Appl Microbiol Biotechnol (2012) 94:637649
DOI 10.1007/s00253-011-3773-6
BIOTECHNOLOGICAL PRODUCTS AND PROCESS ENGINEERING
In silico aided metabolic engineering of Streptomyces
roseosporus for daptomycin yield improvement
Di Huang & Jianping Wen & Guoying Wang &
Guanghai Yu & Xiaoqiang Jia & Yunlin Chen
Received: 18 July 2011 / Revised: 18 September 2011 / Accepted: 21 November 2011 / Published online: 10 March 2012
# Springer-Verlag 2012
Abstract In silico metabolic network models are valuable
tools for strain improvement with desired properties. In this
work, based on the comparisons of each pathway flux under
two different objective functions for the reconstructed meta-
bolic network of Streptomyces roseosporus, three potential
targets of zwf2 (code for glucose-6-phosphate hydrogenase),
dptI (code for -ketoglutarate methyltransferase), and dptJ
(code for tryptophan oxygenase) were identified and selected
for the genetic modifications. Overexpression of zwf2, dptI,
and dptJ genes increased the daptomycin concentration up to
473.2, 452.5, and 489.1 mg/L, respectively. Furthermore, co-
overexpression of three genes in series resulted in a 34.4%
higher daptomycin concentration compared with the parental
strain, which ascribed to the synergistic effect of the enzymes
responsible for daptomycin biosynthesis. Finally, the
engineered strain enhanced the yield of daptomycin up to
581.5 mg/L in the fed-batch culture, which was approximately
43.2% higher than that of the parental strain. These results
demonstrated that the metabolic network based on in silico
Electronic supplementary material The online version of this article
(doi:10.1007/s00253-011-3773-6) contains supplementary material,
which is available to authorized users.
D. Huang : J. Wen : G. Wang : G. Yu : X. Jia
Department of Biochemical Engineering, School of Chemical
Engineering and Technology, Tianjin University,
Tianjin 300072, Peoples Republic of China
J. Wen (*) : X. Jia
Key Laboratory of Systems Bioengineering,
Ministry of Education, Tianjin University,
Tianjin 300072, Peoples Republic of China
e-mail: jpwen@tju.edu.cn
Y. Chen
School of Science, Beijing Jiaotong University,
Beijing 100044, Peoples Republic of China
prediction would be accurate, reasonable, and practical for
target gene identification and strain improvement.
Keywords Daptomycin . Streptomyces roseosporus . In
silico prediction . Metabolic engineering . Strain
improvement
Introduction
As a novel acidic cyclic lipopeptide antibiotic, daptomycin
was first discovered by Eli Lilly and Company in the early
1980s. Produced by Streptomyces roseosporus, the peptide
portion contains a 13 amino acid chain linked by an ester bond
between the carboxyl group of L-kynurenine and the hydroxyl
group of L-threonine (Miao et al. 2005). Daptomycin, which
attaches to the cell membrane via Ca2+ to kill the cells (Mathai
et al. 2009; Nailor and Sobel 2009), is broadly efficacious for
the treatment of complicated skin infections caused by gram-
positive pathogens, including 15 genera and 35 species,
especially penicillin-resistant Streptococcus pneumoniae,
vancomycin-resistant Enterococcus, glycopeptide-insensitive
Staphylococcus aureus, and methicillin-resistant Staphylococ-
cus aureus. The extensive application in clinical therapy has
drawn public attention to the investigation of daptomycin
biosynthesis (Wittmann et al. 2008; Baltz et al. 2005).
It is well known that the production level of most
secondary metabolites is always too low to satisfy the
industrial production. Although the daptomycin produc-
tion has been improved by decanoic acid feeding during
fermentation (Huber et al. 1988), it still lags far behind
the requirement of the economical large-scale produc-
tion. Since metabolic engineering is an effective method
for strain improvement and production enhancement (Li and
Townsend 2006; Paradkar et al. 2001; Okamoto et al. 2003;
638
Tamehiro et al. 2003), it raises our interest to investigate
whether daptomycin production could be improved by
employing an engineered strain with goal-oriented genetic
modification, which directs the metabolic flux toward the
target and reduces the by-products. For instance, Li and Town-
send (2006) disrupted the gap1 gene encoding the 3-
phosphate glyceraldehydes dehydrogenase and kept
down the gap2 gene which was related to glycolysis
pathway, thus leading to the accumulation of 3-phosphate
glyceraldehydes. The corresponding target product clavulanic
acid yield increased from 125 mg/L to 240 mg/L.
However, the present strain improvement is low efficiency
since it is difficult to predict the target genes for amplification
or deletion due to the high complexity of metabolic network
(Taymaz-Nikerel et al. 2010). There are many precursors in
bio-based chemicals biosynthesis, indicating that it is arduous
to orient the target genes accurately. Therefore, it is necessary
to investigate the product synthesis pathway and to understand
the cellular metabolic network quantitatively. Metabolic flux
analysis (MFA) has become an important in silico simulation
tool to characterize physiological states of cells via the esti-
mation of the intracellular metabolic fluxes. Broadly, this
method could be used for designing the intermediary metab-
olism of a cell to optimize cell growth or metabolites produc-
tion (Alper et al. 2005; Park et al. 2007). Furthermore, the
target genes could be identified toward product improvement
aided by MFA. However, to our knowledge, the investigations
of MFA studies on S. roseosporus to guide further genetic
modifications are extremely scarce and need to be developed.
In the present work, a detailed metabolic network of S.
roseosporus was reconstructed, combining with the analysis
of significant intermediate metabolite fluxes. The influence of
reaction on daptomycin production was evaluated through the
reaction fluxes and necessity ratios under two different objec-
tives function. Based on the analysis, the amplification targets
leading to daptomycin production improvement in precursor
pathway were identified. Subsequently, the rationally
designed strategy was verified by overexpressing the target
genes and then the daptomycin production as well as cell
growth was investigated. It was indicated that this strategy
could be used to better understand the metabolic basis of strain
improvement and ultimately to replace the empirical process
with rational design. In addition, the key enzyme activity,
gene relative expression level, and the genetic and fermenta-
tion stability of the engineered S. roseosporus are presented.
Materials and methods
Strains, plasmids, and genetic manipulation
The daptomycin-producing strain S. roseosporus LC-511
used in this study was derived from mutation of the wild
Appl Microbiol Biotechnol (2012) 94:637649
strain S. roseosporus NRRL 11379, which could utilize
inorganic compounds as the sole nitrogen sources. The
Escherichia coli DH5 and E. coli ET12567/pUZ8002
was used as the host for cloning and as the nonmethylating
plasmid donor strain for intergeneric conjugal transfer,
respectively. pTA2 (Toyobo) was used for subcloning,
and integration of E. coliStreptomyces vector pIB139
containing the constitutive ermE* promoter was used for
gene overexpression. The strains and plasmids used in
this study are listed in Table 1.
All DNA manipulations were performed according to
established techniques and the standard protocols (Sambrook
and Russell 2001). The target gene was digested by NdeI/XbaI
and cloned into pIB139 (possessed the integrase to integrate in
chromosome). For the construction of zwf2dptIJ, PCR prod-
uct of zwf2 was excised with KpnIHindIII and transferred to
the same sites of pTA2. The PCR product containing the dptIJ
gene was excised with HindIIIXbaI and inserted into the
same sites of pTA2. The KpnIXbaI fragment of the zwf2
and dptIJ genes was digested with NdeI/XbaI from the result-
ing pTA2 and ligated to the NdeIXbaI sites of pIB139. The
constructed plasmid was passed through E. coli ET12567/
pUZ8002 and then introduced into S. roseosporus LC-511
through conjugal transfer based on the established techniques.
Aliquots were spread on MS plates (Kieser et al. 2000) and
incubated at 30 C for 20 h, then overlaid with 2.5 mL of soft
nutrient agar containing 50 g/mL nalidixic acid and 75 g/
mL apramycin. The positive exconjugants were verified
by PCR. All primers used in this work are listed in
Table 2.
Medium and cultivation condition
The seed cultures were prepared at 30 C for 48 h on a
rotary shaker at 200 rpm. The seed medium contained (g/L):
glucose 10, starch 20, yeast extract 5, (NH4)2SO4 5, NaCl 1,
MgSO47H2O 0.5, K2HPO4 0.5, and FeSO47H2O 0.001.
The chemostat cultivation was carried out at the dilution
rate of 0.05 h1 at 30 C with 1 L working volume in a 3-L
BioFlo 110 bioreactor (New Brunswick Scientific Compa-
ny, USA). The defined phosphate-limited medium contained
(g/L) glucose 25, (NH4)2SO4 7, MgSO47H2O 1, K2HPO4
0.5, CaCl2 0.02, MOPS 20, decanoic acid 0.1, plus 10 mL
trace element solution and 10 mL vitamin solution. The
trace element solution contained (g/L): FeSO47H2O 2,
ZnSO47H2O 0.5, MnSO4H2O 0.15, CuSO45H2O 0.5,
CoCl22H2O 0.05, and Na2MoO42H2O 0.03. The vitamin
solution contained (g/L): thiamine 0.03, riboflavin 0.03,
nicotinic acid 0.03, pyridoxine 0.03, calcium pantothenate
0.2, folic acid 0.03, and cobalamins 0.01. During the culti-
vation, pH was controlled at 7.5 by 1 M HCl or 1 M NaOH.
A constant airflow of 1 vvm was achieved by a flow meter,
and the agitation speed was set to between 600 and
Appl Microbiol Biotechnol (2012) 94:637649 639

Table 1 Strains and plasmids used in this study

Strains/plasmids Relevant featuresa Source/reference

Strains
S. roseosporus
LC-511 A mutant from NRRL 11379 with improved daptomycin productivity Laboratory stock
HP-Z2 LC-511 transformed with pIA1 This study
HP-I LC-511 transformed with pIA2 This study
HP-J LC-511 transformed with pIA3 This study
HP-IJ LC-511 transformed with pIA4 This study
HP-Z2-IJ LC-511 transformed with pIA5 This study
E. coli
DH5 Plasmid construction and general subcloning TaKaRa
ET12567/pUZ8002 Nonmethylating strain used for conjugation with Streptomyces MacNeil et al. 1992
Plasmids
pTA2 PCR cloning vector; bla Toyobo
pIB139 oriT attP int aac(3)IV ermEp* Liu et al. 2006
pIA1 oriT attP int aac(3)IV ermEp* zwf2 This study
pIA2 oriT attP int aac(3)IV ermEp* dptI This study
pIA3 oriT attP int aac(3)IV ermEp* dptJ This study
pIA4 oriT attP int aac(3)IV ermEp* dptIJ This study
pIA5 oriT attP int aac(3)IV ermEp* zwf2 dptIJ This study
a
bla, ampicillin resistance gene; attP, plasmid C31 attachment site; int, integrase gene, confer the plasmid to integrate in chromosome; aac(3)IV,
apramycin resistance gene; oriT, origin of transfer; ermEp*, promoter region of the erythromycin resistance gene

Table 2 Nucleotide sequence of

primers used for overexpression Primer name Sequencea 53
of zwf2, dptI, and dptJ genes, of
primers used for amplifying zwf2-F AATTCATATGGAGGGCTGACCACTTTGT (NdeI)
internal zwf2, dptI, and dptJ zwf2-R AAATTCTAGAGGACGTGGTTTCCGTGAG (XbaI)
fragments in RT-PCR
dptI-F ATATCATATGACCGTGCACGACTACCACGTG (NdeI)
dptI-R TAGTTCTAGACGGTCGTCCGGGTGTCCTG (XbaI)
dptJ-F AATACATATGACAGCGCAGGACACCCGGACG (NdeI)
dptJ-R TATATCTAGAGAACCGGCCTGTCCCGTC (XbaI)
dptIJ-F AATACATATGACCGTGCACGACTACCACG (NdeI)
dptIJ-R TATATCTAGATCGTGTGGGACCGGTTGA (XbaI)
zwf2 (link)-F AATTGGTACCACATATGGAGGGCTGACCACTTTGT (KpnI+NdeI)
zwf2 (link)-R AGATAAGCTTGGACGTGGTTTCCGTGAG (HindIII)
dptIJ (link)-F GTAGAAGCTTACCGTGCACGACTACCACG (HindIII)
dptIJ (link)-R TACCTCTAGATCGTGTGGGACCGGTTGA (XbaI)
pIB-F TTGCGCCCGATGCTAGTCG
pIB-R GCACGACAGGTTTCCCGACTG
RT-zwf2-F GGCGCTGCGATTCGCCA
RT-zwf2-R GACTCGAAGGGCAGGTAGG
RT-dptI-F TCGGAGGCGAAGGCCTGCT
RT-dptI-R CCAGTGCGCTCTCGTCGGTC
RT-dptJ-F GCCCCGGTCCTCTTCCTTG
RT-dptJ-R CGGCCGTCCCTTCAAGGG
RT-rpsL-F GTATTCGACACACCCGACCG
a
Underline stands for the RT-rpsL-R GAGGAGAGCTGTAGACCG
restriction site
640
1,000 rpm. Foam was prevented by the automatic addition
of 10% (v/v) antifoam agent (Sigma 204). All chemostat
experiments were performed at the physiological steady
state, which was defined as at least five volume changes
under the same conditions.
The batch cultivation was conducted in a 7.5-L BioFlo 110
bioreactor (New Brunswick Scientific Company) with 4 L
working volume. Aqueous solution of decanoic acid/ammo-
nia (1:1, v/v) was added in the bioreactor at the rate of 0.1 mL/
(L h) after 48 h. The other operational conditions used for the
batch cultivation were similar to that used for the chemostat
cultivation. The complex fermentation medium contained (g/
L): glucose 50, yeast extract 15, soybean meal 20, K2SO4 0.5,
MgSO47H2O 0.5, CaCl2 0.5, and MOPS 46.
For the fed-batch cultivation, it was implemented in a
7.5-L BioFlo 110 bioreactor as batch cultivation except that
the initial working volume was 3 L and the initial glucose
concentration was 40 g/L. The nutrient feeding solution
used for the fed-batch culture contained 500 g/L glucose.
When the residual glucose concentration was below 10 g/L,
approximately 80 mL of feeding solution was added into the
fermentation bioreactor.
Analytical methods
The biomass was measured by collecting 10-mL samples of
fermentation broth in triplicates. The mycelia were collected
on preweighed paper by vacuum filtration, washed twice
with distilled water, and dried at 105 C to constant weight.
The supernatants were filtered through a 0.2-m membrane
for the following analysis. Glucose concentration was deter-
mined by a glucose biosensor analyzer (SBA-40C, China).
Acetate and lactate were determined by HPLC (Agilent 1200,
USA) with an Aminex HPX-87H column (3007.8 mm, Bio-
Rad Laboratories, Hercules, CA, USA) at 65 C and 210 nm.
The mobile phase was 5 mM H2SO4 and the flow rate was
0.6 mL/min. Daptomycin was determined by HPLC using a
Venusil XDB-C18 column (5 m, 250 mm4.6 mm). The
mobile phase was 0.1% trifluoroacetic acid in water and
acetonitrile (55:45, v/v). The flow rate was 1 mL/min, the
column temperature was 30 C and the detection wavelength
was 220 nm. The concentrations of oxygen and carbon
dioxide in the gas phase were monitored online at the inlet and
outlet of the bioreactor by zirconium and infrared exhaust gas
analyzer, respectively (EX-2000, NBS, USA) and then were
converted to oxygen uptake rate (OUR) and carbon dioxide
evolution rate (CER). The error of the measurement for the
gas composition measurement was 3%.
Determination of enzyme activity
The samples were prepared as described previously (Peng
and Shimizu 2003). In brief, culture samples were harvested
Appl Microbiol Biotechnol (2012) 94:637649
at 60 h and 100 h by centrifugation at 10,000g for 10 min,
washed twice with 100 mM TrisHCl (pH 7) containing
20 mM KCl, 5 mM MnSO4, 2 mM DTT, and 0.1 mM
EDTA, then resuspended in the same buffer. Cells were
broken by ultrasonication on ice bath for 10 min (10 suc-
cessive cycles with each cycle consisting of 30 s on and 30 s
off), followed by centrifugation at 12,000g for 20 min. The
supernant (crude enzyme extract) was stored at 80 C for
further use in the measurement of enzyme activity and the
protein concentration.
The glucose-6-phosphate dehydrogenase (G6PDH, EC
1.1.1.49) assay was measured spectrophotometrically by
following the reduction of NADP+ at 340 nm as described
by Lessie and Vander Wyk (1972) and Butler et al. (2002).
The standard assay system of L-tryptophan 2, 3-dioxygenase
(TDO, EC 1.13.11.11) was manipulated according to
Ishimura et al. (1970). S-adenosyl methionine (SAM)-
dependent -ketoglutarate methyltransferase (MTase)
that catalyzed the stereospecific methylation of -
ketoglutarate leading to (3R)-3-methyl-2-oxoglutarate
was measured with -ketoglutarate substrate and the
methyl group donor SAM (Mahlert et al. 2007). Protein
concentrations were measured using the Bio-Rad protein
assay reagent. The enzyme activities were determined
based on three independent measurements.
Real-Time PCR (RT-PCR) analysis
The relative mRNA abundance of zwf2, dptI, and dptJ genes
of different recombinants was measured by RT-PCR. Total
RNA was extracted from cells in late-exponential phase by
RNAprep pure Bacteria Kit (Qiagen, Germany) and then
treated with DNase I (Fermentas, USA). The quantity and
purity of RNA were determined by measuring the optical
density at 260 and 280 nm and further determined by 1%
formaldehyde agarose gel electrophoresis. The target genes
of zwf2, dptI, and dptJ were represented by the specific
middle regions (about 500 bp). Primers for RT-PCR analysis
are listed in Table 2. RT-PCR reactions were carried out in
an iCycler (Bio-Rad, USA) with the QuantiTect SYBRgreen
RT-PCR kit (Qiagen, Germany) according to the manufac-
turers procedure. The housekeeping gene (rpsL gene) of S.
roseosporus was referred as an internal control (Rhee and
Davies 2006). The fold change of each transcript in each
sample relative to the control sample was measured in
triplicates, normalized to internal control gene of rpsL, and
calculated based on the comparative CT method (Livak and
Schmittgen 2001).
Genetic stability assays
In order to allow nonselective growth, the strain retaining
apramycin resistance was cultured for 10 generations
Appl Microbiol Biotechnol (2012) 94:637649
without antibiotic. Then spores of inoculated exconjugants
were replicated onto plates, either with or without apramycin.
The genetic stability was calculated by the number of colonies
on apramycin plates, as a percentage of the number on plates
without antibiotic. To investigate the structural stability of
target genes, genomic DNA was extracted from the
exconjugants and verified using PCR.
Calculations for MFA
The biochemical stoichiometric network was developed and
shown in the Electronic supplementary material. The amino
acid and nucleotide acid biosynthetic pathways were
simplified from the reactions by the reported information
(Borodina et al. 2005). The nicotinamide nucleotide trans-
hydrogenase of Streptomyces coelicolor A3(2) (SCO7622,
SCO7623) was used to search for corresponding gene in S.
roseosporus NRRL 11379 (Project ID 32281), and a high E
value (0.032) was obtained. It was assumed that nicotinamide
nucleotide transhydrogenase was active. The synthesis path-
way of 3-methyl glutamate reported by Mahlert et al. (2007)
was also simplified. The stoichiometry of daptomycin
Fig. 1 The schematic represen-
tation of the metabolic network
for S. roseosporus grown on
glucose. All reactions and
metabolite abbreviations are
given in the Electronic
supplementary material
641
synthesis was deduced from Miao et al. (2005). The schematic
representation of the metabolic network is presented in Fig. 1.
The accumulation rates are calculated as follows:
X X
ri cj xj ck xk 1
j k
where ri is the accumulation rate of metabolite i, xj is
the flux through reaction j, producing metabolite i with
a stoichiometric coefficient cj, and xk is the flux through
reaction k, consuming i with a stoichiometric coefficient
ck. The concentration of metabolites assumed to hold a
pseudo-steady state was constant (ri 00). The specific
rates of substrates, extracellular metabolites, and bio-
mass were calculated from the experiment. The set of
balance equations can be described in matrix notation as
Ax0r, where A is the mn matrix of the stoichiometric
coefficients, x is the flux vector (with dimension n), and r is
the metabolite accumulation rate vector, m-dimensional. In
this stoichiometric model, the number of metabolites (m) is
less than the number of reactions (n). The in silico network
model was solved by optimizing a defined objective function,
such as the specific growth rate or specific product rate (Kim
642
et al. 2004; Celik et al. 2010). All calculations were imple-
mented in Matlab software (Mathworks Inc., Natick, MA,
USA).
Results
In silico prediction for target gene amplification
As shown in Table 3, carbon balance of the chemostat
cultivation was within the limits (93.92.7%), indicating a
satisfactory carbon recovery. Using MFA with the stoichio-
metric model developed here and specific daptomycin pro-
duction rate as the objective function, the theoretical
daptomycin production rate was 55.61 10 3 mmol/g
DCW/h, whereas the predicted specific growth rate was
zero. When specific growth rate was set as the objective
function, the daptomycin production rate was zero. There-
fore, it is essential to balance the relationship of daptomycin
production and cell growth and improve the strain based on
in silico prediction.
Considering the above analysis, the method proposed by
Fowler et al. (2009) was applied in the present work. A
parameter, the necessity ratio (i), was introduced to compare
one pathway flux (ri) under two different objective functions
(Z) (Fowler et al. 2009):

ri zproduct
i 2
ri jzbiomass
It could be observed that each reaction exerted different
contribution to product improvement from Eq. 2. The signif-
icance of one reaction for daptomycin production can be
determined by computing the necessity ratio under daptomy-
cin maximization (product) versus the flux under specific
growth rate maximization (biomass). Additionally, the neces-
sity ratio allows the target prediction aided by in silico simu-
lation to enhance the production of desired products through
the analysis of flux trends in response to varying product
formation fluxes. Therefore, the metabolic reactions with the
Table 3 Physiological parameters of S. roseosporus LC-511 strain in chemostat culture
Strain Parametera
qGLC qDAP qLAC qAC
LC-511 0.695 (8.331.52)103 (2.670.11)102 (2.570.11)102 62.615.59 56.373.34 10.851.03 9.770.97 93.92.7
0.031
Results are represented as meanSD of three independent observations. Specific rates, CER (or OUR), and carbon balance closure are expressed in
mmol/g DCW/h, mmol/L/h, and% (C/C), respectively
a
qGLC specific glucose consumption rate, qDAP specific daptomycin production rate, qLAC specific lactate production rate, qAC specific acetate
production rate, CER carbon dioxide evolution rate, OUR oxygen uptake rate, qCO2 specific carbon dioxide production rate, qO2 specific oxygen
consumption rate, C-bal carbon balance
Appl Microbiol Biotechnol (2012) 94:637649
most significant changes were screened out based on the
calculated flux distributions. The necessity ratio of five reac-
tions leading to the relevant metabolites biosynthesis are
shown in Table 4.
Through the comparison of the reaction flux variability
with different objectives, it was found that the flux through
the pentose phosphate pathways (PPP) decreased from
0.497 mmol/g DCW/h (daptomycin maximization) to
0.131 mmol/g DCW/h (growth rate maximization). In addi-
tion, the necessity ratio (3.794) implied the necessity of the
increased metabolic flux of the reaction involved in this
pathway. However, less flux changes were observed in
EmbdenMeyerhofParnas (EMP) pathway (glucose-6-
phosphate isomerase, G6PI) and tricarboxylic acid (TCA)
cycle (isocitrate dehydrogenase, ICDH), with a necessity
ratio of only 0.449 and 1.266, respectively. The anaplerotic
pathway (phosphoenolpyruvate carboxylase, PEPC) was
similar to the case of TCA cycle, merely with necessity ratio
of 0.700. The flux through the PPP pathway changed the
highest, which was due to the high requirement of amino
acids for daptomycin synthesis. Besides, the flux directed to
the major NADPH generation which was related to the PPP
pathway exhibited an ascending trend. Therefore, the high
capacity of NADPH generation is one of the possible
features of a high antibiotic-producing strain (Borodina
et al. 2008).
According to the comparison of the flux distribution of
amino acid precursors for daptomycin, the fluxes toward the
nonproteinogenic amino acids (3-methyl glutamate and
kynurenine) changed from zero to 5.55 102 mmol/g
DCW/h. All of these reactions had an infinity necessity
ratio, indicating the necessity to increase the carbon flow
through the corresponding pathway to facilitate daptomycin
production (Table 4). It should be noticed that the two amino
acids only participated in the synthesis of daptomycin rather
than biomass, thus forming the key bottleneck for daptomycin
synthesis. Interestingly, previous work has also demonstrated
that the significance of 3-methyl glutamate precursor for the
lipopeptide yield by the deletion and complementation of dptI
(Nguyen et al. 2006), which is consistent with the prediction.
CER OUR qCO2 qO2 C-bal
Appl Microbiol Biotechnol (2012) 94:637649 643

Table 4 Reaction flux variability and necessity ratios Overexpression of zwf2 gene
Model Flux (mmol/g DCW/h) under Necessity
reactiona ratio G6PDH, catalyzing glucose-6-phosphate (G6P) to gluconolac-
Specific daptomycin Specific growth tone, is pivotal for NADPH generation in the PPP pathway. The
maximization rate maximization enzyme was encoded by both zwf1 and zwf2, while the latter
one proved the key gene (Butler et al. 2002; Ryu et al. 2006).
G6PDH 0.497 0.131 3.794
The target gene was cloned into pIB139 carrying the
ICDH 0.547 0.432 1.266
ermE* promoter and subsequently integrated into S. rose-
PEPC 0.194 0.277 0.700
osporus LC-511 chromosome through conjugal transfer (see
G6PI 0.198 0.441 0.449
2 Materials and methods). To further study the differences of
TDO 5.5510 0
enzyme activities, the batch culture was carried out in a 7.5-
MTase 5.55102 0
L bioreactor. As expected, the G6PDH activity exhibited
a
G6PDH glucose-6-phosphate dehydrogenase, ICDH isocitrate significant differences between HP-Z2 recombinant and pa-
dehydrogenase, PEPC phosphoenolpyruvate carboxylase, G6PI rental strain at 60 and 100 h (Table 5). Based on the results,
glucose-6-phosphate isomerase, TDO L-tryptophan 2, 3-dioxygenase, when the fermentation entered the stationary stage (60
MTase methyltransferase
100 h), the enzyme activity decreased sharply to half of the
value of the exponential stage, which suggested that the
Here, the MTase catalyzes the stereospecific methylation of - primary metabolism became less active and more secondary
ketoglutarate to (3R)-3-methyl-2-oxoglutarate, whereas TDO enzyme complexes were induced to synthesize the antibiotic
catalyzes the formation of N-formyl-L-kynurenine from L- (Hodgson 2000). The increase of G6PDH activity was con-
tryptophan, which is the first step of a two-step formation sistent with the increased specific glucose consumption rate.
for L-kynurenine (Miao et al. 2005). Therefore, another Further validation for gene overexpression was imple-
potential feature of daptomycin high-producing strain mented by estimating the relative mRNA abundance of zwf2
was the high activities of MTase and TDO. with RT-PCR. Taking rpsL gene as internal standard, the zwf2
It needs to be emphasized that there are two kinds of transcription level of HP-Z2 was much higher than that of
reactions not considered in the following genetic mod- parental strain (Fig. 2). The fermentation characterization of
ifications. On one hand, the reactions with the low the genetic engineered strain HP-Z2 and its parental strain was
necessity ratio were excluded in the flux calculation. performed in either defined medium (Table S1) or complex
On the other hand, there are two D-configured amino medium (Fig. 3) to investigate the effects of overexpression of
acids participated in daptomycin synthesis specifically zwf2 on daptomycin production and cell growth. As shown in
(D-alanine was also the precursor of peptidoglycan), Fig. 3, the maximum daptomycin concentration increased
with an infinity necessity ratio for the formation of D- from 406.112.3 mg/L to 473.215.5 mg/L, which was
asparagine and D-serine, which was not considered as enhanced by 16.5%. The enhancement of daptomycin pro-
the potential rate-limiting step. duction was seen since more G6P was converted by the PPP
Thus, the in silico predicted target genes for genetic pathway to form daptomycin precursors (tryptophan). In
amplification were identified as follows: zwf2 (code for addition, it was interesting to note that overexpression
G6PDH), dptI (code for MTase), and dptJ (code for TDO). of zwf2 resulted in the maximum biomass enhancement by
Subsequently, they were overexpressed to investigate the 16.8% from 19.61.5 g/L to 22.91.2 g/L. It seemed that
effects on daptomycin production and cell growth in the improved daptomycin productivity of HP-Z2 originated from
following experiments. the increased biomass. Therefore, a further comparative

Table 5 Specific activity of enzymes by the parental strain S. roseosporus LC-511 and overexpression recombinants of zwf2, dptI, and dptJ in
batch fermentation

Enzyme activities (mU/mg protein) Time (h) S. roseosporus LC-511 HP-Z2 HP-I HP-J HP-IJ HP-Z2-IJ

G6PDH 60 89.561.95 120.332.33 80.594.41 84.092.77 93.375.79 114.821.17

100 40.502.79 55.094.14 48.912.39 45.531.48 42.283.40 47.772.24
TDO 60 0.360.06 0.270.10 0.410.12 0.840.12 0.570.12 0.760.11
100 0.580.11 0.540.10 0.470.14 1.090.05 0.740.08 0.860.13
MTase 60 0.170.07 0.160.01 0.590.14 0.200.08 0.780.04 0.470.11
100 0.290.03 0.140.09 1.100.16 0.240.04 0.870.12 0.660.15

Results are represented as meanSD of three independent observations

644
Fig. 2 The comparison of gene expression by RT-PCR during late-
exponential phase in batch fermentation. The average values of the
housing gene rpsL by S. roseosporus are set as an internal reference
(100%). Values are the averages with standard deviations from three
independent measurements
analysis between strains LC-511 and HP-Z2 was carried out to
investigate the effects of zwf2 overexpression on the metabolic
characterization. Both the maximum specific growth rates
(0.067 h1) and the specific glucose consumption rates
(0.185 mmol/g DCW/h) of the strain HP-Z2 were slightly
increased compared with that of parental strain. Unexpectedly,
the content of daptomycin in the strain HP-Z2 attained
20.7 mg/g DCW, similar to that of parental strain. The data
implied that the genetic modification did not change produc-
tivity of individual cell and the apparent improvement of
daptomycin production resulted from increasing biomass. It
was also found that after overexpressing zwf2 more NADPH
was generated, which was more favorable for cell growth and
precursor synthesis (data not shown). The above results
Fig. 3 The batch fermentation profiles of recombinant strain HP-Z2
and the parental strain. Blue symbols represent LC-511 and red symbols
represent HP-Z2. Values are the averages with standard deviations
from three independent measurements
Appl Microbiol Biotechnol (2012) 94:637649
suggested that efficient regeneration of NADPH via an eleva-
tion of G6PDH activity might supply enough cofactors to
increase cell growth, thus sustaining daptomycin production
(Tian et al. 1998). Therefore, enhancing G6PDH activity was
considered as a more direct approach for efficiently utilizing
NADPH to raise the precursor level.
Overexpression of dptI and dptJ genes
To investigate the effects of the nonproteinogenic amino
acids 3-methyl glutamate and kynurenine on the daptomycin
production, the genes dptI, dptJ, and dptIJ were overex-
pressed, respectively. The enzyme activity of the parental
strain S. roseosporus LC-511 and dptI overexpressing
recombinants (HP-I, HP-IJ) displayed a significant enhance-
ment. The strains harboring an extra dptI gene copy
exhibited higher enzyme activity at 60 h and 100 h (Table 5).
The TDO activity of HP-J and HP-IJ at 60 h was 0.840.12
and 0.570.12 mU/mg protein, respectively, which was
increased by 137.7% and 61.4% compared with the parental
strain (0.360.06 mU/mg protein). Besides, TDO activity
could be up-regulated by the overexpression of the dptJ
gene. However, little change was observed when the dptIJ
operon was overexpressed, which might ascribe to a global
regulation for the strain metabolism. The conclusion was
confirmed by the case of stationary phase (100 h). For dptI
and dptJ gene, an approximately 1.5-fold increase in relative
gene expression was also detected in both recombinants,
indicating that the expression of genes was strongly
stimulated (Fig. 2).
Furthermore, the fermentation profiles of the genetic
engineered strains and the parental strain shows that over-
expression of dptI only resulted in an 11.4% improvement
of daptomycin production (up to 452.517.6 mg/L), where-
as a significant improvement of daptomycin concentration
was achieved in dptJ overexpressed recombinant compared
with the parental strain (up to 489.115.6 mg/L) (Fig. 4). In
addition, the highest daptomycin production up to 510.3
20.3 mg/L was obtained by the dptIJ overexpressed recom-
binant HP-IJ, which was about 25.7% increase compared
with the LC-511. Apparently, although the individual over-
expression of dptI or dptJ gene could result in the precursor
improvement toward daptomycin, the co-overexpression of
both two genes was more effective. Different from HP-Z2,
no variance on biomass yield was observed between the
three engineered and parental strains (Fig. 4), indicating that
overexpressing the dptI and dptJ gene did not influence the
cell growth significantly.
Co-overexpression of zwf2, dptI, and dptJ genes
Since all of the independent overexpressions of zwf2, dptI,
dptJ, and dptIJ improved daptomycin production,
Appl Microbiol Biotechnol (2012) 94:637649 645

follows: 99.7 5.3% after five generations and 96.3

8.7% after 10 generations (Fig. 5). Besides, daptomycin
production kept constant around 540 mg/L after cultur-
ing 10 generations, suggesting that the strain HP-Z2-IJ
had excellent fermentation stability due to the interior
heredity stability (Sun et al. 2009). These observations
suggested that the engineered strain is both genetic and
fermentation stable, which fulfills the requirement of
industrial fermentation.

Growth and metabolic profiles of S. roseosporus HP-Z2-IJ

in fed-batch fermentation

In order to investigate the potential daptomycin produc-

Fig. 4 The daptomycin production profiles of S. roseosporus recom-
binant strains HP-I, HP-J, HP-IJ and the parental strain in batch
tion capacity of the engineered strain HP-Z2-IJ, the fed-
fermentation. Values are the averages with standard deviations from batch cultivation was carried out in a 7.5-L bioreactor.
three independent measurements As shown in Fig. 6a, both glucose consumption and the
cell growth were slightly affected. The daptomycin pro-
investigation on the co-overexpression was carried out for duction was greatly improved by feeding glucose at
further improvement. As shown in Table 5, the specific late-exponential stage. The strain accumulated 581.5
activities of G6PDH, TDO, and MTase of the constructed 12.5 mg/L daptomycin, 43.2% of enhancement com-
strain HP-Z2-IJ at 60 h and 100 h were higher than the pared with the parental strain. In addition, other metab-
parental strain. However, the co-overexpressed strain olites such as lactate and acetate were analyzed to get a
exhibited lower activities than the individual overexpression profound metabolism insight. Less lactate and acetate
strains, which might be due to the interaction among the was observed in HP-Z2 (data not shown) and HP-Z2-
three genes. Additionally, it was worth noting that the ex- IJ (Fig. 6b), confirming that the introduction of zwf2
pression levels of three genes were enhanced as expected in into S. roseosporus directed the host cells to produce
the co-overexpressed recombinants (Fig. 2), which dropped less by-product. To a certain extent, the decreased organic
the hint of the combined role of three genes in daptomycin acids originated from pyruvate were due to the overexpression
biosynthesis. Moreover, it could be observed that the dapto- of the zwf2 gene. Interestingly, it could be observed that the
mycin accumulated up to 545.918.3 mg/L, which was organic acids were generated at the early stage of culture and
about 34.4% higher than that of parental strain. For the re-consumed by the cell at the daptomycin production stage,
recombinant HP-Z2-IJ, the maximal biomass was 21.1 g/ indicating that the strain made a shift for carbon metabolism.
L, which was 7.6% higher than that of HP-IJ. Just as the
previous analysis, comparison of fermentation characteriza-
tion between HP-IJ and HP-Z2-IJ showed that the content of
HP-Z2-IJ (25.87 mg/g DCW) was similar to that of HP-IJ
(25.67 mg/g DCW), further indicating that overexpression
of zwf2 gene affected the cell growth, thus increasing the
production.
Furthermore, the genetic engineered strain HP-Z2-IJ was
passed through 10 generations in the absence of antibiotic
pressure. The progeny still conferred apramycin resistance,
indicating that the strain was genetically stable. Simulta-
neously, the genomic DNA of the second, fifth, and ninth
cultures were extracted for further validation of the stability
of target genes on chromosome via PCR. After cultivating
without antibiotic for 10 generations, the recombinant
strain HP-Z2-IJ possessed excellent heredity stability
and the genes zwf2dptIJ were expressed stably. The Fig. 5 The fermentation stability of S. roseosporus HP-Z2-IJ. Values
percentages of cells cultivated without antibiotic selec- are the averages with standard deviations from three independent
tion pressure retained apramycin resistance were as measurements
646
Fig. 6 The comparison of daptomycin production and metabolic pro-
file between S. roseosporus LC-511 and HP-Z2-IJ strains in fed-batch
fermentation. Blue symbols represent LC-511 and red symbols repre-
sent HP-Z2-IJ. a Glucose, biomass, and daptomycin profiles. b Organ-
ic acids profiles. Values are the averages with standard deviations from
three independent measurements
Discussion
The metabolic network analysis has become an indispens-
able tool to predict target genes for antibiotic production
enhancement. However, the identification of the genes
which are highly related with desired metabolic phenotypes
has been regarded as a bottleneck of metabolic engineering.
In the present work, a two-stage strategy was adopted:
predicting the modification steps based on in silico MFA;
releasing the limited steps by modifying the biosynthetic
pathway and altering the activities of the key enzyme.
The usage of MFA provides insights into strain improve-
ment, genetic manipulation, and process optimization (Bai
et al. 2004). Previous investigations have concentrated on
the systemic approaches on the basis of the genome-scale
metabolic models to identify gene knockout targets (Alper et
al. 2005; Burgard et al. 2003; Feist et al. 2007; Park et al.
2007). However, it is difficult to recognize gene amplifica-
tion targets by the similar method. In this work, the strategy
put forward by Fowler et al. (2009) was adopted to identify
Appl Microbiol Biotechnol (2012) 94:637649
gene overexpression targets based on the necessity ratio.
Since the gene amplification targets were identified by ob-
serving the tendencies of the flux changes, the necessity
ratio in such a way that it scanned for the flux differences
was necessary for the objective flux. During the process, the
internal metabolic fluxes that increased with increasing flux
(necessity ratio) toward product formation were scanned for;
these fluxes were potential targets to be amplified for in-
creased yield of the desired product. Besides, a better choice
that could be theoretically justified was the metabolic con-
trol coefficient. Since it became possible to identify the
genes responsible for the synthesis of enzymes and to over-
express them in microorganisms, a major objective was to
identify the rate-limiting enzymes in pathways that led to
target products. Thus, they could be overexpressed in the
hope of increasing the yields of the desired products. In-
deed, if the kinetic parameters for the system under study are
available, then the construction of a kinetic model is rela-
tively simple and quick; thus, it is simple to calculate the
control coefficients on the flux (or on the concentration of a
metabolite) that one wishes to optimize. Based on the con-
trol coefficients, one can then design a genetic engineering
strategy, which can again be tested in the kinetic model
(Stephanopoulos et al. 1998). By definition, a higher neces-
sity ratio indicated the significance of reaction on target
objective, whereas the highest control coefficient suggested
the highest controlling force to the overall pathway flux.
Both of them could predict the modification targets effec-
tively. In other words, the necessity ratio was related to the
metabolic control coefficient.
As described above, the internal metabolic fluxes that
increased with increasing flux toward product formation
were identified as potential targets to be amplified, and the
corresponding genes and enzymes became the potential
modification steps (Table 4). Herein, two strategies were
applied in this research. Modification of primary metabo-
lism (overexpressing zwf2) changed the supply of NADPH,
which may influence the synthesis of amino acids and the
supply level of precursors for cell synthesis and accordingly
elevated the secondary metabolite (Borodina et al. 2008;
Reeves et al. 2004; Li and Townsend 2006). Whereas
modifying secondary metabolism merely improved the
level of key precursors of antibiotic but exerted little
impact on primary metabolism of the cell (Paradkar et
al. 2001; Thykaer et al. 2010).
To some extent, it was pivotal to engineer precursor
biosynthetic pathways for the desired secondary metabolites
production (Reeves et al. 2004; Thykaer et al. 2010). As an
essential cofactor, the NADPH is mainly generated through
the PPP pathway, which is the dominant pathway for
glucose metabolism during exponential growth (Salas et
al. 1984). A positive correlation between methylenomycin
production and carbon flux through the PPP pathway was
Appl Microbiol Biotechnol (2012) 94:637649
elucidated in S. coelicolor (Obanye et al. 1996), which
suggested that it might be possible to enhance antibiotic
production by improving the intracellular availability of
NADPH and elevating the activity of G6PDH. In addition,
using 13C-labeled substrates, Christensen and Nielsen (2000)
and Christensen et al. (2000) confirmed that the PPP flux was
higher in a high-productive penicillin strain.
The batch fermentations using defined medium were
carried out for different engineering strains. The results
showed that daptomycin production rate of engineered
strains were higher than the parental strain, indicating that
the prediction was rational (Table S1). Of course, it should
be pointed out that batch cultures were also manipulated on
complex medium (Materials and methods). The reason was
that the daptomycin concentration was low in the defined
medium whereas the complex medium could supply the
abundant nutrition to improve the growth and production
of microorganism for the sake of industrial scale application.
From the fermentation profile, it was interesting to note that
the maximum cell yield of HP-Z2 was also increased as
compared with the parental strain. Further calculation indi-
cated that the increase of daptomycin production was pro-
portional to the increase of cell growth. It has been
demonstrated that the levels of pyridine nucleotides are
highly dependent on the PPP flux and the NADPH is im-
portant for optimal operation of the metabolic pathways
(Fhrer et al. 1980), indicating that the zwf2 overexpression
strain might achieve a new physiological state. In addition,
gene expression levels of other pathways requiring NADPH
were up-regulated like pathways leading to some amino
acids and vitamins (data not shown). In this work, the
biomass yield was increased in the zwf2 overexpression
strain (HP-Z2 and HP-Z2-IJ), which was consistent with
the fact that these pathways mainly lead to biomass forma-
tion. These observations indicated that more carbon flux
into the PPP pathway was beneficial for improving the cell
growth, further enhancing the daptomycin biosynthesis
(Tian et al. 1998).
Among the precursors of daptomycin, 3-methyl gluta-
mate and kynurenine only participated in the synthesis of
daptomycin, which presented at a low concentration in vivo.
The genes dptI and dptJ were overexpressed individually
and together, and results were in agreement with the predic-
tion (Fig. 4, Table S1). It was also concluded that dptJ
overexpression exerted a more obvious influence on the
daptomycin production than dptI, indicating that kynurenine
was more essential for daptomycin biosynthesis. Different
from zwf2, the overexpression of dptI and dptJ had no effect
on biomass yield, which might be that the two amino acids
only participated in the synthesis of daptomycin and generated
little influence on cell synthesis.
In general, the individual gene overexpression caused
more carbon flux to daptomycin which showed a good
647
agreement with the prediction. However, the accumula-
tive effect was not proportional (HP-Z2-IJ was 17.9%
and 8.7% higher compared with the HP-Z2 and HP-IJ,
respectively). These data indicated that the effect of
overexpressing zwf2 was slightly small when the three
genes were overexpressed (Table S1). This might be due
to the imperfect nature of the in silico metabolic model
that could not account for complex regulatory mecha-
nisms (Kim et al. 2011). Besides, another reason might
be the synergistic effect caused by the adjacent dptI and
dptJ genes in the genome of S. roseosporus. Further-
more, altering secondary metabolism might be superior
to altering primary metabolism since the former specif-
ically increased the level of key amino acid precursors
for daptomycin and influence the antibiotic synthesis
more directly, whereas the latter only elevated the ami-
no acids level generally (Thykaer et al. 2010). However,
the identification of individual gene amplification targets
(in particular, the zwf2 and dptJ gene) was certified to
be correct.
Moreover, the transcriptional analysis demonstrated the
obvious dependence of daptomycin production on target
gene expression level and further validated the dominant
role of precursor in the daptomycin biosynthesis pathway of
S. roseosporus (Fig. 2), which was consistent with the
results elucidated in several microorganisms (Kim et al.
2011; Shi et al. 2009). Additionally, it was verified through
the increased activity of G6PDH, TDO, and MTase in the
recombinants (Table 5), which were important for daptomy-
cin biosynthesis.
To investigate the potential of the strain S. roseosporus
HP-Z2-IJ in the bioreactor, the performance of the strain in
fed-batch fermentation was tested based on the residual
glucose profile as described in Materials and methods.
Compared with the parental strain, an average of 43.2%
improvement of daptomycin production was achieved by
recombinants (Fig. 6a), while the increase of maximum
biomass was only about 6.7% (28.9 g/L). These results
implied that the engineered strain could utilize enough pre-
cursors to extend the production period and further improve
the product yields. Moreover, the organic acids are
among the most important factors which limit process
stability and cell concentration in fermentation process
(Duan et al. 2010). It was worth mentioning that less
acetate and lactate were observed in fed-batch cultiva-
tion for the recombinant (Fig. 6b). The carbon source
was thus converted to only two products (daptomycin
and CO2) in the production phase, indicating the strain
improvement strategy not only reduced the waste of
carbon source but also diverted the carbon flux into
the pool of daptomycin precursors. Therefore, manipu-
lating the fed-batch fermentation strategy successfully
improved antibiotic production.
648
Acknowledgments This research was financially supported by the
National 973 Project of China (No. 2011CB710800), the Key Program
of National Natural Science Foundation of China (Grant No.
20936002), National Natural Science Foundation of China (No.
21076022), and the Programme of Introducing Talents of Discipline
to Universities (No. B06006).
References
Alper H, Jin YS, Moxley JF, Stephanopoulos G (2005) Identifying
gene targets for the metabolic engineering of lycopene biosynthesis
in Escherichia coli. Metab Eng 7:155164
Bai DM, Zhao XM, Li XG, Xu SM (2004) Strain improvement of
Rhizopus oryzae for over-production of L(+)-lactic acid and meta-
bolic flux analysis of mutants. Biochem Eng J 18:4148
Baltz RH, Miao V, Wrigley SK (2005) Natural products to drugs:
daptomycin and related lipopeptide antibiotics. Nat Prod Rep
22:717741
Borodina I, Krabben P, Nielsen J (2005) Genome-scale analysis of
Streptomyces coelicolor A3(2) metabolism. Genome Res 15:820
829
Borodina I, Siebring J, Zhang J, Smith CP, van Keulen G, Dijkhuizen
L, Nielsen J (2008) Antibiotic overproduction in Streptomyces
coelicolor A3(2) mediated by phosphofructokinase deletion. J
Biol Chem 283:2518625199
Burgard AP, Pharkya P, Maranas CD (2003) OptKnock: a bilevel
programming framework for identifying gene knockout strategies
for microbial strain optimization. Biotechnol Bioeng 84:647657
Butler MJ, Bruheim P, Jovetic S, Marinelli F, Postma PW, Bibb MJ
(2002) Engineering of primary carbon metabolism for improved
antibiotic production in Streptomyces lividans. Appl Environ
Microbiol 68:47314739
Celik E, Calik P, Oliver SG (2010) Metabolic flux analysis for recom-
binant protein production by Pichia pastoris using dual carbon
sources: effects of methanol feeding rate. Biotechnol Bioeng
105:317329
Christensen B, Nielsen J (2000) Metabolic network analysis of
Penicillium chrysogenum using 13C-labeled glucose. Biotechnol
Bioeng 68:652659
Christensen B, Thykaer J, Nielsen J (2000) Metabolic characterization
of high- and low-yielding strains of Penicillium chrysogenum.
Appl Microbiol Biotechnol 54:212217
Duan YX, Chen T, Chen X, Zhao XM (2010) Overexpression of
glucose-6-phosphate dehydrogenase enhances riboflavin produc-
tion in Bacillus subtilis. Appl Microbiol Biotechnol 85:1907
1914
Feist AM, Henry CS, Reed JL, Krummenacker M, Joyce AR, Karp PD,
Broadbelt LJ, Hatzimanikatis V, Palsson BO (2007) A genome-
scale metabolic reconstruction for Escherichia coli K-12 MG1655
that accounts for 1260 ORFs and thermodynamic information.
Mol Syst Biol 3:121
Fowler ZL, Gikandi WW, Koffas MA (2009) Increased malonyl coen-
zyme A biosynthesis by tuning the Escherichia coli metabolic
network and its application to flavanone production. Appl Envi-
ron Microbiol 75:58315839
Fhrer L, Kubicek CP, Rhr M (1980) Pyridine nucleotide levels and
ratios in Aspergillus niger. Can J Microbiol 26:405408
Hodgson DA (2000) Primary metabolism and its control in streptomy-
cetes: a most unusual group of bacteria. Adv Microb Physiol
42:47238
Huber FM, Pieper RL, Tietz AJ (1988) The formation of daptomycin
by supplying decanoic acid to Streptomyces roseosporus cultures
producing the antibiotic complex A21978C. J Biotechnol 7:283
292
Appl Microbiol Biotechnol (2012) 94:637649
Ishimura Y, Nozaki M, Hayaishi O (1970) The oxygenated form of L-
tryptophan 2, 3-dioxygenase as reaction intermediate. J Biol
Chem 245:35933602
Kieser T, Bibb MJ, Buttner MJ, Chater KF, Hopwood DA (2000)
Practical Streptomyces genetics. John Innes Foundation, Norwich
Kim HB, Smith CP, Micklefield J, Mavituna F (2004) Metabolic flux
analysis for calcium dependent antibiotic (CDA) production in
Streptomyces coelicolor. Metab Eng 6:313325
Kim SH, Lee HN, Kim HJ, Kim ES (2011) Transcriptome analysis of an
antibiotic downregulator mutant and synergistic Actinorhodin stim-
ulation via disruption of a precursor flux regulator in Streptomyces
coelicolor. Appl Environ Microbiol 77:18721877
Lessie TG, Vander Wyk JC (1972) Multiple forms of Pseudomomas
multivorans glucose-6-phosphate and 6-phosphogluconate dehydro-
genases: differences in size, pyridine nucleotide specificity and
susceptibility to inhibition by adenosine 5-triphosphate. J Bacteriol
110:11071117
Li R, Townsend CA (2006) Rational strain improvement for enhanced
clavulanic acid production by genetic engineering of the glyco-
lytic pathway in Streptomyces clavuligerus. Metab Eng 8:240
252
Liu T, You D, Valenzano C, Sun Y, Li J, Yu Q, Zhou X, Cane DE,
Deng Z (2006) Identification of NanE as the thioesterase for
polyether chain release in nanchangmycin biosynthesis. Chem
Biol 13:945955
Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression
data using real-time quantitative PCR and the 2(Delta Delta C
(T)) method. Methods 25:402408
MacNeil DJ, Gewain KM, Ruby CL, Dezeny G, Gibbons PH, MacNeil
T (1992) Analysis of Streptomyces avermitilis genes required for
avermectin biosynthesis utilizing a novel integration vector. Gene
111:6168
Mahlert C, Kopp F, Thirlway J, Micklefield J, Marahiel MA (2007)
Stereospecific enzymatic transformation of -ketoglutarate to
(2S,3R)-3-methyl glutamate during acidic lipopeptide biosynthesis.
J Am Chem Soc 129:1201112018
Mathai D, Biedenbach DJ, Jones RN, Bell JM, Turnidge J, Sader HS
(2009) Activity of daptomycin against Gram-positive bacterial
isolates from Indian medical centres. Int J Antimicrob Agents
34:497499
Miao V, Coffet-Legal MF, Brian P, Brost R, Penn J, Whiting A, Martin
S, Ford R, Parr I, Bouchard M, Silva CJ, Wrigley SK, Baltz RH
(2005) Daptomycin biosynthesis in Streptomyces roseosporus: clon-
ing and analysis of the gene cluster and revision of peptide stereo-
chemistry. Microbiology 151:15071523
Nailor MD, Sobel JD (2009) Antibiotics for gram-positive bacterial
infections: vancomycin, teicoplanin, quinupristin/dalfopristin,
oxazolidinones, daptomycin, dalbavancin, and telavancin. Infect
Dis Clin North Am 23:965982
Nguyen KT, Kau D, Gu JQ, Brian P, Wrigley SK, Baltz RH, Miao V
(2006) A glutamic acid 3-methyltransferase encoded by an acces-
sory gene locus important for daptomycin biosynthesis in Strep-
tomyces roseosporus. Mol Microbiol 61:12941307
Obanye AIC, Hobbs G, Gardner DCJ, Oliver SG (1996) Correlation
between carbon flux through the pentose phosphate pathway and
production of the antibiotic methylenomycin in Streptomyces
coelicolor A3(2). Microbiology 142:133137
Okamoto S, Lezhava A, Hosaka T, Okamoto-Hosoya Y, Ochi K (2003)
Enhanced expression of S-adenosylmethionine synthetase causes
overproduction of actinorhodin in Streptomyces coelicolor A3(2).
J Bacteriol 185:601609
Paradkar AS, Mosher RH, Anders C, Griffin A, Griffin J, Hughes C,
Greaves P, Barton B, Jensen SE (2001) Applications of gene
replacement technology to Streptomyces clavuligerus strain de-
velopment for clavulanic acid production. Appl Environ Micro-
biol 67:22922297
Appl Microbiol Biotechnol (2012) 94:637649
Park JH, Lee KH, Kim TY, Lee SY (2007) Metabolic engineering of
Escherichia coli for the production of L-valine based on tran-
scriptome analysis and in silico gene knockout simulation. Proc
Natl Acad Sci USA 104:77977802
Peng L, Shimizu K (2003) Global metabolic regulation analysis for
Escherichia coli K-12 based on protein expression by 2D electro-
phoresis and enzyme activity measurement. Appl Microbiol Bio-
technol 61:163178
Reeves AR, Cernota WH, Brikun IA, Wesley RK, Weber JM (2004)
Engineering precursor flow for increased erythromycin produc-
tion in Aeromicrobium erythreum. Metab Eng 6:300312
Rhee KH, Davies J (2006) Transcription analysis of daptomycin bio-
synthetic genes in Streptomyces roseosporus. J Microbiol Bio-
technol 16:18411848
Ryu YG, Butler MJ, Chater KF, Lee KJ (2006) Engineering of primary
carbohydrate metabolism for increased production of actinorhodin
in Streptomyces coelicolor. Appl Environ Microbiol 72:71327139
Salas JA, Quiros LM, Hardisson C (1984) Pathways of glucose catab-
olism during germination of Streptomyces spores. FEMS Micro-
biol Lett 22:229233
Sambrook J, Russell DW (2001) Molecular cloning: a laboratory manual,
3rd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor
Shi S, Chen T, Zhang Z, Chen X, Zhao X (2009) Transcriptome
analysis guided metabolic engineering of Bacillus subtilis for
riboflavin production. Metab Eng 11:243252
649
Stephanopoulos G, Aristidou AA, Nielsen J (1998) Metabolic engi-
neering: principles and methodologies, 1st edn. Academic, San
Diego
Sun Y, He X, Liang J, Zhou X, Deng Z (2009) Analysis of functions in
plasmid pHZ1358 influencing its genetic and structural stability
in Streptomyces lividans 1326. Appl Microbiol Biotechnol
82:303310
Tamehiro N, Hosaka T, Xu J, Hu H, Otake N, Ochi K (2003) Innova-
tive approach for improvement of an antibiotic-overproducing
industrial strain of Streptomyces albus. Appl Environ Microbiol
69:64126417
Taymaz-Nikerel H, Borujeni AE, Verheijen PJ, Heijnen JJ, van Gulik
WM (2010) Genome-derived minimal metabolic models for
Escherichia coil MG1655 with estimated in vivo respiratory
ATP stoichiometry. Biotechnol Bioeng 107:369381
Thykaer J, Nielsen J, Wohlleben W, Weber T, Gutknecht M, Lantz AE,
Stegmann E (2010) Increased glycopeptide production after over-
expression of shikimate pathway genes being part of the balhi-
mycin biosynthetic gene cluster. Metab Eng 12:455461
Tian WN, Braunstein LD, Pang J, Stuhlmeier KM, Xi QC, Tian X,
Stanton RC (1998) Importance of glucose-6-phosphate dehydro-
genase activity for cell growth. J Biol Chem 273:1060910617
Wittmann M, Linne U, Pohlmann V, Marahiel MA (2008) Role of
DptE and DptF in the lipidation reaction of daptomycin. FEBS J
275:53435354