pengaruh
faktor genetika (Flobmann, etal., 2003). Peranan kompleks
gen berhubungan dengan faktor-faktor risiko intrinsik seperti
hipertensi dan diabetes dengan aspek ekstrinsik seperti diet,
merokok, konsumsi alkohol, dan aktivitas fisik. Berdasarkan
penelitian Xu, etal.,(2010) pada populasi Chinese Han, ditemukan
minor alel C dari kromosom 1p32 Single Nucleotide Polymorphisms
(SNP) berhubungan dengan peningkatan risiko Low-Density
Lipoprotein Cholesterol (LDL-C) level yang tentu saja menjadi risiko
terjadinya stroke iskemia.
Menurut Ardelt (2009), kecenderungan genetika pada stroke
iskemia dapat diklasifikasikan sebagai gen tunggal dan gangguan
poligenik. Risiko poligenik lebih memungkinkan terjadi pada
mayoritas pasien stroke. Hal yang perlu diperhatikan pada gen
tunggal antara lain seperti yang akan dijelaskan berikut ini.
1. Gangguan gen tunggal
(a) Stroke iskemia sebagai manifestasi yang diketahui
Cerebral autosomal dominant arteriopathy with subcortical
infarcts and leukoencephalopathy (CADASIL)
Cerebral autosomal recessive arteriopathy with subcortical
infarcts and leukoencephalopathy (CARASIL)

Bab 1 Selingkup Penyakit Stroke 9


Fabry Disease
Moya-moya Disease
Sickle cell Disease
(b) Stroke iskemia yang jarang terjadi
Ehler-Danlos tipe 4
Mutasi gen kolagen tipe 3
Kecenderungan untuk diseksi arteri dan terbentuknya
aneurisma
Marfan sindrom
Mutasi gen fibrillin
Dihubungkan dengan diseksi aorta dan penyakit katup
jantung
Neurofibromatosis tipe 1
Dihubungkan dengan hipertensi dan sindrom moya-
moya
Familial hemiplegic migraine
Mutasi pada sub unit gen neuronal voltage-gated
calcium channel
Homosistinuria
Resesif autosomal, defisiensi cystathione beta-synthase
Dihubungkan dengan diseksi ataupun penyakit arteri
karotis
Manajemen dilakukan dengan pengaturan pola makan
dengan suplementasi piridoksin dan terapi antiplatelet
2. Gen-gen yang sekarang ini masih dalam penyelidikan
Gen Phosphodiesterase 4D (PDE 4D)
5-Lipoxygenase-activating protein (ALOX5AP)
Gen-gen baru yang mungkin berhubungan dengan stroke
iskemia

1.4.1.4 Ras
Orang kulit hitam, Hispanik Amerika, Cina, dan Jepang
memiliki insiden stroke yang lebih tinggi dibandingkan dengan
orang kulit putih (Wahjoepramono, 2005). Menurut Kissela B,
etal., dalam Ardelt (2009) dari buku Handbook of Cerebrovascular
Disease & Neurointerventional Technique, meningkatnya risiko

10 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


stroke iskemia pada pria dibandingkan wanita premenopause
pada ras Kaukasia dihubungkan dengan penurunan insidensi
stroke iskemia dengan menopause pada wanita dan dipengaruhi
oleh etnis. Sebagai contoh, pada wanita Amerika-Afrika mengalami
penurunan frekuensi yang lebih tinggi terjadinya iskemia
serebral daripada hubungan usia pada pria dan wanita Kaukasia.
Berdasarkan penelitian Zhang, etal., (2006) mengenai hubungan
antara peningkatan tekanan darah terhadap kejadian stroke
iskemia dan hemorragik antara orang Cina dan Kaukasia, diperoleh
hasil ORs dan RRs yang konsisten & signifikan lebih tinggi pada
orang Cina dibandingkan Kaukasia. Ini menunjukkan bahwa ras
Asia memiliki risiko stroke iskemia lebih besar daripada Eropa.
Di Indonesia sendiri, suku Batak dan Padang lebih rentan
terserang stroke dibandingkan dengan suku Jawa. Hal ini
disebabkan oleh pola dan jenis makanan yang lebih banyak
mengandung kolesterol (Depkes, 2007).

1.4.2 Faktor risiko yang dapat dimodifikasi


Faktor risiko yang dapat dimodifikasi adalah faktor risiko
yang dapat dilakukan intervensi untuk mencegah terjadinya suatu
penyakit. Faktor risiko ini bukan merupakan suatu karakteristik
mutlak dari seseorang, yang biasanya dipengaruhi oleh banyak hal,
terutama perilaku. Berikut ini merupakan faktor risiko yang dapat
dimodifikasi.

1.4.2.1 Tekanan Darah


Tekanan darah merupakan salah satu faktor yang harus
diperhatikan dalam kejadian stroke. Tekanan darah tinggi atau
lebih sering dikenal dengan istilah hipertensi merupakan faktor
risiko utama, baik pada stroke iskemia maupun stroke hemorragik.
Hal ini disebabkan hipertensi memicu proses aterosklerosis
yang dikarenakan tekanan yang tinggi. Akibatnya, hal tersebut
mendorong Low Density Lipoprotein (LDL) kolesterol untuk
lebih mudah masuk ke dalam lapisan intima lumen pembuluh
darah dan menurunkan elastisitas dari pembuluh darah tersebut

Bab 1 Selingkup Penyakit Stroke 11


(Lumongga,2007). Hipertensi terjadi akibat interaksi antara faktor
keturunan dan lingkungan.
Terjadinya hipertensi dapat disebabkan oleh beberapa
faktor risiko yaitu umur, jenis kelamin, keturunan, stres fisik
dan pekerjaan, jumlah asupan garam yang berlebihan, konsumsi
alkohol dan kopi berlebihan, obesitas, dan aktivitas fisik rendah
(Patel, 1995). Hipertensi dapat mempengaruhi hampir seluruh
organ tubuh, terutama otak, jantung, ginjal, mata, dan pembuluh
darah perifer. Kemungkinan terjadinya komplikasi tergantung
kepada seberapa besar tekanan darah itu, seberapa lama dibiarkan,
seberapa besar kenaikan dari kondisi sebelumnya, dan kehadiran
faktor risiko lain (Patel, 1995).
Berbagai studi telah membuktikan bahwa dengan
mengendali kan hipertensi akan menurunkan insiden stroke.
Hasil dari 61 penelitian jangka panjang menunjukkan, setiap
peninggian tekanan darah 20/10 mmHg (dimulai dari tekanan
darah 115/75 mmHg) akan meningkatkan mortalitas stroke
hingga dua kali. Sementara itu penurunan 2 mmHg tekanan
sistolik dapat menyebabkan penurunan mortalitas stroke sebesar
10% (Pudjonarko, 2011).
Dari survei Kesehatan Rumah Tangga tahun 2004, prevalensi
hipertensi di Indonesia sekitar 14% dan meningkat sesuai dengan
pertambahan umur. Prevalensi hipertensi pada perempuan lebih
tinggi dibandingkan prevalensi pada laki-laki (Depkes, 2007).
Pemeriksaan tekanan darah merupakan cara mudah untuk
mendeteksi ada tidaknya hipertensi pada seseorang. Oleh karena
itu, berdasarkan The 7th Report of the Joint National Committee
on Prevention, Detection, Evaluation, and Treatment of High
Blood Pressure (JNC 7), hipertensi diklasifikasikan berdasarkan
besarnya tekanan darah seperti pada Tabel 1.1.
Dari Tabel 1.1 dapat dilihat bahwa tekanan darah dibagi dalam
empat klasifikasi berdasarkan tekanan darah sistolik dan diastolik.
Tekanan sistolik berkaitan dengan tingginya tekanan pada arteri
bila jantung berkontraksi (denyut jantung), yang merupakan
tekanan maksimum pada arteri dan tercermin dari hasil

12 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


pembacaan tekanan darah yang nilainya lebih besar. Sementara
itu, tekanan diastolik berkaitan dengan tekanan dalam arteri bila
jantung berada dalam keadaan relaksasi di antara dua denyutan,
yang merupakan tekanan minimum pada arteri dan tercermin dari
hasil pembacaan tekanan darah yang nilainya lebih kecil (Hull,
1993). Mengacu pada tabel tersebut, maka dapat dilakukan tindak
lanjut atas hasil tekanan darah yang diperiksa.

Tabel 1.1Klasifikasi hipertensi berdasarkan tekanan darah


Sistolik Diastolik
Klasifikasi Tindak Lanjut
(mmHg) (mmHg)
Normal < 120 dan < 80 Cek ulang minimal dalam
2 tahun
Pre-Hipertensi 120 139 atau 80 89 Cek ulang dalam 1 tahun,
dengan anjuran perbaiki
gaya hidup
Hipertensi 140 159 atau 90 99 Konfirmasi ulang dalam
Stage1 2 bulan, dengan anjuran
perbaiki gaya hidup
Hipertensi >160 atau > 100 Evaluasi atau rujuk ke
Stage2 spesialis dalam 1 bulan.
Jika tekanan darah lebih
tinggi maka evaluasi dan
segera terapi
Sumber: Wahjoepramono, 2005

1.4.2.2 Kadar gula darah


Kadar gula darah yang normal adalah di bawah 200 mg/dl. Jika
kadar gula darah seseorang melebihi dari itu disebut hiperglikemia.
Dengan demikian, orang tersebut dicurigai memiliki penyakit
diabetes melitus. Kadar gula darah dapat dengan cepat berubah-
ubah, tergantung pada makanan yang kita makan dan seberapa
banyak makanan itu mengandung pemanis sintetis. Kadar gula
darah yang tadinya normal cenderung meningkat setelah usia 50
tahun secara perlahan tetapi pasti, terutama pada orang-orang
yang tidak aktif (Depkes, 2008).
Keadaan hiperglikemia atau kadar gula dalam darah yang
tinggi dan berlangsung kronis memberikan dampak yang tidak

Bab 1 Selingkup Penyakit Stroke 13


baik pada jaringan tubuh. Salah satunya adalah dapat mem
percepat terjadinya aterosklerosis, baik pada pembuluh darah
kecil maupun besar termasuk pembuluh darah yang mensuplai
darah ke otak (Hull, 1993). Keadaan pembuluh darah otak
yang sudah mengalami aterosklerosis sangat berisiko untuk
mengalami sumbatan maupun pecahnya pembuluh darah yang
mengakibatkan timbulnya serangan stroke. Dengan kata lain,
kadar gula darah yang tinggi dapat menjadi faktor risiko untuk
terjadinya stroke. Kadar gula darah yang tinggi juga dapat
memperburuk keadaan defisit neurologis yang dialami oleh
penderita stroke sehingga dapat meningkatkan mortalitas
serangan stroke tersebut. Dalam hal ini dapat dilihat bahwa
pemeriksaan kadar gula darah sewaktu pasien terkena stroke
sangat diperlukan.

1.4.2.3 Kadar kolesterol darah


Kolesterol merupakan senyawa lemak kompleks yang
dihasilkan oleh hati untuk berbagai fungsi, seperti membuat
hormon seks, adrenalin, membentuk dinding sel, dan lainnya
(Soeharto, 2004). Hal ini mencerminkan betapa pentingnya
kolesterol bagi tubuh. Akan tetapi, apabila asupan kolesterol
dalam makanan yang masuk ke tubuh terlalu tinggi jumlahnya
maka kadar kolesterol dalam darah akan meningkat. Kelebihan
kadar kolesterol dalam darah akan beraksi dengan zat lain
sehingga dapat mengendap pada pembuluh darah arteri yang
menyebabkan penyempitan dan pengerasan yang disebut sebagai
plak aterosklerosis (Soeharto, 2004).
Pemeriksaan kadar kolesterol darah sangat penting untuk
dilakukan karena tingginya kadar kolesterol dalam darah
merupakan faktor risiko untuk terjadinya stroke. Hal ini
disebabkan oleh kolesterol darah yang ikut berperan dalam
penumpukan lemak di dalam lumen pembuluh darah yang dapat
mengakibatkan terjadinya aterosklerosis (Hull, 1993). Oleh karena
itu, jika kadar kolesterol dalam darah meningkat maka risiko untuk
aterosklerosis meningkat juga.

14 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Kolesterol tidak larut dalam cairan darah sehingga untuk
proses transportasinya ke seluruh tubuh perlu dikemas
bersama protein menjadi partikel yang disebut lipoprotein
(Soeharto, 2004). Lipoprotein ini banyak jenisnya. Akan tetapi,
dalam hubungannya dengan penyakit stroke, biasanya dalam
pemeriksaan laboratorium terdapat pemeriksaan mengenai
kadar profil lemak yang terdiri dari kolesterol total, Low Density
Lipoprotein (LDL), High Density Lipoprotein (HDL), dan trigliserida
(Soeharto, 2004).
LDL dikenal sebagai kolesterol jahat, karena kadar kolesterol
LDL yang tinggi dapat menyebabkan pengendapan kolesterol
dalam arteri yang merupakan pencetus terjadinya penyumbatan
pada pembuluh darah atau aterosklerosis. Sementara itu, HDL
sering disebut sebagai kolesterol baik karena membawa
kelebihan kolesterol dalam arteri untuk dibawa kembali ke hati
kemudian dibuang dari dalam tubuh (Makmun, 2003). Jadi, HDL
merupakan pelindung terhadap kejadian penyakit stroke. Kadar
kesetaraan antara kolesterol total dan kolesterol LDL tertera di
tabel berikut ini.

Tabel 1.2Kadar kesetaraan antara kolesterol total dan kolesterol LDL


Kolesterol total (mg/dl) Kolesterol LDL (mg/dl)
240 160
200 130
155 100
Sumber: (Junaidi,2004)

Menurut The National Cholesterol Education Program (NCEP),


dalam New Clinical Practice Guidelines on The Prevention and
Management of High Cholesterol in Adults diketahui bahwa kadar
kolesterol LDL yang optimal adalah kurang dari 100 mg/dl dan
kadar kolesterol HDL terendah < 40 mg/dl serta kadar trigliserida
direkomendasikan pada kadar yang moderat (< 200 mg/dl).
Berikut ini merupakan klasifikasi Adult Treatment Panel (ATP III)
terhadap kolesterol total, LDL, dan HDL.

Bab 1 Selingkup Penyakit Stroke 15


Tabel 1.3Klasifikasi Adult Treatment Panel (ATP III) terhadap kolesterol
LDL, total, dan HDL
Kolesterol LDL (mg/dl)
< 100 Optimal
100 129 Mendekati optimal
130 159 Batas tinggi
160 189 Tinggi
> 190 Sangat tinggi
Kolesterol Total (mg/dl)
< 200 Target yang hendak dicapai
200 239 Batas tinggi
> 240 Tinggi
Kolesterol HDL (mg/dl)
< 40 Rendah
> 60 Tinggi
Sumber: Junaidi, 2004

Kadar kolesterol yang tinggi dalam darah dapat menjadi


masalah sebagai pemicu terjadinya stroke. Hal ini terjadi karena
kolesterol merupakan zat yang terdapat di dalam aliran darah.
Semakin tinggi kolesterol, semakin besar kemungkinan kolesterol
tersebut tertimbun pada dinding pembuluh darah. Hal ini
menyebabkan pembuluh darah menjadi lebih sempit sehingga
mengganggu suplai darah ke otak yang disebut dengan stroke
iskemia. Berikut ini merupakan hubungan antara kadar kolesterol
dengan risiko aterosklerosis.

Tabel 1.4Hubungan kadar kolesterol dan risiko aterosklerosis


Kadar Kolesterol
Umur (tahun)
Risiko sedang Risiko tinggi (mg/dl)
< 19 170 185 > 185 200
20 29 200 220 > 220
30 39 220 240 > 240
40 240 260 > 260
Sumber: Junaidi, 2004

Terkadang nilai kadar kolesterol total, LDL, dan HDL yang


dilihat secara tunggal tidak dapat mencerminkan risiko orang
tersebut untuk terkena penyakit stroke dan PJK. Rasio kolesterol
16 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...
total terhadap HDL merupakan kriteria ambang batas nilai rasio
untuk laki-laki dan perempuan yang berumur 20-60 tahun ke atas.
Tabel 1.5 di bawah ini merupakan penggolongan tingkat risiko
berdasarkan rasio kolesterol total terhadap HDL untuk laki-laki dan
perempuan yang berumur 20-60 tahun ke atas.

Tabel 1.5Rasio kolesterol total terhadap HDL dan tingkat risiko


Risiko Sedang Risiko Sangat
Risiko Rendah Risiko Tinggi
Lemak Umur (Moderat) Tinggi
L P L P L P L P
Kolesterol 40-59 2,3-3,6 1,9-2,8 3,7-5,1 2,9-3,6 5,2-6,1 3,7-4,2 > 6,1 > 4,2
Total HDL 20-39 2,6-4,2 2,0-3,0 4,3-6,0 3,1-4,0 6,1-7,4 4,1-4,9 > 7,4 > 4,9
60+ 2,0-3,2 2,0-3,2 4,1-6,0 3,3-4,8 6,1-6,9 4,9-5,5 > 6,9 > 5,5

Keterangan : L = Laki-laki; P = Perempuan Sumber: Cooper dalam Soeharto, 2004

1.4.2.4 Penyakit jantung


Penyakit atau kelainan pada jantung dapat mengakibatkan
iskemia otak. Hal ini disebabkan oleh denyut jantung yang tidak
teratur dan tidak efisien sehingga menurunkan total curah
jantung yang mengakibatkan aliran darah di otak berkurang
(iskemia). Selain itu, juga dengan adanya penyakit atau kelainan
pada jantung dapat terjadi pelepasan embolus (kepingan darah)
yang kemudian dapat menyumbat pembuluh darah otak. Hal ini
yang disebut dengan stroke iskemia akibat trombosis. Seseorang
dengan penyakit atau kelainan pada jantung mendapatkan risiko
untuk terkena stroke lebih tinggi 3 kali lipat dari orang yang tidak
memiliki penyakit atau kelainan jantung (Hull, 1993).

1.4.2.5 Diabetes melitus


Selain dikenal sebagai penyakit, diabetes melitus juga
merupakan faktor risiko untuk terjadinya stroke. Diabetes
melitus digolongkan menjadi dua tipe, yaitu diabetes tipe 1
(akibat defisiensi insulin absolut karena destruksi sel beta yang
disebabkan oleh autoimun ataupun idiopatik) dan diabetes tipe2
(defisiensi insulin relatif yang disebabkan oleh defek sekresi
insulin lebih dominan daripada resistensi insulin ataupun dapat
sebaliknya) (Depkes, 2008).

Bab 1 Selingkup Penyakit Stroke 17


Sementara itu, kejadian diabetes melitus tipe 2 lebih
dipengaruhi oleh perilaku makan seseorang. SKRT 2003,
melakukan pemeriksaan konsentrasi glukosa puasa memakai
strip (dry chemistry) dan menyatakan bahwa seseorang dikatakan
menderita diabetes melitus apabila memiliki kadar gula darah
puasa > 110 mg/dl. Berikut ini merupakan daftar kadar glukosa
darah sesaat dan gula darah puasa sebagai penyaring dan
diagnosisDM.

Tabel 1.6Diagnosis DM menurut kadar glukosa darah sesaat dan puasa


dengan metode enzimatik sebagai patokan penyaring dan diagnosis DM
Belum pasti
Jenis kadar glukosa darah Bukan DM DM
DM
Kadar glukosa darah Plasma Vena < 100 100 199 > 200
sewaktu (mg/dl) Darah Kapiler < 90 90 199 > 200
Kadar glukosa darah Plasma Vena < 100 100 125 > 126
puasa (mg/dl) Darah Kapiler < 90 90 99 > 100
Sumber: Depkes, 2008

Untuk kelompok risiko tinggi yang tidak menunjukkan


kelainan hasil, dilakukan pemeriksaan ulang pada setiap tahunnya.
Bagi mereka yang berusia > 45 tahun dan tanpa faktor risiko lain
maka diagnosis dapat dilakukan setiap 3 tahun.
Berdasarkan Survei Kesehatan Rumah Tangga tahun 2004
didapatkan prevalensi hiperglikemia sebesar 11,2% dan lebih
tinggi pada laki-laki (13%) daripada perempuan (10%), di daerah
perkotaan (12%) daripada pedesaan (10%), dan wilayah Indonesia
Timur (15 %) daripada wilayah Sumatera, Jawa, dan Bali (10%)
(Depkes, 2007).
Kondisi seseorang yang menderita DM dapat meningkatkan
risiko untuk terkena stoke. Hal ini disebabkan karena DM dapat
meningkatkan prevalensi aterosklerosis dan juga meningkatkan
prevalensi faktor risiko lain seperti hipertensi, obesitas, dan
hiperlipidemia. Pengontrolan tekanan darah pada penderita DM
juga perlu dilakukan di samping pemeriksaan ketat kadar gula
darah. Tekanan darah yang dianjurkan pada penderita diabetes
melitus adalah < 130/ 80 mmHg.

18 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


1.4.2.6 Obesitas
Obesitas adalah kondisi di mana Body Mass Index (BMI)
>30kg/m. Obesitas juga didefinisikan sebagai kelebihan berat
badan sebesar 20% dari berat badan idealnya (Hull, 1993).
Obesitas merupakan faktor predisposisi penyakit kardiovaskular
dan stroke (Wahjoepramono, 2005). Hal ini disebabkan oleh
keadaan obesitas berhubungan dengan tingginya tekanan darah
dan kadar gula darah (Pearson, 1994). Jika seseorang memiliki
berat badan yang berlebih maka jantung bekerja lebih keras
untuk memompa darah ke seluruh tubuh sehingga hal itu dapat
meningkatkan tekanan darah (Patel, 1995). Obesitas juga dapat
mempercepat terjadinya proses aterosklerosis pada remaja dan
dewasa muda (Madiyono, 2003). Oleh karena itu, penurunan berat
badan dapat mengurangi risiko terserang stroke (Pearson, 1994).
Obesitas meningkat seiring dengan peningkatan usia.
Penurunan berat badan menjadi berat badan yang normal
merupakan cerminan dari aktivitas fisik dan pola makan yang baik.
Oleh karena itu, berat badan memiliki korelasi yang baik dalam
pengukuran aktivitas fisik dan pola makan seseorang.

1.4.3 Faktor risiko perilaku (primordial)


1.4.3.1 Merokok
Rokok merupakan salah satu faktor yang signifikan untuk
meningkatkan risiko terjadinya stroke. Orang yang memiliki
kebiasaan merokok cenderung lebih berisiko untuk terkena
penyakit jantung dan stroke dibandingkan orang yang tidak
merokok (Stroke Association, 2010). Hal ini disebabkan oleh
zat-zat kimia beracun dalam rokok, seperti nikotin dan karbon
monoksida yang dapat merusak lapisan endotel pembuluh
darah arteri, meningkatkan tekanan darah, dan menyebabkan
kerusakan pada sistem kardiovaskular melalui berbagai macam
mekanisme tubuh. Rokok juga berhubungan dengan meningkatnya
kadar fibrinogen, agregasi trombosit, menurunnya HDL dan
meningkatnya hematokrit yang dapat mempercepat proses
aterosklerosis yang menjadi faktor risiko untuk terkena stroke.

Bab 1 Selingkup Penyakit Stroke 19


Nikotin dalam rokok menyebabkan vasokonstriksi pembuluh
darah yang dapat mengakibatkan naiknya tekanan darah.
Arteri juga mengalami penyempitan dan dinding pembuluh
darah menjadi mudah robek yang mengakibatkan produksi
trombosit meningkat sehingga darah mudah membeku. Selain
itu, merokok dapat mengakibatkan hal buruk bagi lemak darah
dan menurunkan kadar HDL dalam darah. Semua efek nikotin
dari rokok dapat mempercepat proses aterosklerosis dan
penyumbatan pembuluhdarah. Karbon monoksida dari rokok
juga dapat mengurangi jumlah oksigen yang dibawa oleh darah
sehingga menyebabkan ketidakseimbangan antara oksigen yang
dibutuhkan dengan oksigen yang dibawa oleh darah (Stroke
Association,2010).
Hasil penelitian pada Framingham Study, insiden stroke
40% lebih tinggi pada perokok laki-laki dan 60% lebih tinggi
pada perokok perempuan dibandingkan dengan yang bukan
perokok (Pearson, 1994). Sebesar 35% penduduk Indonesia yang
berumur 15 tahun ke atas adalah perokok, baik tiap hari maupun
kadang-kadang. Dari hasil Susenas tahun 2001 dengan tahun
2003, terdapat peningkatan jumlah penduduk yang merokok
sebesar 3%. Berdasarkan jenis kelamin, persentase merokok
pada laki-laki lebih tinggi dibandingkan pada perempuan.
Sementara itu, berdasarkan tempat, persentase merokok pada
daerah pedesaan (37%) lebih tinggi dibandingkan daerah
perkotaan (32%). Sebesar 64% dari total penduduk yang
merokok diketahui bahwa usia pertama kali merokok adalah
pada umur 15-19 tahun (Depkes,2007). Berdasarkan tingkat
pendidikan, persentase perokok semakin tinggi pada kelompok
orang yang berpendidikan rendah. Dengan kata lain, semakin
tinggi tingkat pendidikan maka semakin rendah persentase orang
yang merokok (Luepker, 2004).

1.4.3.2 Kebiasaan mengkonsumsi alkohol


Peran alkohol dalam sumbangannya sebagai faktor risiko
stroke memang masih kontroversial dan diduga tergantung
pada dosis yang dikonsumsi. Alkohol dapat meningkatkan

20 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


risiko terserang stroke jika diminum dalam jumlah banyak,
sedangkan dalam jumlah sedikit dapat mengurangi risiko stroke
(Pearson,1994).
Akan tetapi, kebiasaan mengkonsumsi alkohol dalam jumlah
banyak dapat menjadi salah satu pemicu untuk terjadinya
hipertensi yang memberikan sumbangan faktor risiko untuk
terjadinya penyakit stroke. Dalam sebuah pengamatan,
diperoleh data bahwa mengonsumsi 3 gelas alkohol per hari
akan meningkatkan risiko stroke hemoragik, yaitu perdarahan
intraserebral hingga 7 kali lipat (Wahjoepramono, 2005).

1.4.3.3 Aktivitas fisik


Aktivitas fisik atau olahraga merupakan bentuk pemberian
rangsangan berulang pada tubuh. Tubuh akan beradaptasi jika
diberi rangsangan secara teratur dengan takaran dan waktu yang
tepat. Aktivitas fisik sangat berhubungan dengan faktor risiko
stroke, yaitu hipertensi dan aterosklerosis. Seseorang yang sering
melakukan aktivitas fisik, minimal 3-5 kali dalam seminggu dengan
lama waktu minimal 30-60 menit dapat menurunkan risiko untuk
terkena penyakit yang berhubungan dengan pembuluh darah,
seperti stroke (Depkes, 2007).
Hal tersebut disebabkan oleh aktivitas fisik yang dapat
membuat lumen pembuluh darah menjadi lebih lebar. Oleh karena
itu, darah dapat melalui pembuluh darah dengan lebih lancar tanpa
jantung harus memompa darah lebih kuat. Proses aterosklerosis
pun lebih sulit terjadi pada mereka yang memiliki lumen pembuluh
darah yang lebih lebar. Selain itu, Centers for Disease Control and
Prevention dan National Institutes of Health merekomendasikan
latihan fisik secara rutin (> 30 menit/ hari latihan fisik moderat)
dapat mengurangi komorbid yang menjadi faktor risiko stroke
(Wahjoepramono, 2005).

1.4.3.4 Stres
Stres mungkin bukan sebagai faktor risiko langsung pada
serangan stroke. Akan tetapi, stres dapat mengakibatkan hati

Bab 1 Selingkup Penyakit Stroke 21


memproduksi lebih banyak radikal bebas, menurunkan imunitas
tubuh, dan mengganggu fungsi hormonal (Junaidi, 2004). Stres
dibagi menjadi tiga bentuk, yaitu stres biologis (berupa infeksi
oleh bakteri dan virus pada sel-sel tubuh), stres psikis (mental atau
emosional), dan stres fisik (aktivitas fisik yang berlebihan). Dari
ketiga bentuk stres tadi, stres psikis merupakan stres yang paling
banyak dialami oleh manusia baik disadari maupun tidak. Apabila
stres psikis ini tidak dikelola dengan baik maka akan menimbulkan
kesan bahaya pada tubuh yang mengakibatkan tubuh merespons
secara berlebihan dengan menghasilkan hormon-hormon yang
membuat tubuh waspada, seperti kortisol, katekolamin, epinefrin,
dan adrenalin. Semua hormon yang dihasilkan oleh tubuh tadi
semakin banyak ketika tubuh terus merespons stres tersebut
sebagai bahaya sehingga dapat berdampak buruk pada tubuh
(Junaidi, 2004).
Dalam hubungannya dengan kejadian stroke, keadaan
stres dapat memproduksi hormon kortisol dan adrenalin yang
berkontribusi pada proses aterosklerosis. Hal ini disebabkan
kedua hormon tadi meningkatkan jumlah trombosit dan produksi
kolesterol. Kortisol dan adrenalin juga dapat merusak sel yang
melapisi arteri sehingga lebih mudah bagi jaringan lemak untuk
tertimbun di dalam dinding arteri (Patel, 1995).

1.4.4 Faktor sosial dan ekonomi


Faktor sosial ekonomi merupakan salah satu faktor yang
secara tidak langsung memiliki peran dalam pencetus kejadian
suatu penyakit. Hal ini mungkin berhubungan dengan perilaku
kesehatan seseorang, yang dapat menyebabkan orang tersebut
berstatus sehat atau sakit. Orang dengan status sosial dan ekonomi
yang rendah, lebih berisiko untuk terkena stroke dan penyakit
serebrovaskular lainnya dibandingkan dengan mereka yang
memiliki status sosial dan ekonomi yang lebih tinggi (Engstrom,
2005). Berikut ini merupakan faktor sosial ekonomi seseorang
yang biasa digunakan dalam menilai perilaku kesehatan dan
hubungannya dengan kejadian suatu penyakit.

22 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


1.4.4.1 Pendidikan
Pendidikan secara umum adalah segala upaya yang
direncanakan untuk mempengaruhi orang lain, baik individu,
kelompok, atau masyarakat sehingga mereka melakukan apa
yang diharapkan oleh pelaku pendidik (Notoatmodjo, 2007).
Pendidikan memiliki unsur-unsur yang berperan di dalamnya,
yaitu input (sasaran pendidikan dan pendidik), proses atau upaya
dari pendidikan tersebut, output (pengetahuan yang diharapkan
dapat mengubah perilaku). Dari ketiga unsur tersebut maka dapat
disimpulkan bahwa pendidikan merupakan suatu upaya dalam
mempengaruhi orang lain untuk merubah perilakunya, yang
dalam bahasan kali ini adalah perilaku kesehatan untuk mencegah
terjadinya suatu penyakit.
Stroke merupakan salah satu penyakit multikausal yang
berkaitan erat dengan perilaku atau gaya hidup. Pendidikan
merupakan salah satu upaya menambah informasi dan
pengetahuan seseoarang yang diharapkan ke depannya akan
mengubah perilaku kesehatan menjadi lebih baik. Oleh karena itu,
pendidikan merupakan salah satu faktor sosial dan ekonomi yang
secara tidak langsung ikut berperan dalam terjadinya stroke.

1.4.4.2 Pekerjaan
Pekerjaan merupakan salah satu indikator yang menunjukkan
status sosial ekonomi. Pekerjaan merupakan salah satu faktor
risiko untuk terjadinya stroke. Hal ini mungkin disebabkan oleh
hubungan antara pekerjaan dengan tingkat stres seseorang, di
mana keadaan stres tersebut dapat meningkatkan risiko terkena
serangan stroke.
Pekerja kasar atau pekerja level bawah memiliki risiko 50%
lebih tinggi untuk mendapatkan serangan stroke (Engstrom,
2005). Beban kerja yang besar, gaji yang tidak sesuai harapan, dan
tekanan dari atasan dapat menjadi pemicu stres di tempat kerja,
yang pada akhirnya menyebabkan stres dan menjadi faktor risiko
untuk terjadinya stroke. Kehilangan prestasi kerja, rendahnya
dukungan atasan, kerja shift malam, alokasi penempatan kerja,

Bab 1 Selingkup Penyakit Stroke 23


ataupun masalah gaji yang tidak sesuai dengan apa yang dilakukan
juga dapat meningkatkan risiko penyakit stroke terkait stres akibat
kerja (Patel, 1995).

1.4.4.3 Status pernikahan


Status pernikahan juga dapat digunakan untuk menilai status
sosial individu. Laki-laki dan perempuan yang tidak menikah
ataupun mengalami perceraian memiliki risiko lebih besar untuk
terkena serangan stroke dibandingkan laki-laki dan wanita yang
memiliki istri atau suami (Engstrom, 2005).
Kejadian stroke pada laki-laki di atas umur 65 tahun yang
menikah sebesar 13%, sedangkan pada umur yang sama kejadian
stroke pada laki-laki yang tidak menikah sebesar 16,8%. Kejadian
stroke pada wanita di atas umur 65 tahun yang menikah sebesar
8,2%, sedangkan pada umur yang sama kejadian stroke pada
wanita yang tidak menikah sebesar 10,9%. Hal ini mungkin
disebabkan oleh seseorang yang tidak mempunyai pasangan
memiliki kebiasaan atau gaya hidup yang lebih buruk, seperti
merokok, konsumsi alkohol, perilaku makan yang buruk, dan
tingkat stres yang lebih tinggi dibandingkan dengan mereka yang
telah menikah atau memiliki pasangan hidup.

1.5 Kerugian Paska Stroke


Setelah stroke, sel otak mati dan hematom yang terbentuk
akan diserap kembali secara bertahap. Proses alami ini selesai
dalam waktu 3 bulan. Pada saat itu, 1/3 orang yang selamat
menjadi tergantung dan mungkin mengalami komplikasi yang
dapat menyebabkan kematian atau cacat. Diperkirakan ada
500.000 penduduk yang terkena stroke. Dari jumlah tersebut
hanya 10-15 % penderita stroke bisa kembali hidup normal seperti
sedia kala, sisanya mengalami cacat, sehingga banyak penderita
stroke menderita stres akibat kecacatan yang ditimbulkan setelah
diserang stroke.
Tidak hanya itu stroke akan mengakibatkan beberapa efek
antara lain:

24 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


80% penurunan parsial/total gerakan lengan dan tungkai,
80-90% bermasalah dalam berpikir dan mengingat,
70% menderita depresi, dan
30% mengalami kesulitan bicara, menelan, membedakan
kanan dan kiri.
Stroke menyerang siapa saja. Tidak hanya menyerang
kelompok lansia, namun kini stroke cenderung menyerang
generasi muda yang masih produktif. Hal ini akan berdampak
terhadap menurunnya tingkat produktivitas. Jika yang terkena
stroke tersebut adalah seorang tulung punggung keluarga maka hal
itu dapat mengakibatkan terganggunya sosial ekonomi keluarga.
Hal tersebut diperparah dengan besarnya biaya pengobatan
paskastroke (Seri Gaya Hidup Sehat, 2007).
Bagaimana pengaruh stroke dari segi sosial? Orang yang
menderita stroke kebanyakan mengalami depresi mental pada
waktu pertama kali terkena. Mereka juga merasa rendah diri dan
menutup diri dari lingkungan masyarakat dan hal itu justru akan
menambah beban kejiwaan bagi penyandang stroke itu sendiri.
Kerugian sosial lain yang terjadi karena kasus stroke, menurut
Ascobat Gani adalah hilangnya masa hidup penduduk. Berdasarkan
perhitungan Bank Dunia dan WHO tahun 1994, ada 1.094.000
tahun hidup yang hilang karena stroke yang dialami penduduk
Indonesia. Kalau tahun tidak produktif juga diperhitungkan,
jumlahnya mencapai 1.364.000 tahun. Kerugian waktu produktif
akibat stroke ini lebih banyak di kalangan pria dibandingkan
dengan perempuan (Yayasan Stroke Indonesia (YASTROKI), 2014).
Sementara itu, dampak bagi ekonomi negara, negara akan
mengeluarkan banyak biaya untuk membantu pengobatan
bagi orang-orang stroke yang kurang mampu dalam jangka
waktu yang lama. Pemerintah pun perlu menyediakan fasilitas
kesehatan di rumah sakit untuk melayani para penderita stroke,
seperti pengadaan unit stroke. (Yayasan Stroke Indonesia
(YASTROKI),2014).

Bab 1 Selingkup Penyakit Stroke 25


1.6 Outcome Stroke
Kehilangan fungsi tubuh yang terjadi setelah stroke sering
digambarkan sebagai impairments, disabilitas dan handicaps. WHO
membuat batasan sebagai berikut (Caplan, 2009).
1. Impairments: menggambarkan hilangnya fungsi fisiologis,
psikologis dan anatomis yang disebabkan stroke. Tindakan
psikoterapi, fisioterapi, terapi okupasional ditujukan untuk
menetapkan kelainan ini.
2. Disabilitas: merupakan setiap hambatan, kehilangan
kemampuan untuk berbuat sesuatu yang seharusnya mampu
dilakukan orang yang sehat
3. Handicaps: merupakan halangan atau gangguan pada seorang
penderita stroke untuk berperan sebagai manusia normal
akibat impairments dan disabilitas.
Pada berbagai penelitian klinis, skala Barthel Index dan
Modified Rankin Scale umumnya digunakan untuk menilai outcome
karena mudah digunakan. (Sulter dkk, 1999). Dalam uji klinik
Barthel Index (BI) dan Modified Rankin Scale merupakan skala
yang sering digunakan untuk menilai outcome dan merupakan
pengukuran yang dapat dipercaya. Pengukuran tersebut
memberikan penilaian yang lebih objektif terhadap pemulihan
fungsional setelah stroke (Sulter dkk, 1999).
Barthel Index telah dikembangkan sejak tahun 1965
kemudian dimodifikasi oleh Grager dkk. sebagai suatu teknik yang
menilai pengukuran performasi pasien dalam 10 aktifitas hidup
sehari-hari yang dikelompokkan ke dalam 2 kategori yaitu (Sulter
dkk,1999):
kategori yang berhubungan dengan self care antara lain makan,
membersihkan diri, mandi, berpakaian, perawatan buang air
besar dan buang air kecil, dan penggunaan toilet.
kategori yang berhubungan dengan morbiditas antara lain
berjalan, berpindah tempat, dan menaiki tangga.
Skor maksimum BI adalah 100, yang menunjukkan bahwa
fungsi fisik pasien benar-benar tanpa bantuan, dan nilai terendah

26 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


adalah 0 yang menunjukkan ketergantungan total (Masur
dkk., 2003 dalam Meutia E., 2010). Skala mRS lebih mengukur
performasi aktivitas spesifik, dalam hal ini mental. Demikian juga
adaptasi fisik digabungkan dengan defisit neurologi. Skala ini
terdiri dari 6 derajat, yaitu 0 yang berarti tidak ada gejala, 5 yang
berarti cacat/ketidakmampuan yang berat dan 6 yang berarti
kematian. Skala ini lebih sensitif untuk penilaian pada penderita
dengan disabilitas ringan dan sedang (Masur dkk., 2003 dalam
Meutia E., 2010); Weimardkk.2002).
National Institute of Health Stroke Scale (NIHSS) merupakan
pengukuran kuantitatif defisit neurologis berkaitan dengan stroke
yang dapat memprediksi outcome stroke jangka panjang. Outcome
Stroke jangka panjang terdiri dari 12 jenis pertanyaan (tingkat
kesadaran, respon terhadap pertanyaan, respon terhadap perintah,
gaze palsy, pemeriksaan lapangan pandang, facial palsy, motorik,
ataksia, sensori, bahasa, disartria, dan ekstensi/inattentian). Ada
3 rentang skor NIHSS yang secara signifikan berhubungan dengan
perawatan pasien stroke yaitu:
skor 5 pasien berarti pasien dapat keluar dari rumah sakit,
skor 6-13 pasien memerlukan rehabilitasi, dan
skor > 13 berarti pasien memerlukan fasilitas perawatan yang
lama (Meyer dkk, 2002; Schelegel dkk, 2003).

1.7 Prognosis stroke


Sangat penting membedakan antara prognosis dan
kesembuhan alami (natural history) karena keduanya sangat
berbeda. Kesembuhan alami merujuk pada perkembangan
penyakit dari awitan dan tidak diobati, sedangkan prognosis
merujuk pada kemungkinan hasil yang didapatkan dari peng
obatan yang diberikan setelah diagnosis pada pasien ditetapkan.
Biasanya meskipun tidak selalu, prognosis lebih baik dibandingkan
dengan kesembuhan alamiah. Pada kenyataannya, seseorang
yang menderita stroke tidak mendapatkan kesembuhan alamiah
(secara harfiah) karena biasanya pada negara sedang berkembang,
pasien yang telah didiagnosis dengan stroke akan mendapatkan

Bab 1 Selingkup Penyakit Stroke 27


pengobatan minimal atau tanpa pengobatan serta tidak dilaporkan
mengenai prognosis penyakit ini (Danes C. etal., 2002).
Secara umum, perbaikan stroke digambarkan sebagai berikut:
10% penderita stroke mengalami pemulihan hampir sempurna
25% pulih dengan kelemahan minimum
40% mengalami pemulihan sedang sampai berat
10% tidak membutuhkan perawatan khusus, tapi dirawat oleh
perawat pribadi di rumah
15% lainnya meninggal setelah stroke. (Chamoro A. etal.,
2007; American Thoracic Society,2001).
Terdapat dua tipe perbaikan stroke yang mempengaruhi
perilaku aktifitas kehidupan sehari-hari yaitu tingkat defisit
neurologis dan tingkat fungsional. Perbaikan neurologis merujuk
adanya peningkatan hubungan spesifik antara stroke dengan
defisit neurologis seperti defisit motorik, sensorik, visual atau
bahasa. Perbaikan fungsional merujuk adanya peningkatan
pada aktifitas perawatan diri sendiri dan mobilitas yang dapat
terjadi sebagai konsekuensi dari perbaikan neurologis. Perbaikan
paling sering melibatkan beberapa kombinasi dari peningkatan
neurologis danfungsional (DongoranR.A,2007).
Pengelolaan stroke meliputi akut, rehabilitasi aktif, dan
adaptasi terhadap lingkungan/sosialisasi. Pada fase akut, pasien
stroke menjalani penanganan medikamentosa yang intensif,
pengendalian tekanan darah, gula darah dan rehabilitasi pasif.
Setelah fase akut terlewati, baru pasien ditangani rehabilitasi
aktif, di samping itu beradaptasi dengan lingkungannya (Aduen J.F.
etal.,2005).
Adanya pengurangan defisit neurologis pada pasien stroke
terjadi karena (1) hilangnya edema serebri, (2) perbaikan sel
saraf yang rusak, (3) adanya kolateral, dan (4) retraining
(plastisitasotak) (Dongoran R.A, 2007).
Perbaikan fungsi motorik pada pasien stroke berhubungan
dengan beratnya defisit motorik saat serangan stroke akut (Aduen
J.F. etal.,2005). Pasien dengan defisit motorik ringan akan lebih

28 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


banyak kemungkinan untuk mengalami perbaikan dibandingkan
dengan defisit motorik yang berat (Langdon P.C. etal., 2009).
Dari berbagai penelitian didapatkan bahwa perbaikan status
fungsional tampak nyata pada 3 bulan pertama dan mencapai
tingkat maksimal dalam 6 bulan post stroke. Duncan P.W., (1993)
dalam penelitiannya melaporkan bahwa perbaikan fungsi motorik
dan defisit neurologis terjadi paling cepat dalam 30 hari pertama
setelah stroke iskemia dan menetap setelah 3-6 bulan, walaupun
selanjutnya perbaikan masih mungkin terjadi (Danes C. etal.,
2002). Sementara itu, peneliti lain mendapatkan 50% pasien
mengalami perbaikan fungsional paling cepat dalam 2 minggu
pertama (Tong X. etal., 2007).

Tabel 1.7
Faktor-faktor yang berhubungan dengan peningkatan risiko
kematian dan jeleknya outcome sesudah stroke
Gambaran demografis
Peningkatan umur
Gambaran klinis
Umum Neurologis
- Atrial fibrilasi - Penurunan tingkat kesadaran
- Gagal jantung - Gangguan motorik berat
- Serangan jantung iskemia - Gangguan proprioseptif
- Diabetes mellitus - Disfungsi visuospasial
- Panas - Gangguan kognitif
- Inkontinensia urine - Total anterior circulation syndrome
- Riwayat stroke - Rendahnya skala ADL
sebelumnya
Pemeriksaan sederhana Pemeriksaan canggih (CT / MRI)
- Hiperglikemia - Lesi yang besar
- Tingginya hematokrit - Adanya efek massa
- Abnormalitas EKG - Darah intraventrikular
- Hidrocephalus
Sumber: Danes C. et al., 2002

Bab 1 Selingkup Penyakit Stroke 29


Rangkuman
1. Stroke merupakan penyebab kematian terbanyak kedua
di dunia dan merupakan penyebab kecacatan utama pada
usia produktif.
2. Usia rata-rata penderita stroke di Indonesia adalah
58,8 tahun. Insiden stroke meningkat sesuai dengan
pertambahan usia dan risiko terjadinya stroke meningkat
dua kali setiap dekade setelah usia 55 tahun.
3. Menurut Misbach (1999), stroke dapat diklasifikasikan
berdasarkan atas patologi anatomi (lesi), stadium, dan
lokasi (sistem pembuluh darah).
4. Beberapa gejala atau tanda yang mengarah kepada
diagnosis stroke antara lain hemiparesis, ganguan
sensorik satu sisi tubuh, hemianopia atau buta mendadak,
diplopia, vertigo, afasia, disfagia, disatria, ataksia, kejang
atau penurunan kesadaran yang kesemuanya terjadi
secara mendadak.
5. Menurut Janssen (2010) dan Baldwin (2010) faktor risiko
stroke dibagi menjadi dua kelompok yaitu nonmodifiable
risk factors (faktor risiko yang tidak dapat dimodifikasi)
dan modifiable risk factors (faktor risiko yang dapat
dimodifikasi).
6. Stroke akan mengakibatkan beberapa efek antara lain:
80% penurunan parsial/total gerakan lengan dan
tungkai,
80-90% bermasalah dalam berpikir dan mengingat,
70% menderita depresi, dan
30% mengalami kesulitan bicara, menelan, mem
bedakan kanan dan kiri.
Terjadinya dampak sosial
Juga menimbulkan permasalah di bidang sosial dan
ekonomi.

30 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


7. National Institute of Health Stroke Scale (NIHSS)
merupakan pengukuran kuantitatif defisit neurologis
berkaitan dengan stroke yang dapat memprediksi outcome
stroke jangka panjang. Outcome stroke jangka panjang
terdiri dari 12 jenis pertanyaan (tingkat kesadaran,
respon terhadap pertanyaan, respon terhadap perintah,
gaze palsy, pemeriksaan lapangan pandang, facial palsy,
motorik, ataksia, sensori, bahasa, disartria, dan ekstensi/
inattentian).
8. Sangat penting membedakan antara prognosis dan
kesembuhan alami (natural history) karena keduanya
sangat berbeda. Kesembuhan alami merujuk pada
perkembangan penyakit dari awitan dan tidak diobati,
sedangkan prognosis merujuk pada kemungkinan hasil
yang didapatkan dari pengobatan yang diberikan setelah
diagnosis pada pasien ditetapkan. Biasanya meskipun
tidak selalu, prognosis lebih baik dibandingkan dengan
kesembuhan alamiah.

Bab 1 Selingkup Penyakit Stroke 31


32
Bab2

Memahami
Stroke Iskemia

33
2.1 Apakah Stroke Iskemia Itu?

S
troke iskemia merupakan akibat yang ditimbulkan
secara umum oleh aterotrombosis pembuluh darah
serebral, baik yang besar maupun kecil. Pada stroke
iskemia, penyumbatan bisa terjadi di sepanjang jalur pembuluh
darah arteri yang menuju ke otak. Darah ke otak disuplai oleh dua
arteri karotis interna dan dua arteri vertebralis. Arteri-arteri ini
merupakan cabang dari lengkung aorta jantung. Suatu ateroma
(endapan lemak) bisa terbentuk di dalam pembuluh darah arteri
karotis sehingga menyebabkan berkurangnya aliran darah.
Keadaan ini sangat serius karena setiap pembuluh darah arteri
karotis dalam keadaan normal memberikan darah ke sebagian
besar otak. Endapan lemak juga bisa terlepas dari dinding arteri
dan mengalir di dalam darah kemudian menyumbat arteri yang
lebih kecil (Furie K.L. etal., 2011, Miscbach and Kalim, 2011).
Penyebab utama terjadinya stroke iskemia antara lain
aterosklerosis pada pembuluh arteri besar (makroangiopati),
kardioemboli, dan penyakit pada pembuluh darah kecil otak
(mikroangiopati). Penyebab lain yang lebih jarang ditemukan
antara lain vaskulitis otak, penyakit hematologi dan lain-lain
(Grauetal., 2001)
Arteri karotis dan arteri vertebralis beserta percabangannya
bisa juga tersumbat karena adanya bekuan darah yang berasal
dari tempat lain, misalnya dari jantung. Stroke semacam ini
disebut emboli serebral (emboli = sumbatan; serebral = pembuluh
darah otak) yang paling sering terjadi pada penderita yang baru
menjalani pembedahan jantung dan penderita kelainan katup
jantung atau gangguan irama jantung (terutama fibrilasi atrium).

34 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Sementara itu, emboli lemak jarang menyebabkan stroke. Emboli
lemak terbentuk jika lemak dari sumsum tulang yang pecah
dilepaskan ke dalam aliran darah dan akhirnya bergabung di dalam
sebuah arteri (Miscbach and Kalim, 2011).

Arteri serebral
Darah yang
membeku

Arteri karotis
internal
Simpanan
lemak

Arteri karotis
umum

Aliran darah dari jantung


Sumber: Miscbach and Kalim, 2011

Gambar 2.1Gambaran terjadinya stroke iskemia

Patogenesis stroke iskemia diawali dengan perubahan


fungsi endotel arteri, perubahan tekanan perfusi dan perubahan
komposisi darah melalui proses aterosklerosis. Aterosklerosis
yang menjadi dasar stroke iskemia merupakan suatu kelainan
dinding arteri berupa pembentukan plaque yang didahului oleh
peningkatan ketebalan intima media arteri karotis (Furie K.L. etal.,
2011). Aterosklerosis bermula pada masa anak berupa lapisan
kaya lemak di dalam tunika intima di bawah lapisan sel endotel
yang utuh (fatty streak). Pembentukan plaque fibrosa bermula di
usia muda pada daerah pembuluh darah yang rentan terhadap
pembentukan fatty streak, seperti titik-titik percabangan arteri
(Halcox etal.,2009).

Bab 2 Memahami Stroke Iskemia 35


2.2 Klasifikasi Stroke Iskemia
Stroke iskemia dapat diklasifikasikan menjadi beberapa
bagian berdasarkan gambaran klinik, patologi anatomi, sistem
pembuluh darah dan stadiumnya. Menurut modifikasi Marshall
dalam Dongoran R.A, 2007, klasifikasi stroke iskemia adalah
sebagai berikut.
Berdasarkan patologi anatomi dan penyebabnya, stroke
iskemia dibedakan menjadi:
TIA (Transient Ischemic Attack)
Trombosis serebri
Emboli serebri.
Berdasarkan stadium/pertimbangan waktu:
TIA (Transient Ischemic Attack)
RIND (Reversible Ischemic Neurologic Deficit)
Progressing stroke atau stroke-in-evolution
Completed stroke
Berdasarkan sistem pembuluh darah:
Sistem karotis
Sistem vertebrobasiler
Adams, dkk. (1993) dalam Sjahrir (2003) mengklasifikasikan
subtipe stroke iskemia berdasarkan profil faktor risikonya,
gambaran klinik, penemuan hasil imaging otak scan atau MRI,
kardio imaging, dupleks imaging arteri ekstrakranial, arteriografi,
dan pemeriksaan laboratorium. Berikut ini klasifikasinya.
1. Aterosklerosis arteri besar (embolus/trombosis)
2. Kardioembolism
3. Oklusi pembuluh darah kecil
4. Stroke akibat dari penyebab lain yang menentukan
5. Stroke akibat dari penyebab lain yang tidak menentukan
Pada klasifikasi 1 sampai 4 dapat dipakai istilah possible atau
probable tergantung hasil pemeriksaannya. Diagnosis probable
dipakai apabila penemuan gejala klinis, data neuroimaging dan
hasil dari pemeriksaan diagnostik lainnya yang konsisten dengan
salah satu subtipe dan penyebab etiologi lain dapat disingkirkan.
36 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...
Diagnosis possible dipakai apabila penemuan gejala klinis dan
data neuroimaging cenderung pada salah satu subtipe, tetapi
pemeriksaan lainnya tidak dilakukan.

2.3 Patofisiologi Stroke Iskemia


Tersumbatnya pembuluh darah intrakranial akut menyebab
kan berkurangnya aliran darah ke otak. Aliran darah ke otak
normalnya 50 ml/100 gr otak/menit. Kecepatan aliran darah di
otak bervariasi antara 40-70 cm/detik. Apabila aliran darah otak
meningkat atau arteri menyempit maka kecepatan segmen arteri
juga akan meningkat. Hal ini mengindikasikan adanya toleransi
tinggi terhadap hipertensi dan juga sensitif terhadap hipotensi.
Ketika aliran darah yang menuju serebral di bawah 20ml/100g
per menit maka akan terjadi iskemia. Jika aliran ini terus
mengalami penurunan hingga 12 ml/100 g per menit maka akan
terjadi kerusakan otak permanen yang disebut infark. Jaringan
yang mengalami iskemia namun masih dapat mempertahankan
integritas membrannya disebut sebagai iskemia penumbra karena
biasanya jaringan tersebut mengelilingi inti jaringan infark. Daerah
penumbra ini masih dapat diselamatkan dengan intervensi terapi
(Dipiro etal., 2008).
Sel membran dan fungsi sel akan terganggu sangat parah
seandainya aliran darah otak turun di bawah 10 ml/100 gr/
menit. Sel neuron tidak akan bertahan hidup jika aliran darah di
bawah 5ml/100 gr/menit (Sjahrir, 2003). Apabila tidak ada aliran
darah ke otak dalam waktu 4-10 menit, hal ini akan menyebabkan
kematian otak. Jika aliran darah diperbaiki sebelum terjadi
kematian sel, kemungkinan pasien hanya menunjukkan gejala
Transient Ischemic Attack (Smith, 2006).
Dalam keadaan normal, konsumsi oksigen diukur sebagai
CMRO2 (Cerebral Metabolic Rate for Oxygen) normal 3,5 cc/100gr
otak/menit. Keadaan hipoksia juga mengakibatkan produksi
molekul oksigen tanpa pasangan elektron. Keadaan ini disebut
oxygen-free radicals. Radikal bebas ini akan menyebabkan

Bab 2 Memahami Stroke Iskemia 37


oksidasi asam lemak di dalam organel sel dan plasma sel yang
mengakibatkan disfungsi sel (Dongoran R.A., 2007).
Otak normal membutuhkan 500 cc O2 dan 75-100 mg glukosa
setiap menitnya. Dalam keadaan hipoksia, akan terjadi proses
anaerob glikolisis dalam pembentukan ATP dan laktat sehingga
akhirnya produksi energi menjadi kecil dan terjadi penumpukan
asam laktat, baik di dalam sel ataupun di luar sel. Akibatnya, fungsi
metabolisme saraf terganggu (Dongoran R.A., 2007).
Jika neuron mengalami iskemia maka akan terjadi beberapa
perubahan kimiawi yang berpotensi dan memacu peningkatan
kematian sel. Hal ini disebabkan sel membran tidak mampu
mengontrol keseimbangan ion intra dan ekstra sel. Derajat
keparahan iskemia bervariasi dalam zona yang berbeda di daerah
yang disuplai oleh arteri tersebut. Pada pusat zona, aliran darah
sangat rendah (010ml/100 gr/menit) dan kerusakan iskemia
sangat parah dapat menyebabkan nekrosis. Proses ini disebut
core of infarct. Di daerah pinggir zona tersebut aliran darah agak
lebih besar sekitar 10-20 ml/100 mg/menit karena adanya aliran
kolateral sekitarnya sehingga menyebabkan kegagalan elektrik
tanpa disertai kematian sel permanen. Daerah ini disebut daerah
iskemia penumbra, keadaan antara hidup dan mati, tergantung
aliran darah dan oksigen yang adekuat untuk suatu restorasi
(Marlina Y., 2010).
Adanya respon inflamasi akan memperburuk keadaan iskemia
yang memperberat perkembangan infark serebri. Dalam beberapa
penelitian menunjukkan pada penderita stroke iskemia diperoleh
perubahan kadar sitokin. Produksi sitokin yang berlebih akan
mengakibatkan plugging mikrovaskular serebral dan pelepasan
mediator vasokonstruktif endotelin sehingga memperberat aliran
darah. Selain itu, juga menyebabkan eksaserbasi kerusakan blood
brain barrier dan parenkim melalui pelepasan enzim hidrolitik,
proteolitik, dan produksi radikal bebas yang akan memicu
apoptosis dan menambah neuron yang mati (Marlina Y., 2010).
Pada aterosklerosis karotis, pembentukan plak dihasilkan
oleh akumulasi lipid yang progresif, sel-sel intima arteri yang

38 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


terinflamasi serta hipertrofi sel-sel otot polos pembuluh darah.
Stres dapat memicu lepasnya (ruptur) plak dari dinding pembuluh
darah, terbentuknya kolagen, agregasi platelet, dan pembentukan
bekuan darah (clot). Bekuan darah ini dapat menyebabkan
penyumbatan lokal di daerah yang terbentuk atau dapat mengikuti
aliran darah dan menjadi emboli, terutama di daerah downstream
pada pembuluh darah serebral. Pada akhirnya, pembentukan
trombus dan emboli ini akan menyebabkan penyumbatan arteri,
penurunan aliran darah ke serebral dan terjadinya stroke iskemia
(Dipiro etal., 2008).
Penurunan suplai nutrisi ke sel-sel yang mengalami
iskemia akan menyebabkan terjadinya deplesi fosfat energi
tinggi (adenosine triphosphate [ATP]) yang dibutuhkan untuk
mempertahankan integritas membran. Kemudian akan terjadi
akumulasi kalium ekstraseluler pada waktu yang bersamaan
dengan masuknya air dan natrium ke intrasel yang menyebabkan
terjadinya edema sel dan dapat memicu lisis sel. Ketidakseimbangan
elektrolit ini menyebabkan terjadinya depolarisasi sel dan influx
kalsium ke intrasel (Dipiro etal., 2008).
Peningkatan kalsium intrasel akan mengaktifasi lipase,
protease, dan endonuklease serta pelepasan asam lemak dari
membran fosfolipid. Depolarisasi sel saraf juga memicu pelepasan
asam amino eksitatori seperti glutamat dan aspartat yang dapat
menyebabkan kerusakan sel saraf jika dilepaskan dalam jumlah
berlebih. Akumulasi asam lemak, termasuk asam arakidonat akan
menghasilkan pembentukan prostaglandin, leukotrien, dan radikal
bebas. Pada kondisi iskemia, besarnya produksi radikal bebas ini
melebihi sistem scavenging normal yang menyebabkan molekul-
molekul menjadi reaktif untuk menyerang/merusak membran sel
dan menyebabkan terjadinya asidosis intraseluler. Semua proses
ini terjadi dalam waktu 2-3 jam dari onset terjadinya iskemia yang
berujung pada kematian sel (Shah, 1997).
Dua mekanisme utama yang menyebabkan kerusakan otak
pada stroke adalah iskemia dan perdarahan. Pada stroke iskemia,
yang mewakili sekitar 80% dari semua stroke, penurunan
atau hilangnya aliran darah menyebabkan pasokan glukosa

Bab 2 Memahami Stroke Iskemia 39


menjadi berkurang yang selanjutnya mengakibatkan kegagalan
mitokondria dalam memproduksi ATP (Gambar 2.2). Tanpa ATP,
pompa ion pada membran sel neuron berhenti berfungsi, terjadi
depolarisasi neuron sehingga kalsium intraseluler meningkat
(Fauci etal., 2008).

Reseptor ionotropik Protease


Terminal Fosfolipase
presinaptik Endonuklease
Enzim yang lain
Glutamat

Reseptor
metabotropik
Sel possinaptik
Sel yang mati
Glutamat

Glutamin
Proses astrosit
Sumber: Fauci etal., 2008

Gambar 2.2Mekanisme glutamat dalam meningkatkan influx kalsium

Depolarisasi seluler juga menyebabkan pelepasan glutamat


dan aspartat. Proses ini disebut dengan eksitotoksisitas. Glutamat,
yang pada dasarnya berada di dalam sambungan sinaptik,
dilepaskan di area ekstraseluler yang kemudian akan berikatan
dengan reseptor N-methyl-D-aspartat dan alpha-amino-3-hydroxy-
5-methyl-4-isoxanole propionat (AMPA). Ditempatinya reseptor
NMDA dan AMPA oleh glutamat akan meningkatkan influx ion
kalsium, natrium, dan klorida serta efflux kalium.
Peningkatan konsentrasi kalsium, natrium, dan klorida
intrasel menyebabkan pembengkakan pada neuron dan glia
(edema sitotoksik). Hal ini disebabkan karena aktivasi beberapa
enzim destruktif seperti protease, lipase, dan endonuklease yang

40 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


mengakibatkan pelepasan produk metabolit berupa oksigen
radikal bebas, hidroksida (OH), nitric oxide (NO) dan sitokin.
Produk metabolik tersebut merupakan penyebab hilangnya
integritas seluler berupa rusaknya membran sel dan struktur
protein sel neuron, yang akhirnya menyebabkan kematian sel
(Debetal., 2009). Mekanisme di atas dijelaskan dalam Gambar2.3.

Arteri yang terhambat

Thombolisis Reperfusi
Iskemia Thrombektomi
Respons
Energi yang gagal PARP inflamasi
Pelepasan
glutamat
Mitokondria Adesi
rusak leukosit

Reseptor Ca2+ / Na influx Apoptosis Produksi asam


glutamat arakidonat
Lipolisis
Proteolisis
iNOS Pembentukan
radikal bebas

Kerusakan membran dan


sitoskeletal Fosfolipase

Sel mati

Sumber: Deb etal., 2009

Gambar 2.3Kaskade terjadinya iskemia serebral

Ketika terjadi iskemia maka otak, mikroglia, atrosit, sel


endotel, dan neuron melepaskan sitokin, seperti interleukin-1
(IL1) dan Tumor Necrosis Factor (TNF-), yang menyebabkan
leukosit berkumpul, teraktivasi, dan akhirnya menempel pada sel
endotel. Leukosit juga akan mengaktifkan bahan vasoaktif seperti
radikal bebas, metabolit asam arakidonat (sitokin), dan asam
nitrat. Vasoaktif itu menyebabkan vasodilatasi, vasokonstriksi,
peningkatan permeabilitas sel, dan peningkatan jumlah leukosit
di dinding endotelium. Hal ini menyebabkan kerusakan membran
dan sitoskeletal (Shah, 1997).

Bab 2 Memahami Stroke Iskemia 41


Iskemia otak mengakibatkan perubahan dari sel neuron otak
secara bertahap seperti yang akan dijelaskan berikut ini.

2.3.1 Penurunan aliran darah otak


Terdapat dua mekanisme patofisiologi pada iskemia otak yaitu
hilang atau berkurangnya suplai oksigen dan glukosa yang terjadi
secara sekunder akibat oklusi vaskular, serta adanya perubahan
pada metabolisme seluler akibat gangguan proses produksi energi
akibat oklusi sebelumnya (Truelsen T. etal., 2001; Hassan A.
etal.,2006).
Sebuah percobaan pada otak tikus menunjukkan respon
metabolik tertentu pada penurunan aliran darah otak yang
progresif. Akibat oklusi akan terjadi gangguan hemodinamik aliran
darah otak yang secara bertahap dikenal beberapa critical level
berdasarkan beratnya oklusi, yaitu seperti berikut ini.
1. Tingkat kritikal pertama
Terjadi bila aliran darah otak menurun hingga 70-80% (kurang
dari 50-55 ml/100 gr otak/menit). Menurut Hossmann, pada
keadaan ini respon pertama otak adalah terhambatnya sintesis
protein karena adanya disagregasi ribosom.
2. Tingkat kritikal kedua
Terjadi bila aliran darah otak berkurang hingga 50% (hingga
35 ml/100 gr otak/ menit). Akan terjadi aktivasi glikolisis anaerob
dan peningkatan konsentrasi laktat yang selanjutnya berkembang
menjadi asidosis laktat dan edema sitotoksik.
3. Tingkat kritikal ketiga
Terjadi bila aliran darah otak berkurang hingga 30% (hingga
20 ml/100 gr otak/menit). Pada keadaan ini akan terjadi
berkurangnya produksi adenosine triphosphate (ATP), defisit
energi, serta adanya gangguan transpor aktif ion, instabilitas
membran sel serta dilepaskannya neurotransmiter eksitatorik
yang berlebihan. Pada saat aliran darah otak mencapai hanya 20%
dari nilai normal (10-15 ml/100 gr otak/menit) maka neuron-
neuron otak mengalami kehilangan gradien ion dan selanjutnya
terjadi depolarisasi anoksik dari membran.

42 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Jika jaringan otak mendapat aliran darah kurang dari 10
ml/100 gr jaringan otak per menit akan terjadi kerusakan neuron
yang ireversibel secara cepat dalam waktu 6-8 menit. Daerah ini
disebut ischemic core (inti infark) (Prass K. etal., 2003; ; Prass
K. etal., 2006; Harms H. etal., 2008; Aslanyan S. etal., 2004;
HassanA.etal., 2006; Chen R.L. etal., 2010).

CBF,ml/100 gr
Jaringan otak per menit

80
70 Keadaan normal
60
50 Pengurangan sintesis protein
Selektif ekspresi gen
40
30 Asidosis laktik
Edema sitotoksis
20
Eksitotoksisitas glutamat
10
Depolarisasi anoksik
0 Infark

Jaringan otak merespon ke aliran darah serebral yang berkurang


Sumber: Harms H. etal., 2010

Gambar 2.4Respon jaringan otak terhadap penurunan aliran darah otak

2.3.2 Pengurangan O2
Dalam keadaan normal, konsumsi oksigen yang biasanya
diukur sebagai cerebral metabolic rate for oxygen (CMRO2)
besarnya 3,5 cc/100 gr otak/menit. Keadaan hipoksia juga
mengakibatkan produksi molekul oksigen tanpa pasangan
elektron. Keadaan ini disebut oxygen-free radicals. Radikal bebas
ini menyebabkan oksidasi asam lemak di dalam organel sel dan
plasma sel yang mengakibatkan disfungsi sel. Bila suplai O2
berkurang (hipoksia) proses anaerob glikolisis akan terjadi dalam
pembentukan ATP dan laktat sehingga akhirnya produksi energi
menjadi kecil dan terjadi penumpukan asam laktat, baik di dalam

Bab 2 Memahami Stroke Iskemia 43


sel saraf maupun di luar sel saraf (lactic acidosis). Akibatnya, fungsi
metabolisme sel saraf terganggu (Hassan A. etal., 2006).

2.3.3 Kegagalan energi


Berbeda dengan organ tubuh lainnya, otak hanya meng
gunakan glukosa sebagai sumber energi utama dari otak. Dengan
adanya oksigen, glukosa dirubah oleh mitokondria menjadi
ATP. Otak normal membutuhkan 500cc O2 dan 75-100mg
glukosa setiap menitnya (total sekitar 125 mg glukosa per
harinya). ATP digunakan oleh sel otak untuk semua proses yang
membutuhkan energi. Energi yang berasal dari ATP digunakan
untuk membuat dan mempertahankan komponen dan proses
sel serta memacu fungsi motor, kognitif, dan daya ingat. Suplai
produksi ATP secara konstan penting untuk mempertahankan
integritas neuron mayoritas kation Ca2+, Na+ ekstraseluler dan K+
intraseluler (HarmsH., etal., 2010; Prass K. etal., 2003; Adams
H.P. etal.,1993).
Pada stroke, aliran darah terganggu sehingga terjadi
iskemia yang menghambat penyediaan glukosa, oksigen, dan
bahan makanan lain ke sel otak. Hal tersebut akan menghambat
mitokondria dalam menghasilkan ATP sehingga tidak saja terjadi
gangguan fungsi seluler, tetapi juga aktivasi berbagai proses
toksik. Bila hal ini tidak dikoreksi pada waktunya, iskemia dapat
menyebabkan kematian sel (Prass K. etal., 2003).

2.3.4 Peranan neurotransmiter glutamat pada stroke


iskemia
Neurotransmiter eksitatorik ternyata berperan pada tahap
awal iskemia kaskade. Pada jaringan dengan perfusi yang kurang
dengan adanya kegagalan energi maka akan terjadi depolarisasi
membran dan pelepasan neurotransmiter eksitatorik, seperti
glutamat yang terdapat pada ruangan ekstraseluler, di mana
terminal presinap melepaskan glutamat dan konsentrasinya akan
meningkat hingga 20 kali lipat (Biswas M. etal., 2009; MarnaneM.
etal., 2010). Setelah dilepaskan, glutamat dapat ditangkap oleh
neuron dan sel glia. Sel glia akan mengubah glutamat menjadi

44 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


glutamin oleh aktifitas enzim glutamin sintetase. Glutamin dapat
dilepaskan dan diambil kembali oleh neuron untuk dihidrolisis
menjadi glutamat. Dalam keadaan normal, glutamat dengan cepat
diklirens dari sinapsis dan kadarnya menjadi normal kembali.
Tetapi, pada keadaan iskemia terjadi pelepasan glutamat yang
berlebihan dan terdapat adanya kegagalan pengambilanglutamat
(Grau A.J. etal., 2001).
Glutamat merupakan neurotransmiter eksitatorik di jaringan
otak. Terdapat 2 bentuk reseptor glutamat, yaitu:
1. Reseptor metabotropik, di mana reseptornya bergandengan
dengan protein G dan memodulasi second messenger dalam sel
seperti inositol trifosfat, Ca, dan nukleotid siklik.
2. Reseptor inotropik, yang terdiri atas reseptor yang mempunyai
hubungan langsung dengan saluran ion membran. Reseptor
ini terbagi lagi dalam reseptor N-Methyl-D-Aspartate (NMDA),
reseptor Alpha-amino-3-hydroxy-5-methyl-4-isoxazole propio
nate (AMPA) dan kainat (Prass K. etal., 2003).
ATP sangat diperlukan dalam menjaga keseimbangan ionik
dalam sitoplasma neuron dengan menyediakan energi pada
pertukaran ion melalui Na+K+-ATPase. Pada stroke iskemia
terdapat kekurangan oksigen dan glukosa dalam sel sehingga
produksi ATP dan Na-K-ATPase berkurang, penurunan fungsi
Na+-K+-ATPase akan menyebabkan kenaikan konsentrasi Na+
dalam sel meningkat sehingga timbul pembengkakan sel, serta
pelepasan glutamat karena depolarisasi membran sel. Depolarisasi
ini menyebabkan rangsangan pada berbagai reseptor glutamat
dan masuknya ion bermuatan positif serta secara tak langsung
merangsang pembukaan voltage-gated calsium-channels.
Dari beberapa macam reseptor glutamat, Batjer (1997)
melaporkan bahwa reseptor NMDA yang paling banyak teraktifkan
pada kejadian iskemia fokal. Kekhususan reseptor NMDA terletak
pada kemampuannya memasukkan ion Ca2+ dan adanya ion Mg2+
ekstraselular yang menutup saluran ion tersebut pada keadaan
hiperpolarisasi membran. Purves (2001) mengatakan bahwa
saluran ion yang dibentuk oleh reseptor NMDA hanya terbuka

Bab 2 Memahami Stroke Iskemia 45


bila Mg2+ yang menutupi saluran lepas karena depolarisasi akibat
adanya input eksitatori yang cukup besar. Depolarisasi setelah
iskemia menyebabkan terbukanya saluran ion pada reseptor
NMDA yang mengakibatkan pemasukan ion Ca2+ yang berlebihan
ke dalam sitoplasma (Harms H. etal., 2008; Prass K. etal., 2003;
Chen R.L. etal., 2010; Biswas M. etal., 2009).
Pada keadaan normal, reseptor AMPA yang paling bereaksi
terhadap efek glutamat. Tetapi pada waktu transmisi sinaptik
berfrekuensi tinggi, aktivasi reseptor NMDA menyebabkan Ca
intraseluler bertambah, yang merangsang constitutive Nitric Oxide
Synthase (cNOS). NO yang terbentuk berdifusi kembali ke neuron
presinaptik dan menambah lagi pelepasan glutamat. Pelepasan
glutamat yang berlebihan menyebabkan aktivasi yang lebih besar
dari reseptor glutamat post-sinaptik dan seterusnya menambah
efektivitas sinap tersebut.
Akibat stroke, penyerapan glutamat akan berkurang, sifat
reseptor glutamat berubah yang mengakibatkan terjadinya
abberant cell signaling sehingga terjadi peningkatan kadar kalsium.
Masuknya Ca ke dalam neuron melalui saluran ion yang dirangsang
oleh aktivasi reseptor glutamat dapat menyebabkan kematian sel
(eksitotoksisitas) (Harms H. etal., 2008; Prass K. etal., 2003; Chen
R.L. etal., 2010; Biswas M. etal., 2009).

2.3.5 Peranan Ca dan radikal bebas pada stroke iskemia


Masuknya Ca2+ yang berlebihan akan memicu berbagai reaksi
di dalam sel karena Ca2+ dapat berfungsi sebagai second messenger
yang akan mengaktifkan transduksi sinyal intraseluler. Berbagai
enzim yang berikatan dengan Ca2+ akan teraktifkan secara terus-
menerus dan menimbulkan kerusakan struktur sel. Lodish
(2000) mengatakan bahwa pengaktifan protein kinase C (PKC)
dan 1,4,5-triphosphate (IP3) juga menstimulasi pelepasan Ca2+
dari penyimpanan intraseluler sehingga menambah konsentrasi
Ca2+ pada sitoplasma (Sherki Y.G. etal., 2002). Peningkatan Ca2+
pada sitoplasma akan menstimulasi enzim neuronal nitric oxide
synthase (nNOS) yang akan memacu terbentuknya nitric oxide
(NO). Dalam keadaan normal, NO adalah molekul messenger.
46 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...
Namun ketika konsentrasi NO meningkat, NO berkompetisi
dengan superoxide dysmutase (SOD) untuk mengikat superoksida
(O2). SOD mengkatalisir reaksi O2 menjadi hidrogen peroksida
(H2O2), sedangkan reaksi antara NO dengan O2 akan membentuk
peroksinitrit (ONOO) yang merupakan oksidan poten yang
menyebabkan pembentukan free radical hydroxyl
Chan (2001) melaporkan bahwa peroksinitrit beraksi
langsung dengan berbagai struktur intraselular termasuk lipid,
protein, danDNA. Pan (2001) mengatakan bahwa pengeluaran
Ca2+ dari retikulum endoplasmikum juga akan memacu translokasi
Bax ke membran mitokondria. Bax adalah salah satu anggota
Bcl2 family yang bersifat proapoptotik, sedangkan Bcl-2 adalah
protein antiapoptosis pada membran mitokondria. Marzo (1998)
mengatakan bahwa translokasi Bax ke membran mitokondria
menyebabkan Bax membentuk protein dimer dan akan bergabung
dengan permeability transition pore complex (PTPC) dan
menyebabkan peningkatan permeabilitas membran mitokondria
serta pelepasan sitokrom c. Sitokrom c normalnya terletak pada
ruang di antara kedua membran mitokondria dan akan dikeluarkan
ke sitoplasma bila terjadi pacuan. Sims dan Anderson (2002)
melaporkan bahwa saluran K+ pada mitokondria juga memerlukan
ATP dan pengaktifannya akan menstabilkan fungsi mitokondria
dalam mengatur protein proapoptotik dan antiapoptotik.
Ketidakaktifan saluran K+ pada mitokondria setelah iskemia
menyebabkan penurunan ekspresi Bcl2 dan menghilangkan
hambatan lokalisasi Bax pada membran mitokondria (Sherki Y.G.
etal., 2002).
Masuknya Ca ke dalam neuron dapat mengaktivasi enzim
nuklear misalnya protein kinase C, kalsium/kalmodulin
dependent protein kinase II, fosfolipase, fosfat, nitric oxyde sythase,
endonuklease, ornitin dekarboksilase. Semuanya ini dapat
menyebabkan kematian sel melalui pembentukan radikal bebas.
Radikal bebas adalah satuan molekul atau atom yang mempunyai
elektron tidak berpasangan di lingkaran terluarnya. Adanya
elektron bebas membuat radikal bebas ini menjadi sangat reaktif.
Suatu radikal bebas mudah bereaksi dengan molekul/atom lain

Bab 2 Memahami Stroke Iskemia 47


non radikal bebas, untuk membentuk radikal bebas baru (Prass K.
etal., 2003).
Ca mengaktifkan berbagai proses yang menyebabkan
produksi Reactive Oxygen Species (ROS), termasuk pelepasan asam
arakhidonat, pembentukan NO, degradasi adenosin, kebocoran
electron transport chain (ETC). Ca juga mengaktifkan fosfolipase
termasuk fosfolipase A2 (PLA2) yang memecah fosfolipid. Asam
arakhidonat selanjutnya akan dimetabolisir oleh cyclo-oxygenase
dan lipo-oxygenase menjadi prostaglandin dan leukotrien. Pada
reaksi yang akhir ini akan terbentuk anion superoksida, suatu ROS.
Pada keadaan iskemia, sintesis ATP dalam mitokondria sangat
menurun dan ATP dirusak menjadi adenosin difosfat (ADP),
adenosin monofosfat (AMP) dan adenosin. Kemudian terjadi
degradasi menjadi inosin, hypoxanthine dan xanthine. Reaksi
yang terakhir ini dikatalisis oleh xanthine oxidase (XO), yang
dikonversi dari xanthine dehydrogenase oleh Ca dependent process.
Pembentukan xanthine dari hipoxanthine menghasilkan anion
superoksida, suatu ROS.
Mitokondria merupakan sumber utama dari ROS selama
dan segera setelah serangan stroke. Pada keadaan Ca berlebihan
dan atau manfaat dari ETC berkurang, maka elektron cenderung
bocor dari ETC juga membentuk anion superoksida. Enzim
SOD akan mengkatalisis H2O2 yang sebagian besar akan diubah
menjadi H2O oleh katalase. Namun, apabila terdapat ion Fe, H2O2
akan membentuk hydroxyradical (OH), suatu ROS yang lain. Pada
keadaan biasa, berbagai darah di otak juga mengandung banyak Fe
yang mempermudah pembentukan (OH) ini.
ROS dapat bereaksi secara ireversibel dengan beberapa bahan
seluler seperti protein, double bonds dari fosfolipid, serta nuclear
DNA sehingga menyebabkan kebocoran membran, gangguan
regulasi seluler dan mutasi gen. Kerusakan sel mengakibatkan
gangguan homeostasis ion, gangguan pengenalan sel dan gangguan
ekspresi gen (Prass K. etal., 2003).

48 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


2.3.6 Peran nitrit oksida pada stroke iskemia
Radikal bebas nitrit oksida (NO) dihasilkan oleh 3 jenis
isoform Nitric Oxide Synthase (NOS) yaitu neuronal NOS (nNOS),
inducible NOS (iNOS) dan endotelial NOS (eNOS). eNOS dan nNOS
merupakan enzim yang aktifitasnya tergantung pada kalsium dan
stimulasi terhadap enzim tersebut dapat menghasilkan NO dalam
jumlah kecil. iNOS adalah enzim yang tidak tergantung kalsium dan
diinduksi oleh sitokin yang akan menghasilkan NO dalam jumlah
yang besar.
Terdapat isoform keempat yaitu mitochondrial NOS (mtNOS),
tetapi hingga saat ini belum dapat dikarakteristikkan dengan
jelas. mtNOS dilokalisir di mitokondria dengan menggunakan
teknik mikro sensor biokimia dan teknik imunohisokimia.
Beberapa sumber mengatakan bahwa mtNOS diidentifikasikan
sebagai isoform alfa dari nNOS. Aktivitasnya tergantung ion
kalsium. Fungsinya belum diketahui secara pasti, namun diduga
berhubungan dengan kontrol respirasi mitokondria, mengontrol
potensial transmembran mitokondria dan melindungi mitokondria
dari kelebihan Ca (Sherki Y.G. etal., 2002; Baird E. etal., 2001;
Matsui T. etal., 2003).
Peran NO pada iskemia serebri adalah kompleks. NO dapat
memberikan efek protektif maupun efek merusak pada sel. Dalam
keadaan iskemia, NO yang dihasilkan oleh nNOS melalui aktivasi Ca
dapat merusak sel-sel otak melalui reaksi NO dengan superoksida
yang menghasilkan peroksinitrit yang sangat reaktif, sedangkan
iNOS yang dihasilkan oleh makrofag terlibat dalam proses
inflamasi dan bersifat sitotoksik yang menyebabkan kematian sel.
NO yang dihasilkan oleh eNOS mempunyai efek protektif yaitu
menurunkan agregasi trombosit, mencegah adesi leukosit, dan
meningkatkan vasodilatasi pembuluh darah arteri dan aliran darah
serta mengatur kontraktilitas.
Dalam keadaan normal, otak dapat menghasilkan NO yang
berperan pada pengontrolan aliran darah, perfusi jaringan,
trombogenesis dan modulasi aktitifitas neuronal (Suroto, 2002;
Alderton W. etal., 2002; Del Zoppo G.J. etal., 2000).

Bab 2 Memahami Stroke Iskemia 49


Aktivasi eNOS menghasilkan peningkatan produksi NO di
dalam sel endotel. NO berdifusi keluar dari sel endotel ke dalam
sel otot polos di mana NO akan mengaktifkan guanilat siklase yang
akan menyebabkan relaksasi sel otot, vasodilatasi dan peningkatan
aliran darah serebri. Pelepasan NO juga dapat menurunkan
agregasi dan perlekatan trombosit dan leukosit serta menghambat
Vascular Cell Adesion Molecule-1 (VCAM-1).
Pada tempat inflamasi akan dihasilkan iNOS yang akan
menghasilkan NO yang dapat beraksi dengan radikal superoksida
membentuk peroksinitrit yang kemudian beraksi dengan protein
dan menyebabkan fragmentasi protein. Penurunan glukosa dan
oksigen dapat menginduksi ekspresi iNOS pada sel endotel.
Sementara itu, sejumlah besar NO yang dihasilkan oleh iNOS akan
menyebabkan kematian sel endotel melalui mekanisme apoptosis,
juga menyebabkan disfusi sel endotel yang menghasilkan
disregulasi vaskular dan mempercepat iskemia.
Penelitian menunjukan bahwa pada stroke iskemia akut,
peningkatan kadar metabolit NO berkorelasi dengan keparahan
kerusakan sel otak. Meskipun penurunan aliran darah serebri
pada daerah sentral sema iskemia merupakan faktor utama
yang bertanggung jawab terhadap kerusakan nekrotik, faktor
lain yang juga terlibat adalah derajat metabolik, densitas kapiler,
eksitotoksisitas asam amino, dan mungkin perbedaan dari aktifitas
NOS lokal (Del Zopp G.J. etal., 2000; Sellars C. et.al., 2007).

2.3.7 Apoptosis
Mitchel (1997) menyebutkan ada 2 pola kematian sel yaitu
seperti yang akan dijelaskan berikut ini.
1. Nekrosis, paling sering adalah nekrosis koagulatif, terjadi
setelah menghilangnya aliran darah atau karena racun, dan
ditandai dengan adanya pembengkakan sel, denaturasi protein
dan kerusakan organela.
2. Apoptosis, kejadian yang lebih teratur, merupakan kematian
terprogram dari populasi spesifik dalam keadaan normal

50 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


seperti embriogenesis atau juga pada beberapa keadaan
patologis (Prass K. etal., 2003).
Beberapa gambaran dari apoptosis yaitu:
a. pengkerutan (shrinkage) dari sel sehingga ukurannya lebih
kecil dari normal, sitoplasma lebih padat, organela meskipun
relatif normal tampak lebih mampat.
b. kondensasi kromatin. Ini merupakan tanda yang paling khas
pada apoptosis kromatin menggumpal di perifer, di bawah
membran inti. Inti sendiri dapat terpecah menjadi dua fragmen
atau lebih.
c. fagositosis dari apoptosis sel atau apoptotic bodies oleh sel
sehat di dekatnya, baik oleh sel parenkim atau makrofag
(PrassK. etal., 2003).

2.3.7.1 Kaskade apoptosis


Iskemia mengaktifkan kaspase (famili sistein protease)
yang mengakibatkan apoptosis dan sel bunuh diri. Ini berupa
kondensasi dan fragmentasi nukleus, organel sitoplasma menjadi
padat, pengurangan volume sel serta perubahan membran plasma.
Protease sistein yang disebut kaspase bekerja sebagai eksekutor
dari apotosis. Selama iskemia, kaspase yang telah diaktifkan
membuka sel dengan memecah protein dan enzim sitoskletal
yang penting untuk perbaikan sel (Prass K. etal., 2003).
Terdapat 3 fase pada kejadian apoptosis kematian sel yaitu
sebagai berikut.
1. Fase Induksi
Pada fase ini terdapat pemicu kematian sel seperti
hipoksia/iskemia, trinukleotida repeats dan mutasi presenilin.
2. Fase perkembangan (propagasi)
Anggota famili Bcl-2 dapat melaksanakan 2 tugas yaitu
mengontrol pelepasan sitokrom-C dari mitokondria dan
mengikat APAF-1 (apoptosis protein activating factor)
3. Fase eksekusi
Kaspase inisiator yang aktif mengaktifkan kaskade
proteolitik dan berakhir dengan apoptosis serta kematian sel.

Bab 2 Memahami Stroke Iskemia 51


Hipoksia/iskemia
Trinukleotida repeats I
Pemicu kematian sel
Mutasi presenilin N
D
U
K
Ca++; c-jun; oxidants; bax; acidosis, ceramide S
I
Prokaspase inisiator

Bcl-2 APAF-1
Kaspase inisiator PRO
PA
GA
Prokaspase efektor SI
Mitokondria Sitokrom-C
Kaspase efektor
E
APAF-1 = Apoptosis protein K
activating factor
Substrat protein S
untuk Kaspase E
K
U
Apoptosis S
I

Kematian sel

Sumber: Fishman J.A., 2008


Gambar 2.5Kaskade apoptosis pada stroke iskemia

Kaspase dapat dibagi dalam 2 golongan yaitu sebagai berikut.


1. Kaspase yang mengatur aktivasi dari kaspase lain (kaspase
1,2,4,5,8,9,10)
2. Kaspase yang berhubungan dengan fase eksekusi (kaspase
3,6,7, dan 14)
Aktivasi kaspase-1 menyebabkan toksisitas dan reaksi
inflamasi, sementara itu aktivasi kaspase-3 menyebabkan
apoptosis.

2.3.7.2 Kematian neuron pada iskemia serebri: proses


campuran
Stoll dkk. (1998) mengatakan bahwa pada iskemia fokal
neuron mati pada fase akut dengan nekrosis dan pada bentuk

52 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


lambat dengan programmed cell death/apoptosis. Semula nekrosis
dan apoptosis dianggap sebagai dua macam jalur yang terpisah
pada kematian sel. Pada lesi serebri akut seperti pada iskemia
fokal, adanya campuran tanda morfologis dan biokemis dari
apoptosis dan nekrosis.
Diperoleh hasil bahwa pada stadium awal iskemia otak,
neuron pada daerah yang disebut inti infark menunjukkan
gambaran morfologis, fisiologis dan biokemis suatu apoptosis
awal yang meliputi kondensasi sitoplasma dan inti, serta kaskade
aktivasi kaspase yang khas. Kaskade aktivasi awal melibatkan
death receptor pathway yang berhubungan dengan kaspase-8
dan kaspase 1 pathway. Tidak ada hubungan dengan perubahan
respirasi mitokondria atau aktivasi kaspase-9. Sebaliknya, pathway
yang diaktifkan pada ekspansi sekunder dari lesi di daerah
penumbra meliputi kaspase-9. Sementara itu, aktivasi kaspase-3
menunjukkan perjalanan waktu bifasik.
Diperkirakan bahwa apoptosis merupakan komitmen pertama
untuk kematian sel setelah iskemia serebri akut. Sementara itu,
gambaran morfologik terakhir yang dapat dilihat merupakan
aborsi dari proses yang disebabkan gangguan energi yang berat
pada inti. Sebaliknya, kaskade aktivasi kaspase yang tergantung
pada energi dapat dilihat pada penumbra di mana apoptosis dapat
berkembang penuh karena masih ada sisa aliran darah.
Selain menghasilkan ATP dan mengatur homeostasis ion
Ca, mitokondria juga mengatur 2 bentuk kematian sel, yaitu
nekrosis dan apoptosis. Segera setelah iskemia serebri, campuran
dari dua proses kematian sel tersebut terjadi melalui pelepasan
faktor dari mitokondria yang mengaktifkan kaskade reaksi
kematian sel. Ion kalsium yang diambil oleh mitokondria akan
mengaktifkan mitochondrial permeability transition pore (mPTP)
yang berperan pada apoptosis. Pembukaan dari mPTP juga akan
meningkatkan pelepasan ion Ca dan produksi mitchondrial
mediated ROS yang menyebabkan calsium toxicity dan ROS
damage yang mengakibatkan nekrosis. Leist (1997) menyebutkan
bahwa ischemic cell death merupakan campuran dari nekrosis dan
apoptosis. DNA laddering sering dipakai sebagai bukti adanya
proses apoptosis. Nekrosis dan apoptosis tampaknya mengikuti

Bab 2 Memahami Stroke Iskemia 53


distribusi spasial dalam jaringan. Pada daerah inti infark, neuron
yang mati dengan cepat, lebih banyak melalui proses nekrosis.
Sementara itu, pada daerah penumbra, kematian neuron yang
terjadi lebih lambat, lebih banyak dijumpai tanda apoptosis
(PrassK. etal., 2003).

2.4 Etiologi Stroke Iskemia


Stroke iskemia bisa disebabkan oleh berbagai macam masalah
yang dapat dikelompokkan menjadi 3 bagian, yaitu masalah-
masalah pembuluh darah, jantung dan substrat darah itu sendiri.
Tabel 2.1Kondisi yang berhubungan dengan iskemia fokal serebral
Kelainan Vaskular Kelainan Jantung Kelainan Darah
Aterosklerosis Trombus mural Trombositosis
Displasia fibromuskular Penyakit Jantung Rematik Polisitemia
Gangguan inflamasi Aritmia Penyakit sickle cell anemia
Arteritis sel giant Endokarditis Leukositosis
SLE Prolap katub mitral Status hiperkoagulasi
Poliarteritis nodosa Paradoxic embolus
Granulomatous angiitis Atrial myxoma
Syphilitic arteritis Prosthetic heart valves
AIDS
Diseksi arteri karotis atau
vertebralis
Infark lakuner
Drug abuse
Migren
Sindrom moya-moya
Trombosis sinus atau vena

Sumber: PrassK. etal., 2003

2.5 Gangguan Fungsi Kognitif pada Stroke


Iskemia
Stroke merupakan penyebab kecacatan utama, tidak hanya
akibat disfungsi motorik, namun juga gangguan fungsi kognitif
yang sering terjadi pada stroke. Gangguan kognitif berfluktuasi
sesuai fase stroke. Gangguan kognisi pada fase akut terjadi akibat
dampak langsung lokasi infark pada tempat yang strategis atau
akibat hipoperfusi regio otak lain sebagai respon sekunder infark.
Pada fasesubakut dan paska stroke, faktor di luar stroke yang ikut

54 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


mempengaruhi antara lain suhu, kejadian kejang, komorbiditas,
serta faktor genetika (Gottesman R.F. etal., 2010).

2.5.1 Gangguan fungsi kognitif pada stroke akut


Infark atau iskemia pada lokasi otak tertentu menyebabkan
gangguan kognisi yang sesuai. Stroke pada hemisfer dominan
menyebabkan gangguan berbahasa (afasia) dan apraksia. Pada
hemisfer non dominan gangguan kognitif dapat berupa neglect
(pengabaian) pada salah satu sisi objek atau ruang. Gangguan
kognisi tidak hanya terjadi pada infark di kortikal, namun
dapat juga terjadi pada infark di subkorteks karena mengenai
sirkuit-sirkuit yang ikut mengatur fungsi kognitif antar bagian-
bagian di otak. Gangguan kognisi juga dapat terjadi sekunder
akibat gangguan sensorik, visual, dan motorik (Gottesman R.F.
etal.,2010).

2.5.2 Gangguan fungsi kognitif pada stroke subakut


Kebanyakan gangguan kognitif paska stroke membaik setelah
periode subakut (sampai 3 bulan setelah stroke) atau lebih awal.
Pada fase subakut, proporsi gangguan kognitif berkisar antara
5090%, tergantung populasi dan metode penelitian yang dipakai.
Pada fase ini yang menentukan perkembangan fungsi kognitif
adalah perbaikan sirkulasi serebral karena rekanalisasi spontan,
neuroplastisitas, dan adanya faktor penyulit yang menyertai.
Kebanyakan daerah penumbra mengalami reperfusi dalam waktu
3 bulan stroke. Setelah 3 bulan, ukuran infark dan defisit kognitif
cenderung stabil. Rehabilitasi juga ikut menentukan perbaikan
kognitif pada fase ini (Gottesman R.F. etal., 2010).

2.5.3 Gangguan fungsi kognitif paska stroke


Pemulihan fungsi kognitif paska stroke bervariasi. Penelitian
menunjukkan 83% pasien dengan defisit memori verbal, 78%
pasien dengan gangguan konstruksi visuospasial dan defisit
memori visual membaik dalam waktu 6 bulan, sedangkan domain
kognitif lain kurang menunjukkan perbaikan (Nys G.M.S. etal.,
2005). Penelitian kohort lain menunjukkan gangguan atensi masih

Bab 2 Memahami Stroke Iskemia 55


didapatkan pada 54% pasien setelah 1 tahun, sedangkan defisit
fungsi eksekutif, bahasa, dan memori jangka panjang lebih sedikit
frekuensinya (Lesniak M. etal., 2008).
Penderita stroke dapat mengalami kemunduran kognitif
progresif paska periode akut walaupun tidak terdapat gambaran
klinis stroke iskemia berulang. Pada umumnya, terdapat
komorbiditas pada penderita stroke seperti hipertensi, diabetes
melitus, dislipidemi, yang juga merupakan faktor risiko gangguan
kognitif. Terjadinya stroke yang pertama juga meningkatkan
risiko stroke berikutnya, baik yang menimbulkan manifestasi
klinis maupun tidak (silent brain infarction) (Gottesman R.F. etal.,
2010). Penderita dengan infark multipel di otak secara signifikan
mempunyai kinerja memori, kecepatan pemrosesan, dan fungsi
eksekutif yang lebih buruk (Saczynski J.S. etal., 2009).
Gangguan fungsi kognitif paska stroke dapat merupakan
kelanjutan gangguan fungsi kognitif saat stroke akut, atau akibat
tidak terkendalinya faktor-faktor risiko stroke yang menyebabkan
kelainan pembuluh darah (aterosklerosis, kekakuan arteri,
disfungsi endotel), serta penyakit penyerta yang juga berpengaruh
terhadap fungsi kognitif, seperti misalnya penyakit sistemik,
gangguan organ (jantung, paru-paru, ginjal), penyakit Alzheimer,
Parkinson, dan depresi (Pantoni L. dan Gorelick P., 2011).
Jenis gangguan kognitif yang terjadi dapat berupa gangguan
pada domain kognitif tunggal (atensi, bahasa, memori,
visuospasial, atau fungsi eksekutif), atau gabungan di antaranya.
Gangguan fungsi kognitif pada domain tunggal jarang terjadi,
lebih sering berupa spektrum yang tergolong vascular cognitive
impairment =VCI). VCI sendiri belum dapat didefinisikan secara
jelas. VCI lebih mengacu pada berbagai gangguan kognitif yang
ditimbulkan atau berhubungan dengan penyebab vaskular. Belum
terdapat pembagian VCI secara jelas. Namun umumnya, VCI
diklasifikasikan menjadi 3 subtipe yaitu (Zhao Q.L. etal., 2010):
1. Demensia vaskular,
2. VCI yang tidak memenuhi kriteria demensia (vascular cognitive
impairment, no dementia = VCIND)

56 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


3. Penyakit Alzheimer dengan komponen vaskular
Tabel 2.2 menunjukkan beberapa kunci penting dalam definisi
sub subtipe VCI (Zhao Q.L. etal., 2010 dan PAntoni L & Gorelick P.,
2011). Di antara para ahli belum menghasilkan kesepatan tentang
diagnosis VCI (Zhao dkk (2010) mengusulkan kriteria diagnosis
VCI yang sudah diuji validitas dan reliabilitasnya. Kriteria tersebut
didasarkan pada pedoman harmonisasi dan perkembangan VCI
terbaru (Zhao Q.L. etal., 2010).

Tabel 2.2Kunci-kunci penting dalam diagnosis subtipe VCI


Sub tipe Gambaran klinis
VCIND Gangguan kognitif paling tidak pada 1 domain
Aktivitas sehari-hari tidak terganggu
Tidak termasuk dalam kriteria diagnosis demensia
Kebanyakan individu dengan periode plateau yang panjang
Demensia Demensia
vaskular Gangguan memori ringan
Lebih banyak gangguan dalam fungsi eksekutif
Perjalanan penyakit berfluktuasi, progresif bertahap, dan/
atau stepwise
Campuran Demensia
VCI dan Gangguan utama adalah memori
Alzheimer
Perjalanan penyakit tidak khas (eksaserbasi mendadak,
fluktuasi, atau plateau ringan), mirip Alzheimer
Perburukan gangguan kognitif lebih cepat daripada VCI atau
Alzheimer saja
Sumber: Zhao Q.L etal., 2010)

Berikut ini usulan kriteria diagnosis VCI menurut Zhao, dkk.


(Zhao Q.L etal., 2010).

2.5.3.1 Kriteria diagnosis untuk VCI probable


a. Gangguan kognitif
1. Gangguan kognitif yang diperoleh dari data anamnesis,
manifestasi klinis, dan tes neuropsikologi.

Bab 2 Memahami Stroke Iskemia 57


2. Terdapatnya gangguan kognitif kortikal dan subkortikal,
tapi terutama gangguan frontal dan subkortikal.
3. Gangguan kognitif paling tidak pada 1 domain, atau
disfungsi eksekutif/gangguan memori ditambah 1
tambahan gangguan kognitif lain, dengan distribusi
gangguan yang tidak merata pada tahap awal.
4. Ada/tidaknya gangguan kemampuan sosial dan/atau
aktivitas sehari-hari.
5. Ada/tidaknya gejala neuropsikis atau BPSD (behavioral
and psychological symptoms of dementia) (misalnya:
ansietas, perubahan tidur, depresi, apati, agitasi,
abnormalitas tingkah laku, dan lain lain)
b. Bukti diagnosis klinis penyakit serebrovaskular
Bukti diagnosis klinis penyakit serebrovaskular diperoleh
dari:
1. Terdapatnya gejala dan/atau tanda pemeriksaan
neurologis yang mengindikasikan adanya penyakit
serebrovaskular.
2. Terdapatnya paling tidak satu bukti pemeriksaan
pencitraan neurologis, meliputi CT, CTA, MRI (T1W1,
T2W1, MRA, FLAIR, dan gradient echo), TCD, SPECT.
Infark pembuluh darah besar
Infark lakuner multipel (substansia alba, ganglia
basalis, talamus, kapsula interna, batang otak,
serebelum)
Infark tunggal di tempat strategis (hipokampus, girus
angularis, girus cinguli, talamus, nukleus kaudatus,
globus palidus, dan dasar otak bagian depan)
Perubahan substansia alba akibat vaskular, terutama
yang berlokasi di jaras frontal-subkortikal, khususnya
di substansia alba profunda
Perdarahan intraserebral
Perdarahan subarakhnoid
Hipoperfusi atau hipometabolisme serebral kronis

58 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Terdapatnya atrofi serebral yang berhubungan dengan
vaskular, dengan atrofi bersifat difus atau regional
(misalnya atrofi temporal medial)
Lesi-lesi vaskular yang sulit diidentifikasi
c. Hubungan waktu antara penyakit serebrovaskular/faktor
risiko vaskular dengan gangguan kognitif bersifat pilihan,
manifestasi, atau kesimpulan dari satu atau lebih kondisi
berikut ini.
1. VCI mungkin terjadi sebelum, selama, atau setelah onset
penyakit serebrovaskular, menetap dalam beberapa bulan,
bahkan lebih dari 6 bulan.
2. Onset penyakit serebrovaskuler tiba-tiba atau perlahan,
diikuti oleh perjalanan penyakit yang berfluktuasi,
stepwise, atau progresif bertahap.
3. Terdapatnya bukti laboratorium tentang penyakit
serebrovaskular/faktor risiko vaskular, yang beralasan
dipertimbangkan sebagai etiologi kondisi yang ber
hubungan.
4. Terapi efektif dapat menunda, meningkatkan, bahkan
mengembalikan gejala-gejala kognitif.

2.5.3.2 Gambaran klinis yang mendukung diagnosis VCI


probable
Gambaran klinis yang mungkin mendukung diagnosis VCI
probable antara lain dijelaskan seperti berikut ini.
a. Disfungsi eksekutif (misalnya inisiasi, perencanaan, organisasi,
dan pentahapan)
b. Adanya gambaran awal kelumpuhan pseudobulber, gangguan
gait, tremor, inkontinesia urin, atau kejang.
c. Gangguan kognitif tanpa defisit neurologis fokal, bukti penyakit
serebrovaskuler diperoleh dari CT kepala atau MRI (misalnya
infark tersamar), atau riwayat TIA, atau hanya diperoleh dari
bukti laboratorium mengenai faktor risiko vaskular.

Bab 2 Memahami Stroke Iskemia 59


2.5.3.3 Gambaran klinis yang mendukung diagnosis VCI
possible
Dengan eksklusi penyebab lain seperti depresi, delirium, dan
gangguan kognitif, gambaran klinis yang mungkin mendukung
diagnosis VCI possible meliputi:
a. Terdapatnya gangguan kognitif dan tanda defisit neurologis
fokal, namun tanpa penemuan penyakit serebrovaskular pada
pencitraan neurologis.
b. Terdapatnya gangguan kognitif, namun tanpa gejala dan tanda
defisit neurologis fokal. Demikan juga pencitraan neurologis,
hanya terdapat bukti laboratorium tentang faktor risiko
vaskular.
c. Terdapatnya probable VCI dalam jangka pendek, tidak lebih
dari satu bulan.

2.5.3.4 VCI definite


VCI diperkirakan definite jika didapatkan:
a. Bukti klinis penyakit sesuai dengan usulan kriteria diagnosis
VCI probable.
b. Bukti histopatologis penyakit berdasarkan biopsi atau
penemuan post mortem:
1. Tipe murni: dibutuhkan bukti histopatologis tentang jejas
serebrovaskular saja; atau
2. Tipe campuran: dibutuhkan bukti histopatologis kekusutan
neurofibril dan plak senilis, serta jejas serebrovaskular.

2.6 Faktor yang Mempengaruhi Fungsi Kognitif


Paska Stroke Iskemia
Faktor-faktor yang mempengaruhi fungsi kognitif paska stroke
iskemia dapat dikelompokkan menjadi faktor demografis, faktor
risiko aterosklerosis, faktor yang berhubungan dengan stroke, dan
faktor genetika (Gottesman R.F. etal., 2010).

60 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


2.6.1 Faktor demografis yang mempengaruhi fungsi
kognitif paska stroke iskemia
2.6.1.1 Usia dan jenis kelamin
Usia merupakan faktor risiko yang mendasar pada demensia
vaskular. Usia tua merupakan faktor prediktor penting keluaran
fungsional dan kognitif stroke periode kronik (Hartono B., 2002).
Usia lebih dari 70 tahun lebih berisiko mendapatkan gangguan
kognitif. Setiap pertambahan 5 tahun berisiko 1,5 kali terkena
MCI (mild cognitive impairment) (Gorelick P.B., 2004; Astuti, 2006;
Rahmawati D., 2006).

Tabel 2.3Faktor risiko yang sama pada penyakit Alzheimer dan VCI
No. Faktor Risiko Efek
1 Usia Berdampak pada pembuluh darah besar
dan kecil
Akumulasi amiloid beta meningkat
2 Diabetes Menimbulkan aterosklerosis
Berhubungan dengan Alzheimer melalui
gangguan insulin, insulin growth factor dan
resistensi insulin perifer dengan produksi
ceramid sitotoksik berlebihan
3 Peningkatan kolesterol Aterosklerosis
dan LDL serum Produksi amiloid beta enzimatik
4 Homosisteinemia Aterosklerosis
Dapat meningkatkan pembentukan amiloid
beta serebrovaskular
5 Genotip Apoliprotein Alzheimer lebih awal
6 Merokok Status merokok berhubungan dengan
insiden demensia dan Alzheimer, namun
kurang jelas efeknya terhadap demensia
vaskular
7 Obesitas Aterosklerosis
8 Angiopati amiloid CAA berhubungan dengan disfungsi
serebral (CAA) vaskular dan meningkatkan risiko stroke
CAA merupakan abnormalitas yang sering
terjadi pada Alzheimer
Sumber: Nadeau Y., Black S.E., 2010

Bab 2 Memahami Stroke Iskemia 61


Proses menua pada susunan saraf pusat ditandai dengan
degenerasi neuron diikuti dengan gliosis. Berkurangnya neuron
tidak sama pada bagian-bagian otak, lobus frontalis dan temporalis
mengalami pengurangan yang lebih besar dibanding bagian otak
yang lain. Runtuhnya neuron diikuti juga dengan keruntuhan
dendrit. Terjadi pula pembentukan plak neuritik dan kekusutan
neurofibril, walaupun tidak sebanyak yang ditemukan pada
penyakit Alzheimer (Rahmawati D., 2006).
Perempuan lebih cenderung terkena stroke kardioemboli,
sedangkan laki-laki cenderung terkena stroke lakuner, sehingga
gangguan kognitif paska stroke lebih banyak pada perempuan.
Perempuan juga mendapat stroke pada usia yang lebih tua,
sehingga mungkin sudah terdapat gangguan kognitif sebelum
stroke (Gottesman R.F. etal., 2010).

2.6.1.2 Pendidikan
Beberapa penelitian menyimpulkan bahwa status pendidikan
yang rendah sebelum stroke (di bawah tingkat SMA) merupakan
faktor prediktor yang independen terhadap kejadian VCIND
(OR=3,5) dan demensia (OR=8,7) dalam 1 tahun paska stroke
(Rasquin S.M.C. etal., 2004; Ivan C.S. et al, 2004).

2.6.2 Faktor risiko aterosklerosis


Hipertensi, diabetes melitus, dan hiperlipidemia merupakan
faktor risiko aterosklerosis sekaligus demensia vaskular. Plak
aterosklerotik yang terbentuk dapat menyebabkan penyakit
serebrovaskular melalui proses kalsifikasi, ruptur atau ulserasi,
perdarahan, fragmentasi, kelemahan dinding pembuluh darah
dan aneurisma, atau kombinasinya. Plak yang terbentuk di arteri
karotis atau arteri serebral dapat menurunkan atau membuat
oklusi aliran darah ke otak sehingga meningkatkan kecenderungan
disfungsi kognitif dan gangguan lain (Everson S.A. etal., 2001).

62 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


2.6.2.1 Hipertensi
Penelitian menunjukkan bahwa hipertensi merupakan faktor
risiko independen terhadap gangguan fungsi kognitif, baik dengan
maupun tanpa riwayat stroke sebelumnya. Tekanan darah tinggi
pada usia pertengahan (40-64 tahun) merupakan faktor risiko
terjadinya kemunduran kognitif pada usia lanjut (Rahmawati
D., 2006). Tekanan darah sistolik yang tinggi (>180 mmHg) pada
lanjut usia merupakan faktor risiko demensia (Rahmawati D, 2006;
Hartono B., 2002). Hipertensi secara signifikan menimbulkan
aterosklerosis yang ditunjukkan melalui penebalan tunika
intima media arteri karotis, sekaligus gangguan fungsi kognitif
yang ditunjukkan melalui pemeriksaan MMSE (mini mental
state examination), kecepatan pemrosesan informasi dan fungsi
eksekutif (Marshall R.S. etal., 2011). Hipertensi juga berhubungan
dengan lesi substansia alba yang lebih besar, volume otak yang
lebih kecil, infark kortikal atau subkortikal tersembunyi atau di
tempat strategis, dan hilangnya volume otak di bagian talamus
atau lobus temporal yang penting dalam proses kognitif (Gorelick
P.B. 2004).
Terapi antihipertensi dapat menurunkan risiko demensia
dan memperlambat progresifitas dengan memperbaiki perfusi
serebral lokal dan menghambat angiogenesis sel endotel otak
(RahmawatiD., 2006).

2.6.2.2 Diabetes melitus


Diabetes secara independen berhubungan dengan penurunan
fungsi kognitif maupun peningkatan insiden demensia. Domain
kognitif yang terganggu terutama pada memori verbal dan
kecepatan pemrosesan informasi. Mekanisme gangguan kognitif
pada diabetes kemungkinan akibat hiperglikemia, gangguan
toleransi glukosa, dan episode hipoglikemia, atau gabungan
diantaranya (Kumar R. etal., 2009).
Diabetes menyebabkan aterosklerosis melalui komplikasi
mikroangiopati diabetika berupa disfungsi endotel, reaksi
inflamasi, oksidasi, dan glikasi berlebihan, peningkatan agregasi

Bab 2 Memahami Stroke Iskemia 63


trombosit dan gangguan fibrinolisis. Disregulasi insulin juga
berperan dengan hasil peningkatan inflamasi, stres oksidatif,
peningkatan produk glikasi akhir, penurunan kemampuan
pemulihan neuron dan neurogenesis.
Insulin juga dapat meningkatkan pelepasan A intrasel pada
kultur neuron, dan akumulasi A intrasel sudah dibuktikan sebagai
faktor penting pada patogenesis penyakit Alzheimer. Penemuan ini
mengindikasikan bahwa diabetes, melalui proses neurodegenerasi
dari disfungsi metabolisme, menghasilkan jejas neuron langsung
yang tampak sebagai atrofi otak, sebagai dasar patologi demensia
(Rahmawati D., 2006; Kumar R., etal., 2009).

2.6.2.3 Hiperlipidemia
Peningkatan kolesterol pada usia pertengahan kehidupan
berhubungan kuat dengan risiko demensia Alzheimer (DA)
maupun vaskular (DVa) pada tiga dekade kemudian. Rasio Hazard
(RH) untuk DA 1,23 pada kadar kolesterol tingkat borderline (200-
239 mg/dL) saat pertengahan usia, dan 1,57 untuk kadar kolesterol
tinggi (240 mg/dL). RH DVa 1,50 untuk kolesterol borderline dan
1,26 untuk kolesterol tinggi. Peningkatan HDL dan penurunan LDL
serta kolesterol total meningkatkan fungsi kognitif, sedangkan
kadar trigliserida tidak terlihat pengaruhnya pada fungsi kognitif
(Rahmawati D., 2006; Di Legge S. etal., 2010).

2.6.2.4 Merokok dan konsumsi alkohol


Penelitian menunjukkan bahwa merokok pada usia per
tengahan berhubungan dengan kejadian gangguan fungsi
kognitif pada usia lanjut, sedangkan status masih merokok
dihubungkan dengan peningkatan insiden demensia dan DA.
Konsumsi alkohol pada tingat ringan sampai sedang pada lanjut
usia menurunkan risiko demensia, namun pada pecandu alkohol
berat menyebabkan kerusakan otak berupa reduksi parenkim otak
(RahmawatiD.,2006).

64 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


2.7 Faktor yang Berkaitan dengan Stroke
Iskemia
Beberapa faktor yang berkaitan dengan stroke iskemia akan
dijelaskan berikut ini.

2.7.1 Volume, letak, dan lokasi infark


Seperti yang sudah dijelaskan sebelumnya, infark pada lokasi
strategis di regio spesifik menyebabkan gangguan fungsi kognitif.
Infark pada talamus, nukleus kaudatus, genu kapsula interna, girus
angularis, hipokampus, lobus frontal menghasilkan gangguan
fungsi kognitif yang cukup menonjol (Rahmawati D., 2006). Hasil
penelitian juga menunjukkan bahwa infark di lebih satu lokasi
dan jumlahnya lebih dari 1 berhubungan dengan kinerja memori,
kecepatan, pemrosesan data, dan fungsi eksekutif yang lebih buruk
(Lesniak M. etal., 2008).

2.7.2 Kelainan pada substansia alba (white matter


lession)
Beberapa penelitian menunjukkan bahwa peningkatan lesi di
substansia alba berhubungan dengan gangguan kognitif. Namun,
belum diketahui seberapa besar efek dan domain kognitif apa
yang terkena. Kecepatan pemrosesan dan atensi merupakan
domain kognitif yang paling sering terganggu. Lesi di substansia
alba secara fisiologis meningkat seiring peningkatan usia dan
diperkirakan faktor vaskular berperan dengan adanya proses
inflamasi di dinding arteri.
Lesi di substansia alba menggambarkan area demielinisasi
luas, sel-sel inflamasi di sekitar pembuluh darah yang rusak, serta
infark lakuner (Baune B.T., 2009).
Terdapatnya lesi di substansia alba mengurangi kapasitas
kompensasi otak paska stroke. Kombinasi infark lakuner dan lesi
luas di substansia alba merupakan faktor prediktor buruknya
keluaran fungsi kognitif (Baune B.T., 2009). Pada sebuah penelitian

Bab 2 Memahami Stroke Iskemia 65


menunjukkan bahwa tiap peningkatan volume lesi substansia alba
1 mL/tahun akan meningkatkan gangguan kognitif sebesar 94%
(Silbert L.C. etal., 2009).

2.7.3 Infark serebral tersembunyi


Infark serebral tersembunyi didefinisikan sebagai area
hipodens pada CT scan sesuai dengan gambaran infark
tanpa riwayat stroke (yang didapatkan dari autoanamnesis,
alloanamnesis, atau sumber informasi lain). Infark serebral
biasanya disebabkan oleh infark lakuner, yaitu infark dengan
ukuran kecil (<2cm) di mana manifestasi klinis neurologis
tidak sampai mengganggu aktivitas pasien sehingga pasien tidak
berobat. Namun, secara kebetulan infark ditemukan saat episode
stroke selanjutnya atau saat pasien periksa CT scan karena
penyakit lain.
Hasil penelitian menunjukkan bahwa kondisi lanjut usia
dengan infark serebral tersembunyi mengalami peningkatan risiko
demensia dan penurunan fungsi kognitif yang lebih progresif
(Gorelick P.B., 2004; Vermeer S.E. etal., 2003). Diperkirakan infark
memicu pembentukan plak senilis dan kekusutan neurofibril
yang mencerminkan dampak faktor risiko vaskular terhadap
vulnerabilitas otak. Penurunan fungsi kognitif bersifat stepwise
mungkin mencerminkan episode infark tersembunyi berulang di
otak (Vermeer S.E. etal., 2003).

2.7.4 Atrofi serebral


Atrofi serebral merupakan faktor yang berperan pada
demensia paska stroke, baik secara independen maupun bersama
faktor-faktor lain. Atrofi serebral yang terjadi secara menyeluruh
menggambarkan hipoperfusi serebral. Sementara itu, atrofi di
bagian tertentu disebabkan oleh gangguan mikrovaskuler lokal,
seperti di hipokampus, korteks entorhinal, dan temporal mesial
yang berhubungan dengan penurunan fungsi kognitif, terutama
pada penyakit Alzheimer. Hal ini diperkirakan karena struktur otak

66 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


tersebut berperan penting dalam fungsi kognitif terutamamemori
(Gorelick P.B., 2004; Marshall R.S. etal., 2011; Baune B.T., 2009).
Seperti yang sudah dijelaskan, atrofi serebral yang didapatkan
pada diabetes melitus secara signifikan berkorelasi dengan
gangguan fungsi kognitif (Kumar R. etal., 2009).

2.8 Leukosit Neutrofil pada Stroke Iskemia


2.8.1 Leukosit
Diduga bahwa sel asal pluripotensial setelah sejumlah
pembelahan sel dan langkah diferensiasi, menjadi urutan sel
progenitor untuk tiga jalur sel sumsum tulang utama yaitu eritroid,
granulosit dan monositik serta megakariosit, sebagaimana sel asal
limfoid. Walaupun penampilan sel asal pluripotensial mungkin
serupa dengan limfosit kecil atau sedang, kehadirannya dapat
ditunjukkan dengan teknik kultur.
Keberadaan sel progenitor terpisah untuk tiga garis sel
tersebut juga telah diperlihatkan oleh teknik biakan di luar tubuh
(in-vitro). Prekursor mieloid yang paling dini dideteksi membentuk
granulosit, eritroblas, monosit dan megakariosit dan diberi
istilah CFU GEMM (CFU = colony forming unit in culture medium).
Progenitor yang lebih matang dan khusus dinamakan CFUGM
(granulosit dan monosit), CFUEo (eosinofil), CFUe (eritroid)
dan CFUmeg (megakariosit), BFUe (burst forming unit, eritrosit)
merupakan progenitor eritroid yang lebih dini daripada CFUe.
Sel asal (stem cell) juga memiliki kemampuan untuk mem
perbarui diri kembali sehingga walaupun sumsum tulang adalah
tempat utama produksi sel baru, jumlah sel keseluruhan tetap
konstan pada keadaan seimbang dan normal. Akan tetapi, sel
prekursor sanggup memberi respons terhadap berbagai rangsang
dan pesan hormonal dengan meningkatnya satu atau lain garis sel
bila kebutuhan meningkat (Abbas A.K. etal., 2003).

Bab 2 Memahami Stroke Iskemia 67


Sel asal (stem cell)
memperbarui diri kembali

Progenitor Progenitor
mieloid Limfoid

Sel asal
pluripotensial Timus

Sel Natural
Killer (NK)
Limfosit B
Limfosit T

Eritroid CFU Megakariosit Basofil CFU Eosinofil CFU Granulosit-monosit CFU

Eritrosit Platelet Basofil Eosinofil Netrofil Monosit


Sumber: Sacher R.dan McPherson. 2004

Gambar 2.6Gambaran diagramatis sel asal sumsum tulang

Tiga perempat dari sel-sel yang berinti di sumsum


tulang memproduksi leukosit. Stem sel ini berproliferasi dan
berdiferensiasi menjadi granulosit (neutrofil, eosinofil, dan
basofil), monosit dan limfosit, yang bersama terdiri atas absolut
hitung leukosit (Abbas A.K. etal., 2003).
Pematangan sel leukosit di sumsum tulang dan pelepasan
ke sirkulasi dipengaruhi oleh berbagai faktor interleukin, faktor
nekrosis tumor (TNF) dan beberapa komponen pelengkap. Kira-
kira 90% dari leukosit berada di penyimpanannya di sumsum
tulang, 2-3% di sirkulasi dan 7-8% berlokasi di jaringan.
Di dalam sumsum tulang sel-sel digolongkan menjadi
dua kelompok yaitu satu kelompok adalah proses sintesa dan
pematangan DNA, sedangkan kelompok yang lain pada fase
penyimpanan yang menunggu pelepasan ke dalam sirkulasi.
Sel-sel dalam penyimpanan ini secara cepat dapat merespons

68 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


berdasarkan kebutuhan untuk meningkatkan leukosit sampai
2-3 kali lipat leukosit di sirkulasi dalam waktu 4-5 jam (Abbas
A.K. etal., 2004; Gusev E. dan Skorsova I., 2003). Setelah terjadi
kematian sel, leukosit dilepaskan dalam sirkulasi dan jaringan,
yang memerlukan waktu hanya beberapa jam (3-6 jam).
Jenis leukosit yang dikerahkan pada peradangan akut ini
adalah PMN (neutrofil). Migrasi leukosit paling banyak terjadi
pada 24-72 jam setelah awitan iskemia kemudian menurun
sampai hari ke-7 (Harms H. etal., 2010). Perkiraan lama hidup
leukosit adalah 11-16 hari, termasuk pematangan di sumsum
tulang dan penyimpanannya yang merupakan sebagian besar masa
kehidupannya. Penyebab peningkatan jumlah leukosit didasari
oleh dua penyebab dasaryaitu:
a. Reaksi yang tepat dari sumsum tulang normal terhadap
stimulasi eksternal, misalnya infeksi, inflamasi (nekrosis
jaringan, infark, luka bakar, artritis), stres (over exercise,
kejang, kecemasan, anastesi), obat (kortikosteroid, lithium,
agonis), trauma (splenektomi), anemia hemolitik, leukomoid
maligna.
b. Efek dari kelainan sumsum tulang primer (leukemia akut,
leukemia kronis, kelainan mieloproliferatif) (Gusev E. dan
Skorsova I., 2003).

2.8.2 Neutrofil
Neutrofil merupakan salah satu jenis sel granulosit yang
memiliki diameter 12-15 m dengan inti padat khas yang terdiri
atas dua sampai lima lobus dan sitoplasma yang pucat dengan
garis batas tidak beraturan, mengandung banyak granula merah
muda-biru (azurofilik) atau merah lembayung 34,92 (Abbas A.K.
etal., 2003; Chou W. etal., 2004). Produksi neutrofil distimulasi
oleh granulocyte colony-stimulating factor. Pada orang dewasa
produksi neutrofil lebih dari 1 1011 per hari (Sacher R. dan
Mcpherson),2004).
Neutrofil mengandung tiga tipe granula yang berbeda yaitu:
a. Granula primer/azurophilic yang terbentuk awal saat stadium
premielosit. Granula primer mengandung mieloperoksidase,

Bab 2 Memahami Stroke Iskemia 69


arginine-rich basic protein, mukopolisakarida sulfa, fosfatase
asam, muramidase (lisozim).
b. Granula sekunder/spesifik yang terbentuk setelah saat
stadium mielosit dan mengandung lisozim, laktoferin,
fosfatase asam, aminopeptidase.
c. Granula gelatinase terbentuk saat akhir stadium metamielosit.

Sumber: Wood P.L., 2009


Gambar 2.7Dua buah inti batang netrofil dan dua buah inti segmen neutrofil

Tabel 2.4Granula neutrofil manusia


Jenis Protein Granula Azurofilik Granula Spesifik Granula Gelatinase
Protein Terlarut Gelatinase
Protein Lisozim
mikrobisidal Mieloperoksidase
Lisozim
Defensins
Enzim lain Asam hidrolase Kolagenase
lisosom Gelatinase
Elastase
Cathepsin G
Proteinase 3
Azurocidin
Protein lain Laktoferin
2-mikroglobulin
Vitamin B12-
binding protein
Protein Complement Complement
Membran proteins (CR3) proteins (CR1)
Reseptor untuk: Kemokin Imunoglobin
N-formyl peptides (Fc RIII)
Laminin
Vitronektin
Protein lain CD63 Mac-1 (CD11b/ Mac-1 (CD11b /
CD18) CD18)
Sumber: Wood P.L., 2009

70 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Prekursor neutrofil secara normal tidak tampak dalam darah tepi
normal, tetapi terdapat dalam sumsum tulang. Prekursor paling awal
yang dapat dikenali adalah mieloblas yaitu suatu sel dalam berbagai
ukuran dengan inti yang besar berkromatin halus dan biasanya
memiliki dua sampai lima anak inti (nucleolus). Sitoplasmanya bersifat
basofilik dan tidak terdapat granula sitoplasma. Sumsum tulang
normal mengandung sampai 4% mieloblas. Melalui pembelahan sel,
mieloblas menghasilkan promielosit yang berukuran sedikit lebih
besar dan telah membentuk granula primer dalam sitoplasmanya.
Kromatin inti sekarang lebih padat dan anak inti tidak terlihat.
Bentuk neutrofil antara metamielosit dan neutrofil yang benar-benar
matang disebut batang (band, stab) atau neutrofil muda (juvenile).
Sel-sel ini dapat ditemukan dalam darah tepi normal. Neutrofil
batang tidak mengandung pemisahan berupa filamen tipis yang jelas
antara lobus-lobus inti seperti yang tampak pada neutrofil matang
(Wood P.L., 2009).
Granula sitoplasma neutrofil bereaksi dengan pewarna basa
dan asam menghasilkan granula netral atau ungu muda pada
pewarnaan yang paling sering digunakan yaitu Wright-Giemsa. Pada
sel yang matang, nukleokromatin memadat menjadi gumpalan
atau lobus diskret yang dihubungkan oleh semacam benang tipis.
Sel-sel ini disebut leukosit polimorfonukleus karena gumpalan-
gumpalan inti yang berikatan secara fleksibel ini dapat mengambil
sedemikian banyak (poli-) dan bentuk (morf). Singkatan untuk
deskripsi polisilabik yang sering digunakan adalah PMN dan poli.
Nilai neutrofil 2,5-7,5 109/L (dewasa) neonatus 10,0-25,0 109/L.
Neutrofil merupakan populasi terbanyak pada sirkulasi sel darah
putih dan menjadi perantara fase yang paling awal dari respons
inflamasi (Abbas A.K. etal., 2003).
Neutrofil aktif bergerak dan sebagian besar dapat berkumpul di
tempat jaringan cedera dalam waktu singkat. Neutrofil merupakan lini
pertama pertahanan tubuh apabila jaringan rusak atau benda asing
masuk ke dalam tubuh. Fungsi sel-sel ini berkaitan erat dengan fungsi
sistem pertahanan tubuh yang lain, termasuk pembentukan antibodi
(imunoglobulin) dan pengaktifan sistem komplemen. Interaksi
sistem-sistem ini dengan neutrofil meningkatkan kemampuan sel ini
melakukan fagositosis dan menguraikan beragam partikel. Neutrofil

Bab 2 Memahami Stroke Iskemia 71


mampu mengeluarkan enzim ke dalam sitoplasmanya sendiri untuk
menghancurkan bahan yang tertelan atau difagositosis dan neutrofil
juga dapat mengeluarkan enzim-enzim ke lingkungansekitarnya.
Neutrofil-neutrofil yang keluar dari sumsum tulang mendekatkan
dirinya ke pembuluh darah (neutrofil yang mengalami marginalisasi)
atau tetap berada di dalam sirkulasi. Neutrofil marginal inilah yang
mungkin keluar ke jaringan yang diperlukan. Dalam keadaan normal,
kecepatan sel-sel baru memasuki darah dari sumsum tulang setara
dengan kecepatan sel keluar ke jaringan. Keluarnya neutrofil dari
sirkulasi bersifat acak dan neutrofil matang tetap berada di dalam
aliran darah selama sekitar 7 sampai 10 jam sebelum keluar ke
jaringan atau rongga tubuh. Dalam sirkulasi, neutrofil digolongkan ke
dalam dua pool. Satu pool di sirkulasi bebas dan yang kedua adalah
pool di tepi dinding pembuluh darah. Ketika ada stimulasi oleh
infeksi, inflamasi, obat atau toksin metabolik pool sel yang di tepi
akan melepaskan diri ke dalam sirkulasi (Gusev E. dan Skorsova I.,
2003; Chou W. etal., 2004).
Fungsi normal neutrofil antara lain sebagai berikut.
1. Kemotaksis (mobilisasi dan migrasi sel). Fagosit tertarik ke
bakteri atau lokasi inflamasi oleh zat kemotaktik yang dilepaskan
dari jaringan yang rusak atau oleh komponen komplemen dan
juga oleh interaksi molekul.
2. Fagositosis. Bahan asing (bakteri, jamur, dan lainnya) atau
pejamu yang mati atau rusak difagositosis. Fagosit, termasuk
neutrofil dan makrofag merupakan sel dengan fungsi utama
yaitu untuk mengidentifikasi, mencerna, dan menghancurkan
mikroba (Sacher R. dan McPherson, 2004). Pengenalan partikel
asing dibantu oleh opsonisasi dengan imunoglobulin atau
komplemen karena neutrofil maupun monosit mempunyai
reseptor untuk fragmen imunoglobulin Fc dan C3b. Opsonisasi
sel tubuh normal (misal eritrosit atau trombosit) juga membuat
sel tersebut dapat dirusak oleh makrofag sistem retikuloepitelial,
seperti pada hemolisis autoimun, purpura trombositopenik
idiopatik (autoimun) atau sitoplasma yang diinduksi obat.
Makrofag mempunyai suatu peran sentral dalam presentasi
antigen memproses dan mempresentasikan antigen asing

72 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


di molekul antigen leukosit manusia (HLA) ke sistem imun.
Makrofag juga menyekresi sejumlah besar faktor pertumbuhan
yang mengatur respons inflamasi dan respons imun. Neutrofil
juga dapat mematikan sel-sel yang terikat antibodi melalui
suatu proses yang disebut antibody-dependent cellular toxicity
(ADCC). Manfaat neutrofil yang telah terbukti adalah mencegah
invasi oleh mikroorganisme patogen, serta melokalisasi dan
mematikan patogen-patogen tersebut apabila terjadi invasi.
3. Kemokin adalah sitokin kemotaktik yang terdiri atas dua
kelas utama- kemokin CXC yaitu sitokin pro inflamasi kecil
(8-10000 MW) yang terutama bekerja pada neutrofil dan
kemokin CCseperti protein inflamasi makrofag (macrophage
inflammatory protein = MIP)-1 dan RANTES yang bekerja pada
monosit, basofil, eosinofil dan sel natural killer. Kemokin dapat
dihasilkan secara konsitutif mengatur aktivitas limfosit pada
kondisi fisiologi kemokin inflamatorik diinduksi dan diregulasi
terjadi peningkatan akibat rangsangan inflamasi. Kemokin
berikatan dengan dan mengaktifkan sel melalui reseptor
kemokin dan berperan penting dalam merekrut sel yang sesuai
ke lokasi inflamasi.
4. Membunuh dan mencerna. Ini terjadi melalui jalur dan
bergantung atau tidak bergantung pada oksigen. Pada reaksi
bergantung oksigen, superoksida (O2) hidrogen peroksida
(H2O2) dan spesies oksigen (O2) teraktivasi lainnya dihasilkan
dari O2 dan nikotinamida adenin dinukleotida fosfat
tereduksi (NADPH). Dalam neutrofil H2O2 bereaksi dengan
mieloperoksidase dan halida intraseluler untuk membunuh
bakteri, mungkin juga terdapat keterlibatan oksigen teraktivasi.
Mekanisme mikrobisidal non oksidatif melibatkan penurunan
pH dalam vakuol fagosit tempat dilepaskannya enzim lisosom.
Faktor tambahan yaitu laktoferin, suatu protein pengikat besi
yang terdapat dalam granula neutrofil bersifat bakteriostatik
dengan cara mengambil besi dari bakteri (CraigA. etal., 2009;
Chou W. etal., 2004).

Bab 2 Memahami Stroke Iskemia 73


2.9 Peranan Inflamasi pada Stroke Iskemia
Stoll dkk. (1998) melaporkan bahwa iskemia otak juga akan
diikuti respon inflamasi hebat yang melibatkan infiltrasi granulosit,
limfosit T, dan makrofag pada area iskemia dan daerah sekelilingnya.
Pada daerah pusat infark, sel mikroglia yang merupakan komponen
sel imun intrinsik, mati mulai jam ke-4 setelah iskemia. Komponen
sel imun ekstrinsik bermigrasi dari pembuluh darah masuk ke
daerah infark. Komponen ekstrinsik tersebut berupa neutrofil
yang menginfiltrasi pusat infark pada hari 1-3 dan makrofag yang
akan memenuhi seluruh lesi pada 3-14 hari setelahnya (Sherki Y.G.
etal.,2002).
Pengerahan leukosit ke jaringan otak pada pasien stroke iskemia
akut merupakan salah satu hasil dari reaksi iskemia SSP. Leukosit
muncul setelah terjadi pelepasan sitokin pada daerah iskemia yang
merangsang leukosit yang berada di marginal pool dan leukosit
mature di sumsum tulang untuk memasuki sirkulasi. Masuknya
leukosit ke otak yang mengalami iskemia dimulai dengan adesi ke
endotel sampai di jaringan otak melalui beberapa tahap yaitu migrasi
leukosit dari darah ke otak dimulai dengan interaksi leukosit-endotel
dengan rolling yang diperantarai oleh P-selektin dan E-selektin pada
permukaan endotel, dan L-selektin pada leukosit.
Sejak aktivasi ini, leukosit melekat pada tepi endotel melalui
reseptor glikoprotein dinding leukosit (disebut sebagai CD-18 atau
b2-integrin) dan ligand dari endotel, ICAM-1 (Harms H. etal., 2010;
Prass K. etal., 2003; Baird E. etal., 2001; Feign V., 2006; Warlow C.P.
etal., 1996).
Membran leukosit yang terdiri dari glikoprotein kompleks
yang bertanggung jawab terhadap perlekatan ini disebut CD-18
(b2-integrin). Kompleks ini terdiri dari 3 heterodimers, ketiganya
mempunyai unit beta yang sama (sering kali disebut sebagai CD18)
dan yang membedakan satu dengan lainnya adalah subunit . Tiga
subunit ini (LFA-1 atau CD-11a, ada pada semua leukosit), MAC1
(CD-11b, ada pada kebanyakan PMN dan monosit), dan P150
(CD11c, ada pada neutrofil dan monosit) (Harms H. etal., 2010;
FeignV., 2006; Warlow C.P. etal., 1996).

74 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Reseptor-reseptor yang sesuai untuk CD18 integrin complex
adalah golongan molekul adesi seperti ICAM. ICAM-1 secara luas
terdapat pada banyak sel dan berikatan dengan LFA-1 dan MAC1,
ICAM-2 hanya terdapat pada sel endotel dan leukosit dan hanya
berikatan dengan LFA-1 saja. Tidak seperti ICAM-2 yang ada pada
keadaan normal, ICAM-1 muncul dengan adanya induksi oleh sitokin
peradangan seperti IL-1 dan TNF. Seperti yang telah dijelaskan
bahwa CD-18/ICAM-1 merangsang peningkatan adesi neutrofil
setelah stroke (Harms H. etal., 2010; Feign V., 2006; Warlow C.P.
etal.,1996).

Aktivasi integrin Adhesi


Rolling oleh kemotosin stabil Migrasi ke endotelium

Integrin (Low-affinity state)


Selectin ligand

Leukosit Integrin (High-affinity state)

Selectin

Proteoglikan Integrin ligand Kemokin

Sitokin Makrofag dengan


(CNF, IL-1) mikroba Fibrin dan fibronektin
(matriks ekstraselular)

Rolling L-Selektin Dinding


Shredding of L-Selektin pembuluh darah

Adesi Diapedesis
Neutrofil
Integrin
E-Selektin

Sialy l-Lewisx

Zat aktif dilepaskan oleh


bateri dan jaringan rusak LI-1 dan TNF-

C3a C5a, kemokin,


histamin,
prostagladin, dan
leukotrinin
Fagositosis dan
pengrusakan bakteri C3b

Sumber: Harms H. et al., 2010


Gambar 2.8Pengerahan leukosit ke jaringan otak

Bab 2 Memahami Stroke Iskemia 75


Kato dkk. (1996) melaporkan bahwa pada tepi lesi infark,
dalam 4-7 hari terjadi pengaktifan mikroglia yang memperlihatkan
perubahan morfologi sebelum terjadi infiltrasi neutrofil dan
limfosit T, sedangkan infiltrasi makrofag baru terjadi kemudian.
Wood (1995) mengatakan bahwa inflamasi dihubungkan dengan
pembersihan debris dan proses perbaikan. Mikroglia yang aktif
mengalami transformasi menjadi fagosit dan bersama makrofag
membatasi infark dan memfagositosis debris.
Pada serangan stroke, leukosit teraktifasi dan menyebabkan
inflamasi. Aktivasi ini akan meningkatkan adesi leukosit ke endotel
dan selanjutnya migrasi ke dalam parenkim otak. Efek leukosit
dalam patogenesis kerusakan iskemia serebral dapat terjadi
dengan cara sebagai berikut (Harms H. etal., 2010; Pras K. etal.,
2003; NagatomiR., 2006; Kustiowati E. etal., 2008; Muller M.P.
etal., 2005; alGwaizL.A. etal., 2007).
1. Plugging mikrovaskular serebral dan pelepasan mediator
vasokonstriksi endotel sehingga memperberat penurunan
aliran darah.
2. Eksaserbasi kerusakan blood brain barrier dan parenkim
melalui pelepasan enzim hidrolitik, proteolitik, produksi
radikal bebas dan lipid peroksidase. Reaksi inflamatoris
ini tidak hanya berperan pada peroksidasi membran lipid,
namun juga memperburuk derajat dari kerusakan jaringan
yang disebabkan oleh efek-efek rheologis dari leukosit-
leukosit yang lengket dalam darah, yang mengganggu perfusi
mikrovaskular. Kerusakan juga bertambah karena produk-
produk neurotoksikleukosit (Warlow C.P. etal., 1996; Feign V.
2006; Vincent J.L., 2006).

2.10 Peranan Sitokin pada Stroke Iskemia


Sitokin sebagai mediator peptida molekuler merupakan
protein atau glikoprotein yang dikeluarkan oleh suatu sel dan
mempengaruhi sel lain dalam suatu proses inflamasi. Respon
inflamasi yang timbul segera setelah stroke iskemia juga
melibatkan berbagai sitokin utamanya yaitu sitokin pro-inflamasi
yaitu IL-1, IL-6, IL-8 , TNF (Feign V. 2006; Vincent J.L., 2006).

76 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Pada stroke iskemia akut, pada umumnya didapati peningkatan
sitokin proinflamasi seperti IL-1 dan TNF, sedangkan sitokin anti
inflamasi tidak berubah seperti IL4 atau justru malah menurun
seperti TGF-1 (Vincent J.L. 2006). Sitokin-sitokin seperti misalnya
TNF dan IL-1 bertanggung jawab untuk akumulasi dari sel-
sel inflamasi dalam otak yang mengalami kerusakan dan dapat
mempengaruhi kelangsungan hidup dari neuron-neuron yang
rusak. Selama iskemia, sitokin-sitokin menarik leukosit-leukosit
serta menstimulasi produksi dari reseptor-reseptor adesi pada
leukosit dan sel-sel endotelial (Feign V., 2006).
Sitokin proinflamasi seperti TNF dan IL-1 mengalami
peningkatan ekspresi dalam beberapa jam setelah terjadi
lesi iskemia. TNF terekspresikan pada neuron pada pusat
iskemia dan penumbra segera setelah iskemia dan setelahnya
sitokin ini ditemukan juga pada makrofag pada jaringan infark
(FeignV.,2006).
Zaremba (2000) melaporkan bahwa sitokin memberikan
kontribusi terhadap perluasan infark pada periode post-
iskemia, baik secara langsung maupun melalui induksi mediator
neurotoksik seperti NO, TNF juga memberikan kontribusi pada
kematian neuron dengan keterlibatannya dalam proses apoptosis
(Sherki Y.G. etal., 2002).

2.11 Penumbra Iskemia


Loftus dan Biller (1994) mengatakan bahwa penumbra
iskemia adalah keadaan iskemia otak di mana neuron-neuron
secara fungsional tidak melakukan aktifitas, namun secara
struktural masih intak dan masih bisa diselamatkan. Hakim A.
(1998) mengatakan bahwa penumbra adalah bagian jaringan otak
yang membatasi daerah yang mati dan daerah yang masih cukup
mendapat aliran darah sehingga dapat berkomunikasi normal.
Jadi, penumbra iskemia merupakan daerah jaringan otak yang
mengalami iskemia sedemikian sehingga masih cukup energi
untuk hidup dalam waktu pendek, tetapi sudah tidak cukup untuk
melakukan fungsi dan komunikasi. Umur harapan hidup penumbra
adalah pendek (Prass K. etal., 2006; Cobelens P.M. etal., 2010).

Bab 2 Memahami Stroke Iskemia 77


Jika aliran darah otak di antara 15 dan 10 ml/100 g jaringan
otak per menit maka keadaan iskemia dapat pulih kembali asalkan
segera dikoreksi dengan tepat dan cepat. Love (1999) menyebutkan
bahwa penumbra iskemia atau daerah misery perfusion adalah
kondisi otak iskemia antara dua batas di mana beberapa neuron
yang secara fungsional inaktif tetapi secara struktural masih intak
dan potensial dapat diperbaiki (Prass K. etal., 2006).
Pada daerah yang mengalami iskemia, aliran darah menurun
secara signifikan. Secara mikroskopik daerah yang iskemia
(penumbra) yang pucat akan dikelilingi oleh daerah yang hiperemis
di bagian luar yaitu daerah yang disebut sebagai luxury perfusion,
karena melebihi kebutuhan metabolik sebagai akibat mekanisme
sistem kolateral yang mencoba mengatasi keadaan iskemia. Di
daerah sentral dari fokus iskemia terdapat inti yang terdiri atas
jaringan nekrotik atau jaringan dengan tingkat iskemia terberat
(Prass K. etal., 2006; Cobelens P.M. etal., 2010).

2.12 Reperfusion Injury


Reperfusi yang dilakukan segera setelah sumbatan pada
pembuluh darah dapat menormalkan kembali fungsi neuron.
Namun bila reperfusi dilakukan setelah terjadi iskemia maka
tidak akan dapat menghambat kerusakan neuron. Oleh karena
kembalinya aliran darah yang berlawananan dapat menyebabkan
penghancuran progresif dari sel rusak yang mengakibatkan
disfungsi jaringan dan infark (Harms H. etal., 2008; Marnane M.
etal., 2010; Feign V. 2006; Vincent J.L. 2006). Perfusi otak akan
menyebabkan terjadinya gangguan yaitu:
a. Tahap pertama berupa hiperemia paska iskemia (hiperperfusi)
b. Tahap kedua berupa hipoperfusi paska iskemia. (Harms H.
etal., 2008; Biswas M. etal., 2009).

2.12.1 Hiperemia paska iskemia


Hiperemia paska iskemia terjadi karena penyediaan aliran
darah yang berlebihan lewat pembuluh darah kolateral, rekanalisasi
pembuluh darah yang sebelumnya mengalami sumbatan, namun
disertai pelepasan molekul proinflamasi dan metabolit vasoaktif

78 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


dari jaringan iskemia dengan viskositas darah yang menurun serta
perubahan mekanisme vasodilatasi neurogen. Aliran darah yang
berlebihan ini tidak sesuai dengan kebutuhan metabolik otak.

2.12.2 Hipoperfusi paska iskemia


Stadium hiperemia ini diikuti penurunan aliran darah yang
lebih rendah dibandingkan tingkat pra iskemia. Hipoperfusi paska
iskemia tersebut merupakan akibat dari perubahan-perubahan
metabolik yang tertunda dalam jaringan iskemia yang disebabkan
aktivasi mikroglia dan astrosit untuk memproduksi sintesis
sitokin-sitokin proinflamasi dalam jumlah yang berlebihan, selain
juga aktivasi sekunder protein-protein tertentu. Faktor-faktor ini
menyebabkan gangguan berat sirkulasi darah serta obstruksi dari
pembuluh-pembuluh kecil yang selanjutnya memicu kematian sel
jaringan otak.
Peneliti lain berpendapat reperfusi paska iskemia (hiper
disusul hipoperfusi) yang merupakan peristiwa paling parah
menimbulkan kerusakan pada jaringan otak yang rentan adalah
akibat penurunan yang cepat dari ATP dan supresi jangka
lama sintesa protein. Penurunan ATP disertai depolarisasi dan
peningkatan ion Ca intrasel. Selanjutnya, menimbulkan lipolisis
disertai metabolisme asam lemak bebas dan terbentuknya radikal
bebas peroksida lemak. Hipoperfusi yang kemudian muncul
makin memperparah iskemia sehingga disebut secondary iskemia
(HarmsH. etal., 2008).
Dengan demikian, pemulihan dari aliran darah arterial
menyebabkan perfusi ulang yang tidak menyeluruh dari jaringan
yang sebelumnya mengalami iskemia. Fenomena ini disebut
noreflow (Kustiowati E. etal., 2008; Adams H.P. Jr. etal., 1993).
Mekanisme dasarnya dijelaskan sebagai berikut.
1. Peningkatan viskositas darah dan koagulasi intravaskular.
2. Oklusi mikrovaskular yang disebabkan kompresi dari kapiler-
kapiler oleh astrosit-astrosit edematosa di dekatnya.
3. Peningkatan tekanan intrakranial.
4. Pembengkakan endotel dan pembentukan mikrofili
endotelial.

Bab 2 Memahami Stroke Iskemia 79


5. Hipotensi paska iskemia.
Iadecola memperlihatkan bahwa sirkulasi serebral dalam
periode paska iskemia lumpuh, reaktivitas pembuluh darah
terhadap hiperkapnia (kadar karbon dioksida dalam darah
berlebihan) secara menyolok menurun dan pengaturan
serebrovaskular berubah (Prass K. etal., 2006; Harms H. etal.,
2008; Kustiowati E. etal., 2008; Adams H.P.Jr., etal., 1993;
FeignV.,2006).
Fenomena no reflow sangat menonjol dalam kondisi iskemia
yang lama selain juga pada iskemia yang disebabkan obstruksi
dari vena yang menyebabkan stagnasi darah dalam pembuluh-
pembuluh kecil. Perfusi ulang yang tidak menyeluruh membatasi
kemampuan bertahan hidup dari jaringan iskemia (Harms H.
etal.,2008).

2.13 Peranan Inflamasi pada Reperfusion Injury


Salah satu komponen reperfusion injury adalah reaksi inflamasi
yang melibatkan invasi polimorfonuklear leukosit terutama
neutrofil, monosit dan makrofag berikut molekul-molekul protein
seperti P-selectin, E-selectin, ICAM-1 dan PECAM1 di daerah
infark. Aktivasi sistem komplomen selama iskemia dan reperfusi
dan kenaikan regulasi yang cepat atau induksi dari beberapa
endotelium mengatur pengerahan neutrofil seperti margination
dan rolling. Hal tersebut merupakan salah satu respons dari
penyembuhan jaringan dan luka yang mengikuti nekrosis dan
respons inflamasi yang penting untuk menunjukkan kerusakan
sekunder selama reperfusi (Vincent J.L., 2006).
Implikasi hal ini secara klinis pada kondisi pasien bisa
kelihatan membaik, karena pada mulanya defisit neurologis
yang muncul adalah refleksi dari luasnya inti nekrotik berikut
penumbra. Dengan terjadinya regresi penumbra akibat reperfusi,
terlihat ada perbaikan klinis. Pada saat yang sama, kerusakan
neuron yang tidak dapat balik pada inti nekrotik semakin meluas
secara konsentris dan ini nantinya menentukan beratnya defisit
neurologis yang permanen (Warlow C.P. etal., 1996; FeignV.,2006).

80 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Saat terjadi iskemia jaringan maka neutrofil akan melekat
dan bermigrasi melewati endotelium dari mikrovaskular otak.
Pada saat di ekstravaskular neutrofil akan memproduksi radikal
bebas (O2;OH), melepaskan enzim proteolitik, dan menstimulasi
pelepasan neutrofil dari sel tetangga. Hal ini menyebabkan
terjadinya pengerahan neutrofil dan leukosit lain (Duncan P.W.
etal., 2005). Neutrofil tinggi jumlahnya selama reperfusi dan ini
memperlihatkan bahwa neutrofil merupakan mekanisme yang
penting selama reperfusi. Neutrofil intravaskular dan akumulasi
jaringan merupakan komponen dari respons inflamasi dari
kebanyakan kerusakan jaringan dan infeksi (Vincent J.L., 2006;
Meyer B.C. etal., 2002).
Dua mekanisme keterlibatan leukosit dalam reperfusion injury
adalah pada tingkat sirkulasi menyumbat mikrosirkulasi dan
mediator vasokonstriktor serta pada jaringan otak melepaskan
enzim hidrolitik, lipid peroksidase dan pelepasan radikal bebas.

2.14 Peranan Sitokin pada Reperfusion Injury


Banyak respons inflamasi termasuk reperfusion injury
nampaknya diperantarai oleh berbagai sitokin. Sitokin timbul
sebagai reaksi primer terhadap stimulasi dari luar dan tidak
ada pada hemostasis yang normal (Harms H. etal., 2008;
FeignV.,2006).
Sitokin proinflamasi timbul sebagai konsekuensi langsung dari
ketidakseimbangan ion dan akumulasi kalsium bebas yang timbul
akibat lesi iskemia otak yang memacu dilepaskannya asama amino
bebas dan proinflamasi lain hasil metabolisme lemak. Hal ini
dipercaya meningkatkan, menimbulkan dan melepaskan kaskade
sitokin proinflamasi (Warlow C.P. etal., 1996). Pada kaskade
sitokin proinflamasi, yang pertama dikeluarkan adalah IL1,
TNF. Sitokin ini kemudian merangsang dikeluarkannya sitokin
proinflamasi yang lain seperti IL-6 dan IL-8. Sitokin pro inflamasi
dihasilkan oleh berbagai macam sel seperti sel mikroglia, astrosit,
dan leukosit. Sitokin ini memacu sel sistem saraf pusat (Harms H.
etal., 2008; Feign V., 2006; Warlow C.P. etal., 1996).

Bab 2 Memahami Stroke Iskemia 81


Sitokin proinflamasi dihasilkan oleh berbagai macam sel seperti
sel mikroglia, astrosit, dan leukosit. Sitokin ini memacu sel sistem
saraf pusat mengalami apoptosis, diferensiasi, danproliferasi.
Peningkatan kadar IL-1, TNF, IL-6 dan IL-8 telah diamati pada
iskemia SSP (Harms H. etal., 2008; Prass K. etal., 2003; FeignV.,
2006). Konsentrasi IL-1 mulai muncul setelah 1-3 jam dan
maksimal pada 12 jam, tetap ada sampai 5 hari. Konsentrasi TNF
mulai muncul setelah 3-6 jam, maksimal pada 12 jam tetap ada
sampai 5 hari (Warlow C.p. etal., 1996). Dari beberapa penelitian,
interleukin pada iskemia injury ditemukan dengan nilai IL-6 pada
cairan serebrospinal dan plasma yang memprediksi derajat fungsi
pemulihan pasien dihubungkan dengan besarnya ukuran infark
(Vincent J.L., 2006). Nagahiro dkk. (1998) mengatakan bahwa
sebaliknya reperfusi pada jaringan yang sudah mengalami iskemia
justru akan berbahaya karena menimbulkan peningkatan infiltrasi
sel inflamasi dan oksigen yang dapat menyebabkan peningkatan
radikal bebas.
DeGraba (1998) melaporkan bahwa reperfusi jaringan iskemia
dengan cepat menimbulkan ekspresi sitokin inflamatori, khususnya
TNF dan IL1. Pengaturan fungsi sitokin inflamatori tersebut di
atas mungkin dapat digunakan dalam terapi untuk mengurangi
cedera akibat reperfusi dan mengurangi perluasaninfark
(MeyerB.C. etal., 2002).

Rangkuman
1. Stroke iskemia merupakan akibat yang ditimbulkan secara
umum oleh aterotrombosis pembuluh darah serebral,
baik yang besar maupun kecil.
2. Penyebab utama terjadinya stroke iskemia antara
lain aterosklerosis pada pembuluh arteri besar
(makroangiopati), kardioemboli, dan penyakit pada
pembuluh darah kecil otak (mikroangiopati). Penyebab
lain yang lebih jarang ditemukan antara lain vaskulitis
otak, penyakit hematologi dan lain-lain.

82 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


3. Berdasarkan patologi anatomi dan penyebabnya, stroke
iskemia dibedakan menjadi:
TIA (Transient Ischemic Attack)
Trombosis serebri
Emboli serebri.
4. Berdasarkan stadium/pertimbangan waktu stroke
iskemia dibedakan menjadi::
TIA (Transient Ischemic Attack)
RIND (Reversible Ischemic Neurologic Deficit)
Progressing stroke atau Stroke-in-evolution
Completed stroke.
5. Berdasarkan sistem pembuluh darah stroke iskemia
dibedakan menjadi:
Sistem karotis
Sistem vertebrobasiler.
6. Dua mekanisme utama yang menyebabkan kerusakan
otak pada stroke adalah iskemia dan perdarahan.
Pada stroke iskemia, yang mewakili sekitar 80% dari
semua stroke, penurunan atau hilangnya aliran darah
menyebabkan pasokan glukosa menjadi berkurang yang
selanjutnya mengakibatkan kegagalan mitokondria dalam
memproduksi ATP.
7. Kecepatan aliran darah di otak bervariasi antara 4070
cm/detik. Ketika aliran darah yang menuju serebral di
bawah 20 ml/100 g per menit maka akan terjadi iskemia.
Jika aliran ini terus mengalami penurunan hingga
12ml/100 g per menit maka akan terjadi kerusakan otak
permanen yang disebut infark.
8. Iskemia otak mengakibatkan perubahan dari sel neuron
otak secara bertahap yang meliputi :
Penurunan aliran darah otak
Pengurangan O2
Kegagalan energi

Bab 2 Memahami Stroke Iskemia 83


9. Mitchel (1997) menyebutkan ada 2 pola kematian sel
yaitu seperti:
Nekrosis, paling sering adalah nekrosis koagulatif,
terjadi setelah menghilangnya aliran darah atau karena
racun, dan ditandai dengan adanya pembengkakan
sel, denaturasi protein dan kerusakan organela.
Apoptosis, kejadian yang lebih teratur, merupakan
kematian terprogram dari populasi spesifik dalam
keadaan normal seperti embriogenesis atau juga pada
beberapa keadaan patologis.
10. Stroke iskemia bisa disebabkan oleh berbagai macam
masalah yang dapat dikelompokkan menjadi 3 bagian,
yaitu masalah-masalah pembuluh darah, jantung dan
substrat darah itu sendiri.
11. Stroke merupakan penyebab kecacatan utama, tidak
hanya akibat disfungsi motorik, namun juga gangguan
fungsi kognitif yang sering terjadi pada stroke. Gangguan
fungsi kognitif dapat dibedakan menjadi gangguan akut,
subakut, dan paska stroke. Pada fase subakut dan paska
stroke, faktor di luar stroke yang ikut mempengaruhi
antara lain suhu, kejadian kejang, komorbiditas, serta
faktor genetika.
12. Faktor-faktor yang mempengaruhi fungsi kognitif paska
stroke iskemia dapat dikelompokkan menjadi faktor
demografis, faktor risiko aterosklerosis, faktor yang
berhubungan dengan stroke, dan faktor genetika.
13. Beberapa faktor yang berkaitan dengan stroke iskemia
antara lain:
Volume, letak dan lokasi infark
Kelainan pada substansia alba
Infark serebral tersembunyi
Atrofi serebral.

84 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


14. Sel asal (stem sel) juga memiliki kemampuan untuk
memperbarui diri kembali sehingga walaupun sumsum
tulang adalah tempat utama produksi sel baru, jumlah
sel keseluruhan tetap konstan pada keadaan seimbang
dannormal.
15. Pematangan sel leukosit di sumsum tulang dan pelepasan
ke sirkulasi dipengaruhi oleh berbagai faktor interleukin,
faktor nekrosis tumor (TNF) dan beberapa komponen
pelengkap.
16.
Fungsi normal neutrofil antara lain kemotaksis,
fagositosis, dan kemokin. Selain itu juga berfungsi untuk
membunuh dan pencerna.
17. Sejak aktivasi ini, leukosit melekat pada tepi endotel
melalui reseptor glikoprotein dinding leukosit (disebut
sebagai CD-18 atau b2-integrin) dan ligan dari endotel,
ICAM-1. Pada serangan stroke, leukosit teraktifasi dan
menyebabkan inflamasi. Aktivasi ini akan meningkatkan
adesi leukosit ke endotel dan selanjutnya migrasi ke
dalam parenkim otak. Efek leukosit dalam patogenesis
kerusakan iskemia serebral dapat terjadi dengan cara:
Kedua serebral dan pelepasan mediator vasokonstriksi
endotel sehingga memperberat penurunan aliran darah.
18. Eksaserbasi kerusakan blood brain barrier dan parenkim
melalui pelepasan enzim hidrolitik, proteolitik, produksi
radikal bebas dan lipid peroksidase.
19. Sitokin sebagai mediator peptida molekuler merupakan
protein atau glikoprotein yang dikeluarkan oleh suatu
sel dan mempengaruhi sel lain dalam suatu proses
inflamasi.

Bab 2 Memahami Stroke Iskemia 85


86
Bab3

Anatomi
Pembuluh Darah
dan Arteri
Karotis

87
3.1 Anatomi Pembuluh Darah

D
inding pembuluh darah disusun oleh tiga lapisan
yaitu tunika intima, tunika media dan tunika
adventisia. Tunika intima merupakan lapisan
terdalam pembuluh darah. Yang termasuk di dalam lapisan ini
adalah endotelium dan epitel gepeng; dipisahkan dari membran
elastika interna oleh jaringan ikat longgar dengan sedikit fibroblas,
sedikit sel-sel otot polos dan serat kolagen halus. Tunika media
merupakan lapisan tengah dan lapisan paling tebal dari dinding
pembuluh darah, mengandung otot polos dan serat kolagen. Tunika
media dipisahkan dengan tunika adventisia oleh membran elastika
eksterna yang merupakan pita tipis serat elastin. Tunika adventisia
merupakan lapisan paling luar pembuluh darah dan terdiri dari
kolagen serta serat-serat elastin. Serabut jaringan penyambung
tunika adventisia bercampur dengan jaringan di sekitarnya,
sehingga menjaga kestabilan pembuluh darah (Gray,2000).

Tunika adventisia
Jaringan konektif

Tunika intima

endotelium
Lamina elastis internal

Lamina elastis eksternal Sel otot polos


Tunika media Sumber: Gray, 2000
Gambar 3.1Struktur pembuluh darah

88 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Terdapat perbedaan antara struktur arteri dan vena yang
dapat dilihat pada tabel dan gambar di bawah ini.

Tabel 3.1Perbedaan arteri dan vena


Gambaran Arteri Vena
Tampilan umum Bulat, dinding tebal Pipih, dinding tipis
tampak lintang
Tunika intima
- Endotel Bergelombang karena Mulus
konstriksi pembuluh darah
- M
 embran elastika Ada Tidak ada
interna
Tunika media Tebal, (>> otot polos dan Tipis (>> otot polos
serabut elastin) dan serabut kolagen)
- Membran elastika Ada Tidak ada
eksterna
Tunika adventisia Serabut kolagen, elastin Serabut kolagen,
elastin, otot polos

Vesel adventisia
Membran elastis eksternal
Tunika adventisia
Membran elastis internal

Arteri Otot sirkular


Klep/katup

Tunika intima

Tunika intima
Endotelium

Otot sirkular
Vena
Sel lemak

Sumber: Gray, 2000


Gambar 3.2Penampang arteri dan vena

3.2 Anatomi Arteri Karotis


Pada keadaan normal, otak mendapat aliran darah dari dua
arteri karotis interna dan dua arteri vertebralis. Sementara itu,

Bab 3 Anatomi Pembuluh Darah dan Arteri Karotis 89


arteri vertebralis akan bersatu membentuk arteri basilaris pada
batas inferior pons. Aliran darah ini tidak seluruhnya simetris.
Arteri karotis kommunis kiri dan arteri subklavia kiri umumnya
merupakan cabang terpisah dari arkus aorta, sedangkan arteri
subclavia kanan dan arteri karotis kommunis kanan berasal dari
arteri innominata (truncus brachiocephalica) (Bailey, 2011).

Arteri serebral
anterior
Circle of Willis Arteri serebral
tengah kiri
Arteri serebral
tengah kanan Arteri kommunis
anterior
Arteri basilaris
Arteri serebral
Arteri karotis posterior
eksternal Arteri
Arteri kommunikating
vertebra posterior
Arteri karotis Arteri karotis
kommunis internal

Basilar
Arteri karotis
internal dan Arteri karotis
ekternal kanan internal dan
ekternal kiri
Vertebral

Arteri karotis Arteri kommunis


kommunis kanan kiri
Arteri subklavian
kanan Arteri mamari
internal kiri
Arteri mamari Arteri subklavian kiri
internal kanan
Brakiosefalik Aortic arch
(Inominat)
Sumber: Bailey, 2011
Gambar 3.3Anatomi arteri karotis

90 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Arteri karotis kommunis (CCA) berjalan di posterolateral
kelenjar tiroid dan posterior musculus sternocleidomastoideus dan
vena jugularis, masing-masing bercabang pada bifurcatio menjadi
arteri karotis eksterna (ECA) dan arteri karotis interna (ICA).
Arteri karotis eksterna mempunyai banyak percabangan di leher
dan mendarahi otot leher dan wajah. Arteri karotis interna tidak
mempunyai percabangan tetapi dibagi menjadi beberapa segmen,
yaitu segmen ekstrakranial (bulbus karotis dan segmen ICA
servikal), segmen intraosesus (dalam os petrosus), serta segmen
distal (segmen kavernosus dan intrakranial). Arteri karotis
interna lebih posterolateral dan lebih besar, sedangkan arteri
karotis eksterna lebih anteromedial dan lebih kecil (Bailey, 2011).
Pada sekitar 70% populasi, bifurkatio karotis terletak setinggi
tulang belakang servikalis 3 sampai 5. Ketinggian bifurkatio
karotis asimetris di mana hampir 50% bifurkatio kiri lebih tinggi
(Bailey,2011).
Arteri karotis merupakan sentinel vessel yang menggambarkan
kondisi pembuluh darah secara keseluruhan (Simon and
Chironi,2007).

Rangkuman
1. Dinding pembuluh darah disusun oleh tiga lapisan yaitu
tunika intima, tunika media, dan tunika adventisia.
2. Tunika intima merupakan lapisan terdalam pembuluh
darah. Dalam lapisan tunika intima terdapat endotelium
dan epitel gepeng yang dipisahkan dari membran elastika
interna oleh jaringan ikat longgar dengan sedikit fibroblas,
sedikit sel-sel otot polos, dan serat kolagen halus.
3. Tunika media merupakan lapisan tengah dan lapisan
paling tebal dari dinding pembuluh darah, mengandung
otot polos dan serat kolagen.
4. Tunika adventisia merupakan lapisan paling luar
pembuluh darah dan terdiri atas kolagen serta serat-serat
elastin.

Bab 3 Anatomi Pembuluh Darah dan Arteri Karotis 91


5. Arteri karotis merupakan sentinel vessel yang meng
gambarkan kondisi pembuluh darah secara keseluruhan.
6. Arteri karotis kommunis (CCA) berjalan di postero
lateral kelenjar tiroid dan posterior musculus
sternocleidomastoideus dan vena jugularis, masing-masing
bercabang pada bifurcatio menjadi arteri karotis eksterna
(ECA) dan arteri karotis interna (ICA).
7. Arteri karotis eksterna mempunyai banyak percabangan
di leher dan mendarahi otot leher dan wajah.
8. Arteri karotis interna tidak mempunyai percabangan
tetapi dibagi menjadi beberapa segmen, yaitu segmen
ekstrakranial (bulbus karotis dan segmen ICA servikal),
segmen intraosesus (dalam os petrosus), serta segmen
distal (segmen kavernosus dan intrakranial).

92 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Bab4

Memahami
Aterosklerosis

93
4.1 Patogenesis Aterosklerosis

A
terosklerosis adalah kondisi di mana arteri mengalami
pengerasan dan penyempitan yang menye babkan
berkurangnya pasokan darah ke berbagai organ tubuh.
Aterosklerosis merupakan salah satu tipe dari arteriosklerosis,
yaitu istilah umum untuk penebalan dan pengerasan arteri.
Aterosklerosis berasal dari bahasa Yunani athero berarti pasta
dan sclerosis berarti pengerasan. Aterosklerosis terjadi bila
terdapat pengendapan substansi lemak, kolesterol, cellular waste
product, kalsium dan fibrin pada permukaan dalam arteri. Hasil
pengendapan tersebut disebut plaque (Huittinen, 2003).
Disfungsi endotel merupakan pemicu terjadinya aterosklerosis
berdasarkan hipotesis response to injury. Kelainan awal yang
timbul berupa peningkatan permeabilitas lapisan endotel. Endotel
adalah selapis sel yang melapisi pembuluh darah bagian dalam.
Saat ini diketahui bahwa endotel adalah organ terluas dalam tubuh
dengan luas mencapai 700 m2 dan berat 1,5 kg. Dahulu endotel
dianggap hanya sebagai suatu membran semi permeabel yang
yang membatasi darah dan jaringan interstitial pada pembuluh
darah. Penelitian kemudian membuktikan bahwa selain sebagai
sawar, endotel juga berfungsi dalam proses sintesis, regulasi kerja
vaskular dan metabolisme, serta berfungsi antitrombogenesis
(Huittinen, 2003, Crowther, 2005, Elkind,2006).
Endotel mempunyai peranan yang sangat penting dalam
memelihara homeostasis pembuluh darah. Oleh karena itu,
jika fungsinya terganggu akan memicu timbulnya penyakit
kardiovaskular. Salah satu peranan endotel yang penting adalah
dalam mempertahankan tonus vaskular. Regulasi tonus vaskular

94 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


terjadi melalui melalui keseimbangan antara faktor-faktor
relaksasi dan faktor konstriksi yang dilepaskan sebagai respon
terhadap rangsang mekanik lokal (tekanan, geser, regangan)
kondisi metabolik, berbagai produk yang dihasilkan oleh trombosit
dan faktor koagulasi serta senyawa-senyawa agonis yang bekerja
melalui reseptor (Crowther, 2005).
Faktor risiko aterosklerosis seperti hipertensi, hiperkoles
terolemia, merokok, homosistein dan diabetes melitus dapat
mengubah keseimbangan ini. Pembuluh darah menjadi lebih
cenderung mengalami vasokonstriksi dan sel-sel otot polosnya
menjadi berproliferasi. Selain itu juga terjadi agregasi trombosit,
adesi leukosit dan peningkatan permeabilitas makromolekul
seperti lipoprotein, fibrinogen dan immunoglobulin. Proses
ketidakseimbangan ini disebut sebagai disfungsi endotel
(Crowther,2005).

CEDERA Endotelial permeabel


Endotelium
Migrasi leukosit
Otot
lembut

Disfungsi
endotelial

Pembentukan
plaK sel busa
FIBROUS Endapan
lemak
Migrasi sel
otot lembut

LUKA Pelekatan platelet


fibroFatty dan agregasi

Sumber: Huittinen, 2003

Gambar 4.1Hipotesis respon terhadap injuri berdasarkan Ross 1999

Bab 4 Memahami Aterosklerosis 95


Plaque/ateroma dibentuk oleh lemak, kolesterol, kalsium,
sel mesensimal, dan kolagen jaringan ikat. Saat plaque terbentuk
menyebabkan penyempitan lumen sehingga aliran darah terganggu
dan pada akhirnya menyebabkan kurangnya aliran oksigen pada
organ-organ penting seperti otak dan jantung (Huittinen, 2003).
Terdapat dua jenis plaque yaitu hard plaque (stabil) dan soft plaque
(tidak stabil). Hard plaque menyebabkan dinding pembuluh darah
tebal dan keras sedangkan soft plaque mudah terlepas dari dinding
pembuluh darah dan menyebabkan tromboemboli (Huittinen,
2003, Crowther, 2005, Elkind, 2006).

4.2 Mekanisme Aterosklerosis


Aterosklerosis merupakan proses panjang yang menyebabkan
perubahan berupa obstruksi luminal oleh bahan seluler maupun
aselular. Perubahan itu dapat berupa: (a) lapisan lemak, lesi dini
yang terlihat berwarna kekuningan pada area intima, bergantung
pada akumulasi dari lemak yang berikatan dengan makrofag,
terjadi sekitar 30% pada anak di bawah 5 tahun; (b) lesi yang
semakin meningkat dengan lemak ektraselular pada pembuluh
arteri yang terjadi pada anak-anak dan remaja; (c) complicated
fibrous plaque: area sentral aselular dari lipid yang tertutup oleh
sel otot polos dan kolagen, terjadi pada orang berumur di atas 30
tahun (Deb etal., 2009).
Proses aterosklerosis diawali infiltrasi low-density lipoprotein
(LDL) pada area subendotel. Sel endotel merupakan sel dengan
kecenderungan tinggi untuk dirusak oleh aliran darah. Sel endotel
juga merupakan tempat akumulasi lemak terbanyak. LDL dioksidasi
atau diubah oleh makrofag membentuk sel busa (foam cell). LDL
teroksidasi ini memiliki efek menstimulasi pelepasan sitokin dan
menginhibisi produksi nitric oxide (McPhee etal.,2005).

96 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Fatty streak

Darah
Monosit

Endotelium
Intima
Partikel yang
berisi lipid
Sel busa

Makrofag
(diferensiasi monosit)
Sitokin
Pembelahan sel
otot polos Faktor
pertumbuhan Migrasi sel
Sel T Sitokin otot polos

Media

Sel otot polos


Sumber: Mcphee, etal.,2005

Gambar 4.2Mekanisme pembentukan sel busa

Sel otot polos vaskular di sekitar sel busa akan distimulasi


dan menyebabkan pengurangan jumlah kolagen dan matriks
seluler yang lain. Pada akhirnya, sel otot polos juga menjadi
sel busa dan lemak terakumulasi baik pada intrasel maupun
ekstrasel. Setelah terjadinya stroke, monosit berikatan dengan sel
endotel, menembus ruang endotelium dan menjadi makrofag di
jaringan yang aktif. Makrofag akan mengikat LDL yang teroksidasi
dan berubah menjadi sel busa. Sel T melepaskan sitokin yang
juga mengaktivasi makrofag. Sitokin menyebabkan proliferasi
sel otot polos. Sel otot polos ini kemudian bermigrasi ke ruang
subendotelium lalu berubah menjadi sel busa. Sel busa inilah yang
merupakan kunci berkembangnya lesi aterosklerosis (Mc Phee
etal., 2005).

Bab 4 Memahami Aterosklerosis 97


4.3 Perkembangan Lesi Aterosklerosis
Dinding arteri secara histologi terdiri dari lapisan yang berbeda
yaitu intima, media dan adventisia. Intima dibentuk oleh endotel
dan sel otot polos. Intima merupakan lapisan terdalam dinding
pembuluh darah yang terkena efek terbesar proses aterosklerosis.
Meskipun aterosklerosis dianggap gangguan sistemik yang
mengenai seluruh arteri tetapi sering kali memiliki predileksi
tertentu yaitu di arteri elastika besar dan arteri muskularis ukuran
medium. Daerah yang mudah terkena lesi adalah arteri koronaria,
aorta abdominal distal dengan cabang utamanya dan arkus aorta
dengan cabang utamanya. Lesi aterosklerosis awal biasanya
muncul di aorta (Crowther, 2005).
Aterosklerosis dimulai ketika sel darah putih monosit
berpindah dari aliran darah ke dinding arteri dan menembus ke
dalam sel, mengakumulasi lemak sehingga lapisan arteri menebal
dan mengeras (Crowther, 2005). Disfungsi endotel akan berperan
dalam terjadinya aterogenesis pada tahap awal dan juga proses
perjalanan penyakit selanjutnya karena dinamika plaque. Disfungsi
endotel menyebabkan platelet mudah menempel pada dinding
sel sehingga terjadi kontraksi akibat pembebasan tromboksan
A2 dan serotonin. Selain itu, pembebasan platelet derived growth
factor (PDGF) akan menstimulasi proliferasi dan migrasi sel-sel
otot polos. Disfungsi endotel merupakan hasil injuri oleh faktor
risiko yang menyebabkan perubahan fungsi normal endotel dan
meningkatkan perlekatan trombosit teraktivasi serta leukosit
pada endotel. Disfungsi endotel juga sejalan dengan peningkatan
permeabilitas endotel, sehingga memungkinkan masuknya
lipoprotein dan monosit ke dalam intima (Huittinen, 2003,
Crowther, 2005, Elkind, 2006).
Lesi aterosklerosis dibagi menjadi tiga berdasarkan tingkat
keparahannya (Gambar 4.3), yaitu:

1. Fatty streak
Fatty streak merupakan tahap awal pembentukan lesi
aterosklerosis dan sudah mulai terjadi pada anak. Karena

98 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Lumen vaskular
Monosit
Adesi
Sel
Migrasi endotelium
Matriks LDL
ekstraseluler Responss
homeostasis

Intima
mmLDL LDL oxidation
(a) Sel busa
oxLDL
Lamina elastis
internal
ox LDL uptake
Makrofag
Media

Sel otot polos

Sel
endotelium
Fibrinogen

Sitokin Sel busa


makrofag
(b)
Th2

Th1

Sel otot polos


Lumen
vaskular Platelet

SMC-derived
foam cell
Necrotic
core
Extracellular
Tissue lipid
factor
Gruel
Sel busa
(c) makrofag
MMPs

Sel
Th1 IFN

Sel otot polos

Sumber: Huittinen, 2003

Gambar 4.3Perkembangan lesi aterosklerosis: (a) pembentukan fatty


streak (b) pembentukan fibrous plaque dan (c) terjadinya lesi komplikasi

Bab 4 Memahami Aterosklerosis 99


adanya mekanisme adaptasi arteri untuk mengkompensasi,
maka manifestasi klinis ini biasanya baru timbul pada usia
pertengahan dan usia tua. Tahap ini dimulai dengan akumulasi
lipoprotein di dalam tunika intima arteri yang diikuti adesi
dan invasi monosit dan limfosit ke daerah penumpukan
lipid tersebut. Setelah mencapai tunika intima, monosit
berdiferensiasi menjadi makrofag. Partikel lipoprotein akan
difagositosis oleh makrofag sehingga menumpuk di dalam
makrofag. Pada proses ini makrofag tampak sebagai sel busa
yang kaya dengan lipid (Huittinen, 2003, Crowther, 2005).
2. Fibrous plaque
Fibrous plaque secara histologis tampak putih dan
lebih tebal sehingga menonjol ke dalam lumen. Fibrous
plaque timbul karena proliferasi lokal sel-sel otot polos dari
intima dan oleh migrasi sel-sel otot polos dari tunika media
melalui penetrasi dalam membran elastika interna untuk
bergabung dengan fibrous plaque yang terdapat di intima.
Munculnya sel-sel otot polos bersama dengan makrofag pada
intima merupakan tanda penting fibrous plaque. Fibrous
plaque merupakan lesi yang secara klinis bermakna dan
mempengaruhi aliran darah untuk sekurang-kurangnya
dalam dua mekanisme yang berbeda. Pertama, respons
fibroproliferatif dinding arteri secara mekanik menyumbat
lumen arteri dan secara progresif menghambat aliran darah.
Kedua, fibrous plaque sering bekerja sebagai suatu nidus bagi
trombosis dan obstruksi akut lumen arteri (Huittinen, 2003,
Crowther, 2005).
3. Lesi komplikasi
Lesi komplikasi merupakan tahap terjadinya komplikasi
trombosis pada fibrous plaque. Gangguan pada fibrous plaque
seperti erosi atau ruptur akan menyebabkan terjadinya
kontak antara darah dan komponen inti lipid yang bersifat
trombogenik. Lesi komplikasi ini ditandai oleh hilangnya
endotel, inti nekrotik yang besar, sejumlah kristal kolesterol
ekstraselular dan kalsifikasi yang luas. Hilangnya lapisan
endotel menunjukkan lesi lanjut rentan terhadap trombosis

100 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


akut dan oklusi arterial akut. Robekan lesi komplikasi oleh
shear stress akibat derasnya aliran darah, trauma mekanik atau
perdarahan akut ke dalam inti nekrotik memicu pembentukan
bekuan (Huittinen, 2003, Crowther, 2005).
American Heart Association menggolongkan lesi aterosklerosis
menjadi 6 derajat histologis. Lesi awal (tipe I dan II) dan lesi
intermediate (tipe III) dapat dianggap sebagai prekursor lesi lanjut
(tipe IV dan V) dan lesi komplikasi (tipe VI). Lesi tipe I tampak
sebagai perubahan awal dinding arteri dengan peningkatan
makrofag intima dan transformasi makrofag menjadi foam
cell yang mengandung kolesterol. Lesi tipe II dibentuk dari
lapisan-lapisan foam cell makrofag dan sel otot polos lipid laden.
Lesi tersebut disebut sebagai fatty streak dan dapat berlanjut
menjadi lesi tipe III dengan berkumpulnya sedikit droplet lipid
ekstraseluler dan partikel yang mempengaruhi susunan sel otot
polos intima. Pada lesi tahap lanjut, inti dari lemak ekstraseluler
mulai berkembang (ateroma) dan proses berlanjut dengan fibrous
menyelimuti inti lemak (fibroateroma). Pada perkembangan
lesi yang komplikata fibroatheroma menjadi kompleks dengan
kalsifikasi, defek permukaan lumen, perdarahan dan deposit
trombosit (Kallio,2009).
Saat ini, belum diketahui apakah tipe-tipe lesi di atas merupa
kan perkembangan lesi yang berurutan pada proses athero
sklerotik. Bagaimanapun, masing-masing tipe lesi cenderung
terjadi dan dominan pada kelompok umur tertentu. Pembentukan
fatty streak telah diobservasi pada periode fetal di aorta, dan di
setiap anak dengan umur di atas 3 tahun. Penelitian menemukan
lesi intermediate pada arteri hampir terjadi pada seluruh remaja.
Pada orang dewasa muda telah ditemukan lesi atherosklerotik
lanjut pada arteri koroner. Dengan adanya data dan fakta bahwa
lesi tahap lanjut terjadi pada lokasi tertentu tempat terjadinya lesi
tahap awal maka kemungkinan terjadi perkembangan dari lesi
prekursor menjadi lesi tahap lanjut (Kallio, 2009).

Bab 4 Memahami Aterosklerosis 101


4.4 Aterosklerosis Sebagai Reaksi Inflamasi
Aterogenesis adalah suatu proses inflamasi. Proses atero
genesis dimulai ketika lapisan endotel mengalami kerusakan
atau menjadi disfungsional. Penyebab disfungsi endotel antara
lain shear stress yang berhubungan dengan hipertensi, low-
density lipoprotein (LDL) teroksidasi, homosistein, dan merokok.
Disfungsi endotel mengarah kepada peningkatan permeabilitas
terhadap lipoprotein dan up-regulasi leukosit serta molekul adhesi
endothelial. Sebagai respons terhadap adanya substansi antara lain
LDL teroksidasi, MCP-1, interleukin (IL)-8, dan platelet-derived
growth factor (PDGF), leukosit bermigrasi ke dalam dinding arteri
(Gambar 4.4) (Elkind, 2006).

Oxydized LDL Elevated


Infection Homocysteine
Platelet
Hyperglycemia Hypertension Aggregation

Smoking

Endothelial injury
Activation of
endothelium
Activation of
Macrophages SMC Proliferation
and T-cells
Lipid Cytokines, Chemokines,
Deposition Growth Factors

Inflammatory Lipid Core

Sumber: Elkind, 2006


Gambar 4.4Mekanisme aterogenesis pada stroke

Akibat induksi LDL teroksidasi, MCP-1 menyebabkan


diapedesis monosit melintasi endotel. Granulocyte-macrophage
colony-stimulating factors mengubah monosit menjadi macro
phage, mengelaborasi tumor necrosis factor (TNF) , IL1,

102 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


enzimproteolitik termasuk matrix metalloproteinases, dan growth
factors termasuk PDGF dan insulin-like growth factor (ILGF).
Macrophage ini menyebabkan aktivasi sel T dengan adanya
antigen, termasuk LDL teroksidasi. Faktor trophic yang lain seperti
IL-2, TNF, dan granulocyte-macrophage menstimulasi faktor
yang menyebabkan aktivasi sel T untuk memproduksi interferon
(IFN) g, TNF dan TNF, mengarahkan pada stimulasi macrophage
dan lebih jauh menyebabkan up-regulasi molekul adesi leukosit.
Umpan balik ini mengamplifikasi siklus inflamasi (Elkind, 2006).

Modified LDL Sitokin (TNF , IL-1)


Monocyte Chemotactant Enzim proteolitik (MMP,dll.)
Protein Growth factor (ILGF, PDGF)
Osteopontin

G-M colony
stimulating
factor Aktivasi sel T

Aktivasi
sel T
TNF , TNF , TNF

Up-regulasi molekul adhesi

Sumber: Elkind, 2006

Gambar 4.5Umpan balik siklus inflamasi pada stroke

4.5 Terbentuknya Aterosklerosis pada Usia Dini


Aterosklerosis adalah penyakit kronis yang berkembang
melalui proses yang lama. Proses aterosklerosis dimulai sejak masa
anak-anak. Gejala aterosklerosis telah dapat diidentifikasi pada
dekade pertama kehidupan, jauh sebelum terbentuknya plaque
yang berakibat timbulnya gejala dan tanda penyakit kardiovaskular
dan stroke (Barra etal., 2009, Koskinen etal., 2009). Penelitian

Bab 4 Memahami Aterosklerosis 103


awal tentang perubahan pada arteri akibat aterosklerosis dini
berawal dari otopsi tentara-tentara yang terbunuh pada perang
Korea dan Vietnam. Penelitian terbaru, hasil dari Studi PDAY
(Pathological Determinants of Aterosklerosis in Youth) dan Bogalusa
Heart Study menunjukkan bahwa aterosklerosis subklinis telah
tampak pada arteri anak. Lebih lanjut lagi, fatty streak telah
ditemukan di arteri fetus sebagai konsekuensi hiperkolesterolemia
pada ibu selama hamil. Pada otopsi anak usia antara 215 tahun,
ditemukan fatty streak di aorta pada 20% kasus dan di arteri
koronaria pada 8% kasus. Aterosklerosis dini tersebut berkorelasi
dengan faktor risiko tradisional (Kallio, 2009).
Proses aterosklerosis dipercepat dengan adanya faktor risiko.
Penelitian prospektif berskala besar pada anak-anak dan dewasa
muda yang menggambarkan faktor risiko dan gaya hidup saat anak-
anak dalam aterogenesis misalnya Muscatine study, Bogalusa Heart
Study, Cardiovaskular Risk in Young Finns Study, Coronary Artery
Disease Risk Development in Young Adults (CARDIA) study, Dietary
intervention Study in Children (DISC), the Avon Longitudinal Study of
Parents and Children (ALSPAC) study dan STRIP study. Bertambah
luasnya lesi aterosklerosis pada anak dan dewasa, sesuai dengan
jumlah faktor risiko penyakit vaskular aterosklerosis pada masa
anak (Kallio, 2009).

4.6 Faktor Risiko Aterosklerosis


Aterosklerosis sebagai penyebab stroke iskemia merupakan
kelainan pembuluh darah kronis, progresif dan kompleks akibat
interaksi multifaktorial genetika dan lingkungan. Penyebab pasti
aterosklerosis sampai saat ini belum jelas. Akan tetapi beberapa
kondisi telah dapat dibuktikan secara evidence based dapat
meningkatkan kemungkinan kejadian aterosklerosis, kondisi itu
disebut sebagai faktor risiko.
Faktor risiko stroke dapat dibagi menjadi tiga yaitu faktor risiko
yang dapat diubah, tidak dapat diubah dan dapat diubah secara
potensial. Namun faktor risiko tersebut ada yang terdokumentasi
dengan baik dan ada pula yang tidak (Goldstein etal., 2006). Faktor

104 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


risiko utama stroke iskemia yang terdokumentasi antara lain
faktor risiko yang tidak dapat diubah yaitu umur, jenis kelamin, ras,
riwayat keluarga penderita stroke, dan berat lahir rendah. Adapun
faktor risiko yang dapat diubah yaitu hipertensi, atrial fibrilasi,
diabetes, dislipidemia, rokok, penyakit sickle cell, terapi hormon
postmenopause serta gaya hidup yang berhubungan dengan
peningkatan risiko stroke (obesitas, kurangnya aktivitas fisik,
dan diet). Sementara itu, faktor risiko yang dapat diubah secara
potensial yaitu migrain, penggunaan kontrasepsi oral, alkohol, dan
obat-obatan terlarang (Dipiro etal., 2008).
Risiko stroke akan meningkat seiring dengan peningkatan
usia. Risiko menjadi dua kali lebih besar setiap satu dekade
peningkatan usia lebih dari 55 tahun. Ras-ras tertentu seperti
Afrika Amerika, Asia Pasifik, dan Hispanic juga memiliki risiko
lebih tinggi dibandingkan ras lain (Thon etal., 2006; Cooperet al.,
2000). Jenis kelamin juga merupakan faktor risiko stroke iskemia.
Laki-laki memiliki risiko lebih tinggi terkena stroke daripada
wanita pada usia yang sama. Namun, wanita yang terkena stroke
biasanya cenderung lebih parah dan berujung pada kematian
(Thon etal., 2006).
Faktor risiko yang dapat dimodifikasi yaitu hipertensi,
merokok, diabetes, atrial fibrilasi, dan dislipidemia. Pengobatan
hipertensi yang dimulai pada pertengahan abad ke-20 terbukti
dapat menurunkan laju kematian akibat stroke secara drastis di
Amerika Serikat (Cooper etal., 2000). Faktor risiko lain adalah
penyakit jantung. Pasien dengan kelainan pembuluh darah, gagal
jantung kongestif, hipertrofi ventrikel kiri, dan atrial fibrilasi,
berpotensi besar mengalami stroke iskemia (Goldstein etal., 2006;
Helgason and Wolf, 1997). Faktor risiko lain yang diketahui juga
menjadi penyebab stroke iskemia adalah aterosklerosis. Diabetes
melitus, dislipidemia, dan rokok adalah faktor-faktor pencetus
terjadinya aterosklerosis yang dapat menyebabkan penyakit
jantung dan stroke iskemia (Goldstein etal., 2006; Helgason and
Wolf, 1997).
Penelitian terbaru dari INTERHEART study menunjukkan
bahwa abnormalitas lemak, rokok, hipertensi, diabetes, obesitas

Bab 4 Memahami Aterosklerosis 105


abdominal, faktor psikososial, konsumsi buah dan sayur tidak
teratur, tidak (minimnya) olahraga secara reguler terhitung
sebagai risiko terbesar infark myocard.
Faktor risiko aterosklerosis pada anak serupa dengan dewasa.
Faktor risiko pada anak dan dewasa muda telah diidentifikasi
dan berhubungan dengan penanda aterosklerosis subklinis. Hal
tersebut meliputi peningkatan tekanan darah, diabetes, obesitas,
C-Reactive Protein (CRP), agen infeksi (misalnya Chlamydia
pneumonia), merokok, hiperkolesterol, dan gaya hidup sedentary
(Kallio, 2009).

Rangkuman
1. Aterosklerosis adalah kondisi ketika arteri mengalami
pengerasan dan penyempitan yang menyebabkan
berkurangnya pasokan darah ke berbagai organ
tubuh. Aterosklerosis merupakan salah satu tipe dari
arteriosklerosis, yaitu istilah umum untuk penebalan dan
pengerasan arteri.
2. Aterosklerosis terjadi bila terdapat pengendapan
substansi lemak, kolesterol, cellular waste product,
kalsium, dan fibrin pada permukaan dalam arteri. Hasil
pengendapan tersebut dinamakan plaque.
3. Plaque/ateroma dibentuk oleh lemak, kolesterol, kalsium,
sel mesensimal, dan kolagen jaringan ikat. Saat plaque
terbentuk akan menyebabkan penyempitan lumen
sehingga aliran darah terganggu dan pada akhirnya
menyebabkan kurangnya aliran oksigen pada organ-organ
penting seperti otak dan jantung.
4. Aterosklerosis merupakan proses panjang yang
menyebabkan perubahan berupa obstruksi luminal oleh
bahan seluler maupun aseluler.

106 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


5. Proses aterosklerosis diawali infiltrasi low-density
lipoprotein (LDL) pada area subendotel. Sel endotel
merupakan sel dengan kecenderungan tinggi untuk
dirusak oleh aliran darah.
6. Daerah yang mudah terkena lesi adalah arteri koronaria,
aorta abdominal distal dengan cabang utamanya dan
arkus aorta dengan cabang utamanya. Lesi aterosklerosis
awal biasanya muncul di aorta
7. Lesi aterosklerosis dibagi menjadi tiga berdasarkan
tingkat keparahannya yaitu fatty streak, fibrous plaque,
dan lesi komplikasi.
8. Aterogenesis adalah suatu proses inflamasi. Proses
aterogenesis dimulai ketika lapisan endotel mengalami
kerusakan atau menjadi disfungsional. Penyebab disfungsi
endotel antara lain sheer stress yang berhubungan dengan
hipertensi, low-density lipoprotein (LDL) teroksidasi,
homosistein, dan merokok.
9. Berdasarkan hasil penelitian menunjukkan bahwa
aterosklerosis subklinis telah tampak pada arteri anak.
Lebih lanjut lagi, fatty streak telah ditemukan di arteri
fetus sebagai konsekuensi hiperkolesterolemia pada ibu
selama hamil.
10. Faktor risiko aterosklerosis dapat dibagi menjadi tiga
yaitu faktor risiko yang dapat diubah, tidak dapat diubah
dan dapat diubah secara potensial.
11. Faktor risiko utama stroke iskemia yang terdokumentasi
antara lain faktor risiko yang tidak dapat diubah yaitu
umur, jenis kelamin, ras, riwayat keluarga penderita
stroke, dan berat lahir rendah.
12. Diabetes melitus, dislipidemia, dan rokok adalah faktor-
faktor pencetus terjadinya aterosklerosis yang dapat
menyebabkan penyakit jantung dan stroke iskemia. .

Bab 4 Memahami Aterosklerosis 107


108
Bab5

Menentukan
Ketebalan
Arteri Karotis

109
5.1 Penebalan Intima Media Arteri Karotis

K
etebalan intima media arteri karotis merupakan
marker yang menggambarkan aterosklerosis
secara umum dan merupakan prediktor keadaan
pembuluh darah pada masa mendatang. Penebalan intima media
arteri karotis terbukti berhubungan dengan peningkatan risiko
stroke dan infark myocard (Rundek, etal., 2002, Brenner, etal.,
2006, Barra, etal., 2009). Peningkatan ketebalan intima media
arteri karotis ~1 mm berhubungan dengan peningkatan 12%-16%
risiko terjadinya infark myocard (Simon and Chironi, 2007).
Penebalan Carotid Intima Media (CIMT) didefinisikan sebagai
sebuah ukuran jarak antara permukaan luminal intimal dan
permukaan media adventisial pada arteri karotis. Lebih spesifik
lagi, CIMT adalah dua garis berpola yang dilihat melalui B-mode
vaskular ultrasound. Gambar ini terdiri atas persimpangan antara
lumen pembuluh dan intima, persimpangan antara media dan
adventisia (Laviakis etal., 2010). CIMT merupakan prediktor kuat
terjadinya stroke, di mana pengukuran penebalan arteri CIMT
memiliki ketepatan tinggi dalam memprediksi terjadinya infark
myokard (O'Leary, etal., 1999).
CIMT bisa menjadi skrining yang sangat optimal dikarenakan
beberapa hal seperti berikut ini.
1) CIMT dapat secara langsung menggambarkan kondisi vaskular
tidak seperti biomarker lain seperti low density lipoprotein
(LDL) atau C-reactive (protein yang jumlahnya meningkat
sebagai respon terjadinya inflamasi).

110 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


2) CIMT dengan melakukan pemeriksaan plak dapat dilakukan
pada setiap alat USG dan dapat diatur dengan kecepatan dan
biaya yang menguntungkan.
3) CIMT dapat dengan mudah diukur melalui software pendeteksi
otomatis. Pemeriksaan ini juga bebas radiasi sehingga aman
untuk dilakukan (Liviakis et al., 2010).

5.2 Hubungan Aterosklerosis dengan Penebalan


Intima Media Arteri Karotis
CIMT merupakan marker pengganti aterosklerosis yang
bermakna. CIMT dapat digunakan dalam memperkirakan terjadinya
aterosklerosis pada pembuluh darah arteri karotis. Hubungan
antara aterosklerosis dengan penebalan arteri karotis intima media
yaitu semakin tebal arteri karotis intima media, semakin tinggi
tingkat kejadian infark miokard dan stroke (Coll etal., 2008). Dalam
sebuah penelitian dijelaskan hubungan antara nilai penebalan arteri
karotis intima media dengan subtipe stroke iskemia mempunyai
nilai statistik yang signifikan berdasarkan klasifikasi TOAST (Trial
of Org 10172 in Acute Stroke Treatment). Hal ini bermakna bahwa
peningkatan nilai rata-rata CIMT berhubungan kuat dengan stroke
iskemia (Mutu, et al., 2012).
Pada studi klinis, pengukuran CIMT berhubungan dengan faktor
risiko kardiovaskular. Selama bertahun-tahun, studi klinis telah
membuktikan hasil yang mendukung peranan pengukuran CIMT
dalam memprediksi kejadian kardiovaskular (Coll, et al., 2008).
Lorenz, etal., merangkum data CIMT dari 37.000 individu dan dari
data itu dapat disimpulkan bahwa pada penambahan 0,1mm CIMT
terdapat peningkatan 10%-15% risiko mengalami infark myokard
dan peningkatan 13%-18% untuk mengalamistroke.

5.3 Ketebalan Intima Media pada Anak dan


Remaja
Pada orang dewasa, pengukuran ketebalan intima media arteri
dilakukan di arteri karotis kommunis, bulbus karotis dan arteri
karotis interna. Biasanya pengukuran dilakukan di arteri karotis
kommunis 1-2 cm di bawah bifurcatio yang mudah dilakukan pada

Bab 5 Menentukan Ketebalan Arteri Karotis 111


orang dewasa dan anak. Tempat kedua pengukuran ketebalan
intima media adalah di arteri femoralis superfisialis, pada 1/3
proksimal. Perbedaan dengan arteri karotis adalah arteri femoralis
mengandung lebih banyak sel otot polos pada tunika medianya
(Litwin and Niemirska, 2009).
Pengukuran ketebalan intima media arteri karotis telah
dilakukan pada anak dan dewasa muda dengan faktor risiko
penyakit kardiovaskular dengan tujuan evaluasi keadaan subklinis.
Peningkatan ketebalan intima media arteri karotis relatif
dibandingkan anak normal tampak pada anak dengan familial
hypercholesterolemia (FH), hipertensi, obesitas, DM tipe 1, dan
sindroma metabolik (tabel 5.1). Studi longitudinal menunjukkan
peningkatan ketebalan intima media arteri karotis pada dewasa
muda berhubungan dengan faktor risiko kardiovaskular pada anak
dengan riwayat orang tua infark myocard. Ketebalan intima media
arteri karotis juga digunakan untuk evaluasi risiko kardiovaskular
pada populasi anak dengan kondisi medis kronis seperti penyakit
renal stadium akhir, SLE, infeksi HIV, penyakit Kawasaki dan pada
pasien dengan perbaikan coartasio aorta (Urbina, et al., 2009).
Beberapa kondisi yang berkaitan dengan peningkatan ketebalan
intima media arteri karotis dapat dilihat pada tabel 5.1 berikut.

Tabel 5.1Kondisi yang berkaitan dengan peningkatan ketebalan intima


media arteri karotis
Kondisi Referensi/Rujukan
Keturunan hiperkolesterol Aggoun et al, Jrvisalo et al,
Koeijvoets et al, Tonstad et al,
Wiegman et al,
Hipertensi Lande et al, Sorof et al
Obesitas Meyer et al, Woo et al
Diabetes melitus Jrvisalo et al, Singh et al
Sindrom metabolik Lannuzzi et al
HIV Charakida et al
Penyakit Kawasaki Noto et al
Intervensi
Statin therapy Koeijvoets et al, Wiegman et al
Diet dan olahraga Woo et al
Sumber: Urbina etal., 2009

112 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Ketebalan intima media arteri karotis bervariasi tergantung
umur, jenis kelamin, dan ras pada populasi dewasa. Akan tetapi,
beberapa studi yang meneliti hubungan hal tersebut pada anak dan
remaja tidak menunjukkan perbedaan signifikan antara ketebalan
intima media arteri karotis dengan jenis kelamin. Pada 160 subjek
normal dengan usia 10 dan 18 tahun, Sass dkk., tidak menemukan
perbedaan signifikan antara hubungan umur dengan ketebalan
intima media arteri karotis. Pada populasi anak normal yang lebih
muda yaitu usia 5-14 tahun, Ishizu dkk., menunjukkan hubungan
lemah. Namun secara statistik terdapat korelasi signifikan antara
umur dengan ketebalan intima media arteri karotis. Pada studi
Cohort Jourdan dkk., pada anak dan remaja dilaporkan adanya
korelasi positif lemah antara umur dengan ketebalan intima media
arteri karotis (r=0,15) dan korelasi lebih kuat antara ketebalan
intima media arteri karotis dengan indeks massa tubuh dan tinggi
badan (Urbina etal., 2009).
Tidak diketahui apakah perubahan nilai ketebalan intima
media arteri karotis yang terjadi menunjukkan adaptasi vaskular
normal atau perubahan patologis. Bots dkk. membandingkan
antara lumen saat end diastolik terhadap ketebalan intimamedia
arteri karotis untuk studi hubungan antara shear stress dan
tekanan transmural. Botts menemukan bahwa pada derajat
ketebalan intima media arteri karotis lebih rendah, penebalan
mencerminkan adaptasi yang menyebabkan keseimbangan
antara tekanan dan aliran. Dalam keadaan melebihi level tertentu,
ketebalan intima media arteri karotis mengindikasikan perubahan
aterosklerosis yang sesungguhnya (Urbina, et al., 2009).
Terdapat banyak penelitian mengenai nilai normal ketebalan
intima media arteri karotis, antara lain Jukka dkk., pada tahun
1993 menuliskan ketebalan normal intima media arteri karotis
adalah 0,7-1,2mm. Caroll pada tahun 1995 mengatakan nilai
normal ketebalan intima media arteri karotis adalah <1,2 m. Freed
pada tahun 1998 melaporkan bahwa intima media arteri karotis
dianggap menebal bila ketebalannya >0,8 mm (Casella, etal.,
2008). Adapun nilai normal ketebalan intima media arteri karotis

Bab 5 Menentukan Ketebalan Arteri Karotis 113


dewasa berdasarkan umur yang dipakai sebagai nilai rujukan
sampai saat ini, dapat dilihat pada tabel5.2.
Pada tabel 5.2 dianggap ketebalan intima media arteri karotis
untuk usia kurang dari 35 tahun adalah sama. Belum banyak
dilakukan penelitian untuk melihat ketebalan intima media arteri
karotis pada usia kurang dari 35 tahun. Barra dkk. pada tahun 2009
melakukan pengukuran ketebalan intima media arteri karotis pada
anak usia 5-12 tahun dan mendapatkan rata-rata ketebalan intima
media arteri karotis sebesar 0,382 mm (0,062 mm) dengan rata-
rata diameter lumen 4,950mm ( 0,516 mm) (Barra, etal., 2009).

Tabel 5.2Nilai normal ketebalan intima media arteri karotis dewasa


CCA Kiri CCA Kanan
Usia (tahun)
50th perc. 75th perc. 95th perc. 50th perc. 75th perc. 95th perc.
Laki-laki
< 35 0,61 0,67 0,78 0,59 0,66 0,75
3544 0,67 0,74 0,86 0,64 0,71 0,85
4564 0,72 0,81 1,03 0,68 0,75 0,96
5564 0,77 0,89 1,15 0,74 0,84 1,05
6574 0,86 0,96 1,39 0,85 0,95 1,20
75 0,91 1,05 2,17 0,88 1,01 1,85
Perempuan
< 35 0,59 0,65 0,72 0,58 0,63 0,73
3544 0,64 0,69 0,80 0,63 0,68 0,78
4564 0,69 0,75 0,90 0,66 0,73 0,88
5564 0,74 0,83 1,02 0,71 0,88 0,97
6574 0,81 0,91 1,14 0,89 0,87 1,04
> 75 0,85 0,99 1,28 0,82 0,91 1,16
Sumber: Dietz etal., 2004

Ketebalan intima media arteri karotis pada anak dan remaja


dapat dilihat pada tabel 5.3 berikut ini.

114 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Tabel 5.3Nilai normal ketebalan intima media arteri karotis pada anak
dan remaja
Rata-
No. Jenis Mean cIMT,
rata usia Sisi Segmen Wall Referensi
subjek kelamin mm
(tahun)
11 2 30 M, F R, L CC FW 0,420,04 Jrvisalo et al
11,1 3,0 27 M, F R CC FW 0,50,03 Aggoun et al
11 1 28 M, F R, L CC FW 0,420,04 Jrvisalo et al
14,2 2,3 20 M R CC FW 0,480,06 Tonstad et al
13,9 2,4 10 F R CC FW 0,420,05 Tonstad et al
14,7 2,1 20 M, F R, L CC NW, FW 0,390,05 Meyer et al
15,7 2,7 35 M, F R, L CC FW 0,320,08 Woo et al
13,5 4,0 33 M, F R CC FW 0,380,06 Mitsnefes et al
16,3 4,7 20 M, F R CC FW 0,48008 Noto et al
11 2 60 M, F R, L CC FW 0,440,05 Ishizu et al
M indicate male; F, Female; R, rigth; L, left; CC, common carotid artery; FW, far wall; and NW,
near wall.
Sumber: Urbina etal., 2009

Berikut ini merupakan tabel ketebalan intima media arteri


karotis berdasarkan kelompok umur.

Tabel 5.4Nilai normal ketebalan intima media arteri karotis berdasarkan


kelompok umur
Kisaran Usia No. Jenis
Sisi Segmen Wall Mean cIMT, mm
(tahun) subjek kelamin
Sass etal. Unstated*
1012 23 M R, L CC 0,490,04
1012 23 F R, L CC 0,480,03
1314 13 M R, L CC 0,500,03
1314 24 F R, L CC 0,490,03
1516 20 M R, L CC 0,490,03
1516 23 F R, L CC 0,490,03
1718 17 M R, L CC 0,500,04
1718 17 F R, L CC 0,480,03
Jourdan etal. Far Wall
10,013,9 41 M R, L CC 0,380,04
10,013,9 61 F R, L CC 0,380,03
14,016,9 51 M R, L CC 0,400,04

Bab 5 Menentukan Ketebalan Arteri Karotis 115


Kisaran Usia No. Jenis
Sisi Segmen Wall Mean cIMT, mm
(tahun) subjek kelamin
14,016,9 34 F R, L CC 0,390,05
17,020,0 28 M R, L CC 0,390,03
17,020,0 32 F R, L CC 0,400,03
*Not specified.

Sumber: Urbina etal., 2009

Meskipun analisa ketebalan intima media arteri karotis


telah digunakan secara luas pada studi cross-sectional pada anak,
sedikit uji klinis yang menggunakan ketebalan intima media arteri
karotis sebagai tujuan akhir penelitian anak. Hubungan linear
positif ditunjukkan pada obesitas masa anak dan ketebalan intima
media arteri karotis saat dewasa muda. Individu yang memiliki
peningkatan indeks massa tubuh, masa anak dan remaja yang
tetap kelebihan berat badan dalam jangka waktu terlama akan
memiliki ketebalan intima media arteri karotis terbesar. Pada
penelitian dampak diet dan olah raga terhadap penanda noninvasif
aterosklerosis pada anak obesitas, Woo dkk. menunjukkan
penurunan signifikan ketebalan intima media arteri karotis dalam
intervensi 1 tahun. Temuan penelitian ini menunjukkan manfaat
ketebalan intima media arteri karotis dalam uji klinis intervensi
yang melibatkan anak dan remaja sebagai usaha mengubah sejak
dini faktor risiko kardiovaskular yang dapat dimodifikasi (Urbina
et al., 2009).

5.4 Pengukuran Ketebalan Intima Media Arteri


Karotis
Pengukuran ketebalan intima media arteri karotis telah
dilakukan pada penelitian lebih dari 20 tahun, penggunaan klinis
sejak tahun 2002. Pengukuran ketebalan intima media arteri
karotis sudah diuji validitasnya pada banyak jurnal dengan reputasi
baik. Pengukuran ketebalan intima media artori karotis juga telah
digunakan pada studi epidemiologis dan telah direkomendasikan
oleh American Heart Association sebagai tes rutin pada usia lebih 45
tahun atau lebih muda bila memiliki banyak faktor risiko (riwayat

116 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


keluarga, hiperlipidemia, dyslipidemia, hipertensi, sindrom
metabolik). Pada tahun 2003 American College of Cardiology telah
merekomendasikan pengukuran ketebalan intima media sebagai
screening tool yang efektif (Cardiorisk, 2009). Saat ini, pengukuran
ketebalan intima media arteri karotis merupakan prosedur standar
pada orang dewasa dengan faktor risiko kardiovaskuler (Litwin
and Niemirska, 2009). Publikasi mengenai pengukuran ketebalan
intima media arteri karotis pada anak yang termasuk kelompok
risiko tinggi seperti hipertensi, diabetes, penyakit ginjal kronis,
obesitas, hiperlipidemia dan homosisteinuria juga semakin banyak
(Litwin and Niemirska, 2009).
Pengukuran ketebalan intima media arteri karotis dilakukan
dengan ultrasonografi. Ultrasonografi dapat menampilkan
visualisasi dinding arteri pada tiap tahapan aterosklerosis, dari
normal sampai oklusi arteri total. Ultrasonografi karotis dapat
mengevaluasi diameter lumen pembuluh darah, ketebalan intima
media dan menilai plaque serta perluasannya (Dietz, etal., 2004).
Secara umum, pemeriksaan ultrasonografi pada arteri karotis
dilakukan dengan tujuan untuk menilai ketebalan rata-rata intima
media, mengukur grading fokal plaque (index plaque) dan rasio
velocity, serta menentukan apakah plaque mempengaruhi aliran
darah pada arteri karotis interna (Casella, et al., 2008).
Pada tahun 1982, Zwibel dan James pertama kali men
deskripsikan gambaran suatu garis yang dilihat menggunakan USG
pada dinding arteri dan menyebutnya dengan the I and M lines.
Wendelhag dkk. pada tahun 1991 menyatakan bahwa pengukuran
ketebalan intima media arteri karotis bisa dilakukan pada ukuran
near wall maupun far wall. Akan tetapi, pengukuran near wall
arteri karotis lebih sulit karena struktur ekhogenik tunika
adventisianya. Wong dkk. (1993) serta Wikstrand dan Wendelhag
(1994) menyimpulkan bahwa hanya far wall arteri karotis yang
dapat diukur secara akurat dengan USG (Casella, et al., 2008).

Bab 5 Menentukan Ketebalan Arteri Karotis 117


Sumber: Casella, etal., 2008
Gambar 5.1Ketebalan intima media arteri karotis

Lapisan dinding arteri karotis dapat dibedakan dengan USG 2


dimensi di beberapa lokasi. Penelitian yang mengevaluasi ketebalan
intima media arteri karotis pada anak dan dewasa memiliki
berbagai variasi dalam metode analisa meliputi pengukuran arteri
karotis kommunis, bulbus karotis, arteri karotis interna atau indeks
untuk menentukan lokasi multipel, bagian dinding dekat atau jauh,
serta perbedaan waktu pengukuran berdasar siklus jantung. Plaque
karotis dan karakteristik anatomi sering mempengaruhi hasil
pemeriksaan (Urbina, et al., 2009).
Beberapa protokol pengukuran ketebalan intima media arteri
karotis yang bervariasi telah digunakan untuk menentukan risiko
kardiovaskular pada orang dewasa. Protokol yang ketat digunakan
pada ACAPS (Asymptomatic Carotid Progression Study) yang sering
kali digunakan dalam studi risiko kardiovaskular pada orang
dewasa. Protokol skaning pada ACAPS meliputi imaging pada
kedua arteri karotis kanan dan kiri dengan identifikasi sisi dinding
terdekat (bagian terdekat dengan permukaan kulit) dan sisi dinding
terjauh (bagian terjauh dari permukaan kulit) dari 3 segmen arteri

118 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


yaitu bifurkatio karotis dimulai 8 mm proksimal dari arteri karotis
interna, pada ujung aliran terbagi menjadi arteri karotis interna
dan eksterna. Arteri karotis kommunis 8-16mm proksimal dari
aliran terbagi. Nilai rata-rata dari pengukuran ketebalan intima
media arteri karotis maksimal digunakan sebagai hasil pengukuran
pada teknik ACAPS. Peneliti ACAPS juga menunjukkan penentuan
ketebalan intima media arteri karotis yang dapat dipercaya. Mereka
menekankan pentingnya keseragaman monitoring pelatihan dan
penampilan di seluruh periode studi untuk mempertahankan
pengukuran ketebalan intima media arteri karotis yang berkualitas
tinggi dan dapat direproduksi (Urbina, etal., 2009).
Protokol lain yang digunakan pada pasien dewasa adalah
ARIC (Atherosclerosis Risk In Communities). Protokol ARIC serupa
dengan ACAPS, namun hanya mengukur sisi dinding yang jauh dari
6 lokasi (karotis kommunis distal, bifurkatio karotis dan karotis
interna proksimal bilateral). Peneliti ARIC melaporkan distribusi
ketebalan intima media arteri karotis pada populasi dewasa usia
45-64 tahun dalam jumlah besar yang dikelompokkan berdasar
ras dan jenis kelamin. Persentase pasien yang diperiksa juga dibagi
dalam subgrup (misalnya laki-laki kulit hitam, wanita kulit hitam,
laki-laki kulit putih dan wanita kulit putih). Segmen arteri karotis
kommunis ditampilkan secara adekuat pada 89%-92% pasien,
bifurkatio karotis pada 68-82% dan arteri karotis interna pada
37%-63%. Imaging arteri karotis interna terbatas pada wanita dan
dapat digambarkan secara adekuat hanya 37% pada wanita kulit
putih dan 41% pada wanita kulit hitam. Pada penelitian Crouse
dkk. lebih dari 99% arteri karotis kommunis, 94% bulbus karotis
dapat dievaluasi secara adekuat, namun 78% arteri karotis interna
yang dapat dievaluasi. Evaluasi dari sisi dinding terdekat juga
dilaporkan tidak berhasil (Urbina et al., 2009).
Walaupun landmark studi pada orang dewasa telah meng
kombinasikan pengukuran sisi terdekat dan terjauh dinding
arteri untuk menentukan ketebalan intima media arteri karotis,
mayoritas studi pada pediatrik terfokus pada penentuan dinding
terjauh arteri karotis yang tervisualisasi. Pada studi in vitro yang
dilakukan oleh Montauban dkk. hubungan antara analisa USG dan

Bab 5 Menentukan Ketebalan Arteri Karotis 119


histologi intra dan ekstravaskular pada dinding terdekat dan terjauh
dilakukan. Korelasi antara pengukuran USG dan histologi dinding
terjauh ekstravaskular dan intravaskular memiliki koefisien
korelasi 0,91 dan 0,87. Korelasi antara pengukuran histologi
dinding terdekat ekstravaskular dan intravaskular memiliki
koefisien 0,49 dan 0,37. Dari hasil penelitian tesebut disimpulkan
bahwa terdapat keterbatasan dan kesalahan dalam penentuan
batas tepi ekogenik dari sisi terdekat dinding ekstravaskuler yang
menjelaskan perbedaan observasi. Penemuan ini menunjukkan
bahwa penentuan sisi dinding terjauh pembuluh darah dengan
batas tepi pertemuan lumen-intima dan media-adventisia lebih
akurat dalam mencerminkan ketebalan sesungguhnya dari
kompleks intima media. Dari analisa Espeland dkk. hubungan
antara ketebalan intima media arteri karotis dan faktor risiko lebih
kuat dengan pengukuran sisi dinding terjauh dibandingkan sisi
dinding terdekat arteri karotis (Urbina, etal.,2009).
Perbedaan hubungan antara letak spesifik arteri karotis dan
risiko kardiovaskular juga telah diteliti. Hubungan lebih kuat antara
faktor risiko dan ketebalan intima media arteri karotis diukur
pada bifurkatio dan segmen arteri karotis interna dibandingkan
dengan segmen arteri karotis kommunis. Beberapa studi telah
menunjukkan nilai pengukuran arteri karotis kommunis dalam
memprediksi kejadian penyakit koroner dan mengidentifikasi
pasien berisiko tinggi, sedangkan penelitian yang lain
menunjukkan meskipun rata-rata pengukuran di 12 lokasi lebih
informatif untuk menjelaskan aterosklerosis, penentuan ketebalan
intima media arteri karotis dalam analisa arteri karotis interna dan
bulbus karotis memberikan sedikit tambahan kekuatan prediksi
(Urbina, etal., 2009).
Sejumlah studi tidak mengkhususkan tujuan siklus jantung
saat pengukuran ketebalan intima media arteri karotis. Para
peneliti lebih sering memberi frame pada bagian yang dipilih atas
dasar kompleks intima media yang tervisualisasi paling baik dan
paling tebal. Pada studi yang mengkhususkan waktu pengukuran,
sering kali dipilih end diastolic. Evidence menunjukkan ketebalan
intima media arteri karotis tidak berbeda ( 5%) antara diameter

120 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


lumen maksimal dan minimal, dengan ketebalan intima media
arteri karotis sedikit menebal saat diameter lumen mengecil yaitu
pada end diastolic. Penelitian ini menunjukkan bahwa standarisasi
pengukuran ketebalan intima media arteri karotis harus dibuat
pada siklus kardia yang sama (Urbina, et al., 2009).
Seperti dijelaskan di atas, kebanyakan studi pediatrik fokus
dalam penentuan sisi dinding terjauh segmen arteri karotis
kommunis. Lokasi dan jumlah lokasi spesifik yang dianalisa
bervariasi antar studi. Rata-rata pengukuran sisi dinding terjauh
di 10 mm distal arteri karotis kommunis di kedua sisi kiri dan
kanan, telah digunakan untuk evaluasi ketebalan intima media
arteri karotis pada sejumlah studi cross sectional pada pasien anak
dengan hipertensi, diabetes melitus dan penyakit ginjal kronis.
Beberapa studi cross sectional telah menggunakan rata-rata dari
pengukuran dinding sisi terdekat dan terjauh, pengukuran kedua
sisi maupun berbagai segmen arteri (Urbina, et al., 2009).
Beberapa uji klinis pada anak yang memakai ketebalan
intima media arteri karotis sebagai tujuan akhir, dua penelitian
menggunakan lokasi multipel arteri karotis, sedangkan Woo dkk.
menggunakan sisi dinding terjauh untuk arteri karotis kommunis
kanan dan kiri untuk mengevaluasi efek diet dan olah raga pada
anak obesitas. Protokol yang sama digunakan pada dua penelitian
menentukan efek terapi statin terhadap ketebalan intima media
arteri karotis. Untuk penelitian tersebut, rata-rata sisi dinding
terjauh di ukuran pada 6 lokasi (arteri karotis kommunis distal,
bulbus karotis dan arteri karotis interna kanan dan kiri) (Urbina,
etal., 2009).

Rangkuman
1. Ketebalan intima media arteri karotis merupakan marker
yang menggambarkan aterosklerosis secara umum dan
merupakan prediktor keadaan pembuluh darah pada
masa mendatang.

Bab 5 Menentukan Ketebalan Arteri Karotis 121


2. Penebalan Carotid Intima Media (CIMT) didefinisikan
sebagai sebuah ukuran jarak antara permukaan luminal-
intimal dan permukaan media-adventisial pada arteri
karotis. CIMT adalah dua garis berpola yang dilihat
melalui B-mode vaskularultrasound.
3. Hubungan antara aterosklerosis dengan penebalan intima
media arteri karotis yaitu semakin tebal arteri karotis
intima media, semakin tinggi tingkat kejadian infark
miokard dan stroke.
4. Peningkatan ketebalan intima media arteri karotis relatif
dibandingkan anak normal tampak pada anak dengan
familial hypercholesterolemia (FH), hipertensi, obesitas,
DM tipe1 dan sindroma metabolik.
5. Ketebalan intima media arteri karotis bervariasi
tergantung umur, jenis kelamin, dan ras pada populasi
dewasa.
6. Individu yang memiliki peningkatan indeks massa tubuh,
masa anak dan remaja yang tetap kelebihan berat badan
dalam jangka waktu terlama akan memiliki ketebalan
intima media arteri karotis terbesar.
7. Pengukuran ketebalan intima media arteri karotis
dilakukan dengan ultrasonografi. Secara umum,
pemeriksaan ultrasonografi pada arteri karotis dilakukan
dengan tujuan untuk menilai ketebalan rata-rata intima
media, mengukur grading fokal plaque (index plaque)
dan rasio velocity, serta menentukan apakah plaque
mempengaruhi aliran darah pada arteri karotis interna.

122 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Bab6

Monocyte
Chemoattractant
Protein-1
(MCP-1)

123
6.1 Peran MCP-1 pada Terjadinya Aterosklerosis

M
CP-1 merupakan kandidat kemokin yang berperan
pada patogenesis kondisi yang berkaitan dengan
aterosklerosis seperti stroke iskemia dan infark
myocard. Kemokin (chemotactic cytokines) adalah polipeptida
dengan berat molekul rendah, mempunyai fungsi kemotaktik yang
poten dan efek aktivasi pada populasi leukosit spesifik (Koyanagi
etal., 2000). Kemokin merupakan protein heparin-binding kecil
yang secara selektif merekrut monosit, neutrofil dan limfosit pada
daerah injury pembuluh darah, inflamasi, dan perkembangan
aterosklerosis. Terdapat 50 khemokin yang terbagi menjadi 3
famili utama berdasar perbedaan struktur dan fungsinya.
Famili terbesar dikenal dengan C-C chemokines karena
dua residu sistein pertama dari empat sistein yang merupakan
karakteristik chemokines berdekatan. C-C chemokin cenderung
menarik sel mononuclear dan terdapat pada inflamasi kronis. C-C
chemokines dengan karakteristik sempurna adalah MCP-1 (juga
disebut CCL2), monosit agonis yang paling poten, memori sel T,
dan basofil. MCP-1 merupakan pemain kunci rekrutmen monosit
dari darah pada lesi dini aterosklerosis, perkembangan hiperplasia
intima setelah angioplasti, serta vaskulogenesis pada trombosis.
Family lain dari C-C chemokines antara lain RANTES (CCL5),
macrophage inflammatory protein1 (MIP-1 / CCL3), dan MIP-1
(CCL4) (Charo and Taubman, 2004).
CC chemokine ligand (CCL) lebih dikenal dengan Monocyte
Chemoattractant Protein-1 (MCP-1) merupakan sel attractant
mononuclear yang potent. MCP-1 sudah diketahui mempunyai
implikasi pada perkembangan stroke iskemia dan infark myocard.
Pada penelitian dengan hewan uji, level mRNA MCP-1 tinggi
ditemukan di otak, 6 jam setelah terjadi iskemia (Arakelyan, etal.,

124 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


2005). Level kemokin tidak dipengaruhi oleh faktor risiko yang telah
diketahui untuk stroke iskemia dan infark myocard seperti hipertensi,
diabetes, merokok, dan konsumsi alkohol (Manolio, etal., 2004).
MCP-1 diproduksi oleh berbagai tipe sel termasuk monosit,
sel otot polos, dan sel endothel secara terus-menerus, atau setelah
induksi oleh stress oxidative, sitokin atau faktor pertumbuhan.
Peningkatan ekspresi mRNA atau protein MCP-1 ditemukan pada
hewan atau manusia dengan arteriosklerosis atau aterosklerosis
(Koyanagi, etal., 2000). MCP-1 mempunyai peranan penting pada
proses penebalan lapisan media pembuluh darah koroner setelah
inhibisi sintesis Nitric Oxide dengan merekrut dan mengaktivasi
monosit (Koyanagi, etal., 2000). MCP-1 bekerja melalui reseptor
CCR2, mempunyai peran penting merekrut monosit pada stadium
dini aterosklerosis dan hiperplasia intima setelah injury arteri
(Charo and Taubman, 2004). Penelitian yang dilakukan oleh Boring
dkk. menunjukkan bahwa delesi gen CCR2 (reseptor untuk MCP-1)
secara parsial mensupresi pertumbuhan lesi atherosklerotik pada
tikus defisiensi apoprotein-E dengan menginhibisi rekrutmen
monosit. Hasil penelitian tersebut memperlihatkan pentingnya
jalur MCP-1/CCR2 pada perkembangan aterosklerosis, terutama
pada keadaan hiperkolesterolemia (Koyanagi, et al., 2000).

Arah aliran

I. Berguling II. Menangkap III. Menyebar IV. Diapedesis


Cytokines MCP-1
Ox LDL MCP-1

Ox LDL
Cytokines
MCP-1 MCP-1
SMC Sitokin

Growth factors
Makrofag
Kemokin
Sel busa
Sumber: Charo and Taubman, 2004

Gambar 6.1Peran MCP-1

Bab 6 Monocyte Chemoattractant Protein-1 (MCP-1) 125


6.2 Polimorfisme MCP-1
Kadar plasma MCP-1 diketahui meningkat 2 kali pada pasien
stroke iskemia dan infark myocard dibandingkan dengan kontrol
normal. Walaupun kenaikan ini tidak terkait dengan faktor risiko
lainnya seperti misalnya hipertensi, kebiasaan merokok, konsumsi
alkohol serta faktor lain seperti misalnya umur dan gender. Dari
hasil penelitian ini disimpulkan bahwa kenaikan kadar MCP-1
merupakan akibat dari proses inflamasi yang terjadi pada daerah
plaque aterosklerosis yang selanjutnya memicu stroke iskemia dan
infark myocard (Arakelyan, et al., 2005).
Polimorfisme MCP-1 terkait dengan peningkatan kadar plasma
MCP-1 SNP A-2518G yang terletak pada daerah promoternya dan
diketahui mempengaruhi aktivitas transkripsi gen ini, di mana genotip
AA memiliki kadar MCP-1 plasma yang lebih rendah daripada genotip
GG atau AG (Tabara, et al., 2003, Bucova, et al., 2009). Penelitian lain
yang dilakukan oleh Brenner, 2006 membuktikan bahwa SNP G-927C
dan A-2578G secara signifikan memberikan pengaruh terhadap
penebalan intima media arteri karotis. SNP A-2578G telah diteliti
pada berbagai populasi dan terbukti terkait dengan pembentukan
ketebalan intima media arteri karotis, sementara SNP G-927C belum
banyak diteliti (Brenner, etal., 2006).

Rangkuman
1. MCP-1 merupakan kandidat khemokin yang berperan
pada patogenesis, yaitu kondisi yang berkaitan dengan
aterosklerosis seperti stroke iskemia dan infark myocard.
2. Khemokin merupakan protein heparin-binding kecil yang
secara selektif merekrut monosit, neutrofil dan limfosit
pada daerah injury pembuluh darah, inflamasi, dan
perkembangan aterosklerosis.
3. Polimorfisme MCP-1 terkait dengan peningkatan kadar
plasma MCP-1 SNP A-2518G yang terletak pada daerah
promoternya dan diketahui mempengaruhi aktivitas
transkripsi gen ini, di mana genotip AA memiliki kadar
MCP1 plasma yang lebih rendah daripada genotip GG
atauAG.

126 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Bab7

Memahami
Osteopontin
(OPN)

127
O
PN merupakan glikoprotein yang pertama kali
ditemukan di osteoblas pada tahun 1986. Definisi secara
harfiah, osteo berarti protein yang diekspresikan di
tulang. Sedangkan pontin berasal dari bahasa Latin pons yang
berarti jembatan yang menjelaskan peranan osteopontin sebagai
protein penghubung (Gursoy et al., 2010).

7.1. Fungsi Osteopontin (OPN)


Dalam keadaan iskemia otak, kadar OPN meningkat, dilihat
pertama kali di mikroglia dan makrofag yang ditemukan di regio
infark dan periinfark. Ekspresi OPN paralel dengan waktu infiltrasi
makrofag ke infark dan ekspresi CD44 yang merupakan reseptor
OPN. Ekspresi astrosit, reseptor OPN lain yaitu integrin v 3,
paralel dengan waktu temporal upregulasi OPN pada iskemia. OPN
merupakan kemoatraktan yang merekrut mikroglia, makrofag, dan
astrosit untuk membantu pembentukan glial scar setelah injuri
iskemia (Meller, et, al., 2005).
Osteopontin dan reseptor integrin mempunyai fungsi pada
kelangsungan hidup sel, fungsi yang berkebalikan dengan jalur
apoptotik atau meningkatkan pertumbuhan sel. OPN bekerja
melalui jalur intraseluler multipel dan efektor downstream (Kurata,
etal., 2006).
Osteopontin merupakan fosfoprotein multifungsional
yang disekresikan oleh berbagai tipe sel, seperti osteoblas,
limfosit, makrofag, sel epitel dan VSMCs (vascular smooth muscle
cells) (Kurata, et al., 2006). OPN merupakan matriks protein
ekstrasellular yang tersusun dari sequence Arg-Gly-Asp seperti
fibronektin, vitronektin dan kolagen dan berfungsi sebagai sitokin
pro-inflammatory (Isoda, etal., 2002, Kurata, et al., 2006).

128 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


OPN adalah sitokin multifungsional dan protein adesi yang
berhubungan dengan berbagai proses fisiologi dan patologi,
termasuk di dalamnya pembentukan kembali tulang, meningkatkan
aktivitas imun yang dimediasi sel, menjaga integritas sel
selama terjadinya proses inflamasi, dan metastase sel tumor.
(Mazzali, etal., 2002, Meller et al., 2005). OPN mensekresikan
phosphoprotein glycosylate yang ditemukan di semua cairan
tubuh dan terdapat sebagai protein matriks ekstraseluler yang
terimmobilisasi di jaringan mineralisasi. Regulasi ekspresi OPN
dipengaruhi oleh stimuli mediator proinflamasi, hormon, growth
factors dan stressormekanik.
OPN memiliki struktur protein yang kompleks. OPN terdiri dari
sekitar 300 asam amino, tergantung pada spesiesnya (Giacopelli,
et al., 2004). Protein ini mengandung motif Arg-Gly-Asp (RGD)
yaitu bagian dari glikoprotein ekstraseluler yang memediasi
penempelan dengan sel melalui ikatannya dengan reseptor
integrin. Protein ini dapat ditemukan pada seluruh cairan tubuh,
pada jaringan bentuk matriks protein ekstraseluler dan sebagai
sitokin pada cairan tubuh yang bisa menempati beberapa reseptor
termasuk V-3 dan reseptor integrin lainnya, dan protein ini juga
bisa menjadi ligan untuk beberapa variasi bentuk CD44. Interaksi
OPN dengan reseptor dan ligan tersebut menyebabkan aktifnya
jalur signaling sel, memediasi interaksi sel matriks dan interaksi
sel-sel (Giacopelli, et al., 2004)
COOH

-helix
heparin binding site
hydroxyapatite binding site
-sheet
calcium binding site
NH2
Sumber: Isoda, etal., 2002
Gambar 7.1Struktur osteopontin

Bab 7 Memahami Osteopontin (OPN) 129


OPN bekerja pada sejumlah tipe sel (sel endotel, fibroblas,
sel otot polos, makrofag) melalui RGD (arginineglycineaspartic
acid) motif yang berikatan dengan beberapa integrin v (1, 2 atau
5) dan (4, 5, 8 atau 9) 1, dan berbagai isoform CD44. Hasil
akhir signal yang dihantarkan oleh OPN tergantung pada reseptor
partikel yang terlibat, konteks seluler dan jalur transduksi signal
yang digunakan. Efek downstream signalling OPN sangat kompleks
dan sulit untuk mengelusidasi peranan biologi yang pasti
untukOPN.
Penelitian menggunakan OPN knockout mice atau OPN
rekombinan menunjukkan OPN mungkin mempunyai fungsi
penting pada kelangsungan hidup sel dan memelihara integrasi
jaringan pada keadaan injuri (Mazzali, etal., 2002). Beberapa
penelitian menunjukkan OPN terlibat dalan respons seluler
terhadap iskemia injury. Efek murni OPN pada kondisi iskemia
sangat sulit dievaluasi karena OPN mempunyai efek promote cell
survival, efek proinflamasi dan antiinflamasi (Meller, etal., 2005).
Adanya lesi ateroskelrosis ditandai dengan tingginya kadar
mediator inflamasi (Scetana, etal., 2007). Mediator inflamasi ini
merupakan prediktor adanya gangguan kardiovaskular seperti
penyakit jantung koroner, stroke dan gagal jantung kongestif
(Kurata, etal., 2006; Ohmori, etal., 2003; Scetana, et al., 2007;
Luomala, etal., 2007). OPN juga merupakan mediator proinflamasi
yang dapat mempercepat proses terjadinya inflamasi pada penyakit
vaskular (Luomala, etal., 2007). Sehingga dapat diartikan bahwa
peningkatan ekspresi OPN akan sebanding dengan perkembangan
kondisi aterosklerosis (Ohmori, etal., 2003; Golledge, et al., 2004).
Secara fungsional, OPN mempunyai peranan penting pada
proses fisiologis normal dan patologis. Selama perkembangan fetus
in utero, ekspresi OPN terdapat selama gastrulasi di notochord dan
interface embryonicmaternal, di regio kondensasi kartilago dan
pembentukan tulang serta sejumlah jaringan epitel. Pada manusia
dewasa protein OPN hanya terdapat di tulang, ginjal dan lapisan
epitel. Secara klinis, level OPN plasma meningkat pada beberapa
kelainan seperti inflamasi kronis termasuk Chrons disease,
beberapa tipe kanker, penyakit autoimun dan obesitas. Level OPN

130 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


plasma secara signifikan berhubungan dengan kejadian serta
tingkat keparahan penyakit kardiovaskular. Level OPN plasma
lebih tinggi pada post restenosis, adanya klasifikasi pembuluh
darah dan aneurisma aorta abdominalis (Scatena, et al., 2007).
Osteopontin diduga berperan dalam biomineralisasi, penyem
buhan luka, invasi tumor, metastase sel kanker, cell survival serta
aktivasi fungsi leukosit yang dapat dilihat pada gambar 7.2 (Sase,
et al,. 2012).

Biomineralisasi
Regulasi resorpsi
tulang normal Kanker biologi
Inhibisi kristalisasi Invasi tumor
urin dan kalsifikasi
kardiovaskular Metastasis

iNos regulasi sel Fungsi leukosit


epitelium
Produksi sitokin
Sel Epitel OPN makrofag
Makrofag
Aktivasi sel T

Perbaikan luka Survival sel


Proliferasi sel Sel epitell
Sel endotel
Fibrosis Sel otot polos

Sumber: Sase, et al., 2012


Gambar 7.2Fungsi biologis OPN

Secara umum, OPN melakukan dua aktivitas, adesi (menem


pel) dan migrasi (berpindah). Aktivitas adesi ini disebabkan
kandungan motif RGD yang mampu berikatan dengan reseptor
integrin. Secara fungsional, OPN mempunyai fungsi penting dalam
keadaan fisiologi normal juga pada proses patologis. Selama
proses tumbuh kembang, osteopontin berperan dalam proses

Bab 7 Memahami Osteopontin (OPN) 131


gastrulasi pada notochord dan pada bagian kondensasi kartilago
dan pembentukan tulang dan jaringan epitel (Scatena, etal., 2007).
Dalam reaksi inflamasi, OPN dapat mengaktivasi migrasi
makrofag dan menstimulasi migrasi sel otot polos dari bagian
medial ke bagian intima. Aktivasi makrofag dan stimulasi sel
otot polos ini menyebabkan peningkatan jumlah sel busa seperti
yang terjadi pada proses aterosklerosis. OPN diekspresikan pada
makrofag setelah terjadinya luka miokard dan selama pemulihan
luka pada kulit. Selain itu, ekspresi antisense OPN dapat
menurunkan tumorigenisitas dan kemampuan metastasis sel
(Nau, 2000).
OPN berfungsi sebagai adhesi sel dan migrasi molekul yang
dapat berikatan dengan beberapa ligan termasuk v3, integrin,
CD44 dan fibronectin (Isoda etal., 2002). Penelitian invitro
menunjukkan OPN mendorong adhesi dan migrasi makrofag
serta proliferasi VSMC. Pada tikus transgenik, overekspresi OPN
menyebabkan peningkatan ketebalan lapisan intima media dan
pembentukan lapisan neointima arteri setelah injuri (Isoda, etal.,
2002). Pada manusia, ekspresi OPN mRNA didapatkan pada lesi
aterosklerosis arteri karotis, arteri koronaria dan aorta. Level
OPN plasma lebih tinggi pada penderita CAD (coronary artery
disease) dan berhubungan dengan tingkat keparahan CAD (Kurata,
etal.,2006).
OPN berperan dalam biomineralisasi, proses yang sangat
penting dalam remodelling tulang. Osteopontin menghambat
pembentukan osteoklas menjadi matriks mineral tulang hidroksi
apatit [Ca(PO4)(OH)2]. Kekurangan mineral ini dapat menyebabkan
terjadinya osteoporosis. OPN diekspresikan oleh osteoklas dan
osteoblas yang sama-sama berperan dalam remodelling tulang.
Secara normal, selama proses mineralisasi tulang, OPN yang
diekspresikan oleh osteoklas akan menghambat pembentukan
mineral hidroksi apatit (Sase, etal., 2012).
OPN juga berperan sebagai perlekatan sel dan perpindahan
molekul yang dapat berikatan dengan beberapa ligan seperti
integrin v3, CD44, dan fibronektin. OPN juga merupakan

132 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


faktor kunci dalam remodelling vaskular maupun perkembangan
aterosklerosis. Studi in vitro menunjukkan bahwa OPN juga
meningkatkan proliferasi otot polos pembuluh darah pada
tikus dan otot polos pembuluh darah arteri koroner manusia.
Berdasarkan penelitian ini, ekspresi berlebihan OPN berhubungan
dengan peningkatan ketebalan medial secara signifikan seiring
dengan peningkatan usia serta penebalan intimal setelah adanya
injury pada arteri (Isoda, etal., 2002).
Selain itu, OPN juga berperan dalam cell survival. OPN, baik
yang bekerja sebagai sitokin maupun yang tidak termobilisasi
ke jaringan dan berfungsi sebagai matriks protein ekstraseluler,
berfungsi memproteksi sel dari apoptosis dan menginduksi
proliferasi serta pertahanan dari beberapa jenis sel seperti sel-
sel otot polos dan epitel. OPN di permukaan sel endotel OPN akan
melindungi sel dari apoptosis yang diinduksi oleh TRAIL. Fungsi
ini dimediasi oleh aktifasi integrin v3 dan nuclear factor kappa B
(NF-kB). OPN akan menginduksi aktifasi NF-kB di sel endotel yang
akan menyebabkan peningkatan ekspresi dari osteoprotegerin
(OPG). OPG ini akan membentuk kompleks dengan TRIAL yang
akan menghambat proses apoptosis (Standal, etal., 2004)

7.2 Peranan Osteopontin pada Kelainan


Pembuluh Darah

7.2.1 Remodelling dan biomineralisasi


OPN di reekspresi pada proliferasi dan migrasi sel pembuluh
darah berhubungan dengan pembentukan neointima dan sel
inflamasi. Pada lesi aterosklerosis, ekspresi OPN terdapat pada
sel otot polos pada lesi, sel endotel angiogenik dan makrofag. OPN
juga direekspresi di sel otot polos pada lesi restenotik (Scatena,
etal., 2007).

7.2.2 Inflamasi pembuluh darah dan aterosklerosis


Pada hewan coba, OPN terbukti mempunyai peranan penting
pada terjadinya aterosklerosis. Ekspresi gen OPN distimulasi oleh

Bab 7 Memahami Osteopontin (OPN) 133


TNF (tumour necrosis factor), IL1 (interleukin-1), iNOS
(inducible nitric oxide synthase), hipoksia dan angiotensin II. OPN
mengaktivasi makrofag dan sel T melalui reseptor v3 atau CD44
untuk memproduksi sitokin lain. OPN mempunyai kemampuan
untuk menstimulasi proliferasi dan migrasi VSMCs melalui integrin
v3 pada remodeling pembuluh darah (Kurata, etal., 2006).
OPN sudah diidentifikasi sebagai komponen lesi aterosklerosis
manusia yang prominen yang disintesis oleh derivat sel monosit/
makrofag dan endotel dan VSMC dalam jumlah lebih kecil
(Minoretti, etal., 2006). OPN diketahui mempunyai efek induksi
pergerakan kemotaktik beberapa sel yang terlibat dalam proses
aterosklerosis seperti VSMC dan makrofag, mempunyai kapasitas
menginduksi proliferasi VSMC dan menghambat ekspresi nitric
oxide synthase di makrofag dan sel endotel. OPN berperan pada
proses inflamasi dalam dinding arteri pada aterogenesis dan
disrupsi plaque (Scatena, etal., 2007).

7.3 Hubungan Osteopontin dengan Penebalan


Intima Media Arteri Karotis
OPN direekspresikan dalam proses proliferasi dan migrasi sel
pada pembuluh darah yang berhubungan dengan pembentukan
neointima dan pada sel inflamasi, lesi aterosklerosis manusia, sel
endotel angiogenik, dan pada makrofag. OPN juga diekspresikan
pada sel otot polos yang berhubungan dengan lesi restenotik
(penyempitan pembuluh darah yang terjadi kembali) manusia
(Scatena, etal., 2007).
Penelitian terbaru menunjukkan bahwa ekspresi berlebih
OPN menyebabkan menebalnya lapisan medial dan meningkatkan
formasi neointima. Hal tersebut terjadi karena peningkatan
proliferasi sel otot polos produksi MMP (matrix-metalloproteases)
yang distimulasi oleh OPN melalui aktivasi nF-B. Saat terjadi
luka, sel otot polos akan bermigrasi ke area luka dan menginduksi
terjadinya restenosis. Dalam hal ini, restenosis merupakan meka
nisme perbaikan pada pembuluh darah setelah terjadinya luka.
Dalam proses ini, ekspresi berlebih OPN dapat meningkatkan

134 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


respon proliferasi neointimal yang selanjutnya akan berkembang
menjadi restenosis. Dalam penelitian ini dapat disimpulkan
penghambatan pada ekspresi gen OPN pada area luka dapat
menjadi terapi untuk mencegah terjadinya restenosis (Isoda,
etal.,2002).

7.4 Peranan Osteopontin sebagai


Neuroprotektif pada Stroke
Osteopontin (OPN) adalah protein multifungsi yang memliki
fungsi biologis berkebalikan. Selain berperan dalam proses
inflamasi, migrasi sel dan proses apoptosis, OPN juga berperan
sebagai agen neuroprotektif potensial untuk stroke iskemia akut.
Dalam penelitian yang dilakukan oleh Mellert, etal. tahun 2005,
dinyatakan bahwa osteopontin dapat mengurangi kematian sel
pada stroke iskemia secara signifikan pada penelitian in vitro
maupun in vivo. Saat OPN eksogen diadministrasikan pada tikus
model stroke, didapatkan hasil bahwa OPN dapat menginduksi
marker protektif yang melawan kerusakan sel pada stroke iskemia.
Efek neuroprotektif OPN ini dimediasi melalui jalur PI3K/Akt
dan diaktifasi melalui kaskade p42/44 MAPK. Aktifasi dari Akt
dan p24/44 MPK ini dapat meningkatkan fosforilasi Bad (protein
yang berfungsi sebagai pro cell death). Efek ini dihambat oleh
inhibitor reseptor integrin RGD (arginine-glysine-aspartate) yang
menandakan bahwa efek neuroprotektif terjadi melalui ikatan OPN
dengan reseptor integrin (Meller, etal., 2005). Aktifasi integrin
pada sel saraf akan meningkatkan toleransi sel saraf terhadap
toksisitas glutamat (Meller, etal., 2005). Penelitian sebelumnya
melaporkan bahwa OPN dapat mengaktifasi beberapa mekanisme
cell survival, antara lain menurunkan induksi sintesis nitrat oksida
(Denhardt, etal., 1995), meningkatkan aktifitas NF-k (Das etal.,
2003), dan meningkatkan aktifasi PI3K (Zheng, etal., 2000).
Berdasarkan hasil penelitian tersebut, OPN dapat berperan
sebagai agen neuroprotektif yang mampu memberikan efek terapi
pada pengobatan stroke iskemia. Namun, penggunaannya dapat
terhambat masalah rute pemakaian di mana hanya protein-protein

Bab 7 Memahami Osteopontin (OPN) 135


tertentu sajalah yang dapat diadministrasikan secara langsung
ke otak, sehingga dibutuhkan penelitian lebih lanjut. Penelitian
tentang OPN mimetik yang memiliki kemiripan struktur serta
mampu meningkatkan potensi dan efek farmakokinetiknya dapat
dijadikan sebagai salah satu inovasi dalam pengembangan OPN
sebagai agen terapetik pada stroke iskemia. Oleh karena itu, OPN
ataupun analog OPN dapat menjadi inovasi desain obat yang efektif
pada pengobatan stroke iskemia (Meller, etal., 2005).

Rangkuman
1. Definisi secara harfiah, osteo berarti protein yang
diekspresikan di tulang. Sedangkan pontin berasal
dari bahasa Latin pons yang berarti jembatan yang
menjelaskan peranan osteopontin sebagai protein
penghubung.
2. OPN merupakan matriks protein ekstrasellular yang
tersusun dari sequence Arg-Gly-Asp seperti fibronektin,
vitronektin dan kolagen dan berfungsi sebagai sitokin
pro-inflammatory.
3. Osteopontin dan reseptor integrin mempunyai fungsi
pada kelangsungan hidup sel, fungsi yang berkebalikan
dengan jalur apoptotik atau meningkatkan pertumbuhan
sel. OPN bekerja melalui jalur intraseluler multipel dan
efektor downstream.
4. OPN adalah sitokin multifungsional dan protein adhesi
yang berhubungan dengan berbagai proses fisiologi dan
patologi, termasuk di dalamnya pembentukan kembali
tulang, meningkatkan aktivitas imun yang dimediasi
sel,menjaga integritas sel selama terjadinya proses
inflamasi, dan metastase sel tumor.
5. OPN merupakan mediator proinflamasi yang dapat
mempercepat proses terjadinya inflamasi pada penyakit
vaskular. Dengan demikian, dapat diartikan bahwa

136 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


peningkatan ekspresi OPN akan sebanding dengan
perkembangan kondisi aterosklerosis.
6. Osteopontin diduga berperan dalam biomineralisasi,
penyembuhan luka, invasi tumor, metastase sel kanker,
cell survival serta aktivasi fungsi leukosit.
7. Pada lesi aterosklerosis, ekspresi OPN terdapat pada
sel otot polos pada lesi, sel endotel angiogenik dan
makrofag. OPN juga direekspresi di sel otot polos pada
lesi restenotik.
8. OPN berperan pada proses inflamasi dalam dinding arteri
pada aterogenesis dan disrupsi plaque.
9. OPN juga diekspresikan pada sel otot polos yang
berhubungan dengan lesi restenotik (penyempitan
pembuluh darah yang terjadi kembali )manusia.
10. Berdasarkan hasil penelitian tersebut, OPN dapat
berperan sebagai agen neuroprotektif yang mampu
memberikan efek terapi pada pengobatan stroke
iskemia.

Bab 7 Memahami Osteopontin (OPN) 137


138
Bab8

Pengaruh Variasi
Genetika pada
Stroke Iskemia

139
8.1 Variasi Genetika

V
ariasi genetika didefinisikan sebagai perbedaan
genetika yang terjadi secara alamiah pada individu
dalam populasi. Variasi genetika berasal dari
mutasi acak yang terjadi pada genom organisme. Hal ini dapat
terjadi akibat adanya mutasi atau rekombinasi gen. Rekombinasi
gen terjadi karena gen-gen berpasangan secara bebas saat
pembentukan gamet. Sementara itu, mutasi gen dapat dipengaruhi
oleh faktor eksternal maupun internal yang dapat menyebabkan
terjadinya penyimpangan sifat-sifat individu dari sifat normal.
Variasi genetika yang terjadi lebih dari 1% populasi dianggap
sebagai polimorfisme yang mampu mendasari analisis hubungan
faktor genetika dengan suatu kondisi tertentu (Frankham, 1996).

8.2 Polimorfisme

8.2.1 Definisi polimorfisme


Polimorfisme genetika adalah adanya perbedaan rangkaian
DNA pada populasi. Termasuk di antaranya Single Nucleotide
Polymorphism (SNP), adanya pengulangan, insersi, delesi, dan
rekombinasi. Polimorfisme genetika ini dapat disebabkan oleh
perubahan proses atau akibat adanya induksi agen eksternal
seperti virus dan radiasi. Jika perubahan rangkaian DNA ini
berhubungan dengan penyakit tertentu, biasanya disebut sebagai
mutasi genetika. Perubahan rangkaian DNA yang disebabkan oleh
agen eksternal secara umum lebih dikenal dengan istilah mutasi
daripada polimorfisme (Smith, 2002).

140 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Mutasi genetika adalah terjadinya perubahan urutan
nukleotida pada molekul DNA. Mutasi genetika merupakan salah
satu jenis polimorfisme genetika. Istilah mutasi secara umum
merujuk pada perubahan rangkaian DNA yang berhubungan
dengan penyakit atau faktor risiko penyakit tertentu (Smith, 2002).

8.2.2 Jenis-jenis polimorfisme


Polimorfisme terjadi karena adanya mutasi genetika.
Perbedaan jenis polimorfisme tergantung pada jenis mutasi
yang terjadi. Jenis polimorfisme yang paling sederhana adalah
mutasi tunggal basa nukleotida di mana satu basa nukleotida
menggantikan basa nukleotida lainnya yang disebut dengan single
nucleotide polymorphism (SNP). Beberapa penelitian menduga
bahwa SNP terjadi dalam setiap 0,3-1 kilo pasang basa (kbp).
Jenis lain polimorfisme adalah insersi dan delesi. Insersi dan
delesi ini umumnya terjadi pada daerah genetika yang memiliki
banyak pengulangan basa atau pola nukleotida yang hampir sama
(Schork, etal., 2000). Jenis polimorfisme yang paling sering terjadi
adalah SNP (90% dari polimorfisme DNA manusia). Ada 2 jenis
substitusi (penggantian) basa nukleotida pada SNP, yaitu transisi
dan tranversi. Transisi merupakan substitusi yang terjadi ketika
satu basa purin digantikan oleh satu basa purin lain (A,G) atau
satu basa pirimidin digantikan oleh satu basa pirimidin lain (C,T).
Sementara itu, tranversi adalah substitusi yang terjadi ketika satu
basa purin digantikan oleh satu basa pirimidin (Smith, 2002).

8.2.3 Polimorfisme osteopontin


Penelitian pada tikus transgenik menunjukkan bahwa OPN
meningkatkan ketebalan intima media arteri karotis, proliferasi
sel otot polos medial, aktivasi matrix metalloproteinase (MMP) 2
dan MMP 9 pada aorta, serta mengiduksi pembentukan atheroma.
Ekspresi OPN diregulasi oleh motif CCTCATGAC pada lokasi -72
sampai -80 pada transcription start site. Daerah promoter ini
berkompleks dengan berbagai faktor transkripsi yang meliputi

Bab 8 Pengaruh Variasi Genetika pada Stroke Iskemia 141


upstream stimulatory factor, activator protein-1, dan liver X receptor
(LXR) (Isoda, etal., 2002).
Studi yang dilakukan oleh De las Fuentes pada tahun 2008
berhasil membuktikan peran OPN dalam pembentukan ketebalan
intima media arteri karotis pada manusia. Adanya polimorfisme
T-66G pada gen OPN diketahui terkait dengan peningkatan
ketebalan intima media arteri karotis manusia (De las Fuentes,
etal., 2008).
Studi lain menunjukkan keterkaitan polimorfisme T-443C
dengan peningkatan ketebalan intima media arteri karotis.
Polimorfisme ini juga terjadi pada daerah promoter gen OPN dan
diketahui merupakan bentuk polimorfisme yang cukup umum.
Polimorfisme ini terjadi pada daerah binding site MYT1 zinc
finger, walaupun bagaimana polimorfisme ini mempengaruhi
pembentukan ketebalan intima media arteri karotis belum
diketahui secara jelas (Brenner, etal., 2006).

PPP P P P P P P P PP
NH 2 RGD COOH

M R I AV I C F C L L G I T C A I P V K Q A D S G S S E E K Q N A V S S E E T N D F K Q E T L P S K S N E S

HDHMDDMDDEDDDDHVDSQDSIDSNDSDDVDDTDDSHQSDESHHSDESDE
166
LV T D F P T D L PAT E V F T P V V P T V D T Y G D R G D S V V YG L R SKSKKFRRPDIQ
168
201 201
Y P D AT D E D I T S H M E S E E L N G A Y K I P VA Q D LNAPSDWDSRGKDSYETSQ

L D D Q S A E T H S H K Q S R LY K R K A N D E S N E H S D V I D S Q E L S K V S R E F H S H E F H S H

EDMLVVDPKSKEEDKHLKFRIS HELDSASSEVN

MPPs Thrombin
Keterangan: D
 aerah pengikatan digambarkan dalam warna merah, hijau, dan biru.
Daerah pengikatan kalsium digambarkan dalam warna abu-abu; daerah
fosforilasi ditandai dengan P; sisi pemotongan ditunjukkan dengan tanda
panah.
Sumber: Scatena, etal., 2007

Gambar 8.1Gambaran struktural osteopontin

142 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Beberapa polimorfisme telah ditemukan pada gen OPN, di
antaranya berhubungan dengan oligoarticular (pauciarticular)
juvenile idiopathic arthritis, nephrolithiasis, dan chronic hepatitisC.
Studi terbaru menunjukkan bahwa pasien dengan G/G genotip
pada nt-156 di promoter OPN lebih sering didiagnosa dengan
advanced stage (IIIB-IV) nonsmall cell lung cancer (NSCLC) daripada
mereka dengan genotip yang lain (Zhao, etal., 2012). Dalam sebuah
studi klinis, ditemukan peningkatan CIMT pada pasien stroke
yang memiliki alel C pada OPN C-443T SNP. Meskipun beberapa
penelitian telah memperlihatkan terjadinya polimorfisme pada
alel C-443T, namun belum diketahui dengan tepat konsekuensi
polimorfisme pada promoter C-443 T terhadap regulasi transkipsi.
Berbeda dengan alel T-66G, polimorfisme pada promoter ini
terbukti dapat memprediksikan risiko seseorang mengalami
penyakit makrovaskular (Fuentes etal., 2008). Polimorfisme lainnya
adalah G-156 GG (rs17524488) yang dilaporkan secara signifikan
berhubungan dengan peningkatan aktivitas OPN (Zhao, etal., 2012).
Pada penelitian tahun 2006 yang dilakukan oleh Brenner etal.,
didapatkan hasil bahwa dari 54 percobaan polimorfisme ternyata
ada perbedaan CCA-IMT (Common Carotid Artery Intima Media
Thickness) yang signifikan pada genotipe osteopontin (OPN) T-443C,
monocyte chemoattractant protein-1 (MCP-1) G-927C dan MCP-1
A-2578G. Dalam penelitian ini juga dijelaskan bahwa polimorfisme
OPN T-443C berhubungan dengan peningkatan IMT pada dominant
model (alel yang diekspresikan secara penuh dalam fenotipe).
Adapun polimorfisme MCP-1 G-927C berhubungan dengan
peningkatan IMT pada additive model (alel yang memberikan
kontribusi seimbang dalam menghasilkan fenotipe). Sementara itu,
polimorfisme MCP-1 A-2578G berhubungan dengan penurunan IMT
pada recessive model (alel yang pemunculan fenotipenya tertutupi
oleh alel dominan) (Brenner, etal., 2006).
Sehubungan dengan banyaknya hasil penelitian yang menun
jukkan peran OPN dalam proses inflamasi dan aterosklerosis, studi
genomik yang meneliti tentang polimorfisme OPN dan kaitannya
dengan pembentukan ketebalan intima media arteri karotis
masih kurang. Topik ini penting untuk dikembangkan lebih lanjut
mengingat peran OPN yang krusial dalam pembentukan ketebalan

Bab 8 Pengaruh Variasi Genetika pada Stroke Iskemia 143


intima media arteri karotis sejak masa kanak-kanak yang merupakan
prediktor terjadinya aterosklerosis pada usiadewasa.

8.2.4 Polimorfisme osteopontin T-443C


Pasien dengan genotipe T pada basa ke -443 memiliki rata-
rata CCA-IMT lebih rendah daripada pasien dengan alel C dan
diketahui bahwa alel -443C memiliki efek yang signifikan terhadap
peningkatan IMT (Brenner, etal., 2006). Berdasarkan hasil
penelitian menggunakan analisis multivariate yang dilakukan
oleh Brenner etal. pada tahun 2006 ditemukan bahwa terdapat
hubungan yang kuat antara alel OPN -443C dengan peningkatan
kete
balan intima media arteri karotis (p<0,001). Polimorfisme
ini terjadi di daerah promoter OPN (Brenner etal., 2006).
Polimorfisme di daerah promoter OPN ini akan mempengaruhi
aktivitas transkripsinya (Giacopelli, etal., 2004).

8.3 Faktor Genetika Vascular Cognitive


Impairment
Faktor genetika yang berperan dalam vascular cognitive
impairment (VCI) terdiri atas gen-gen yang berimplikasi pada
hipertensi dan penyakit arteri karotis (keduanya berhubungan
dengan stroke dan gangguan kognitif), dan gen yang
mempengaruhi respon otak terhadap penyakit vaskular (toleransi
vaskular dan plastisitas neuron). Kelainan monogenik yang
berkaitan dengan VCI yang sudah ditemukan antara lain CADASIL,
apolipoprotein E (ApoE), varian herediter angiopati amiloid
serebral, penyakit sel sabit, penyakit Fabry, dan homosistinuria,
vaskulopati serebroretina, dan hereditary endotheliopathy with
retinopathy, nephropathy, dan stroke (HERNS). Namun yang sudah
banyak diteliti dan memberi hasil konsisten adalah gen CADASIL
dan ApoE (Di Legge S. et al., 2010).

8.3.1 Gen CADASIL


CADASIL (cerebral autosomal dominant arteriopathy with
subcortical infarcts and leukoencephalopathy) merupakan bentuk

144 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


arteriopati akibat mutasi gen Notch3 pada kromosom kromosom
19. CADASIL sudah diidentifikasi sejak tahun 1993 sebagai etiologi
demensia vaskular murni (Chabriat H., et al., 2007).
Pada penderita yang simtomatis, manifestasi klinis yang paling
sering adalah serangan iskemia sepintas atau stroke subkortikal
pada usia 40-50 tahun. Demensia merupakan manifestasi klinis
kedua tersering, dan terjadi pada 90% pada sepertiga pasien
yang simtomatis. Rata-rata pasien mengalami demensia saat
usia 60 tahun, dan usia termuda onset ditemukan saat 35 tahun.
Kemampuan kognitif dapat terganggu sebelum serangan iskemia
atau stroke, dan tersering pada memori kerja dan fungsi eksekutif.
Perjalanan penyakit berlangsung secara bertahap (stepwise) pada
90% kasus, dan progresif, terisolasi pada 10% kasus (Chabriat H.,
etal., 2007).
Domain positif yang terkena dominan pada fungsi eksekutif
(terutama apatis) dan gangguan memori, sedangkan afasia,
apraksia, atau agnosia jarang terjadi, atau terjadi pada tahap akhir
penyakit. Demensia disertai dengan tanda piramidal, kelumpuhan
pseudobulber, kesulitan gait, dan/atau inkonensia urine.
(ChabriatH., etal., 2007).
Gambaran patologis berupa penebalan tunika media arteri
substansia alba dan leptomeningeal oleh bahan-bahan granuler,
eosinofilik (gambaran khas CADASIL), dan non amiloid yang terikat
di sel-sel otot polos. Didapatkan terutama pada tingkat subkorteks
(korpus kalosum, striatum, kapsula interna, dan hipokampus)
berupa lesi substansia alba ekstensif. Mungkin tidak ditemukan lesi
patologis kortikal pada pencitraan, namun ditemukan penurunan
metabolisme, konsumsi glukosa, dan berkurangnya neuron
kolinergik kortikal yang merupakan efek jarak jauh dari infark
ganglia basalis (diaskisis) pada tingkat kortikal yang menyebabkan
demensia (Chabriat H., etal., 2007; Jiwa N.S., etal., 2010).
Terdapat varian CADASIL yaitu CARASIL (cerebral
autosomal recessive arteriopathy with subcortical infarcts and
leukoencephalopathy), namun belum terdapat banyak penelitian
mengenai manifestasi klinis, patobiologi, dan mekanisme
pengaruhnya terhadap gangguan kognitif (Di Legge S., etal., 2010).

Bab 8 Pengaruh Variasi Genetika pada Stroke Iskemia 145


8.3.2 Gen Apoliprotein E (ApoE)
Gen ApoE awalnya lebih banyak dibahas sebagai faktor risiko
penyakit Alzheimer. Namun demikian, akhir-akhir ini berdasarkan
hasil penelitian ditemukan bahwa gen ApoE juga berperan pada
VCI (Wagle J., et al., 2009). Gen ApoE terletak pada kromosom
19q13.2, memiliki panjang 3,7 kilobasa, terdiri dari 4 ekson dan 3
intron dan memproduksi polipeptida 299 asam amino. Gen ApoE
bersifat polimorfik dengan alel tersering adalah 2, 3, dan 4, yang
mengkode 3 isoform utama protein ApoE, yaitu E2, E3, dan E4.
Perbedaan ketiga isoform tersebut terdapat pada pertukaran
asam amino yang terletak pada residu 112 dan 158: E3 (Cys
112-Arg158), E4 (Arg112-Arg158), dan E2 (Cys112-Cys158).
Polimorfisme ini membentuk 6 genotip, yaitu 3 homozigot, berupa
2/ 2, 3/ 3, 4/ 4, dan 3 heterozigot, berupa 4/ 3, 4/ 2, 3/ 2.
Genotip yang paling sering ditemukan di seluruh populasi, mulai dari
yang tersering adalah APOE 3/ 3, 4/ 3, 3/ 2, 4/ 4, 4/ 2, dan
2/ 2. Keenam genotip itu menghasilkan enam fenotip, yaitu masing-
masing ApoE 3/ 3, 4/ 3, 3/ 2, 4/ 4, 4/ 2, dan 2/ 2. Untuk
menyederhanakan, fenotip yang dihasilkan dari genotip homozigot,
cukup disebut E4, E3, dan E2 (Davignon J., etal., 1998).
Alel ApoE 3 merupakan gen yang paling banyak ditemukan
di seluruh populasi. Oleh karena itu, protein ApoE 3 yang
dihasilkannya dianggap sebagai protein normal, sedangkan ApoE2
dan ApoE4 dianggap sebagai variannya (Helzner E.P., etal., 2009;
Venkatramana P., et al., 2001; Botham K.M. et al., 2009). Distribusi
alel ApoE Melayu (penelitian pada orang Malaysia yang tinggal di
Singapura pada tahun 1991) masing-masing sebesar 0,114; 0,767;
dan 0,119, sedangkan di Jepang masing-masing sebesar 0,081;
0,849; dan 0,067 (Venkatramana P., et al., 2001).
ApoE terutama disintesis di hati, tetapi juga disintesis oleh
jaringan tubuh lain seperti otak, limpa, ginjal, adrenal, gonad, dan
makrofag. Otak merupakan tempat produksi dan penyimpanan
ApoE terbanyak setelah hati. ApoE merupakan penyusun beberapa
lipoprotein seperti kilomikron, sisa kilomikron, IDL (intermediate
density lipoprotein) dan HDL (high density lipoprotein) yang berperan
penting dalam transpor, penggunaan, dan metabolismelipid
(Davignon J., et al., 1998; Botham K.M., etal.,2009).

146 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Fungsi utama ApoE adalah sebagai ligan untuk reseptor
lipoprotein di permukaan sel. ApoE tersusun atas 2 domain
protein yaitu gugus N (nitrogen) dan gugus C (karboksil). GugusC
berfungsi sebagai tempat pengikatan lipid, sedangkan fragmenN
merupakan tempat terikatnya ApoE dengan reseptor di permukaan
sel. Jenis lipid yang diikat oleh ApoE terutama adalah kolesterol dan
triasilgliserol. Setelah ApoE terikat pada reseptor, kompleks ApoE-
lipoprotein-lipid akan mengalami internalisasi dan degradasi dalam
sel. Lipid yang dilepas akan dipakai untuk regenerasi sel terutama
untuk mempertahankan integritas dinding sel, sedangkan reseptor
akan didaur ulang untuk digunakan kembali. Lipid (terutama
kolesterol) dan ApoE pada susunan saraf pusat berperan penting
dalam homeostasis, pembentukan mielin, dan regenerasi neuron
(Hauser P.S., et al., 2011; Botham K.M., etal.,2009).

8.3.3 Hubungan ApoE dan fungsi kognitif paska stroke


iskemia
Hubungan ApoE dan fungsi kognitif paska stroke iskemia masih
kontroversial. Penelitian yang mendukung menemukan bahwa
polimorfisme gen ApoE secara signifikan berpengaruh terhadap
keluaran kognitif paska stroke (Wagle J., et al., 2009), seperti pada
penelitian berbasis populasi menyimpulkan bahwa terdapat efek
sinergis antara penyakit serebrovaskular dan ApoE 4 dengan
penurunan kognitif (Ivan C.S., etal., 2004; KnopmanD.S., etal.,
2009). Penelitian lain menunjukkan peningkatan frekuensi APOE 4
pada pasien demensia vaskuler dibandingkan populasi umum, APOE
4 sebagai faktor risiko demensia vaskuler, maupun faktor prediktor
perubahan cognitive impairment, no dementia (CIND) menjadi
demensia caskuler (Dik M.G. etal., 2003; Hsiung G.Y.R. etal., 2004).
Namun penelitian lain tidak dapat membuktikan hubungan antara
APOE 4 dan demensia vaskuler (Kawamata J., etal., 1994; Gofir A.,
etal., 2009).
Polimorfisme ApoE mempengaruhi hemodinamika vaskular
serebral pada Alzheimer, di mana terdapat penurunan perfusi paling
buruk pada kelompok ApoE 4 (Hooijmans C.R. etal., 2008). Pada
kelompok ApoE 4 homozigot juga ditemukan lesi substansia alba
yang lebih luas daripada karier 3 akibat kerusakan mielin luas
(Bartzokir G. etal., 2007).

Bab 8 Pengaruh Variasi Genetika pada Stroke Iskemia 147


Belum diketahui mekanisme pasti pengaruh gen ApoE terhadap
gangguan fungsi kognitif paska stroke iskemia. Namun dari beberapa
hasil penelitian, isoform ApoE mempunyai efek berbeda terhadap
kolesterol plasma dan plastisitas sel-sel di susunan saraf pusat.

8.3.3.1 Peran apolipoprotein E pada kolesterol plasma


dan aterosklerosis
ApoE di plasma merupakan penyusun lipoprotein kilomikron,
kilomikron remnan, IDL, dan HDL. ApoE berperan membersihkan
kilomikron remnan dan kelebihan kolesterol. Lipid yang terikat
ApoE akan dibawa ke hati, kemudian ApoE melalui terminal amino
akan terikat dengan reseptor LDL (B/E), reseptor ApoE, atau LDL
receptor related protein (LRP = reseptor remnan) yang terdapat di
hati. Selanjutnya, lipoprotein mengalami endositosis dan masuk
dalam hepatosit (Davignon J., et al., 1998).
ApoE dalam bentuk HDL juga dapat mengikat kolesterol
dari sel busa (makrofag) dengan bantuan enzim LCAT (lecithin
cholesterol acyl transferase) untuk selanjutnya dibawa ke hati. Sel
busa yang kaya kolesterol merupakan faktor penting dalam proses
aterosklerosis. Diketahui pula bahwa ApoE mampu terikat pada
heparin dan heparin like proteoglikan yang terdapat pada matriks
dinding arteri sehingga ApoE juga berperan dalam proliferasi dan
migrasi sel otot polos di tunika intima yang merupakan karakteristik
penyakit vaskular aterosklerotik (Davignon J., etal.,1998).
Fenotip ApoE mempunyai pengaruh yang berbeda pada
lipoprotein plasma sehingga polimorfisme ApoE diduga merupakan
salah satu faktor yang menentukan perbedaaan individual dalam
permulaan dan progresifitas aterosklerosis. ApoE 2 homozigot
kurang dapat mengikat reseptor LDL dan ApoE sehingga terjadi
akumulasi lipoprotein remnan dan hiperlipidemia. Namun
demikian, kebanyakan 2 homozigot mempunyai kadar kolesterol
dan LDL rendah karena katabolisme lipoprotein yang lambat
sehingga memacu kolesterol eksogen dan perifer masuk ke hati
melalui uptake yang dimediasi ApoE. Sebagai kompensasi, terjadi
peningkatan aktivitas reseptor LDL (B/E) sehingga uptake LDL
meningkat dan LDL plasma menurun. Lipoprotein yang mengandung
ApoE4 lebih cepat dikatabolisme sehingga lebih banyak kolesterol

148 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


yang dikirim ke sel hati melalui uptake yang dimediasi ApoE pada
subjek dengan alel 4. ApoE4 lebih terikat pada lipoprotein yang
kaya trigliserida seperti VLDL, sedangkan ApoE2 dan E3 lebih
terikat pada HDL. ApoE4 mempunyai kemampuan mengikat lipid
dari absorbsi intestinal yang lebih efisien dibandingkan ApoE2.
Namun hal ini menyebabkan aktivitas reseptor LDL di hati menurun
dan menyebabkan berkurangnya sintesis kolesterol oleh hati
(DavignonJ., et al., 1998).
Individu dengan alel ApoE 4 mempunyai kadar kolesterol total
dan LDL yang cenderung lebih tinggi daripada karier genotip ApoE
lainnya (Davignon J. et al., 1998; Sing C.F. and Davignon J., 1985).
Sementara itu, kadar kolesterol dan LDL yang tinggi diketahui
sebagai faktor risiko aterosklerosis (Smith E.E and KoroshetzW.J.
2004) dan aterosklerosis merupakan faktor risiko gangguan kognitif
(Everson S.A. et al., 2001), baik dengan perantaraan penyakit
serebrovaskular yang menimbulkan manifestasi klinis maupun tidak
(Haan M.N. et al., 1999). ApoE 4 juga berperan dalam pembentukan
aterosklerosis melalui proses stres oksidatif dan inflamasi. Peran
ApoE 4 dalam sterosklerosis ini ditemukan baik pada pembuluh
darah kecil maupun pembuluh darah besar (Abboud S. et al., 2008;
Saidi S. et al., 2007).
ApoE 4 juga merupakan faktor risiko angiopati amiloid
serebra dan berhubungan bermakna dengan stroke hemoragik
(Hooijmans C.R. et al., 2008). Penelitian berbasis populasi
Rotterdam dan Medicare (California) mendukung data bahwa
gen ApoE 4 berhubungan dengan demensia vaskular melalui
mekanisme aterosklerosis yang ditunjukkan melalui peningkatan
ketebalan dinding arterikarotis (Haan M.N., et al., 1999; Hofman A.,
etal.,1997).
Telah ditemukan pula bukti bahwa terdapat peran serebro
vaskular pada penyakit Alzheimer, sedangkan ApoE 4 diketahui
merupakan faktor risiko penyakit Alzheimer. Penelitian pada sampel
pasien Alzheimer ditemukan bahwa riwayat penyakit jantung
dan stroke berhubungan dengan penurunan kogniitf pada karier
gen ApoE 4, dan tiap peningkatan 10-U kolesterol dan LDL-C
berhubungan signifikan dengan penurunan skor kognitif 0.10-SD
per tahun (Helzner E.P., et al., 2009). Penelitian lain menemukan

Bab 8 Pengaruh Variasi Genetika pada Stroke Iskemia 149


bahwa stroke mempunyai hubungan paling kuat dengan penyakit
Alzheimer dibandingkan faktor risiko vaskular lain (Honig L.S., et al.,
2003).

8.3.3.2 ApoE pada susunan saraf pusat


ApoE dalam susunan saraf pusat pada kondisi fisiologis
diproduksi terutama oleh astrosit, sedangkan pada kondisi
patologis (misalnya paska jejas otak) diproduksi oleh neuron dan
mikroglia. Dalam kondisi basal, produksi ApoE astrosit 2-3 kali
lipat produksi neuron (Hauser P.S. et al., 2011). Pada susunan saraf
pusat ApoE berperan dalam transpor kolesterol yang dibutuhkan
untuk mempertahankan integritas neuron dan glia, pembentukan
membran dan pertumbuhan panjang neurit selama perbaikan sel
(Huang Y. et al., 1995). ApoE dan kolesterol yang terdapat di susunan
saraf pusat diproduksi secara lokal, terpisah dari yang beredar di
sirkulasi perifer karena tidak dapat melewati sawar darah otak
(Huang Y. et al., 1995).
Keseluruhan mekanisme hubungan antara ApoE dan
penyakit serebrovaskular belum diketahui. Kemungkinan ApoE
mempengaruhi keluaran paska jejas serebral melalui perbedaan
efek isoform terhadap perbaikan sinap, remodelling, dan
proteksi. Tampaknya ApoE alel4 mempunyai dampak merugikan
dibandingkan dengan alel 3. ApoE 3 terbukti meningkatkan
pertumbuhan dan percabangan neurit, sedangkan ApoE 4 berefek
sebaliknya (Horsburgh K. et al., 2000). ApoE 2 belum diketahui efek
protektifnya kecuali pada penyakit Alzheimer (HiekkanenH.,2009).
Beberapa perbedaan efek ApoE 3 dan ApoE 4 dapat dilihat
pada Tabel 8.1. Mekanisme tentang bagaimana isoform ApoE4
berpengaruh terhadap keluaran yang lebih buruk dan menghambat
pemulihan kemungkinan melalui penurunan efisiensi transpor lipid,
akumulasi amiloid beta dan terdapatnya deposit amiloid beta luas
sebelum jejas, lebih banyak inflamasi di otak, kurangnya kemampuan
proteksi terhadap jejas oksidatif, perfusi otak paska jejas lebih
buruk, sitoskeleton lebih rentan terhadap kerusakan, berkurangnya
pertumbuhan dan percabangan neurit sehingga pemulihan lebih
buruk, sembab serebral lebih besar, penyakit aterosklerosis sebelum
sakit lebih banyak, pemulihan dalam kondisi metabolisme anaerob

150 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


lebih lambat, dan eksitotoksisitas N-methyl-D-aspartat lebih buruk
(Horsburgh K., et al., 2000; Hiekkanen H., 2009).

Tabel 8.1Perbedaan efek ApoE3 dan ApoE4 pada susunan saraf pusat
Efek Protektif ApoE3 Efek Merugikan ApoE4
Stimulasi bersihan amiloid beta Meningkatkan deposisi amiloid beta
Efek antioksidan Menghambat pertumbuhan neurit
Mencegah fosforilasi protein tau Stimulasi fosforilasi tau
Mencegah neurodegenerasi Menyebabkan neurodegenerasi
Mencegah penurunan kognitif Menyebabkan neurodegenerasi
melalui fragmen apoE4
Potensiasi kebocoran lisosomal yang
diinduksi A
Menurunkan reseptor androgen
Menyebabkan penurunan kognitif
Sumber: Horsburgh K. et al., 2000

Namun ApoE 4 juga mempunyai efek proteksi. Protein ApoE4


mengaktivasi kaskade kinase ekstraseluler yang diatur sinyal
untuk menghasilkan aktivasi respon bagian cAMP yang terikat
protein dan induksi berbagai macam gen, termasuk gen protektif
Bcl-2. Mekanisme protektif lain mungkin melalui kolesterol. Karier
ApoE 4 diketahui mempunyai kadar low density lipoprotein (LDL)
dan kolesterol total yang tinggi sehingga -glutamil-transferase
yang bersifat protektif terhadap efek neurotoksik asam amino
eksitotoksik. ApoE 4 juga lebih berefek positif terhadap
neurogenesis pada tikus transgenik dibandingkan dengan tikus
dengan ApoE 3 (Horsburgh K. et al., 2000; Hiekkanen H., 2009).

8.3.3.3 Peran ApoE terhadap kolesterol di susunan saraf


pusat
Kolesterol dalam susunan saraf pusat diproduksi oleh sel
glia dan neuron melalui jalur HMG-KoA reduktase, kemudian
dikeluarkan dari sel (efluks) dan terikat pada apolipoprotein
(sebagai bagian dari lipoprotein) yang akan mengangkut kolesterol.
Efluks kolesterol dan migrasi kolesterol dari sitoplasma ke
permukaan sel diatur oleh ABC (ATP-binding cassette transporter)
A1, A2, dan G1. Kompleks lipoprotein-kolesterol akan ditangkap

Bab 8 Pengaruh Variasi Genetika pada Stroke Iskemia 151


oleh reseptor lipoprotein di permukaan sel, mengalami influks
dan ikatan lipoprotein-kolesterol akan dipecah sehingga kolesterol
bebas dapat berfungsi untuk mempertahankan dan memperbaiki
struktur membran sel, regenerasi neuron dan glia paska jejas.
Sementara itu, lipoprotein didaur ulang untuk digunakan kembali
(Leduc V., et al., 2010; Mathew A. et al., 2011; Bjorkhem I.,
etal.,2004).
Pada keadaan fisiologis kolesterol lebih banyak diproduksi di
astrosit daripada di neuron (2-3 kali lipat). Kemungkinan untuk
menghemat energy, neuron yang lebih banyak digunakan untuk
pembentukan impuls elektrik. Pada usia dewasa, pembentukan
kolesterol dalam otak menurun drastis dibandingkan saat janin.
Hal ini disebabkan waktu paruh kolesterol dalam otak sangat
lama, berkisar antara 6 bulan sampai 5 tahun, dan kolesterol yang
sudah terbentuk didaur ulang secara efisien (Leduc V., et al., 2010;
Mathew A., et al., 2011; Bjorkhem I,. et al., 2004).
Kolesterol dalam otak terpisah dari kolesterol sirkulasi karena
tidak dapat menembus sawar darah otak. Namun, kolesterol
yang berlebihan dalam otak diekskresikan ke sirkulasi dalam
bentuk 24S- hidroksikolesterol yang dapat menembus sawar
darah otak. Perubahan kolesterol menjadi 24S-hidroksikolesterol
hanya terjadi di neuron oleh CYP46, suatu jenis sitokrom P-450
sehingga 24S-hidroksikolesterol sering digunakan sebagai
penanda homeostasis kolesterol di otak karena tidak diproduksi di
perifer (Leduc V., et, al., 2010; Mathew A., et al., 2011; Bjorkhem I.,
etal.,2004).
Kolesterol dalam otak terdapat dalam mielin, membran neuron
dan glia. Pada neuron menyusun 25% komponen membran dan
berperan penting dalam plastisitas neuron, sedangkan pada mielin,
kolesterol juga merupakan komponen utama di samping protein.
Kolesterol berperan dalam fungsi fisiokimia seperti pengaturan
enzim, reseptor, dan saluran ion yang terdapat pada membran
neuron. Selain itu, kolesterol juga diperlukan untuk pembentukan
sinap neuronal. Lipid rafts merupakan mikrodomain membran
neuron yang kaya sfingolipid dan kolesterol, berperan dalam adesi
sel neuron, panduan aksonal, transmisi sinaptik, transduksi sinyal
faktor pertumbuhan, perjalanan vesikel, proteolisis dan membantu

152 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


neuron mengatur proses-proses tersebut. Kebutuhan kolesterol
sel dapat dipenuhi dari produksi de novo maupun dari internalisasi
kompleks kolesterol-lipoprotein (Leduc V. et al., 2010; Mathew A.,
et al., 2011; Bjorkhem I. et al., 2004).
ApoE merupakan apolipoprotein utama dalam otak, menyusun
lipoprotein terutama HDL (ApoE-rich high density like complex)
dan dapat terikat pada reseptor LDL (low density lipoprotein),
reseptor LRP1 (LDL related protein), reseptor 2 ApoE (ApoER2),
serta reseptor VLDL di permukaan sel (Kuller L.H., et al., 1998;
Horsburgh K., et al., 2000; Hiekkanen H., 2009).
Berbagai isoform ApoE mempunyai perbedaan dalam efisiensi
transpor dan penggunaan kolesterol dalam otak dengan urutan
ApoE2>ApoE3>ApoE4. Efisiensi transpor dan penggunaan
kolesterol dalam otak sangat penting karena produksi de novo
pada usia dewasa sangat sedikit sehingga kebutuhan kolesterol
sel tergantung dari transpor dan internalisasi kolesterol oleh
lipoprotein. ApoE4 merupakan isoform yang paling tidak efisien
dibandingkan isoform lainnya sehingga pada individu dengan
alel gen ApoE 4 transpor serta penggunaan kolesterol kurang
efisien untuk mempertahankan membran dan regenerasi sel glia
dan neuron (Kuller L.H. et al., 1998; Horsburgh K. et.al., 2000;
Hiekkanen H., 2009).
Patofisiologi ApoE4 terhadap kolestrol di otak berlangsung
melalui mekanisme berikut ini.
1. Perbedaan jumlah ApoE
Jumlah ApoE pada individu dengan alel gen ApoE lebih sedikit
daripada alel gen ApoE lainnya (Riddell D.R.). Tampaknya tidak
terdapat pengaruh gen ApoE terhadap sintesis ApoE. Perbedaan
jumlah total ApoE ini kemungkinan disebabkan ApoE4 lebih
mudah mengalami degradasi oleh enzim-enzim proteolisis dan
mudah rusak dalam pH dan lingkungan biokimia yang tidak
fisiologis (Kuller L.H., et al., 1998; Horsburgh K., et al., 2000;
Hiekkanen H.,2009).
2. Pengaruh ApoE4 terhadap efluks kolesterol
ApoE4 kurang mampu memicu efluks kolesterol baik pada
astrosit maupun neuron daripada isoform ApoE lain. Kemampuan

Bab 8 Pengaruh Variasi Genetika pada Stroke Iskemia 153


ini mungkin berkaitan dengan pengaruh ApoE4 terhadap ABCA1
dan LpE (lipoprotein E gamma) (Horsburgh K., et al., 2000;
Hiekkanen H., 2009; Huang Y., et al., 1995).
Gamma LpE merupakan salah satu lipoprotein akseptor yang
penting dalam efluks kolesterol ke plasma. LpE hanya terdiri
dari ApoE, berfungsi sebagai akseptor yang pertama menangkap
kolesterol setelah efluks ke dalam plasma. Dari penelitian
ditemukan bahwa LpE hanya ditemukan pada individu yang
mengekspresikan paling tidak 1 alel ApoE3, namun tidak ada pada
individu tanpa alel ApoE3, sehingga pada alel ApoE4/4, ApoE 2/2,
ApoE 2/4 terjadi gangguan efluks kolesterol. Belum diketahui
peran LpE di otak (Huang Y., et al., 1995).
3. Interaksi ApoE dengan reseptor lipoprotein
ApoE mempunyai kemampuan berubah bentuk (konformasi)
jika sudah berikatan dengan lipid. Konformasi terbuka seperti
sabuk memanjang menunjukkan perubahan struktur terminalN.
Keseimbangan konformasi ApoE menentukan kemampuan
bersihan lipoprotein melalui interaksi ApoE dengan keluarga
reseptor LDL (Horsburgh K., et al., 2000).
Kemampuan pengikatan ApoE2 terhadap reseptor hanya
1% dari kapasitas pengikatan ApoE3. Namun kondisi ini
dikompensasi dengan peningkatan aktivitas reseptor LDL terhadap
apolipoprotein lain seperti ApoB sehingga tidak menimbulkan
aterosklerosis. Sementara itu, ApoE4 mempunyai kapasitas
pengikatan reseptor yang paling kuat (Kuller L.H., et al., 1998).
Setelah terikat reseptor, lipoprotein mengalami internalisasi
pada pH netral, yang kemudian disusul penurunan pH sehingga
ligan lipoprotein terlepas. Proses internalisasi memerlukan
celah lisosom. Pada ApoE 4 didapatkan kebocoran lisosom dan
apoptosis yang lebih banyak daripada ApoE 3 (Gladstone).
4. ApoE4 cenderung meningkatkan stres retikulum endoplasma
astrosit dan respon protein yang tidak terlipat sehingga
astrosit lama-kelamaan tidak berfungsi optimal. Sebagai
konsekuensi, astrosit tidak dapat mendukung kerja neuron
dan neuron akan memproduksi ApoE4 sendiri untuk
memenuhi kebutuhan sendiri (Horsburgh K., et al., 2000).

154 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Terdapat perbedaan sifat ApoE yang diproduksi astrosit dan
neuron (Tabel 8.2) (Huang Y., et al., 1995).

Tabel 8.2Perbedaan sifat ApoE4 yang diproduksi oleh astrosit dan neuron
ApoE4 dari Astrosit ApoE4 dari Neuron
Produksi A Neurotoksisitas yang disebabkan fragmentasi
Produksi A Pertumbuhan neurit
Fosforilasi tau
Pertumbuhan neurit Kebocoran lisosom
Efluks kolesterol Neurodegenerasi
Penurunan kognitif Defisiensi reseptor androgen
Penurunan kognitif

Berbagai perbedaan ini mungkin berkaitan dengan struktur


molekul ApoE4 yang berbeda dengan isoform lain. Perbedaan
tersebut terletak pada struktur interaksi domain yang hanya
terdapat pada ApoE4 dan tidak terdapatnya sistein pada ApoE4.
Berikut ini penjelasan keduanya.
a. Interaksi domain pada ApoE4
Arginin pada rantai asam amino ke 112 (arg-112) pada
ApoE4 menyebabkan reorientasi asam amino rantai samping
yang menginduksi terbentuknya jembatan garam antara Arg-61
pada terminal N dengan Glu-255 di terminal C. Kondisi ini disebut
interaksi domain dan hanya terjadi pada ApoE4, karena Arg-61
pada ApoE2 dan ApoE3 mempunyai konformasi berbeda yang
tidak memungkinkan interaksi antara terminal N dan C.
Interaksi domain pada ApoE4 menyebabkan struktur ApoE4
lebih kompak daripada ApoE3. Namun oleh tubuh dikenali sebagai
protein sehingga cepat didegradasi oleh enzim-enzim proteolisis
(protease serine chymotrypsin-like) dan paling tidak stabil terhadap
pengaruh suhu dan pH yang tidak fisiologis. Denaturasi ApoE4
menghasilkan struktur berupa globulus dengan lipatan yang tidak
selesai (partially folded intermediate). Struktur ini stabil namun
bersifat toksik, menginduksi terbentuknya kekusutan neurofibril
intrasel serta amiloid beta ekstrasel. Fragmen pecahan ApoE4
ditemukan pada mitokondria, mengganggu integritas dan fungsi
mitokondria dan mengganggu organisasi sitoskeleton.

Bab 8 Pengaruh Variasi Genetika pada Stroke Iskemia 155


Interaksi domain juga menyebabkan ApoE4 cenderung lebih
mengikat lipoprotein besar seperti VLDL dan sisa kilomikron
sehingga ApoE4 kurang efektif dalam pembersihan LDL yang
berefek aterogenik. Peningkatan proporsi molekul ApoE4 pada
resptor yang inaktif juga dapat meningkatkan perubahan sisa VLDL
menjadi LDL yang aterogenik (Huang Y., et al., 1995; Horsburgh K.,
etal., 2000).
b. ApoE4 tidak memiliki sistein
Terdapatnya sistein pada ApoE2 dan ApoE3 memungkinkan
pembentukan homodimer dan heterodimer yang terikat disulfid
dan berfungsi memodulasi reseptor aktif ApoE. Bentuk ikatan
disulfid mempengaruhi pengikatan lipid misalnya homodimer dan
heterodimer ApoE3-ApoAII cenderung mengikat HDL daripada
bentuk monomer. Namun demikian, belum diketahui perbedaan
ikatan lipid potensial lain yang mempengaruhi transpor lipid
diotak (Huang Y. et al., 1995).

8.3.3.4 ApoE dan amiloid beta (A)


Amiloid beta diproduksi dari pemecahan protein prekursor
amiloid oleh sekretase yang diikuti pemecahan oleh sekretase
(presenilin) pada retikulum endoplasma dan membran plasma.
Amiloid beta ditemukan pada otak normal dalam jumlah terbatas
dan segera dibersihkan setelah berikatan dengan lipoprotein
melalui ambilan mikroglia dan astrosit (berikatan dengan keluarga
reseptor LDL) atau transpor melalui sawar darah otak yang
dimediasi LRPI. A merupakan pembentuk utama plak amiloid
yang merupakan gambaran hispatologis ekstraseluler utama pada
penyakit Alzheimer.
Peningkatan deposit A dihubungkan dengan akselerasi
penurunan fungsi kognitif pada penyakit Alzheimer karena
menginduksi neurodegenerasi. Salah satunya melalui peningkatan
aktivitas kaspase dan kinase terminal JunN sehingga apoptosis
meningkat. Mutasi gen APP (amiloid precursor protein) pada
kromosom 21, gen presenilin 1 pada kromosom 14, dan presinilin2
pada kromosom 1 bertanggung jawab terhadap deposit A
berlebihan pada penyakit Alzheimer familial, sedangkan gen ApoE

156 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


secara konsisten bermakna pada penyakit Alzheimer sporadik
(non familial), terutama alel ApoE 4 homozigot (Riddell D.R.).
Karier alel ApoE4 mempunyai penumpukan A yang lebih
luas paska cedera otak traumatik dibanding alel ApoE yang lain.
Belum diketahui apakah ApoE langsung menghasilkan hasil negatif
atau melalui hilangnya mekanisme proteksi. Diperkirakan bahwa
ApoE4 menghasilkan efek negatif melalui efek sinergis dengan
A1-42, sedangkan ApoE2 bersifat protektif, dan interaksi ApoE-
A secara spesifik berlangsung pada oligomer A1-42. Penelitian
ini menggambarkan kerumitan interaksi ApoE dengan A sehingga
diperlukan penelitian lebih lanjut untuk mempelajari pengaturan
produksi neuronal ApoE sehingga dapat menjadi dasar mekanisme
hubungan ApoE4 dengan penyakit neurodegeneratif (HorsburghK.,
et al., 2000; Hiekkanen H., 2009; Mathew A. et al., 2011).
ApoE4 kemungkinan berperan terhadap A di otak dengan
jalan peningkatan produksi dan agregasi serta bersihan A yang
tidak efisien.

8.3.3.4.1 Pengaruh ApoE4 terhadap produksi amiloid beta


dan plak amiloid
ApoE berperan dalam metabolisme APP. Penelitian kultur
sel menunjukkan penurunan produksi A yang sebanding antara
penambahan ApoE2, E3, atau E4 sehingga diperkirakan ApoE
mengurangi pemecahan APP oleh sekretase . ApoE menstimulasi
efluks kolesterol menyebabkan perubahan konsentrasi
kolesterol dan dengan demikian mikrodomain pada kolesterol
mempengaruhi akses sekretase pada APP. Mekanisme lain
mungkin melalui ikatan langsung APP dengan ApoE sehingga
mengurangi pemecahan oleh sekretase dan berpengaruh
terhadap jumlah dan distribusi APP (Hooijmans C.R. et al., 2008).
Kompleks kolesterol-ApoE selalu ditemukan pada inti
plak yang mengindikasikan peran kompleks tersebut dalam
pembentukan plak fibriler. Pada penelitian in vitro, A ditambah
ApoE4 delipidasi lebih efisien meningkatkan pembentukan plak
amiloid dibandingkan ApoE3 dan ApoE2 (Hooijmans C.R., et al.,
2008). Plak amiloid terbentuk lebih padat dan lebih cepat daripada
ApoE3 (Hauser P.S., et al., 2011). ApoE4 kemungkinan berperan

Bab 8 Pengaruh Variasi Genetika pada Stroke Iskemia 157


memacu konformasi rantai pada A terlarut menjadi serabut
amiloid (Hooijmans C.R., et al., 2008).

8.3.3.4.2 Pengaruh ApoE4 terhadap deposit dan bersihan


amiloid beta
A dapat terikat pada terminal karboksil ApoE. Kemampuan
pengikatan tergantung pada status lipidasi ApoE dan jenis isoform
ApoE. Dalam kondisi kurang terlipidasi, ApoE3 mempunyai afinitas
2-3 kali lebih efisien dan tidak berpotensi menimbulkan deposit
plak amiloid. Pada kondisi terlipidasi, ApoE4 mempunyai afinitas
lebih baik daripada ApoE sehingga mengganggu homeostasis dan
transpor lipid/kolesterol. ApoE3 juga mengurangi interaksi A
dengan permukaan sel.
Bersihan ApoE 4 terhadap A paling tidak efektif dibanding
ApoE 2 dan ApoE 3. A yang terikat pada ApoE4 menggeser
bersihan yang dimediasi LRP1 menjadi reseptor VLDL sehingga
kurang efektif dibandingkan ApoE2 dan ApoE3 yang melalui
reseptor LDL (Horsburgh K. et al., 2000).

8.3.3.5 Peran ApoE terhadap fosforilasi protein tau


Protein tau secara integral mengikat mikrotubulus dalam
akson dan berfungsi mempertahankan strukturnya. Fosforilasi
protein tau membentuk filamen helix berpasangan yang
menyebabkan struktur mikrotubulus tidak stabil. Hiperfosforilasi
protein tau merupakan proses patologis primer pembentukan
kekusutan neurofibril dan toksisitas neuron yang didapatkan pada
Alzheimer.
ApoE4 diketahui meningkatkan fosforilasi tau di neuron, tapi
tidak pada astrosit, terutama setelah jejas yang memicu produksi
ApoE neuronal. Terminal karboksil menstimulasi fosforilasi tau
dan peningkatan inklusi mirip kekusutan neurofibril intrasel pada
percobaan in vitro (Horsburgh K., et al., 2000; Hiekkanen H., 2009).
Fragmen karboksil ApoE berinteraksi dengan protein
tau di sitosol yang meningkatkan toksisitas seluler dibanding
dengan ApoE yang intak. Fosforilasi tau mungkin dimediasi A
dan dihambat oleh interaksi ApoE3 dengan protein tau yang

158 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


tidak terfosforilasi pada terminal N (Horsburgh K., et al., 2000;
HiekkanenH., 2009).

8.3.3.6 ApoE dan inflamasi


Terdapat bukti-bukti bahwa ApoE memodukasi sistem
imunitas, namun mekanisme pastinya belum jelas. Aktivasi astrosit
dan mikroglia setelah jejas dengan hasil pelepasan mediator-
mediator inflamasi diperkirakan merusak sawar darah otak
dan menyebabkan sembab serebral. Pada susunan saraf pusat
yang mengalami jejas, ApoE mungkin mengurangi aktivasi glia
dan respon inflamasi endogen. Isoformn ApoE4 kurang efektif
dalam mengurangi peran sitokin-sitokin inflamasi daripada
ApoE3, baik di perifer maupun dalam otak sehingga ApoE4
menyebabkan respon inflamasi lebih besar daripada ApoE3. ApoE
juga mempunyai kemampuan mengikat reseptor yang kuat dan
memulai respon pensinyalan yang tergantung kalsium pada sel-
sel yang immokompeten. Pada manusia, perbedaan spesifik pada
masing-masing isoform menunjukkan penyebaran dan aktivasi
mikroglia pada pasien yang membawa alel ApoE 4 (Horsburgh K.
etal., 2000; Hiekkanen H., 2009).

8.4 Fungsi Neuroprotektif Osteopontin pada


Stroke
Dalam sebuah studi klinis yang dilakukan secara in vitro
maupun in vivo, OPN terbukti dapat digunakan dalam terapi
penyakit stroke karena fungsinya sebagai neuroprotektor. OPN
terbukti meningkatkan sel yang hidup setelah terjadinya iskemia.
Sebagai neuroprotektor, OPN bekerja melalui aktivasi P42/P44
MAPK/Akt/PIK dan interaksi pada reseptor integrin. Aktivasi
P42/P44 MAPK/Akt/PIK menyebabkan peningkatan fosforilasi
dari Akt yang memiliki fungsi neuroprotektif dengan meningkatkan
ekspresi OPN. Aktivasi reseptor integrin oleh OPN membuat
neuron dapat mentoleransi toksisitas glutamat. Mekanisme OPN
dalam mencegah kematian sel antara lain mensintesis nitrit
oksida, meningkatkan aktivitas NF-B, dan meningkatkan aktivitas

Bab 8 Pengaruh Variasi Genetika pada Stroke Iskemia 159


PIK. Fungsi-fungsi di atas meningkatkan ekspresi OPN dan
meningkatkan fungsi neuroprotektifnya (Meller, etal., 2005).
Hanya saja, pada studi klinis di atas, pemberian OPN pada
mencit dilakukan dengan memberikannya secara langsung ke
otak. Hal ini menjadi hambatan dalam penggunaannya sebagai
agen terapi. Cara pemberian yang mungkin dapat dilakukan
adalah dengan pemberian intranasal (Meller etal., 2005). Dalam
penelitian lain, OPN dapat diberikan intra nasal dan hasilnya
menunjukkan bahwa OPN intranasal efisien untuk diberikan pada
mencit dengan target kerja di otak (Doyle etal., 2008). Secara
umum, OPN telah banyak diteliti sebagai terapi pada beberapa
penyakit dan yang paling berkembang di antaranya adalah sebagai
target terapi pada kanker payudara. OPN dapat digunakan sebagai
biomarker dalam mendeteksi terjadinya kanker payudara dan
dapat dijadikan target terapi dalam manajemen kanker payudara
(Ahmed and Kundu, 2010).

Rangkuman
1. Variasi genetika didefinisikan sebagai perbedaan genetika
yang terjadi secara alamiah pada individu dalam populasi.
2. Variasi genetika berasal dari mutasi acak yang terjadi pada
genom organisme. Hal ini dapat terjadi akibat adanya
mutasi atau rekombinasi gen.
3. Rekombinasi gen terjadi karena gen-gen berpasangan
secara bebas saat pembentukan gamet. Sementara itu,
mutasi gen dapat dipengaruhi oleh faktor eksternal
maupun internal yang dapat menyebabkan terjadinya
penyimpangan sifat-sifat individu dari sifat normal.
4. Polimorfisme genetika adalah adanya perbedaan rangkaian
DNA pada populasi. Termasuk di antaranya Single
Nucleotide Polymorphism (SNP), adanya peng ulangan,
insersi, delesi, dan rekombinasi.
5. Polimorfisme genetika ini dapat disebabkan oleh perubahan
proses atau akibat adanya induksi agen eksternal seperti
virus dan radiasi.

160 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


6. Jika perubahan rangkaian DNA ini berhubungan dengan
penyakit tertentu, biasanya disebut sebagai mutasi
genetika. Mutasi genetika adalah terjadinya perubahan
urutan nukleotida pada molekul DNA. Mutasi genetika
merupakan salah satu jenis polimorfisme genetika.
7. Perbedaan jenis polimorfisme tergantung pada jenis mutasi
yang terjadi. Jenis polimorfisme yang paling sederhana
adalah mutasi tunggal basa nukleotida di mana satu basa
nukleotida menggantikan basa nukleotida lainnya yang
disebut dengan single nucleotide polymorphism (SNP).
8. Jenis lain polimorfisme adalah insersi dan delesi. Insersi
dan delesi ini umumnya terjadi pada daerah genetika yang
memiliki banyak pengulangan basa atau pola nukleotida
yang hampir sama.
9. Polimorfisme juga terjadi pada daerah promoter gen OPN
dan terjadi pada daerah binding site MYT1 zinc finger,
walaupun bagaimana polimorfisme ini mempengaruhi
pembentukan ketebalan intima media arteri karotis belum
diketahui secara jelas.
10. Berdasarkan hasil penelitian menggunakan analisis
multivariate yang dilakukan oleh Brenner etal. pada
tahun 2006 ditemukan bahwa terdapat hubungan yang
kuat antara alel OPN -443C dengan peningkatan ketebalan
carotid intima media (p<0,001).
11. Faktor genetika yang berperan dalam vascular cognitive
impairment (VCI) terdiri atas gen-gen yang berimplikasi
pada hipertensi dan penyakit arteri karotis (keduanya
berhubungan dengan stroke dan gangguan kognitif), dan
gen yang mempengaruhi respon otak terhadap penyakit
vaskular (toleransi vaskular dan plastisitas neuron).
12. Kelainan monogenik yang berkaitan dengan VCI yang
sudah ditemukan antara lain CADASIL, apolipoproteinE
(ApoE), varian herediter angiopati amiloid serebral,
penyakit sel sabit, penyakit Fabry, dan homosistinuria,
vaskulopati serebroretina, dan hereditary endotheliopathy
with retinopathy, nephropathy, dan stroke (HERNS).

Bab 8 Pengaruh Variasi Genetika pada Stroke Iskemia 161


13. CADASIL (cerebral autosomal dominant arteriopathy with
subcortical infarcts and leukoencephalopathy) merupakan
bentuk arteriopati akibat mutasi gen Notch3 pada
kromosom 19.
14. Gen ApoE terletak pada kromosom 19q13.2, memiliki
panjang 3,7 kilobasa, terdiri dari 4 ekson dan 3 intron dan
memproduksi polipeptida 299 asam amino. Gen ApoE
bersifat polimorfik dengan alel tersering adalah 2, 3, dan
4, yang mengkode 3 isoform utama protein ApoE, yaitu E2,
E3, dan E4.
15. Polimorfisme gen ApoE secara signifikan berpengaruh
terhadap keluaran kognitif paska stroke, seperti pada
penelitian berbasis populasi menyimpulkan bahwa
terdapat efek kognitif.
16. ApoE di plasma merupakan penyusun lipoprotein
kilomikron, kilomikron remnan, IDL, dan HDL. ApoE
berperan membersihkan kilomikron remnan dan kelebihan
kolesterol.
17. ApoE dalam susunan saraf pusat pada kondisi fisiologis
diproduksi terutama oleh astrosit, sedangkan pada kondisi
patologis (misalnya paska jejas otak) diproduksi oleh
neuron dan mikroglia.
18. Kolesterol dalam otak terdapat dalam mielin, membran
neuron dan glia. Pada neuron menyusun 25% komponen
membran dan berperan penting dalam plastisitas neuron,
sedangkan pada mielin, kolesterol juga merupakan
komponen utama di samping protein.
19. Dalam sebuah studi klinis yang dilakukan secara invitro
maupun in vivo, OPN terbukti dapat digunakan dalam terapi
penyakit stroke karena fungsinya sebagai neuroprotektor.
OPN terbukti meningkatkan sel yang hidup setelah
terjadinya iskemia.

162
Bab9

Polymerase
Chain Reaction (PCR)

163
9.1 Definisi PCR

P
olymerase Chain Reaction (PCR) adalah metode
amplifikasi (perbanyakan) DNA secara enzimatik sesuai
dengan urutan DNA spesifik (Giasuddin, 1995). Teknik
ini mampu memperbanyak rangkaian DNA secara eksponensial
sampai jutaan kali dalam beberapa jam (Sulistyaningsih, 2007).
Teknik amplifikasi PCR ini melibatkan primer spesifik
yang mampu mengapit segmen urutan DNA spesifik yang
akan diperbanyak. Selanjutnya adalah pengulangan siklus
melalui pemisahan (denaturation) DNA template, penempelan
(annealing) pasangan primer dengan urutan komplementernya,
dan perpanjangan (extension) primer yang dikatalisis oleh DNA
polimerase (Saiki etal., 1998).
Teknik PCR ini merupakan teknik amplifikasi DNA dan
identifikasi urutan basanya melalui proses sekuensing. Dasar
metode ini adalah untai ganda DNA akan diurai menjadi untai
tunggal kemudian dilakukan sintesis untai ganda yang baru dari
untai tunggal tersebut sebagai tempat memulainya sintesis DNA
baru. Kekurangannya, teknik ini sangat sensitif sehingga dapat
menyebabkan positif palsu karena adanya kontaminasi silang dari
spesimen tertentu (Sulistyaningsih, 2007).

9.2 Komponen PCR


Komponen yang dibutuhkan selama proses PCR antara lain
(Sulistyaningsih, 2007) seperti berikut ini.

164 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


1. DNA template
DNA template merupakan rangkaian DNA yang
akan digandakan. Kualitas DNA template ini akan sangat
mempengaruhi produk PCR yang akan dihasilkan. Karena DNA
template dapat mengandung kontaminasi polimerase inhibitor
yang dapat menghambat efektivitas reaksi. Selain kualitas,
ukuran DNA template juga penting. Jumlah DNA template yang
digunakan pada reaksi sangat mempengaruhi performa dari
PCR. Jumlah yang terlalu sedikit (<10 ng) akan menyebabkan
pengulangan reaksi dengan modifikasi spesifik atau harus
mendesain kembali primer yang akan digunakan. Jumlah
DNA template yang disarankan untuk DNA genom manusia
maksimal adalah 500 ng.

2. Primer
Primer adalah molekul oligonukleotida untai tunggal
yang terdiri atas sekitar 30 basa. Susunan primer merupakan
salah satu kunci keberhasilan PCR. Primer terdiri dari
2 oligonukleotida yang mengandung 18-24 nukleotida,
memiliki 40-60% G/C, titik lelehnya antara 55-65C, dan tidak
memiliki komplementer satu dengan yang lain di ujung3.
Ujung 3 primer penting dalam menentukan spesifisitas dan
sensitivitas PCR. Ujung ini tidak boleh mempunyai 3 atau lebih
basa G atau C karena dapat menstabilisasi penempelan primer
nonspesifik.
Konsentrasi optimal primer antara 0,10,5 M.
Konsen trasi primer yang terlalu tinggi akan menyebabkan
penempelan yang tidak spesifik dan akumulasi produk non
spesifik serta meningkatkan kemungkinan terbentuk primer
dimer. Sebaliknya, jika konsentrasi primer terlalu sedikit maka
PCR menjadi tidak efisien sehingga hasilnya rendah.

3. DNA polimerase
DNA polimerase adalah enzim yang mengkatalisis
polimerisasi DNA. DNA polimerase yang umum digunakan
adalah Taq polymerase yang stabil pada suhu tinggi karena
enzim ini diisolasi dari Thermus aquaticus yang hidup pada

Bab 9 Polymerase Chain Reaction (PCR) 165


sumber air panas. Konsentrasi enzim yang dibutuhkan
untuk PCR umumnya 0,5-2,5 unit. Jika konsentrasinya terlalu
tinggi, hal itu dapat mengakibatkan akumulasi produk non
spesifik. Sementara itu, jika terlalu rendah maka produk yang
dihasilkan akan sangat sedikit.

4. Deoxynucleotide Triphosphate (dNTP)


Proses PCR memerlukan semua jenis dNTP (dATP,
dGTP, dCTP, dan dTTP) untuk mensintesis untai DNA
komplementer. Konsentrasi dNTP masing-masing sebesar 20-
200 M untuk menghasilkan keseimbangan optimal antara
hasil, spesifitas, dan ketepatan PCR serta meminimalkan
kesalahan penempelan. Konsentrasi dNTP yang rendah akan
meminimalkan kesalahan penempelan pada daerah non target
dan menurunkan kemungkinan perpanjangan nukleotida
yang salah. Oleh karena itu, spesifitas dan ketepatan PCR akan
meningkat pada konsentrasi dNTP yang lebih rendah.
5. Konsentrasi Mg2+
Konsentrasi Mg2+ akan mempengaruhi beberapa proses,
di antaranya proses penempelan primer, suhu denaturasi,
spesifitas produk PCR, pembentukan primer dimer serta
aktivitas dan ketepatan enzim Taq polymerase. Ion bebas Mg2+
akan mengikat DNA template dan primer dan selanjutnya akan
membentuk kompleks terlarut dengan dNTP agar dikenali oleh
enzim Taq polymerase. PCR harus mengandung 0,5-2,5 mM
Mg2+ dari total konsentrasi dNTP. Konsentrasi yang lebih tingi
akan meningkatkan jumlah produk PCR tetapi menurunkan
spesifitasnya. Konsentrasi ion ini bergantung pada konsentrasi
bahan-bahan yang mengikatnya seperti dNTP dan EDTA.

9.3 Tahapan PCR


Terdapat beberapa tahapan dalam proses PCR yaitu seperti
yang akan dijelaskan berikut ini (Sulistyaningsih, 2007).

166 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


1. Denaturasi
Denaturasi dengan pemanasan (90C-95C) dalam proses
PCR dimaksudkan untuk memisahkan untai ganda DNA
template menjadi untai tunggal. Suhu denaturasi dipengaruhi
oleh sekuen target. Jika sekuen target kaya akan G-C maka
diperlukan suhu yang lebih tinggi. Suhu denaturasi yang terlalu
tinggi atau waktu denaturasi yang terlalu lama mengakibatkan
hilangnya aktivitas enzim. Waktu paruh aktivitas Taq
polymerase adalah > 2 jam pada suhu 92,5C, 40menit pada
95C, dan 5 menit pada 97,5C.

2. Annealing (Penempelan)
Proses annealing dimaksudkan untuk menempelkan primer
pada sekuen target DNA. Suhu dan lamanya waktu yang dibutuhkan
tergantung pada komposisi basa, panjang basa, dan konsentrasi
primer. Suhu annealing biasanya 5C di bawah suhu Tm primer,
yaitu sekitar 55C-72C.

3. Extension (Perpanjangan)
Suhu extension ditujukan untuk proses perpanjangan
sekuen DNA. Suhu yang dipilih umumnya adalah 72C karena
merupakan suhu optimum Taq polymerase. Suhu yang rendah
dengan konsentrasi dNTP tinggi dapat menyebabkan kesalahan
perpanjangan nukleotida. Sebaliknya, kombinasi suhu annealing
yang tinggi dengan konsentrasi dNTP yang rendah akan
menghasilkan ketepatan produk PCR yang tinggi. Lamanya
waktu pemanjangan ini bergantung pada panjang sekuen target,
konsentrasi sekuen target, dan suhu extension.
Jumlah siklus optimum biasanya adalah 25-35 siklus.
Siklus yang terlalu sedikit akan memberikan hasil yang sedikit,
sebaliknya jika terlalu banyak akan meningkatkan jumlah
kompleksitas produk non spesifik sehingga menimbulkan efek
plateu. Deteksi produk amplifikasi dapat dilakukan dengan
visualisai menggunakan elektroforesis gel agarose, dengan enzym
immunoassay menggunakan deteksi probe-based colorimetric atau
dengan teknologi emisi fluoresensi (Loei, etal., 2000).

Bab 9 Polymerase Chain Reaction (PCR) 167


A. Bahan-bahan untuk PCR
* dATP
* dGTP
* dTTP
* dCTP
Heat stable Template DNA Equal proportions
taq DNA (Spesimen DNA) of deoxy-ribonucleotide
Polymerase triphosphates

Primers actually
1520 bases long
B. Ilustrasi sederhana tahap-tahap dalam satu siklus PCR
1. Denaturation
(Heat to 95C)

2. Annealing (Cool to 37C)


2025 cycles of heating
Second and cooling build up over
cycle a million copies of the
original DNA template

3. Extension (Heat to 72C)


With each cycle the
number of copies of the
DNA template is doubled

Sumber: Giasuddin, 1995

Gambar 9.1Komponen PCR dan tahapan PCR

9.4 Aplikasi PCR untuk Deteksi SNP


SNP (Single Nucleotide Polymorphism) merupakan pasangan
basa yang berbeda pada satu individu dengan individu lain yang
terdistribusi secara acak pada genome dan diturunkan dari
generasi ke generasi. SNP berkontribusi untuk memperlihatkan
kemiripan keluarga misalnya kemiripan fisiologis dan risiko untuk
mengalami gangguan tertentu yang kemungkinan diperoleh dari
orang tuanya. Dalam dunia kedokteran, SNP telah menjadi salah
satu parameter yang dapat digunakan dalam mencari alternatif
terapi yang baru. (Mullis, 1990).

168 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Analisa SNP dapat dilakukan dengan berbagai teknik
genotiping misalnya penggunaan hibridisasi dengan enzim
restriksi dan teknik DNA sekuensing yang berbasis analisis
fragmen. Salah satu teknik yang banyak digunakan adalah teknik
DNA sekuensing. Dengan teknik DNA sekuensing, dapat diketahui
basa yang menyusun suatu DNA. Teknik DNA sekuensing harus
diawali dengan metode PCR. DNA yang akan ditentukan urutan
basanya akan dijadikan cetakan untuk kemudian diamplifikasi
agar jumlahnya mencukupi untuk selanjutnya dilakukan proses
sekuensing. Oleh karena itu, PCR mempunyai peran penting dalam
bidang penelitian obat (Papp, etal., 2003).

9.5 DNA Sekuensing


DNA sekuensing merupakan metode yang digunakan untuk
menentukan urutan basa nukleotida adenin, guanin, sitosin, dan
timin pada molekul DNA. Urutan basa DNA dapat diketahui dengan
prosedur kimia melalui pemecahan molekul DNA yang terlabeli
secara parsial pada setiap pengulangan basa. Panjang fragmen yang
terlabeli akan mengidentifikasi posisi basa. Reaksi yang memotong
basa DNA, secara khusus dibagi menjadi dua. Pertama, reaksi
yang memotong basa adenin, guanin, sitosin dan timin. Kedua,
reaksi yang memotong sitosin saja. Produk DNA akan dipisahkan
berdasarkan panjang pasang basa melalui elektroforesis, kemudian
urutan DNA dapat dibaca melalui pola radioaktif (Munshi, 2012).

3.500
190 195
3.000 G T G G G G C G C T G C
2.500
2.000
1.500
100
500
0

Sumber: Mushi, 2012

Gambar 9.2Cetakan basa DNA menggunakan Dye-terminating Sequensing


yang dilabel dengan flourosense

Bab 9 Polymerase Chain Reaction (PCR) 169


Terdapat beberapa metode DNA sekuensing yang dapat
digunakan, antara lain MaxamGilbert sequencing, Chain-
termination methods, Dye-terminator sequencing, Automation
and sample preparation, dan Large scale sequencing strategies.
Gambar 9.2 di atas menunjukkan urutan basa DNA yang diketahui
melalui metode Dye-terminating sequensing. Adapun metode
yang umum digunakan adalah metode Chain-termination methods
(Sanger Methods) yang dinilai lebih efisien dan lebih minim
radioaktif dibandingkan dengan metode yang lain (Munshi, 2012).

Rangkuman
1. Polymerase Chain Reaction (PCR) adalah metode
amplifikasi (perbanyakan) DNA secara enzimatik sesuai
dengan urutan DNA spesifik.
2. Teknik PCR ini merupakan teknik amplifikasi DNA dan
identifikasi urutan basanya melalui proses sekuensing.
3. Komponen yang dibutuhkan selama proses PCR antara lain
DNA template, primer, DNA polimerase, Deoxynucleotide
Triphosphate (dNTP), Konsentrasi Mg2+.

170 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


4. Tahapan dalam proses PCR terdiri atas denaturasi,
annealing (penempelan), dan extension (perpanjangan).
5. SNP (Single Nucleotide Polymorphism) merupakan
pasangan basa yang berbeda pada satu individu dengan
individu lain yang terdistribusi secar aacak pada genom
dan diturunkan dari generasi ke generasi.
6. DNA sekuensing merupakan metode yang digunakan
untuk menentukan urutan basa nukleotida adenin,
guanin, sitosin, dan timin pada molekul DNA.

Bab 9 Polymerase Chain Reaction (PCR) 171


172
Bab10

Mengenal
Berbagai Deteksi
Stroke

173
S
troke dapat mematikan otak hanya dalam hitungan
menit. Stroke bukan saja menimbulkan gejala yang
temporer, tetapi juga dapat menyebabkan kerusakan
permanen. Oleh karena itu, berbagai langkah deteksi stroke sangat
penting kita ketahui. Untuk mencegah stroke, kita dapat mengenali
berbagai faktor risiko stroke. Berikut ini akan dijelaskan mengenai
deteksi faktor risiko stroke.
Secara garis besar, deteksi faktor risiko stroke dapat kita
bedakan menjadi anamnesis, pemeriksaan fisik diagnostik, dan
pemeriksaan penunjang (Gofir A., 2014).
Deteksi faktor risiko anamnesis dapat kita ketahui dari:
Riwayat merokok
Riwayat mengonsumsi alkohol
Riwayat pemakaian kontrasepsi
Riwayat TIA dan stroke sebelumnya
Riwayat pemakaian obat-obatan terlarang
Riwayat pemakaian kontrasepsi jangka panjang
Riwayat cuci darah.
Deteksi faktor risiko fisik diagnostik dapat dilakukan dengan
memperhatikan:
Tekanan darah
Obesitas: BMI atau waist hip ratio
Fisik diagnostik : inspeksi, palpasi, perkusi, auskultasi.
Sementara itu, untuk deteksi faktor risiko pemeriksaan
penunjang antara lain dilakukan dengan cara:
Elektrokardiografi
Foto thorax

174 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Laboratorium darah rutin
Profil lemak
Kimia darah
Faktor pembekuan darah
Agregasi trombosit
Ekhokardiografi
Transkranial doppler
Angiografi (Gofir A., 2014)
Berikut ini akan dijelaskan beberapa metode deteksi untuk
stroke.

10.1 F-A-S-T Cara Mudah Mendeteksi Stroke


Pada sebagian besar pasien stroke telah merasakan keluhan
mulai dari rumah. Dengan demikian, mengenal gejala stroke
dan perawatan daruratan sangat penting bagi masyarakat luas
(termasuk pasien dan orang terdekat dengan pasien) dan petugas
kesehatan profesional (dokter umum dan resepsionisnya, perawat
penerima telpon, atau petugas gawat darurat). Tenaga medis atau
dokter terlibat di unit gawat darurat atau pada fasiltas prahospital
harus mengerti tentang gejala stroke akut dan penanganan
pertama yang cepat dan benar. Pendidikan berkesinambungan
perlu dilakukan terhadap masyarakat tentang pengenalan atau
deteksi stroke (Wirawan N. & I.B. Kusuma Putra).
Konsep time is brain berarti pengobatan stroke merupakan
keadaan gawat darurat. Jadi, keterlambatan pertolongan pada fase
prahospital harus dihindari dengan pengenalan keluhan dan gejala
stroke bagi pasien dan orang terdekat. Pada setiap kesempatan,
pengetahuan mengenai keluhan stroke, terutama pada kelompok
risiko tinggi (hipertensi, atrial fibrilasi, kejadian vaskular lain dan
diabetes) perlu disebarluaskan. Untuk mengetahui dan mendeteksi
terjadinya stroke, kita dapat mengikuti empat langkah berikut ini
(Wirawan N. & I.B. Kusuma Putra).
Empat langkah tersebut adalah F-A-S-T yang berarti:

Bab 10 Mengenal Berbagai Deteksi Stroke 175


F Facial Movement,

A Arm Movement,

S Speech, dan

T Time to Call

10.1.1 Facial movement


Facial movement merupakan penilaian pada otot wajah.
Pemeriksan ini dilakukan dengan tahapan sebagai berikut:
a) Minta pasien untuk tersenyum atau menunjukkan giginya.
b) Amati simetrisitas dari bibir pasien, tandai pilihan YES
bila terlihat ada deviasi dari sudut mulut saat diam atau saat
tersenyum.
c) Kemudian identifikasi sisi sebelah mana yang tertinggal atau
tampak tertarik, lalu tandai apakah di sebelah kiri L atau
sebelah kanan R (AHA/ASA Guideline, 2007).

10.1.2 Arm movement


Arm movement merupakan penilaian pergerakan lengan
untuk menentukan apakah terdapat kelemahan pada ekstremitas,
pemeriksaannya dilakukan dengan tahapan berikut:
a) Angkat kedua lengan atas pasien bersamaan dengan sudut 90
bila pasien duduk dan 45 bila pasien terlentang. Minta pasien
untuk menahannya selama 5 detik.
b) Amati apakah ada lengan yang lebih dulu terjatuh dibanding
kan lengan lainnya.
c) Jika ada, tandai lengan yang terjatuh tersebut lengan sebelah
kiri atau kanan (AHA/ASA Guideline, 2007).

10.1.3 Speech
Speech merupakan penilaian bicara yang meliputi cara dan
kualitas bicara. Pemeriksanya dilakukan dengan tahapan berikut:
a) Perhatikan jika pasien berusaha untuk mengucapkan sesuatu.
b) Lakukan penilaian apakah ada gangguan dalam berbicara.

176 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


c) Dengarkan apakah ada suara pelo.
d) Dengarkan apakah ada kesulitan untuk mengungkapkan
atau menemukan kata-kata. Hal ini bisa dikonfirmasi dengan
meminta pasien untuk menyebutkan benda-benda yang
terdapat di sekitar, seperti pulpen, gelas, piring, dan lain-lain.
e) Apabila terdapat ganguan penglihatan, letakkan barang
tersebut di tangan pasien dan minta pasien menyebutkan
nama benda tersebut (AHA/ASA Guideline, 2007).

10.1.4 Time to call


Jika salah satu atau ketiga gejala di atas dialami seseorang
maka segera lakukan langkah keempat yaitu time to call.
Maksudnya adalah kita harus segera menghubungi rumah sakit,
dokter atau lembaga kesehatan lainnya untuk dapat melakukan
pengecekan secara lanjut mengenai gejala stroke yang timbul
(Meetdoctor, 2014).

10.2 Transcranial Doppler (TCD)


Selama 4 dekade terakhir, berbagai tes non-invasive dan
aplikasi klinis telah dikembangkan untuk mendeteksi dan
memonitoring penyakit serebrovaskular. Tujuan tes ini pada
penyakit serebrovaskular adalah untuk membedakan keadaan
normal dengan pembuluh darah arteri yang mengalami kelainan,
mengidentifikasi stenosis, lokasi dari proses penyakit termasuk
oklusi, progresivitas penyakit, emboli serebri, melihat gambaran
karakteristik morfologi plak aterosklerosis, dan mengukur
potensial sirkulasi kolateral untuk mempertahankan CBF
(Neumyer dkk, 2004; Noort dkk,1990; Sloan dkk, 2004).
Single gate spectral TCD diperkenalkan pertama kali oleh Rune
Aaslid pada tahun 1982 untuk mengukur hemodinamik serebri
secara non-invasive. Terdapat 4 window untuk insonasi dari TCD,
yaitu: (Kassab dkk.,2007; Neumyer dkk., 2004)
Temporal: mengukur kecepatan pada arteri serebri media
(MCA), anterior (ACA), posterior (PCA) dan arteri komunikans.

Bab 10 Mengenal Berbagai Deteksi Stroke 177


Orbital: insonasi sifon arteri oftalmikus (OA) dan arteri karotis
interna (ICA).
Suboksipital: insonasi arteri veterbralis (VA) dan basilaris (BA)
melalui foramen magnum.
Submandibular: mengukur kecepatan ICA.
Keuntungan TCD adalah dapat dilakukan pada bedside dan
dapat diulangi sesuai yang dibutuhkan atau dilakukan untuk
monitoring secara berkelanjutan, lebih murah dibandingkan
dengan teknik yang lain, dan tidak memerlukan penggunaan
bahan kontras. Keterbatasannya yang utama adalah hanya dapat
menggambarkan kecepatan aliran darah serebral pada segmen-
segmen tertentu vaskular besar intrakranial, di mana penyakit
arteri sering timbul pada lokasi ini (Sloan dkk., 2004).

10.2.1 Hemodinamik serebrovaskular


Aliran darah dalam suatu sistem sirkulasi dipengaruhi oleh
darah, tekanan, tahanan dan alirannya. Manipulasi pada tekanan
dan tahanan dalam sistem kardiovaskular dapat mempengaruhi
parameter aliran darah secara langsung dan penambahan
hemodinamik (Eggers dkk, 2006; Neumyer dkk, 2004).
1. Viskositas darah terutama ditentukan oleh hematokrit.
Peningkatan hematokrit akan menyebabkan peningkatan
pergesekan antara lapisan sel darah, penurunan kecepatan
aliran dan penambahan tekanan yang diperlukan untuk aliran
darah pada sirkulasi sistemik. Jika disertai dengan penurunan
interval diameter pembuluh darah (PD), peningkatan pada
viskositas darah secara signifikan dapat mengganggu aliran
darah. Viskositas darah dapat berubah yang dipengaruhi oleh
tingkat kecepatan aliran, heart rate, bentuk PD, hematokrit,
temperatur, dan shear stress (Neumyer dkk, 2004).
2. Aliran darah di dalam vaskular terutama ditentukan oleh dua
faktor yaitu perbedaan tekanan (PL-P2) antara dua ujung
vaskular dan tahanan vaskular terhadap aliran darah. Hukum
Ohm sering digunakan untuk menggambarkan aliran darah
dalam PD. Dikatakan bahwa aliran darah berbanding lurus

178 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


terhadap perbedaan tekanan, tetapi berbanding terbalik
dengan tahanan.

Aliran darah = tekanan/tahanan

Hukum Laplace menjelaskan bahwa regangan otot (T)


pada vaskular yang diperlukan untuk mempertahankan
tekanan aliran spesifik (P) akan menurun jika diameter
vaskular (R) lebih kecil (P = T/R). Ini berarti semakin kecil
diameter vaskular maka regangan yang diperlukan untuk
mempertahankan tekanan dalam vaskular semakin menurun
(Neumyer dkk, 2004).
3. Tahanan atau hambatan pada aliran dapat diperoleh melalui
pengukuran aliran darah dan perbedaan tekanan dalam
vaskular. Tahanan merupakan hasil dari perubahan diameter
vaskular yang disertai dengan peningkatan viskositas darah
dan area potong lintang vaskular. Tahanan berhubungan
dengan perubahan diameter vaskular yang mempengaruhi
aliran darah melalui fenomena yang dikenal sebagai
streamlining atau aliran laminar. Aliran laminar digambarkan
sebagai pergerakan sel darah yang parabolik dalam tiap
lapisannya dalam vaskular, di mana lapisan darah yang paling
dekat dengan dinding vaskular akan memiliki kecepatan
aliran yang lambat. Sementara itu, kecepatan aliran sel darah
di lapisan tengah akan semakin meningkat. Aliran turbulensi
timbul jika terdapat hambatan aliran, dinding vaskular yang
tidak rata, atau akibat adanya perubahan yang tajam dari
arah aliran. Hal ini dapat mengakibatkan pusaran arus aliran
dengan peningkatan pergesekan pada lapisan sel darah
danresistensi.
Hukum Poiseuille menggambarkan pengaruh tahanan aliran
darah. Hukum ini menyatakan bahwa aliran dari suatu cairan pada
suatu pipa berbanding lurus terhadap perbedaan tekanan di antara
kedua ujung pipa dan berbanding terbalik dengan panjang pipa
dan viskositas cairan. Hubungan konsep ini terhadap variasi rerata
aliran darah dapat diilustrasikan oleh perubahan pada tekanan

Bab 10 Mengenal Berbagai Deteksi Stroke 179


arterial. Peningkatan tekanan arterial akan meningkatkan daya
dorong sel darah dan pelebaran dinding vaskular sehingga dapat
menurunkan tahanan vaskular dan terjadi peningkatan aliran
darah (Neumyer dkk, 2004). Jika ketiga hal di atas dihubungkan
dengan hemodinamik serebrovaskular, maka akan diterjemahkan
sebagai CBF = cerebral perfussion pressure (CPP)/cerebrovascular
resistance (CVR). Cerebral perfussion pressure dapat diukur dari
mean arterial blood pressure (MABP) dan intracranial pressure
(ICP) (CPP=MABP-ICP). Resisten serebrovaskular mempengaruhi
keadaan fisiologis dengan mengkonstriksikan dan dilatasi vaskular
kecil di otak. Pada keadaan patologis, perubahan fokal pada
tahanan dapat dilihat segera di daerah yang terdapat stenosis.
Tujuan utama hemodinamik serebrovaskular adalah untuk
menjaga CBF tetap stabil meskipun terjadi perubahan pada CPP
dan CVR (Kassab dkk.,2007).

10.2.2 Interpretasi temuan TCD


Pada pemeriksaan TCD, gambaran bentuk gelombang aliran
darah merupakan gambaran time dependence dari kecepatan
aliran darah terhadap aktivitas jantung. Bentuk gelombang dapat
dilihat selama pemeriksaan TCD dimulai dengan mendengar sinyal
aliran yang diikuti dengan analisa visual pada tampilan sinyal
tersebut pada layar (Neumyer dkk, 2004). Pada pemeriksaan
TCD perlu diperhatikan velocity, bentuk aliran darah, adanya
perubahan aliran atau sinyal mikroemboli. Informasi tersebut
memberikan gambaran blood flow velocity, arah aliran dan juga
dapat memberikan ukuran parameter yang dapat ditambahkan
pada evaluasi TCD. Pulsasity Index (PI) merupakan salah satu
ukuran parameter yang bermanfaat, dan dipertimbangkan sebagai
penanda dari tahanan distal dari sisi insonasi. Pulsasity Index
dihitung dengan menggunakan rumus Gosling, di mana PI = Peak
Systolic Velocity (PSV)-End Diastolic Velocity (EDV))/mean velocity
(Kassab dkk.,2007; Neumyer dkk., 2004).
Normal rasio kecepatan aliran darah (MFV) pada MCA > ACA >
Siphon > PCA > BA > VA. Individu normotensi memiliki positif EDV
kira-kira 25-50% dari nilai PSV dan nilai PI antara 0,6-1,1 pada

180 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


seluruh arteri intrakranial. Pola tahanan aliran yang tinggi (PI>,2)
hanya dijumpai pada OA dan dapat juga dijumpai pada kronik
hipertensi, hiperventilasi dan peningkatan kardiak output. Hal
yang harus diingat adalah sebagai berikut (Neumyer dkk., 2004).
1. TCD velocity bukan untuk mengukur volume CBF. Akan tetapi,
perubahan velocity pada pengukuran TCD berkorelasi dengan
perubahan pada CBF.
2. CBF dan mean flow velocity (MFV) dapat menurun dengan
pertambahan usia.
3. Hipertensi (termasuk yang kronik) meningkatkan pulsasi
aliran dan MFV.
4. Hiperventilasi dapat menurunkan MFV dan meningkatkan
pulsasi aliran.
5. Hiperkapnea dapat meningkatkan MFV dan menurunkan
pulsasi aliran.
6. Bentuk gelombang ditentukan oleh berbagai faktor seperti
kardiak output, tekanan darah, autoregulasi otak, respon
vasomotor dan lesi fokal arteri. Pengaruh usia pada parameter
CBF telah dilaporkan pada beberapa studi. Penurunan CBF
dengan peningkatan usia diduga berhubungan dengan
perubahan pada hemodinamik serebrovaskular seperti
penurunan kebutuhan metabolisme, peningkatan hematokrit
dan penurunan level tekanan parsial karbon dioksida,
perubahan ukuran vaskular dan penurunan kardiak output.
Beberapa penelitian menemukan penurunan 20% pada
doppler shift pada MCA pada usia 17-67 tahun dan beberapa
studi yang menemukan penurunan rerata velocity sebesar
0,51% pada MCA, 0,5% pada ACA dan 0,37% pada PCA per
tahunnya pada pasien dengan riwayat kejadian neurologis,
tetapi pada pemeriksaan neurologis ditemukan normal. Selain
itu, juga telah diketahui bahwa kecepatan aliran yang tertinggi
dijumpai pada subjek pediatrik dan mulai menurun secara
signifikan pada usia > 40 tahun (Demirkaya dkk., 2008).

Bab 10 Mengenal Berbagai Deteksi Stroke 181


Signal intensity
Velocity Scale (cm/s) Background (dB)
with no noise
100

75

50

25

Base- 0
line Flow
25 direction
50

75

100 towards
Time P1 MEAN Diasys
+ away
axis from the
transducer
1 second Pulsatility index Mean, Diastolic, Systolic
flow velocities
1 beginning of systoli; 2 peak systoli; 3 diacrotic notch; 4 end diastoli distance
1 2 systoli acceleration; 2 3 late systolic decelaration; 3 4 diastolic decelaration
Sumber: Neumyer etal. 2004

Gambar 10.1Cara membaca bentuk gelombang pada pengukuran TCD

< 0,6 0,6 - 1,1 1,2 - 1,6 1,7 - 1,9 2,0

PI = 0,3 0,7 1,2 1,7 N/A


EDV > 50% 50 - 25% < 25% 20% 0 - 10%
Sumber: Neumyer etal. 2004

Gambar 10.2Nilai pulsasity index

Diagnosis oklusi arteri serebralis intrakranial dengan


menggunakan TCD diperoleh dengan hilangnya sinyal doppler
pada arteri serebral pada pasien dengan bukti acoustic window
yang terdeteksi pada satu arteri serebralis ipsilateral. Morfologi
waveform dibandingkan velocity aliran darah pada TCD
dapat memberikan informasi mengenai lokasi clot, obstruksi
hemodinamik yang signifikan, dan tahanan pada PD distal
(Eggersdkk, 2006).

182 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Tabel 10.1Nilai normal mean flow velocity pada TCD
Ketebalan Mean Flow
Artery Window Arah
(mm) Velocity
MCA Temporal 30 to 60 Toward probe 55 12 cm/s
ACA Temporal 60 to 85 Away 50 11 cm/s
PCA Temporal 60 to 70 Bidirectional 40 10 cm/s
TICA Temporal 55 to 65 Toward 39 09 cm/s
ICA (siphon) Orbital 60 to 80 Bidirectional 45 15 cm/s
OA Orbital 40 to 60 Toward 20 10 cm/s
VA Occipital 60 to 80 Away 38 10 cm/s
BA Occipital 80 to 110 Away 41 10 cm/s
TCD, transactional Doppler; MCA, middle celebral artery; ACA, anterior cerebral
artery; PCA, posterior cerebral artery; TICA, terminal internal carotid artery; ICA,
internal carotid artery; OA, opthalmic artery; VR, vetebral artery; BA, basilar artery.
Sumber: Kassab et al., 2007

Untuk menjelaskan morfologi waveform pada TCD dikembang


kan TIBI residual flow grading system dengan tingkatan
dari 0 sampai 5 yang memiliki arti absen, minimal, blunted,
dampened, stenosis dan aliran yang normal (secara berurutan)
(Eggersdkk,2006).
Sejumlah penelitian telah menduga pengukuran velocity untuk
grading stenosis. Kriteria yang paling sering digunakan biasanya
berdasarkan rasio PSV arteri karotis internal dan arteri karotis
kommunis serta velocity distolik untuk menentukan batasan
pengukuran (Sidhu, 2000).
Kriteria diagnostik TCD telah divalidasi pada beberapa
penelitian dan dapat mengidentifikasi lokasi trombus dengan
akurasi 90% pada MCA dan ICA. Oklusi arteri intrakranial yang
terdeteksi oleh TCD berhubungan dengan perburukan neurologis,
disabilitas atau kematian setelah 90-hari, di mana gambaran
normal pada TCD memprediksikan perbaikan yang cepat. Pasien
dengan stroke pada daerah ICA, temuan TCD, stroke severity
pada 24 jam, dan ukuran lesi pada CT merupakan prediktor yang
independen dengan outcome setelah 30 hari (Sloan dkk, 2004;
Neumyer dkk, 2004).

Bab 10 Mengenal Berbagai Deteksi Stroke 183


Grade 0

Grade 1

Grade 2

Grade 3

Grade 4

Grade 5

Grade 0 Absent flow signals are defined by the lack of reguler pulsatile flow
Absent signals despite varying degrees of background noise.
Grade 1 Systolic spikes of variable velocity and duration.
Minimal Absent diastolic flow during all cardiac cycles based on visual
interpretation of periods of no flow during end-diastole.
Reverberating flow is a type of minimal flow.
Grade 2 Flattened systolic flow acceleration of variable duration compared to
Blunted control.
Positive end-diastolic velocity and pulsatility index < 1,2.
Grade 3 Normal systolic flow acceleration.
Dampened Positive end-diastolic velocity.
Decreased mean flow velocity (MFV) by >30% compared to control.
Grade 4 MFV od > 80cm/s and velocity difference of > 30% compared
Stenotic to control side; if velocity difference is = 30%, additional sign of
stenosis, i.e. turbulance, spectral narrowing OR if both affected
and comparison sides have MFV < 80 cm/s due to low end-diastolic
velocities, MFV > 30% compared to control side and signs of
turbulance.
Grade 5 < 30 % mean velocity difference compared to control.
Normal Similar waveform shapes compared to control.
Sumber: Eggers, et.al., 2006

Gambar 10.3Modifikasi TIBI flow grading system

184 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Normal < 30% stenosis 70-90% stenosis
PSV < 125 cm/s; EDV < 30% cm/s PSV > 250 cm/s; EDV > 100% cm/s
No Spectral breedening Focal acceleration; turbulance

30-49% stenosis 91-99% stenosis


PSV > 125 cm/s; EDV < 40% cm/s PSV very high or very low
Focal flow disturbance EDV very high, very low, or none
50-69% stenosis 100% stenosis (Oxcluded)
PSV > 125 cm/s; EDV > 40% cm/s No flow by spectral, color or power
Focal flow disturbance CCA diastolic flow to zero;
CCA pulsatility asymetric

Sumber: Neumyer, etal., 2004

Gambar 10.4Nilai PSV dan EDV pada stenosis arteri karotis

Tabel 10.2 Kriteria tingkat penurunan diameter arteri karotis interna


Penurunan
PSV EDV PSVICA / PSVCOA
Diameter (%)
0-29 < 100 < 40 < 32
30-49 110-130 < 40 < 32
50-59 > 130 < 40 < 32
60-69 > 130 40-110 32-40
70-79 > 230 110-140 > 40
80-95 > 230 > 140 > 40
96-99 'String flow'
100 'No flow'
CCA, common carotid artery; PSV, peak systolic velocity; EDV, end
diastolic velocity, PSVICA/PSVCOA, ratio of the velocities. Velocity
measurements are in cm/s.
Sumber: Sidhu, P.S. 2000

10.3 Hubungan Nilai Ankle Brachial Index dengan


Stroke Iskemia
Stroke merupakan penyakit serebrovaskular yang memiliki
morbiditas, mortalitas, dan tingkat kecacatan yang tinggi di dunia.
Nilai Ankle Brachial Index (ABI) yang abnormal merupakan salah
satu faktor risiko potensial untuk stroke iskemia. Ankle Brachial
Index (ABI) adalah salah satu pemeriksaan untuk mendiagnosis
penyakit arteri perifer secara sederhana, non-invasif, objektif,

Bab 10 Mengenal Berbagai Deteksi Stroke 185


murah, serta memiliki keakuratan yang tinggi dengan sensitivitas
95% dan spesifisitas 94-100% (Akhtar B.S.S 7 Khan R.A. 2009; Kim
E.S.H. et.al., 2012).
Ankle Brachial Index (ABI) merupakan rasio tekanan darah
sistolik tungkai dengan tekanan darah sistolik lengan yang dapat
diukur dengan cepat dan mudah sebagai pemeriksaan penyakit
arteri perifer (Begelman S. & Jaff M., 2009; Fowkes F.G.R. et.al.,
2008). Pemeriksaan ABI dapat dilakukan dengan berbagai
metode yaitu dengan menggunakan doppler ultrasound, teknik
oscillometric, plethysmography, photoplethysmography, auskultasi,
dan palpasi (AHA, 2012; WOCN, 2012). Nilai ABI abnormal
merupakan suatu faktor risiko potensial yang berhubungan
dengan stroke iskemia.
Berbagai kelompok studi besar di dunia seperti Trans
Atlantic Inter-Society Consensus for the Management of Peripheral
Arterial Disease (TASC II) (2007), American College of Cardiology
Foundation/American Heart Association (2011), dan The Fifth Joint
European Task Force (2012) telah merekomendasikan pemeriksaan
ABI untuk mengidentifikasi risiko penyakit kardiovaskular
(AkhtarB., et al., 2009; Kim E.S.H., et al., 2012). Pemeriksaan ABI
mempunyai akurasi yang lebih baik dibandingkan dengan metode
penyaringan penyakit aterosklerosis lain seperti anamnesis,
riwayat penyakit dan palpasi pulsasi perifer (Akhtar B., et al., 2009;
Kim E.S.H., et al., 2012).
Reinanda H. dkk pada tahun 2013 telah melakukan penelitian
yang bertujuan untuk mengetahui hubungan antara nilai ABI
dengan kejadian stroke iskemia. Metode yang digunakan adalah
penelitian observasional dengan rancangan cross sectional yang
dilakukan di klinik saraf RSUD Dokter Soedarso Pontianak periode
Juni hingga Juli tahun 2013. Sebanyak 90 sampel penelitian
dipilih dengan teknik consecutive sampling berdasarkan kriteria
inklusi dan eksklusi. Data dikumpulkan dari wawancara, rekam
medis, dan pemeriksaan langsung terhadap subjek penelitian lalu
dianalisis menggunakan uji chi square dan dilanjutkan dengan
analisis regresi logistik.

186 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Berdasarkan hasil penelitian karakteristik subjek penelitian
menggambarkan bahwa pasien yang berobat ke Klinik Saraf RSUD
dr.Soedarso Pontianak lebih banyak berusia 60-69 tahun (32%)
dan berjenis kelamin wanita (60%). Selain itu, pasien yang berobat
juga didominasi oleh pasien dengan riwayat stroke negatif pada
keluarga (73%), hipertensi (80%), non diabetes melitus (86%), non
dislipidemia (57%), bukan perokok (78%), non obesitas (54%),
nilai ABI normal (70%), dan diagnosis non stroke iskemia(72%)
(Reinanda, H., 2013).
Hasil uji chi square ini menunjukkan terdapat 4 variabel yang
berhubungan secara signifikan terhadap stroke iskemia, yaitu nilai
ABI (p=0,000), hipertensi (p= 0,003), diabetes melitus (p= 0,023),
dan dislipidemia (p= 0,024). Usia, jenis kelamin, riwayat keluarga,
status merokok, dan status obesitas terbukti tidak memiliki
hubungan yang bermakna secara statistik. Hasil analisis bivariat ini
menjadi acuan untuk analisis multivariat. Semua variabel dengan
nilai p< 0,25 akan diolah lebih lanjut dengan analisis multivariat
(Reinanda, H., 2013).
Hasil analisis multivariat menunjukkan nilai ABI memiliki nilai
OR yang paling tinggi, yaitu sebesar 10,240 (IK 95% 3,079-34,053),
disusul oleh hipertensi dengan OR sebesar 5,808 (IK 95% 0,951-
35,482), diabetes melitus dengan OR sebesar 4,430 (IK 95% 1,071-
18,326), dan dislipidemia dengan OR sebesar 2,731 (IK 95% 0,861-
8,662). Hal ini menunjukkan nilai ABI memiliki hubungan yang
paling kuat terhadap kejadian stroke iskemia (Reinanda,H.,2013).
Hasil penelitian setelah dilakukan uji chi-square untuk mencari
hubungan antara nilai ABI dan stroke iskemia memperoleh nilai
p sebesar 0,000 (p< 0,05). Hasil penelitian ini menunjukkan
terdapat hubungan yang bermakna antara nilai ABI dengan stroke
iskemia (ReinandaH.,2013).
Hasil penelitian ini sesuai dengan hasil penelitian yang
dilakukan oleh Pramudita, Busch et al, Purroy et al, Sen et al, dan
Weimar etal. Pada penelitian yang dilakukan oleh Pramudita di
RSUP dr. Sardjito Yogyakarta mengenai hubungan nilai ABI dan
stroke iskemia akut diperoleh nilai p sebesar 0,001 dan Rasio

Bab 10 Mengenal Berbagai Deteksi Stroke 187


Prevalens (RP) sebesar 2,13 (IK 95% = 1,50-3,01), sedangkan
Purroy et al di Spanyol dalam penelitian yang berjudul Predictive
Value of Ankle Brachial Index in Patients With Acute Ischaemic Stroke
mendapatkan hasil dengan nilai p sebesar 0,031 (PramuditaE.A.,
2011; Puroy F. et al., 2011).
Hasil penelitian ini juga didukung oleh penelitian kohort
prospektif terhadap 102 pasien yang di follow up selama periode
satu tahun yang dilakukan oleh Senetal. di Amerika Serikat.
Menurut Senetal. penyakit arteri perifer asimptomatik yang
ditandai dengan nilai ABI yang rendah secara independen
berhubungan dengan frekurensi stoke atau kelainan vaskular lain
(p= 0,001, OR:6,5 IK 95%: 2,1-19,9) (Sen S. et al., 2009).
Hasil yang tidak jauh berbeda juga dipaparkan oleh penelitian
yang dilakukan di Jerman oleh Busch etal. dan Weimar etal.
Busch et al. menyatakan nilai ABI yang rendah meningkatkan
risiko seseorang dua kali lipat lebih tinggi untuk menderita
stroke dibandingkan individu dengan nilai ABI normal (p=0,03,
RP:2,2 IK 95% 1,1-4,5) (Busch M.A., et al., 2009). Sementara itu,
Weimaretal. menyatakan risiko stroke berulang meningkat pada
individu dengan nilai ABI abnormal (p=0,024, OR:2,0 IK 95%
1,12-3,56) (Weimar C. et al., 2009).
Berdasarkan penelitian-penelitian ini maka semakin mem
perkuat teori yang menyatakan terdapat hubungan yang signifikan
antara nilai ABI yang abnormal dengan kejadian stroke iskemia
(Reinanda H., 2013).

10.4 Polimorfisme Gly972Arg Gen IRS-1 dan


G2350A Gen ACE pada Stroke Iskemia
Stroke merupakan gangguan multifaktorial yang sangat
heterogen, dan mempunyai defek substansial tentang komponen
genetika pada stroke iskemia. Identifikasi asosiasi genetika sebagai
faktor risiko stroke yang baru sebagai penyebab stroke iskemia
akan sangat membantu perbaikan strategi pencegahan stroke dan
dapat menentukan target pengobatan terbaru dari stroke iskemia
(Syahrul, 2013).

188 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Penelitian yang dilakukan oleh Syahrul bertujuan untuk
mengidentifikasi polimorfisme Gly972Arg gen IRS-1 dan G2350A
gen ACE sebagai faktor risiko stroke iskemia, sindrom metabolik,
dan resistensi insulin pada penderita stroke iskemia. Telah
dilakukan penelitian kasus kontrol dengan matching pada jenis
kelamin dan ras pada 85 kasus penderita stroke iskemia dan
86 kontrol subjek sehat bukan stroke. Terhadap kasus stroke
iskemia dilakukan pemeriksaan fisik umum, neurologi lengkap,
BMI, diagnosis sindrom metabolik sesuai kriteria ATP III NHLBI
2002, pengukuran HOMA resistensi insulin mengunakan
rumus HOMA-IR. Dilakukan pemeriksaan CT scan atau MRI
kepala untuk pembuktian stroke iskemia, pemeriksaan EKG,
laboratorium gula darah puasa, trigliserida, HDL-kolesterol,
dan insulin darah puasa. Dilakukan isolasi DNA, dilanjutkan
dengan pemeriksaan PCR-RFLP menggunakan enzim SmaI untuk
analisis genotipe Gly972Arg gen IRS-1 yang menggunakan primer
5CTTCTGTCAGGTGTCCATCC3 forward dan 5TGGCGAGGTGTCCAC
GTAGC3 reverse. Apabila terdapat polimorfisme maka alel
GGG menjadi RGG. Untuk analisis genotipe ACE dilakukan
pemeriksaan lokus polimorfisme G2350A gen ACE menggunakan
primer forward5- CTGACGAATGTGATGGCCGC-3 upstream
dan reverse 5TTGATGAGTT CCACGTATTTCG-3 downstream.
Apabila terdapat polimorfisme maka alel G beubah menjadi A
(Syahrul,2013).
Pada subjek kontrol dilakukan pemeriksaan yang sama, dan
tidak dilakukan pemeriksaan CT scan/MRI kepala. Hasil penelitian
terhadap 85 kasus stroke iskemia dengan usia rerata 57,3 tahun,
dan 86 subjek kontrol dengan usia rerata 44,2 tahun. Distribusi
nukleotida polimorfisme Gly972Arg gen IRS-1 pada kasus stroke
terdiri atas GG35 (32.2%), GR 29 (16%), RR 1 (0.5%); pada kontrol
GG 71 (41.5%), GR 13 (7.6%), RR 2 (1.9%). Distribusi nukleotida
polimorfisme G2350A gen ACE pada kasus stroke iskemia terdiri
atas GG 7 (4.1%), GA 34 (19.9%), AA 44 (25.7%), pada kontrol
GG6 (3.5%), GA 35 (20.5%), AA 45 (26%) (Syahrul, 2013).
Pada penelitian ini didapatkan polimorfisme Gly972Arg gen
IRS-1 berperan sebagai faktor risiko stroke iskemia dengan OR 2.6

Bab 10 Mengenal Berbagai Deteksi Stroke 189


(1.27-5.27); IK 95%, p =0.008, juga berperan sebagai faktor risiko
sindrom metabolik dengan OR 2.33 (1.14-4.9); IK 95%, p=0.021,
sebagai faktor risiko resistensi insulin OR 4,25 (1,5-12,2); IK95%,
p=0.02, dan hipertensi OR 2,02 (1,01-4,030; IK95%; p=0,045
pada pasien stroke iskemia (Syahrul, 2013).
Polimorfisme G2350A gen ACE tidak menunjukkan peran
sebagai faktor risiko stroke iskemia dengan OR 1,023 (0,56-
1,9); IK 95%, p=0,941, sindrom metabolik OR 1,53 (0.76-3,55);
IK95%, p=0.233, dan resistensi insulin OR 0.73 (0.08-6,21);
IK95%, p=0,379 tetapi merupakan faktor risiko hipertensi OR2.8
(IK95%:1.5-5,4), p=0.001. Polimorfisme Gly972Arg gen IRS-1
berperan sebagai faktor risiko stroke iskemia (OR 2,6; p=0,008)
dan sebagai faktor risiko sindrom metabolik (OR 2,33; p=0,021),
resistensi insulin (OR 4,25; p=0,04) dan hipertensi (OR 2,02;
p=0,045) pada stroke iskemia. Polimorfisme G2350A gen ACE
tidak menunjukkan peran sebagai faktor risiko stroke iskemia,
sindroma metabolik dan resistensi insulin pada stroke iskemia.
Polimorfisme G2350 gen ACE hanya berperan sebagai faktor risiko
hipertensi (OR 2,8; p=0,001) pada stroke iskemia (Syahrul, 2013).

10.5 Peran Polimorfisme -455G/A dan -148C/T


Gen Fibrinogen Terhadap Kejadian
Hiperfibrinogen dan Stroke Iskemia Akut
Usia Muda
Pada umumnya, stroke menyerang usia tua, tetapi ada
kecenderungan peningkatan insiden stroke pada usia muda. Hal
tersebut kemungkinan ada hubungannya dengan faktor genetika
seperti polimorfisme -445G/A dan -148C/T gen fibrinogen .
Kedua faktor ini mempunyai kecenderungan meningkatkan kadar
fibrinogen dalam darah sejak awal. Peningkatan ini berisiko
menimbulkan proses aterosklerosis dan aterotrombosis yang
secara perlahan akan menimbulkan stroke iskemia (Imran, 2010).
Berhubungan dengan permasalahan di atas, Imran melakukan
penelitian yang bertujuan untuk mengetahui peran polimorfisme

190 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


-455G/A dan -148C/T terhadap peningkatan kadar fibrinogen
dan stroke iskemia. Penelitian ini merupakan Case Control Study.
Populasi sampel adalah pasien yang dirawat inap dan rawat jalan
di Bagian/SMF Ilmu Penyakit Saraf Rumah Sakit dr. Hasan Sadikin
Bandung. Populasi dikelompokkan berdasarkan jenis kelamin
dan kelompok usia. Pengambilan sampel dilakukan berdasarkan
urutan kedatangan pasien (consecutive sampling). Semua sampel
stroke dilakukan pemeriksaan neurologis dan pengambilan
darah tepi sebanyak 5 ml untuk pemeriksaan kadar fibrinogen,
kolesterol total, HDL, LDL, trigliserida, GDN, GD2PP, dan asam urat.
Selanjutnya dilakukan isolasi DNA, PCR dan Restriction Fragment
Length Polymorphism (RFLP) menggunakan enzim restriksi
HaeIII dan HindIII. Hasilnya kemudian dielektroforesis dan dibaca
(Imran,2010).
Sampel penelitian berjumlah 330 (165 pasien stroke, terdiri
atas 72 pria dan 93 wanita; 165 pasien non-stroke, terdiri atas
67 pria dan 98 wanita). Jumlah sampel stroke berusia >50 tahun
adalah 55 (45.5%) dan kontrol 66 (54.6%), sedangkan pada usia
<50 tahun; kasus stroke 110 (52.6%), dan kontrol 99 (47.4%),
p=0.209. Kadar fibrinogen rata-rata pada kasus stroke usia
>50 tahun; 402.7 mg/dl dan pada kelompok usia < 50 tahun;
434mg/dl, sedangkan pada kelompok kontrol kadar fibrinogen
rata-rata adalah normal (Imran, 2010).
Hasil analisis uji chi kuadrat pada kelompok usia < 50 tahun
menunjukkan bahwa fibrinogen (cut off 350 mg/dl) berperan
menimbulkan stroke iskemia secara bermakna dengan OR 2.51
(CI95%; 1.41-4.46), p=0.002. Diperkuat oleh hasil analisis
regresi logistik dengan hasil yang hampir sama; OR 2.57 CI95%;
1.19-5.54, p=0.016. Polimorfisme -148C/T juga menunjukkan
peran bermakna yang menimbulkan stroke iskemia (OR 3.96,
CI95%; 1.5-10.46, p=0.006), sedangkan polimorfisme -455G/A
tidak menunjukkan peran bermakna, p=0.061. Hasil analisis
regresi logistik, faktor yang bermakna berperan menimbulkan
hiperfibrinogenemia pada usia < 50 tahun adalah alel polimorfisme
-455C/T (OR 2.75, CI95% 1.27-5.98, p=0.011, sedangkan pada
usia > 50 tahun adalah DM (OR 3.08, p=0.026) dan merokok

Bab 10 Mengenal Berbagai Deteksi Stroke 191


(OR 2.58, p=0.05). Polimorfisme -148C/T menunjukkan peran
yang lebih besar terhadap peningkatan kadar fibrinogen (405.7
mg/dl, n=189) dibanding polimorfisme A-455 (400.7 mg/dl,
n=165). Haplotip GT menunjukkan kadar fibrinogen tertinggi
(404.5mg/dl).
Fibrinogen merupakan salah satu faktor risiko stroke.
Polimorfisme -148C/T gen fibrinogen berperan langsung dalam
kejadian stroke dan mungkin berpotensi sebagai salah satu faktor
risiko stroke, khususnya pada pasien usia muda. Polimorfisme
-455G/A gen fibrinogen tidak berperan menimbulkan hiper
fibrinogenemia atau stroke usia muda.

Rangkuman
1. Secara garis besar, deteksi faktor risiko stroke dapat
kita bedakan menjadi anamnesis, pemeriksaan fisik
diagnostik, dan pemeriksaan penunjang.
2. Deteksi faktor risiko anamnesis dapat kita ketahui
dari riwayat merokok, riwayat mengonsumsi alkohol,
riwayat pemakaian kontrasepsi, riwayat TIA dan stroke
sebelumnya, riwayat pemakaian obat-obatan terlarang,
riwayat pemakaian kontrasepsi jangka panjang, riwayat
cuci darah.
3. Deteksi faktor risiko fisik diagnostik dapat dilakukan
dengan memperhatikan tekanan darah, obesitas: BMI atau
waist hip ratio, fisik diagnostik : inspeksi, palpasi, perkusi,
auskultasi.
4. Deteksi faktor risiko pemeriksaan penunjang antara lain
dilakukan dengan cara elektrokardiografi, foto thorax,
laboratorium darah rutin, profil lemak, kimia darah, faktor
pembekuan darah, agregasi trombosit, ekhokardiografi,
transkranial doppler, dan angiografi

192 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


5. Untuk mengetahui dan mendeteksi terjadinya stroke,
kita dapat mengikuti empat langkah berikut ini F - Face
Movement, A - Arm Movemnet, S - Speech, dan T - Time to Call.
6. Tujuan transcanial doppler (TCD) pada penyakit
serebrovaskular adalah untuk membedakan keadaan
normal dengan pembuluh darah arteri yang mengalami
kelainan, mengidentifikasi stenosis, lokasi dari proses
penyakit termasuk oklusi, progresivitas penyakit, emboli
serebri, melihat gambaran karakteristik morfologi plak
aterosklerosis, dan mengukur potensial sirkulasi kolateral
untuk mempertahankan CBF.
7. Nilai Ankle Brachial Index (ABI) yang abnormal
merupakan salah satu faktor risiko potensial untuk stroke
iskemia. Ankle Brachial Index (ABI) adalah salah satu
pemeriksaan untuk mendiagnosis penyakit arteri perifer
secara sederhana, non-invasif, objektif, murah, serta
memiliki keakuratan yang tinggi dengan sensitivitas 95%
dan spesifisitas 94-100%.
8. Ankle Brachial Index (ABI) merupakan rasio tekanan darah
sistolik tungkai dengan tekanan darah sistolik lengan
yang dapat diukur dengan cepat dan mudah sebagai
pemeriksaan penyakit arteri perifer.
9. Pemeriksaan ABI dapat dilakukan dengan berbagai metode
yaitu dengan menggunakan doppler ultrasound, teknik
oscillometric, plethysmography, photoplethysmography,
auskultasi, dan palpasi.
10. Berdasarkan penelitian maka diperoleh hasil bahwa
polimorfisme Gly972Arg gen IRS-1 berperan sebagai
faktor risiko stroke iskemia dengan OR 2.6 (1.27-5.27).
Polimorfisme G2350 gen ACE hanya berperan sebagai
faktor risiko hipertensi (OR 2,8; p=0,001) pada stroke
iskemia.
11. Insiden stroke pada usia muda kemungkinan ada
hubungannya dengan faktor genetika seperti polimorfisme

Bab 10 Mengenal Berbagai Deteksi Stroke 193


-445G/A dan -148C/T genfibrinogen . Kedua faktor
ini mempunyai kecenderungan meningkatkan kadar
fibrinogen dalam darah sejak awal. Peningkatan ini
berisiko menimbulkan proses aterosklerosis dan
aterotrombosis yang secara perlahan akan menimbulkan
stroke iskemia.
12. Polimorfisme -148C/T gen fibrinogen berperan
langsung dalam kejadian stroke dan mungkin berpotensi
sebagai salah satu faktor risiko stroke, khususnya pada
pasien usia muda. Polimorfisme -455G/A gen fibrinogen
tidak berperan menimbulkan hiperfibrinogenemia atau
stroke usia muda.

194
Bab11

Deteksi Dini
Stroke Iskemia
dengan Pemeriksaan
Ultrasonografi
Vaskular

195
U
ntuk melakukan deteksi dini stroke iskemia dapat
dilakukan dengan beberapa cara. Salah satunya
yaitu dengan pemeriksaan ultrasonografi vaskular.
Mengapa metode ini yang dipilih? Seperti kita ketahui bahwa salah
satu indikasi terjadinya stroke iskemia ditunjukkan oleh ketebalan
intima media arteri karotis. Untuk mengukur ketebalan intima
media arteri karotis dapat digunakan ultrasonografi. Ketebalan
intima media arteri karotis merupakan keadaan arteriosklerosis
subklinis. Ketebalan intima media arteri karotis menggambarkan
keadaan vaskular secara general. Kelebihan ultrasonografi
dibanding dengan metode lainnya yaitu ultrasonografi merupakan
modalitas yang mudah, murah, dan tidak invasif.
Deteksi melalui pemeriksaan ultrasonografi vaskular termasuk
dalam deteksi dini. Mengapa demikian? Hal ini disebabkan
penebalan intima media merupakan prediktor aterosklerosis yang
perlu waktu panjang untuk menjadi aterosklerosis. Jadi, dengan
memeriksa ketebalan intima media bisa diprediksi keadaan
vaskularnya di masa mendatang. Dengan demikian, diharapkan
jika seseorang sudah mengetahui adanya penebalan intima media
arteri karotis pada tubuhnya maka ia harus menghindari faktor
risiko penyebab stroke. Apa saja yang dilakukan untuk pemeriksaan
ultrasonografi vaskular ini? Berikut ini penjelasannya.

11.1 Pemeriksaan Fisik dan Laboratorium


Sebelum dilakukan pemeriksaan ketebalan intima media
perlu dilakukan pemeriksaan fisik dan pemeriksaan laboratorium
yang semuanya berhubungan dengan kondisi ketebalan intima
media seseorang pada sampel yang meliputi tinggi badan,
berat badan, indeks massa tubuh, dan tekanan darah. Tabel
berikut ini menyajikan hasil pemeriksaan fisik pada sampel
(YueniwatiY.,2012).

196 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Tabel 11.1Karakteristik sampel pada pemeriksaan fisik
Pemeriksaan fisik Kasus (n = 27) Kontrol (n = 27)
Umur (tahun) 18,41(2,44) 16,96(2,46)
Tinggi Badan (cm) 163,41(8,08) 163,93(10,45)
Berat Badan (kg) 60,37(13,82) 52,62(14,52)
Indeks Massa Tubuh (kg/m2) 22,44 (3,93) 19,29(3,35)
Tekanan Darah sistolik 118,89(10,13) 116,85(9,11)
Tekanan Darah diastolik 76,67(5,55) 74,07(7,47)
Keterangan:
Penelitian ini dilakukan dengan menggunakan sampel yaitu 27 orang
kelompok kasus dan 27 orang kelompok kontrol. Sampel kelompok kasus
adalah anak kandung penderita stroke iskemia populasi Jawa yang berusia
10-21 tahun. Sementara itu, kelompok kontrol adalah anak populasi Jawa
dengan orang tua sehat.

Pada kelompok kasus terdapat 14 (52%) laki-laki dan 13


(48%) perempuan, sedang pada kelompok kontrol terdapat 15
(55%) laki-laki dan 12 (45%) perempuan. Distribusi berdasarkan
jenis kelamin kelompok kasus dan kelompok kontrol digambarkan
dalam diagram sebagai berikut (YueniwatiY.,2012).

Kontrol Kasus
15
Banyak Sampel

10
15
14
13
5 12

0
Laki-laki Perempuan Laki-laki Perempuan
Jenis Kelamin
Gambar 11.1Distribusi sampel berdasar jenis kelamin

11.2 Pemeriksaan Ketebalan Intima Media


Arteri karotis merupakan sentinel vessels keadaan vaskular,
letaknya superfisial dan relatif mudah diperiksa daripada aorta dan
Bab 11 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi Vaskular 197
arteri femoralis. Arteri karotis juga telah diakui sebagai valuable
mirror untuk status arteri koronaria. Pengukuran arteri karotis
dilakukan di ruang ultrasonografi vaskular. Pasien istirahat dengan
nyaman pada posisi terlentang. Leher pasien sedikit ekstensi
dengan kepala menoleh 45 derajat ke arah yang berlawanan dari
bagian yang akan diperiksa (Yueniwati Y., 2012).
Pemeriksa mengevaluasi penderita dengan duduk pada
sisi penderita atau di atas kepala penderita. Transduser yang
digunakan tergantung habitus penderita dan karakteristik mesin
USG. Biasanya dipakai transduser linier frekuensi tinggi 7-12
MHz. Transduser frekuensi tinggi ini dapat memperlihatkan
detail anatomi pembuluh darah. Pembuluh darah sebaiknya
tegak lurus untuk mendapatkan gambaran optimal dari dinding
pembuluh darah. Arteri karotis kemudian diperiksa pada
aksis panjangnya dengan berbagai sudut (anterior, lateral, dan
posterior) dan bifurcatio carotis diidentifikasi. Secara umum,
gambar diambil pada ketebalan intima media arteri karotis yang
tervisualisasi maksimal. Beberapa desain studi longitudinal
membutuhkan pengukuran dengan batas anatomi spesifik atau
dengan menggunakan alat pengukur sudut untuk studi follow up
yang diambil pada sudut sebelumnya. Magnifikasi dari dinding
pembuluh darah memudahkan identifikasi kompleks intima media
yang didefinisikan sebagai batas antara lumen pembuluh darah
yang hipoechoic dan intima yang hiperechoic dengan media yang
hipoechoic dan adventisia yang hiperechoic. Sering kali dilakukan
analisa magnifikasi gambar digital pada 10 mm distal arteri
karotis kommunis, bulbus karotis dan 10 mm proksimal arteri
karotisinterna (AHA/ASA Guideline, 2007).
Pemeriksaan dimulai pada proyeksi transversal dan dilakukan
sepanjang alur arteri karotis servikalis. Pemeriksaan dimulai dari
daerah supraklavikula ke arah kranial sampai angulus mandibula.
Bulbus karotis tampak sebagai pelebaran arteri karotis interna
dekat bifurkatio. Proyeksi longitudinal arteri karotis normal
memperlihatkan lapisan dinding karotis sebagai dua garis
echogenik yang sejajar, dipisahkan oleh daerah hipoechoic atau
anechoic. Echo pertama membatasi lumen pembuluh darah dengan

198 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


intima (Yueniwati Y., 2012). Media adalah zona anechoic/hipoechoic
antara garis-garis echoic. Jarak antara dua garis echogenik yang
dipisahkan oleh area hipoechoic disebut sebagai kompleks intima
media (Dietz, etal., 2004, Casella, etal., 2008).

Sumber: Casella, etal., 2008

Gambar 11.2Cara pemeriksaan ketebalan intima media arteri karotis


dengan sudut pengukuran : A = transversal ; B = posterolateral; C =
anterolateral

Pembagian segmen arteri karotis secara umum didefinisikan


berdasarkan bifurkatio, 10 mm di atas bifurkatio disebut arteri
karotis interna. Perluasan ke superior arteri karotis dimulai pada

Bab 11 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi Vaskular 199
tempat aliran terbagi. Aspek inferior dimulai dari awal dilatasi
berhubungan dengan bifurkatio. Panjang bifurkatio karotis
bervariasi di antara subjek sehingga sonografer harus konsisten
dengan tempat pengukuran. Arteri karotis komunis didefinisikan
sebagai 10 mm di bawah bulbus. Doppler merupakan alat yang
berguna untuk membedakan arteri karotis interna dan eksterna, di
mana arteri karotis interna memiliki pola aliran yang lebih pulsatil
dan arteri karotis eksterna menunjukkan aliran diastolik kontinu
di antara sistolik (Urbina etal., 2009)
Arteri karotis eksternal Arteri karotis internal

Level of 10 mm
Flow divider
10 mm
Origin of Bulb
10 mm

Permukaan kulit Arteri karotis kommunis

Near Wall Far Wall

Sumber: Urbina, etal., 2009

Gambar 11.3Lokasi pemeriksaan ketebalan intima media arteri karotis,


reprinted dari Howard, etal.

Hasil pemeriksaan arteri karotis komunis kanan dan kiri,


pengukuran ketebalan intima media dan diameter arteri karotis
dapat dilihat pada tabel berikut ini (Yueniwati Y., 2012).

Tabel 11.2Hasil pemeriksaan ultrasonografi


Pengukuran Kasus (n = 27) Kontrol (n = 27) p-Value
Mean ketebalan intima media kanan 0,61 (0,015) 0,53 (0,016) 0,032
(mm)
Mean ketebalan intima media kiri (mm) 0,60 (0,013) 0,51 (0,018) 0,034
Mean ketebalan intima media kanan 0,61 (0,012) 0,52 (0,015) 0,021
kiri (mm)
Mean diameter karotis kanan (mm) 6,381 (0,058) 6,507 (0,051) 0,397
Mean diameter karotis kiri (mm) 6,289 (0,047) 6,570 (0,047) 0,034

200 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Jika kita perhatikan tabel di atas maka ketebalan rata-rata
intima media arteri karotis anak dengan orang tua stroke iskemia
0,61 0,012 mm, sedangkan ketebalan rata-rata intima media
arteri karotis anak dengan orang tua sehat 0,52 0,015 mm.
Sampai saat ini, belum ada data acuan nilai normal ketebalan
intima media arteri karotis pada populasi Indonesia. Acuan yang
dipergunakan sekarang berdasarkan nilai ketebalan intima media
arteri karotis pada Teaching Manual of Color Doppler Sonography,
di mana pada buku tersebut tebal intima media arteri karotis
pada usia kurang dari 35 tahun dianggap sama, yaitu antara 0,58-
0,78 mm. Arteri karotis kiri lebih tebal daripada arteri karotis
kanan, dan arteri karotis laki-laki lebih tebal daripada perempuan
(Dietz,etal., 2004).
Urbina dkk. pada tahun 2009 menyusun nilai ketebalan intima
media arteri karotis pada anak dan remaja berdasar hasil laporan
beberapa peneliti sebelumnya. Pada tabel tersebut didapatkan
ketebalan intima media arteri karotis usia 10 sampai 18 tahun
kurang dari 0,50 mm (Urbina, etal., 2009).
Baik pada anak dengan orang tua stroke iskemia maupun anak
dengan orang tua sehat ketebalan rata-rata intima media arteri
karotis yang didapat pada penelitian ini masih dalam batas normal
sesuai tabel yang dibuat oleh Dietz dkk. untuk usia < 35 tahun.
Akan tetapi, lebih tebal bila dibandingkan dengan tabel yang dibuat
oleh Urbina dkk.
Penelitian sebelumnya yang dilakukan di RS dr.Saiful
Anwar Malang dengan kelompok umur lebih muda (5-18 tahun)
menunjukkan tebal rata-rata intima media arteri karotis yang lebih
tipis yaitu 0,53 0,06 mm pada anak dengan orang tua stroke
iskemia dan 0,49 0,06 mm pada anak dengan orang tua sehat
(Siswinarti, 2011). Perbedaan tebal intima media arteri karotis
tersebut sesuai laporan beberapa peneliti bahwa ketebalan intima
media arteri karotis meningkat sesuai dengan pertambahan usia
(Dietz, etal., 2004, Davis, etal., 2010).
Beberapa peneliti melakukan pengukuran tebal intima media
arteri karotis pada usia kurang dari 35 tahun, antara lain seperti

Bab 11 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi Vaskular 201
yang diuraikan berikut ini. Penelitian yang dilakukan di Finlandia
pada anak umur 11 2 tahun menunjukkan tebal intima media
arteri karotis 0,42 0,04 mm (Jrvisalo, etal., 2001). Davis dkk.
melakukan studi cohort pada populasi ras Kaukasia normal berusia
11-35 tahun dengan usia rata-rata 20,4 tahun dan mendapatkan
tebal intima media arteri karotis 0,50 0,04 mm pada laki-laki dan
0,49 0,04 mm pada perempuan. Ketebalan intima media arteri
karotis tersebut meningkat 0,04 mm per dekade (Davisetal.,
2010). Tamura dkk. melakukan pengukuran ketebalan intima
media arteri karotis pada populasi Jepang berusia 6-14 tahun
mendapatkan nilai 0,40 0,1 mm (Tamura, et al., 2011).
Walaupun hasil ketebalan intima media pada penelitian ini
masih dalam rentang normal sesuai tabel menurut Dietz tahun
2004, akan tetapi ketebalan rata-rata intima media arteri karotis
anak dengan orang tua stroke iskemia yang didapatkan pada
penelitian ini lebih tebal dari yang didapat oleh Davis dkk. yang
melakukan penelitian pada ras Kaukasia dan tabel yang dibuat
oleh Urbina dkk. Ketebalan rata-rata intima media artori karotis
juga lebih tebal dibanding yang didapat pada penelitian anak
dengan orang tua infark myocard oleh Cuomo dkk. yang melakukan
penelitian pada populasi Italia berusia 5-30 tahun yaitu 0,48
0,077 mm dan Barra dkk. yang melakukan penelitian pada anak
Italia usia 5-12 tahun yaitu 0,444 0,076 mm (Cuomo etal., 2002,
Barra etal., 2009). Kemungkinan perbedaan hasil ketebalan intima
media arteri karotis di atas disebabkan perbedaan ras.
Diketahui ketebalan intima media arteri karotis dipengaruhi
oleh ras dan jenis kelamin (Roger, et al., 2011). Kenyataan bahwa
intima media arteri karotis anak populasi Jawa yang lebih tebal
daripada intima media ras Kaukasia seharusnya membuat kita lebih
waspada sebab ketebalan intima media arteri karotis merupakan
surrogate marker yang menggambarkan aterosklerosis secara
umum dan merupakan prediktor keadaan pembuluh darah pada
masa mendatang. Penebalan intima media arteri karotis terbukti
berhubungan dengan peningkatan risiko stroke iskemia (Rundek
etal., 2002, Brenner etal., 2006, Barra etal., 2009). Hasil penelitian
ini dapat menjadi dasar rekomendasi pengukuran ketebalan

202 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


intima- media arteri karotis dengan ultrasonografi sebagai
prosedur rutin deteksi dini aterosklerosis pada anak dengan risiko
tinggi stroke iskemia dan aterosklerosis sehingga hasil penelitian
ini makin mempertegas peranan ultrasonografi sebagai modalitas
deteksi dini aterosklerosis dengan akurasitinggi.
Pada uji komparasi yang dilakukan pada penelitian ini terdapat
perbedaan bermakna antara ketebalan intima media arteri karotis
anak dengan orang tua stroke iskemia dan ketebalan intima media
anak dengan orang tua sehat (Yueniwati Y., 2012). Hasil tersebut
sesuai dengan hasil penelitian yang dilakukan oleh Cuomo pada
tahun 2002 dan Barra pada tahun 2009. Cuomo dkk. melakukan
penelitian pada anak penderita infark myocard berusia 5-30
tahun dengan membagi kelompok usia menjadi 5-18 tahun dan
1930 tahun. Cuomo mendapatkan peningkatan ketebalan rata-
rata intima media arteri karotis pada kelompok usia 5-18 tahun
yaitu sebesar 0,450,07mm dibanding 0,40 0,066 mm dengan
nilai p = 0,008 dan 0,48 0,077 mm dibanding 0,45 0,078 mm
dengan nilai p=0,007 pada kelompok usia 19-30 tahun (Cuomo
etal.,2002).
Barra dkk. melakukan penelitian pada anak dengan orang
tua infark myocard berusia 5-12 tahun (rata-rata usia 9,1 tahun)
dan mendapatkan peningkatan rata-rata ketebalan intima media
arteri karotis 0,444 0,076 mm dibandingkan 0,382 0,062 mm
dengan nilai p = 0,001 (Barra et al., 2009). Hasil uji komparasi
ini makin menegaskan lagi perlunya dilakukan skrining dengan
ultrasonografi pada anak dengan risiko aterosklerosis dan stroke
iskemia sebagai prediktor dan deteksi dini aterosklerosis.
Baik pada anak dengan orang tua stroke iskemia maupun
anak dengan orang tua sehat intima media arteri karotis kanan
lebih tebal dari intima media arteri karotis kiri (Yueniwati Y.,
2012). Hasil ini sesuai yang didapat oleh Cuomo dkk. yang juga
mendapatkan intima- media arteri karotis kanan lebih tebal
daripada kiri (Cuomo etal., 2002). Sebaliknya, Dietz dan Barra
memperlihatkan intima media rata-rata arteri karotis kiri lebih
tebal daripada kanan (Dietz et al., 2004, Barra etal., 2009). Akan
tetapi, penelitian yang dilakukan oleh Yang dkk. pada anak Cina

Bab 11 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi Vaskular 203
tidak menunjukkan perbedaan yang signifikan antara ketebalan
intima media arteri karotis kanan dan kiri (Yang etal., 2007).
Perbedaan hasil ketebalan intima media arteri karotis kanan dan
kiri tersebut kemungkinan disebabkan perbedaan anatomi arteri
karotis sesuai ras.
Tanpa memperhitungkan kelompok kasus dan kontrol,
didapatkan ata-rata intima media arteri karotis anak laki-laki lebih
tebal daripada anak perempuan, hasil yang sesuai tabel Dietz (Dietz
etal., 2004). Sebaliknya, Tamura dkk. yang melakukan pengukuran
ketebalan intima media arteri karotis pada anak-anak Jepang
berusia 6-14 tahun mendapatkan intima media anak perempuan
lebih tebal (Tamura et al., 2011). Perbedaan ketebalan berdasar
jenis kelamin ini kemungkinan disebabkan perbedaananatomis.
Tanpa memandang kasus dan kontrol, rata-rata intima media
anak laki-laki lebih tebal daripada anak perempuan, yaitu anak
laki-laki 0,58 (0,014) mm dan anak perempuan 0,55 (0,013) mm
(Yueniwati Y., 2012).
Berikut ini merupakan perbandingan beberapa pemeriksaan
antara kelompok kasus dan kontrol berdasarkan jenis kelamin
(Yueniwati Y., 2012).

Tabel 11.3Komparasi kelompok kasuskontrol anak perempuan


Jenis Pemeriksaan Kasus (n = 12) Kontrol (n = 13) p-Value
Mean ketebalan intima media 0,63 (0,014) 0,48 (0,079) 0,004
kanan kiri (mm)
Kolesterol total (mg/dl) 185,50 (37,53) 170,46 (37,86) 0,329
Kolesterol LDL (mg/dl) 116,42 (38,97) 97,38 (25,35) 0,158
Kolesterol HDL (mg/dl) 55,33 (5,40) 62,85 (16,71) 0,151
Trigliserida (mg/dl) 129,83 (61,75) 66,69 (17,25) 0,002
Indeks Massa Tubuh (kg/m2) 20,41 (1,92) 18,52 (2,55) 0,049
Independent Sample t tests. Data are mean (SD)

Dari tabel di atas terlihat bahwa pada t test independent yang


mempunyai nilai p < = 0,05 adalah ketebalan rata-rata intima
media arteri karotis dan trigliserida. Jadi, dapat disimpulkan hanya
ketebalan rata-rata intima media arteri karotis dan trigliserida

204 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


kelompok kasus dan kelompok kontrol anak perempuan yang
mempunyai perbedaan yang signifikan (Yueniwati Y., 2012).
Berikut ini merupakan komparasi beberapa pemeriksaan
kelompok kasuskontrol pada anak laki-laki (Yueniwati Y., 2012).
Tabel 11.4Komparasi kelompok kasuskontrol anak laki-laki
Jenis Pemeriksaan Kasus (n = 15) Kontrol (n = 14) p-Value
Mean ketebalan intima media 0,59 (0,009) 0,56 (0,018) 0,554
kanan kiri (mm)
Kolesterol total (mg/dl) 184,73 (49,71) 162,07 (30,28) 0,153
Kolesterol LDL (mg/dl) 120,40 (44,21) 94,43 (26,91) 0,069
Kolesterol HDL (mg/dl) 44,93 (4,95) 56,71 (10,40) 0,001
Trigliserida (mg/dl) 102,40 (55,27) 61,71 (20,01) 0,015
Indeks Massa Tubuh (kg/m2) 24,06 (4,40) 20,01 (3,90) 0,014
Independent Samples t tests. Data are mean (SD)

Tampak pada tabel di atas t test independent menunjukkan


kolesterol HDL, trigliserida dan indeks massa tubuh kelompok
kasus dan kelompok kontrol laki-laki mempunyai perbedaan
yangsignifikan (Yueniwati Y., 2012).
Apabila dibandingkan antara kelompok anak dengan orang
tua stroke iskemia dan kelompok anak dengan orang tua sehat
berdasarkan jenis kelamin didapatkan perbedaan yang sangat
bermakna ketebalan intima media arteri karotis pada anak
perempuan, p = 0,004, sedangkan pada anak laki-laki tidak
didapatkan perbedaan yang bermakna, p = 0,554 (YueniwatiY.,
2012). Hasil ini sesuai dengan penelitian bahwa ketebalan
intima media arteri karotis anak perempuan dengan risiko
terkait aterosklerosis cenderung lebih tebal daripada anak laki-
laki (Johnsen etal.,2007). Penemuan ini menarik karena secara
umum risiko untuk menderita aterosklerosis dan stroke iskemia
pada perempuan sebelum menopause rendah bila dibandingkan
laki-laki. Temuan ini membuka peluang dilakukannya penelitian
lebih lanjut untuk mencari penyebab peningkatan ketebalan
intima media pada anak perempuan dengan risiko aterosklerosis
(Yueniwati Y., 2012). Beberapa kondisi diketahui berhubungan
dengan peningkatan ketebalan intima media arteri karotis,
antara lain hiperkolesterolemia, dislipidemia, hipertensi, diabetes
Bab 11 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi Vaskular 205
melitus, kebiasaan merokok, alkohol, pola hidup, dan obesitas
(Urbina etal., 2009).

11.3 Hasil Analisis Pemeriksaan Ultrasonografi


Vaskular
Hasil analisis korelasi ketebalan rata-rata intima media
arteri karotis dengan variabel karakteristik sampel dan hasil
laboratorium adalah sebagai berikut (Yueniwati Y., 2012).

Tabel 11.5Analisis korelasi ketebalan rata-rata intima media arteri karotis


Variabel Independen Koefisien Korelasi p Value
Umur 0,010 0,943
Tinggi badan 0,112 0,422
Berat badan 0,098 0,482
Indeks Massa Tubuh 0,046 0,739
Tekanan darah sistole 0,028 0,839
Tekanan darah diastole 0,062 0,654
Glukosa puasa 0,053 0,705
Kolesterol total 0,168 0,226
Kolesterol LDL 0,253 0,065
Kolesterol HDL 0,149 0,282
Trigliserida 0,205 0,137
Variabel dependen = ketebalan intima media arteri karotis

Pada uji korelasi dengan uji Pearson Product Moment


terdapat korelasi negatif antara ketebalan rata-rata intima media
arteri karotis dengan umur, tinggi badan, berat badan, indeks
massa tubuh, glukosa puasa, kolesterol total , HDL, LDL, maupun
dengan trigliserida. Hal ini ditunjukkan dengan nilai Sig (p)
atau p-Value semua menunjukkan nilai lebih besar dari = 0,05
(YueniwatiY.,2012).
Pada penelitian ini, berat badan rata-rata anak dengan orang
tua stroke iskemia 60,37 13,82 kg, sedangkan anak dengan orang
tua sehat 52,62 14,52 kg. Pada uji komparasi terdapat perbedaan
yang bermakna antara berat badan rata-rata anak dengan orang

206 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


tua stroke iskemia dan anak dengan orang tua sehat, p = 0,030
(YueniwatiY.,2012).
Massa lemak tubuh pada penelitian ini ditentukan dengan
indikator indeks massa tubuh yang dihitung berdasar berat dan
tinggi badan. Indeks massa tubuh pada anak dengan orang tua
stroke iskemia rata-rata 22,44 3,93. Indeks massa tubuh tertinggi
26,36 dikategorikan overweight (BMI 25) sesuai klasifikasi
indeks massa tubuh menurut WHO. Indeks massa tubuh rata-rata
anak dengan orang tua sehat 19,29 3,35, dikategorikan normal
(indeks massa tubuh = 18,50-24,99) menurut klasifikasi WHO
(WHO, 2006). Rata-rata indeks massa tubuh anak dengan orang
tua stroke iskemia dan anak dengan orang tua sehat menunjukkan
perbedaan yang sangat bermakna, p = 0,003 (YueniwatiY.,2012).
Hasil yang didapat pada penelitian ini sesuai dengan hasil
penelitian Cuomodkk. pada tahun 2002 dan Barra dkk pada tahun
2009. Cuomo dan Barra melakukan penelitian pada anak dengan
orang tua infark myocard dan mendapatkan hasil berat badan dan
indeks massa tubuh rata-rata anak-anak dengan orang tua infark
myocard lebih tinggi daripada berat badan dan indeks massa
tubuh anak tanpa risiko. Pada uji komparasi terdapat perbedaan
yang bermakna antara anak dengan dengan orang tua infark
myocard dan anak dengan orang tua sehat (Cuomo et al., 2002,
Barra, etal.,2009).
Anak-anak dengan orang tua stroke iskemia mempunyai rata-
rata kadar kolesterol LDL 118,63 41,22 mg/dl. Lebih tinggi dari
nilai rujukan normal kadar kolesterol LDL yaitu < 100 mg/dl.
(YueniwatiY.,2012). Tingginya kadar kolesterol LDL diketahui
berhubungan dengan risiko terjadinya stroke iskemia (Tziomalos
et al., 2009). Kadar kolesterol LDL anak dengan orang tua stroke
iskemia mempunyai perbedaan bermakna dibanding anak dengan
orang tua sehat, p = 0,018. Anak-anak tersebut juga mempunyai
rata-rata nilai kolesterol HDL dan trigliserida yang walaupun masih
dalam rentang normal tapi mempunyai perbedaan yang sangat
bermakna dengan anak dengan orang tua sehat. Dapat disimpulkan
disini bahwa anak dengan orang tua stroke iskemia mempunyai
kecenderungan mengalami dislipidemia (YueniwatiY.,2012). Hasil

Bab 11 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi Vaskular 207
penelitian ini juga sesuai dengan hasil penelitian yang dilakukan
pada anak dengan orang tua infark myocard yang juga mempunyai
kecenderungan mengalami dislipidemia (Cuomo et al., 2002,
Barra et al., 2009). Dislipidemia merupakan faktor risiko mayor
untuk coronary heart diseases (CHD) dan stroke. Dislipidemia
atherogenik (kadar kolesterol HDL rendah; kadar trigliserida
tinggi) berhubungan dengan kejadian stenosis arteri intrakranial
dan kemungkinan rekurensi stroke (Tziomalos et al., 2009,
Sirimarco etal., 2011). Peningkatan kadar kolesterol LDL dan
trigliserida berhubungan dengan risiko terjadinya stroke iskemia.
Dislipidemia berhubungan dengan kejadian beberapa subtipe
stroke, yaitu stroke lakunar dan stroke kardioembolik (Tziomalos
et al., 2009).
Pada analisis statistik ternyata tidak terdapat hubungan antara
ketebalan intima media arteri karotis dengan massa lemak tubuh,
tekanan darah, gula darah, dan profil lipid. Diperkirakan faktor
genetika mempunyai kontribusi pada peningkatan ketebalan
intima media arteri karotis yang terjadi. Perlu dilakukan penelitian
untuk lebih memastikan faktor genetika apa yang berpengaruh
mengingat banyaknya faktor genetika yang mempunyai hubungan
dengan perubahan ketebalan intima media arteri karotis sebagai
fenotip intermediate aterosklerosis. Apabila diketahui faktor
genetika yang berpengaruh, penatalaksanaan akan lebih terarah
dan dapat dilakukan tindakan prediktif serta preventif terhadap
faktor risiko lain dan penatalaksanaan dini yang akan berdampak
menurunnya kejadian aterosklerosis dan stroke iskemia
padaakhirnya (YueniwatiY.,2012).

Rangkuman
1. Sebelum dilakukan pemeriksaan ketebalan intima media
perlu dilakukan pemeriksaan fisik dan pemeriksaan
laboratorium yang semuanya berhubungan dengan
kondisi ketebalan intima media seseorang pada sampel

208 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


yang meliputi tinggi badan, berat badan, indeks massa
tubuh, dan tekanan darah.
2. Pengukuran intima media arteri karotis dilakukan dengan
menggunakan ultrasonografi.
3. Berdasarkan hasil penelitian yang dilakukan maka
diperoleh hasil bahwa intima media arteri karotis anak
populasi Jawa dengan orang tua stroke iskemia lebih tebal
dibanding anak populasi Jawa dengan orang tuasehat.
4. Diharapkan bahwa pemeriksaan ketebalan intima media
arteri karotis dengan ultrasonografi dapat menjadi
prosedur rutin (SOP) sebagai upaya prediktif dan preventif
aterosklerosis pada anak dengan risiko aterosklerosis
secara umum dan stroke iskemia khususnya.

Bab 11 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi Vaskular 209
210
Bab12

Deteksi Dini
Stroke Iskemia
dengan Pemeriksaan
Variasi Genetika

211
D
alam beberapa penelitian ditemukan bahwa
gen promotor MCP-1 dan gen pengkode OPN
menunjukkan hubungan yang dekat dengan kejadian
stroke iskemia dibandingkan gen-gen lainnya. Inilah alasan utama
mengapa penulis melakukan penelitian tentang deteksi variasi
genetika pada polimorfisme promotor MCP-1 dan gen pengkode
OPN. Kedua gen tersebut sangat terkait dengan kejadian stroke
iskemia. Hal itu dibuktikan bahwa pada anak penderita stroke
dengan polimorfisme/variasi genetika pada OPN dan MCP-1
menunjukkan intima media yang lebih tebal.
Faktor genetika sampai saat ini dianggap sebagai faktor
risiko stroke iskemia yang tidak bisa diubah. Berbagai variasi
genetika dianggap sebagai faktor penyebab stroke. Banyak
penelitian menemukan hubungan antara kejadian stroke dengan
variasi genetika (polimorfisme dan atau mutasi) gen OPN dan
MCP-1. Dengan demikian, perlu dilakukan pemeriksaan untuk
menilai ada tidaknya variasi genetika pada dua gen tersebut.
Dengan mengetahui adanya variasi genetika tersebut maka dapat
diantisipasi kejadian stroke.

12.1 Polimorfisme Promotor MCP-1 pada Anak


Populasi Jawa dengan Orang Tua Stroke
Iskemia
Salah satu cara yang dapat dilakukan untuk melakukan
deteksi dini terhadap faktor risiko stroke iskemia yaitu dengan
pemeriksaan variasi genetika. Peningkatan ketebalan intima
media arteri karotis dipengaruhi oleh multifaktorial genetika dan
lingkungan dengan kemungkinan diturunkan 30% sampai 40%.
Penelitian genetika epidemiologis menunjukkan ketebalan intima
212 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...
media arteri karotis berhubungan secara signifikan dengan gen
MCP-1. Oleh karena itu, penelitian lanjutan ini sebaiknya juga
dilakukan sehingga akan terlihat keterkaitan antara keduanya
sebagai deteksi dini terjadinya stroke iskemia (Yueniwati Y., 2012).

12.1.1 Isolasi DNA


Pada sampel darah untuk analisis genotiping, langkah
pertama dilakukan isolasi DNA. Hasil isolasi DNA dianalisis dengan
elektoforesis gel agarosa 1% kemudian divisualisasi dengan UV
transluminator. Hasil isolasi dapat dilihat pada Gambar 12.1 yang
menunjukkan pita DNA genom manusia (Yueniwati Y., 2012).

Keterangan: No. 1 DNA Marker; no. 2 18 DNA Sampel


Sumber: Yueniwati Y., 2012
Gambar 12.1Hasil isolasi DNA

12.1.2 Amplifikasi gen


Amplifikasi gen pengkode MCP-1 dengan menggunakan primer
spesifik MCP-1 menghasilkan produk PCR berukuran 929 pasang
basa. Daerah yang diamplifikasi dapat dilihat pada Gambar 12.2,

Bab 12 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Variasi Genetika 213
dimana primer yang membatasi daerah target diberi warna hijau.
Dari penggambaran tersebut dapat diketahui ukuran DNA target
adalah 929 pasang basa, yaitu mulai basa 4805 sampai 5733. Hal ini
sesuai dengan ukuran produk PCR secara teoritis, yaitu sekitar 900bp
(Yueniwati Y., 2012).

GenBank: Y18933.1
Homo sapiens MCP-1 gene and enhancer region
4441 cagaagttgg tgggagccca ggcagtggct tcagatcttt ccagagagct cacttttact
4501 tcctcttttt ttcacccctg acactgagtg ggagtctgca gcgatgacca aggttcatgc
4561 agaggatctt agtggtgggg tcagaccccg ggaggaatga agaaagcatt attcaccaag
4621 aggagctttt ccattcttta tctatgagtt gatagagagg aggccccggg gtaactgagg
4681 attctggaca gcatcagagc attgaccctc attttcccca tagcccctct gggggccttt
4741 cccttgtgtg tccccaagcg agagtccaac caaggtttgt gccagagcct aacccaggct
4801 tgtgccgaga tgttcccagc acagccccat gtgagagctc cctggctccg ggcccagtat
4861 ctggaatgca ggctccagcc aaatgcattc tcttctacgg gatctgggaa cttccaaagc
4921 tgcctcctca gagtgggaat ttccactcac ttctctcacg ccagcactga cctcccagcg
4981 ggggagggca tcttttcttg acagagcaga agtgggaggc agacagctgt cactttccag
5041 aagactttct tttctgattc atacccttca ccttccctgt gtttactgtc tgatatatgc
5101 aaaggccaag tcactttcca gagatgacaa ctccttcctg aagtagagac atgcttccaa
5161 cactcagaag cctatgtgaa cactcagcca gcaaagctgg gaagtttttc tctgtgacca
5221 tgggctaatt ggtctccttc tctggattgt ggctttatca gataaaaaca agtggtcatg
5281 ccacaggatg tctataagcc cattgattct gggattctat gagtgatgct gatatgacta
5341 agccaggaga gacttattta aagatctcag catctttcag cttgttaacc tagagaaaac
5401 ccgaagcatg actggattat aaagggaaat tgaatgcggt ccaccaagtt catggtaaag
5461 gatgcactaa cagattagag agaggtttcc cctgatatga ggaaaacttc ttggaagatg
5521 aggtgagatg gcctaggaag aaattcctac acaaagttgc acagtctcta gtcctggaaa
5581 cattttattc attggataag aatggattga ggcatgagca gaggactgag acaaacacag
5641 agaagtttca acactggttg gggagaaaag gagtaactag tgagattcag gcagaacaag
5701 aataaggctc ctcaagaggc acaagcaaag cagggctcga gttgatttgt tctctcttca
5761 tcctgctttt tgtaattcca ccagagtctg aaatggccac tccatagagt ctctgctctg
5821 ggattctcca ggaaaccaat atccatcatg agacatcaag tctagtccca ggaagaagag
5881 attctggaat ggaaacatcc tgggtgggag tctcagcaca tctactattc
tgtctgagtt
5941 actggacaaa taacttcagt tttaacctaa cgaaagctgg gttggttgga
ggactgggca

gtttactgtc tgatatatgc
Amplified region: 4805 - 5733:
929 bp SNP: -2518 = codon no 7610 -2518 =
codon no 5092
7201 ttcatctagt ttcctcgctt ccttcctttt ctgcagtttt cgcttcacag aaagcagaat
7261 ccttaaaaat aaccctctta gttcacatct gtggtcagtc tgggcttaat ggcaccccat
7321 cctccccatt tgctcatttg gtctcagcag tgaatggaaa aagtgtctcg tcctgacccc
7381 ctgcttccct ttcctacttc ctggaaatcc acaggatgct gcatttgctc agcagattta
7441 acagcccact tatcactcat ggaagatccc tcctcctgct tgactccgcc ctctctccct
7501 ctgcccgctt tcaataagag gcagagacag cagccagagg aaccgagagg ctgagactaa
7561 cccagaaaca tccaattctc aaactgaagc tcgcactctc gcctccagca tgaaagtctc
7621 tgccgccctt ctgtgcctgc tgctcatagc agccaccttc attccccaag ggctcgctca
7681 gccaggtaag gccccctctt cttctccttg aaccacattg tcttctctct gagttatcat
7741 ggaccatcca agcagacgtg gtacccacag tcttgcttta acgctacttt tccaagataa
7801 ggtgactcag aaaaggacaa ggggtgagcc caaccacaca gctgctgctc ggcagagcct4805-

gcctccagca tgaaagtctc
Start codon: 7610

Keterangan: Hijau: primer ; merah: SNP


Gambar 12.2Amplifikasi gen pengkode MCP-1
(regio amplifikasi 48055733: 929 bp)

214 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Adapun hasil PCR adalah sebagai berikut.

900 BP

Keterangan: 1: kontrol negatif; 2 14: sampel; 15: DNA marker


Sumber: Yueniwati Y., 2012
Gambar 12.3Elektroforegram hasil PCR MCP-1

Semua sampel menunjukkan hasil positif (adanya pita),


sementara kontrol negatif tidak menunjukkan adanya pita
(Yueniwati Y., 2012).

12.1.3 Sekuensing Hasil PCR


Hasil PCR disekuensing. Berikut adalah hasil sekuensing pada
salah satu sampel.

Bab 12 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Variasi Genetika 215
Sumber: Yueniwati Y., 2012
Gambar 12.4Hasil sekuensing dengan primer MCP-1 forward

Sumber: Yueniwati Y., 2012

Gambar 12.5Hasil sekuensing dengan primer MCP-1 reverse

216 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Urutan nukleotida hasil sekuensing diidentifikasi dengan
program BLAST yang diakses pada http://www.ncbi.nlm.nih.gov.
Hasil identifikasi tersebut menunjukkan adanya homologi tinggi
dengan gen pengkode MCP-1. Berikut ini adalah hasil BLAST dari
salah satu sampel (Yueniwati Y., 2012).

Query 1 CCCTTGTGTGTCCCCAAGCGAGAGTCCAACCAAGGTTTGTGCCAGAGCCTAACCCAGGCT 60
Sbjct 240430 CCCTTGTGTGTCCCCAAGCGAGAGTCCAACCAAGGTTTGTGCCAGAGCCTAACCCAGGCT 240489
Query 61 TGTGCCGAGATGTTCCCAGCACAGCCCCATGTGAGAGCTCCCTGGCTCCGGGCCCAGTAT 120
Sbjct 240490 TGTGCCGAGATGTTCCCAGCACAGCCCCATGTGAGAGCTCCCTGGCTCCGGGCCCAGTAG 240549
Query 121 CTGGAATGCAGGCTCCAGCCAAATGCATTCTCTTCTACGGGATCTGGGAACTTCCAAAGC 180
Sbjct 240550 CTGGAATGCAGGCTCCAGCCAAATGCATTCTCTTCTACGGGATCTGGGAACTTCCAAAGC 240609
Query 181 TGCCTCCTCAGAGTGGGAATTTCCACTCACTTCTCTCACGCCAGCACTGACCTCCCAGCG 240
Sbjct 240610 TGCCTCCTCAGAGTGGGAATTTCCACTCACTTCTCTCACGCCAGCACTGACCTCCCAGCG 240669
Query 241 GGGGAGGGCATCTTTTCTTGACAGAGCAGAAGTGGGAGGCAGACAGCTGTCACTTTCCAG 300
Sbjct 240670 GGGGAGGGCATCTTTTCTTGACAGAGCAGAAGTGGGAGGCAGACAGCTATCACTTTCCAG 240729
Query 301 AAGACTTTCTTTTCTGATTCATACCCTTCACCTTCCCTGTGTTTACTGTCTGATATATGC 360
Sumber: Yueniwati Y., 2012
Gambar 12.6Hasil BLAST MCP-1

12.1.4 Analisis hasil sekuensing


Hasil sekuensing dianalisis dengan menggunakan program
Seqman (DNASTAR) untuk melihat ada/tidaknya mutasi yang
terjadi (Yueniwati Y., 2012).
Hasil analisis pada basa nomor -2518 tidak menunjukkan
adanya mutasi. Untuk semua sampel yang dianalisis tidak terjadi
perubahan basa guanin, seperti dapat dilihat sebagai berikut
(Yueniwati Y., 2012).

Bab 12 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Variasi Genetika 217
Sumber: Yueniwati Y., 2012
Gambar 12.7Analisis mutasi basa no -2518 pada hasil sekuensing dengan
primer MCP-1 forward

Sumber: Yueniwati Y., 2012


Gambar 12.8Analisis mutasi basa no -2518 pada hasil sekuensing dengan
primer MCP-1 reverse

218 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Mutasi terjadi pada basa nomor -2138 di mana terjadi
substitusi basa adenin menjadi timin. Mutasi terjadi pada dua
sampel yang merupakan sampel kontrol dan satu sampel yang
merupakan sampel kasus. Berikut adalah hasil analisis mutasi pada
basa no. -2138 pada hasil sekuensing yang menggunakan primer
reverse dan forward. Sekuensing dari 2 arah tersebut menunjukkan
terjadinya mutasi pada lokasi yang sama pada sampel yang
samapula (Yueniwati Y., 2012).

Sumber: Yueniwati Y., 2012


Gambar 12.9Analisis mutasi basa no -2138 pada hasil sekuensing dengan
primer MCP-1 forward

Bab 12 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Variasi Genetika 219
Sumber: Yueniwati Y., 2012
Gambar 12.10Analisis mutasi basa no -2138 pada hasil sekuensing dengan
primer MCP-1 reverse

Mutasi selanjutnya terjadi pada basa nomor -2464 di mana


terjadi mutasi basa guanin menjadi adenin. Mutasi terjadi pada
satu sampel yang merupakan sampel kasus. Berikut adalah hasil
pensejajaran untuk analisis mutasi pada basa nomor -2464 pada
hasil sekuensing menggunakan primer forward maupun reverse
(Yueniwati Y., 2012).

220 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Sumber: Yueniwati Y., 2012
Gambar 12.11Analisis mutasi basa no -2464 pada hasil sekuensing dengan
primer MCP-1 forward

Sumber: Yueniwati Y., 2012


Gambar 12.12Analisis mutasi basa no -2464 pada hasil sekuensing dengan
primer MCP-1 reverse

Bab 12 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Variasi Genetika 221
Hasil sekuensing yang mengalami polimorfisme tampak pada
tabel berikut.

Tabel 12.1Deskripsi hasil sekuensing


Nama sampel St23, Se5, Se21 St7
Perubahan nukleotida A-2138 T G-2464 A
Keterangan: P
 ada 20 anak (74%) dari 27 anak dengan orang tua stroke iskemia
dan 14 anak (51,9%) dari 27 anak dengan orang tua sehat yang
disekuensing, ditemukan 4 (11,8%) yang mengalami perbedaan
basa nukleotida.
Sumber: Yueniwati Y., 2012

Seperti tercantum pada tabel 12.1, hasil sekuensing DNA


menunjukkan adanya dua macam perbedaan basa nukleotida pada
gen pengkode MCP-1. Perbedaan pertama adalah perubahan basa
adenin menjadi timin pada basa ke -2138 (A-2138T), ditemukan
pada 5% anak populasi Jawa dengan orang tua stroke iskemia dan
14,3% anak populasi Jawa dengan orang tua sehat. Perbedaan
kedua adalah perubahan basa guanin menjadi adenin pada basa ke
-2464 (G-2464A), ditemukan pada 5% anak populasi Jawa dengan
orang tua stroke iskemia dan tidak ditemukan pada anak populasi
Jawa dengan orang tua sehat. Kedua perbedaan basa nukleotida
tersebut dapat dikatakan sebagai polimorfisme karena terjadi pada
lebih dari 1% sampel yang mewakili populasi (Yueniwati Y., 2012).
Telah diketahui bahwa polimorfisme adalah perubahan sekuen
DNA yang terjadi pada lebih dari 1% populasi. Polimorfisme
dibedakan dengan mutasi berdasar frekuensi kejadiannya. Mutasi
adalah perubahan sekuen DNA yang terjadi pada kurang dari 1%
populasi (Twyman, 2003). Temuan polimorfisme MCP-1 pada
penelitian ini baru dan spesifik, berbeda secara signifikan dengan
yang pernah dilaporkan sebelumnya (Yueniwati Y., 2012).
Polimorfisme MCP-1 yang ditemukan merupakan mutasi gen
pada tingkat nukleotida yang disebut mutasi titik (point mutation),
di mana hanya satu basa pada DNA yang mengalami perubahan.
Mutasi pertama terjadi akibat perubahan basa adenin menjadi
timin pada basa ke -2138, disebut transversi karena terjadi
substitusi basa purin oleh pirimidin. Mutasi kedua terjadi akibat
perubahan basa guanin menjadi adenin pada basa ke -2464,

222 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


disebut transisi akibat substitusi basa purin (Yueniwati Y., 2012).
Transisi jauh lebih sering terjadi daripada transversi, karena
transversi membutuhkan modifikasi-modifikasi molekul DNA yang
lebih besar (Granner and Weil, 2006).
Perubahan basa nukleotida tersebut terjadi karena
ketidakstabilan basa nukleotida dalam DNA. Basa nukleotida dapat
mengalami perubahan struktural yang disebut tautomeric shift.
Perubahan tersebut menyebabkan penyebaran ulang elektron
dan proton yang menyebabkan basa tidak dapat berpasangan
secara normal. G mungkin berpasangan dengan T atau A denganC.
Perubahan sekuen nukleotida tersebut dapat diwariskan. Tipe
variasi sekuen DNA yang paling sering dijumpai dalam genome
manusia adalah SNP (single nucleotide polymorphism), yaitu apabila
satu basa berbeda antar individu. SNP terjadi lebih kurang satu
kali setiap 1000 pasangan basa dalam genom (Twyman,2003).
Pada genom manusia bisa terjadi 10 juta SNP. Akan tetapi, hanya
1% yang mungkin memiliki konsekuensi fungsional (Granner
and Weil, 2006)
Baik basa -2138 maupun basa -2464 merupakan situs promoter
yaitu situs pengontrol yang terletak di awal gen struktural,
upstream dari start site MCP-1. Situs pengontrol adalah sekuen
nukleotida pada DNA yang mengontrol ekspresi gen struktural
yang terletak di sebelahnya. Promoter adalah bagian dari DNA
yang memfasilitasi transkripsi partikular gen, Transkripsi suatu
gen struktural hanya terjadi jika di dekat ujung gen tersebut ada
promoter untuk pengikatan RNA polimerase. Sekuens pasangan
basa promoter tersebut menentukan efisiensi pengikatan dengan
RNA polimerase dan dengan demikian menentukan pula efisiensi
transkripsi. Faktor transkripsi melekat pada situs pengikatan
di daerah promoter dan merangsang RNA polimerase untuk
berikatan dengan situs promoter. Promoter terletak berdekatan
dengan DNA yang diregulasi, pada strand yang sama dan biasanya
upstream. Polimorfisme pada situs promoter akan mempengaruhi
aktivitas transkripsi dan ekspresi gen. Situs promoter tidak ikut
pada proses translasi (Yueniwati Y., 2012).

Bab 12 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Variasi Genetika 223
Polimorfisme promoter MCP-1 A-2138T ditemukan pada
anak populasi Jawa dengan orang tua stroke iskemia dan anak
populasi Jawa dengan orang tua sehat. Polimorfisme ini belum
pernah dilaporkan ditemukan pada orang sehat sehingga
temuan penelitian ini merupakan temuan baru. Polimorfisme
MCP-1 A-2138T pernah dilaporkan ditemukan pada penderita
infark myocard di Jepang yang berusia lebih dari 65 tahun. Pada
penelitian tersebut adanya polimorfisme MCP-1 A-2138T secara
signifikan berhubungan dengan kadar serum MCP-1 dan kejadian
infark myocard (Iwai etal., 2006).
Polimorfisme MCP-1 A-2138T pada penelitian ini ditemukan
pada kelompok kasus dan kelompok kontrol. Deskripsi anak
populasi Jawa dengan polimorfisme A-2138T pada penelitian ini
adalah seperti yang dijelaskan berikut ini (Yueniwati Y., 2012).
1. Sampel anak penderita stroke iskemia yang mempunyai
polimorfisme adalah anak laki-laki berusia 15 tahun dengan
ayah penderita stroke iskemia. Serangan pertama saat ayah
berusia 45 tahun dan serangan kedua saat berusia 48 tahun.
Kakek dari pihak ayah meninggal dunia akibat infark myocard.
Sampel mempunyai indeks massa tubuh = 30.8 kgm2, menurut
klasifikasi WHO termasuk obese kelas 1. Hasil kolesterol LDL
117 mg/dl dan trigliserida 185 mg/dl, lebih tinggi dari nilai
normal, menunjukkan anak ini dislipidemia. Hasil pengukuran
ketebalan rata-rata intima media arteri karotis 0,50 mm.
2. Sampel kelompok kontrol yang mempunyai polimorfisme
adalah anak laki-laki berusia 15 tahun. Orang tuanya, baik
ayah atau ibu sehat, tapi kakek dari pihak ayah maupun ibu
meninggal akibat infark myocard. Indeks massa tubuh = 25.7
kg/m2, termasuk kategori pre obese sesuai klasifikasi WHO.
Ketebalan rata-rata intima media arteri karotisnya 0,60 mm.
3. Sampel kelompok kontrol yang juga mempunyai polimorfisme
adalah anak laki-laki berusia 20 tahun. Ayah dan ibunya sehat,
nenek dari pihak ibu meninggal karena stroke hemorrhagik.
Ketebalan intima media arteri karotisnya 0,60 mm.

224 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Dari uraian di atas tampak bahwa anak yang mempunyai
polimorfisme MCP-1 A-2138T, baik yang termasuk kelompok
kasus maupun kelompok kontrol mempunyai intima media arteri
karotis yang lebih tebal dari rata-rata ketebalan intima media
arteri karotis anak dengan rentang usia sama dan lebih tebal dari
intima media arteri karotis anak dengan orang tua infark myocard
berdasar penelitian terdahulu (Cuomo etal., 2002, Barra etal.,
2009, Urbina etal., 2009, Davis etal., 2010). Stroke iskemia dan
infark myocard merupakan komplikasi terkait aterosklerosis yang
mempunyai patogenesis serupa, mempunyai faktor risiko yang
sama. Perbedaannya hanyalah pada kualitas dan kuantitas faktor
risiko. Data pada penelitian ini dibandingkan dengan data anak
dengan orang tua infark myocard karena belum pernah dilakukan
penelitian pada anak dengan orang tua stroke iskemia sebelumnya.
(Arakelyan, etal., 2005, Bucova, etal., 2009).
Dua anak dengan polimorfisme MCP-1 A-2138T di atas
mempunyai riwayat keluarga dengan penyakit infark myocard dan
mempunyai indeks massa tubuh lebih dari 25 (Yueniwati Y., 2012).
Pada penelitian Iwai dkk. tahun 2006, polimorfisme A-2138T
ditemukan pada penderita infark myocard di Jepang dengan
indeks massa tubuh lebih dari 25 kg/m2. Mengingat polimorfisme
mempunyai kemungkinan diwariskan, maka kemungkinan anak
dengan polimorfisme MCP1 A-2138T ini mendapat warisan
polimorfisme MCP-1 A-2138T dari orang tuanya. Tentu saja
perlu penelitian lanjut untuk membuktikan adanya pewarisan
polimorfisme MCP-1 A-2138T tersebut (Yueniwati Y., 2012).
Sampai saat ini, belum pernah dilaporkan adanya temuan
polimorfisme MCP-1 G-2464A, sehingga polimorfisme MCP1
G-2464A pada penelitian ini benar-benar baru dan spesifik.
Polimorfisme MCP-1 G-2464A juga terletak pada situs promoter,
upstream dari start site MCP-1. Pada penelitian ini, polimorfisme
ditemukan pada sampel kasus yaitu anak dengan orang tua stroke
iskemia. Sampel ini perempuan berusia 19 tahun dengan ibu
penderita stroke iskemia, serangan stroke pada saat ibu berusia
32 tahun. Kakek dari pihak ayah juga penderita stroke iskemia dan
hipertensi. Nenek dari pihak ibu penderita hipertensi. Kolesterol

Bab 12 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Variasi Genetika 225
total 208 mg/dl dan kolesterol LDL 136 mg/dl menunjukkan
gambaran dislipidemia (Yueniwati Y., 2012). Ketebalan rata-rata
intima media arteri karotisnya 0,60 mm, lebih tebal dari rata-
rata ketebalan intima media arteri karotis anak dengan rentang
usia yang sama dan anak dengan orang tua infark myocard sesuai
penelitian sebelumnya (Cuomo etal., 2002, Barra etal., 2009,
Urbina etal., 2009, Davis etal., 2010).
Pada penelitian ini terlihat bahwa anak dengan polimorfisme,
mempunyai intima media arteri karotis yang lebih tebal dari anak
dengan rentang usia yang sama. Perhitungan risiko relatif dengan
rasio Odds menunjukkan anak dengan polimorfisme gen pengkode
MCP-1 mempunyai kemungkinan 1,471 kali untuk mengalami
penebalan intima media arteri karotis daripada anak tanpa
polimorfisme. Hasil penelitian tersebut menegaskan pentingnya
pemeriksaan genetika, khususnya analisis polimorfisme gen
pengkode MCP-1 pada anak dengan faktor risiko aterosklerosis
umumnya dan stroke iskemia khususnya. Dengan demikian,
apabila didapatkan polimorfisme dapat dilakukan penatalaksanaan
dini aterosklerosis berupa tindakan preventif terhadap faktor
risikolain (Yueniwati Y., 2012).
Polimorfisme MCP-1 yang ditemukan, keduanya merupakan
polimorfisme pada situs promoter MCP-1. Anak dengan
polimorfisme pada situs promoter MCP-1 pada penelitian ini
mempunyai intima media arteri karotis lebih tebal daripada anak
dengan rentang usia yang sama. Peningkatan ketebalan intima
media arteri karotis tersebut dapat diterangkan sebagai berikut.
Polimorfisme pada situs promoter akan meningkatkan aktivitas
transkripsional MCP-1 yang bekerja secara sinergis dengan
reseptornya yaitu CC Chemokine Receptor 2 (CCR2) sehingga
aktivitas biologi reseptor CCR2 meningkat. Akibatnya, terjadi
peningkatan aktivitas biologi sistem MCP-1/CCR2 messenger,
dan terjadi peningkatan rekrutmen lokal monosit pada tempat
injuri di dinding arteri (Yueniwati Y., 2012). Sistem MCP-1/CCR2
telah diketahui mempengaruhi risiko terjadinya aterosklerosis
sehingga peningkatan aktivitas sistem MCP-1/CCR2 messenger
akan menyebabkan peningkatan kejadian aterosklerosis (Nyquist,
et al., 2009, Nyquist, et al., 2010).

226 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Adanya pengaruh polimorfisme pada situs promoter MCP-1
terhadap peningkatan ketebalan intima media arteri karotis telah
dilaporkan pada beberapa penelitian yaitu adanya polimorfisme
MCP-1 G-927C dan A-2578G yang secara signifikan berhubungan
dengan peningkatan ketebalan intima in vitro pada penderita
stroke iskemia (Brenner et al., 2006). Polimorfisme MCP-1 G362C
pada populasi kulit hitam yang berhubungan dengan peningkatan
ketebalan intima media arteri karotis dan risiko aterosklerosis
karotis (Nyquist et al., 2009). Polimorfisme pada situs promoter
MCP-1 G928C berhubungan dengan peningkatan ketebalan
intima media arteri karotis invitro dan peningkatan risiko
aterosklerosis karotis (Nyquist etal., 2009, Nyquist et al.,2010).
Diketahui ketebalan intima media arteri karotis meningkat 0,036
mm untuk setiap C allele yang tampak. AC berhubungan dengan
tebalnya intima media arteri karotis, CG berhubungan dengan
tipisnya intima media arteri karotis (Brenner, et al., 2006).
Berbeda dengan beberapa penelitian lain yang dilakukan pada
kondisi terkait aterosklerosis, pada penelitian ini tidak didapatkan
polimorfisme MCP-1 pada basa ke -2518. Polimorfisme pada basa
ke -2518 ini sebenarnya yang diharapkan dapat ditemukan pada
penelitian ini mengingat banyaknya laporan penelitian adanya
polimorfisme di lokasi tersebut pada kondisi terkait aterosklerosis
(Tabara et al., 2003, Cermakova etal., 2005, Yuasa et al., 2009), dan
adanya hubungan polimorfisme MCP-1 A-2518G dengan kejadian
stroke iskemia (Buraczynska, et al., 2010).
Beberapa penelitian juga menunjukkan hubungan poli
morfisme MCP-1 G-2518A dengan ketebalan intima media arteri
karotis. Yuasa (2009) mendapatkan polimorfisme G-2518A,
berhubungan secara signifikan dengan peningkatan ketebalan
intima media arteri karotis (Yuasa, et al., 2009). Sementara itu,
Tabara (2003) mendapatkan polimorfisme MCP-1 G-2518A,
berhubungan dengan level MCP-1 tapi tidak berhubungan dengan
ketebalan intima media arteri karotis (Tabara et al., 2003). Posisi
basa -2518 terletak di situs promoter yang merupakan area
transkripsi utama. Diketahui bahwa transkripsi MCP-1 terjadi
pada fase awal aterosklerosis. Polimorfisme MCP-1 G-2518A

Bab 12 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Variasi Genetika 227
sudah diketahui mempengaruhi transkripsi gen dan berhubungan
dengan kejadian penyakit arteri koroner (Tabara, et al., 2003).
Polimorfisme pada regio pengontrol yaitu substitusi G-2518A,
sudah teridentifikasi dan menunjukkan pengaruh terhadap
transkripsi gen. Dilaporkan genotipe GG dari -2518 gen MCP-1
berhubungan dengan kejadian penyakit arteri koroner (Tabara,
etal., 2003).
Adanya perbedaan temuan polimorfisme genetika di atas
kemungkinan disebabkan perbedaan populasi dan geografis.
Diketahui bahwa populasi dan geografis menyebabkan perbedaan
polimorfisme genetika (Zhong etal., 2010). Sampai saat ini, belum
pernah diteliti peta polimorfisme populasi Indonesia dan populasi
Jawa khususnya sehingga penelitian genetika pada populasi Jawa
masih merupakan lahan luas yang harus diteliti demi tindakan
preventif, prediktif, dan penatalaksanaan dini berbagai penyakit
(Yueniwati Y., 2012).
Transkripsi MCP-1 berperan terhadap beratnya stroke
(Hughes, et al., 2002, Schilling et al., 2009). Transkripsi MCP1
dipengaruhi oleh beberapa faktor risiko seperti hipertensi,
hiperkolesterol, merokok, dan diabetes (Nyquist et al., 2010).
Untuk mengendalikan kemungkinan pengaruh faktor risiko
tersebut sampel penelitian diperiksa tekanan darah, profil
lipid, dan kadar glukosa darah. Kriteria inklusi semua sampel
adalah tidak merokok. Semua sampel tekanan darahnya normal,
kadar glukosanya normal dan tidak merokok. Profil lipid pada
penelitian ini merupakan variabel yang tidak bisa dikendalikan.
Terdapat hubungan antara profil lipid dengan MCP-1. Ekspresi
monosit meningkat pada hiperkolesterolemia. Tingginya kadar
LDL plasma meningkatkan ekspresi CCR2 monosit dan respon
kemotaksis terhadap stimuli eksternal. Hal tersebut meningkatkan
rekrutmen monosit ke intima dan mempercepat pembentukan lesi
aterosklerosis. Sebaliknya, HDL membantu menurunkan ekspresi
CCR2 dan kemotaksis mediated MCP-1 yang berakibat menurunkan
monosit di dinding arteri. Penelitian invitro menunjukkan sel
endotel dapat memproduksi MCP-1 sebagai respon terhadap LDL
(Arakelyan, etal., 2005).

228 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Dua anak dengan polimorfisme mempunyai indeks massa
tubuh lebih dari 25 kg/m2, satu anak mengalami dislipidemia.
Hasil ini sesuai hasil penelitian yang dilakukan pada anak
penderita infark myocard, yaitu anak-anak penderita infark
myocard mempunyai kecenderungan obesitas dan dislipidemia
(Cuomo et al., 2002, Barra et al., 2009). Anak dengan polimorfisme
juga mengalami dislipidemia. Hasil penelitian di atas menunjukkan
perlunya penelitian lebih lanjut mengetahui pengaruh
polimorfisme gen pengkode MCP-1 terhadap profil lipid dan
massa lemak tubuh. Pada penelitian ini didapatkan hasil bahwa
polimorfisme bukan merupakan faktor risiko dislipidemia maupun
massa lemak tubuh. Kemungkinan hal tersebut disebabkan umur
sampel yang masih muda sehingga saat ini belum terlihat pengaruh
(Yueniwati Y., 2012).
Berdasarkan hasil penelitian di atas, terdapat beberapa hal
yang harus diperhatikan seperti yang dijelaskan berikut ini.
Pertama, telah ditemukan dua polimorfisme pada promoter MCP1
yang baru dan spesifik, yaitu A-2138T dan G-2464A. Kedua, anak
populasi Jawa dengan polimorfisme mempunyai intima media
arteri karotis yang lebih tebal daripada intima media arteri
karotis anak pada rentang umur yang sama. Anak populasi Jawa
dengan polimorfisme mempunyai kemungkinan 1,471 kali untuk
mengalami penebalan intima media arteri karotis daripada anak
tanpa polimorfisme (Yueniwati Y., 2012).
Sementara itu, terdapat beberapa hal yang sebaiknya
diperhatikan dengan hasil penelitian ini, antara lain pertama,
perlu dilakukan evaluasi genetika polimorfisme MCP-1 pada
anak dengan risiko stroke iskemia dan aterosklerosis sehingga
dapat dilakukan tindakan preventif terhadap faktor risiko lain
dan penatalaksanaan dini. Kedua, perlu dilakukan penelitian
lebih lanjut untuk menentukan polimorfisme promoter MCP-1
yang ditemukan fungsional atau nonfungsional dengan menilai
ekspresigen (Yueniwati Y., 2012).

Bab 12 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Variasi Genetika 229
12.2 Polimorfisme Gen Pengkode OPN pada
Anak Populasi Jawa dengan Orang Tua
Stroke Iskemia
OPN adalah sitokin proinflamasi yang merupakan sialoprotein
fosforilasi yang disekresi oleh osteoblas, sel otot polos vaskular,
activated T-cells, dan sel dari turunan monosit/makrofag. Pada
tikus transgenik, OPN diketahui berhubungan dengan peningkatan
ketebalan intima media arteri karotis, proliferasi sel otot polos, dan
pembentukan ateroma (De las Fuentes etal., 2008). Polimorfisme
OPN T-443C terbukti berhubungan dengan peningkatan ketebalan
intima media arteri karotis. T-443C terletak pada regio promoter di
mana T-443C merupakan binding site MYT1 zinc finger. Bagaimana
pengaruh polimorfisme tersebut pada transkripsi gen belum
diketahui (Brenner etal., 2006). Polimorfisme T-66G yang juga
merupakan regio promoter pada penelitian De las Fuentes tahun
2008 terbukti berhubungan dengan peningkatan ketebalan intima
media arteri karotis (De las Fuentes et al., 2008).
Peranan OPN pada kejadian aterosklerosis sudah jelas
diketahui. Pengaruh polimorfisme OPN terhadap patogenesis
aterosklerosis khususnya ketebalan intima media arteri
karotis belum banyak diteliti. Hal tersebut menjadi dasar
dilakukan penelitian polimorfisme pada gen pengkode OPN dan
pengaruhnya terhadap ketebalan intima media arteri karotis
(YueniwatiY.,2012).

12.2.1 Amplifikasi gen target OPN


Bagian dari gen target OPN diamplifikasi menggunakan primer
yang mengenali daerah promoter pada nukleotida -469 sampai
+155. Dari penggambaran tersebut dapat diketahui ukuran DNA
target adalah 642 pasang basa, yaitu mulai basa -469 sampai +155.
Hal ini sesuai dengan ukuran produk PCR secara teoritis, yaitu
sekitar 600 bp. Dari hasil BLAST yang dilakukan untuk menganalisis
spesifisitas primer, diketahui bahwa primer OPN mengenali secara
spesifik gen target OPN, yaitu teridentifikasi sebagai SPP1 secreted
phosphoprotein 1 atau OPN (YueniwatiY.,2012).

230 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890
13443568 ATCTGTTCCTTTAGAAATGTGCAAAATTTCCTTATTGATGCATACAATTTAAAGATCTTACGTCTACTCTCATTTTAATAACCTGTTCTT
13443658 TTAAAGGACATTACAATTCGTGACTGCCTGCCCCTCTTAAAAATTTCATAATAGTTAACACACATATAGTCCTTAAGATACGCAGAGCAT
13443748 TTGCATCTAATATGTGCTAAGCATTGCTAGTTTAACATACTAATTCATTTAAACCCCTCAAAAACCCCATGACCTAGGTAATAGTATTGC
13443838 ATTTCATGGATGAGGGAACAAGGATAGGTAGGCTGGGCGATTTGCCCAAGGTTGCACAGGTCAGCAGTGACACAGCGGAATTCAGAACCA
13443928 CGGTCTGGCTCCTGAAGCAGCCCTCTCAAGCAGTCATCCTGCTCTCAGTCAGAAACTGCTTTACTTCTGCAACATCTAGAATAAATTACC
13444018 ATTCTTCTATTTCATATAGAATTTTATATTTTAATGTCACTAGTGCCATTTGTCTAAGTAACAAGCTACTGCATACTCGAAATCACAAAG
13444108 CTAAGCTTGAGTAGTAAAGGACAGAGGCAAGTTTTCTGAACTCCTTGCAGGCTTGAACAATAGCCTTCTGGCTCTTCAATAAGTACAATC
13444198 ATACAGGCAAGAGTGGTTGCAGATATTACCTTTATGTTACTTAAACCGAAAGAAACAAAAATCCATTCTATTTAATTTTACATTAATGTT
13444288 TTTCCCTACTTTCTCCCTTTTTCATGGGATCCCTAAGTGCTCTTCCTGGATGCTGAATGCCCATCCCGTAAATGAAAAAGCTAGTTAATG
13444378 ATATTGTACATAAGTAATGTTTTAACTGTAGATTGTGTGTGTGCGTTTTTGTTTTTTTTTGTTTTAACCACAAAACCAGAGGGGGAAGTG
13444468 TGGGAGCAGGTGGGCTGGGCAGTGGCAGAAAACCTCATGACACAATCTCTCCGCCTCCCTGTGTTGGTGGAGGATGTCTGCAGCAGCATT
13444558 TAAATTCTGGGAGGGCTTGGTTGTCAGCAGCAGCAGGAGGAGGCAGAGCACAGCATCGTCGGGACCAGACTCGTCTCAGGCCAGTTGCAG
13444648 CCTTCTCAGCCAAACGCCGACCAAGGTACAGCTTCAGTTTGCTACTGGGTTGTGCATTCAGCTGAATTTCATGGGGAAGTCCAAATTCTA
13444738 AGGAAAAATATTTTTAATTGTAATGCTGTTAAACAGACTTAAATTTTCTAGCCTTTTTAATAAGCAGATTAGATACATTGCAGGTCTCCT
13444828 GGAACAAAGGTGTCTAGATATTTTGAATGCCAATCAAATTTAAAACTTAAAAATACTTCCACTGGGTCCTCAAAAGAACGGAAACCACCG
13444918 ATGCTAATCAGAAAATAGTAAAATTAAATTCCCCTTTGGAATAATTATACCTATATAATTTTCAGTGGGTGACTGTGCAGGAATTTAAAA
13445008 GAAAAGGGATCTTTTATGCTAATTAAACCAATTACAATGCTATTTTTTAAATGATGTATCTCACTTTTAAGGGGAAGAAAACCCTTTCTG
13445098 AATATGCCACTGCTAAATTTAGCTGTTAAAATATTCACCAAGATACCTGTATGACACTGTGTAGGCTTATTATTACAAATAGAAAAGCTG
13445188 TTGGCTATTTTCAATGTTTTCCTTTGAATTTCAAATTTTTAGAACATCTTACTTAAATAACAAATTTCAGAGATAGTTTGATTTCACCTA
13445278 AGTAGCACCTACTTGATAATTAAGCTAAAAGTCACATTTAAAGTACATGTTGGAAAAATGGATAAAGCAAATTTTTTTCATTTTTTTCTG
13445368 TGAGTTTTTTCTTCTCTAAAAAATATTCCCATACTAGCTTATTAATATAATTAAGTTACTGTTGATCTGTTTGTAGGTTTAGAGAGCTAG
13445458 ATATATAAGGTAGTAATGGTATAATTTCTGGAACTCTAAATTTTAAAGTTGAATAAATACAGACTTGCAAAATTTCCCTTTCCCTTGCCT
13445548 AATAGTGAAAGATGGATAATAGGTGGCAATATAAATATTAACTTGAAAGACTATAATACTAAAAAGAAAAGGCATCTCTAAGAAGTAGAA
13445638 AAGATTCTATAGAAAATATATTTTATTTGTGATCATTTTGTAATGTGGTAGTATAAAAAGGTATCACTGTTGTAACCTATGAAGATGTCA
13445728 GCTATTCCTTATGAAATATTTTGCAGGAAAACTCACTACCATGAGAATTGCAGTGATTTGCTTTTGCCTCCTAGGCATCACCTGTGCCAT
m r I A V I C F C L L G I T c a i
13445818 aCCAGTGAGTACAGTTGCATCTTAAAGAAAATTCCTGAAAATAACTGAATTGTGTGCTTCCATGTGCTAGGAGGACATTCTTGTAATCTT
P

Keterangan: S ekuen bergaris bawah merah: primer OPN Fwd dan Rev; sekuen dengan latar biru:
mRNA; sekuen dengan latar hijau: intron; sekuen dengan background merah: daerah
yang ditranslasikan (NCBI Reference Sequence: NT_016354.19)
Sumber: Yueniwati Y., 2012
Gambar 12.13Sekuen Homo sapiens chromosome 4 genomic contig,
GRCh37.p5 Primary Assembly, dengan SNP OPN T-66G

Telah dilakukan berbagai optimasi kondisi PCR untuk


memperoleh pita tunggal OPN. Pita tunggal dibutuhkan untuk
memperoleh hasil sekuensing yang baik. Produk PCR yang terdiri
dari beberapa pita tidak memungkinkan untuk disekuensing
karena akan mengacaukan urutan nukleotida. Hasil PCR OPN
adalah sebagai berikut (YueniwatiY.,2012).

Keterangan:
No. 1: DNA marker ;
no. 2-5: sampel


Sumber: Yueniwati Y., 2012
Gambar 12.14Elektroforegram hasil PCR OPN

Bab 12 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Variasi Genetika 231
12.2.2 Analisis primer OPN
Karakteristik primer dianalisis menggunakan program Primer
Select (DNASTAR). Hasil dari analisis primer OPN terlihat dari tabel
di bawah ini (YueniwatiY.,2012).

Tabel 12.2Hasil analisis primer OPN


Self Hair Pair Product
Primers Sequences TM Length dimer pin dimer length
OPN
5TGTCACTAGTGCCATTG3 45 17 6 2 10 625 bp
Forward
OPN
5CAAACGCCGACCAAGG3 49 16 3 1
Reverse

12.2.3 Optimasi proses amplifikasi


Dari analisis primer OPN tersebut diketahui bahwa primer
OPN telah memenuhi kriteria untuk digunakan sebagai primer
ideal untuk mengamplifikasi daerah target OPN, yaitu suhu
melting point yang berdekatan, jumlah self dimer, pair dimer,
dan hair pin yang tidak terlalu banyak. Dalam proses amplifikasi
tersebut dilakukan optimasi untuk memperoleh kondisi ideal.
Optimasi dilakukan meliputi beberapa variabel yang meliputi suhu
penempelan, jumlah primer dan template, konsentrasi MgCl2, suhu
elongasi, lama elongasi, dan jumlah siklus (YueniwatiY.,2012).
Optimasi pada suhu penempelan dimulai pada suhu 45C yang
menghasilkan tiga pita produk PCR pada analisis migrasi. Oleh
karena itu, selanjutnya dilakukan peningkatan suhu penempelan
menjadi 47C, yang tidak menghasilkan produk PCR; sehingga
dilakukan penurunan suhu menjadi 46C dan 45,5C. Pada
masing-masing suhu tersebut masih tidak diperoleh pita tunggal
(YueniwatiY.,2012).
Optimasi selanjutnya adalah memvariasikan jumlah template
dan primer, yang tidak memberikan pengaruh berarti pada hasil
PCR, yaitu tidak memberikan hasil pita tunggal. Optimasi yang
dilakukan dengan melakukan variasi jumlah MgCl2, lama proses
annealing dan suhu elongasi juga masih belum memberikan hasil
optimal. Ringkasan dari variasi kondisi dengan primer OPN ini
dapat dilihat pada Tabel 12.3 berikut ini (YueniwatiY.,2012).

232 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Tabel 12.3Optimasi kondisi PCR untuk amplifikasi gen target OPN menggunakan primer OPN I
I II III IV V VI VII VIII IX X XI XII XIII XIV XV
Primer OPN I OPN I OPN I OPN I OPN I OPN I OPN I OPN I OPN I OPN I OPN I OPN I OPN I OPN I OPN I
Jumlah primer 1 1 1 1 1 0,75 0,75 0,75 0,75 0,75 0,75 0,75 0,5 0,75 0,5
25 uM (L)
Jumlah 1 1 1 1,5 1 1 1 1 1,5 1 1,5 1 1 1 1
template (L)
Penambahan 0 0 0 0 0 0 0,5 1 1 0,5 0,5 0,75 0,75 0,5 0,5
MgCl2 25 mM
(L)
Suhu 45 47 46 45.5 45 45 45 45 45 45 45 45 45 44 44
annealing (C)
Lama 30 30 30 30 30 30 30 30 30 30 30 30 30 20 20
annealing
(detik)
Suhu elongasi 72 72 72 72 72 72 72 72 72 72 72 72 72 68 68
(C)
Lama elongasi 1 1 1 1 1 1 1 1 1 1 1 1 1 45 45
(detik)

Bab 12 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Variasi Genetika


Jumlah siklus 35 35 35 35 35 35 35 35 35 35 35 35 35 35 35
Hasil 3 pita di negatif 3 pita 4 pita 3 pita 3 pita 3 pita 3 pita 3 pita 3 pita 3 pita 3 pita 3 pita 3 pita 3 pita
1200,800, di 800, di 900, di 800, di 800, di 800, di 800, di 800, di 800, di 800, di 800, di 800, di 800, di 800,
600 bp 700, 800, 700, 700, 700, 700, 700, 700, 700, 700, 700, 700, 700,
600 bp 600, 600 bp 600 bp 600 bp 600 bp 600 bp 600 bp 600 bp 600 bp 600 bp 600 bp 600 bp
500 bp (plg (plg

233
tebal) tebal)
Oleh karena optimasi kondisi dengan primer awal tidak
menghasilkan pita tunggal, maka dilakukan perancangan
primer selanjutnya, di mana dilakukan penambahan 4 basa
pada primer OPN forward dengan harapan untuk meningkatkan
spesifisitasnya. Pasangan primer baru ini disebut dengan OPN II
(YueniwatiY.,2012).
Optimasi menggunakan pasangan primer kedua ini dilakukan
dengan memvariasikan suhu annealing mulai dari 49,5C, 50C,
51C, dan 53C. Kondisi optimasi dengan primer OPN II dapat
dilihat pada Tabel 12.4. Optimasi pada suhu 49,5C memberikan
hasil pita tipis di ukuran sekitar 600 bp yang merupakan ukuran
gen target. Kondisi ini selajutnya digunakan untuk perbanyakan
sampel untuk selanjutnya disekuensing (YueniwatiY.,2012).

Tabel 12.4
Optimasi kondisi PCR untuk amplifikasi gen target OPN
menggunakan primer OPN II
XVI XVII XVIII XIX
Primer OPN II OPN II OPN II OPN II
Jumlah primer 25 uM (L) 1 1 1 1
Jumlah template (L) 1 1 1 1
Penambahan MgCl2 25 0 0 0 0
mM (L)
Suhu annealing (C) 50 53 51 49.5
Lama annealing (detik) 30 30 30 60
Suhu elongasi (C) 72 72 72 72
Lama elongasi (detik) 1 1 1 1
Jumlah siklus 35 35 35 35
Hasil 3 pita di 600, negatif Negatif Pita tipis di
400, 300 bp 600 bp

12.2.4 Sekuensing Sampel


Hasil sekuensing salah satu sampel adalah sebagai berikut
(Gambar 12.15-12.16).
Urutan nukleotida hasil sekuensing diidentifikasi dengan
program BLAST yang diakses pada http://www.ncbi.nlm.nih.gov.

234 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Hasil identifikasi tersebut tidak menunjukkan adanya homologi
dengan gen pengkode OPN (Gambar 12.17).

Sumber: Yueniwati Y., 2012


Gambar 12.15Hasil sekuensing dengan primer OPN forward

Sumber: Yueniwati Y., 2012


Gambar 12.16Hasil sekuensing dengan primer OPN reverse

Bab 12 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Variasi Genetika 235
Sumber: Yueniwati Y., 2012
Gambar 12.17Hasil BLAST OPN

Pada penelitian ini belum diperoleh data polimorfisme OPN.


Beberapa hal yang sebaiknya diperhatikan berhubungan dengan
hasil penelitian ini yaitu perlu dilakukannya evaluasi genetika
polimorfisme OPN pada anak dengan risiko stroke iskemia dan
aterosklerosis sehingga dapat dilakukan tindakan preventif
terhadap faktor risiko lain dan penatalaksanaan dini. Selain itu,
juga perlu dilakukan eksplorasi dan optimasi kondisi PCR OPN
lebih mendalam sehingga diperoleh hasil sekuensing dengan
homologi tinggi sesuai gen target OPN yang diharapkan. Terakhir,
perlu dilakukan penelitian lebih lanjut untuk menentukan
polimorfisme promoter OPN yang ditemukan fungsional atau
nonfungsional dengan menilai ekspresi gen (YueniwatiY.,2012).

12.3 Variasi Genetika Promoter OPN T-443C


pada Anak Populasi Jawa dengan Orang Tua
Stroke Iskemia
Mengetahui gejala dini adanya penyakit tertentu sangat perlu
dilakukan, termasuk penyakit stroke iskemia. Untuk keperluan
itu telah dilakukan berbagai penelitian. Salah satu penelitian yang
dilakukan yaitu deteksi variasi genetika promoter osteopontin
T-443C pada anak populasi Jawa dengan orang tua stroke iskemia.
Penelitian ini bertujuan untuk menjelaskan adanya hubungan
variasi genetika promoter OPN pada basa ke -433 anak populasi
Jawa dengan orang tua stroke iskemia serta pengaruhnya terhadap
ketebalan intima media arteri karotis pada anak populasi Jawa
dengan orang tua stroke iskemia (YueniwatiY.,2012).

236 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


12.3.1 Karakteristik sampel penelitian
Sampel pada penelitian ini adalah anak populasi Jawa dengan
orang tua stroke iskemia sebagai kelompok kasus dan anak populasi
Jawa dengan orang tua sehat sebagai kelompok kontrol. Rentang
umur sampel penelitian ini adalah 10-21 tahun karena menurut
National Law and Police on Minimum Ages, batas usia anak yang
diangap bertanggung jawab secara hukum adalah 21 tahun (UNICEF,
2008). Sementara itu, batas umur terbawah adalah 10 tahun dengan
mengacu pada penelitian sebelumnya yang pernah dilakukan di RSUD
Saiful Anwar Malang. Berdasarkan penelitian tersebut didapatkan
data tidak ada penderita stroke iskemia yang sedang dirawat maupun
berobat di RSUD Saiful Anwar Malang mempunyai anak berumur
kurang dari 10 tahun (Yueniwati 2009 dan Siswinarti 2011).
Hasil pengukuran karakteristik sampel, data laboratorium serta
pemeriksaan ultrasonografi pada penelitian ini didapatkan dari
penelitian sebelumnya karena penelitian ini merupakan penelitian
lanjutan. Namun, tidak semua sampel diikutsertakan pada penelitian
ini. Terdapat 10 laki-laki dan 9 perempuan dan pada kelompok kasus
serta 9 laki-laki dan 4 perempuan pada kelompok kontrol. Rata-
rata umur kelompok kasus adalah 18,32 2,79 tahun. Sementara
itu, rata-rata umur kelompok kontrol adalah 16,31 3,04 tahun.
Semua sampel belum menikah, tidak memiliki riwayat hipertensi,
kadar glukosa darah normal, tidak merokok baik aktif maupun pasif.
Semua orang tua anak kelompok kasus mendapat serangan stroke
iskemia pada usia 50 tahun (YueniwatiY.,2012).

12.3.2 Analisis genotiping variasi genetika promoter


osteopontin (OPN) T-443C
Analisis genotiping dimulai dengan analisis primer yang
sesuai dengan daerah target yang akan diamplifikasi. Selanjutnya,
dilakukan optimasi PCR yang dilanjutkan dengan perbanyakan
kemudian sekuensing produk hasil PCR (YueniwatiY.,2012).
Langkah awal analisis primer adalah dengan mengidentifikasi
gen yang akan diamplifikasi dan menentukan daerah targetnya.
Penentuan daerah target ini tergantung pada letak mutasi yang ingin
dilihat serta ukuran produk yang ingin dicapai (YueniwatiY.,2012).

Bab 12 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Variasi Genetika 237
Selanjutnya, dilakukan perancangan primer yang terdiri
dari primer reverse dan forward untuk mengapit daerah target
yang akan diamplifikasi. Pasangan primer diperoleh dari
penelitian sebelumnya, yaitu primer spesifik OPN berupa primer
forward: 5ATTACAATTCGTGACTGCCTGCC3 dan primer reverse:
5TGTACCTTGGTCGGCGTTTG3 (Giacopelli etal., 2004). Primer yang
digunakan ditandai dengan garis bawah pada gambar berikutini.

123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890
88895471 AAACCACAATTACTTTTGCAGCAACCTAATAATAAATAGCACCATTTATTTTTCATCTCAATTACACACAAGTCTTAACAATAAAGGTGT
88895561 AAGGTAAATAAATAGTGCAATCTGCATTTCACAACTGAGAAAGCAAATGAAGATAAGTAATCTCAAGGCAATATTAAATATTTTAAAAGG
88895651 ACCCAGAGCTCTGCTATCCCTGAATTCTGCTCTAATATTCGGACTTTCCCTGTAATTTTCTTTCATTCAGACACCTTTTAAATACCTAGT
88895741 AAAGTGTTTTTTAATACAGAAATTTTTAAAAATGTTTTTCTTTTTAAGTGGCCTACTTTACATACCTTGGGAGAAAAACTAGAAAAAAAG
88895831 ATGATTCCAAAATCGAATCTGTTCCTTTAGAAATGTGCAAAATTTCCTTATTGATGCATACAATTTAAAGATCTTACGTCTACTCTCATT
88895921 TTAATAACCTGTTCTTTTAAAGGACATTACAATTCGTGACTGCCTGCCCCTCTTAAAAATTTCATAATAGTTAACACACATATAGTCCTT
88896011 AAGATACGCAGAGCATTTGCATCTAATATGTGCTAAGCATTGCTAGTTTAACATACTAATTCATTTAAACCCCTCAAAAACCCCATGACC
88896101 TAGGTAATAGTATTGCATTTCATGGATGAGGGAACAAGGATAGGTAGGCTGGGCGATTTGCCCAAGGTTGCACAGGTCAGCAGTGACACA
88896191 GCGGAATTCAGAACCACGGTCTGGCTCCTGAAGCAGCCCTCTCAAGCAGTCATCCTGCTCTCAGTCAGAAACTGCTTTACTTCTGCAACA
88896281 TCTAGAATAAATTACCATTCTTCTATTTCATATAGAATTTTATATTTTAATGTCACTAGTGCCATTTGTCTAAGTAACAAGCTACTGCAT
88896371 ACTCGAAATCACAAAGCTAAGCTTGAGTAGTAAAGGACAGAGGCAAGTTTTCTGAACTCCTTGCAGGCTTGAACAATAGCCTTCTGGCTC
88896461 TTCAATAAGTACAATCATACAGGCAAGAGTGGTTGCAGATATTACCTTTATGTTACTTAAACCGAAAGAAACAAAAATCCATTCTATTTA
88896557 ATTTTACATTAATGTTTTTCCCTACTTTCTCCCTTTTTCATGGGATCCCTAAGTGCTCTTCCTGGATGCTGAATGCCCATCCCGTAAATG
88896641 AAAAAGCTAGTTAATGATATTGTACATAAGTAATGTTTTAACTGTAGATTGTGTGTGTGCGTTTTTGTTTTTTTTTGTTTTAACCACAAA
88896731 ACCAGAGGGGGAAGTGTGGGAGCAGGTGGGCTGGGCAGTGGCAGAAAACCTCATGACACAATCTCTCCGCCTCCCTGTGTTGGTGGAGGA
88896821 TGTCTGCAGCAGCATTTAAATTCTGGGAGGGCTTGGTTGTCAGCAGCAGCAGGAGGAGGCAGAGCACAGCATCGTCGGGACCAGACTCGT
88896911 CTCAGGCCAGTTGCAGCCTTCTCAGCCAAACGCCGACCAAGGTACAGCTTCAGTTTGCTACTGGGTTGTGCATTCAGCTGAATTTCATGG
88897001 GGAAGTCCAAATTCTAAGGAAAAATATTTTTAATTGTAATGCTGTTAAACAGACTTAAATTTTCTAGCCTTTTTAATAAGCAGATTAGAT
88897091 ACATTGCAGGTCTCCTGGAACAAAGGTGTCTAGATATTTTGAATGCCAATCAAATTTAAAACTTAAAAATACTTCCACTGGGTCCTCAAA
88897181 AGAACGGAAACCACCGATGCTAATCAGAAAATAGTAAAATTAAATTCCCCTTTGGAATAATTATACCTATATAATTTTCAGTGGGTGACT
88897271 GTGCAGGAATTTAAAAGAAAAGGGATCTTTTATGCTAATTAAACCAATTACAATGCTATTTTTTAAATGATGTATCTCACTTTTAAGGGG
88897361 AAGAAAACCCTTTCTGAATATGCCACTGCTAAATTTAGCTGTTAAAATATTCACCAAGATACCTGTATGACACTGTGTAGGCTTATTATT
88897451 ACAAATAGAAAAGCTGTTGGCTATTTTCAATGTTTTCCTTTGAATTTCAAATTTTTAGAACATCTTACTTAAATAACAAATTTCAGAGAT
88897541 AGTTTGATTTCACCTAAGTAGCACCTACTTGATAATTAAGCTAAAAGTCACATTTAAAGTACATGTTGGAAAAATGGATAAAGCAAATTT
88897631 TTTTCATTTTTTTCTGTGAGTTTTTTCTTCTCTAAAAAATATTCCCATACTAGCTTATTAATATAATTAAGTTACTGTTGATCTGTTTGT
88897721 AGGTTTAGAGAGCTAGATATATAAGGTAGTAATGGTATAATTTCTGGAACTCTAAATTTTAAAGTTGAATAAATACAGACTTGCAAAATT
88897811 TCCCTTTCCCTTGCCTAATAGTGAAAGATGGATAATAGGTGGCAATATAAATATTAACTTGAAAGACTATAATACTAAAAAGAAAAGGCA
88897901 TCTCTAAGAAGTAGAAAAGATTCTATAGAAAATATATTTTATTTGTGATCATTTTGTAATGTGGTAGTATAAAAAGGTATCACTGTTGTA
Sumber: Yueniwati Y., 2012
Keterangan: S ekuen bergaris bawah merah: Primer OPN forward dan reverse; sekuen dengan
latar belakang biru: mRNA; sekuen dengan latar belakang hijau: intron; sekuen
dengan latra belakang merah: exon; kotak hijau: lokasi basa nomor -443.
Gambar 12.18Sekuen Homo sapiens chromosome 4 genomic contig,
GRCh37.p5 Primary Assembly, dengan SNP OPN T-443C

Primer yang sudah dirancang kemudian dianalisis meng


gunakan program Primer BLAST. Analisis primer ini meliputi
self dimer, pair dimer, hair pin, dan T annealing. Berikut ini hasil
analisis primer (Yueniwati Y., 2012).
Tabel 12.5Hasil analisis primer OPN
Parameter yang dianalisis
Jenis Primer
Sekuen Panjang Tm Self dimer Hair pin
Forward 5ATTACAATTCGTGACTGCCTGCC3 23 55,86 5 5
Reverse 5TGTACCTTGGTCGGCGTTTG3 20 55,14 6 1

238 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Berdasarkan hasil analisis tersebut, primer telah memenuhi
kriteria ideal untuk mengamplifikasi daerah target OPN, yaitu
panjang sekuen primer antara 18-30 basa, titik leleh yang
berdekatan, jumlah self dimer dan hair pin yang tidak terlalu
banyak. Sementara itu, suhu annealing yang digunakan adalah55C
(Yueniwati Y., 2012).

12.3.3 Optimasi PCR dan analisis migrasi produk PCR


Optimasi PCR dilakukan untuk mendapatkan pita tunggal
spesifik di ukuran basa yang diinginkan agar diperoleh hasil
sekuensing yang baik. Dalam penelitian ini, ukuran basa yang
diinginkan adalah 1011 pasang basa. Optimasi ini dilakukan
dengan mengoptimalkan kondisi, konsentrasi dan komposisi PCR.
Produk PCR kemudian dianalisis migrasi dengan elektroforesis
DNA agarose 1% dan menghasilkan satu pita tunggal spesifik di
ukuran sekitar 1000bp. Produk ini selanjutnya disebut sebagai
OPN I (Yueniwati Y., 2012).
Hasil PCR OPN I tersebut adalah sebagai berikut.
1 2 3 4 5 6 7 8

1500 bp
1000 bp
800 bp
600 bp Keterangan:
500 bp
400 bp No.1-6: Sampel;
300 bp No.7: Kontrol negatif;
200 bp
100 bp No.8: DNA Marker
Sumber: Yueniwati Y., 2012
Gambar 12.19Elektroforegram hasil PCR OPN I

Namun, pada optimasi selanjutnya tidak ada pita yang ter


bentuk, baik di daerah target maupun di daerah lainnya. Optimasi
dilanjutkan menggunakan sampel yang pernah berhasil dengan
kondisi dan komposisi yang sama namun tidak ada pita yang

Bab 12 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Variasi Genetika 239
terbentuk. Selanjutnya dilakukan elektroforesis DNA template
untuk memastikan sampel masih dalam kondisi baik. Sampel yang
digunakan untuk elektroforesis adalah 3 sampel yang pernah
berhasil diamplifikasi dan 3 sampel yang gagal teramplifikasi
yang dipilih secara acak. Berikut hasil elektroforesis DNA
templatetersebut (Yueniwati Y., 2012).

1 2 3 4 5 6 7

1500 bp
1000 bp
800 bp
600 bp
500 bp
400 bp
300 bp
200 bp Keterangan:
100 bp No.1-6: Sampel;
No.7: DNA Marker

Sumber: Yueniwati Y., 2012


Gambar 12.20Elektroforegram DNA Template

Berdasarkan hasil analisis migrasi di atas, DNA template masih


dapat dikatakan baik dan layak untuk diamplifikasi.
Ringkasan hasil optimasi OPN I dapat dilihat dalam tabel
berikut ini (Yueniwati Y., 2012).
Tabel 12.6Optimasi PCR untuk amplifikasi gen target OPN menggunakan
master mix OPN I
Parameter Optimasi ke-
yang
dioptimasi I II III IV V VI VII VIII IX
Volume DNA 1 1 1 1 1 1 1 1
template (ul) Dilakukan
elektroforesis
Volume Primer 1 1 1 1 DNA template 1 1 1 (Aliquot 1
R/F (ul) baru)
Volume master 10 10 10 10 10 10 10 (Aliquot 10
mix baru)
Hasil 1 pita di 1 pita di Negatif Negatif DNA template Negatif Negatif Negatif Negatif
1000bp 1000bp masih dalam
kondisi baik

240 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Optimasi selanjutnya dilakukan pada sampel yang pernah
berhasil teramplifikasi dan masih dalam kondisi baik berdasarkan
hasil elektroforesis. Optimasi ini menggunakan Pfu DNA polimerase
dan buffer baru (Pfu Promega). Hasilnya, terbentuk beberapa pita
yang tidak spesifik di daerah lain dan ada sisa primer (primer
dimer) yang menunjukkan sampel tidak teramplifikasi dengan baik
sehingga suhu annealing dinaikkan dari 55C menjadi 57C agar
produk yang dihasilkan lebih spesifik. Namun, hanya terbentuk
primer dimer (Yueniwati Y., 2012).
Suhu annealing kemudian diturunkan menjadi 54C dengan
harapan muncul pita di daerah target. Kondisi inipun tidak
berhasil. Selanjutnya, volume DNA template dinaikkan dari 1
ul menjadi 2 ul dengan tujuan meningkatkan kemungkinan
menempelnya primer pada template. Optimasi dilanjutkan dengan
menurunkan kembali suhu annealing menjadi 50C agar pita yang
muncul lebih tebal. Produk PCR ini selanjutnya disebut dengan
OPN II (YueniwatiY.,2012).
Hasil optimasi PCR OPN II diringkas dalam tabel berikut
(Yueniwati Y., 2012).

Tabel 12.7Optimasi PCR menggunakan Pfu DNA polimerase OPN II


Parameter yang Optimasi ke-
dioptimasi X XI XII XIII XIV
Volume Pfu (ul) 0,32 0,32 0,32 0,32 0,32
Volume Buffer (ul) 2,5 2,5 2,5 2,5 2,5
Volume dNTP (ul 0,5 0,5 0,5 0,5 0,5
Volume Primer F/R (ul) 1 1 1 2 1
Volume DNA template (ul) 1 1 1 2 1
Suhu Annealing (C) 55 57 54 54 50
Lama Elongasi (detik) 60 120 120 120 60
Hasil 2 pita di 200 Negatif. Negatif. Negatif. Negatif.
dan 300bp. Hanya Hanya Hanya Hanya
Terbentuk terbentuk terbentuk terbentuk terbentuk
primer primer primer primer primer
dimer dimer dimer dimer dimer

Optimasi kembali dilakukan menggunakan dNTP baru


sebagai salah satu komponen utama untuk mensintesis untai
DNA komplementer, menaikkan suhu annealing menjadi 55C
dan memperpanjang waktu predenaturasi menjadi 5 menit agar
denaturasi lebih sempurna sehingga meningkatkan jumlah tempat

Bab 12 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Variasi Genetika 241
penempelan primer. Karena masih belum mendapatkan kondisi
yang optimal, optimasi dilanjutkan dengan menurunkan kembali
waktu predenaturasi menjadi 2 menit. Waktu predenaturasi yang
telalu lama dapat merusak kondisi sampel. Selain itu, ditambahkan
pula enhancing agent yaitu gliserol dengan final concentration
5% untuk meningkatkan spesifitas dan ketebalan pita. Volume
primer juga dinaikkan dari 1 ul menjadi 1,5 ul dengan volume DNA
template 1 ul. Dengan kondisi ini, didapatkan pita tipis di daerah
200bp dan masih terbentuk primer dimer. Oleh karena itu, volume
DNA template kembali dinaikkan menjadi 2 ul agar pita yang
terbentuk menjadi lebih tebal. Hasilnya, sisa primer lebih tebal
dan tidak ada pita yang muncul di daerah target maupun daerah
lain sehingga suhu annealing kembali diturunkan menjadi 50C
dengan harapan terbentuk pita yang lebih banyak. Pada kondisi ini,
terbentuk pita di daerah 300bp dan smear di daerah lain sehingga
pada optimasi selanjutnya suhu annealing diturunkan menjadi
45C. Tujuannya agar meningkatkan jumlah pita yang terbentuk,
khususnya di daerah target. Namun, hanya terbentuk primer
dimer. Suhu annealing kemudian ditingkatkan menjadi 48C dan
mengganti gliserol 5% dengan DMSO 5%. DMSO juga merupakan
enhancing agent yang dapat meningkatkan spesifitas dan
ketebalan pita produk PCR. Akan tetapi, pita juga tidak terbentuk
pada kondisi ini. Produk PCR dengan dNTP baru ini disebut
sebagai OPNIII. Tabel 12.8 merupakan ringkasan hasil PCR OPN III
(Yueniwati Y., 2012).
Optimasi diulang dengan meningkatkan suhu annealing
menjadi 50C. Karena tetap tidak berhasil, optimasi dicoba dengan
menggunakan master mix baru Taq DNA Polimerase (Promega)
dengan suhu annealing 55C yang disebut sebagai OPN IV. Namun
tidak ada produk PCR yang dihasilkan(Yueniwati Y., 2012).
Optimasi selanjutnya adalah mengganti master mix dengan
master mix Taq DNA Polymerase Intron. Konsentrasi dan kondisi
PCR disesuaikan dengan master mix yang baru. Suhu annealing yang
digunakan adalah 54. Dengan optimasi ini, didapatkan pita tunggal
yang spesifik di daerah target yaitu di 1000bp. Namun, masih
terbentuk smear dan sisa primer sehingga dilakukan optimasi
ulang dengan mengubah suhu annealing menjadi 56; 54,5; 54 dan

242 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Tabel 12.8Optimasi PCR menggunakan dNTP baru OPN III
Optimasi ke-
Parameter yang dioptimasi
XV XVI XVII XVIII XIX XX XXI XXII XXIII XXIV
Volume Pfu (ul) 0,32 0,32 0,32 0,5 0,5 0,5 0,5 0,5 0,5
Volume Buffer (ul) 2,5 2,5 2,5 2,5 2,5 2,5 2,5 2,5 2,5
Volume dNTP baru (ul) 0,5 0,5 0,5 0,5 0,5 0,5 0,5 0,5 0,5
Volume Primer F/R (ul) 1 1 1 1,5 1 1 1 1 1
Volume DNA template (ul) 1 1 2 1 2 1 1 1 1
Dilakukan
Suhu Annealing (C) 50 55 55 elektroforesis 55 55 50 45 48 50
Lama Elongasi (menit) 2 2 2 DNA Template 2 2 2 2 2 2
Lama Predenaturasi (menit) 2 5 2 2 2 2 2 2 2
Penambahan Gliserol final - - 1,25 1,25 1,25 1,25 1,25 - -
concentration 5% (ul)
Penambahan DMSO final - - - - - - - 1,25 1,25
concentration 5% (ul)
1 pita 1 pita
1 pita
Negatif. Negatif. Negatif. tipis di tipis Negatif. Negatif.
tipis di
Hanya Hanya Hanya DNA template 200bp. pada Hanya Hanya
200bp.
Hasil terbentuk terbentuk terbentuk masih dalam Sisa 300bp. terbentuk Negatif terbentuk
Masih

Bab 12 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Variasi Genetika


primer primer primer kondisi baik primer Masih primer primer
ada sisa
dimer dimer dimer lebih ada sisa dimer dimer
primer
tebal. primer

243
53. Harapannya pita yang terbentuk di daerah target menjadi lebih
tebal. Akan tetapi, setelah dilakukan percobaan, ternyata kondisi
paling optimal adalah pada suhu 54. Untuk sampel yang belum
menghasilkan produk, volume sampel ditingkatkan menjadi 2ul
dengan kondisi yang sama. Hasil PCR ini disebut sebagai OPN V
seperti yang tampak pada gambar berikut ini.
14 13 12 11 10 9 8 7 6 5 4 3 2 1

1500 bp
1000 bp
800 bp
600 bp
500 bp
400 bp Keterangan:
300 bp No. 1: DNA marker;
200 bp
100 bp No. 2: Kontrol negatif;
No. 3-14: Sampel

Sumber: Yueniwati Y., 2012


Gambar 12.21Elektroforegram hasil PCR OPN V

Hasil ringkasan optimasi PCR OPN V dapat dilihat pada


Tabel12.9.

12.3.4 Perbanyakan produk PCR


Setelah optimasi berhasil, selanjutnya dilakukan perbanyakan
produk PCR untuk memenuhi persyaratan jumlah minimum
sampel yang dapat disekuensing. Komposisi, konsentrasi serta
kondisi yang digunakan sama dengan optimasi. Produk PCR
yang akan disekuensing dalam penelitian ini adalah produk PCR
unpurified (belum dipurifikasi) sehingga volume minimal yang
dibutuhkan adalah 30 ul dengan konsentrasi 100 ng/ul. Untuk
mengetahui konsentrasi produk PCR yang dihasilkan maka
dilakukan pengukuran terhadap beberapa sampel menggunakan

244 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Tabel 12.9 Optimasi PCR menggunakan master mix OPN V
Parameter yang Optimasi ke-
dioptimasi XXVI XXVII XXVIII XXIX XXX XXXI XXXII XXXIII
Volume DNA
1 2 2 2 2 2 2 3
template (ul)
Volume Primer R/F 1 1 1 1 1 1 1 1,5
(ul)
Suhu Annealing (0C) 54 54 53 56 54 54 54 54,5
Lama Elongasi (detik) 45 45 45 45 45 45 45 50
Hasil 1 pita di 1 pita 1 pita tipis 1 pita di 1 pita 1 pita tebal 1 pita tebal Negatif.
1000bp. tebal di di 1000bp. 1000bp. tebal di di 1000bp. di 1000bp. Smear lebih
Ada smear. 1000bp. Ada Pita sangat 1000bp. Smear lebih Smear lebih tebal.
Ada sisa Smear smear. tipis. Ada Smear tipis. Sisa tipis. Sisa
primer lebih Sisa smear. lebih primer lebih primer lebih
tipis. Sisa primer Sisa primer tipis. Sisa tipis tipis
primer lebih tebal lebih tebal primer
lebih tipis lebih tipis

Bab 12 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Variasi Genetika


245
spektrofometer nanodrop. Hasilnya, konsentrasi sampel memenuhi
kriteria untuk disekuensing. Berikut hasil pengukuran konsentrasi
produk PCR tersebut (Yueniwati Y., 2012).

Tabel 12.10Hasil pengukuran konsentrasi produk PCR

Identitas Sampel Konsentrasi (ng/ul)


10E 519,54
9E 474,90
8N 510,71
7N 525,40

12.3.5 Sekuensing produk PCR


Produk PCR selanjutnya dikirim ke Macrogen untuk
disekuensing. Tujuannya untuk mengetahui urutan basa dari
produk PCR sehingga dapat dilakukan analisis mutasi pada sampel.
Berikut ini hasil sekuensing salah satu sampel (Yueniwati Y., 2012).

Sumber: Yueniwati Y., 2012


Gambar 12.22Hasil sekuensing dengan primer OPN forward

246 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Sumber: Yueniwati Y., 2012
Gambar 12.23Hasil sekuensing dengan primer OPN reverse

Urutan basa nukleotida hasil sekuensing tersebut selanjutnya


dianalisis menggunakan program BLAST untuk melihat kemung
kinan homologi dengan gen pengkode OPN. Berdasarkan hasil
BLAST tersebut, diketahui bahwa ada homologi tinggi produk PCR
dengan gen pengkode osteopontin. Berikut hasil BLAST salah satu
sampel (Yueniwati Y., 2012).
Homo sapiens secreted phosphoprotein 1 (SPP1), RefSeqGene on chromosome 4

Next Match Previous Match

Query 42 ACGCCGAGCATTTGCTTTTAATATGTGCTAAGCATTGCTAGATTAACATACTAATTCATT 101


Sbjct 4216 ACGCAGAGCATTTGCATCTAATATGTGCTAAGCATTGCTAGTTTAACATACTAATTCATT 4275
Query 102 TTAACCCCTCAAAAACCACATGACCTAGGTAATAATATTGCATTTCATGGATGAGGGAAC 161
Sbjct 4276 TAAACCCCTCAAAAACCCCATGACCTAGGTAATAGTATTGCATTTCATGGATGAGGGAAC 4335
Query 162 AAGGATAGGTAGGCTGGGCGATTTGCCCAAGGTTGCACAGGTCAGCAGTGACACAGCGGA 221
Sbjct 4336 AAGGATAGGTAGGCTGGGCGATTTGCCCAAGGTTGCACAGGTCAGCAGTGACACAGCGGA 4395
Query 222 ATTCAGAACCACGGTCTGGCTCCTGAAGCAGCCCTCTCAAGCAGTCATCCTTCTCTCAGT 281
Sbjct 4396 ATTCAGAACCACGGTCTGGCTCCTGAAGCAGCCCTCTCAAGCAGTCATCCTGCTCTCAGT 4455
Query 282 CAGAAACTGCTTTACTTCTGCAACATCTAGAATAAATTACCATTCTTCTATTTCATATAG 341
Sbjct 4456 CAGAAACTGCTTTACTTCTGCAACATCTAGAATAAATTACCATTCTTCTATTTCATATAG 4515
Query 342 AATTTTATATTTTAATGTCACTAGTGCCATTTGTCTAAGTAACAAGCTACTGCATACTCG 401
Sbjct 4516 AATTTTATATTTTAATGTCACTAGTGCCATTTGTCTAAGTAACAAGCTACTGCATACTCC 4575
Query 402 AAATCACAAAGCTAAGCTTGAGTAGTAAAGGACAGAGGCAAGTTTTCTGAACTCCTTGCA 461
Sbjct 4576 AATTTTATATTTTAATGTCACTAGTGCCATTTGTCTAAGTAACAAGCTACTGCATACTCC 4575
Query 462 GGCTTGAACAATAGCCTTCTGGCTCTTCAATAAGTACAATCATACAGGCAAGAGTGGTTG 521
Sbjct 4636 GGCTTGAACAATAGCCTTCTGGCTCTTCAATAAGTACAATCATACAGGCAAGAGTGGTTG 4695
Query 522 CAGATATTACCTTTATGTTACTTAAACCGAAAGAAACAAAAATCCATTCTATTTAATTTT 581
Sbjct 4696 CAGATATTACCTTTATGTTACTTAAACCGAAAGAAACAAAAATCCATTCTATTTAATTTT 4755
Query 582 ACATTCATGTTTTTCCCTACTTTCTCCCTTTTTCATGGGATCCCTAAGTGCTCTTCCTGG 641
Sbjct 4756 ACATTAATGTTTTTCCCTACTTTCTCCCTTTTTCATGGGATCCCTAAGTGCTCTTCCTGG 4815
Query 642 ATGCTGAATGCCCATCCCGTAAATGAAAAAGCTAGTTAATGATATTGTACATAAGTAATG 701
Sbjct 4816 ATGCTGAATGCCCATCCCGTAAATGAAAAAGCTAGTTAATGATATTGTACATAAGTAATG 4875

Sumber: Yueniwati Y., 2012


Gambar 12.24Hasil BLAST OPN

Bab 12 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Variasi Genetika 247
Selanjutnya, hasil sekuensing dianalisis menggunakan
program CLC Main Workbench 6.0 untuk mensejajarkan urutan
basa nukleotida sehingga dapat dilihat ada atau tidaknya mutasi
yang terjadi (Yueniwati Y., 2012).

12.3.6 Analisis mutasi pada basa no. -443


Hasil analisis pada basa nomor -443 menunjukkan adanya
mutasi pada beberapa sampel yaitu substitusi basa timin menjadi
sitosin. Mutasi terjadi pada enam belas sampel kasus dan lima
sampel kontrol. Sekuensing dua arah tersebut menunjukkan
terjadinya mutasi pada lokasi yang sama, namun pada beberapa
sampel yang berbeda. Berikut (Gambar 12.25-12.26), hasil analisis
mutasi pada basa nomor -443 (Yueniwati Y., 2012).
Berdasarkan analisis hasil sekuensing, 11 sampel mengalami
mutasi pada OPN forward dan 10 sampel pada OPN reverse.
Namun, hanya 6 sampel yang dapat dikatakan mengalami mutasi
yang terdiri dari 4 kelompok kasus dan 2 kelompok kontrol. Karena
hanya 6 sampel tersebut yang mengalami mutasi yang sama, baik
pada OPN forward maupun reverse. Berikut hasil ringkasannya
(Yueniwati Y., 2012).

Tabel 12.11Data mutasi sampel promoter OPN T-443C menggunakan


program CLC main workbench 6.0
Daftar Sampel yang Mengalami Mutasi
OPN Forward Ketebalan CA-IMT OPN Reverse
(Kelompok) (mm) (Kelompok)
11 E (S) 0,06 11 E (S)
14 E (S) 0,06 14 E (S)
4 E (S) 0,06 4 E (S)
6 N (S) 0,05 6 N (S)
13 E (K) 0,04 13 E (K)
1 N (K) 0,045 1 N (K)
2 E (K) 7 E (S)
2 N (S) 8 E (S)
6 E (K) 8 N (S)
12 N (S) 10 N (S)
5 E (S)
Sumber: Yueniwati Y., 2012

248 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


800 820 820
wild type A T CA C AAAGC T AAG C T T GAG T AG T AAAGGA C AGAGG C AAG - - - - - - - - T T T T C T G A A - - - 481
10E A T C A C AAAGC T AAG C T T GAG T AG T AAAGGA C AGAGG C AAG - - - - - - - - T T T T C T G A A - - - 452
9E A T C A C AAAGC T AAG C T T GAG T AG T AAAGGA C AGAGG C AAG - - - - - - - - T T T T C T G A A - - - 455
16E A T C A C AAAGC T AAG C T T GAG T AG T AAAGGA C AGAGG C AAG - - - - - - - - T T T T C T G A A - - - 461
15E A T C A C AAAGC T AAG C T T GAG T AG T AAAGGA C AGAGG C AAG - - - - - - - - T T T T C T G A A - - - 456
12E A T C A C AAAGC T AAG C T T GAG T AG T AAAGGA C AGAGG C AAG - - - - - - - - T T T T C T G A A - - - 571
15N A T C A C AAAGC T AAG C T T GAG T AG T AAAGGA C AGAGG C AAG - - - - - - - - T T T T C T G A A - - - 453
11N A T C A C AAAGC T AAG C T T GAG T AG T AAAGGA C AGAGG C AAG - - - - - - - - T T T T C T G A A - - - 450
14E A T C A C AAAGC T AAG C T T GAG T AG T AAAGGA C AGAGG C AAG - - - - - - - - T T C T C T G A A - - - 454
2E A T C A C AAAGC T AAG C T T GAG T AG T AAAGGA C AGAGG C AAG - - - - - - - - T T C T C T G A A - - - 466
13N A T C A C AAAGC T AAG C T T GAG T AG T AAAGGA C AGAGG C AAG - - - - - - - - T T T T C T G A A - - - 459
10N A T C A C AAAGC T AAG C T T GAG T AG T AAAGGA C AGAGG C AAG - - - - - - - - T T T T C T G A A - - - 460
14N A T C A C AAAGC T AAG C T T GAG T AG T AAAGGA C AGAGG C AAG - - - - - - - - T T T T C T G A A - - - 458
1E A T C A C AAAGC T AAG C T T GAG T AG T AAAGGA C AGAGG C AAG - - - - - - - - T T T T C T G A A - - - 462
11E A T CAC T AAC C T AA T C T T GAA T AG T AAAGGA C AAAGG C AAG - - - - - - - - T T C T C T G A A - - - 454
2N A T C A C AAAGC T AAG C T T GAG T AG T AAAGGA C AGAGG C AAG - - - - - - - - T T C T C T G A A - - - 470
9N A T C A C AAAGC T AAG C T T GAG T AG T AAAGGA C AGAGG C AAG - - - - - - - - T T T T C T G A A - - - 458
6E A T C A C AAAGC T AAG C T T GAG T AG T AAAGGA C AGAGG C AAG - - - - - - - - T T C T C T G A A - - - 468
5N A T C A C AAAGC T AAG C T T GAG T AG T AAAGGA C AGAGG C AAG - - - - - - - - T T T T C T G A A - - - 468
13E C T C T C C AAGC T AA A C T T GAG T AG T AAAGGA C AGAGG C AAG - - - - - - - - T T C T C T G A A - - - 460
16N A T C A C AAAGC T AA T C T T GAG T AG T AAAGGA C AGAGG C AAG - - - - - - - - T T T T C T G A A - - - 455
1N A T C A C AAAGC T AA T C T T GAG T AG T AAAGGA C AGAGG C AAG - - - - - - - - T T C T C T G A A - - - 458
4E A T C A C AAAGC T AA A C T T GAG T AG T AAAGGA C AGAGG C AAG - - - - - - - - T T C T C T G A A - - - 469
4N A T C A C AAAGC T AAG C T T GAG T AG T AAAGGA C AGAGG C AAG - - - - - - - - T T T T C T G A A - - - 465
12N C T C T C T AAGC T T AG C T T GAG T AG T AAA GA C AGAGG C AAG - - - - - - - - T T C T C T G A A - - - 458
3E A T C A C AAAGC T AA A C T T GAG T AG T AAAGGA C AGAGG C AAG - - - - - - - - T T T T C T G A A - - - 464
6N T T C T C T AAG T T AA T C T T GAG T C G T AGAGGA C AGAGG C AAG - - - - - - - - T T C G C T G A A - - - 460
7E - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - G T T - - - 67
5E AGG T T AGGG T T AAAAAGGGG GAA C T GGAA T GGGG C C AAA AGG T T T C C T T C C C T G G A A A A 840
8N - - - - - - - - - - - - - - - - - - - - - - - - - - - - GG C AGAGG - - - - - - - - - - - - - - - - - - - - - - - - 88
8E - - - - - - - - - - - - - - - - - - AG T T GCAAAGT G C - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 94
3N - - - - - - - - - - - - - - - - - - - - - - - - GA C GGG C AAGGG C A A - - - - - - - - - - - - - - - - - - - - - 93
7N - - C AA - GGGA C AA T T T T T A T C T G T AA C GGA C C GGGGAG - - - - - - - - - - - - - - - - - - - - - 451
Consensus A T C A C AAAGC T A AGGT T GA G T A GT A A A GGA C A GA GGC A A G - - - - - - - - T T T T C T GAA - - -
100%
Conservation
0%
Sequence Logo

Sumber: Yueniwati Y., 2012


Gambar 12.25Analisis mutasi basa no -443 pada hasil sekuensing dengan
primer OPN forward

Sumber: Yueniwati Y., 2012


Gambar 12.26Analisis mutasi basa no -443 pada hasil sekuensing dengan
primer OPN reverse

Bab 12 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Variasi Genetika 249
Kemudian, dilakukan perbandingan analisis hasil sekuensing
menggunakan program lain yaitu Sequencher 5.1. Pada program
ini, digunakan persen kemiripan sampel dengan wild type
sebesar 80% untuk dapat disejajarkan. Dengan demikian, tidak
semua sampel dapat disejajarkan pada program ini karena tidak
memenuhi persen minimal kemiripan dengan wild type. Berikut
hasil analisisnya (Gambar 12.27-12.28).
Berdasarkan hasil analisis menggunakan program tersebut,
10 sampel mengalami mutasi pada OPN forward dan 5 sampel
pada OPN reverse. Namun, hanya 4 sampel yang dapat dikatakan
mengalami mutasi yang terdiri dari 3 kelompok kasus dan 1
kelompok kontrol. Perbedaan hasil analisis kedua program
tersebut disebabkan perbedaan pengaturan persen kemiripan
sampel dengan wild type-nya. Namun, kedua program tersebut
menunjukkan mutasi yang sama pada sampel yang sama pula.
Berikut hasil ringkasannya (Yueniwati Y., 2012).

Tabel 12.12Data mutasi sampel promoter OPN T-443C menggunakan


program Sequencher 5.1
Daftar Sampel yang Mengalami Mutasi
OPN Forward (Kelompok) Ketebalan CA-IMT (mm) OPN Reverse (Kelompok)
11 E (S) 0,06 11 E (S)
14 E (S) 0,06 14 E (S)
4 E (S) 0,06 4 E (S)
13 E (K) 0,04 13 E (K)
12 N (S) 7 E (S)
1 N (K)
2 E (K)
2 N (S)
6 E (K)
6N (S)
Sumber: Yueniwati Y., 2012

250 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Page #1
12N # 11 AGCTTGAGTA G T A A A TGAC A GAG G CAAG T T C TCTG AACT C
6N # 11 ATCTTGAGTC G T A G A GGAC A GAG G CAAG T T C GCTG AACT C
11E > # 1> N N A A GGAC A AAG G CAAG T T C TCTG AACT C
1N > # 1> N N A A GGAC A GAG G CAAG T T C TCTG AACT C
9N > # 1> N N A A GGAC A GAG G CAAG T T T TCTG AACT C
14E > # 1> N N A A GGAC A GAG G CAAG T T C TCTG AACT C
16N > # 1> N N A A GGAC A GAG G CAAG T T T TCTG AACT C
6E > # 1> N N A A GGAC A GAG G CAAG T T C TCTG AACT C
13N > # 1> N N A A GGAC A GAG G CAAG T T T TCTG AACT C
13E > # 1> N N A A GGAC A GAG G CAAG T T C TCTG AACT C
4E > # 1> N N A A GGAC A GAG G CAAG T T C TCTG AACT C
2N > # 1> N N A A GGAC A GAG G CAAG T T C TCTG AACT C
5N > # 1> N N A A GGAC A GAG G CAAG T T T TCTG AACT C
12E > # 1> N N A A GGAC A GAG G CAAG T T T TCTG AACT C
11N > # 1> N N A A GGAC A GAG G CAAG T T T TCTG AACT C
Wt > # 1> N N A A GGAC A GAG G CAAG T T T TCTG AACT C
15E > # 1> N N A A GGAC A GAG G CAAG T T T TCTG AACT C
9E > # 1> N N A A GGAC A GAG G CAAG T T T TCTG AACT C
14N > # 1> N N A A GGAC A GAG G CAAG T T T TCTG AACT C
16E > # 1> N N A A GGAC A GAG G CAAG T T T TCTG AACT C
2E > # 1> N N A A GGAC A GAG G CAAG T T C TCTG AACT C
10E > # 1> N N A A GGAC A GAG G CAAG T T T TCTG AACT C
15N > # 1> N N A A GGAC A GAG G CAAG T T T TCTG AACT C
10N > # 1> N N A A GGAC A GAG G CAAG T T T TCTG AACT C
1E > # 1> N N A A GGAC A GAG G CAAG T T T TCTG AACT C

# 11 AKNT GAGTMNG T A A A GGAC A GAG G CAAG T T T TCTG AACT C


++

Sumber: Yueniwati Y., 2012


Gambar 12.27Analisis mutasi basa no -443 pada hasil sekuensing dengan
primer OPN forward
Page #10
Wt reverse #422 A G G A G GT C AG AAA A CTTGC C T C T G TC C TT
12N #422 A G G A G TT C AG AAA A CTTGC C T C T G TC C TT
1E #422 A G G A G TT C AG AAA A CTTGC C T C T G TC C TT
13E #422 A G G A G TT C AG AGA A CTTGC C T C T G TC C TT
14E #422 A G G A G TT C AG AGA A CTTGC C T C T G TC C TT
4E #422 A G G A G TT C AG AGA A CTTGC C T C T G TC C TT
14N #422 A G G A G TT C AG AAA A CTTGC C T C T G TC C TT
16E #422 A G G A G TT C AG AAA A CTTGC C T C T G TC C TT
16N #422 A G G A G TT C AG AAA A CTTGC C T C T G TC C TT
3E #422 A G G A G TT C AG AAA A CTTGC C T C T G TC C TT
11N #422 A G G A G TT C AG AAA A CTTGC C T C T G TC C TT
10E #422 A G G A G TT C AG AAA A CTTGC C T C T G TC C TT
9E #422 A G G A G TT C AG AAA A CTTGC C T C T G TC C TT
12E #422 A G G A G TT C AG AAA A CTTGC C T C T G TC C TT
15N #422 A G G A G TT C AG AAA A CTTGC C T C T G TC C TT
13N #422 A G G A G TT C AG AAA A CTTGC C T C T G TC C TT
15E #422 A G G A G TT C AG AGA A CTTGC C : C T G TC C TT
7E #422 A G G A G TT C AG AGA A CTTGC C T C T G TC C TT

#422 A G G A G TT C AG AAA A CTTGC C T C T G TC C TT

Sumber: Yueniwati Y., 2012


Gambar 12.28Analisis mutasi basa no -443 pada hasil sekuensing dengan
primer OPN reverse

Bab 12 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Variasi Genetika 251
12.3.7 Uji kekuatan hubungan kelompok mutasi dan
nonmutasi terhadap ketebalan intima media
arteri karotis serta hubungan profil lipid, indeks
massa tubuh dan glukosa puasa terhadap
peningkatan ketebalan intima media arteri karotis
Pada uji ini didapatkan hasil bahwa variasi genetika tidak
bermakna sebagai faktor risiko peningkatan ketebalan intima media
arteri karotis. Kolesterol total, indeks massa tubuh serta glukosa
puasa juga tidak bermakna sebagai faktor risiko peningkatan
ketebalan intima media arteri karotis (YueniwatiY.,2014).
Pada penelitian ini didapatkan 6 sampel mengalami mutasi
yang terdiri dari 4 kelompok kasus dan 2 kelompok kontrol dengan
deskripsi sebagai berikut (Yueniwati Y., 2014).
1. Sampel kelompok kasus yang mengalami variasi genetika
T-443C adalah anak laki-laki berusia 18 tahun dengan orang
tua stroke iskemia. Sampel mempunyai nilai indeks massa
tubuh sebesar 29,2 kg/m2 yang termasuk dalam kategori
overweight (WHO). Nilai kolesterol LDL adalah 110 mg/dL
yang menunjukkan anak tersebut dislipidemia. Sementara
itu, hasil pengukuran ketebalan rata-rata intima media arteri
karotisnya adalah 0,06 mm.
2. Sampel kelompok kasus yang juga mengalami variasi genetika
T-443C adalah anak laki-laki usia 18 tahun. Nilai indeks massa
tubuh normal yaitu 22,2 kg/m2. Nilai kolesterol normal dengan
ketebatalan rata-rata intima media arteri karotis 0,06 mm.
3. Sampel kelompok kasus berikutnya adalah anak perempuan
berusia 11 tahun dengan nilai indeks massa tubuh 17,26 kg/m2
yang termasuk dalam kategori underweight. Nilai trigliserida
lebih tinggi dari normal yaitu 170 mg/dL. Ketebalan rata-rata
intima media arteri karotis 0,06 mm.
4. Sampel kelompok kasus yang terakhir adalah anak laki-
laki usia 15 tahun. Indeks massa tubuh sebesar 18,4 kg/m2
(underweight) dengan nilai ketebalan rata-rata intima media
arteri karotis 0,05 mm.
5. Sampel kelompok kontrol adalah anak laki-laki berusia 19
tahun dengan nilai indeks massa tubuh 17,9 kg/m2 yang

252 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


masuk dalam kategori underweight. Nilai rata-rata ketebalan
sampel ini adalah 0,04 mm.
6. Sampel kelompok kontrol yang juga mengalami mutasi adalah
anak perempuan usia 20 tahun. Indeks massa tubuhnya
adalah 21,2 kg/m2 sehingga masuk dalam kategori normal.
Nilai rata-rata ketebalan intima media arteri karotisnya
adalah0,045mm.

Berdasarkan hasil tersebut, dapat dilihat 4 dari 6 sampel yang


mengalami variasi genetika adalah sampel kelompok kasus yang
memiliki ketebalan intima media arteri karotis lebih tebal daripada
2 kelompok kontrol yang juga mengalami variasi genetika.
Berdasarkan nilai ketebalan intima media arteri karotis ini, dapat
dikatakan bahwa anak dengan orang tua yang memiliki riwayat
stroke iskemia mempunyai intima media arteri karotis yang lebih
tebal daripada rata-rata ketebalan intima media arteri karotis pada
anak dengan rentang usia sama yaitu 0,05 mm (Urbina etal., 2009).
Hal ini sesuai dengan hasil penelitian terdahulu yang menyebutkan
bahwa variasi genetika promoter osteopontin T-443C memiliki
efek yang signifikan terhadap peningkatan ketebalan intima
media arteri karotis akibat gangguan aktivitas transkripsi gen
osteopontin (Brenner etal., 2006).
Adanya variasi genetika T-443C di daerah promoter
osteopontin menyebabkan terjadinya pengikatan faktor transkripsi
MYT1 dengan motif zinc finger pada daerah promoter. Pengikatan
faktor transkripsi ini menyebabkan afinitas ikatan RNA polimerase
terhadap promoter meningkat sehingga aktivitas transkripsinya
juga meningkat. Akibatnya, terjadi overekspresi OPN yang
menyebabkan proliferasi otot polos pembuluh darah terjadi lebih
dini dan cepat. Akibatnya, penyempitan dan pengerasan pembuluh
darah juga terjadi lebih cepat yang menyebabkan terjadinya
penurunan pasokan darah ke berbagai organ, khususnya otak.
Penurunan pasokan darah yang mengandung oksigen ke otak inilah
yang menyebabkan terjadinya stroke iskemia (YueniwatiY.,2014).
Dua sampel lain yang juga mengalami variasi genetika
merupakan sampel kelompok kontrol yang pada penelitian ini

Bab 12 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Variasi Genetika 253
diharapkan tidak terjadi variasi genetika. Hal ini dapat disebabkan
oleh kondisi lain yang juga ditandai dengan terjadinya variasi
genetika promoter osteopontin T-443C. Antara lain riwayat infark
miokard pada orang tua, obesitas dan kanker (Sase etal., 2012).
Selain itu, beberapa penelitian terdahulu menjelaskan bahwa
variasi genetika promoter osteopontin T-443C yang menyebabkan
peningkatan aktivitas transkripsi pada promoter sehingga terjadi
overekspresi OPN plasma tidak selalu berhubungan dengan
peningkatan ketebalan intima media arteri karotis namun juga
berhubungan dengan beberapa kondisi lain seperti penyakit lupus
erythematosis, multiple sclerosis, urolithiasis, dan primary biliary
cirrhosis (Chiocchetti, 2004).
Overekspresi OPN juga ditemukan pada beberapa kondisi
seperti arthritis kronis, infark myokard, fibrosis intersisial pada
ginjal akibat obstruksi uropati, dan pada proses penyembuhan
luka sebagai salah satu fungsi fisiologis OPN (Giacopelli et al.,
2004). Berdasarkan hasil penelitian tersebut maka variasi genetika
promoter osteopontin T-443C yang terjadi pada kelompok kontrol
dimungkinkan berhubungan dengan kondisi lain seperti yang
telah disebutkan. Dengan demikian, kelompok kontrol yang juga
mengalami variasi genetika promoter osteopontin T-443C tidak
mengalami peningkatan ketebalan intima media arteri karotis
(Yueniwati Y., 2014).

12.3.8 Pengaruh variasi genetika promoter osteopontin


T-443C terhadap ketebalan intima media arteri
karotis
Osteopontin merupakan protein yang memediasi berbagai
macam fungsi biologis dan memiliki peranan dalam patogenesis
beberapa penyakit seperti kanker, aterosklerosis dan inflamasi
kronis (Susan etal., 2009). OPN terekspresi di sel otot polos
endotel angiogenik dan makrofag pada lesi aterosklerosis. OPN
memodulasi proliferasi, migrasi dan akumulasi sel otot polos
dan endotel yang terlibat dalam proses repair dan remodelling
vaskulatur.

254 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


OPN juga berperan penting dalam pengaturan deposisi
mineral arteri pada kondisi injury dan penyakit vaskular. OPN
memiliki efek antipengerasan (antikalsifikasi) pembuluh darah
dan mampu meningkatkan reposisi mineral (Singh etal.,2007).
Hal ini menunjukkan bahwa adanya ekspresi OPN pada plak
aterosklerosis dapat menjadi penanda terhadap tingkat keparahan
aterosklerosis serta pengerasan (kalsifikasi) yang terjadi (Sase
etal., 2012).
Tingginya konsentrasi osteoprotegerin (OPG) dan osteopontin
(OPN) menunjukkan besarnya potensi plak aterosklerosis menjadi
plak yang tidak stabil (Golledge etal., 2004; Huang etal., 2001;
Sase etal., 2012). Kedua protein tersebut berhubungan dengan
dekalsifikasi arteri, proses yang menyebabkan terjadinya ruptur
plak aterosklerosis (Huang etal., 2001; Sase etal., 2012).
Variasi genetika yang diteliti pada penelitian ini adalah adanya
Single Nucleotide Polymorphism (SNP) pada basa ke -443 berupa
substitusi basa timin menjadi sitosin. Variasi genetika promoter
Osteopontin T-443C merupakan salah satu faktor genetika yang
diduga memiliki hubungan dengan ketebalan intima media
arterikarotis (Yueniwati Y., 2014).
Basa ke -443 ini adalah situs promoter yang merupakan bagian
dari DNA tempat dimulainya transkripsi. Transkripsi terjadi ketika
sekuen promoter berikatan dengan RNA Polymerase II. Variasi
genetika T-443C menyebabkan terjadinya penempelan faktor
yang tidak diketahui pada sekuen promoter yang menyebabkan
terjadinya overekspresi OPN (Giacopelli etal., 2004). Masih dalam
penelitian yang sama, Giacopelli menduga bahwa faktor transkripsi
yang menempel pada sekuen promoter OPN ini MYT1 dengan
motif zinc finger yang banyak terlibat dalam proses neurogenesis.
Zinc finger merupakan salah satu motif yang memediasi
pengikatan protein regulator terhadap DNA. Dengan demikian,
protein regulator dapat berikatan secara spesifik dengan afinitas
tinggi yang dapat meningkatkan aktivitas transkripsi (Murray
etal.,2003).

Bab 12 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Variasi Genetika 255
Pada beberapa penelitian sebelumnya, disebutkan bahwa
variasi genetika promoter osteopontin T-443C memiliki hubungan
yang signifikan dengan ketebalan intima media arteri karotis.
Penelitian yang dilakukan oleh Brenner etal. pada tahun 2006
menyatakan bahwa pasien dengan genotipe T pada basa ke
-443 memiliki rata-rata CCA-IMT lebih rendah daripada pasien
dengan alel C dan diketahui bahwa alel -443C memiliki efek yang
signifikan terhadap peningkatan IMT. Uji yang digunakan adalah
analisis multivariate dan ditemukan terdapat hubungan yang
kuat antara alel OPN -443C dengan peningkatan ketebalan carotid
intima media (p<0,001). Penebalan intima media arteri karotis
ini terbukti memiliki hubungan dengan peningkatan faktor risiko
stroke iskemia (Brenner etal., 2006). Selain itu, ketebalan intima
media arteri karotis juga meningkat pada anak dengan orang tua
yang memiliki riwayat infark myokard yang dapat dideteksi pada
usia 5-12 tahun (Barra, 2009).
Overekspresi OPN tidak hanya berhubungan dengan
terjadinya penebalan intima media arteri karotis saja. Namun,
ada kondisi lain yang juga ditandai oleh overekspresi OPN. Pada
penelitian yang dilakukan oleh Chiocetti, 2004 dijelaskan bahwa
variasi genetika OPN juga berhubungan dengan penyakit lupus
erythematosis, multiple sclerosis, urolithiasis, dan primary biliary
cirrhosis. Selain itu, peningkatan ekskresi OPN juga terjadi pada
kondisi obesitas, kanker ovarium, payudara, prostat, paru dan
pankreas (Sase, 2012). Overekspresi OPN juga ditemukan pada
beberapa kondisi seperti arthritis kronis, infark myokard, fibrosis
intersisial pada ginjal akibat obstruksi uropati, dan pada proses
penyembuhan luka (Giacopelliet al., 2004). Overekspresi OPN ini
juga dapat menjadi prediktor risiko terjadinya aterosklerosis pada
pasien dengan hipertensi esensial (Kurata, 2006).
Selain dipengaruhi oleh faktor genetika, ketebalan intima-
media arteri karotis juga dapat dipengaruhi oleh faktor lain seperti
umur, kadar kolesterol, tekanan darah serta riwayat hipertensi
dan penyakit kardiovaskular lain yang pernah diderita. Dengan
demikian, perlu dilakukan uji korelasi antara confounding factor
tersebut dengan ketebalan intima media arteri karotis. Peningkatan

256 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


ketebalan intima media arteri karotis juga ditemukan pada anak
serta orang dewasa muda usia 5-30 tahun dengan riwayat orang
tua penderita infark miokard (Cuomo, 2002).
Berdasarkan hasil uji analisis statistik, tidak ada korelasi
antara indeks massa tubuh, kadar glukosa darah, kolesterol total,
tekanan darah sistolik dan diastolik dengan ketebalan intima-
media arteri karotis. Hal ini menunjukkan bahwa ada kemungkinan
pengaruh faktor genetika terhadap peningkatan ketebalan intima
media arterikarotis (Yueniwati Y., 2014).
Untuk mengetahui ada tidaknya hubungan antara faktor
genetika dengan ketebalan intima media arteri karotis maka
perlu dilakukan uji lebih lanjut. Sebelumnya, perlu dilakukan uji
komparasi ketebalan intima media arteri karotis kelompok kasus
dan kontrol yang hasilnya tidak ada perbedaan ketebalan intima
media arteri karotis yang signifikan antara anak populasi Jawa
dengan orang tua stroke iskemia dengan anak populasi Jawa
dengan orang tua sehat (YueniwatiY.,2014).
Selanjutnya, dilakukan analisis deskriptif keberadaan variasi
genetika promoter osteopontin T-443C pada masing-masing
kelompok sampel. Hasilnya, 4 dari 6 sampel yang mengalami
mutasi adalah sampel kasus (anak populasi Jawa dengan orang tua
stroke iskemia). Sementara itu, 2 sampel lain yang juga mengalami
mutasi merupakan sampel kelompok kontrol. Hal ini dapat
disebabkan oleh kondisi lain selain peningkatan ketebalan intima-
media arteri karotis yang juga ditandai dengan terjadinya variasi
genetika promoter osteopontin T-443C, antara lain riwayat infark
miokard pada orang tua, obesitas, dan kanker (YueniwatiY.,2014).
Berikutnya adalah uji hipotesis kedua yang menyatakan ada
hubungan antara variasi genetika promoter osteopontin T-443C
pada anak populasi Jawa dengan orang tua stroke iskemia terhadap
penebalan intima media arteri karotis. Hasilnya, tidak terdapat
perbedaan nilai rata-rata ketebalan intima media arteri karotis
antara kelompok mutasi dan non mutasi. Uji ini dilanjutkan untuk
mengetahui kekuatan hubungannya. Hasilnya, variasi genetika

Bab 12 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Variasi Genetika 257
T-443C tidak bermakna sebagai faktor risiko terjadinya penebalan
intima media arteri karotis (YueniwatiY.,2014).
Selain itu, hasil analisis antara profil lipid, indeks massa tubuh
dan kadar glukosa puasa terhadap ketebalan intima media arteri
karotis yang menyatakan bahwa ketiga faktor tersebut tidak
bermakna sebagai faktor risiko terjadinya penebalan intima media
arteri karotis. Hal ini berlawanan dengan teori yang menyatakan
ada hubungan yang signifikan antara variasi genetika T-443C
dengan penebalan intima media arteri karotis. Meskipun demikian,
berdasarkan hasil analisis deskriptif, terdapat kecenderungan
penebalan intima media arteri karotis pada sampel kasus (anak
populasi Jawa dengan orang tua stroke iskemia) yang mengalami
variasi genetika promoter osteopontin T-443C, meskipun tidak
bermakna secara statistik (YueniwatiY.,2014).
Kelemahan utama yang dapat menjadi faktor penyebab
ketidaksesuaian hasil penelitian dengan hipotesa yang telah
diajukan adalah jumlah sampel yang kurang representatif sehingga
analisis statistik yang dilakukan juga kurang kuat. Selain itu,
beberapa hasil sekuensing yang didapatkan tidak sesuai dengan
ukuran basa yang diinginkan sehingga ada beberapa sampel
yang lokasi mutasinya tidak dapat dilihat. Akibatnya, tidak dapat
ditentukan apakah sampel tersebut mengalami mutasi atau tidak.
Kemudian perbedaan mutasi yang terjadi antara sampel forward
dan reverse juga menjadi salah satu faktor yang melemahkan
penelitian ini. Mutasi yang tidak sama antara forward dan
reverse tidak dapat dinyatakan sebagai mutasi karena tidak valid.
Perbedaan mutasi ini disebabkan oleh jumlah pasang basa yang
berbeda antara forward dan reverse sehingga cakupan lokasi yang
dapat dianalisa pun terbatas. Hal tersebut dapat disebabkan oleh
penempelan primer terhadap DNA template yang kurang sempurna
pada saat dilakukan sekuensing (YueniwatiY.,2014).
Namun, ketidaksesuaian ini dapat menjadi peluang dilaku
kannya penelitian terhadap variabel lain yang juga dipengaruhi
oleh variasi genetika promoter osteopontin T-443C, misalnya
penyakit kanker. Pada penelitian yang dilakukan oleh Lee etal.,
2013 ditemukan bahwa kombinasi polimorfisme promoter

258 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


osteopontin SNP -443 (T/C atau C/C) dan SNP -616 (T/T atau T/G)
memiliki hubungan yang sangat signifikan dengan gastric cancer
(OR=3,95; 95% CI: 1.58-9,90). Artinya, polimorfisme tersebut
bermakna sebagai faktor risiko terjadinya gastric cancer. Penelitian
lain juga menyebutkan bahwa survival rate pasien gastric cancer
dengan alel C pada promoter osteopontin -443 jauh lebih rendah
daripada pasien dengan alel T. Ada perbedaan aktivitas promoter
osteopontin yang signifikan antara pasien dengan gastric cancer
stage IV dan stage II dengan nilai p = 0,013 (Fujun etal., 2012).
Selain di daerah basa -443, variasi genetika pada basa ke -156
dan -66 juga dilaporkan dapat meningkatkan ketebalan intima
media arteri karotis secara signifikan. Mutasi yang terjadi pada basa
ke -156 adalah insersi satu basa guanin, sedangkan pada basa ke
-66 adalah substitusi basa timin oleh guanin (YueniwatiY.,2014).

12.3.9 Peranan osteopontin sebagai neuroprotektif pada


stroke iskemia
Osteopontin (OPN) adalah protein multifungsi yang memiliki
fungsi biologis berkebalikan. Selain berperan dalam proses
inflamasi, migrasi sel dan proses apoptosis, OPN juga berperan
sebagai agen neuroprotektif potensial untuk stroke iskemia akut.
Dalam penelitian yang dilakukan oleh Meller etal. tahun 2005,
dinyatakan bahwa osteopontin dapat mengurangi kematian sel
pada stroke iskemia secara signifikan pada penelitian in vitro
maupun in vivo. Saat OPN eksogen diadministrasikan pada tikus
model stroke, didapatkan hasil bahwa OPN dapat menginduksi
marker protektif yang melawan kerusakan sel pada stroke iskemia.
Efek neuroprotektif OPN ini dimediasi melalui jalur PI3K/Akt
dan diaktivasi melalui kaskade p42/44 MAPK. Aktivasi dari Akt
dan p24/44 MAPK ini dapat meningkatkan fosforilasi Bad (protein
yang berfungsi sebagai pro cell death). Efek ini dihambat oleh
inhibitor reseptor integrin RGD (arginine-glysine-aspartate) yang
menandakan bahwa efek neuroprotektif terjadi melalui ikatan OPN
dengan reseptor integrin (Meller etal., 2005). Aktifasi integrin
pada sel saraf akan meningkatkan toleransi sel saraf terhadap
toksisitas glutamat (Meller etal., 2005). Penelitian sebelumnya
Bab 12 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Variasi Genetika 259
melaporkan bahwa OPN dapat mengaktifasi beberapa mekanisme
cell survival, antara lain menurunkan induksi sintesis nitric oxide
(Denhardt etal., 1995), meningkatkan aktivitas NF-k (Das etal.,
2003), dan meningkatkan aktifasi PI3K (Zheng etal., 2000).
Berdasarkan hasil penelitian tersebut, OPN dapat berperan
sebagai agen neuroprotektif yang mampu memberikan efek terapi
pada pengobatan stroke iskemia. Namun, penggunaannya dapat
terhambat masalah rute pemakaian, di mana hanya protein-
protein tertentu sajalah yang dapat diadministrasikan secara
langsung ke otak sehingga dibutuhkan penelitian lebih lanjut
(YueniwatiY.,2014).
Penelitian tentang OPN mimetik yang memiliki kemiripan
struktur serta mampu meningkatkan potensi dan efek
farmakokinetiknya dapat dijadikan sebagai salah satu inovasi
dalam pengembangan OPN sebagai agen terapetik pada stroke
iskemia. Oleh karena itu, OPN ataupun analog OPN dapat menjadi
inovasi desain obat yang efektif pada pengobatan stroke iskemia
(Meller etal., 2005).
Berdasarkan hasil penelitian deteksi variasi genetika promoter
osteopontin T-443 pada anak populasi Jawa dengan orang tua
stroke iskemia serta pengaruhnya terhadap ketebalan intima
media arteri karotis maka dapat diperoleh hasil sebagai berikut.
Pertama, ditemukan variasi genetika promoter osteopontin
T-443C pada anak populasi Jawa dengan orang tua stroke iskemia.
Kedua, variasi genetika promoter osteopontin T-443C pada anak
populasi Jawa dengan orang tua stroke iskemia merupakan salah
satu faktor risiko terjadinya peningkatan ketebalan intima media
arterikarotis (YueniwatiY.,2014).
Penelitian lanjutan yang diharapkan dari hasil penelitian
ini antara lain pertama, perlu dilakukan pengukuran kadar
osteopontin dalam plasma sebagai fenotipe variasi genetika
promoter osteopontin T-443C. Kedua, perlu dilakukan penelitian
lebih lanjut terhadap faktor lain yang berhubungan dengan variasi
genetika promoter osteopontin T-443C seperti riwayat infark
miokard pada orang tua, obesitas, dan proliferasi sel kanker. Ketiga,

260 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


perlu dilakukan penelitian lebih lanjut terkait fungsi fisiologis
OPN yang sangat luas sehingga dapat ditemukan potensi OPN
sebagaiterapi (YueniwatiY.,2014).

12.4 Variasi Genetika Insersi G-156GG Promoter


OPN pada Anak Populasi Jawa dengan
Orang Tua Stroke Iskemia
Berbagai penelitian untuk mengetahui metode deteksi dini
variasi genetika pada penyakit stroke iskemia terus dilakukan.
Salah satu penelitian yang dilakukan yaitu deteksi variasi genetika
insersi G-156GG promoter osteopontin pada anak populasi Jawa
dengan orang tua stroke iskemia. Sampel penelitian ini diperoleh
dari hasil penelitian sebelumnya (Yueniwati, 2010). Sampel
kelompok kasus adalah anak kandung penderita stroke iskemia
populasi Jawa berumur 10-21 tahun yang pernah atau sedang
dirawat di Bagian Neurologi RS dr. Saiful Anwar Malang dan atau
berobat di Poliklinik Neurologi di RS dr. Saiful Anwar Malang.
Kelompok kontrol adalah anak populasi Jawa dengan orang
tua sehat. Jumlah sampel kelompok kasus adalah 19 orang dan
kelompok kontrol adalah 13 orang (YueniwatiY.,2014).
Pada kelompok kasus terdapat 10 orang laki-laki (52,63%)
dan 9 orang perempuan (47.37%), sedangkan pada sampel kontrol
terdapat 9 orang laki-laki (69.23%) dan 4 orang perempuan
(30,77%). Semua orang tua yang termasuk di dalam kelompok
kasus mengalami serangan stroke iskemia pada umur 50
tahun, usia termuda yang mengalami serangan stroke adalah 29
tahun, ada 76% kasus ayah yang menderita stroke iskemia dan
30% orang tua mengalami serangan stroke lebih dari satu kali
(YueniwatiY.,2014).
Pada semua sampel dilakukan pengukuran berat badan, tinggi
badan, indeks massa tubuh dan tekanan darah. Dilakukan pula
pemeriksaan laboratorium yang terdiri dari pengukuran kadar
gula darah puasa, kadar kolesterol total, trigliserida, LDL, dan HDL.
Diperiksa pula ketebalan intima media arteri karotis kanan, intima
media arteri karotis kiri, intima media arteri karotis kanan dan kiri

Bab 12 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Variasi Genetika 261
serta diameternya dengan menggunakan ultrasonografi. Setelah
itu, dilakukan analisa genotyping yang sebelumnya diawali dengan
optimasi dan perbanyakan DNA target dengan PCR kemudian
dilakukan sekuensing (YueniwatiY.,2014).

12.4.1 Karakteristik sampel penelitian


Karakteristik sampel penelitian diperlihatkan pada tabel
berikut ini.
Tabel 12.13 Karakteristik sampel penelitian
Pemeriksaan Kasus Kontrol p value
Umur (tahun) 19.13 12.65 0.041
Tinggi badan (cm) 161,76 163,73 0.608
(7.59) 12.07)
Berat badan (kg) 58.82 53.20 0.330
(13.71) (16.87)
Indeks massa tubuh (kg/m2) 22.37 19.44 0.057
(4.28) (3.95)
Tekanan darah sistolik 118,95 115,00 0.357
(12.42) (11.18)
Tekanan darah diastolik 17.55 14.96 0.397
Independent samples t tests

Dari tabel di atas dapat disimpulkan bahwa pada variabel tinggi


badan, berat badan, body mass indeks, tekanan darah sistolik dan
diastolik tidak ada perbedaan yang signifikan antara sampel kontrol
dan kasus. Sementara itu, untuk umur dapat disimpulkan bahwa
ada perbedaan yang signifikan antara sampel kontrol dankasus
(YueniwatiY.,2014).
Pada kelompok kasus terdapat 10 (52,63%) laki-laki dan 9
(47.37%) perempuan, sedangkan pada sampel kontrol terdapat
9 (69.23%) laki-laki dan 4 (30,77%) perempuan. Distribusi
berdasarkan jenis kelamin dapat dilihat pada diagram pada
Gambar12.29-12.30 (YueniwatiY.,2014).
Berikut adalah karakteristik data hasil pemeriksaan
laboratorium (YueniwatiY.,2014).

262 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Tabel 12.14 Hasil laboratorium
Pemeriksaan Kasus Kontrol p value
Glukosa puasa (mg/dl) 81.89 (12.93) 79.31 (5.31) 0.442
Kolesterol total (mg/dl) 183.11 (39.02) 158.15 (23.57) 0.032
Kolesterol LDL 112.58 (33.24) 88.46 (19.22) 0.015
Kolesterol HDL 50.89 (8.12) 58.85 (12.80) 0.062
Trigliserida 115.74 (61.10) 64.62 (20.80) 0.003
Independent samples tests

Histogram
untuk kelompok = kasus
10 Mean = 1.47
Std. Dev. = 0.513
N = 19
8
Frekuensi

0
0.5 1.00 1.50 2.00 2.50
Jenis kelamin
Sumber: Yueniwati Y., 2014
Gambar 12.29Distribusi sampel berdasarkan jenis kelamin pada sampel
kasus (kanan: laki- laki, kiri: perempuan)

Histogram
untuk kelompok = kontrol
10

8 Mean = 1.31
Std. Dev. = 0.48
N = 13
Frekuensi

0
0.5 1.00 1.50 2.00 2.50
Jenis kelamin
Sumber: Yueniwati Y., 2014
Gambar 12.30Distribusi sampel berdasarkan jenis kelamin pada sampel
kontrol (kanan: laki- laki, kiri: perempuan)

Bab 12 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Variasi Genetika 263
Berdasarkan data di atas, dapat diketahui bahwa pada
kolesterol total, kolesterol LDL, dan trogliserida terdapat perbedaan
yang signifikan antara data kasus dan kontrol. Selanjutnya, glukosa
puasa dan kolesterol HDL menunjukkan tidak terdapat perbedaan
yang signifikan antara kasus dan kontrol (YueniwatiY.,2014).

12.4.2 Ketebalan intima media arteri karotis


Data ketebalan intima media arteri karotis diperoleh dengan
menggunakan ultrasonografi B mode resolusi tinggi. Pemeriksaan
dilakukan pada arteri karotis kommunis kanan dan kiri, diukur
ketebalannya dan diameter arteri karotisnya. Data tersebut
kemudian dihitung rata-ratanya. Hasilnya adalah sebagai berikut
(YueniwatiY.,2014).

Tabel 12.15 Hasil pemeriksaan ultrasonografi

Pemeriksaan Kasus Kontrol p value


Mean ketebalan intima media kanan (mm) 0.57 (.012) 0.60 (0.018) 0.513
Mean ketebalan intima media kiri (mm) 0.56 (.012) 0.58 (0.024) 0.794
Mean ketebalan intima media kanan dan 0.56 (.010) 0.59 (0.018) 0.602
kiri (mm)
Mean diameter karotis kanan (mm) 6.37 (.0062) 6.515 (0.014) 0.488
Mean diameter karotis kiri 6.37 (.0050) 6.515 (0.047) 0.177
Independent samples tests

Berdasarkan data di atas dapat diketahui, mean ketebalan


intima media kanan, kiri, diameter kanan serta diameter kiri
menunjukkan tidak terdapat perbedaan yang signifikan antara
kasus dan kontrol (YueniwatiY.,2014).
Selanjutnya, dilakukan komparasi kelompok kasus kontrol
berdasarkan jenis kelamin, sebagai berikut (YueniwatiY.,2014).

Tabel 12.16 Komparasi kelompok kontrol kasus anak perempuan

Pemeriksaan Kasus Kontrol p value


Mean ketebalan intima media 0.59 (0.014) 0.05 (0.0115) 0.269
kanan kiri (mm)
Kolesterol total (mg/dl) 195.22 (44.72) 173.25 (22.76) 0.267

264 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Pemeriksaan Kasus Kontrol p value
Kolesterol LDL 116.67 (39.64) 95.00 (14.49) 0.179
Kolesterol HDL 57.44 (4.71) 64.00 (17.94) 0.521
Trigliserida 133.56 (66.88) 79.75 (12.41) 0.045
Indeks massa tubuh (kg/m2) 21.09 (2.97) 16.57 (2.26) 0.018
Independent samples tests

Berdasarkan data di atas, dapat diketahui bahwa mean


ketebalan intima media kanan kiri, kolesterol total, kolesterol LDL,
dan HDL menunjukkan tidak terdapat perbedaan yang signifikan
antara data kasus dan kontrol. Selanjutnya trigliserida dan indeks
massa tubuh menunjukkan terdapat perbedaan yang signifikan
antara kasus dan kontrol (YueniwatiY.,2014).

Tabel 12.17 Komparasi kelompok kontrol kasus anak laki-laki


Pemeriksaan Kasus Kontrol p value
Mean ketebalan intima media 0.054(0.005) 0.063 (0.019) 0.191
kanan kiri (mm)
Kolesterol total (mg/dl) 172.20 (31.42) 151.44 (21.77) 0.111
Kolesterol LDL 108.90 (27.97) 85.55 (21.08) 0.055
Kolesterol HDL 45 (5.54) 56.55 (10.29) 0.011
Trigliserida 99.70 (53.74) 57.88 (20.64) 0.042
Indeks massa tubuh (kg/m2) 23.52 (5.07) 20.71 (3.94) 0.194
Independent samples t tests

Berdasarkan data di atas, dapat diketahui, mean ketebalan


intima media kanan kiri, kolesterol total, kolesterol LDL, dan
indeks massa tubuh menunjukkan tidak terdapat perbedaan yang
signifikan antara data kasus dan kontrol. Selanjutnya, trigliserida
dan HDL menunjukkan terdapat perbedaan yang signifikan antara
kasus dan kontrol (YueniwatiY.,2014).
Selain variasi genetika, terdapat kemungkinan lain penyebab
terjadinya penebalan intima media arteri karotis. Untuk mencegah
kemungkinan pengaruh dari faktor-faktor tersebut, maka
ditentukan confounding factor yang dinilai berpengaruh terhadap
ketebalan intima media arteri karotis yakni diabetes melitus
dengan parameter glukosa puasa, dislipidemia dengan parameter
profil lipid, dan obesitas dengan parameter indeks massa tubuh.

Bab 12 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Variasi Genetika 265
Tabel 12.18 Komparasi ketebalan intima media arteri karotis dengan
faktor pengganggu
Pemeriksaan 0.05 mm < 0.05 mm p value
Umur (tahun) 18.68 16.40 0.903
Tinggi badan (cm) 1.5736E2 1.6402E2 0.113
Berat badan (kg) 54.7143 57.0460 0.780
(20.00803) (13.85824)
Indeks massa tubuh (kg/m2) 21.5343 (5.69855) 21.0768 (4.01922) 0.847
Tekanan darah sistolik 1.1283E2 1.1860E2 0.305
Tekanan darah diastolik 13.50 17.34 0.291
Glukosa puasa (mg/dl) 77.42 (6.02) 81.80 (11.32) 0.189
Kolesterol total (mg/dl) 182.24 (32.09) 170.32 (36.45) 0.411
Kolesterol LDL 107.14 (26.17) 52.58 (9.49) 0.644
Kolesterol HDL 59.71 (14.13) 52.58 (9.49) 0.245
Trigliserida 85.85 (56.92) 97.52 (54.92) 0.640
Independent samples t tests

Berdasarkan data di atas, dapat diketahui mean ketebalan


intima media kanan kiri, kolesterol total, kolesterol LDL,
trigliserida, HDL, indeks massa tubuh, tinggi badan, berat badan,
tekanan darah sistolik dan diastolik menunjukkan tidak terdapat
perbedaan yang signifikan antara data ketebalan intima media
normal dan tidak (YueniwatiY.,2014).

12.4.3 Hasil Analisis Genotyping Polimorfisme


Osteopontin (OPN)
Bagian dari gen target pengkode promoter osteopontin
diamplifikasi dengan primer spesifik yang mengenali bagian
promoter pada nukleotida -917 hingga +94. Dari penjelasan
tersebut dapat kita ketahui panjang basa yang akan diamplifikasi
adalah sebanyak 1011 pasang basa, yaitu basa -917 hingga
basa +94, sehingga setelah dilakukan elektroforesis diharapkan
diperoleh pita pada panjang basa 1000 bp (YueniwatiY.,2014).
Hasil analisis migrasi sampel DNA memperlihatkan beberapa
sampel mempunyai pita yang tebal. Pita tebal ini menunjukkan
kuantitas DNA. Semakin tebal pita maka semakin banyak molekul
DNA pada sampel tersebut. Adapun posisi pita menunjukkan besar

266 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


molekul DNA, semakin dekat pita dengan sumuran, semakin besar
molekul DNA sampel tersebut (YueniwatiY.,2014).
Dalam penelitian ini, terdapat sampel dengan pita yang tebal.
Hal ini baik karena menandakan bahwa sampel masih mengandung
molekul DNA dan bisa digunakan pada tahapan selanjutnya yaitu
amplifikasi DNA. Sampel dengan pita yang tipis menandakan
kondisi DNA kemungkinan tidak cukup stabil karena telah
disimpan dalam waktu lama atau terjadi degradasi molekul DNA
saat proses isolasi. Posisi semua sampel dekat dengan sumuran
yang menandakan molekul DNA yang panjang(YueniwatiY.,2014).

123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890
88895758 agaaatttttaaaaatgtttttctttttaagtggcctactttacataccttgggagaaaaactagaaaaaaagatgattccaaaatcgaa
88895848 tctgttcctttagaaatgtgcaaaatttccttattgatgcatacaatttaaagatcttacgtctactctcattttaataacctgttcttt
88895938 Taaaggacattacaattcgtgactgcctgcccctcttaaaaatttcataatagttaacacacatatagtccttaagatacgcagagcatt
88896028 Tgcatctaatatgtgctaagcattgctagtttaacatactaattcatttaaacccctcaaaaaccccatgacctaggtaatagtattgca
88896118 Tttcatggatgagggaacaaggataggtaggctgggcgatttgcccaaggttgcacaggtcagcagtgacacagcggaattcagaaccac
88896208 ggtctggctcctgaagcagccctctcaagcagtcatcctgctctcagtcagaaactgctttacttctgcaacatctagaataaattacca
88896298 Ttcttctatttcatatagaattttatattttaatgtcactagtgccatttgtctaagtaacaagctactgcatactcgaaatcacaaagc
88896388 taagcttgagtagtaaaggagagacccaacttttctgaactccttgcaggcttgaacaatagccttctggctcttcaataagtacaatca
88896478 tacaggcaagagtggttgcagatattacctttatgttacttaaaccgaaagaaacaaaaatccattctatttaattttacattaatgttt
88896568 ttccctactttctccctttttcatgggatccctaagtgctcttcctggargcrgaatgcccatcccgtaaatgaaaaagctagttaatga
88896658 TattgtacataagtaatgttttaactgtagattgtgtgtgtgcgtttttgtttttttttgTTTTaaccacaaaaccagagggggaagtgt
88896748 gggagcaggtgggctgggcagtggcagaaaacctcatgacacaatctctccgcctccctgtgttggtggaggatgtctgcagcagcattt
88896838 aaattctgggagggcttggttgtcagcagcagcaggaggaggcagagcacagcatcgtcgggaccagactcgtctcaggccagttgcagc
88896928 Cttctcagccaaacgccgaccaaggtacagcttcagtttgctactgggttgtgcattcagctgaatttcatggggaagtccaaattctaa
88897018 ggaaaaatatttttaattgtaatgctgttaaacagacttaaattttctagcctttttaataagcagattagatacattgcaggtctcctg
88897108 gaacaaaggtgtctagatattttgaatgccaatcaaatttaaaacttaaaaatacttccactgggtcctcaaaagaacggaaaccaccga
88897198 tgctaatcagaaaatagtaaaattaaattcccctttggaataattatacctatataattttcagtgggtgactgtgcaggaatttaaaag
88897288 aaaacccatcttttatcctaattaaaccaattacaatcctattttttaaatcatctatctcacttttaaccccaacaaaaccctttctca
88897378 aTATGCCACTGCTAAATTTAGCTGTTAAAATATTCACCAAGATACCTGTATGACACTGTGTAGGCTTATTATTACAAATAGAAAAGCTGT
88897468 TGGCTATTTTCAATGTTTTCCTTTGAATTTCAAATTTTTAGAACATCTTACTTAAATAACAAATTTCAGAGATAGTTTGATTTCACCTAA
88897558 GTAGCACCTACTTGATAATTAAGCTAAAAGTCACATTTAAAGTACATGTTGGAAAAATGGATAAAGCAAATTTTTTTCATTTTTTTCTGT
88897648 GAGTTTTTTCTTCTCTAAAAAATATTCCCATACTAGCTTATTAATATAATTAAGTTACTGTTGATCTGTTTGTAGGTTTAGAGAGCTAGA
88897738 TATATAAGGTAGTAATGGTATAATTTCTGGAACTCTAAATTTTAAAGTTGAATAAATACAGACTTGCAAAATTTCCCTTTCCCTTGCCTA
88897828 ATAGTGAAAGATGGATAATAGGTGGCAATATAAATATTAACTTGAAAGACTATAATACTAAAAAGAAAAGGCATCTCTAAGAAGTAGAAA
88897918 AGATTCTATAGAAAATATATTTTATTTGTGATCATTTTGTAATGTGGTAGTATAAAAAGGTATCACTGTTGTAACCTATGAAGATGTCAG
88898008 CTATTCCTTATGAAATATTTTGCAGGAAAACTCACTACCATGAGAATTGCAGTGATTTGCTTTTGCCTCCTAGGCATCACCTGTGCCATA
88898098 CCAGTGAGTACAGTTGCATCTTAAAGAAAATTCCTGAAAATAACTGAATTGTGTGCTTCCATGTGCTAGGAGGACATTCTTGTAATCTTT
88898188 CTTCATCTTTTCTGTTTCTAAGGTTAAACAGGCTGATTCTGGAAGTTCTGAGGAAAAGCAGGTAAGCATCTTTTATGTTTTTATATAGTT

Keterangan: S ekuen bergaris bawah merah: primer OPN fwd dan rev; sekuen
dengan latar belakang biru: mRNA; sekuen dengan latar belakang
hijau: intron (NCBI Reference Sequence: NT_016354.16).
Sumber: Yueniwati Y., 2014
Gambar 12.31Sekuen Homo sapiens chromosome 4 genomic contig,
GRCh37.p5 Primery Asslembly, dengan SNP OPN T-156 GG

Adapun hasil PCR dengan kondisi optimasi terbaik sebagai


berikut.

Bab 12 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Variasi Genetika 267
1 2 3 4 5 6 7 8 9 10 11
12 13
14
1000 bp

Sumber: Yueniwati Y., 2014


Keterangan: 1-12: sampel, 13: kontrol negatif, 14: Marker
Gambar 12.32Elektroforegram hasil PCR OPN

12.4.4 Hasil Sekuensing OPN


Hasil sekuensing promoter OPN menunjukkan adanya variasi
genetika pada lokasi -156 yang terjadi pada enam sampel dilihat
dari terjadinya insersi basa guanin (G) ke dalam urutan nukleotida
nomor -156 baik pada hasil sekuensing primer forward maupun
primer reverse. Sampel tersebut terdiri dari kelompok kontrol
maupun kasus. Terdapat empat sampel dari kelompok kontrol dan
dua sampel dari kelompok kasus (YueniwatiY.,2014).
Beberapa sampel yang disekuensing dengan menggunakan
primer forward menunjukkan adanya variasi genetika. Namun,
hal yang sama tidak terjadi pada sampel yang disekuensing
menggunakan primer reverse, begitu pula sebaliknya. Hal ini
disebabkan beberapa hasil sekuensing baik dari primer forward
maupun reverse tidak mempunyai hasil sekuensing yang
panjangnya sama dengan wild type. Ada banyak hal yang dapat
menyebabkan hal ini, yang dapat kita analisa dengan melihat
gambar hasil sekuensing (YueniwatiY.,2014).

268 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Sumber: YueniwatiY.,2014
Gambar 12.33Hasil sekuensing dengan primer forward

Sumber: YueniwatiY.,2014
Gambar 12.34Hasil sekuensing dengan primer reverse

Di beberapa bagian terdapat peak (puncak) teratur yang


menunjukkan urutan basa nukleotida yang baik. Sementara itu, di
bagian lain terdapat peak saling tindih yang kemungkinan dapat

Bab 12 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Variasi Genetika 269
disebabkan kualitas DNA yang rendah. Dapat pula disebabkan
primer sekuensing menempel pada dua atau lebih situs penem
pelan pada template atau saat proses PCR primer menempel pada
dua situs penempelan dan membentuk produk. Selain itu, jika
kemungkinan saat proses PCR salah satu strand tidak mengalami
pemanjangan yang sempurna maka salah satu strand tersebut akan
lebih pendek. Inilah juga yang menyebabkan hasil sekuensing antara
primer forward dan reverse bisa berbeda (YueniwatiY.,2014).

12.4.5 Variasi Genetika pada Lokasi -156


Hasil sekuensing promoter OPN kemudian dianalisis dengan
menggunakan program CLC Main Workbench 6 untuk melihat
ada tidaknya mutasi. Hasil analisis pada basa -156 menunjukkan
adanya mutasi pada beberapa sampel. Mutasi yang terjadi adalah
penambahan basa guanin. Berikut adalah hasil analisis hasil
sekuensing dengan menggunakan program CLC Main Workbench6
(YueniwatiY.,2014).
10E T GG T T T - - - - TTTTTTGTTT TAAC CACA - - 755
1011 TG - TTT - - - - TTTTTTGTTT TAAC CACA - - 783
9E TG - TTT - - - - TTTTTTGTTT TAAC CACA - - 757
16E T GG T T T - - - - TTTTTTGTTT TAAC CACA - - 764
15E T GG T T T - - - - T T T T T GG T T T AAC CAACA - - 759
15N TG - TTT - - - - TTTTTTGTTT TAAC CACA - - 755
12E TG - TTT - - - - TTTTTTGTTT TAAC CACA - - 873
11N T GG T T T - - - - TTTTTTGTTT TAAC CACA - - 753
14E TG - TTT - - - - TATTTTGTTT AAAC CACA - - 756
2E T GG T T T - - - - T T T T T GG T T T TACCCCCA - - 769
13N T GG T T T - - - - TTTTTTGTTT TAAC CACA - - 762
10N TG - TTT - - - - TTTTTTTGTT T TACCCCC - - 762
14N TG - TTT - - - - TTTTTTGTTT TAAC CACA - - 760
1E T GG T T T - - - - TTTTTTGTTT TAAC CACA - - 765
11E - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 695
2N T GG T T T - - - - T T T T T GGAA C - AAC T C CA - - 772
9N TGA T T T - - - - TTTTTGTATT AAAC CAAT - - 761
6E TG - TGT - - - - T T T T T T GG T T AAAC CAC C - - 770
5N TGAA T T - - - - A T T A T GG T T T CAAC CACA - - 771
13E TGTTTT - - - - TTTTTG - - TT TAAC C C CA - - 761
16N CCATAT - - - - AGA T A TGT C T TAACGTAT - - 758
1N TGTGTT - - - - T T C T T AG - - - - - - - - - - - - - 751
4E - - GT T T - - - - T T C C T CAGAA AAAC T T C T - - 770
4N GAC C T T - - - - C C T AGAGA T A CACTCTCATC 775
12N TGA T T T - - - - TTTTT - GTTT TAAC TACA - - 761
3E TGAA T T - - - - ACTGTGTCTC C - - - - - - - - - 752
6N TGTTTT - - - - TTTTCATTTT AAAC CA - - - - 762
7E - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 199
5E AAA T T GGAAA T AA T T T T T GG TAAC CAT T TA 1320
8N - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 203
8E - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 197
3N - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 201
7N - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 201
Consensus TG - TTT - - - - TTTTTTGTTT TAAC CACA - -
100%
Conservation
0%

Sumber: YueniwatiY.,2014
Gambar 12.35Analisis mutasi basa nomor -156 pada hasil PCR dengan
primer forward

270 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


11E AAC - AAAAAC GCACACACAC AAT C T ACAGT 250
9E AAC - AAAAAC GCACACACAC AAT C T ACAGT 250
15N AAC - AAAAAC GCACACACAC AAT C T ACAGT 247
12E AAC - AAAAAC GCACACACAC AAT C T ACAGT 249
10E AAC CAAAAAC GCACACACAC AAT C T ACAGT 250
1011rev AAC - AAAAAC GCACACACAC AAT C T ACAGT 276
11N AAC CAAAAAC GCACACACAC AAT C T ACAGT 252
13N AAC CAAAAAC GCACACACAC AAT C T ACAGT 250
14E AAACAAAAAC GCACAC T CAC AAT C T ACAGT 352
10N AAC CAAAAAC GCACACACAC AAT C TACCGT 258
14N A - T CAAAAAC GCAC T C T CCC AAT C T ACAGT 257
4E AAC CAAAAAC GCACAC T CAC AAT C TACCGT 262
1E AT C TAAAAAC GCACACACAC AAT C T ACAGT 255
16E AAC CAAAAAC GCACACACAC AAT C T ACAGT 256
12N TAT - AAAAC C GCAC T C T CCC AAT C T A C GG T 259
7E AAC CAAAAAC GCACACACAC AAT C TACCGT 258
3E AAC CAAAAAC GCCCACACAC CTC CAACAGT 249
13E GAC - GCAAAC GC T CCCCCAC AAT C T A C GG T 261
15E AAC CAAAAC C CACCCCCACC ATC CAACAT T 250
5E AAC CAAAAC C CCCCCCCCCC ATC CAACGT T 251
6E AAC CAAAAC C CCCCCCCCCC ATC CAACAT T 249
5N AAC CAAAAC C CCCCCCCCCC ATC C T CCGT T 257
4N - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 205
2E - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 200
2N - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 202
10N - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
1N - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 2
6N - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 2
8E - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 2
8N - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 2
7N - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 2
9N - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 55
8N - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 12
Consensus AAC - AAAAAC GCACACACAC AAT C T ACAGT
100%
Conservation
0%

Sumber: YueniwatiY.,2014
Gambar 12.36Analisis mutasi basa no -156 pada hasil sekuensing dengan
primer reverse

Mutasi terjadi pada basa nomor -156 yaitu terjadi insersi atau
penyisipan basa guanin. Mutasi ini terjadi pada enam sampel, baik
pada sampel kontrol dan sampel kasus. Tidak semua sampel yang
disekuensing dengan primer forward terlihat pada primer reverse,
begitu pula sebaliknya (YueniwatiY.,2014).
Insersi merupakan bagian dari frameshift mutation (mutasi
pergeseran kerangka) yang dapat berupa insersi atau delesi.
Insersi merupakan penambahan basa pada rangkaian nukleotida.
Jika insersi ini terjadi akan menyebabkan perubahan kelompok
kodon. Perubahan kelompok kodon akan menyebabkan perubahan
stop kodon sehingga translasi akan terus berlanjut hingga stop
kodon selanjutnya. Namun, insersi ini tidak berpengaruh pada
perubahan penterjemahan asam amino, sebab promoter bukanlah
bagian dari gen yang ditrankripsikan (YueniwatiY.,2014).
Mutasi pada lokasi basa nukleotida -156 sudah pernah
ditemukan pada penelitian terdahulu yang juga meneliti pengaruh

Bab 12 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Variasi Genetika 271
terjadinya variasi genetika terhadap peningkatan ekspresi gen
promoter osteopontin (Zhao, 2012), (Alvarez, 2012) (Giacopelli,
2004). Penelitian tersebut menyatakan bahwa variasi genetika
pada titik ini berpengaruh secara signifikan dengan peningkatan
aktivitas transkripsi OPN. Selain variasi genetika terdapat
kemungkinan lain penyebab menebalnya intima media arteri
karotis, di antaranya adalah diabetes mellitus tipe 2, dislipidemia,
dan obesitas. Dalam penelitian dijelaskan bahwa pasien dengan
gangguan toleransi glukosa mempunyai intima media arteri
karotis yang tebal secara signifikan dibandingkan sampel kontrol
dengan perbedaan ketebalan 0.04 (95% CI: 0.014-0.071) mm
(Brohall etal., 2006). Selain itu, intima media arteri karotis juga
ditemukan meningkat secara signifikan pada orang dengan riwayat
hiperkolesterolemia dan berhubungan dengan peningkatan
kolesterol LDL (Khan etal., 2011).
Pada penelitian lain dijelaskan mengenai hubungan antara
peningkatan kadar OPN dengan peningkatan sintesis kolesterol
dengan niali signifikansi p=0.001 (Luomala, 2007). Adapun
obesitas dapat menjadi faktor penting pada proses aterosklerosis
pada intima media arteri karotis. (Kotsis etal., 2006), sedangkan
indeks massa tubuh juga diketahui berkorelasi dengan peningkatan
kadar protein OPN. Penelitian tersebut menjelaskan bahwa
kelompok obesitas mempunyai kadar OPN dalam plasma yang
lebih tinggi dari kelompok kontrol (Gursoy, 2010), sedangkan nilai
rata-rata ketebalan intima media arteri karotis lebih tinggi secara
signifikan dibandingkan dengan kelompok kontrol p<0.001
(Sharma etal., 2009).
Berdasarkan penelitian ini, diketahui hubungan variasi
genetika yang terjadi dengan penebalan intima media arteri
karotis yang ditunjukkan dengan nilai Odd Ratio yaitu 2.100
(CI0.29714.875), artinya bahwa variasi genetika tidak bermakna
sebagai faktor risiko. Penelitian ini memberikan kesimpulan
bahwa tidak ada pengaruh variasi genetika terhadap penebalan
intima media arteri karotis. Begitu pula dengan variabel lain yaitu
besarnya profil lipid dan indeks massa tubuh yang berturut-turut
memiliki nilai Odd Ratio 1.500 (CI 0.14615.461) dan 1.190 (CI

272 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


0.11312.585). Besarnya Odd Ratio tersebut menunjukkan variasi
genetika tidak berpengaruh secara signifikan terhadap profil lipid
maupun indeks massa tubuh (YueniwatiY.,2014).
Terdapat enam sampel yang dinyatakan mengalami variasi
genetika dinilai dari analisis menggunakan CLC Main Workbench 5
dan program Sequencher. Dua di antaranya adalah kelompok kasus
(10.52% dari seluruh sampel kasus) dan empat adalah sampel
kontrol (30.76% dari seluruh sampel kontrol). Berikut adalah
penjabaran masing-masing karakteristik sampel yang positif
terjadi variasi genetika (YueniwatiY.,2014).
1. Terdapat dua sampel kontrol yang mengalami variasi genetika
dan mempunyai ketebalan intima media arteri karotis kanan
dan kiri lebih dari 0.05 mm, sedangkan profil lipid dan indeks
massa tubuh normal.
2. Terdapat dua sampel kontrol yang mengalami variasi genetika,
sedangkan ketebalan intima media arteri karotisnya di bawah
0.05 mm. Salah satu sampel mempunyai total kolesterol di atas
200 mg/dl dan indeks massa tubuhnya normal, sedangkan
sampel lainnya mempunyai total kolesterol normal dan indeks
massa tubuh di atas 25 kg/m2 yang masuk dalam kategori
obesitas.
3. Terdapat dua sampel kasus yang mengalami variasi genetika
dan keduanya mempunyai ketebalan intima media arteri
karotis di atas 0.05mm, sedangkan total kolesterol dan indeks
massa tubuhnya normal.
Dari deskripsi di atas diketahui bahwa beberapa sampel
menunjukkan adanya kecenderungan hubungan antara variasi
genetika dengan ketebalan intima media arteri karotis. Pada poin1
dijelaskan bahwa terdapat dua sampel kontrol yang mengalami
penebalan intima media arteri karotis dari empat sampel kelompok
kontrol yang mengalami variasi genetika (50%). Padahal,
kelompok kontrol merupakan kelompok dengan orang tua tanpa
penyakit kardiovaskular yang tidak diharapkan mengalami variasi
genetika (YueniwatiY.,2014).

Bab 12 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Variasi Genetika 273
Jika dikaji lebih lanjut, terdapat kemungkinan lain penyebab
terjadinya penebalan intima media arteri karotis selain confounding
factor yang telah dianalisis. Meningkatnya kadar osteopontin dalam
tubuh karena overekspresi dapat menyebabkan peningkatan
potensi invasi sel kanker dan juga berpengaruh dalam progresivitas
kanker (Pan etal., 2003). Selain itu, OPN juga dapat meregulasi
infiltrasi makrofag selama proses inflamasi dan jumlah OPN plasma
ditemukan berhubungan dengan beberapa penyakit inflamasi
seperti Osteoartritis (Sudhir etal., 2012). Dalam penelitian ini,
orang tua sampel tidak menjalani pemeriksaan terkait dengan
segala penyakit yang pernah diderita oleh orang tua di luar penyakit
kardiovaskular. Kemungkinan sampel kontrol yang mengalami
variasi genetika dengan penebalan intima media arteri karotis
memiliki orang tua dengan penyakit-penyakit lain misalnya kanker
atau penyakit-penyakit inflamasi (YueniwatiY.,2014).
Pada poin 2 terdapat dua sampel kontrol yang mengalami
variasi genetika namun tidak mengalami penebalan intima media
arteri karotis dari empat sampel kelompok kontrol yang mengalami
variasi genetika (50%). Penebalan intima media merupakan salah
satu marker yang menandai meningkatnya jumlah osteopontin
plasma. Secara umum, OPN memiliki beberapa fungsi yang akan
mempengaruhi fisiologis tubuh. Salah satunya adalah ketebalan
intima media arteri karotis. Selain itu, overekspresi OPN juga dapat
meningkatkan jumlah sel-sel proinflamasi yang berkorelasi dengan
terjadinya penyakit-penyakit inflamasi (YueniwatiY.,2014).
OPN juga dapat meningkatkan jumlah osteoklas dan sel-sel
yang berperan dalam mekanisme bond remodeling lainnya. Fungsi-
fungsi di atas kemungkinan tidak berjalan sama pada masing-
masing individu. Bisa jadi, satu individu dengan variasi genetika SNP
-156 mengalami penebalan intima media arteri karotis, sementara
pada individu lain yang juga mengalami varisi genetika di titik
yang sama mengalami gejala lain misalnya peningkatan jumlah sel-
sel proinflamasi yang menyebabkan penyakit-penyakit inflamasi
seperti lupus atau osteoartritis (Farouk et al., 2009). Oleh karena itu,
dalam kasus poin 2 terdapat kemungkinan bahwa sampel kelompok
ini tidak mengalami penebalan intima media arteri karotis, namun

274 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


mengalami bentuk fisiologis lain akibat terjadinya variasi genetika.
Sayangnya bentuk fisiologis lain itu tidak diteliti dalam penelitian ini
atau belum diketahui secara pasti (YueniwatiY.,2014).
Pada poin 3, terdapat dua sampel kasus yang kedua-duanya
mengalami penebalan intima media arteri karotis (100% dari
sampel kasus yang mengalami variasi genetika). Hal ini telah senada
dengan berbagai literatur yang menjelaskan hubungan antara
variasi genetika pada titik G-156GG dengan penebalan intima media
arteri karotis. Poin 3 kembali menguatkan penelitian-penelitian
sebelumnya bahwa terdapat kecenderungan variasi genetika
pada titik G-156GG berhubungan dengan penebalan intima media
arterikarotis (YueniwatiY.,2014).
Secara teori, kecenderungan di atas dapat dijelaskan sebagai
berikut. Dalam sebuah penelitian (Giacopelli, 2004) dijelaskan
bahwa kehadiran dua basa guanin dalam urutan DNA di lokasi -156
menyebabkan terbentuknya binding site untuk faktor RUNT. RUNX2
yaitu salah satu faktor transkripsi dapat berikatan dengan binding
site yang terbentuk karena adanya insersi G pada urutan basa. Ikatan
ini memiliki afinitas yang besar sehingga dapat meningkatkan
aktivitas transkripsi promoter OPN. Aktivitas transkripsi promoter
OPN ini menyebabkan peningkatan konsentrasi OPN dalam plasma
(YueniwatiY.,2014).
OPN banyak diekspresikan pada sel makrofag di jaringan
adiposa manusia. Banyaknya jaringan adiposa juga berhubungan
dengan terjadinya obesitas. Peningkatan aktivitas transkripsi OPN
juga menyebabkan terjadinya peningkatan rekrutmen lokal monosit
pada tempat injuri di dinding arteri sehingga akan meningkatkan
risiko terjadinya aterosklerosis (YueniwatiY.,2014).
Pengukuran OPN plasma sangat dibutuhkan untuk melihat
akibat langsung dari terjadinya variasi genetika pada titik G-156GG.
Sebab peningkatan OPN plasma tidak hanya berhubungan
dengan ketebalan intima media arteri karotis, tapi juga dengan
parameter lain seperti jumlah sel proinflamasi atau peningkatan
jumlah osteoklas dan sel yang berperan dalam bond remodeling
(YueniwatiY.,2014).

Bab 12 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Variasi Genetika 275
Selain titik -156, terdapat dua titik lain yang sering dilaporkan
berhubungan dengan penebalan intima media arteri karotis. Titik-
titik itu adalah C-443T dan T-66G. Kedua titik ini telah banyak
dilaporkan dapat memprediksi risiko seseorang mengalami
penyakit kardiovaskular, terutama pada titik T-66C. Sementara itu,
titik C-44T belum diketahui dengan tepat konsekuensi terjadinya
mutasi pada titik ini terhadap regulasi transkripsi protein OPN
(YueniwatiY.,2014).

12.4.6 OPN sebagai Terapi


OPN terbukti dapat digunakan dalam terapi penyakit
stroke karena fungsinya sebagai neuroprotektor. OPN terbukti
meningkatkan sel yang hidup setelah terjadinya iskemia. Mekanisme
OPN dalam mencegah kematian sel antara lain mensintesis nitrit
oxide, meningkatkan aktivitas NF-B, dan meningkatkan aktivitas
PIK. Fungsi-fungsi di atas meningkatkan ekspresi OPN dan
meningkatkan fungsi neuroprotektifnya (Meller etal., 2005).
OPN dapat meningkatkan sintesis nitrit oxide yang sangat
berguna dalam keadaan stroke, yakni dengan mekanisme
vasodilatasi vaskular yang akan meningkatkan pasokan oksigen
ke otak. Adapun aktivitas NF-B dapat meningkatkan aktivitas
transkripsi dari protein antiapoptosis. Hal ini dapat mencegah
banyaknya neuron di otak yang mati karena terjadinya stroke.
Sebagai neuroprotektor, OPN juga bekerja melalui aktivasi P42/
P44 MAPK/Akt/PIK dan interaksi pada reseptor integrin. Aktivasi
P42/P44 MAPK/Akt/PIK menyebabkan peningkatan fosforilasi
dari Akt yang memiliki fungsi neuroprotektif dengan meningkatkan
ekspresi OPN. Aktivasi reseptor integrin oleh OPN membuat
neuron dapat mentoleransi toksisitas glutamat sehingga aktivasi
ini memberikan dampak penurunan protein pro apoptosis dan
proliferasi sel yang akan menjaga cell survival (YueniwatiY.,2014).
Meskipun penelitian ini tidak menunjukkan adanya hubungan
yang signifikan antara variasi genetika dengan penebalan intima
media arteri karotis, maka perlu dilakukan penelitian lebih lanjut
mengingat masih terbatasnya penelitian mengenai hal ini. Hasil
penelitian ini hendaknya dilanjutkan pada penelitian selanjutnya

276 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


berupa bagaimana membentuk sediaan yang tepat. Sejauh ini, OPN
telah dicoba untuk diberikan melalui intranasal (Meller etal., 2005).
Hasil pemberian OPN intranasal terbukti efisien untuk diberikan
pada mencit dengan target kerja di otak (Doyle etal., 2008).
Adapun keterbatasan penelitian antara lain jumlah
sampel yang kurang representasitif untuk menjelaskan hasil
penelitian. Diperlukan penelitian lebih lanjut dengan sampel
yang representatif sehingga dapat diperoleh hasil analisis yang
signifikan. Selain itu, tidak semua hasil sekuensing dapat dianalisa
keberadaan mutasinya sehingga tidak bisa ditentukan apakah
semua sampel yang tidak dapat dianalisa tersebut tidak mengalami
variasi genetika. Perlu dipertimbangkan pemilihan master mix
dan bahan-bahan yang dapat mempengaruhi proses amplifikasi
sehingga dapat meningkatkan homologi hasil sekuensing
(YueniwatiY.,2014).
Berdasarkan hasil penelitian tentang pengaruh variasi
genetika pada SNP G-156GG terhadap ketebalan intima media
arteri karotis pada anak populasi Jawa, maka diperoleh hasil
sebagai berikut. Pertama, terdapat variasi genetika pada titik
G-156GG pada anak populasi Jawa. Ditemukan enam kasus yang
mengalami variasi genetika pada titik G-156GG. Kedua, terdapat
kecenderungan penebalan intima media arteri karotis pada anak
populasi Jawa dengan orang tua stroke iskemia. Hal ini menguatkan
teori bahwa variasi genetika berpengaruh sebagai faktor risiko
(YueniwatiY.,2014).
Beberapa hal yang disarankan terkait hasil penelitian ini
antara lain pertama, perlu dilakukan optimasi kondisi yang lebih
mendalam agar diperoleh hasil sekuensing dengan homologi
tinggi sesuai dengan target gen OPN yang diinginkan. Kedua,
perlu dilakukan pengukuran jumlah OPN plasma sebagai akibat
langsung dari terjadinya variasi genetika di titik G-156GG pada
sampel sehingga dapat dikorelasikan antara terjadinya variasi
genetika dengan peningkatan jumlah OPN dalam plasma. Ketiga,
perlu dilakukan pemeriksaan menyeluruh terkait riwayat penyakit
orang tua sampel, terutama penyakit yang berhubungan dengan
peningkatan jumlah OPN plasma sehingga dapat diketahui faktor
lain yang mungkin berpengaruh pada terjadinya overekspresi OPN.

Bab 12 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Variasi Genetika 277
Keempat, perlu dikaji lebih dalam terkait fungsi fisiologis OPN
yang berhubungan dengan patologis penyakit tertentu, sehingga
dapat dipertimbangkan apakah OPN dapat digunakan sebagai
terapi atausebaliknya (YueniwatiY.,2014).

Rangkuman
1. Dalam beberapa penelitian ditemukan bahwa gen promoter
MCP-1 dan gen pengkode OPN menunjukkan hubungan
yang dekat dengan kejadian stroke iskemia dibandingkan
gen-gen lainnya.
2. Banyak penelitian menemukan hubungan antara kejadian
stroke dengan variasi genetika (polimorfisme dan atau
mutasi) gen OPN dan MCP-1.
3. Telah ditemukan dua polimorfisme pada promoter MCP-1
yang baru dan spesifik, yaitu A-2138T dan G-2464A. Kedua,
anak populasi Jawa dengan polimorfisme mempunyai
intima media arteri karotis yang lebih tebal daripada
intima media arteri karotis anak pada rentang umur
yang sama. Anak populasi Jawa dengan polimorfisme
mempunyai kemungkinan 1,471 kali untuk mengalami
penebalan intima media arteri karotis daripada anak tanpa
polimorfisme.
4. Pada penelitian polimorfisme gen pengkode OPN belum
diperoleh data polimorfisme OPN. Beberapa hal yang
sebaiknya diperhatikan berhubungan dengan hasil
penelitian ini yaitu perlu dilakukannya evaluasi genetika
polimorfisme OPN pada anak dengan risiko stroke iskemia
dan aterosklerosis sehingga dapat dilakukan tindakan
preventif terhadap faktor risiko lain dan penatalaksanaan
dini. Selain itu, juga perlu dilakukan eksplorasi dan optimasi
kondisi PCR OPN lebih mendalam sehingga diperoleh hasil
sekuensing dengan homologi tinggi sesuai gen target OPN
yang diharapkan. Terakhir, perlu dilakukan penelitian lebih
lanjut untuk menentukan polimorfisme promoter OPN
yang ditemukan fungsional atau nonfungsional dengan
menilai ekspresi gen.

278 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


5. Berdasarkan hasil penelitian deteksi variasi genetika
promoter osteopontin T-443 pada anak populasi Jawa
dengan orang tua stroke iskemia serta pengaruhnya
terhadap ketebalan intima media arteri karotis maka dapat
diperoleh hasil sebagai berikut. Pertama, ditemukan variasi
genetika promoter osteopontin T-443C pada anak populasi
Jawa dengan orang tua stroke iskemia. Kedua, variasi
genetika promoter osteopontin T-443C pada anak populasi
Jawa dengan orang tua stroke iskemia merupakan salah
satu faktor risiko terjadinya peningkatan ketebalan intima-
media arteri karotis.
6. Berdasarkan hasil penelitian tentang pengaruh variasi
genetika pada SNP G-156GG terhadap ketebalan intima
media arteri karotis pada anak populasi Jawa, maka
diperoleh hasil sebagai berikut. Pertama, terdapat variasi
genetika pada titik G-156GG pada anak populasi Jawa.
Ditemukan enam kasus yang mengalami variasi genetika
pada titik G-156GG. Kedua, terdapat kecenderungan
penebalan intima media arteri karotis pada anak populasi
Jawa dengan orang tua stroke iskemia. Hal ini menguatkan
teori bahwa variasi genetika berpengaruh sebagai
faktorrisiko.

Bab 12 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Variasi Genetika 279
280 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...
Bab13

Kesimpulan

281
S
troke merupakan penyakit serebrovaskular yang
memiliki morbiditas, mortalitas, dan tingkat
kecacatan yang tinggi di dunia. Oleh karena itu,
sangat diperlukan adanya berbagai deteksi sehingga risiko
terjadinya stroke dapat dikurangi. Untuk mencegah stroke, kita
dapat mengenali berbagai faktor risiko stroke. Secara umum,
deteksi faktor risiko stroke dapat kita bedakan menjadi anamnesis,
pemeriksaan fisik diagnostik, dan pemeriksaan penunjang
(Gofir,A., 2014).
Beberapa contoh metode deteksi stroke yang sudah banyak
dilakukan misalnya metode FAST, transcanial Doppler (TCD), nilai
ABI, dan beberapa deteksi melalui pemeriksaan genetika seperti
mengetahui adanya polimorfisme Gly972Arg Gen IRS-1 dan
G2350A gen ACE pada stroke iskemia dan polimorfisme -455G/A
dan -148C/T gen fibrinogen terhadap kejadian hiperfibrinogen
dan stroke iskemia akut usia muda.
Deteksi lainnya dilakukan dengan pemeriksaan ultrasonografi
vaskular. Metode ini dipilih karena salah satu indikasi terjadinya
stroke iskemia ditunjukkan oleh ketebalan intima media arteri
karotis. Untuk mengukur ketebalan intima media arteri karotis
dapat digunakan ultrasonografi. Ketebalan intima media
arteri karotis merupakan keadaan arteriosklerosis subklinis.
Kelebihan ultrasonografi dibanding dengan metode lainnya yaitu
ultrasonografi merupakan modalitas yang mudah, murah, dan
tidak invasif.
Deteksi melalui pemeriksaan ultrasonografi vaskular termasuk
dalam deteksi dini karena penebalan intima media merupakan
prediktor aterosklerosis yang memerlukan waktu panjang untuk

282 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


menjadi aterosklerosis. Jadi, dengan memeriksa ketebalan intima
media bisa diprediksi keadaan vaskularnya di masa mendatang.
Dalam beberapa penelitian ditemukan bahwa gen promotor
MCP-1 dan gen pengkode OPN menunjukkan hubungan yang dekat
dengan kejadian stroke iskemia dibandingkan gen-gen lainnya.
Kedua gen tersebut sangat terkait dengan kejadian stroke iskemia.
Hal itu dibuktikan bahwa pada anak penderita stroke dengan
polimorfisme/variasi genetika pada OPN dan MCP-1 menunjukkan
intima media yang lebih tebal. Faktor genetika sampai saat
ini dianggap sebagai faktor risiko stroke iskemia yang tidak
bisa diubah. Berbagai variasi genetika dianggap sebagai faktor
penyebab stroke. Dengan demikian, perlu dilakukan pemeriksaan
untuk menilai ada tidaknya variasi genetika pada dua gen tersebut.
Dengan mengetahui adanya variasi genetika tersebut maka dapat
diantisipasi kejadian stroke.
Berdasarkan hasil penelitian tentang pengaruh polimorfisme
promoter MCP-1 dan OPN terhadap ketebalan intima media arteri
karotis anak populasi Jawa dengan orang tua stroke iskemia, maka
disimpulkan bahwa:
Ditemukan dua polimorfisme pada promoter MCP-1 yang
baru dan spesifik, yaitu A-2138T dan G-2464A.
Intima media arteri karotis anak populasi Jawa dengan
orang tua stroke iskemia lebih tebal dibanding anak
populasi Jawa dengan orang tua sehat.
Anak populasi Jawa dengan polimorfisme A-2138T dan
G-2464A mempunyai intima media arteri karotis yang
lebih tebal daripada intima media arteri karotis anak pada
rentang umur yang sama.
Anak populasi Jawa dengan polimorfisme A-2138T dan
G-2464A mempunyai kemungkinan 1,471 kali untuk
mengalami penebalan intima media arteri karotis daripada
anak tanpa polimorfisme.
Berdasarkan hasil penelitian deteksi variasi genetika promoter
osteopontin T-443 pada anak populasi Jawa dengan orang tua

Bab 13 K
 esimpulan 283
stroke iskemia serta pengaruhnya terhadap ketebalan intima-
media arteri karotis, maka dapat disimpulkan bahwa:
Ditemukan variasi genetika promoter osteopontin T-443C
pada anak populasi Jawa dengan orang tua stroke iskemia.
Variasi genetika promoter osteopontin T-443C pada anak
populasi Jawa dengan orang tua stroke iskemia merupakan
salah satu faktor risiko terjadinya peningkatan ketebalan
intima media arteri karotis.
Berdasarkan hasil penelitian tentang pengaruh variasi
genetika pada SNP T-156GG terhadap ketebalan intima media
arteri karotis pada anak populasi Jawa, maka dapat disimpulkan
bahwa:
Terdapat variasi genetika pada titik G-156GG pada anak
populasi Jawa.
Ditemukan enam kasus yang mengalami variasi genetika
pada titik G-156GG.
Terdapat kecenderungan penebalan intima media arteri
karotis pada anak populasi Jawa dengan orang tua stroke
iskemia. Hal ini menguatkan teori bahwa variasi genetika
berpengaruh sebagai faktor risiko.

284 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Daftar Pustaka

Abbas, A.K., Lichtman A.H. Cellular and molecular immunology. Philadelphia.


Saunders Elsevier Science. 2003. p. 275-97.
Abboud, S., Viiri L.E., Lutjohann D., Goebeler S., Luoto T., FriedrichsS. et.al.,
Association of Apolipoprotein E gene with ischemic stroke and
intracranial atherosclerosis. Eur J. Hum Genet; 2008. 16: 955-60.
Adams, H.P. Jr., Bendixen B.H., Kappelle L.J., Biller J., Love B.B., Gordon D.L.,
etal., Classification of subtype of ischemic stroke. Definitions for
use in a multicenter clinical trial TOAST trial of org 10172 in acute
stroke treatment. Stroke. 1993. 24: 35-41.
Adam, H., Davis P., Torner J., Grimsman K., Berg J.V., NIH Stroke scale: Available
at URL: http://www.vh.org/adult/provider/Neurology/Stroke.html.
2003. [Accessed 25 Maret 2014].
Adams, H.P., del Zoppo G., Alberts M.J., Bhatt D.L., Brass L., FurlanA., etal.
Guidelines for The Early Management of Adults With Ischemic
Stroke : A Guideline from the American Heart Association/American
Stroke Association. Stroke. 2007 ; 38 : 1655 - 711
Aduen, J.F., Hellinger W.C., Kramer D.J., Stapelfeldt W.H., Bonatti H., Crook
J.E., etal., Spectrum of pneumonia in the current era of liver
transplantation and its effect on survival. Mayo Clin Proc. October
2005: 80 (10): 1303-06.
AHA/ASA Guideline. Guidelines for the early management of adults with
ischemic stroke. Stroke. 2007;38:1655-1711
Ahmed M., Kundu G.C., Osteopontin selectively regulates p70S6K/mTOR
phosphorylation leading to NF-kappaB dependent AP1-mediated
ICAM-1 expression in breast cancer cells. Mol. Cancer, 2010: 9,
p.101.
Akhtar B., Siddique S., Khan R.A. Detection of atherosclerosis by ankle brachial
index: Evaluation of palpatory method versus ultrasound doppler
technique. J.Ayub.Med.Coll.Abbot. 2009; 21(1): 1-6.
AlainPierre G., Herve C., Daniele D.M.K., Jean, Marie D., Lamazaiere and
Clande D.: Time course of osteopontin, osteocalcin and osteonectin
accumulation and calcification after acute vessel wall injury. Journal
of Histochemistry and Cytochemistry, 2001; 49: 79-86.
Alavantic, D., Djuric T., Risk factors of atherosclerosis: A Review of genetic
epidemiology data from a serbian population. Exp Clin Cardiol.
2006; 11: 78-82.
Albers, G.W., Amerenco P., Easton J.D., etal. Antithrombotic and thrombolytic
therapy for ischemic stroke: The seventh ACCP Conference on
Antithrombotic and Thrombolytic Therapy. Chest, 2004; 126 (3
suppl): 483S512S.

285
Alemzadeh, R., David T., Diabetes Mellitus. In: Behrman, R., Kliegman, R. &
Jenson, H. (eds.) Textbook of Pediatrics. 17 ed. Tokyo: WB Saunders.
2003.
Al-Gwaiz L.A., Babay H.H., The Diagnostic value of absolute neutrophil count,
Band count and morphologic change of neutrophils in predicting
bacterial infections. Med Princ Pract. 2007; 16: 344-7.
Amarenco, P., Bogousslavsky J., Caplan L.R, Donnan, Hennerici. Classification
of stroke subtypes. Cerebrovasc Dis. 2009; 27:493501.
American Heart Association (AHA), Measurement and interpretation of the
Ankle-Brachial Index : A Scientific Statement for the American Heart
Association, Circulation, 2012.1-15.
American Stroke Association. Types of stroke. 2011. Available at :http://www.
strokeassociation.org/STROKEORG/AboutStroke/TypesofStroke/
IschemiClots/Ischemic-Clots_UCM_310939_Article.jsp. [Accessed
22 September 2011].
American Thoracic Society. Guidelines for management of adults with
community acquired pneumonia. Diagnosis, assesment of severity,
antimicrobial terapy, and prevention. Am J. Respir Crit Care Med.
2001: 163: 1730-54.
Anuurad, E., Shiwaku K., Nogi A., Kitajima K., Enkhmaa B., Shimono K. etal.,
The new BMI Criteria for Asians by the regional office for the western
pacific region of WHO are suitable for screening of overweight to
preven metabolic syndrome in elder Japanese workers. J. Occup
Health. 2003; 45.p. 335-43.
Arakelyan, A, Petrkova J, Hermanova Z, Boyajyan A, Lukl J, Petrek M, 2005.
Serum levels of the MCP-1 chemokine in patients with ischemic
stroke and myocardial infarction. Mediators Inflamm; 2005 (3):
175-179.
Alderon, W., Cooper C., Kowles R., Nitrocoxides syntase: Structure, function,
inhibition. Biochem J. 2002: 357.p. 593-615.
Ardelt, A.A., 2009. Acute ischemic stroke. In: Harrigan, M.R., & Deveikis, J.P.,
ed. Handbook of cerebrovascular disease & neurointerventional
technique. New York: Humana Press, 571-605.
Ashwal, S. Tone B. Tian H.R. Core and penumbral nitric oxide syntase
activity during cerebral ischemia and reperfusion. American Heart
Association Journal. Stroke. 1998; 29: 1037-47.
Aslanyan, S., Weir C.J. Diener H-C., Kaste M., Lees K.R., Pneumonia and urinary
tract infection after acute ischaemic stroke: a tertiary analysis of the
GAIN international trial. Eur J. Neurol. 2004: 11: 49-53.
Astuti. Prognosis gangguan kognitif dan mild cognitive impairment pada
usia lanjut. Dalam Muhartono H., Trianggoro B., eds. Update
management of neurological disorders in erderly. Semarang: BP
UNDIP, 2006: 68-75.
Atai, N., etal. Osteopontin is up-regulated and associated with neutrophil and
macrophage inltration in glioblastoma. Blackwell Publishing Ltd.
Immunology, 2010; 132: 3948.

286 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Badjatia, N., Rosand J. Intracerebral hemorrhage. Neurologist, 2005; 11(6):
311324
Bailey, R., 2011. Carotid arteries [Online]. Available at http://biology.about.
com/od/anatomy/ss/carotid-arteries.htm. [Accessed 22 September
2011].
Baird, E., Dambrosia J., Janket S., Eichbaum Q., Chaves C., Silver B., A Three
item scale for the early prediction of stroke recovery. The Lancet:
2001: 357: 2095-9.
Baldwin, K. etal., 2010. Acute ischemic stroke update from pharmacotherapy.
J Medscape 30 (5):493-514.
Barra, S., etal. Early increase of carotid intima-media thickness in children
with parental history of premature myocardial infarction. Heart;
2009. 95: 642-645.
Bartzokis, G., Lu P.H., Geschwind D.H., Tingus K., Huang D., Mendez M.F.,
et.al., Apoliprotein E affects both myelin breakdown and cognition:
Implications for age-related trajectories of decline into dementia.
Biol Psychiatry 2007; 62: 1380-7.
Baune, B.T. The puzzle of predicting the impact of brain infarcts on cognitive
impairment in the aging brain. Stroke 2009; 40: 667-9.
Becker, J.U., Wira, C.R., and Arnold, J.L., 2010. Stroke, Ischemic. Available
from: http://emedicine.medscape.com/article/793904-print.html.
[Accessed 20 February 2011].
Beckman, J.S. Ye Y.Z., Chen J., Conger K.A. Interaction of nitric oxide with oxygen
radicals and scavenger in cerebral ischemic injury. Philadelphia:
Lippincott-Raven Publishers;1996:330-45.
Begelman, S. dan Jaff M. Non-invasive diagnostic strategies for peripheral
arterial disease. Cleve.Clin.J.Med. 2009; 73: 22-29.
Bertola, A., etal. Elevated expression of osteopontin may be related to adipose
tissue macrophage accumulation and liver steatosis in morbid
obesity. Diabetes, 2009; 58(1): 125-33.
Bhatnagar, P., etal. The Incidence of all sroke and stroke subtype in the United
Kingdom 1985 to 2008: A Systematic Review. BMC. 2010; (10): 539-
549.
Biswas, M., Sen S., Simmons J., Original articles: Etiology and risk factors of
ischemic stroke in Indian American patient from a hospital-based
registry in New Jersey, USA. Neurol Asia. 2009: 14(2): 81-6.
Bjorkhen, I., Meaney S. Brain cholesterol: Long secret life behind a barrier.
Thromb Vasc Biol. 2004; 24: 804-15.
Botham, K.M., Mayes P.A. Lipid transport & storage. In : Murray R.K., Bender
D.A., Botham K.M., Kennely P.J. Rodwell V.W., Weil P.A., eds. Harpers
Illustrated Biochemistry. 28th Ed. New York: McGraw Hill Co. 2009:
212-23.
Brenner, D., etal. Cytokine polymorphisms associated with carotid intima-
media thickness in stroke patients. Stroke; 2006. 37: 1691-6.

Daftar Pustaka 287


Brohall, G.,Odn A.,Fagerberg B., Carotid artery intima-media thickness
in patients with type 2 diabetes mellitus and impaired glucose
tolerance: A. Diabet Med. 2006; Jun; 23(6):609-16.
Bucova, M., etal., The MCP-1 -2518 (A/G) single nucleotide polymorphism is
associated with ischemic heart disease and myocardial infarction in
men in the slovak population. Bratisl Lek List;, 2009a; 110 (7): 385-9.
Bucova, M., Lietava J., Penz P., Mrazek F., Petrkova J., Bernadic M., Petrek M.,
Association of MCP-1 -2518 A/G single nucleotide polymorphism
with the serum level of CRP in slovak patients with ischemic heart
disease, angina pectoris, and hypertension. Mediators Inflamm;
2009b. : 111 (8): 420-25.
Buraczynska, K., Luchowski P., Wocjzal J., Ksiasek A., Stelmasiak Z., Monocyte
chemoattractant protein (MCP-1) A-2518G gene polymorphism in
sroke patients with different comorbidities. Clinical Biochemistry;
2010. 43: 1421-1426.
Busch, M.A., Lutz K., Eric J., etal. Low ankle brachial idex predicts cardiovascular
risk after acute ischemic stroke or transient ischemic attack. Stroke.
2009; 40: 3700-3705.
Caplan, L.R., Caplans stroke: clinical approach. 4th ed.Philadelphia: Saunders,
2009.
Cardiorisk F. Frequently asked questions about carotid intima media thickness
testing (CIMT). 2009. [Online]. Available at: http://www.cardiorisk.
us/faq.php. [Accessed 22 September 2011].
Casella, I.B., etal., A Practical protocol to measure common carotid artery
intima-media thickness. Clinics Sao Paulo; 63: 515-20.
Cermakova, Z., etal., The MCP-1 -2518 (A to G) Single nucleotide polymorphism
is not associated with myocardial infarction in the Czech population.
Int. J. Immunogenet; 2005; 32: 315-8.
Chabriat, H., Godefroy O., Vascular dementia. In: Godefroy O, Bogousslavsky.,
J. eds. The behavioral and cognitive neurology of stroke. Cambridge:
Cambridge University Press, 2007: 596-8.
Chamoro, A., Urra X., Planas A.M., Infection after acute ischemic stroke. A
Manifestation of brain-induced immunodeppresion : Stroke. 2007;
38: 1097-103.
Charo, I.F., Taubman M.B., Chemokines in the pathogenesis of vascular
disease. Circ Res; 2004; 95: 858-66.
Chen, R-L., Balam J.S., Esiri M.M., Chen L-K., Buchan A.M., et.al., Ischemic
stroke in the elderly: an overview of evidence. Nat. Rev. Neurol.
2010. 6:256-65.
Chen, X., Touyz R.M., Park J.B., Schiffrin E.L. Antioxidant effects of vitamin C
and E associated with altered activation of vascular NADPH oxidase
and SOD in stroke-prone SHR. Journal of The American Heart
Association. Dallas. 2001; 38: 606-11.
Cherubini, A., Polidori M.C., Bregnocchi M., Pezzuto S., Cecchetti R., IngegniT.,
etal., Antioxidant profile and early outcome in stroke patients.
American Heart Association Journal. Stroke.2000; 31; 2295-2300.

288 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Chiocchetti, A., etal., High Levels of Osteopontin Associated with
Polymorphisms in Its Gene are A Risk Factor for Development of
Autoimmunity/Lymphoprolif-Eration. Blood, 2004; 103: 1376
1382.
Chou, W., Choi D., Zhang H., Mu D., Neutrophil protein kinase Cas a mediator
of stroke reperfusion injury. J. Clin. Invest.2004; 114: 49-56.
Cobelens, P.M., Tiebosch I., Dijkhuizen R.M., Van der Meide P.H., Zwartbol
R., Heijnen C.J., etal., Interferon-b attenuates lung inflamation
following experiment subarachnoid hemorrhage. Crit Care. 2010:
14: R157.
Coll, B, Feinstein Sb. Carotid intima-media thickness measurements:
Techniques and clinical relevance. Current Atherosclerosis Reports,
2008, 10:XxXx.
Combs. The Vitamins, 2nd ed. California: Academic Press; 1998: 57-58; 246-75.
Cooper, R., Cutler J., Desvigne-Nickens P., etal. Trends and disparities in
coronary heart disease, stroke, and other cardiovascular diseases in
the United States: Findings of the National Conference on Cardiovas-
cular Disease Prevention. Circulation, 2000; 102: 31373147.
Craig, A., Mai J., Cai S., Jeyaseelan S., Minireview: Neutrophil recruitment to
the lungs during bacterial pneumonia. Infection and immunity. Am
Society for Microbiol. Vol. 77. No. 2. 2009.p. 568-75.
Crowther, M.A.,Pathogenesis of atherosclerosis. Hematology Am Soc Hematol
Educ Program; 2005. 436-41.
Cuomo, S., etal., Increased carotid intima-media thickness in children
adolescents, and young adults with a parental history of premature
myocardial infarction. European Heart Journal; 2002. 23: 1345-
1350.
Dahlan, M.S., Besar sampel dalam penelitian kedokteran dan kesehatan.
Seri2. Jakarta: PT Arkans: 2006.p.19-70.
Danes, C., Gonzales-Martin J., Pumarola T., Rano A., Benito N., Torres A., etal.,
Pulmonary infiltrates in immunosuppressed patient: Analysis of a
diagnostic protocol. J Clin Microbiol. 2002:40(6): 2134-40.
Das, R., Mahabeleshwar G.H., Kundu G.C., Osteopontin stimulates cell motility
and nuclear factor kappaB mediated secretion of urokinase type
plasminogen activator through phosphatidylinositol 3-kinase/
Akt signaling pathways in breast cancer cells. J. Biol Chem, 2003;
278:28593606.
Davignon, J. Gregg R.E., Sing C.F., Apoliprotein E polymorphism and
atherosclerosis. Arterioscler Thromb Vasc Biol, 1998;8:1-21.
Davis, P.H., Dawson J.D., Blecha M.B., Mastbergen R.K., Sonka M., Measurement
of aortic intimal-medial thickness in adolescents and young adults.
Ultrasound in Medicine & Biology; 2010. 36: 560-565.
Deb, P., Sharma S., Hassan Km. Pathophysiologic mechanisms of acute
ischemic stroke: An overview with emphasis on therapeutic
significance beyond thrombolysis. Elsevier. 2010 (17)197218.

Daftar Pustaka 289


De Las Fuentes, L., etal., Osteopontin promoter polymorphism is associated
with increased carotid intima-media thickness. J Am Soc
Echocardiogr; 2008; 21: 954-60.
Del Zoppo, G.J., Becker K., Hallenbeck J.M., The role of inflamation in
ischemic stroke. 4th World Stroke Congress. Melbourne. Nov 2000.
Melbourne University.27-30.
Demirkaya, S., Uluc, K, Bek, S. and Vural. O. 2008. Normal blood flow velocity of
basal cerebral arteries decrease with advancing age: A transcranial
doppler sonography study. Tohoku J. Exp.Med. 214 (2):145-149.
Denhardt, D.T., Lopez C.A., Rollo E.E., Hwang S.M., An XR, Walther S.E.,
Osteopontin induced modifications of cellular functions. Ann N Y
Acad Sci, 1995; 760:12742.
Departemen Kesehatan RI. Pedoman pengendalian penyakit jantung dan
pembuluh darah. Jakarta: Direktorat Jenderal Pengendalian Penyakit
dan Penyehatan Lingkungan Departemen Kesehatan RI. 2007.
Departemen Kesehatan RI. Pedoman surveilans epidemiologi penyakit jantung
dan pembuluh darah. Jakarta: Direktorat Jenderal Pengendalian
Penyakit dan Penyehatan Lingkungan Departemen Kesehatan RI.
2007.
Departemen Kesehatan RI. Laporan hasil riset kesehatan dasar (Riskesdas)
Indonesia Tahun 2007. Jakarta: Badan Penelitian dan Pengembangan
Departemen Kesehatan RI. 2008.
Departemen Kesehatan RI. Pedoman teknis penemuan dan tata laksana
penyakit diabetes melitus. Jakarta: Direktorat Jenderal Pengendalian
Penyakit dan Penyehatan Lingkungan Departemen Kesehatan RI.
2008.
Departemen Kesehatan RI. Petunjuk teknis pengukuran faktor risiko diabetes
melitus. Jakarta : Direktorat Jenderal Pengendalian Penyakit dan
Penyehatan Lingkungan Departemen Kesehatan RI. 2008.
Departemen Kesehatan RI. Riset Kesehatan Dasar Riskesdas 2007. Epi., Info
Badan Penelitian Dan Pengembangan Kesehatan. Kementerian
Kesehatan RI. 2012; Hal 122-124.
Deshmane, S.L., Kremlev S., Amini S., Sawaya B.E., Monocyte Chemoattractant
Protein-1 (MCP-1): An overview. J Interferon Cytokine Res; 2009; 29:
313-26.
Dietz, A., Hoffer M., Sitzer M., Teaching manual of color doppler sonography,
Stuttgart Germany, Georg Thieme Verlag. 2004.
Dik, M.G., Deeg D.J.H., Bouter L.M., Corder E.H., Kok A., Jonker C., Stroke and
Apoliprotein E (epsilon)4 are independent risk factors for cognitive
decline: A population-based study. Stroke. 2000; 31: 2431-6.
Di Legge, S., Hachinski V., Vascular cognitive impairment (VCI): Progress
towards knowledge and treatment. Dement Neuropsychol 2010;
4(1):4-13.
Dipiro, J.T., Robert L.T, Gary C.Y, Gary R.M, Barbara G.W, L. Michael P.
Pharmacotherapy: A pathophysiologic approach, 7th Ed. McGraw
Hill Companies: USA. 2008.

290 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Doobay, A.V., Anand S.S., Sensitivity and specificity of the Ankle Brachial Index
to predict future cardiovascular outcomes: A Systematic Review.
J.Arterioscler. Thromb. Vasc. Biol. 2005; 25: 1463-1469.
Dongoran, R.A., Jumlah neutrofil absolut sebagai indikator keluaran stroke
iskemik. Program Pasca Sarjana Magister Ilmu Biomedik dan
Program Pendidikan Dokter Spesialis Ilmu Penyakit Saraf Universitas
Diponegoro, Semarang. 2007. Available at: http://mbiomedik.
undip.ac.id/ [Accesed 3 September 2014].
Doyle, K.P., Yang T., Lessov N.S., Ciesielski T.M., Stevens S.L., Simon R.P. etal.,
Nasal administration of osteopontin peptide mimetics confers
neuroprotection in stroke. J Cereb Blood Flow Metab. 2008;
28:12351248.
Duncan, P.W., Zorowitz R., Bates B., Choi J.Y., Glasberg J.J., Graham G.D. etal.,
Management of adult stroke rehabilitation care. A Clinical Practise
Guideline. Stroke. 2005;36:100-43.
Easton, J.D., etal., Definition and evaluation of transient ischemic attack:
A scientific statement for healthcare professionals from the
American Heart Association/American Stroke Association Stroke
Council; Council On Cardiovascular Surgery And Anesthesia;
Council On Cardiovascular Radiology And Intervention; Council
On Cardiovascular Nursing; And Vascular Disease: The American
Academy Of Neurology Affirms The Value Of This Statement As An
Educational Tool For Neurologists. The Interdisciplinary Council On
Peripheral. 2009; 40:2276-2293.
Eggers, J. Evans, D.H., Baumgartner, R.W., Seidel, G. and Meyer-Wiethe, K.
Handbook on neurovascular ultrasound. Karger. New York. 2006.
Elkind, M.S., Inflammation, atherosclerosis, and stroke. Neurologist 2006; 12:
140-8.
Engstrom, Gunnar, etal. Occupation. (2005). Marital status, and low-grade
inflamation (Mutual confounding or independent cardiovascular risk
factors). Journal of The American Heart Asociation. Available:http:
atvb.ahajournals.org/content/26/3/643.full. pdf. [Accessed 1
Desember 2011].
Everson, S.A., Healkala E.L., Kaplan G.A., Salonen J.T., Atherosclerosis
and cognitive functioning. In: Waldstein S.R., Elias M.F. eds.
Neuropsychology of cardiovascular disease. New Jersey: Lawrence
Erlbaum Associates Inc., 2001: 105-20.
Farouk, A., Gamal B.M, Abd El-Maboud, Esmat A.L., Plasma concentration of
osteopontin (OPN) in children with systemic lupus erythematosus:
Relationship with disease Activity. The Open Autoimmunity Journal,
2009; 1,59-6359.
F-A-S-T Cara Mudah Mendeteksi Stroke. Available at:http://meetdoctor.com/
article/f-a-s-t-cara-mudah-mendeteksi-stroke#/page/2. [Accessed:
3 Agustus 2014].

Daftar Pustaka 291


Fauci, A., ,Kasper Dl., Longo Dl., Braunwald E., Hauser S.l, Jameson Jl.,
LoscalzoJ. Harrison's principles of internal medicine, 17th Ed., The
Mcgraw-Hill Companies, Inc, 2008. Chapter 364.
Feign, V., Panduan bergambar tentang pencegahan dan pemulihan stroke.
Ed. Indonesia. Cetakan ke-2. Jakarta: PT Bhuana Ilmu Populer. 2006
Agustus: 94-108.
Fisher, M. Occlusion of the internal carotid artery. AMA Arch Neural Psychiatryi,
1951; 65:346.
Fishman, J.A., Nosocominal pneumonia in fishmans pulmonary diseases and
disordes. 4th ed. New York: McGraw-Hill Int. 2008.
Flomann, E., Schulz, U.G.R., and Rothwell, P.M., 2003. Systematic review
of methods and result of studies of the genetic epidemiology of
ischemic stroke. J Stroke 35: 212-227.
Fowkes, F.G.R., Murray G.D., Butcher I., etal. Ankle Brachial Index combined
with framingham risk score to predict cardiovascular events and
mortality: A Meta Analysis. JAMA. 2008; 300: s197-s208.
Frankham, R. Relationship of genetic variation to population siza in wildlife.
Conservation Biology, 1996; 21(6): 1500-1508.
Fuentes, L, C., etal., Osteopontin promoter polymorphism is associated with
increased carotid intima-media thickness. J Am Soc Echocardiogr,
2008; 21(8): 954960.
Fujun Zhao, Xiaoyi Chen, Tingting Meng, Bo Hao, Zhihong Zhang and Guoxin
Zhang. Genetic polymorphisms in the osteopontin promoter
increases the risk of distance metastasis and death in chinese
patients with gastric cancer. BMC Cancer. 2012; 12 :477.
Furie, K.L., Kasner, S.E., Adams, R.J., Albers, G.W., Bush, R.L., Fagan, S.C.,dkk.,
Guidelines for the prevention of stroke in patients with stroke or
transient ischemic attack a guideline for healthcare professionals
from the American Heart Association/ American Stroke Association.
Stroke, 2011;42: 227276.
Giacopelli, F., Renato M., Angela P., Paolo C, Silvana C., Gerard K., Roberto R.,
Polymorphisms in the osteopontin promoter affect its transcriptional
activity. Physiol. Genomics. 2004; 20: 87-96.
Giasuddin, A.S.M. Polymearase chain reaction technique: Fundamental
aspects and applications in clinical diagnostics. Journal of Islamic
Academy of Sciences, 1995; 8: 129-132.
Gladstone. Alzheimers disease and Apoliprotein E.
Gofir, A., Manajemen stroke. Evidence based medicine. Pustaka Cendekia
Press, Yogyakarta. 2009. 45-50.
Gofir, A., Susilowati R., Zucha M.A., Ar-Rochmah M., Zulyadaini E., Hidayati
A.Z., Apoliprotein E polymorphism as a risk factor for Javanese with
vascular dementia in Yogyakarta. J Neuro Sci. 2009;285(1):S267.
Gofir, A. Diagnosis dini dan penanganan pertama stroke, Bagian Ilmu Penyakit
Saraf Fakultas Kedokteran UGM/ RS Sardjito Yogyakarta, Available
at: http://www.academia.edu/8070312 / DIAGNOSIS_DINI_DAN_
PENANGANAN_PERTAMA_STROKE_Bagian_Ilmu_Penyakit_Saraf_

292 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Fakultas_Kedokteran_UGM_RS_Sardjito_Yogyakarta.[Accessed: 17
Agustus 2014].
Goldstein, L.B., Adams R., Alberts M.J., etal. Primary Prevention of Ischemic
Stroke. A Guideline from the American Heart Association/
American Stroke Association Stroke Council: Cosponsored by the
atherosclerotic peripheral vascular disease interdisciplinary working
group; Cardiovascular nursing council; Clinical Cardiology Council;
Nutrition, Physical Activity, and Metabolism Council; and the Quality
of Care and Outcomes Research Interdisciplinary Working Group.
Stroke, 2006; 37: 15831633.
Golledge, J., Mc Cann M., Mangan S., Lam A., Karan M., Osteoprotegerin
and osteopontin are expressed at high concentrations within
symptomathic carotid atherosclerosis stroke. Stroke, 2004; 35:
1636 - 1641.
Gorelick, P.B., Risk factor for vascular dementia and alzheimer disease. Stroke
2004;35[sppl I]:2620-2622.
Gottesman, R.F., Hillis A.E., Predictors and assessment of cognitive dysfunction
resulting from ischemic stroke. Lancet Neurol 2010; 9: 895-905.
Granner, D.K., Weil A., Regulation of gene expression. Harper's Ilustrated
Biochemistry. Twenty-Seventh ed. India: The McGraw-Hill
Companies,Inc. 2006.
Grau, Aj., Weimar C., Buggle F., Heinrich A., Goertler M., Neumaier S., Glahn
J., Brandt T., Hacke W., Diener Hc. Risk factors, outcome, and
treatment in subtypes of ischemic stroke. The German Stroke Data
Bank. Stroke, 2001; 32;2559-2566.
Gray, H., Anatomy of the human body. New York: Bartleby.Com. 2000.
Gursoy, G., etal., Osteopontin a new probable marker for atherosclerosis in
obese women. Department of Internal Medicine, Ankara Education
and Research Hospital: Ankara, Turkey, 2010; 2(3): 35-40.
Gusev, E., Skorsova I., Mechanisms of ischaemic brain damage. In Eugene I,
Veronica S., Brain ischaemia. 1st ed. New York: Kluwer Academic/
Plenum Publisher, 2003: p.1-72.
Haan, M.N., Shemanski L., Jagust W.J., Manolio T.A., Kuller L., The Role of Apoe
e4 in modulating effects of other risk factors for cognitive decline in
elderly persons. JAMA 1999; 281(1):40-5.
Halcox, J.P.J., Donald A.E., Ellins E., Witte D.R., Shipley M.J., Brunner E.J.,
Marmot M.G., Deanfield J.E., Endothelial function predicts
progression of carotid intima-media thickness. Circulation; 2009;
119: 1005-1012.
Harian Umum Pelita, Hidup Sehat Bersama Stroke, Jakarta.2014. Available at:
http://www.pelita.or.id/baca.php?id=26946 [Accessed 28 Agustus
2014].
Harms, H., Halle E., Meisel A., Post-stroke infections-diagnosis, prediction,
prevention, and treatment to improve patient outcomes. 2008;
63:p.402-52. Citation: Eur Neurol Rev: 2010; 5(1): 39-43.

Daftar Pustaka 293


Hartono, B., Cognitive problems in elderly: the recent concept and approach.
In: Soetedjo, Duarsa, A.B., eds. Cognitive problems in elderly.
Semarang: BP UNDIP, 2002: 1-6.
Hassan, A., Khealani B.A., Shafqat S., Aslam M., Salahuddin N., Syed N.A.,
etal., Stroke-associated pneumonia: microbiological data and
outcome. Singapore Med J. 2006;47;204-7.
Hauser, P.S., Narayanaswami V., Ryan R.O., Apoliprotein E: from lipid transport
to neurobiology. Progress in lipid research. 2011; 5062-74.
Helgason, C.M., Wolf PA. American Heart Association Prevention Conference
IV. Prevention and rehabilitation of stroke. Circulation, 1997; 96:
701707.
Helzner E,.P., Luchsinger J.A., Scarmeas N., Cosentino S., Brickman A.M.,
Glymour M.M., Stern Y. Contribution of vascular risk factors to the
progression in Alzheimer disease. Arch Neurol, 2009;66(3): 343-8.
Hiekkanen, H., Apoliprotein E and recovery from traumatic brain injury
[dissertation]. Turku: University of Turku; 2009.
Hofman, A., Ott A., Breteler M.M.B., Bots M.L., Slooter A.J.C., vnaHarskampF.,
etal., Atherosclerosis, apoliprotein E, and prevalence of dementia
and Alzheimers disease in the Rotterdam Study. Lancet,
1997;349:151-4.
Hong, Y.M., Atherosclerotic cardiovascular disease beginning in childhood.
Korean Circ J;2010; 40: 1-9.
Honig, L.S., Tang M.X., Albert S., Costa R., Luchsinger J., Manly J., Stern Y.,
etal., Stroke and teh risk od Alzheimers disease. Arch Neurol,
2003;60:1707-12.
Hooijmans, C.R., Kiliaan A.J., Fatty acids, lipid metabolism and Alzheimer
pathology. Eur J. Pharm, 2008;585:176-96.
Horsburgh, K., McCarron M.O., Whitea F., Nicollb J.A.R. The role of apoliprotein
E in Alzheimers disease, acute brain injury and cerebrovascular
disease: evidence of common mechanisms and utility of animal
models. Neurobiology of Aging, 2000;21:245-55.
Hsiung, G.Y.R., Sadovnick D., Feldman H., Apoliprotein E 4 genotype as a risk
factor for cognitive decline and dementia: data from the Canadian
Study of Health and Aging. CMAJ, 2004;171(8):863-7.
Huang, Y., Eckardstein A., Wu S., Assmann G., Effects of the apoliprotein E
polymorphism on uptake and transfer of cell-derived cholesterol in
plasma. J Clin Invest. 1995;96:2693-701.
Huang, H., Virmani R. Younis H., Burke A. P., Kamm R. D., Lee R. T. The Impact
of calcification on the biomechanical stability of atherosclerotic
plaques. Circulation, 2001; 103: 1051-1056.
Hughes, P.M., Allegrini PR, Rudin M, Perry VH, Mir AK, Wiessner C, Monocyte
chemoattractant protein-1 deficiency is protective in a murine
stroke model. J Cereb Blood Flow Metab; 2009; 22: 308-317.
Huittinen, T.S.N., Atherosclerosis. Disertation, University of Oulu, Finland.
2003.

294 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Hull, Allison. Penyakit jantung, Hipertensi, dan Nutrisi. Jakarta : PT Bumi
Aksara. 1993.
Imran, Peran polimorfisme -455G/A dan -148C/T gen fibrinogen terhadap
kejadian hiperfibrinogenemia dan stroke iskemik akut usia muda,
Program Pascasajana, Fakultas Kedokteran, Universitas Padjajaran
Bandung, 2010. Available at : http://www.perdossi.or.id/doc/
cpd/attachment/218/12362/Cover%20Disertasi.pdf [Acessed: 5
September 2014].
Intan, M., Wijaya A., Penanda biokimia baru untuk stress oksidatif dan
inflamasi. Forum Diagnostikum. Jakarta: Prodia Diagnostic
Educational Service; 2004: 1-19.
Irita, J., Okura, T., Manabe, S. etal. Plasma osteopontin levels are higher in
patients with primary aldosteronism than in patients with essential
hypertension. Am. J. Hypertens, 2006; 19: 293297.
Isoda K., Kamezawa Y., Ayaori M., Kusuhara M., Tada N., Ohsuzu F., Osteopontin
transgenic mice fed a high-cholesterol diet develop early fatty-
streak lesions. Circulation;2003; 107: 679-681.
Isoda, K., Nishikawa K., Kamezawa Y., Yoshida M., Kusuhara M., Moroi M.,
Tada N., Ohsuzu F., Osteopontin plays an important role in the
development of medial thickening and neointimal formation. Circ
Res; 2002; 91: 77-82.
Ivan, C.S., Seshadri S., Beiser A., Au R., Kase C.S., Kelly-Hayes M., Wolf
P.A., Dementia after stroke: The Framingham Study. Stroke.
2004;35:1264-1269.
Iwai, N., Kajimoto K., Kokubo Y., Okayama A., Miyazaki S., Nonogi H., GotoY.,
Tomoike H., Assessment of genetic effects of polymorphisms in the
MCP-1 gene on serum MCP-1 levels and myocardial infarction in
Japanese. Circ J; 2006; 70: 805-9.
Janssen, A.W.M., Leeuw, F.E., Janssen, M.C.H., 2011. Risk factors for ischemic
stroke and transient ischemic attack in patients under age 50.
JThromb Thrombolysis 31:85-91.
Japardi I., Patofisiologi stroke infark akibat tromboemboli. Bagian bedah saraf
Fakultas Kedokteran Universitas Sumatera Utara. 2002:1-9.
Jrvisalo, M.J., Jartti L., Nnt-Salonen K., Irjala K., Rnnemaa T., Hartiala
J.J., Celemajjer D.S., Raitakari O.T., Increased aortic intima-media
thickness. Circulation; 2001; 104: 2943-2947.
Jennie, M.N., Yudiarto L.Y., Pengelolaan mutakhir stroke: Patofisiologi stroke.
Semarang: Badan Penerbit Universitas Diponegoro. Semarang;
1992:17-26.
Jerrad-Dunne P., Markus H.S., Steckel D.A., Buehler A., Von Kegler S., Sitzer
M., Early carotid atherosclerosis and family history of vascular
disease. Arteriosclerosis, thrombosis, and vascular biology; 2003;
23: 302306.
Jiwa, N.S., Garrad P., Hainsworth H., Experimental models of vascular
dementia and vascular cogntive impairment: a systematic review.
JNeurochem 2010;115: 822.

Daftar Pustaka 295


Johnsen, S.H., Mathiesen E.B., Joakimsen O., Stensland E., Wilsgaard T.,
Lchen M.L., Njlstad I., Arnesen E., Carotid atherosclerosis is a
stronger predictor of myocardial infarction in women than in men.
Stroke; 2007; 38: 2873-2880.
Junaidi, Iskandar. Panduan praktis pencegahan dan pengobatan stroke.
Jakarta: PT Bhuana Ilmu Populer. 2004.
Kallio, K., Exposure to tobacco smoke and markers of subclinical atherosclerosis
in children and adolescents, The STRIP Study. Disertation, University
of Turku, Turku, Finland. 2009.
Kamus Besar Bahasa Indonesia, Pusat Bahasa Departemen Pendidikan
Nasional. Jakarta .2008.
Kamus Besar Bahasa Indonesia (KBBI) Online-definisi kata. Available at:http://
kbbi.web.id/ [Accessed: Agustus 2014].
Kassab, M.Y., Majid,A., Farooq,M.U., Azhary, H., Hershey, L.A., Bednarczyk,
E.E., Graybeal, F.D. and Johnson, M.D. Transcranial doppler: An
Introduction for primary care physicians. J Am Board Fam Med.
2007;20:6571.
Kawamata J., Tanaka S., Shimohama S., Ueda K., Kimura J., Apoliprotein E
polymorphism in Japanese patients with Alzheimers disease or
vascular dementia. J Neurol Neurosurg Psych 1994;57:1414-6.
Khan, S.P., Ahmed K.Z. ,Yaqub Z., Ghani R., Caroti intima-media
thickness correlation with lipid profilein patients with familial
hypercholesterolemia versus controls. J Coll Physicians SurgPak.
2011 Jan; 21(1):30-3.
Kiefer, F., etal., Osteopontin expression in human and murine obesity:
Extensive loca lup-regulation in adipose tissue but minimal
systemic alterations. Endocrinology, 2008: 149(3): 1350-1357.
Kim, E.S.H., Wattanakit K., Gornik HL. Using the Ankle Brachial Index to
diagnose peripheral arterial disease and assess cardiovascular risk.
Cleve.Clin.J.Med. 2012; 79: 651-661.
Knopman, D.S., Roberts R.O., Geda Y.E., Boeve B.F., Pankratz V.S., Cha R.H.,
Tangalos E.G., etal., Association of prior stroke with cognitive
function and cognitive impairment: A population-based study. Arch
Neurol. 2009;66(5):614-9.
Koda-Kimble Ma, Lloyd Yy. ,Alldredge Bk., Corelli Rl, Guglielmo Bj., Kradjan
Wa, Williams Br., .Applied therapeutics: The clinical use of drugs, 9th
Ed. Lippincott Williams & Wilkins. 2009. Chapter 55.
Konto, A.H., Oxygen radicals in cerebral ischemia. American Heart Association
Journal. Stroke, 2001; 32:2712.
Koskinen, J., etal., Conventional cardiovascular risk factors and metabolic
syndrome in predicting carotid intima media thickness progression
in young adults. Circulation; 2009; 120: 229-236.
Kotsis, V.T., Stabouli S.V., Papamichael CM, Zakopoulos N.A., Impact of
obesityin intima media thicknessof carotid arteries. Obesity (Silver
Spring). 2006 Oct;14(10):1708-15.

296 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Koyanagi, M., Egashira K., Kitamoto S., Ni W., Shimokawa H., Takeya M.,
Yoshimura T., Tajeshita A., Role of monocyte chemoattractant
protein-1 in cardiovascular remodeling Induced by chronic blockade
of nitric oxide synthesis. Circulation; 2000; 102: 2243-2248.
Kuller, L.H., Shemanski L., Manolio T., Haan M., Fried L., Bryan N., Burke G.L.,
etal., Relationship between ApoE, MRI findings, and cognitive
function in the cardiovascular health study. Stroke. 1998;29:388-98.
Kumar, R., Looi J.C.L., Raphael B., Type 2 diabetes mellitus, cognition and brain
in aging: A brief review. Indian J Psychiatry 2009;51(Suppll):S35-8.
Kurata, M., Okura T., Watanabe S., Fukuoka T., Higaki J., Osteopontin and
carotid atherosclerosis in patients with essential hypertension. Clin.
Sci; 2006;111: 319-324.
Kurl, S., Laukkanen J.A., Nyyssonen K., Lakka T., Sivenius J., Salonen J.T., Plasma
vitamin C modifies the association between hypertension and
risk of stroke. Journal of The American Heart Association. Dallas.
2002;33:1568-73.
Kurniasih, R., Wijaya A., Peranan radikal bebas pada iskemia-reperfusi serebral
atau miokardium. Forum Diagnostikum. Jakarta: Prodia Diagnostic
Educational; 2002; 1-22.
Kurtzke, J.F., Epidemiology: Stroke, pathophysiology, diagnosis, and
management. 1st ed. New York: Churchill Livingstone; 1996: 3-19.
Kustiowati, E., Dharmana E., Dongoran R.A., Jumlah neutrofil absolut
sebagai indikator keluaran stroke iskmeik akut [Tesis] Universitas
Diponegoro, Semarang. 2008.
Kusuma, Y., Venketasubramnian N., Kiemas L.S., Misbach, J. Burden of stroke
in Indonesia. Int J Stroke; 2009. 4: 379-80.
Lamarche, B., Moorjani S., Lupien P.J., Cantin B., Bernard P.M., Dagenaiset
G.R., etal., Apoliprotein A-1 and B levels and the risk of ischemic
heart disease during a five-year follow-up of men in the Quebec
cardiovascular study. Circulation. 1996;94:p.273-8.
Langdon, P.C., Lee A.H., Binns C.W., High incidence of respiratory infections
in Nil by mouth tube-fed acute ischemic stroke patients.
Neuroepidemiol. 2009; 32:107-13.
Leduc, V., Be Langer S.J., Poirier J., ApoE and cholesterol homeostasis
in Alzheimers disease. Trends in Molecular Medicine, 2010;
16(10):46975.
Lee, T.Y., Lin J.T., Wu C.C., Yu C.C., Wu M.S., Lee T.C., Chen H.P., Wu C.Y.,
Osteopontin promoter polymorphisms are associated with
susceptibility to gastric cancer. J Clin Gastroenterol, 2013; 47(6):
e55-e59.
Lemeshow, S. Adequacy of sample size in health studies, Chichester England
and New York, NY, USA, Published on behalf of the World Health
Organization by Wiley. 1990.
Lesniak, M., Bak T., Czepiel W., Seniow J., Czlonkowska A. Frequency and
prognostic value of cognitive disorders in stroke patients. Dement
Geriatr Cogn Disord, 2008; 356-63.

Daftar Pustaka 297


Leupker, Russell V., etal. Cardiovascular survey methods. Geneva: WHO. 2004.
Liao, Y.C., Lin H.F., Rundek T., Cheng R., Guo Y.C., Sacco R.L., Juo SHH.. Segment-
specific genetic effects on carotid intima-media thickness. Stroke;
2008; 39: 3159-3165.
Litwin, M, Niemerska A. Intima-media thickness measurements in children
with cardiovascular risk factors. Pediatr Nephro; 2009; 24: 707-19.
Liviakis, L., Pogue B., Paramsothy P., Bourne A, Gill Ea. Carotid intima-media
thickness for the practicing lipidologist. Journal Of Clinical Lipidology,
2010; 4, 2435.
Lloyd, J.D., etal., Heart diseaseand stroke statistic. Update: A Report From
the American Heart Association Statistics Committee and Stroke
Statistics Subcommittee. Circulation, 2009; 119:e21-e181.
Lorenz, M.W., etal., Prediction of clinical cardiovascular events with carotid
intima-media thickness: A Systematic review and meta-analysis.
Circulation. 2007, 115:459467.
Louie, M., Louei, L. And Simor, A.E. The Role of DNA amplification technology
in the diagnosis of infectious disease. CMAJ, 2000; 163 (3): 301-309.
Lumongga, Fitriani. (2007). Atherosclerosis. 2007. Available at: http://
repository.usu.ac.id/bitstream/123456789/2060/1/09E01458.pdf
[Accessed: 28 November 2011].
Luomala, M., Paiva H., Thelen K., Laaksonen R., Saarela M., Matiala K.,
Ltjohann D., Lehtmak T., Osteopontin levels are associated
with cholesterol synthesis markers in mildly hypercholestrolemic
patients. Acta Cardiol, 2007; 62(2): 177-181.
Lusis, A.J., Mar R., Pajukanta P., Genetics of atherosclerosis. Annu Rev
Genomics Hum Genet; 2004; 5: 189-218.
Madiyono, B., Muslichan S., Sastroasmoro S., Boediman I., Purwanto S.H.,
Perkiraan besar sampel. Dalam: Sastroasmoro S., Ismael S., editors.
Dasar-dasar metodologi penelitian klinis. Edisi 2, Jakarta: CV Sagung
Seto. 2002.p.259-286.
Madiyono, B., Suharti K., Suherman. Pencegahan stroke dan serangan
jantung pada usia muda. Jakarta : Fakultas Kedokteran Universitas
Indonesia. 2003.
Magyar, Mt., Szikszai Z., Balla J., Valikovics A., Kappelmayer J.,Imre S., Balla
G., Jeney V., Csiba L., Bereczki D., Early-onset carotid atherosclerosis
is associated with Increased intima-media thickness and elevated
serum levels of inflammatory marker. Stroke, 2003;34:58-63.
Manolio, T.A., Boerwinkle E., ODonnel C.J., Wilson A.F., Genetics of
ultrasonographic carotid atherosclerosis. Arteriosclerosis,
thrombosis, and vascular biology; 2004; 24: 1567-1577.
Mardjono, M., Sidharta P., Neurologi klinis dasar. Jakarta: Dian Rakyat; 2000.
368-69.
Marlina, Y. 2010. Gambaran faktor risiko pada penderita stroke iskemik di RSUP
H. Adam Malik Medan, Universitas Sumatera Utara , Available at:
http://repository.usu.ac.id/handle/123456789/31212 [Accessed: 3
September 2014].

298 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Marnane, M., Duggan C.A., Sheehan O.C., Merwick A., Hannon N., CurtinD.,
etal., Stroke subtype classification to mechanism-specific and
undertermined categories by TOAST, A-S-C-O, and causative
classification system. Direct comparison in the North Dublin
population stroke study. Stroke. 2010;41:1579-86.
Marshall, R.S., Lazar R.M., Pumps, Aqueducts, and drought management:
vascular physiology in vascular cognitive impairment. Stroke,
2011;42:221-6.
Mathew, A., Yoshida Y., Maekawa T., Kumar D.S., Alzheimers disease:
Cholesterol a menace? Brain res. Bull. 2011.
Matsui, T., Ebihara T., Ohrui T., Yamaya M., Arai H., Sasaki H., Cerebrovascular
disease and pneumonia in elderly. Nippon Ronen Igakkai Zasshi.
2003 Jul:40(4): 325-8.
Mazzali, M., Kipari T., Ophascharoensuk V., Wesson J.A., Johnson R., HughesJ.,
Osteopontin-a molecule for all seasons. QJM; 2002; 95: 3-13.
McPhee J.T., Schanzer A., Messina L.M., Eslami M.H., Carotid artery stenting
has increased rates of postprocedure stroke, death, and resource
utilization than does carotid endarterectomy in the United States,
2005. Journal of Vascular Surgery. 2008;48:144250.
Meldrum, B., The role of nitric oxide in ischemic damage. Philadelphia:
Lippincott-Raven Publishers; 1996: 355-60.
Meller, R., Stevens S.L., Minami M., Cameron J.A., King S., Rosenzweig H.,
DoyleK., Lessov N.S., Simon R.P., Stenzel-Poore M.P. Neuroprotection
by osteopontin in stroke. J Cereb Blood Flow Metab;2005;25: 217-
225.
Meng, W., Tobin J.R., Busija D.W., Glutamate induced cerebral vasodilatation
in mediated by nitric oxide through NMDA receptors. American
Heart Association Journal. Stroke: 1995;26:857-63.
Meutia, E., Efek parameter hematologi rutin dan usia terhadap hasil
pemeriksaan transcranial doppler dan hubungan nya dengan
outcome pada pasien stroke iskemik akut. Program Magister
Kedokteran Klinik Spesialis Ilmu Penyakit Saraf, Fakultas Kedokteran
Universitas Sumatera Utara, Medan. 2010. Available at: http://
repository.usu.ac.id/ handle/123456789/19329 [Accessed: 10
September 2014].
Meyer, B.C., Hemmen, T.M., Jackson, C.M. and Leyden, P.D. 2002. Modified
national institutes of health stroke scale for use in stroke clincal
trials: Prospective realibility and validity. Stroke: 33:1261-1266
Miller, D.T., Ridker P.M., Libby P., Kwiatkowski D.J., Atherosclerosis: The
path from genomics to therapeutics. J Am Coll Cardiol; 2007; 9:
15891599.
Minoretti, P., Falcone C., Calcagnino M., Emanuele E., BuzziI M.P., Coen E.,
Geroldi D., Prognostic significance of plasma osteopontin levels in
patients with chronic stable angina. European Heart Journal; 2006;
27: 802-807.

Daftar Pustaka 299


Misbach, J., Stroke, aspek diagnostik, patofisiologi, manajemen, edisi pertama,
BP FK Universitas Indonesia, Jakarta. 1999.
Misbach, J., Kalim H. Stroke mengancam usia produktif. Jakarta. Available
at: http://medicastore.com/stroke/Stroke_Pembunuh_No_3_di_
Indonesia.php. 2011. [Accessed 27 0ktober 2011].
Muller, M.P., Tomlinson G., Marrie T.J., Tang P., McGeer A., Low D.E., etal.,
Can routine laboratory tests discriminate between severe acute
respiratory syndrome and other causes of community-acquired
pneumonia? Clin Infect Dis. 2005;40:1079-86.
Mullis, K.B., The unusual origin of the polmerase chain reaction. Scientific
American. 1990;3:56-65
Munshi, Anjana. DNA sequencingmethods and applications. In Tech: Croatial.
2012.
Murray, R.K., Granner D.K., Mayes P.A., Rodwell V.W., Harpers biochemistry.
24th ed. Stamford: Appleton & Lange: 1993;120-122: 736-37.
Murray, R., Daryl K., Peter A., Victor W., Harpers Illustrated Biochemistry.
McGraw-Hill Companies: USA. 2003.
Mutu, C., Minea N., Pereanu M., Comparative study of carotid intima
media thickness in ischemic stroke subtypes. Romanian Journal Of
NeurologyVolume Xi, No. 2, 2012.
Nadeau, Y., Black S.E., Mixed dementia: The most common cause of dementia.
Canadian J Diag. 2010.
Nagatomi, R., Leukocyte counts and immune function. The implication of
alterations in leukocyte subset counts on immune function. Exerc.
Immunol. 2006. Rev.12: 54-71.
National High Blood Pressure Education Program Working Group on High
Blood Pressure in Children and Adolescents. The Fourth report on
the diagnosis, evaluation, and treatment of high blood pressure in
children and adolescents. Pediatrics; 2004;114: 555-76.
Nau, G.J., Osteopontin. In: Oppenhium J.J., Feldmann M., Durum S.K., editors.
Cytokine reference: A compendium of cytokines and other mediators
of host defense. 1st ed. San Diego: Academic Press. 2000. 689701.
Ness, J., Aronow W.S., Ahn, C., Risk factors for ischemic stroke in older persons
in an Academic Hospital based geriatrics practice. J Preventive
Cardiology 1999; 3:118-120.
Neumyer, M.M., Alexandrov, A.V., Bartels, E., Wojner, A.W. and Demchuk, A.M.
Cerebrovascular ultrasound in stroke prevention and treatment.
Blackwell Publishing. New York. 2004.
Noort, A.V.D., Caplan, L., Dyck, P., Ferguson, J., Greenberg,J., Jacobs, L.,
Kittredge, F., Markham, C., Nuwer, M., Richard, T., Adam, R.J., Brass,
L.M., Caplan, L.R., Witt, D.D., Gomez, C.R., Otis, S.M., Reutern,
O.G.M. and Wechsler, L.R. Assessment: Transcranial Doppler
Neurology.1990;40;680-684.
Norgren, L., Hiatt W.R., Dormandy J.A., etal. Inter-society consensus for the
management of peripheral arterial disease (TASC II). J.Vasc.Surg.
2007; 45 (suppl.A): 5-67.

300
Notoatmodjo, Soekidjo. Promosi kesehatan dan ilmu perilaku. Jakarta : Rineka
Cipta. 2007.
Nyquist, P.A., Winkler R.C.A., Mckenzie L.M., Yanek L.R., Becker L.C., Becker
D.M., Single nucleotide polymorphisms in monocyte chemoattractant
protein-1 and its receptor act synergistically to increase the risk of
carotid atherosclerosis. Cerebrovasc Dis; 2009; 28: 124-30.
Nyquist, P.A., Zhang J., De Graba T.J.. The -928 G/C and -362 G/C Single-
nucleotide polymorphisms in the promoter of MCP-1: Increased
transcriptional activity and novel binding sites. Cerebrovasc Dis;
2010; 29: 242-7.
Nys, G.M.S., Zandvoort M.J.E., De Kort P.L.M., Jansen B.P.W., Van Der Worp
H.B., Kappelle L.J. etal., Domain-specific cognitive recovery aafter
firts-ever stroke: a follow-up study of 111 cases. J Int Neuropsychol
Soc 2005; 11: 795-806.
Ohmori, R., Momiyama, Y., Taniguchi, H. etal. Plasma osteopontin levels are
associated with the presence and extent of coronary artery disease.
Atherosclerosis, 2003; 170: 333337.
O'leary, Dh., Polak Jf., Kronmal Ra., Manolio Ta, Burke Gl., Wolfson Sk,Jr.
Carotid-artery intima and media thickness as a risk factor for
myocardial infarction and stroke in older adults. Cardiovascular
Health Study. Collaborative Research Group.Nengl JMed,1999;
340(1):14-22.
Pan, H.W., Ou Y.H., Peng S.Y., Liu S.H., Lai P.L., Lee P.H., Sheu J.C., etal.
Overexpression of osteopontinis associated with intrahepatic
metastasis, early recurrence, and poorer prognosis of surgically
resected hepatocellular carcinoma. Cancer, 2003; 98:119127.
Pantoni, L. Gorelick P. Advances in vascular cognitive impairment 2010. Stroke.
2011 42: 291-3.
Papp, A.C., Pinsonneault J.K., Cooke G., etal. (2003). Single nucleotide
polymorphism genotyping using allele-specific PCR and fluorescence
melting curves. Biotechniques 34:106872.
Patel, Chandra. Fighting heart disease: A practical self-help guide to prevention
and treatment. 3rd ed. Great Britain: Dorling Kindersly. 1995.
Paul, Schoenhagen. Osteopontin, coronary calcification & cardiovascular
events: Future diagnostic & therapeutic targets for disease
prevention. Eupopean Heart Jounal, 2006; 27: 766 767.
Paulus, W., Frantsz S., Kelly R., Nitric oxide and cardiac contractility in huma
heart failure. American Heart Association. Circulation. 2001; 104:
2260-62.
Pearson, Thomas A. etal. (1994). Primer in preventive cardiology. Texas
American Heart Association.
PERDOSSI, P. S., Guideline stroke tahun 2004, Edisi ketiga. Kelompok Studi
Serebrovaskuler Perhimpunan Dokter Spesialis Saraf Indonesia
PERDOSSI, Jakarta: 2004.
PERDOSSI, P. S., Guideline stroke tahun 2011, Perhimpunan Dokter Spesialis
Saraf Indonesia (PERDOSSI). Jakarta: 2011.

301
Pramudita, E.A., Hubungan nilai Ankle Brachial Index dengan stroke iskemik
akut. Fakultas Kedokteran Universitas Gajah Mada. Yogyakarta,
2011.
Prass, K., Braun J.S., Dirnagl U., Meisel A., Stroke propagates bacterial
aspiration to pneumonia in a model of cerebral ischemia. Stroke
2006; 37: 2607-12.
Prass, K., Meisel C., Hoflich C., Braun J., Halle E., Wolf T. etal., Stroke induced
immunodeficiency promotes spontaneous bacterial infections and is
mediated by symphatetic activation reversal by poststroke T helper
cell type 1-like immnunostimulation. J. Exp. Med.2003; 198: 725-36.
Pudjonarko, Dwi. Keterkaitan stroke dan jantung. 20 November 2011.
Available at: http://suaramerdeka.com/v1/index.php/read/cetak/
2009/10/08/83213/Keterkaitan-Stroke-dan-Jantung. [Accessed: 3
Agustus 2014].
Puroy, F, Coll B, Oro M, etal. Predictive value of ankle brachial index in patients
with Acute ischemic stroke, Eur.J.Neurol. 2011; 4: 602-6.
Rahman, A., Faktor-faktor risiko mayor aterosklerosis pada berbagai penyakit
aterosklerosis di RSUP Dr. Kariadi Semarang. (skripsi). Semarang.
Fakultas Kedokteran Universitas Diponegoro. 2012.
Rahmawati, D., Diagnosis dan faktor risiko demensia vaskuler pada usia lanjut.
Dalam: Muhartomo H.M., Trianggoro B., eds. Update managemen
of neurological disordes in elderly. Semarang: BP UNDIP, 2006:
12945.
Rambe, A.S., Stroke: Sekilas tentang definisi, penyebab, efek, dan
faktor risiko. 2010. Available at: http://repository.usu.ac.id/
bitstream/../18925/../ikm-des2006-10%20(3).pdf [Accessed 23
April 2011].
Rasquin, S.M.C., Verhey F.R.J., van Oostenbrugge R.J., Lousberg R., Lodder J.,
Demographic and CT scan features related to cognitive impairment
in the first year after stroke. J Neurol Neurosurg Psychiatry 2004;
75: 1562-1567.
Reinanda, H., Hubungan Nilai Ankle Brachial Index dengan stroke iskemia
di RSUD Dokter Seodarso Pontianak. Universitas Tanjungpura,
Pontianak. 2013. Available at: http:// jurnal.untan.ac.id/index.php/
jfk/article/viewFile/4155/4188. [Accessed 12 Agustus 2014].
Ryerson, S.D., Hemiplegia in Umphred DA (Ed). Neurological Rehabilitation.
3rd ed. St. Louis: Mosby: 1985; 681-721.
Riddell, D.R., Zhou H., Atchison K., Warwick H.K., Atkinson P.J., Jefferson J.,
etal., Impact of Apoliprotein E (ApoE) polymorphism on brain ApoE
levels.
Roger, V.L., etal., Heart Disease and Stroke Statistics2011 Update / 1. About 1.
About These Statistics / 2. American Heart Association's 2020 Impact
Goals / 3. Cardiovascular Diseases / 4. Subclinical Atherosclerosis /
5. Coronary Heart Disease, Acute Coronary Syndrome, and Angina
Pectoris / 6. Stroke (Cerebrovascular Disease) / 7. High Blood
Pressure / 8. Congenital Cardiovascular Defects / 9. Cardiomyopathy

302
and Heart Failure / 10. Other Cardiovascular Diseases / 11. Family
History and Genetics / 12. Risk Factor: Smoking/Tobacco Use / 13.
Risk Factor: High Blood Cholesterol and Other Lipids / 14. Risk Factor:
Physical Inactivity / 15. Risk Factor: Overweight and Obesity / 16.
Risk Factor: Diabetes Mellitus / 17. End-Stage Renal Disease and
Chronic Kidney Disease / 18. Metabolic Syndrome / 19. Nutrition /
20. Quality of Care / 21. Medical Procedures / 22. Economic Cost
of Cardiovascular Disease / 23. At-a-Glance Summary Tables / 24.
Glossary. Circulation; 2011; 123: e18-e209.
Roquer, J., Segura T., Joaquin S., Cuadrado-Godia E., Blanco M., Garcia-
GarciaJ., Castillo J., Value of carotid intima-media thickness and
significant carotid stenosis as markers of stroke recurrence.
Stroke, 2011; 42:3099-3104.
Rundek, T., Elkind M.S., Pittmann J., Boden-Albala B., Martin S., Humphries
S.E., Juo S.H.H., Sacco, R.L., Carotid intima-media thickness is
associated with allelic variants of stromelysin-1, interleukin-6, and
hepatic lipase genes. Stroke; 2002; 33: 1420-1423.
Russo, T., Felzani G., Marini C., Stroke in the Very Old: A Systematic review of
studies on incidence, outcome, and resource use. J Aging Res; 2011:
108785.
Sacco, R.L., Vascular Disease. In: Rowland, L.P, ed. Merritts neurology. 8th ed.
Dallas: Williams & Wilkins, 2000. 275-290.
Sacco, R.L., Blanton S.H., Slifer S., Beecham A., Glover K., Gardener H., Wang
L., Sabala E., Juo S.H., Rundek T., Heritability and linkage analysis for
carotid intima-media thickness: The Family study of stroke risk and
carotid atherosclerosis. Stroke; 2009; 40: 2307-12.
Saczynski, J.S., Sigurdsson S., Jonsdottir M.K., Eiriksdottir G., Jonsson P.V.,
Garcia M.E., Kjartansson O., etal., Cerebral infarcts and cognitive
performance importance of location an dnumber of infarcts. Stroke.
2009; 40: 677-682.
Saidi, S., Slamia L.B., Ammou S.B., Mahjoub T., Almawi W.Y., Association of
Apoliprotein E gene polymorphism with ischemic stroke involving
large-vessel disease and its relation to serum lipids levels. J Stroke
Cerebrovasc Dis 2007; 16(4): 160-6.
Saiki, R.K, Gelfund, D.H, Stoffel, S., Scharf, S.J., Higuchi, R., Horn, G.T., Mullis,
K.B. and Erlich, H.A., 1988. Primer-directed enzymatic amplification
of DNA with a thermostable DNA polymerase. Sci. 2006;239:
487491.
Sase, S.P., Jayashree V. Ganu, Nitin Nagane., Osteopontin: A Novel protein
molecule. Indian Medical Gazette. 2012.
Satyanegara. Ilmu bedah saraf, Ed. ke-4, PT Gramedia Pustaka Utama, Jakarta
2011; 226-230.
Scarborough, P., Peto V., Bhatanagar P., Kaur A., Leal J., Luengo-Fernandes
R., Gray A, Rayner M., Allender S., Stroke statistics. British Heart
Foundation Statistics Database. 2009, p. 44-45.

303
Scatena M., Liaw L., Giachelli Cm., Osteopontin: A Multifunctional molecule
regulating chronic inflammation and vascular disease. Arterioscler
Thromb Vasc Biol. 2007; 27:2302-2309.
Schlegel, D., Kolb, S.J., Luciano, J.M., Tovar, J.M., Cucchiara, B.L., Liebeskind,
D.S. and Kasner S.E. Utility of the NIH stroke scale as a predictor of
hospital disposition. Stroke. 2003;34:134-137
Schilling, M., Strecker J.K., Ringelstein E.B., Schbitz W.R., Kiefer R. The Role of
CC chemokine receptor 2 on microglia activation and blood-borne
cell recruitment after transient focal cerebral ischemia in mice. Brain
Research; 2009; 1289: 79-84.
Schork, N.J., Fallin D., Lanchbury S., Single nucleotide polymorphisms and the
future of genetic epidemiology. Clin Genet, 2000; 58: 250 264.
Sellars, C., Bowie L., Bagg J., Sweeney M.P., Miller H., Tilston J., etal., Risk
factors for chest infection in acute stroke. A prospective Cohort
study. Stroke. 2007; 38: 2284-91.
Sen, S., Lynch DR, Kaltsas JE, etal. Association of asymptomatic peripheral
arterial Disease with vascular events in patients with stroke or
transient ischemic attack. J. Stroke. 2009; 40: 3472-3477.
Seri Gaya Hidup Sehat: Cara bijak hadapi stroke, jantung & pembuluh darah,
Agustus 2007, PT Gramedia.
Shah, S. Stroke pathophysiology. Foundation For Education And Research In
Neurological Emergencies.1997; 3.
Sharma, P., Lohani B., SP Chat aut.Ultrasonographic evaluation of carotid
intima-media thicknessin hypertensive and normotensive
individuals. Original Article Nepal MedColl J. 2009; 11(2): 133-135.
Sherki, Y.G., Rosenbaum Z., Melamed E., Offen D., Antioxidant therapy in acute
central nervous system injury: Current State. The American Society
for Pharmacology and Experimental Therapeutics, Pharmacol Rev,
2002; 54: 271-84.
Sidhu, P.S. Ultrasound of the carotid and vertebral arteries. British Medical
Bulletin. 2000.;56 (No 2): 346-366.
Silbert, L.C., Howieson D.B., Dodge H., Kaye J.A., Cognitive impairment risk:
white matter hyperin tensity progression matters. Neurology, 2009;
73: 120-5.
Simon, A., Chironi G., The Relationship between carotid intima-media
thickness and coronary atherosclerosis revisited. European Heart
Journal, 2007; 28: 20492050.
Sing, C.F., Davignon J., Role of Apoliprotein E polymorphism in determining
normal plasma lipid and lipoprotein variation. Am J Hum Genet,
1985; 37: 268-82.
Singh, M., Ananthula S., Milhorn D. M., Krishnaswamy G., Singh K. Osteopontin:
A Novel inflammatory mediator of cardiovascular disease. Frontiers
in Bioscience, 2007; 12: 214-221.
Sirimarco, G., Deplanaque D., Lavale P.C., Labreuche J., Meseguer E., Cabrejo
L., Guidoux C., Olivot J.M., Abboud H., Lapergue B., Klein I.F., Mazighi

304
M., Touboul P.J., Bruckert E., Amarenco P. Atherogenic dyslipidemia
in patients with Transient ischemic attack. Stroke. 2011.
Siswanto, Y. Beberapa faktor risiko yang mempengaruhi kejadian stroke
berulang. Fakultas Kedokteran Universitas Diponegoro. Semarang,
2005.
Siswinarti. Peran ultrasonografi untuk deteksi dini atherosklerosis subklinis
pada anak dengan orang tua stroke iskemia. Master, Universitas
Brawijaya, Malang. 2011.
Sjahrir, H., 2003. Stroke iskemik. Medan: Yandira Agung.
Sloan, M.A., Alexandrov, A.V., Tegeler, C.H., Spencer, M.P., Caplan, L.R.,
Feldmann, E., Wechsler, L.R., Newell, D.W., Gomez, C.R., Babikian, V.L.,
Lefkowitz, D., Goldman, R.S., Armon, C., Hsu, C.Y. and Goodin,D.S.
Assessment: Transcranial Doppler ultrasonography : Report of the
Therapeutics and Technology Assessment. Subcommittee of the
American Academy of Neurology. Neurology.2004; 62: 14681481.
Smith, E.E., Koroshetz W.J., Epidemiology of stroke. In: Furie K.L., Kelly P.J.,
eds. Handbook of stroke prevention in clinical practise. New Jersey:
Humana Press, 2004: 1-8.
Smith, K. Genetic polymorphism and SNPs. 2002.
Smith, S.C. Jr, Allen J., Blair S.N., etal. AHA/ACC Guidelines for secondary
prevention for patients with coronary and other atherosclerotic
vascular disease: 2006 update: Endorsed by the National Heart, Lung,
and Blood Institute [Erratum Appears in Circulation 2006;113:e847].
Circulation, 2006; 113: 23632372.
Soeharto, Iman. Serangan jantung dan stroke hubungannya dengan lemak
dan kolesterol. Jakarta : PT Gramedia Pustaka Utama. 2004.
Soewoto, H., Peran radikal bebas pada proses menua. Pertemuan Nasional
Neurogeriatri. Jakarta: 2002: 1-16.
Sulistyaningsih, E. 2007. Polymerase Chain Reaction (PCR): Era baru diagnosis
dan manajemen penyakit infeksi. Biomedis. 1(1): P. 17-25.
Suroto. The Biomolecular aspect of acute ischaemic stroke. In: Management
of acute stroke. Temu Regional Neurologi Jateng-DIY ke XIX,
16-19 September 2002, Semarang: Badan Penerbit Universitas
Diponegoro,2002: 23-35.
Standal, T., Borset M., Sundan A., Role of osteopontin in adhesion, migration,
cell survival and bone remodeling. Exp Oncol 26.2004.
Stanimirovic, D., Ssatoh K., Inflammatory mediators of cerebral endothelium:
A role in ischemic brain inflammation. Journal of brain pathology.
Canada. 2000; 10: 113-26.
Stroke Association. (2010). Converging risk factors. 2010. Available at: http://
www.strokeassosiation.org. [Accessed: 8 Desember 2011].
Sudhir, P.S., Jayashree V.G., Nitin N., Osteopontin: A Novel protein molecule.
Indian Medical Gazette. 2012. Ed 62.
Sulter, G., Steen, C. and Keyser, J.D., Use of the barthel index and modified
rankin scale in acute stroke trials. Stroke. 1999; 30:1538-1541.
Suroto. Peran sitokin pada stroke iskemik akut. Neurona: 2002: 19: 3: 4-8.

305
Susan Amanda Lund, Cecilia M. Giachelli, and Marta Scatena., The role of
osteopontin in inflammatory process. J Cell Commun Signal. Dec
2009; 3 (3-4): 311-322. Published online 2 Ockotober 2009. doi:
10.1007/s12079-009-0068-0 , Available at: http://www. ncbi.nlm.
nih.gov/pmc/articles/PMC2778587/, [Accessed 3 Agustus 2014].
Syahrul, Polimorfisme GLY 972ARG gen IRS-1 dan G2350A gen ACE pada stroke
iskemik, Universitas Gadjah Mada, Yogyakarta, 2013. Available at:
http://etd.ugm.ac.id/index.php?mod=penelitian_detail&sub=Pen
elitianDetail&act=view&typ=html&buku_id=62835&obyek_id=4,
[Accessed 6 Agustus 2014]
Tabara, Y., Kohara K., Yamamoto Y., Igase M., Nakura J., Kondo I., Miki T.
Polymorphism of the monocyte chemoattractant protein (MCP-
1) gene is associated with the plasma level of MCP-1 but not with
carotid intima-media thickness. Hypertens Res; 2003; 26: 677-83.
Tamura, H., Suzue T., Jitsunari F., Hirao T., Evaluation of carotid arterial intima-
media thickness (IMT) and its relation to clinical parameters in
Japanese children. Acta Med Okayama; 2011; 65: 21-5.
Tershakovec, A., Daniel J., Disorders of Lipoprotein Metabolism and Transport.
In: Behrman R, Kliegman R, Jenson H. (eds.) Textbook of pediatrics.
17 ed. Tokyo: WB Saunders. 2003.
Thon, T., Haase N., Rosamond W., etal. Heart Disease and Stroke Sstatistics-2006
Update: A Report from the American Heart Association Statistics
Committee and Stroke Statistics Subcommittee. Circulation, 2006;
113: 85151.
Tong, X., Kukklina E.V., Gilespie C., George M.G., Medical complications among
hospitalizations for ischemic stroke in the United States from 1998
to 2007. Stroke, 2010: 4;1: 980-6.
Toole, J.F., Applied phisiology of the cerebral circulation. In: Cerebrovaskular
disordes. 4th ed. New York: Raven Press; 1990: 28-49.
Touboul, P.J., Hennerici M.G., Meairs S., Adams H., Amarenco P., Bornstein
N., Csiba L, Desvarieux M, Ebrahim S, Fatar M, Hernandez R, Jaff
M, Kownator S, Prati P, Rundek T, Sitzer M, Schminke U, Tardif JC,
Taylor A, Vicaut E, Woo KS, Zannad F, Zureik M. 2007. Mannheim
carotid intima-media thickness consensus (2004-2006). An Update
on Behalf of the Advisory Board of the 3rd and 4th Watching the
Risk Symposium, 13th and 15th European Stroke Conferences,
Mannheim, Germany, 2004, and Brussels, Belgium, 2006.
Cerebrovasc Dis; 23: 75-80.
Truelsen, T., Bonita R., Jamrozik K., Surveillance of stroke: A global perspective.
Int J Epidemiol. 2001; 30 Suppl 1: S11-6.
Twyman, R., Mutation or polymorphism? 2003. [Online]. Available at :http://
genome.wellcome. ac.uk/doc_wtd020780.html. [Accessed 22
September 2011].
Tziomalos, K., Athyros V.G., Karagiannis A., Mikhailidis D.P., Dyslipidemia as a
risk factor for ischemic stroke. Curr Top Med Chem; 2009; 9: 1291-7.

306
UNICEF. National law and policies on minimum ages, 2008. [Online]. Available
at :http://www. right-to-education.org/country-node/357/country-
minimum. [Accessed 22 September 2011].
University of medicine and dentistry of New Jersey. Stroke statistics. 2007.
Urbina, E.M., Williams R.V., Alpert B.S., Collins R.T., Daniels S.R., Hayman
L., Jacobson M., Mahoney L., Mietus-Snyder M., Rocchini A.,
Steinberger R.J., Mccrindle B., Noninvasive assessment of subclinical
atherosclerosis in children and adolescents. Hypertension; 2009; 54:
919-950.
Venkantramana, P., Reddy P.C., Ferrell R.E., Apoliprotein E polymorphism
among the Indian population and its comparison with other Asian
populations. IJHG 2001; 1(2): 123-8.
Vermeer, S.E., Prins N.D., den Heijer T., Hofman A., Koudstaal P.J., Breteler
M.M.B., Silent brain infarcts and the risk of dementia and cognitive
decline.N Engl J Med, 2003; 348: 1215-22.
Vincent, J-L. ARDS and sepsis. Eur respir mon. 2006; 34: 253-61.
Wada, T., Mckee M. D., Steitz S., Giachelli C. Calcification of vascular smooth
muscle cell cultures: Inhibition by osteopontin. M. Circ Rse, 1999;
84: 166-178.
Wagle, J., Farner L., Flekkoi K., Wyller T.B., Sandvik L., Eiklid K.L., etal.,
Association between ApoE epsilon4 and cognitive impairment after
stroke. Dement Geriatr Cogn Disord. 2009; 27 (6): 525-33.
Wahjoepramono, Eka J. Stroke tata laksana fase akut. Universitas Pelita
Harapan. Jakarta: 2005.
Warlow, C.P., Dennis M.S., Van Gijn J., Hankey G.J., Stroke: A practical guide to
management. Oxford: Blackwell Science. 1996. p. 1-552.
Weimar, C., Goertler M, Rother J, etal. Predictive value of the essen stroke risk
score and Ankle Brachial Index in acute ischaemic stroke patients
from 85 German stroke units. J.Neurol.Neurosurg. Psychiatry.
2009; 79:13391343.
Weimar, C., Kurt, T., Kraywikel, K., Wagner, M., Busse, O., Haberl, R.L. and
Diener, H.C. 2002. Assessment of functioning and disability after
ischemic stroke. Stroke.33:2053-2059.
WHO. BMI Classification. 2006. [Online]. Available at: http://apps.who.
int/ bmi/index.jsp?introPage=intro_3.html. [Accessed 10 Oktober
2011].
WHO. Stroke, Cerebrovascular Accident. 2011. [Online]. Available at: http://
www.who.int/topics/cerebrovascular_accident/en/. [Accessed 26
October 2011].
Wilkinson, I.M.S., Essential neurology, 3rd ed. Cambridge: Blackwell Science:
1999; 25-31.
Wirawan N. & Ida Bagus K.P., 2013. Manajemen prehospital pada stroke akut.
Bagian SMF Neurologi Fakultas Kedokteran Universitas Udayana,
Rumah Sakit Umum Pusat Sanglah Denpasar. E- Jurnal Medika
Udayana, Volume 2 Nomor 4. Available at: http://ojs.unud.ac.id/

307
index.php/eum/article/view/5117/3910. [Accessed: 2 Agustus
2014].
Wood, P.L., Neuroinflammation: mechanisms and management. 2nd ed. New
Jersey. Humana Press Inc., 2003. 189-215.
Wound Ostomy and Continence Nurses Society (WOCN). Ankle Brachial
Index: Quick reference guide for clinicians, J.WOCN. Nurs., 2012; 39:
S21-S29.
Xu, C. etal., 2010. Minor allele C of chromosome 1p32 single nucleotide
polymorphism rs11206510 confers risk of ischemic stroke in Chinese
Han population. J Stroke 41:1587-1592.
Yamaguchi, S Kobayashi, S Koide, H Tsunematsu. Longitudinal study of regional
cerebral blood flow changes in depression after stroke. Stroke. 1992;
23: 1716-20.
Yang X.Z., Liu Y., Mi J., Tang C.S., Du J.B, Pre-clinical atherosclerosis evaluated
by carotid artery intima-media thickness and the risk factors in
children. Chin Med J (Engl); 2007; 120: 359-62.
Yayasan Stroke Indonesia (YASTROKI), Indonesia tempati urutan pertama
di dunia dalam jumlah terbanyak penderita stroke. Jakarta. 2009.
Available at: http://www.yastroki.or.id/read.php?id=341. [Accessed
31 Oktober 2010].
Yayasan Stroke Indonesia (YASTROKI), Pengetahuan Sekilas Tentang Stroke.
Jakarta. 2014. Available at: http://www.yastroki.or.id/read.
php?id=340 [Accessed 3 September 2014].
Yuasa, S, Maruyama T, Yamamoto Y, Hirose H, Kawai T, Matsunaga-Irie S,
Itoh H. MCP-1 gene A-2518G polymorphism and carotid artery
atherosclerosis in patients with type 2 diabetes. Diabetes Research
and Clinical Practice; 86: 193-198.
Yueniwati Y., (in press) Profil penderita stroke iskemia di RSUD dr Saiful Anwar
Malang. FKUB - RSSA Malang. 2009.
Yueniwati, Y., Pengaruh polimorfisme promoter MCP-1 dan OPN terhadap
ketebalan intima media arteri carotis anak populasi Jawa dengan
orang tua stroke iskemik. Program Pascasarjana Universitas
Airlangga: Surabaya. 2012.
Yueniwati, Y., Deteksi variasi genetik promoter osteopontin T-443 C pada
anak populasi Jawa dengan orang tua stroke iskemik. FKUB-RSSA
Malang. 2014.
Yueniwati, Y., Uji keberadaan variasi genetik insersi G-156GG promoter
osteopontin pada anak populasi Jawa dengan orang tua stroke
iskemik. FKUB-RSSA Malang. 2014.
Yueniwati, Y., Valentina Yurina, and Mohammad Rasjad Indra, Thicker carotid
intima media thickness in children with monocyte chemoattractant
protein-1: A-2138T and A-2464G mutation, Neurology Research
International, vol. 2014, Article ID 176535, 6 pages, 2014.
doi:10.1155/2014/176535.
Zhang, X.F., Attia J., DEste C., Ma XY., 2006. The Relationship between higher
blood pressure and ischaemic, haemorrhagic stroke among Chinese

308
and Caucasians: Meta-analysis. European Journal of Cardiovascular
Prevention and Rehabilitation 13: 429-437.
Zhao, Q.L., Zhou Y., Wang Y.L., Dong K.H., Wang Y.J., A new diagnostic
algorithm for vascular cognitive impairment:the proposed criteria
and evaluation of its reliability and validity. Chin Med J, 2010;
123(3): 311-9.
Zhao, F., Chen X., Meng T., Hao B., Zhang Z., Zhang G., Genetic polymorphisms
in the osteopontin promoter increases the risk of distance metastasis
and death in Chinese patients with gastric cancer. Bmc Cancer,
2012,12:477
Zheng, D.Q., Woodard A.S., Tallini G., Languino L.R., Substrate specificity
of alpha () beta () integrin-mediated cell migration and
phosphatidylinositol 3-kinase/AKT pathway activation. J Biol Chem,
2000; 275:2456574.
Zhong, C., Luzhan Z., Genshan M., Jiahong W., Xiaoli Z., Qi Q, Monocyte
chemoattractant protein-1-2518 G/A polymorphism, plasma levels,
and premature stable coronary artery disease. Mol Biol Rep; 2010;
37: 7-12.

309
Glosarium

Aorta: pembuluh arteri utama yang menghubungkan jantung dengan


semua organ utama tubuh (otak, perut, ginjal, dll).
Segmen aorta di dalam rongga dada disebut aorta dada
dan yang di dalam perut disebut aorta perut.
Apoptosis: suatu bentuk kematian sel yang diprogram dalam urutan
kejadian yang mengarah pada penghapusan sel tanpa
melepaskan zat berbahaya ke daerah sekitarnya.
Apoptosis berperan penting dalam mengembangkan dan
menjaga kesehatan dengan menghilangkan sel-sel tua,
sel-sel yang tidak perlu, dan sel sehat.
Annealing: sebuah proses yang dimaksudkan untuk menempelkan
primer pada sekuen target DNA.
Arteri:pembuluh darah berdinding tebal yang membawa darah
beroksigen dari jantung ke jaringan di semua organ,
termasuk otot, otak, dan hati. Tekanan darah pada sistem
arteri biasanya cukup tinggi, hingga 140 mm Hg pada
individu normal.
Arteri karotid:pembuluh darah utama yang memasok darah
beroksigen ke kepala dan leher. Masing-masing memiliki
dua cabang utama, arteri karotid eksternal dan internal.
Asam amino : senyawa organik yang mengandung gugus amino (NH2),
sebuah gugus asam karboksilat (COOH), dan salah satu
gugus lainnya, terutama dari kelompok 20 senyawa yang
memiliki rumus dasar NH2CHRCOOH, dan dihubungkan
bersama oleh ikatan peptida untuk membentuk protein.
Aterosklerosis:merupakan kelainan pembuluh darah kronis, progresif,
dan kompleks akibat interaksi multifaktorial genetika dan
lingkungan. Aterosklerosis terjadi bila arteri mengalami
pengerasan dan penyempitan yang menyebabkan
berkurangnya pasokan darah ke berbagai organ tubuh
Denaturasi: proses untuk memisahkan untai ganda DNA template
menjadi untai tunggal dengan pemanasan (90C 95C)
dalam proses PCR.

310
Diastolik: tekanan darah arteri terendah selama siklus denyut jantung
dan angka kedua dalam pembacaan tekanan darah
(misalnya, 120/80).
Dislipidemia: gangguan metabolisme lipoprotein.
DNA polimerase: enzim yang mengkatalisis polimerisasi DNA.
DNA sekuensing: merupakan metode yang digunakan untuk
menentukan urutan basa nukleotida adenin, guanin,
sitosin, dan timin pada molekul DNA.
DNA template: merupakan rangkaian DNA yang akan digandakan.
Emboli (tunggal: embolus): koleksi bekuan darah atau materi
partikulat (seperti kolesterol) yang tercerabut dari
jantung atau pembuluh darah utama (seperti aorta perut
atau vena femoralis) dan memasuki aliran darah. Setelah
bebas mengalir dalam sistem vaskular, emboli dapat
melakukan perjalanan ke setiap organ dalam tubuh dan
menyebabkan berbagai masalah, termasuk stroke, gagal
ginjal, dan/atau emboli paru.
Endotelium: lapisan sel yang melapisi pembuluh darah dan getah
bening, hati, dan berbagai rongga tubuh.
Epidemiologi: studi tentang seberapa sering suatu penyakit terjadi
pada kelompok orang yang berbeda dan mengapa
hal itu terjadi. Informasi epidemiologi digunakan
untuk merencanakan dan mengevaluasi strategi
untuk mencegah penyakit dan sebagai panduan untuk
pengelolaan pasien yang telah mengembangkan penyakit
tersebut.
Fatty streak: merupakan tahap awal pembentukan lesi aterosklerosis
dan sudah mulai terjadi pada anak.
Fenotipe:dampak gen terhadap suatu organisme, seperti apa
penampilan atau fungsinya. Sebagai contoh, gen mutan
dapat menghasilkan fenotipe abnormal pada organisme.
Fibrilasi atrium (atrial fibrilasi): kondisi di mana ruang atas jantung
(atrium) berdenyut terlalu cepat dan kacau. Karena
darah tidak sepenuhnya dipompa ke ventrikel, ruang
jantung atas dan bawah tidak bekerja sama dengan baik,
yang mengakibatkan detak jantung secara keseluruhan
menjadi tidak teratur. Fibrilasi atrium juga dikenal sebagai

Glosarium 311
aritmia supraventrikel karena merupakan aritmia yang
berasal dari atas ventrikel.
Genom:himpunan materi genetika dalam organisme secara
keseluruhan.
Genotipe: sehimpunan gen tertentu yang ditemukan dalam organisme.
High Density Lipoprotein (HDL): protein dalam plasma darah yang
memperbaiki kerusakan dan mengurangi kolesterol dari
tubuh. HDL mengangkut kolesterol dari jaringan tubuh
ke hati untuk dibuang (dalam empedu). Oleh karena itu,
HDL dianggap kolesterol baik. Semakin tinggi kadar
kolesterol HDL, semakin rendah risiko terjangkit penyakit
arteri koroner.
Hipertensi: atau tekanan darah tinggi, kadang-kadang disebut juga
dengan hipertensi arteri adalah kondisi medis kronis
dengan tekanan darah di arteri meningkat. Peningkatan
ini menyebabkan jantung harus bekerja lebih keras dari
biasanya untuk mengedarkan darah melalui pembuluh
darah.
Homeostasis: suatu kondisi keseimbangan internal yang ideal, di mana
semua sistem tubuh bekerja dan berinteraksi dalam cara
yang tepat untuk memenuhi semua kebutuhan dalam
tubuh.
Indeks massa tubuh (IMT): rasio standar berat terhadap tinggi, dan
sering digunakan sebagai indikator kesehatan umum.
IMT dihitung dengan membagi berat badan (dalam
kilo gram) dengan kuadrat tinggi badan (dalam meter).
Angka IMT antara 18,5 dan 24,9 dianggap normal untuk
kebanyakan orang dewasa. IMT yang lebih tinggi mungkin
mengindikasikan kelebihan berat badan atau obesitas.
Infark miokard (IM): dikenal sebagai serangan jantung, terjadi ketika
sekelompok otot jantung mati karena penyumbatan
mendadak dari arteri koroner (trombosis koroner). Hal
ini biasanya disertai dengan nyeri dada luar biasa dan
sejumlah kerusakan jantung.
Infeksi: peristiwa masuk dan berkembangnya agen infeksi ke dalam
tubuh seseorang atau hewan. Pada infeksi yang manifes,
orang yang terinfeksi tampak sakit secara lahiriah. Pada
infeksi yang non-manifes, tidak ada gejala atau tanda
lahiriah.

312 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Inflamasi: atau peradangan adalah bengkak kemerahan, panas, dan
nyeri pada jaringan karena cedera fisik, kimiawi, infeksi,
atau reaksi alergi.
Kanker: atau neoplasma ganas adalah penyakit yang ditandai dengan
kelainan siklus sel khas yang menimbulkan kemampuan
sel untuk tumbuh tidak terkendali (pembelahan sel
melebihi batas normal),menyerang jaringan biologis
di dekatnya dan bermigrasi ke jaringan tubuh yang lain
melalui sirkulasi darah atau sistem limfatik, yang disebut
metastasis.
Kardiovaskular: berkenaan dengan jantung dan pembuluh darah.
Khemokin (chemotactic cytokines): polipeptida dengan berat molekul
rendah, mempunyai fungsi kemotaktik yang potent dan
efek aktivasi pada populasi leukosit spesifik
Kolesterol: zat lembut berlilin yang hadir di semua bagian tubuh
termasuk sistem saraf, kulit, otot, hati, usus, dan jantung.
Kolesterol dapat dibuat oleh tubuh maupun diperoleh
dari produk hewani dalam makanan.
Lesi: jaringan yang fungsinya terganggu karena penyakit atau cedera,
seperti tumor, ulkus, atau abses.
Low density lipoprotein (LDL): sering kali disebut sebagai kolesterol
buruk, adalah jenis lipoprotein yang terlibat dalam
pengangkutan kolesterol dari hati ke seluruh tubuh kita.
Tingginya kadar LDL secara dramatis dapat meningkatkan
risiko penyakit jantung, stroke, dan penyakit arteri
lainnya.
Makrofag: sebuah sel fagosit besar seri mononuklear yang ditemukan
dalam jaringan. Kemampuannya termasuk fagositosis
dan presentasi antigen ke sel T.
Monocyte Chemoattractant Protein-1 (MCP-1):merupakan sel
attractant mononuclear yang potent yang mempunyai
implikasi pada perkembangan stroke iskemia dan infark
myocard. MCP-1 mempunyai peranan penting pada
proses penebalan lapisan media pembuluh darah koroner
setelah inhibisi sintesis nitric oxide dengan merekrut dan
mengaktivasi monosit
Mutasi gen: perubahan permanen dalam DNA yang membentuk gen.
Nukleotida: unit struktural dasar asam nukleat (DNA atau RNA).

Glosarium 313
Obesitas: kondisi kronis di mana terdapat jumlah lemak tubuh
berlebihan. Sejumlah tertentu lemak tubuh diperlukan
untuk menyimpan energi, menginsulasi panas, meredam
goncangan, dan fungsi lainnya. Jumlah normal lemak
tubuh (dinyatakan sebagai persentase persentase lemak
tubuh) adalah antara 25% -30% pada wanita dan 18%
-23% pada pria. Wanita dan pria yang memiliki lemak
tubuh masing-masing lebih dari 30% dan 25% dianggap
mengalami obesitas.
Osteoblas: sel-sel tulang yang membentuk lapisan tulang baru selama
tahap pembentukan dalam proses remodeling tulang.
Sel-sel ini mengisi rongga dan terowongan yang dibuat
oleh osteoklas.
Osteopontin :atau OPN adalah sitokin multifungsional dan
protein adhesi yang berhubungan dengan berbagai
proses fisiologi dan patologi, termasuk di dalamnya
pembentukan kembali tulang, meningkatkan aktivitas
imun yang dimediasi sel, menjaga integritas sel selama
terjadinya proses inflamasi, dan metastase sel tumor.
Otot polos: otot yang melakukan tugas-tugas otomatis, seperti
konstriksi pembuluh darah, pencernaan, dan lain
sebagainya.
Polimorfisme: ketika dua atau beberapa fenotipe yang berbeda
ada dalam populasi suatu spesies atau dalam kata lain,
kemunculan lebih dari satu bentuk. Agar dapat disebut
sebagai polimorfisme, bentuk-bentuk tersebut harus
berada dalam habitat yang sama pada waktu yang sama
dan tergolong dalam populasi panmiktik (perkawinan
acak.
Polymerase Chain Reaction (PCR): metode amplifikasi (perbanyakan)
DNA secara enzimatik sesuai dengan urutan DNA spesifik.
Prevalensi: seberapa sering suatu penyakit atau kondisi terjadi pada
sekelompok orang. Prevalensi dihitung dengan membagi
jumlah orang yang memiliki penyakit atau kondisi dengan
jumlah total orang dalam kelompok.
Primer: molekul oligonukleotida untai tunggal yang terdiri atas sekitar
30 basa.
Profil lipid:tes darahyang mengukurkolesterol total,trigliserida,dan
kolesterolHDL.Kolesterol LDL kemudian dihitungdari

314 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


hasilnya.Sebuahprofil lipidmerupakan salah satu
ukuranrisiko seseorang terhadappenyakitkardiovaskular.
Promotor: urutan DNA spesifik yang berperan dalam mengendalikan
transkripsi gen struktural dan terletak di daerah upstream
(hulu) dari bagian struktural gen.
Promoter inti: tempat awal terjadinya proses transkripsi oleh RNA
polimerase II dan tempat proses transkripsi tersebut
dikendalikan.
Rasio odds gabungan: (pooled odds ratio/POR) adalah penggabungan
data rasio odds dari beberapa studi.
Remodelling tulang: atau peremajaan tulang adalah sebuah proses
seumur hidup di mana sel-sel tulang tua dimusnahkan
dari tulang dan diganti dengan sel-sel tulang baru.
Reseptor: molekul khusus pada permukaan sel yang merespons sinyal
eksternal.Ketika reseptor menerima utusan kimia atau
obat pengikat reseptor, berbagai fungsi sel diaktifkan
atau dihambat.
Stroke: keadaan terjadinya disfungsi otak secara mendadak yang
disebabkan gangguan aliran darah akibat obstruksi atau
pecahnya pembuluh darah.
Stroke hemoragik: kerusakan atau pembengkakan di dalam otak
akibat pecahnya pembuluh darah di dalam otak atau di
dekat otak.
Stroke iskemia: suatu kondisi yang disebabkan oleh adanya oklusi
(penyumbatan) pada arteri serebral serta di daerah
intrakranial/ekstrakranial akibat pembentukan trombus
lokal atau terjadinya emboli.
Tekanan sistolik: tekanan tertinggi di mana tekanan darah naik oleh
kontraksi ventrikel.
Transduser: komponen USG yang ditempelkan pada bagian tubuh
yang akan diperiksa, seperti dinding perut atau dinding
poros usus besar pada pemeriksaan prostat. Di dalam
transduser terdapat kristal yang digunakan untuk
menangkap pantulan gelombang yang disalurkan oleh
transduser.
Transkripsi: proses penyalinan kode-kode genetika yang ada pada
urutan DNA menjadi molekul RNA.

Glosarium 315
Trauma: cedera fisik atau emosional. Secara medis, trauma mengacu
pada cedera serius atau kritis, luka, atau syok.
Trombosis: pengembangan pembekuan darah dalam pembuluh darah
atau jantung.
Trombus: bekuan darah di pembuluh darah atau dalam jantung.
Dari kata Yunani thrombo yang berarti benjolan atau
gumpalan, atau dadih atau gumpalan susu.
Ultrasonografi:atau USG adalah sebuah metode untuk mem
visualisasikan bagian-bagian internal tubuh atau janin
dalam rahim dengan menggunakan gelombang suara
ultrasonik, yaitu gelombang suara yang memiliki frekuensi
sangat tinggi (250 kHz2000 kHz).
Variasi genetika: perbedaan genetika yang terjadi secara alamiah pada
individu dalam populasi.
Vena: pembuluh darah yang membawa darah menuju jantung.
Vena dapat dikategorikan menjadi empat jenis utama
yaitu vena paru, vena sistemik, vena superfisialis, dan
venadalam.

316 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Indeks

A Arteriosklerosis subklinis 196


Asam amino 310
Abberant cell signaling 46
Aterosklerosis 34, 35, 38, 94, 98,
ABI xix
103, 310
ACAPS xix
Atheroma 96
Acoustic window 182
ATP-binding cassette transporter
Additive model 143
151
Adesi 131
Atrial fibrilasi 311
Adesi leukosit 95
Atrofi serebral 66
Agregasi trombosit 95
Alkohol 20 B
Alzheimer 147, 149
Barthel Index 26
Amiloid beta 156
Basa
Amiloid precursor protein 156 purin 222
Amplifikasi 230 Basa nukleotida 222, 223
gen 213
PCR 164 Berat badan 261
Analisis Biomarker 110
genotiping 237 Biomineralisasi 132, 133
hasil sekuensing 217 BLAST xix
migrasi 239 Blood brain barrier 38
primer OPN 232 BMI xix
statistik 208 Body Mass Index 19
Anamnesis 174 Brain attack. LihatStroke
Anatomi arteri karotis 89
Ankle Brachial Index 185186 C
Annealing 167, 310
CAD xix
Aorta 98, 104, 310
CCA xix
Aplikasi PCR 168
Cell survival 131, 133, 276
Apoptosis 50, 5053, 53, 310
Cellular waste product 94
ARIC xix
Chain-termination methods 170
Arm movement 176
Chemotactic cytokines 124, 313
Arteri 89, 310
Chlamydia pneumonia 106
karotid 310
karotis 34, 197 CIMT 110
vertebralis 34 Complicated fibrous plaque 96
Confounding factor 274

317
Core of infarct 38 Endotelium 311
Coronary artery disease 132 Enzym immunoassay 167
Critical level 42 Epidemiologi 311
Etiologi 54
D
Extension 167
Delesi. LihatPolimorfisme
F
Denaturasi 167, 310
Deoxynucleotide Triphosphate Facial movement 176
(dNTP) 166 Fagositosis 72
Depolarisasi seluler 40 Faktor
Deteksi dini 196 demografis 61
stroke 6 genetika 9, 144, 208, 212
Deteksi faktor risiko 174 psikososial 106
pemeriksaan penunjang 174 risiko 104
Deteksi SNP 168 aterosklerosis 95, 104
stroke 104
Diabetes 2, 95
melitus 17, 63 tradisional 124
risiko aterosklerosis 62
Diastolik 311 risiko stroke 6
Disfungsi endotel 94 sosial ekonomi 22
Dislipidemia 311 Familial hypercholesterolemia
DNA 223 112
polimerase 165, 311 Far wall 115
sekuensing 169, 311
template 165, 311 Fase
eksekusi 51
Domain kognitif tunggal 56 Induksi 51
Dominant model 143 propagasi 51
Doppler 200 F-A-S-T 175
Dye-terminating sequensing 170 Fatty streak 98, 101, 104, 311
E FDA xix
Fenotipe 311
ECA xix FH xix
Efek 24 Fibrilasi atrium 311
plateu 167 Fibrous plaque 100
Efluks kolesterol 153 Foam cell 96
Ekspresi gen 223 Fosfoprotein 128
Emboli 311 Fosforilasi tau 158
lemak 35
Frameshift mutation 271
serebral 34
Fungsi
Emisi fluoresensi 167
biologis OPN 131
End diastolic 120 kognitif 55
Endotel 94

318 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


G Hipertensi 2, 12, 63, 312
Hipoperfusi 79
G2350A Gen ACE 188
Homeostasis 312
Gastric cancer 259
Homosistein 95
Gaya hidup 105
Hukum Poiseuille 179
Gejala 6
Gen I
pengkode OPN 212
promotor MCP-1 212 ICA xix
tunggal 9 IFN- xix
Gen apoliprotein E (ApoE) 146 IL-1 xix
Gen CADASIL 144 IL-8 xix
GENIC study xix ILGF xix
Genom 312 IMT xix
Genotipe 312 Indeks massa tubuh 252, 261,
Genotyping 262 312
Geografis 228 Infark 65
Glial scar 128 miokard 257, 312
Glukosa puasa 252 multipel 56
myocard 106, 207
Glutamat 45 serebral tersembunyi 66
Gly972Arg Gen IRS-1 188 Infeksi 312
Granulocyte-macrophage colony- Inflamasi 50, 102, 159, 313
stimulating factors 102 iNOS xix, 49
Gula darah puasa 261 Insersi 271. LihatPolimorfisme
H Interaksi domain 155
Inti infark 53
Hard plaque 96 Intima 98
Hasil media 226
analisis 206 Intima media
sekuensing 222 arteri karotis 110, 134
HDL 148, 261, 312 Ischemic core 43
Heart rate 178 Iskemia 4
Hemineglect 6 penumbra 37
Hemodinamik serebrovaskular Isolasi DNA 213
178
Hemorrhagik 4 J
High Density Lipoprotein 312 Jenis-jenis polimorfisme 141
Hiperemia 78 Jenis kelamin 8
Hiperkolesterolemia 125 JNC VII xix
Hiperlipidemia 64

Indeks 319
K Low-density lipoprotein choles-
terol 9
Kadar
Lupus erythematosis 254
gula darah 13
kolesterol darah 14 Luxury perfusion 78
kolesterol total 261
M
Kanker 2, 313
payudara 160 Macrogen 246
Kardioemboli 34 Makroangiopati 34
Kardiovaskular 313 Makrofag 230, 313
Kaskade apoptosis 51 Maxam Gilbert sequencing 170
Kasus stroke 2 MCP-1 xix, 124, 313
Kegagalan energi 44 M-CSF xix
Kematian 2 Mekanisme glutamat 40
neuron 52 Membunuh 73
Kemokin 73. LihatChemotactic Mencerna 73
cytokines Merokok 64, 95
Kemotaksis 72 Migrasi 131
Ketebalan intima media 111, 196 Mikroangiopati 34
Klasifikasi stroke 4 Mini mental state examination
iskemia 36 63
Kolesterol 14, 151, 313 Modifiable risk factors 6
Komorbiditas 56 Modified Rankin Scale 26
Komponen PCR 164 Monocyte Chemoattractant Pro-
Kondensasi kromatin 51 tein-1 313
Konsentrasi Mg2+ 166 Multiple sclerosis 254
Konsumsi alkohol 64 Mutasi 219, 220
L gen 222, 313
gen APP 156
Landmark studi 119 genetik 141
LDL xix, 96, 102, 125, 148, 261, titik 222
313 N
teroksidasi 102
Lesi 313 Near wall 115
aterosklerosis 98, 101 Nekrosis 50, 53
komplikasi 99, 100 Neuroprotektif 135, 159, 259
restenotik 134 Neuroprotektor 276
Leukosit 67 Neurotransmiter 44
Lokasi infark 54 Neutrofil 69
Low density lipoprotein 96, 102, NIHSS 27
313 NINDS xix

320 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Nonmodifiable risk factors 6 Pengurangan O2 43
Nonsmall cell lung cancer 143 Penumbra iskemia 77
Nukleotida 313 Penyakit
jantung 17
O serebrovaskular 3
vaskular 2
Obesitas 19, 314
Peranan Ca 46
Olahraga 21
Peran nitrit oksida 49
OPN xix, 135. LihatOsteopontin
Perbaikan stroke 28
Optimasi 241
proses amplifikasi 232 Permeability transition pore com-
Osteoblas 314 plex 47
Osteoklas 274 Pirimidin 222
Osteopontin 128, 135, 314 Pita tunggal 231
T-443C 236 Plak aterosklerosis 14
Otot polos 314 Plaque 94, 96, 134
Outcome Stroke 26 Platelet derived growth factor 98
Oxygen-free radicals 37 Plugging 38
Polimorfisme 222, 314
P -148C/T Gen Fibrinogen 190
-455G/A 190
Paska stroke 24, 55 A-2138T 224
Patofisiologi genetik 140
stroke iskemia 37 insersi 141
Patofisiologi ApoE4 153 MCP-1 126
Patogenesis 35 MCP-1 A-2138T 224
aterosklerosis 94 MCP-1 G-2464A 225
PCR xx, 164, 314 osteopontin 141
osteopontin T-443C 144
PDAY xx
Polymerase Chain Reaction 164,
PDGF xx
314
Peak 269
Populasi 228
Pekerjaan 23
Jawa 3, 224
Pembuluh darah 88
Positif palsu 164
Pemeriksaan
Prahospital 5
fisik 196
fisik diagnostik 174 Predileksi 98
laboratorium 196 Prevalensi 314
penunjang 174 Primary biliary cirrhosis 254
ultrasonografi 206 Primer 165, 314
Pendidikan 23 forward 268
Pengkerutan 51 reverse 268, 271
Pengukuran ketebalan intima Probe-based colorimetric 167
116 Produk PCR 244

Indeks 321
Profil lipid 252, 273, 314 Sedentary 106
Prognosis 27 Sekuen nukleotida 223
stroke 27 Sekuensing 262
Promote cell survival 130 hasil PCR 215
Promoter 223 sampel 234
osteopontin T-443C 254 Sel
Promotor 315 mononuclear 124
Protein tau 158 Sel busa 96, 97
Protokol 118 Sentinel vessel 91
ARIC 119 Sequencher 5.1 250
skaning 118 Serebrovaskular 59
Proyeksi transversal 198 Shear stress 101, 102
Pulsasity Index (PI) 180 Sickle cell 105
Single Nucleotide Polymorphism
R
168
Radikal bebas 46, 47 Sitokin 129
Ras 10 proinflamasi 230
Rasio odds gabungan 315 Sitokinin 76
Reactive Oxygen Species 48 Skala mRS 27
Reaksi inflamasi 132 SNP xx, 223
Recessive model 143 Soft plaque 96
Remodelling SOP xx
tulang 315 Speech 176
vaskular 133 Status pernikahan 24
Reperfusion injury 80 Stres 2122
Reseptor 315 Stress
AMPA 46 oxidative 125
glutamat 45 Stroke 2, 34, 282, 315
inotropik 45 hemoragik 21, 149
integrin 276 hemorrhagik 4
lipoprotein 154 iskemia 35, 77, 212, 224, 315
metabotropik 45
NMDA 45 Studi
cross sectional 116, 121
Respon inflamasi 74 pediatrik 121
Response to injury 94 Substansia alba 65
Restenosis 135 Substitusi 223
RNA polimerase 223 Susunan saraf 3
Rokok 19
T
S
Tahapan PCR 166
Scavenging 39 Tanda 6

322 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...


Taq polymerase 167 media 88
Tautomeric shift 223
U
TCD xx
Tekanan Uji
darah 11, 261 hipotesis 257
sistolik 315 komparasi 203
Terapi statin 121 Ultrasonografi 196, 316
Thermus aquaticus 165 Umur 7
TIA 6 Urolithiasis 254
Time to call 177 USG xx
Tinggi badan 261
Tingkat produktivitas 2
V
TNF- xx Variasi genetika 140, 212, 316
TNF- xx Vascular cognitive impairment
Tonus vaskular 94 144
Transcranial Doppler (TCD) 177 Vasoaktif 41
Transduser 198, 315 Vasodilatasi vaskular 276
Transient Ischemic Attack 67, VCAM-1 xx
37 VCI 56, 144
Transisi 223 possible 60
Transkripsi 223, 315 probable 57
Translasi 223 Vena 89, 316
Transversi 222 VSMCs xx
Trauma 316 W
Trigliserida 261
Trombosis 316 Waist hip ratio 174
Trombus 316
Z
Tunika
adventisia 88 Zinc finger 255
intima 88

Indeks 323
Riwayat Penulis

D
oktor yang bernama lengkap Yuyun
Yueniwati ini lahir di Malang, 31
Oktober 1968. Ia merupakan anak
pertama dari Bapak Wadjib (almarhum) dan Ibu R.A.
Siti Suparsiyah (almarhum). Hasil pernikahannya
dengan dr. Eko Arisetijono Sp.S. (K) membuahkan 2
orang putra dan seorang putri.
Ia menyelesaikan pendidikan dasarnya di SDN
Ngaglik I Batu, Malang pada tahun 1981 lalu menempuh
pendidikan menengah pertama di SMPN I Batu, Malang.
Setelah itu, masuk pendidikan menengah atas di SMA PPSP IKIP
Malang dan lulus pada tahun 1986. Pada tahun 1987, ia diterima
di Fakultas Kedokteran Universitas Brawijaya Malang dan lulus
pada tahun 1994. Untuk mengembangkan kemampuannya sebagai
dokter, ia mengambil Program Pasca Sarjana di Universitas Airlangga
Surabaya dan lulus sebagai Magister (MKes) dalam bidang ilmu FAAL
pada tahun 2000. Ia berhasil menjadi lulusan terbaik IKD Pasca
Sarjana UNAIR. Tidak berhenti di situ, ia pun melanjutkan studinya
dengan mengambil spesialisasi radiologi di Fakultas Kedokteran
Universitas Indonesia Jakarta, dan lulus pada tahun 2007. Saat itu,
ia berhasil meraih prestasi sebagai juara III Ujian Nasional BPNRI.
Pendidikan tertingginya ia tempuh dengan mengambil Program
Doktor di Fakultas Kedokteran Universitas Airlangga Surabaya,
dan lulus sebagai Doktor pada tahun 2012 dengan prestasi lulus
dengan predikat cum laude dan sebagai wisudawan terbaik UNAIR
periode Juli 2012. Pada tahun 2013, ia mendapatkan gelar konsultan
Neuroradiologi dari Kolegium Radiologi Indonesia (KRI). Selain
menempuh pendidikan formal di atas, ia juga menempuh beberapa
pendidikan nonformal yang diikutinya baik di dalam maupun di
luarnegeri.
Awal karirnya dimulai dengan menjadi seorang dokter PTT
di Puskesmas Bareng, Malang. Pada tahun 1996-sekarang, ia aktif
sebagai pengajar di Fakultas Kedokteran Universitas Brawijaya-
RSUD dr. Saiful Anwar Malang. Ia juga dipercaya sebagai Sekretaris
Program Studi Radiologi FKUB dari tahun 2012 sampai sekarang.
324 Deteksi Dini Stroke Iskemia dengan Pemeriksaan Ultrasonografi ...