Anda di halaman 1dari 52

KARAKTERISASI DAN KONSTRUKSI VEKTOR EKSPRESI

GEN SMALL HEAT SHOCK PROTEIN (sHSP) Lactobacillus


plantarum SEBAGAI ALTERNATIF PENANDA SELEKSI
FOOD GRADE DI Lactococcus lactis

HASLIA MARGARETA

SEKOLAH PASCASARJANA
INSTITUT PERTANIAN BOGOR
BOGOR
2015
PERNYATAAN MENGENAI TESIS DAN
SUMBER INFORMASI SERTA PELIMPAHAN HAK CIPTA*

Dengan ini saya menyatakan bahwa tesis berjudul Karakterisasi dan


Konstruksi Vektor Ekspresi Gen small Heat Shock Protein (sHSP) Lactobacillus
plantarum sebagai Alternatif Penanda Seleksi Food Grade di Lactococcus lactis
adalah benar karya saya dengan arahan dari komisi pembimbing dan belum
diajukan dalam bentuk apa pun kepada perguruan tinggi mana pun. Sumber
informasi yang berasal atau dikutip dari karya yang diterbitkan maupun tidak
diterbitkan dari penulis lain telah disebutkan dalam teks dan dicantumkan dalam
Daftar Pustaka di bagian akhir tesis ini.
Dengan ini saya melimpahkan hak cipta dari karya tulis saya kepada Institut
Pertanian Bogor dan LIPI.

Bogor, November 2015

Haslia Margareta
NIM P051130211
RINGKASAN

HASLIA MARGARETA. Karakterisasi dan Konstruksi Vektor Ekspresi Gen small Heat
Shock Protein (sHSP) Lactobacillus plantarum sebagai Alternatif Penanda Seleksi Food
Grade di Lactococcus lactis. Dibimbing oleh UTUT WIDYASTUTI dan APON ZAENAL
MUSTOPA.

Bakteri asam laktat dikenal dengan bakteri yang memiliki status Generallly
Recogninize As Safe (GRAS) yaitu mikroba yang aman dan tidak beresiko terhadap
kesehatan. BAL umumnya digunakan pada industri fermentasi makanan. Lactobacillus
plantarum U10 adalah salah satu BAL yang telah diisolasi dari makanan fermentasi
tradisional Indonesia, yaitu Tempoyak. BAL mempunyai sifat yang sensitif terhadap
kondisi lingkungan, ketika digunakan sebagai starter komersial atau ketika produk
fermentasi sedang diproses, diangkut dan disimpan. Strategi yang digunakan untuk
meningkatkan ketahanan BAL terhadap tekanan lingkungan adalah dengan
mengembangkan food grade vector dengan marka seleksi gen small Heat Shock Protein
(sHSP). Penelitian ini bertujuan untuk mengkarakterisasi gen small Heat Shock Protein
(sHSP) asal L. plantarum U10 yang diisolasi dari makanan tradisional Indonesia
Tempoyak. Selain itu penelitian ini juga bertujuan untuk mengklon promotor slpA dan
gen sHSP ke dalam vektor kloning pGEM-T dan konstruksi gen fusi antara promotor slpA
dan gen sHSP ke dalam vektor ekspresi pNZ8148, serta mengintroduksikannya ke dalam
strain BAL jenis L. lactis NZ3900.
Penelitian ini terdiri dari tiga tahapan, yaitu karakterisasi, kloning dan konstruksi.
karakterisasi dimulai dengan perlakuan kejut panas pada L. plantarum U10 dan SDS-
PAGE. Selanjutnya dilakukan uji aktivitas Chaperon, isolasi total RNA dan analisis
Reverse Transcriptase PCR. Tahapan kloning dimulai dari amplifikasi gen sHSP dari
DNA kromosom L. plantarum U10 dan promotor slpA dari isolat L. acidophilus C9-9,
kemudian mengkloningnya ke dalam vektor kloning pGEM-Teasy. Selanjutnya vektor
kloning pGEM-T slpA digunakan sebagai sumber untuk memperoleh promotor slpA dan
pGEM-T sHSP sebagai sumber untuk gen sHSP. Konstruksi vektor food grade dilakukan
dengan memfusikan promotor dan gen terlebih dahulu. Fusi keduanya dilakukan dengan
teknik PCR overlapping sehingga menghasilkan fusi antara promotor slpA dan gen sHSP.
Fusi dipotong dengan menggunakan enzim restriksi SalI-BglII. Vektor ekspresi pNZ8148
juga dipotong dengan enzim yang sama pada daerah kloramfenikol, dan kemudian
diligasikan dengan fusi slpA-sHSP. Tahapan terakhir adalah mengintroduksikan hasil
ligasi ke inang L. lactis NZ3900 menggunakan teknik elektroporasi, dan dilakukan
konfirmasi dengan PCR Koloni.
Karakterisasi dari small Heat Shock Protein (sHSP) dari isolat Lactobacillus
Plantarum yang diisolasi dari Tempoyak telah diteliti. Protein yang berhubungan dengan
respon panas memiliki ukuran yang bervariasi antara 18-51 kDa. Fraksi Intraselular
Protein (IP) dari kejut panas L. plantarum U10 menunjukkan aktivitas chaperon
dibuktikan dengan kemampuan untuk mencegah hilangnya aktivitas proteinase K dari
denaturasi. Selain itu, gen sHSP berhasil di identifikasi dengan metode PCR dengan ukuran
423 pb. Protein sHSP dengan ukuran 18 kDa karena peningkatan regulasi setelah L.
plantarum U10 diberi perlakuan tekanan panas yang dibuktikan dengan Reverse
Transcriptase-PCR. Hasil ini menunjukkan bahwa protein sHSP 18 kDa pada penelitian
ini dapat mempertahankan kelangsungan hidup L. plantarum dan mampu melindungi sel
terhadap tekanan suhu.
Fragmen promotor slpA berukuran 192 pb berhasil teramplifikasi dari L.
acidhopilus C9-9. Fragmen gen sHSP berukuran 423 pb berhasil teramplifikasi dari
kromosom L. plantarum U10. Hasil analisis sekuen menunjukkan bahwa promotor slpA
memiliki tingkat kemiripan mendekati 100% dengan L. acidophilus ATCC 4356 referensi.
Analisis sekuen gen sHSP juga menunjukkan tingkat kemiripan tinggi 100% dengan L.
plantarum WCFS1 referensi. Fusi antara promotor slpA dan gen sHSP berhasil
termplifikasi dengan ukuran 615 pb dengan teknik PCR overlapping. Fusi gen tersebut
berhasil dimasukkan ke dalam vektor ekspresi dengan mengganti bagian kloramfenikol
yang telah dipotong terlebih dahulu dengan enzim restriksi yang sama yaitu SalI dan BglII
sehingga terbentuk pNZ8148-slpA-sHSP dan diintroduksikan ke inang L. lactis NZ3900.
Konfirmasi vektor rekombinan dilakukan dengan PCR koloni dengan penggunakan primer
dari gen fusi slpA dan sHSP dan PCR koloni dengan menggunakan primer promotor dan
terminator pNZ8148.

Kata kunci: small Heat shock Protein, Lactobacillus plantarum, food grade vector,
Lactococcus lactis.
SUMMARY
HASLIA MARGARETA. Characterization and Construction Of Lactobacillus
plantarum small Heat Shock Protein (sHSP) Gene Expression Vector As
Alternative Food Grade Selection Marker in Lactococcus lactis. Supervised by
UTUT WIDYASTUTI and APON ZAENAL MUSTOPA.

Lactic acid bacteria are known generally recognize as safe (GRAS) that
microbes are safe, without risk on health. LAB is commonly used in food
fermentation industry. Lactobacillus plantarum U10 is one of LAB has been
isolated from Indonesian traditional fermented food, namely Tempoyak. LAB are
sensitive to environmental conditions when commercial starters or fermentation
products are being processed, transported and strored. The startegy used to increase
resistance of LAB to environmental stress is to develop food grade vektor with
selection marker small heat shock protein (sHSP) gene. This study aimed to
characterize the genes small Heat Shock Protein (sHSP) of L. plantarum U10
isolated from Indonesian traditional food "Tempoyak". In addition , this study also
aims to clone a promoter slpA and sHSP gene into the cloning vector pGEM-T and
the construction of a fusion gene between the promoter slpA and sHSP gene into
the expression vector pNZ8148, and introduction into strain L. lactis NZ3900.
This study consisted of three phases, namely the characterization, cloning
and construction. Characterization starting with heat shock treatment on L.
plantarum U10 and SDS-PAGE. The next step is Chaperon activity assay, total
RNA isolation and Reverse-Transcriptase PCR analysis. Cloning starts with
amplification of sHSP gene from chromosomal DNA of L. plantarum U10 and
Promoter slpA from isolate L. acidhophilus C9-9, then cloned into cloning vector
pGEM-Teasy. Furthermore the cloning vector pGEM-T slpA used as a source for
obtain the slpA promoter and pGEM-T sHSP as a source for sHSP genes. The
construction of food grade vector is done with promoter and genes merge first. The
fusion between slpA promoter and sHSP genes by overlapping PCR technique. The
result of fusion then digested with restriction enzymes SalI-BglII. Expression
vector pNZ8148 also digested with same enzyme in chlorampenicol area, and then
ligated with fusion slpA-sHSP. The last step is introduce the result of ligation to
host L. lactis NZ3900 using electroporation technique, and confirmed by PCR
colonies.
The characterization of small heat shock protein (sHSP) from tempoyak-
originated Lactobacillus plantarum was investigated. The heat adaptive response
proteins were ranging from 18 kDa to 51 kDa. The Intercellular Protein (IP)
fraction of heat shocked-L.plantarum U10 exhibited chaperone like activity by the
ability to prevent loss of proteinase K activity from denaturation. Furthermore, The
sHSP gene that related to the predicted sHSP 18 kDa protein were successfully
identified by PCR method and this gene has 423 pb size. Moreover, the sHSP 18
kDa was indeed up-regulated after L. plantarum U10 treated by heat shocking as
proven by Reverse Transcriptase-PCR. This result suggested that sHSP protein 18
kDa in our study may confers a survival advantage on Lactobacillus plantarum and
capable of protecting the cell against under temperature stress.
slpA promoter fragment size 192 pb successfully amplified from L.
acidhopilus C9-9. Fragment of sHSP gene size 423 pb successfully amplified from
the chromosome of L. plantarum U10. Results of sequence analysis showed that
the promoter slpA have a similarity rate approaching 100 % with L. acidophilus
ATCC 4356 reference. Analysis of gene sequence similarity sHSP also show high
rate 100% with L. plantarum WCFS1 reference. Fusion between the slpA promoter
and sHSP gene successfully termplifikasi with the size 615 pb PCR overlapping.
The fusion gene was successfully inserted into the expression vector by replacing
the chlorampenicol that has been cut in advance with the same restriction enzyme
that SalI and BglII to form pNZ8148-slpA-sHSP and introduced into the host L.
lactis NZ3900. Confirmation recombinant vector is done by colony PCR with the
use of gene fusion primer slpA and SHSP and colony PCR using a primer promoter
and terminator pNZ8148.

Keywords: small Heat Shock Protein, Lactobacillus plantarum, food grade vector
Lactococcus lactis.
Hak Cipta Milik IPB dan LIPI, Tahun 2015
Hak Cipta Dilindungi Undang-Undang
Dilarang mengutip sebagian atau seluruh karya tulis ini tanpa mencantumkan atau
menyebutkan sumbernya. Pengutipan hanya untuk kepentingan pendidikan,
penelitian, penulisan karya ilmiah, penyusunan laporan, penulisan kritik, atau
tinjauan suatu masalah; dan pengutipan tersebut tidak merugikan kepentingan IPB
dan LIPI.

Dilarang mengumumkan dan memperbanyak sebagian atau seluruh karya tulis ini
dalam bentuk apa pun tanpa izin IPB dan LIPI
KARAKTERISASI DAN KONSTRUKSI VEKTOR EKSPRESI
GEN SMALL HEAT SHOCK PROTEIN (sHSP) Lactobacillus
plantarum SEBAGAI ALTERNATIF PENANDA SELEKSI
FOOD GRADE DI Lactococcus lactis

HASLIA MARGARETA

Tesis
sebagai salah satu syarat untuk memperoleh gelar
Magister Sains
pada
Program Studi Bioteknologi

SEKOLAH PASCASARJANA
INSTITUT PERTANIAN BOGOR
BOGOR
2015
Penguji Luar Komisi pada Ujian Tesis: Dr Ir Harsi Dewantari Kusumaningrum
PRAKATA

Puji dan syukur penulis panjatkan kepada Allah subhanahu wa taala atas segala
karunia-Nya sehingga karya ilmiah ini berhasil diselesaikan. Karya ilmiah ini berjudul
Karakterisasi dan Konstruksi Vektor Ekspresi Gen small Heat Shock Protein (sHSP)
Lactobacillus plantarum sebagai Alternatif Penanda Seleksi Food Grade di Lactococcus
lactis yang telah dilaksanakan sejak bulan November 2014 sampai Juni 2015.
Terima kasih penulis ucapkan kepada Ibu Dr Ir Utut Widyastuti, MSi selaku
pembimbing utama dan Bapak Dr Apon Zaenal Mustopa, MSi selaku anggota pembimbing
atas bimbingan dalam penyusunan karya ilmiah ini. Ucapan terima kasih juga
disampaikan kepada Dr Ir Harsi Dewantari Kusumaningrum yang telah memberikan
masukan dalam memperkaya tulisan ini. Penulis juga mengucapkan terima kasih kepada
Dr Ir Bambang Sunarko sebagai Kepala Pusat Penelitian Bioteknologi LIPI yang telah
memberikan izin kepada penulis untuk melakukan penelitian di Pusat Penelitian
Bioteknologi LIPI. Penulis juga mengucapkan terima kasih kepada Ayahanda Sarman,
AmdPd dan Ibunda Miharsyawati, AmdPd atas doa dan kasih sayangnya, serta keempat
saudara saya Yenni Afrida, SPt, Dwi Wahyu Gandadi Putra, Amd, Seppi Triani, SH dan
Lisa Puspita Sari, SKM yang selalu memberikan semangat dan kasih sayang kepada saya.
Tidak lupa saya ucapkan terima kasih kepada teman-teman dan rekan-rekan staf di
Laboratorium Bioteknologi-LIPI, dan teman-teman Bioteknologi 2013-2014 yang
membantu penulis. Selain itu, ucapan terima kasih juga saya haturkan kepada Badan
Litbang Pertanian, Kementerian Pertanian yang telah membiayai penelitian ini melalui
skema Kerjasama Kemitraan Penelitian dan Pengembangan Pertanian Nasional (KKP3N)
2014-2015.
Penyusunan karya ilmiah ini tentunya tidak terlepas dari kekurangan. Oleh karena
itu, penulis mengharapkan adanya saran dan kritik yang membangun untuk
menyempurnakan penulisan karya ilmiah ini. Semoga karya ilmiah ini bermanfaat.

Bogor, November 2015

Halia Margareta
DAFTAR ISI

DAFTAR TABEL xii


DAFTAR GAMBAR xii
DAFTAR LAMPIRAN xii

1 PENDAHULUAN
Latar Belakang 1
Tujuan Penelitian 2

2 TINJAUAN PUSTAKA 3
Lactobacillus plantarum 3
Small Heat Shock Protein 4
Penanda Seleksi 5
Lactococcus lactis 6

3 METODE 7
Tempat dan Waktu Penelitian 7
Bahan 7
Prosedur Kerja 9

4 HASIL DAN PEMBAHASAN 13


Pengaruh Perlakuan Kejut Panas pada Profil Ekspresi Protein
L.plantarum U10 13
Ekspresi Gen dari Kejut Panas L. plantarum U10 dan Uji Aktivitas
Chaperon 14
Konstruksi Vektor Kloning pGEM-T slpA dan pGEM-T 16
Konstruksi Vektor Ekspresi dengan Fusi Promotor slpA
dan Gen sHSP 20

5 SIMPULAN DAN SARAN 23


Simpulan 23
Saran 23

DAFTAR PUSTAKA 24
LAMPIRAN 28
RIWAYAT HIDUP 37
DAFTAR TABEL
1 Primer yang digunakan untuk amplifikasi gen 7
2 Plasmid dan strain bakteri 9
3 Kondisi reaksi PCR 11
4 Profile ekspresi protein intraseluler L. plantarum U10 setelah perlakuan
kejut panas. 14

DAFTAR GAMBAR
1 Scaning Electron Micrograph dari L. plantarum WCFS1 3
2 Mekanisme Pengaturan Heat Shock Response dan HSF-1 5
3 Vektor kloning pGEM-Teasy dan vektor ekspresi pNZ8148 7
4 Diagram Alir Penelitian 8
5 Profile ekspresi L. plantarum protein intraseluler setelah perlakuan 13
kejut panas.
6 Analisis cDNA sHSP L. plantarum 14
7 Uji aktivitas Chaperon 15
8 Hasil amplifikasi PCR promotor slpA dan Peta vektor kloning 16
rekombinan pGEM-slpA
9 Hasil transformasi E. coli TOP 10 dengan pGEM-slpA. 17
10 Hasil PCR Koloni dan PCR Plasmid E. coli TOP 10 dengan pGEM- 17
slpA.
11 Hasil amplifikasi PCR promotor sHSP dan Peta vektor kloning 18
rekombinan pGEM-sHSP
12 Hasil transformasi E. coli TOP 10 dengan pGEM-sHSP. 18
13 Hasil PCR Koloni dan PCR Plasmid E. coli TOP 10 dengan pGEM- 19
sHSP
14 Hasil analisis sekuen promotor surface layer protein A 19
15 Hasil analisis sekuensing gen penyandi small Heat Shock Protein 20
16 Skema prosedur kontsruksi pNZ8148 slpA_sHSP 21
17 Hasil amplifikasi fusi slpA dan sHSP dan Transformasi 22
pNZ8148_slpA_ sHSP ke L. lactis
18 Hasil PCR koloni menggunakan primer F/R gen fusi pada L. lactis 23
rekombinan.
19 Hasil PCR koloni menggunakan primer F/R Pro NisA dan Term 23
pNZ8148.

DAFTAR LAMPIRAN
1 Komposisi media pertumbuhan de Man, Rogosa, Sharpe (MRS) 30
2 Komposisi larutan elektroforesis SDS-PAGE 31
3 Metode Isolasi Total RNA 32
4 Komposisi media pertumbuhan bakteri Luria-Bertani (LB) 33
5 Komposisi media pertumbuhan M17 34
6 Zona Bening Uji Aktivitas Chaperon 35
7 Hasil pengurutan nukleotida promotor pGEM-T slpA 36
8 Hasil pengurutan nukleotida gen pGEM-T sHSP 37
1 PENDAHULUAN

Latar Belakang

Bakteri asam laktat dikenal dengan bakteri yang memiliki status Generallly
Recogninize As Safe (GRAS) yaitu mikroba yang aman dan tidak beresiko terhadap
kesehatan. BAL umumnya digunakan pada industri pangan dan farmasi. Dalam
industri pangan bakteri asam laktat telah digunakan secara luas sebagai kultur
starter untuk beragam fermentasi daging, susu, sayuran, buah, dan roti. Selain itu
BAL juga digunakan sebagai pengawet produk pangan, karena BAL mampu
menghasilkan senyawa antimikroba yang disebut bakteriosin. Pada industri
farmasi, bakteri asam laktat digunakan sebagai probiotik dan untuk produksi
vaksin. BAL merupakan sel inang yang aman terhadap pangan. Bakteri asam laktat
digunakan dalam berbagai macam industri fermentasi makanan dan telah diketahui
memberikan efek yang menguntungkan bagi kesehatan manusia. Metabolit yang
dihasilkan oleh BAL dapat secara efektif mengontrol pertumbuhan bakteri patogen
dan pembusuk. BAL sebagai food grade microorganism dikatakan aman terutama
dalam pangan karena sifatnya tidak menghasilkan racun bahkan beberapa jenis
diantaranya berguna bagi kesehatan.
Sel inang yang aman dan telah memiliki status GRAS yang sering digunakan
dalam mengekspresikan protein rekombinan adalah Lactococcus lactis (Mierau et
al. 2005). Selain aman, penggunaan L. lactis juga dikarenakan inang tersebut
mudah ditangani, telah dikarakterisasi sebagai mikroorganisme yang baik untuk
industri dan mampu mensekresikan protein rekombinan pada media
pertumbuhannya sehingga produk yang dihasilkan bebas dari endotoksin. Terdapat
banyak penelitian yang telah dikembangkan dengan menggunakan inang L. lactis
misalnya produksi protease, amilase dan bakteriosin sendiri (Martin et al. 2007;
Liang et al. 2010; Jorgensen et al. 2013; Wu et al. 2013 dan Lages et al. 2015).
BAL mempunyai sifat yang sensitif terhadap kondisi lingkungan, ketika
digunakan sebagai starter komersial atau ketika produk fermentasi sedang diproses,
diangkut dan disimpan (Tian et al. 2012). Strategi yang digunakan untuk
meningkatkan ketahanan BAL terhadap tekanan lingkungan adalah dengan
mengembangkan food grade vector dengan marka seleksi gen small Heat Shock
Protein (sHSP).
Food grade vector merupakan vektor yang dapat diaplikasikan dalam industri
makanan karena berasal dari mikroorganisme yang tidak berbahaya bagi tubuh
manusia (Johansen 2003). Food grade vector yang telah dikembangkan antara lain
pNP40 dari Lactococcus lactis DRC3 dan pSF01 dari L. lactis strain 10.088 (Morelli
et al. 2004), dan vektor pGF1 dari strain Lactococcus lactis (Kim et al. 2002).
Teknologi rekayasa genetik sudah banyak dilakukan dan dikembangkan, metode
yang digunakan saat ini untuk mempertahankan stabilitas vektor dalam sel inang
adalah dengan menyisipkan sekuen DNA yang relatif besar, misalnya resisten
antibiotik atau bakteriosin. Penggunaan seleksi antibiotik memiliki beberapa
kelemahan. Residu antibiotik dalam pangan dapat mengancam kesehatan masyarakat.
Ancaman tersebut antara lain resistensi bakteri, alergi terhadap pangan dan juga
keracunan (Donkor et al. 2011). Selain itu, penggunaan gen resistensi pada plasmid
akan menyebabkan antibiotik dan bakteriosin terdapat di dalam media budidaya. Hal
2
2 2

ini tidak diinginkan dalam pembuatan produk makanan dan pakan (Diekely et al.
1995). Saat ini, telah banyak digunakan penanda seleksi untuk membangun food
grade vector seperti -galaktosidase dari S. thermophilus (Herman et al. 1985), gen
sHSP (El Demardash et al. 2003; Spano et al. 2005), gen yang terkait auxotrophy
(Bron et al. 2002), bakteriosin (Mills et al. 2002; Takala et al. 2002), dan jalur
metabolik baru (Boucher et al. 2002) telah digunakan dalam konstruksi food grade
vector sebagai marka seleksi.
Lactobacillus plantarum dengan kode isolat U10 pada penelitian ini telah
diisiolasi dan dikarakterisasi dari makanan tradisioanal Indonesia yaitu tempoyak
yang merupakan makanan fermentasi dari buah durian. L. plantarum ini
menunjukkan aktivitas antibakteri yang sangat baik terhadap bakteri patogen dan
galur ini menunjukkan keuntungan yang akan diterapkan dalam bidang medis sebagai
antibakteri alami (Urnemi et al. 2010). Studi lain tentang L. plantarum sudah
dilakukan oleh Spano (2005) yaitu dengan mengklon dan mengkarakterisasi gen
small heat shock protein (sHSP) dari L. plantarum yang diisolasi dari Wine. Gen
sHSP memiliki peranan terhadap stres lingkungan pada L. plantarum dan menurut El
Demardash et al. 2003 gen sHSP dari plasmid S. thermophilus merupakan marka
seleksi yang ideal digunakan karena gen sHSP dapat meningkatkan ketahanan
terhadap tekanan lingkungan.
Heat shock protein merupakan suatu protein yang dihasilkan karena adanya
stres lingkungan. Gen sHSP merupakan gen yang berperan dalam proteksi terhadap
beberapa jenis stres dengan berat molekul protein berkisar 11-42 kDa dan banyak
terdapat pada prokariot dan eukariot (Tian et al. 2012). Heat shock protein
terekspresi karena adanya stres atau disebut juga gen yang sifatnya inducible. Studi
promotor yang akan digunakan yaitu promotor surface layer protein A (slpA) telah
dilakukan oleh McCracken (1999) dari tipe liar Lactobacillus acidophilus ATCC
4356 ke dalam plasmid pNZ272 yang merupakan promotor kuat.
Dari penjelasan di atas untuk meningkatkan ketahanan dari BAL yang bersifat
sensitif terhadap stress lingkungan adalah dengan konstruksi vektor ekspresi yang
membawa gen small heat shock protein atau disebut juga sHSP yang dapat
meningkatkan stres resinten dari sel inang.

Tujuan Penelitian

Penelitian ini bertujuan untuk mengkarakterisasi gen small Heat Shock


Protein (sHSP) asal L. plantarum U10 yang diisolasi dari makanan tradisional
Indonesia Tempoyak. Selain itu penelitian ini juga bertujuan untuk mengklon
promotor slpA dan gen sHSP ke dalam vektor kloning pGEM-T dan konstruksi gen
fusi antara promotor slpA dan gen sHSP ke dalam vektor ekspresi pNZ8148, serta
mengintroduksikannya ke dalam strain BAL jenis L. lactis NZ3900.
3

2 TINJAUAN PUSTAKA

Lactobacillus plantarum

Bakteri asam laktat (BAL) adalah kelompok bakteri Gram positif, tidak
membentuk spora, katalase negatif, tanpa sitokrom, bersifat anaerob, dan oksidase
positif, toleran asam, asam laktat sebagai produk utama fermentasi karbohidrat.
Umumnya bakteri asam laktat tumbuh pada habitat yang kaya nutrisi, seperti
produk makanan, susu, daging, dan sayuran. Bakteri asam laktat merupakan bakteri
yang banyak terlibat dalam hasil fermentasi pangan terutama yang melibatkan
proses fermentasi spontan seperti bekasam (fermentasi daging sapi), dadih
(fermentasi susu kerbau), tape ketan (fermentasi beras ketan), dan tempoyak
(fermentasi buah durian).
Lactobacillus plantarum merupakan salah satu jenis dari BAL yang juga
termasuk dalam bakteri Gram positif yang berbentuk kokus atau batang, tidak
menghasikan spora dan katalase, resisten terhadap kondisi lingkungan yang asam,
tumbuh optimum secara anaerobik aerotoleran pada suhu 30 C (mesofilik) atau
42 C (termofilik) dengan kisaran pH optimum 4.0-4.5(Gambar 1). Lactobacillus
plantarum banyak diisolasi dari makanan fermentasi. L. plantarum bersifat
heterofermentatif fakultatif, dimana proses fermentasi karbohidrat pada umumnya
melalui jalur sintesa fosfoketolase. Fermentasi pentosa (xylosa dan ribosa) akan
menghasilkan piruvat dan asetil fosfat yang nantinya akan dikonversi menjadi laktat
dan asetat. Selain itu, heksosa (glukosa, fruktosa dan mannosa) juga akan
dikonversi menjadi laktat, CO2 dan etanol (Mayo et al. 2010; Todorov dan Franco
2010; Hammes dan Vogel 1995). Selain itu pula, L. plantarum juga telah
dikembangkan sebagai produk probiotik, salah satu strain yang telah
dikomersialkan adalah L. plantarum 299v (Siezen dan van Hylckama Vlieg 2011).

Gambar 1 Scaning Electron Micrograph dari L. plantarum WCFS1


(Bron et al. 2004) Penerbit American society for
Microbiology.

L. plantarum diketahui aman digunakan dalam proses fermentasi pangan


karena sifatnya yang tidak menghasilkan toksik, yang disebut juga food grade
microorganism. Pangan fermentasi merupakan lingkungan hidup yang cocok bagi
4
4 4

BAL karena menyediakan kompleks nutrisi yang mendukung pertumbuhan BAL.


Jenis mikroorganisme BAL pada pangan tempoyak diantaranya adalah L.
plantarum, L. sakei dan L. corynebacterium (Yuliana dan Garcia 2009). Penelitian
ini menggunakan Lactobacillus plantarum U10 yang berhasil diisolasi dari
Tempoyak makanan fermentasi dari buah durian (Urnemi et al. 2010).

small Heat Shock Protein

Protein merupakan kompenen utama dalam metabolisme suatu sel. Pada


suatu organisme terdapat perbedaan ekspresi protein dari jaringan satu dengan
jaringan lain tergantung kondisi lingkungan. Heat Shock Protein (HSP) merupakan
protein yang dihasilkan karena adanya tekanan lingkungan. HSP juga merupakan
suatu molekular chaperon yang berfungsi untuk melindungi protein lain dari
agregasi, melonggarkan protein yang beragregasi, membantu pelipatan protein baru
atau pelipatan kembali protein yang rusak, mendegradasi protein yang rusak cukup
parah dan dalam kasus kerusakan yang sangat berat, mengasingkan protein yang
rusak menjadi agregat yang lebih besar (Felix et al. 2009).
HSP dihasilkan karena adanya Heat shock response (HSR). HSR adalah
suatu respon untuk menginduksi gen-gen yang mengkode molekular chaperon,
protease dan protein-protein lain yang penting dalam mekanisme pertahanan dan
pemulihan terhadap seluler yang berhubungan dengan terjadinya misfolded protein.
HSR merupakan suatu tanggapan sel terhadap berbagai macam gangguan, baik
yang bersifat fisiologik maupun yang berasal dari lingkungan (Wiesterheide et al.
2005).
Klasifikasi kelas-kelas HSP dilakukan berdasarkan ukuran molekul dan
fungsinya. Ada subkelas HSP100, HSP90, HSP70, HSP60, HSP40 dan small heat
shock protein (sHSP). Angka yang mengikuti kata HSP menunjukkan berat
molekulnya, contoh: angka 100 menunjukkan berat molekul dari HSP, yakni 100
kDa. sHSP adalah sub-kelas dari HSP yang mempunyai karakter berat molekular
yang rendah (9-40 kDa) (Lelj et al. 2006).
HSR (Heat Shock Response) adalah reaksi sel dari organisme terhadap
kenaikan suhu (heat shock atau heat stress). Heat stress yang berat dapat
mengakibatkan kerusakan dan kematian sel, sedangkan dosis subletal dari heat
stress akan memicu reaksi seluler yang disebut heat shock response (Schoffl dan
Reindl 1998). HSR diatur pada tingkat transkripsi oleh suatu mekanisme yang
melibatkan heat shock transciption factor (HSF).
Pada manusia telah ditemukan 3 jenis gen HSF, HSFI, HSF2, dan HSF4.
HSFl memiliki peran penting dalam modulasi HSR. Beberapa faktor yang dapat
mengaktivasi HSFI di antaranya kesalahan dalam pelipatan protein, gangguan
homeostasis protein, dan perubahan kondisi redoks intraselular yang diakibatkan
karena perubahan temperatur atau stress (Gambar 2). HSF 1 dapat dihambat oleh
mekanisme umpan balik negatif melalui interaksinya dengan HSP70 dan HSP90.
Ekspresi HSP90 dan HSP70 yang tinggi pada suatu sel akan mengakibatkan
terminasi ekspresi gen heat shock (proses autoregulasi). Selain itu HSF1 juga dapat
dihambat oleh mekanisme umpan balik melalui fosforilasi. HSF1 difosforilasi pada
residu serin di daerah regulator yang memodulasi daerah aktivasi pada suhu normal.
Residu serin terlibat dalam mempertahankan jumlah HSFI pada keadaan buruk
dalam kondisi basal. Fosforilasi residu ini akan meningkat melalui stimulasi jalur
5

Raf/ERK, jalur protein kinase yang diaktivasi mitogen yang responsif pada faktor
pertumbuhan, dan berakibat pada inhibisi aktivitas HSF1 (Felix et al. 2009 dan
Schoffl dan Reindl 1998).

Gambar 2 Mekanisme Pengaturan Heat Shock Response dan HSF-1


(Felix et al. 2009).

Ciri khususnya small heat shock protein (sHSP) adalah memiliki urutan
asam amino 80-100 residu yang berperan pada proses stabilisasi. Kelompok HSP
ini memiliki ukuran yang relatif rendah berkisar 11-42 kDa. sHSP merupakan gen
yang berperan dalam proteksi terhadap beberapa jenis stres dan banyak terdapat
pada prokariot dan eukariot (Tian et al. 2012). sHSP diinduksi oleh berbagai
tekanan, seperti tekanan suhu dan pH yang rendah. Protein ini dapat meningkatkan
ketahanan BAL terhadap tekanan suhu dan pH (OSullivan et al. 1999 dan Solow
et al. 2000). sHSP terdiri dari kelompok yang diinduksi oleh tekanan dari molekul
chaperon yang dapat mengikat protein terdenaturasi. sHSP berfungsi mencegah
agregasi dan mempertahankan protein dari kesalahan pelipatan di bawah kondisi
tekanan (Helsbeck et al. 2002 dan Narberhaus et al. 2002). Gen sHSP dari plasmid
S. thermophilus merupakan marka seleksi yang ideal digunakan karena gen sHSP
dapat meningkatkan ketahanan terhadap tekanan lingkungan (El Demardhash et al.
2003)

Penanda Seleksi

Penanda seleksi digunakan dalam kegiatan rekayasa genetika, misalnya pada


kegiatan transformasi baik pada tanaman maupun bakteri. Penanda seleksi
melindungi organisme dari agen selektif yang akan membunuh atau mencegah
pertumbuhannya. Gen seleksi berguna untuk membedakan organisme yang
transforman dan tidak transforman. Berbagai gen seleksi telah dikenal sejak
ditemukannya teknik transfer gen atau rekayasa genetika. Saat ini gen seleksi yang
paling umum digunakan adalah gen ketahanan terhadap antibiotik. Penggunaan
antibiotik sebagai gen seleksi telah menimbulkan perdebatan pada masyarakat luas
terutama karena kurangnya pengetahuan tentang pengaruh dari antibiotik yang
digunakan terhadap lingkungan dan kesehatan manusia. Pencarian dan
6 5

pengembangan gen seleksi baru untuk mengatasi permasalahan tersebut telah


dilakukan yaitu dengan mengembangkan food grade vector.
Food grade vector merupakan suatu vektor yang tidak berbahaya dan dapat
digunakan dalam industri makanan (Song et al. 2012). Vektor ini berasal dari
mikroorganisme yang tidak membahayakan manusia.Transformasi pada bakteri
menggunakan plasmid sebagai pembawa gen atau vektor yang akan dimasukkan ke
sel inang. Plasmid adalah DNA ekstrakromosomal yang umumnya berbentuk
sirkular dan secara alami dapat dijumpai pada bakteri dan beberapa jenis yeast
uniselular seperti Saccharomyces cereviseae. Plasmid berukuram mulai dari 1000
base pair (bp) sampai 1000 kilo base pair (Kbp), dengan jumlah per sel bervariasi
dari satu sampai ribuan salinan (copy) molekul. Plasmid umumnya merupakan
elemen genetik yang dapat dipindahkan dari satu individu sel ke individu lainnya
melalui konjugasi.
Plasmid memiliki peran yang sentral dalam rekayasa genetika sebagai vektor
untuk pengklonan dan ekspresi gen. Sebagai vektor yang ideal, plasmid memiliki
ori (origin of replication) sebagai titik awal replikasi untuk perbanyakannya di
dalam sel inang. Plasmid juga memiliki daerah multiple cloning sites (MCS)
sebagai tempat penyisipan segmen DNA atau gen yang akan diklon atau
diekspresikan. Plasmid memiliki gen penanda seleksi, misalnya gen resistensi
antibiotik yang berguna untuk seleksi klon. Food grade vector sudah banyak
dikembangkan, pada penelitian ini penanda seleksi yang digunakan adalah gen
sHSP untuk mengganti gen resisten antibiotik kloramfenikol pada plasmid
pNZ8148.

Lactococcus lactis

Strain Lactococcus lactis telah banyak diisolasi dari berbagai sumber dan
telah berhasil disekuensing. Salah satu karakteristik genetik dari L. lactis yaitu
memiliki kandungan basa nitrogen guanin (G) dan sitosin (C) yang relatif rendah
yaitu sekitar 35% (Cavanagh et al. 2015). Hal ini membuat L. lactis telah banyak
dimanfaatkan dalam beberapa bidang bioteknologi seperti dalam ekspresi antigen
bakteri dan virus sebagai pengembangan vaksin oral yang aman, produksi hormon
sitokinin dan agen terapeutik lainnya, serta pilot production pengembangan produk
farmasetika (Mierau 2005).
L. lactis berstatus GRAS (generally recognize as safe) yang membuat L. lactis
bersifat aman dalam memproduksi protein untuk tujuan pangan maupun biomedis
(Kunji et al. 2003). L. lactis NZ3900 merupakan strain yang umum digunakan dalam
pengembangan produk berbasis food grade. Gen LacF pada operon laktosa yang
dimiliki strain ini telah didelesi/dihapus sehingga membuatnya tidak mampu tumbuh
pada media yang disuplementasi dengan laktosa, kecuali telah terinsersi plasmid
yang memiliki penanda seleksi gen LacF (de Ruyter et al. 1996)
7

3 METODE

Tempat dan Waktu Penelitian

Penelitian ini dilaksanakan pada bulan November 2014 - Juni 2015 di


Laboratorium Aplikasi Rekayasa Genetika dan Desain Protein, Pusat Penelitian
Bioteknologi LIPI, Cibinong, Bogor.

Bahan

Bahan yang digunakan pada penelitian ini adalah media tumbuh bakteri Luria-
Bertani (LB), M17B glukosa, MRS (de Man, Rogosa, Sharpe), enzim restriksi, enzim
taq polimerase, enzim ligase, DNA ladder 1 kb (Thermo) dan 100 pb (Kappa), ampisilin,
kloramfenikol. Plasmid yang digunakan adalah pGEMT (vektor kloning) dan pNZ8148
yang digunakan sebagai vektor ekspresi (Gambar 3). Beberapa pasang primer, serta
beberapa vektor dan strain bakteri yang digunakan dalam penelitian ini dapat dilihat
pada Tabel 1 dan Tabel 2

Gambar 3 Peta Plasmid pGEM-Teasy dan peta plasmid pNZ8148

Tabel 1. Primer yang digunakan untuk amplifikasi gen


Enzim
Primer Sekuens (5 3)
Restriksi
sHSP-F EcoRI 5CG GAATTCATGGCTAATACTTTAATGAATC3
sHSP-R HindIII 5CGAAGCTT TTATTGAATTTCGATTTGACCG 3
slpA-F NheI 5CGGCTAGCTTTTTCGGTCATTTTAACTTGC3
slpA-R EcoRI 5 CG GAATTCCAAGTAAAGCAGCAGCAGCA3
slpA_sHSP-F1 SalI 5CGGTCGACTCGTGGTAAGTAATAGGACGTG3
slpA_sHSP R1 BglII 5TCAGATCTTTATTGAATTTCGATTTGACC3
slpA_sHSP F2 Overlap 5CCACATGGCTAATACTTTAATGAATCGG3
slpA_sHSP R2 Overlap 5ATTAGCCATGTGGTCTTTTCCTCCTTGAA3
Situs restriksi pada urutan nukleotida ditandai dengan garis bawah
8

Karakterisasi

Perlakuan Kejut Panas Uji Aktivitas Isolasi Total RNA dan


dan SDS-PAGE Chaperon Analisis RT-PCR

Kloning

Isolasi DNA Genom L. plantarum U10 dan L.


acidophilus C9-9

PCR promotor slpA dan gen sHSP

Ligasi pGEM-T dan slpA dan Ligasi pGEM-T


dan sHSP

Introduksi ke inang E. coli

Verifikasi : PCR Koloni, PCR Plasmid,


Sekuensing dan Analisis Data

Konstruksi

Fusi promotor slpA Introduksi pNZ8148- Introduksi pNZ8148-


dengan gen sHSP dan slpA_sHSP ke L. lactis slpA_sHSP ke L. lactis
ligasi dengan pNZ8148 NZ900 NZ900

Gambar 4. Diagram Alir Penelitian


9

Tabel 2. Plasmid dan strain bakteri


Strain dan plasmid Karakteristik Sumber atau acuan
Strain
E. coli TOP10 Bakteri inang Novagen
L. plantarum U10 Isolat tempoyak, sumber gen sHSP Koleksi laboratorium
L. acidophilus C9-9 Isolat asal ayam, sumber slpA Koleksi laboratorium
L. lactis NZ3900 Bakteri Inang MoBiTec
Plasmid
pGEM-Teasy Vektor Kloning Promega
pNZ8148 Vektor Ekspresi MoBiTec

Prosedur Kerja

Perlakuan Kejut Panas dan SDS-PAGE


Perlakuan kejut panas dilakukan dengan menumbuhkan L. plantarumU10
dalam 5 ml media MRS (de Man, Rogosa, Sharpe) dan diinkubasi pada 37 C
semalaman. Selanjutnya, L. plantarum U10 ditumbuhan dalam media 100 ml MRS.
Sel dipanen dengan sentrifugasi pada 10000 x g ketika OD 600 adalah ~0,6. Pelet
yang didapatkan diresuspensi dengan media 20 ml MRS baru. Perlakuan kejutan
panas dilakukan pada 42 C : (a) Kontrol (tanpa heat shock) , (b) heat shock 30
menit , (c) heat shock 45 menit. Setelah perlakuan, sampel dibiarkan pada suhu
ruang selama 20 menit. Tingkat kelangsungan hidup sel dipantau dengan
menghitung CFU pada agar setelah inkubasi pada 37 C semalaman. Perlakuan
berdasarkan Delmas et al. 2001 dan Guzzo et al. 1997 dengan modifikasi. SDS-
PAGE (Lampiran 2) dilakukan dengan meresuspen sampel yang telah diberi
perlakuan dengan buffer sonikasi dan disonikasi selama 15 detik, kemudian diulang
sebanyak 20 kali. Ekstrak sampel yang sudah disonikasi diisolasi dengan
sentrifugasi pada 17000 x g, 4 C selama 20 menit. Supernatan dipindahkan ke
tabung steril kemudian pelet dianalisis dengan SDS PAGE.

Uji Aktivitas Chaperon


Uji aktivitas chaperon dilakukan mengikuti metode dari Collada et al. 1997,
Kim et al. 1998 dengan kombinasi. Sebanyak 0,25 gram agarose dilarutkan dalam
50 mM Tris-HCl pH 7,4 dan kemudian dipanaskan. Larutan agarose kemudian
ditambahkan 2,5 ml 2% gelatin, diaduk sampai tercampur rata. Sebanyak 25 ml
larutan agar dituangkan ke cawan petri, dibiarkan mengeras dan bentuk sumuran
pada agar. Perlakuan terdiri dari beberapa kombinasi untuk masing-masing sampel:
sampel 1; proteinase K denaturasi selama 15 menit pada 100C dicampur dengan
IP (protein intraselular L. plantarum U10) (1:1, w/w), kemudian sampel 2;
proteinase K tanpa denaturasi dicampur dengan IP (1:1, w/w), sampel 3; IP tanpa
denaturasi, sampel 4; proteinase K (4 mg/uL) denaturasi selama 15 menit pada 100
C, sampel 5; proteinase K (8 mg/uL) tanpa denaturasi. Sampel diinkubasi selama
24 jam pada 37 C. Aktivitas chaperon terdeteksi oleh aktivitas Proteinase K dan
ditunjukkan dengan pembentukan zona bening.
10

Isolasi Total RNA dan Analisis RT-PCR


Total RNA dari L. plantarum U10 diperoleh dengan menumbuhkan L.
plantarum U10 dalam medium MRS selama 13 jam pada 30 C. Setelah itu, sel
dipindahkan ke dalam media MRS segar kemudian diinkubasi pada kondisi yang
sama sampai OD 600 mencapai 0,6. Sampel dipanen dengan sentrifugasi pada
13000 x g. Perlakuan kejut panas dilakukan dengan menambahkan 1 mL MRS segar
pada pelet dan kemudian dipanaskan di 42 C selama 15 menit dan kontrol tanpa
perlakuan heat shock, kemudian dibiarkan pada suhu ruang selama 20 menit.
Langkah selanjutnya isolasi RNA mengikuti panduan Ribo Pure Bakteri Kit
Ambion (Lampiran 3). Kualitas sampel RNA diperiksa pada 1,2% agrose gel, dan
konsentrasi ditentukan secara spektrofotometri pada 260 nm. Sekitar 150 ng RNA
total yang digunakan dalam volume akhir 25 uL untuk sampel RT-PCR. Program
RT-PCR adalah sebagai berikut: 45 C, 30 menit (reaksi reverse transcriptase), 94
C, 5 menit; 94 C, 30 detik (denaturasi); 52 C, 1 menit (anealing); 72 C, 1 menit;
72 C, 5 menit (ekstensi). Fragmen PCR kemudian divisualisasikan pada gel
agarosa 1,2%.

Isolasi DNA Genom L. plantarum U10 dan L. acidophilus C9-9


Genom L. plantarum U10 dan L. acidophilus C9-9 diisolasi dengan
menggunakan metode Mustopa dan Fatimah (2014). L. plantarum U10 dan L.
acidophilus C9-9 ditumbuhkan di dalam media 5 mL MRS (de Man, Rogosa,
Sharpe) (Lampiran 1) dipanen pada fase stasioner dengan sentrifugasi pada
kecepatan 11000 x g selama 10 menit. Pelet yang didapatkan diresuspen dengan
540 L bufer Tris-EDTA yang mengandung 5 mg/mL lisozim, kemudian
diinkubasi selama 1 jam pada suhu 37 C. Proses lisis sel dilanjutkan dengan
menambahkan 200 L 10% sodium dedocyl sulfate, 100 L 5M NaCl, dan 80 L
10% CTAB kemudian diinkubasi selama 30 menit pada suhu 68 C. Campuran
tersebut ditambahkan kloroform dengan perbandingan 1:1, kemudian disentrifugasi
pada kecepatan 23000 x g selama 10 menit. Sentrifugasi menghasilkan tiga fase
larutan dimana fase paling atas merupakan cairan bening yang mengandung
nukleotida untuk kemudian dipresipitasi dengan isopropanol. Pelet atau DNA yang
diendapkan disentrifugasi dan dikering-anginkan untuk menghilangkan sisa
alkohol. DNA dilarutkan dengan nuclease-free water yang telah mengandung 0.1
mg/mL RNAse. DNA disimpan pada suhu -20 C.

Kloning pGEM-T slpA dan pGEM-T sHSP


Kloning diawali dengan mendapatkan promotor slpA dari isolat
Lactobacillus acidophilus dengan kode isolat C9-9. Gen sHSP dari isolat
Lactobacillus plantarum dengan kode isolat U10. DNA genom dari isolat C9-9 dan
U10 digunakan sebagai template dalam amplifikasi menggunakan Polymerase
Chain Reaction (PCR). Promotor slpA dengan pasangan primer sHSP_NheI_F dan
sHSP_EcoRI_R. Gen sHSP dengan pasangan primer sHSP_EcoRI_F dan
sHSP_HindIII_R. Kondisi PCR disajikan dalam Tabel 3. Produk amplifikasi untuk
promotor slpA adalah 192 pb dan gen sHSP 423 pb. Promotor slpA dan gen sHSP
yang didapatkan kemudian dimurnikan menggunakan QIAquick Gel Extraction
Kit (QIAGEN 2011). Hasil pemurnian DNA dapat dilihat secara kualitatif melalui
elektroforesis gel agarosa 2%. DNA yang telah murni kemudian diligasikan dengan
vektor pGEM-T Easy (Promega). Promotor slpA dan Gen sHSP yang telah
11
1
terligasi dengan vektor pGEM-T kemudian diintroduksikan ke dalam E.coli TOP 1
10 (Sambrook et al. 2002). Vektor rekombinan pGEM-T_slpA dan pGEM-T_sHSP
dikonfirmasi dengan menggunakan PCR koloni, PCR plasmid dan sekuensing.
Karakteristik promotor slpA dan gen sHSP dilihat melalui homologi sekuen
nukleotida dan asam amino yang analisis menggunakan BLAST
(http://blast.ncbi.nlm.nih.gov/Blast.cgi) dan Bioedit versi 7.0.9.0 (Tom Hall).

Tabel 3 Kondisi reaksi PCR


Kondisi sHsp slpA slpA_sHSP
Pre-denaturasi 94 C ; 5 menit 94 C ; 2 menit 94 C ; 2 menit
Denaturasi 94 C ; 1 menit 94 C ; 15 detik 94 C ; 15 detik
Annealing 55 C ; 1 menit 58,5 C ; 1 menit 57,5C ; 1 menit
Ekstensi 72 C ; 30 detik 72 C ; 45 detik 72 C ; 45 detik
Final Ekstensi 72 C ; 5 menit 72 C ; 5 menit 72 C ; 5 menit
Siklus 35 35 35

Konstruksi Vektor Ekspresi dengan Fusi Promotor slpA dan Gen sHSP
Fusi gen dilakukan dengan merancang primer overlapping antara promotor
slpA dan gen penyandi sHSP. Proses PCR dilakukan tiga tahap, tahap pertama yaitu
amplifikasi promotor slpA dari template pGEM-T_slpA. Tahap kedua yaitu
amplifikasi gen sHSP template pGEM-T_sHSP. Tahap ketiga yaitu amplifikasi fusi
antara promotor slpA dan gen sHSP. Gen yang telah didapatkan kemudian
dimurnikan dengan QIAquick Gel Extraction Kit. Gen yang telah murni kemudian
dipotong menggunakan enzim restriksi, sebanyak 5-15 ug DNA plasmid, 2 L
larutan penyangga reaksi 10x (sesuai enzim yang digunakan), 1 L enzim restriksi
(10 unit/L) dan ddH2O hingga volume larutan menjadi 20 L kemudian
diinkubasi pada suhu 37 C selama 2 jam. Enzim restriksi yang digunakan adalah
SalI-BglII untuk gen fusi, selain itu plasmid pNZ8148 juga dipotong menggunakan
enzim yang sama untuk memotong bagian kloramfenikolnya. Gen maupun plasmid
yang telah terpotong kemudian dimurnikan kembali sebelum dilakukan ligasi.
Ligasi antara insert dan vektor dengan perbandingan 3:1 hingga volume akhir 15 l
dilakukan dengan menggunakan T4 DNA ligase (NEB) dan diinkubasi pada suhu
40C selama overnight.

Introduksi Hasil Ligasi ke dalam E.coli dan L.lactis


Transformasi E. coli dilakukan dengan metode Heat shock (Sambrook et
al. 2001). Pembuatan sel kompeten dilakukan dengan menumbuhkan E. coli TOP
10 di dalam 5 ml LB (Lampiran 4) pada inkubator goyang kecepatan 150 rpm pada
suhu 37 oC selama semalam. Selanjutnya 1 mL dari kultur yang diinkubasi selama
semalam dikultur kembali di dalam 100 mL LB pada suhu 37 oC pada inkubator
goyang dengan kecepatan 150 rpm. Pemanenan dilakukan saat OD600 ~0,4.
Sentrifugasi dilakukan pada kecepatan 2700 x g pada suhu 4 C selama 10 menit.
Supernatan hasil sentrifugasi dipisahkan dari pelet, sebanyak 30 mL larutan
CaCl2-MgCl2 (80 mM MgCl2, 20 mM CaCl2) ditambahkan ke dalam pelet
hingga teresuspensi. Sentrifugasi kembali pada kecepatan 2700 x g pada suhu 4
C selama 10 menit. Supernatan hasil sentrifugasi dipisahkan dari pelet. Setelah
tidak ada lagi sisa supernatan, maka dilakukan penambahan 2 mL 0,1 M CaCl2.
12

Selanjutnya sel kompeten ini ditransformasi. Transformasi dilakukan


dengan mencampurkan 100 L sel kompeten dengan 5 L hasil ligasi. Kemudian
campuran tersebut diinkubasi di dalam es selama 30 menit, disusul dengan
dipanaskan di dalam water bath pada 42 oC selama 90 detik. Setelah pemanasan
selesai, dengan segera di pindahkan kedalam es dan diinkubasi selama2 menit.
Sebanyak 400 L LB ditambahkan ke dalam eppendof dan diinkubasi pada suhu
37 oC selama 2 jam. Proses selanjutnya adalah penumbuhan hasil transformasi
ke media LB agar yang telah ditambah 100 g/mL ampisilin sebagai penanda
seleksi. Penumbuhan hasil transformasi dilakukan dengan teknik surface plate atau
spread plate. Sebanyak 100 L hasil transformasi ditumbuhkan di atas medium
menggunakan triangle dryglass. Sel kompeten juga ditumbuhkan di LB agar yang
mengandung ampisilin sebagai kontrol positif dan tanpa ampisilin sebagai kontrol
negatif. Sel kompeten yang ditumbuhkan sebanyak 50 L. Selanjutnya hasil
penumbuhan tersebut diinkubasi pada suhu 37 oC selama 16 jam. PCR koloni
dilakukan terhadap transforman yang tumbuh. Koloni tunggal yang mengandung
plasmid dengan sisipan gen target ditumbuhkan pada media LB untuk kemudian
diisolasi plasmid rekombinan yang membawa gen target. Isolasi plasmid pada E.
coli dilakukan dengan menggunakan GenJET Plasmid Miniprep Kit (Thermo
Scientific). Plasmid yang didapatkan selanjutnya digunakan sebagai template dalam
PCR dan disekuensing untuk mengkonfirmasi gen yang telah disisipkan ke dalam
plasmid.
Vektor pNZ8148 yang telah membawa fusi promotor slpA dan gen sHSP
diintroduksikan ke inang L. lactis NZ3900 menggunakan metode elektroporasi.
Proses transformasi dilakukan dengan menggunakan Gene Pulser BIORAD
(MoBiTec). Preparasi sel elektrokompeten L. lactis NZ3900 dimulai dengan
menumbuhkan isolat ke dalam 100 L M17 (Lampiran 5) yang mengandung 0.5 M
sukrosa, 2.5% glisin dan 0.5% glukosa. Kultur bakteri diinkubasi pada suhu 30 C
hingga mencapai OD 600 ~0.3, kemudian disentrifugasi dengan kecepatan 6000 x
g selama 10 menit pada suhu 4 C. Pelet diresuspen dengan buffer pencuci (0.5 M
sukrosa dan 10% gliserol), kemudian disentrifugasi kembali selama 10 dengan
kecepatan 6000 x g pada suhu 4 C. Pelet diresuspeni dengan buffer inkubasi (0.5
M sukrosa, 10% gliserol dan 0.05 M EDTA), dan disimpan di dalam es selama 15
menit, kemudian disentrifugasi kembali. Pelet dicuci dengan buffer pencuci,
kemudian diresuspensi sebanyak 1 L dengan buffer yang sama. Vektor
rekombinan dicampurkan ke dalam 100 L sel kompeten, kemudian dimasukkan
ke dalam kuvet elektroda. Elektroforasi dilakukan dengan kondisi tegangan 2 kV,
kapasitas 25 F dan hambatan 200 . Sel bakteri yang sudah dielektroforasi
ditambahkan 400 L media M17 yang mengandung 20 mM MgCl2, 2 mM CaCl2.
Selanjutnya, 100 L hasil elektroporasi yang telah diinkubasi disebar pada media
M17 agar tanpa antibiotik yang diinkubasi pada suhu 41 C selama 24 jam
kemudian diiukuti dengan 30 C selama overnight (Tian et al. 2012). Koloni yang
tumbuh dan terseleksi kemudian dikonfirmasi dengan PCR koloni menggunakan
primer fusi untuk memastikan gen fusi promotor slpA dan gen sHSP yang berhasil
diintroduksikan ke dalam inang L. lactis.
13

4 HASIL DAN PEMBAHASAN

Pengaruh Perlakuan Kejut Panas pada Profil Ekspresi


Protein L. plantarum U10

Karakterisasi gen small heat shock protein (sHSP) dilakukan dengan


memberikan perlakuan kejut panas pada L. plantarum U10. Tujuan dari perlakuan
ini adalah untuk melihat keragaman dan fungsi protein heat shock pada
pertumbuhan dan kelangsungan hidup L. plantarum U10. Bakteri L. plantarum U10
diberi perlakuan dengan inkubasi pada suhu yang berbeda yaitu 42 C (Delmas et
al. 2001 dan Guzzo et al. 1997). Pengaruh dari kejut panas (42 C) pada ekspresi
protein diamati selama 30 menit dan 45 menit. Hasil pengamatan menunjukkan
bahwa ekspresi protein dinyatakan dengan berat molekul yang beragam (18,16 kDa,
34 kDa, 40,48 kDa dan 51,93 kDa). Hasil SDS menunjukkan bahwa lama waktu
induksi perlakuan panas berpengaruh terhadap ekspresi protein. Waktu induksi
perlakuan panas yang lebih lama (45 menit) menunjukkan hasil ekpresi protein
berkurang apa bila dibandingkan dengan waktu induksi 30 menit, hal itu disebabkan
karena perbedaan pada waktu degradasi protein dalam sel (Gambar 5).

Gambar 5 Profil ekspresi protein intraseluler L. Plantarum U10 setelah perlakuan


kejut panas. Marker protein (kDa). Kontrol L. plantarum tanpa
perlakuan. Bakteri diinkubasi di 42 C selama 30 menit dan 45 menit

Pada penelitian ini ditemukan beberapa protein dari L. plantarum U10


setelah diberikan perlakuan suhu menjadi 42 C dengan massa protein berkisar
18,16 kDa sampai dengan 51,93 kDa, yang diprediksi sebagai kelompok heat shock
protein. Guzzo et al. 1997 melaporkan bahwa protein dari intraselular sel L. oenos
memiliki berat molekul yang beragam (75 kDa, 66 kDa, 64 kDa, 24 kDa, 18 kDa
dan 14,5 kDa) setelah diberi perlakuan panas dengan suhu 42 C, OD 0,4. Protein
dengan berat molekul 18 kDa menunjukkan ekspresi yang paling tinggi di bawah
tekanan panas dan asam. small Heat shock Protein (sHSP) dengan berat molekul
18 kDa memiliki peranan penting dalam adaptasi dan kelangsungan hidup bakteri
asam laktat terhadap tekanan lingkungan.
Kelangsungan hidup L. plantarum U10 setelah perlakuan panas ditampilkan
pada Tabel 4. Konfirmasi stres panas dalam mengurangi viabilitas atau kemampuan
hidup sel yang berdampak pada kuantitas protein, dilakukan dengan menghitung
jumlah koloni untuk setiap perlakuan. Berdasarkan Tabel 4 menunjukkan bahwa
14

tidak ada perbedaan yang signifikan antara kelompok perlakuan panas (3.3x1010
CFU uL/1 selama 30 menit induksi, dan 3.2x1010 CFU uL/1 selama 45 menit
induksi) apabila dibandingkan dengan kelompok kontrol (3x1010 CFU uL/1). Hal
ini disebabkan karena suhu perlakuan yang diberikan tidak berbeda jauh dengan
suhu kontrol. Delmas et al. 2001 melaporkan bahwa pengaruh tekanan suhu 45 C
sampai 60 C terhadap sHSP Lo18 Oenococcus oeni dapat meningkatkan ketahanan
hidup bakteri Oenococcu oeni dibandingkan dengan kontrol (30 C). Hasil pada
penelitian ini menunjukkan bahwa ekspresi protein meningkat pada L. plantarum
U10 adalah karena efek perlakuan stres panas.

Tabel 4 Profil ekspresi protein intraseluler L. plantarum U10 setelah perlakuan


kejut panas. Populasi bakteri dihitung sebelum dan sesudah perlakuan
kejut panas dan ditampilkan sebagai CFU/ml
Perlakuan CFU/mL
Kontrol 3.0x1010 CFU/mL
Heat Shock 42 C, 30 min 3.3x1010 CFU/mL
Heat Shock 42 C, 45 min 3.2x1010 CFU/mL

Ekspresi Gen dari Kejut Panas L. plantarum U10 dan Uji Aktivitas Chaperon

Lactobacillus plantarum U10 merupakan bakteri asam laktat yang diisolasi


dari Tempoyak. Fiacco et al. 2007 menyatakan bahwa peranan sHSP dalam
adaptasi dan kelangsungan hidup BAL di bawah kondisi tekanan tertentu, seperti
stres abiotik panas, dingin, dan etanol sangat berdampak pada tingkat ekspresi dari
mRNA sHSP dan juga kuantitas produksi sHSP. Hasil karakterisasi menunjukkan
adanya protein dengan ukuran 18.16 kDa yang diperkirakan merupakan protein
sHSP. Selain itu, konfirmasi dilakukan dengan Reverse transcriptase-PCR pada
tingkat ekspresi mRNA sHSP. RNA hasil isolasi dari L. plantarum U10 kemudian
dijadikan cetakan untuk RT-PCR. Ekspresi dari gen penyandi sHSP dari L.
plantarum U10 diekspresikan setelah suhu lingkungan pertumbuhan sel menjadi 42
C. Hasil RT-PCR menunjukkan terdapat pita dengan ukuran 423 pb (sHSP) dan
tidak ada pita yang berhubungan dengan sHSP pada kontrol. Kontrol pada
perlakuan ini tanpa kejut panas (Gambar 6). Hasil ini menunjukkan gen protein heat
shock diekpresikan di bawah lingkungan stres panas.

Gambar 6 Analisis cDNA sHSP L. plantarum U10 1: sampel yang diberi perlakuan
panas dan 2: sampel tanpa perlakuan panas, M: 100 pb Kappa universal
DNA ladder. Pita yang sesuai dengan mRNA sHSP ditunjukkan oleh
panah kuning.
15

Protein Heat Shock diketahui mengandung aktivitas chaperon dimana


protein ini dalam kondisi stres akan membantu dalam mencegah protein
intraselular (IP) dari mekanisme degradasi seluler (Ehrnsperger et al. 1997,
Veinger et al. 1998, Lee and Vierling 2000). Pada penelitian ini dilakukan metode
sederhana berdasarkan modifikasi Collada et al. 1997 dan Kim et al. 1998 untuk
mendeteksi aktivitas chaperon dalam IP L. plantarum menggunakan uji aktivitas
enzim proteolitik pada agarose. Metode ini berdasarkan aksi perlindungan yang
diduga protein chaperon terhadap degradasi enzim proteolitik karena perlakuan
panas dengan pengukuran aktivitas residu enzim setelah perlakuan panas pada
protein pendamping yang mengandung sampel. Uji aktivitas chaperon dilakukan
untuk mengkonfirmasi keterlibatan gen sHSP pada L. plantarum U10 terhadap
ketahanan stres panas. Uji aktivitas chaperon pada fraksi protein interselular (IP)
dari L. plantarum U10 dengan mengamati aktivitas proteinase K. Hasil fraksi IP
menunjukkan aktivitas chaperon (Gambar 7). Sampel 1 menunjukkan adanya
aktivitas setelah denaturasi (1.30.11 cm) (Lampiran 6), sedangkan sampel 4
proteinase K sendiri tanpa IP kehilangan aktivitas proteinase K setelah denaturasi
(0.730.11 cm). Proteinase K sampel 5 tanpa denaturasi memiliki aktivitas yang
tinggi (3.360.11 cm), sedangkan pada sampel 3 (IP didenaturasi) tidak memiliki
aktivitas proteinase. Hasil ini menunjukkan bahwa resistensi panas L. plantarum
U10 dimungkinkan karena aktivitas cheperon di dalam selnya.

Gambar 7 Uji aktivitas chaperon. Sampel 1: proteinase K denaturasi dicampur


dengan IP, 2: proteinase K tanpa denaturasi dicampur dengan IP, 3:
IP tanpa denaturasi, 4: proteinase K denaturasi, 5: proteinase K tanpa
denaturasi.

Uji aktivitas chaperon menunjukkan aktivitas protein yang mengandung


fraksi IP berdasarkan kemampuan chaperon untuk melindungi proteinase K dari
degradasi. Interaksi langsung antara protein chaperon (dalam fraksi IP) dengan
proteinase K menyebabkan enzim proteolitik menjadi tahan panas. Leroux et al.
1997 dan Lee et al. 1997 melaporkan bahwa interaksi langsung beberapa protein
sHSP dengan protein target menstabilkan protein yang beragregat selama tekanan
panas. Protein chaperon bekerja sama tidak hanya mencegah agregasi proteinase
K, tetapi juga dalam mengaktifkan kembali aktivitas proteolitik proteinase K
selama perlakuan panas.
16

Konstruksi Vektor Kloning pGEM-T slpA dan pGEM-T sHSP

Surface layer protein A memiliki bentuk kristal pada permukaan sel dan telah
diisolasi lebih dari 300 spesies yang berbeda termasuk bakteri Gram positif dan
Gram negatif. slpA terdiri dari subunit protein tunggal atau glikoprotein dengan
berbagai ukuran 40-200 kDa. Promotor surface layer protein A (slpA) merupakan
salah satu promotor kuat yang telah diisolasi dari tipe liar Lactobacillus acidophilus
oleh McCracken 1999. Pada studi ini promotor slpA diisolasi dari dari isolat
Lactobacillus acidophilus dengan kode isolat C9-9. Promotor slpA merupakan
salah satu promotor konstitutif yang umum digunakan dalam ekspresi BAL dari
Lactobacillus brevis, dimana telah diketahui dapat meningkatkan level ekspresi
sebesar 28% terhadap protein amino peptidase N (Diep et al. 2009).
Konstruksi vektor kloning dilakukan dengan isolasi genom dari L. plantarum
U10 dan L. acidophilus C-9-9. L. plantarum U10 digunakan sebagai sumber untuk
gen sHSP dan L. acidophilus C-9-9 sebagai sumber promotor slpA. Promotor slpA
telah berhasil diamplifikasi dengan menggunnakan primer spesifik promotor slpA
dengan menggunakan metode PCR. Hasil amplifikasi promotor slpA menggunakan
primer slpA-F dan primer slpA-R menunjukkan bahwa ukuran amplikon adalah
sebesar 192 pb (Gambar 8a). Gen promotor slpA tersebut telah berhasil diligasikan
dengan plasmid pGEM-Teasy (Gambar 8b) dan ditransformasikan pada E.coli
TOP10.

a b
Gambar 8 a. Hasil amplifikasi PCR promotor slpA (192pb) dari template
pGEM- T slpA, M: 100 pb Kappa universal DNA ladder.
b. Peta vektor kloning rekombinan pGEM-slpA

Introduksi plasmid rekombinan pGEM-slpA ke dalam E.coli TOP 10


dilakukan dengan metode Heat Shock (Sambrook et al. 2001). Ligasi pGEM-T dan
promotor slpA berhasil diintroduksikan ke inang E. coli TOP 10, yang ditandai
dengan tumbuhnya koloni putih pada media seleksi biru putih (ampisilin, X-gal dan
IPTG). Koloni putih diduga membawa plasmid rekombinan pGEM-slpA (Gambar
9). Konfirmasi koloni membawa plasmid rekombinan pGEM-slpA maka dilakukan
analisis terhadap beberapa koloni dengan menggunakan PCR koloni dan PCR
plasmid. PCR koloni dan PCR plasmid menghasilkan promotor slpA dengan ukuran
sekitar 192 pb (Gambar 10).
17

a b
Gambar 9 Hasil transformasi E. coli TOP 10 dengan pGEM-slpA. a: Kontrol
negatif. b: TOP 10 pGEM-slpA. Koloni transforman ditandai dengan
lingkaran hitam.

a b
Gambar 10 a. Hasil PCR Koloni E. coli TOP 10 dengan pGEM-slpA. M: 100
pb Kappa universal DNA ladder , 1, 2, 3, 4 dan 5 koloni
rekombinan.
b. PCR Plasmid E. coli TOP 10 dengan pGEM-slpA. M: 100 pb
Kappa universal DNA ladder.

Gen small Heat Shock Protein (sHSP) yang merupakan protein yang
berperan dalam stres panas. Studi tentang peranan gen sHSP terhadap tekanan
panas pada L. plantarum telah dilakukan. Gen sHSP dari L. plantarum (wine) telah
diklon ke vektor pGEM-T (promega) dan diintroduksikan ke E. coli JM109 (Spano
et al. 2005). Gen sHSP pada penelitian ini diisolasi dari isolat Lactobacillus
plantarum dengan kode isolat U10. Heat Shock Protein terutama dengan massa
molekul 18 kDa telah dipelajari secara intensif karena memiliki peranan yang
penting dalam pertumbuhan mikroorganisme, adaptasi dan kelangsungan hidup
dalam respon terhadap stres lingkungan (Sugimoto et al. 2008, Tsakalidou dan
Papadimitriou 2011, De Angelis dan Gobetti 2011). Kelompok protein ini dalam
industri makanan menunjukkan dampak yang signifikan terhadap peningkatan
BAL terutama ketika digunakan sebagai strain pemula (Carvalho et al. 2004,
Ricciardi et al. 2012).
Hasil amplifikasi gen sHSP juga dilakukan menggunakan primer sHSP-F
dan primer sHSP-R menunjukkan bahwa ukuran amplikon adalah sebesar 423 pb
(Gambar 9a). Gen sHSP tersebut juga telah berhasil diligasikan dengan plasmid
pGEM-Teasy (Gambar 9b) dan ditransformasikan pada E.coli TOP10.
18

a b
Gambar 11 a. Hasil amplifikasi PCR promotor sHSP (423pb) dari template
pGEM- T sHSP, M: 100 pb Kappa universal DNA ladder.
b. Peta vektor kloning rekombinan pGEM-sHSP

Gen sHSP berukuran 423 pb yang telah teramplifikasi menggunakan primer


spesifik berhasil disisipkan ke daerah multiple cloning site (MCS) pada vektor
kloning pGEM-T, sehingga membentuk vektor rekombinan yang berukuran 3438
pb. Ukuran DNA vektor yang tidak terlalu besar dapat mempermudah proses
introduksi ke bakteri inang. Seleksi transforman menggunakan antibiotik ampisilin
dikarenakan vektor kloning pGEM-T dilengkapi dengan gen penyandi resisten
ampisilin sebagai marka seleksi.
Plasmid rekombinan pGEM-sHSP yang telah diintoduksikan ke dalam
E.coli TOP 10 menghasilkan bebarapa koloni yang diduga membawa plasmid
rekombinan pGEM-sHSP (Gambar 12). Konfirmasi koloni membawa plasmid
rekombinan pGEM-sHSP maka dilakukan analisis terhadap beberapa koloni
dengan menggunakan PCR koloni dan PCR plasmid. PCR koloni dan PCR plasmid
menghasilkan gen sHSP dengan ukuran sekitar 423 pb (Gambar 13).

a b
Gambar 12 Hasil transformasi E. coli TOP 10 dengan pGEM-sHSP. a: Kontrol
negatif. b: TOP 10 pGEM-sHSP. Koloni transforman ditandai
dengan lingkaran hitam.
19

a b
Gambar 13 a. Hasil PCR Koloni E. coli TOP 10 dengan pGEM-sHSP. M: 100
pb Kappa universal DNA ladder, 1,2,4: koloni rekombinan. 3:
koloni bukan rekombinan.
b. PCR Plasmid E. coli TOP 10 dengan pGEM-sHSP. M: 100 pb
Kappa universal DNA ladder.
Kromatografi sekuensing promotor slpA dan gen sHSP di E. coli TOP 10
(Lampiran 7) selanjutnya digunakan untuk analisis sekuen. Hasil analisis sekuen
menunjukkan Promotor slpA berukuran 192 pb memiliki similarity yang tinggi (99%)
apabila dibandingkan dengan sekuen referensi L. acidhopilus ATCC 4356 (Gambar
14). Hasil BLAST menunjukkan urutan nukleotida sHSP dari L. plantarum U10
memiliki tingkat homolog yang tinggi (100%) dengan sHSP dari L. plantarum
WCFS1 referensi (Gambar 15). Hasil analisis sekuen menunjukkan tersebut
menunjukkan bahwa hasil kloning ini dapat digunakan sebagai sumber untuk
mendapatkan promotor slpA dan sekuen gen penyandi small Heat Shock Protein
(sHSP).

Gambar 14 Hasil analisis sekuen promotor surface layer protein A (slpA)


dengan ukuran 192 pb.
20

Gambar 15 Hasil analisis sekuensing gen penyandi small Heat Shock Protein
(sHSP) dengan ukuran 423 pb.
Konstruksi Vektor Ekspresi dengan Fusi Promotor slpA dan Gen sHSP

Metode yang digunakan untuk memfusikan suatu gen dengan promoter lain
terdapat beberapa metode. Metode tersebut antara lain dengan menggunakan linker
dan PCR overlapping. Tian et al. 2012 melakukan konstruksi plasmid dengan
menggunakan PCR overlapping dari fragmen yang mengandung promotor 32 dan
gen penyandi sHSP. Pada penelitian konstruksi vektor rekombinan dilakukan dengan
menggunakan PCR overlapping dari fragmen promotor slpA dan gen penyandi sHSP
(Gambar 16).
Konstruksi vektor ekspresi dilakukan dengan PCR promotor slpA dari
pGEM-slpA dan PCR gen sHSP dari pGEM-sHSP. Hasil PCR dijadikan sebagai
template untuk PCR Fusi dengan teknik overlapping. PCR overlapping dilakukan
dengan mendesain primer spesifik untuk fusi promotor slpA dan gen sHSP. Pada
penelitian ini primer slpA-sHSP-F1 dengan situs restriksi SalI, primer slpA-sHSP-F2
dan R-2 dengan bagian tumpang tindih (overlap), yaitu urutan nukleotida merupakan
bagian dari promotor slpA dan gen sHSP, dan primer slpA-sHSP-R1 dengan situs
restriksi BglII.
21

Gambar 16 Skema prosedur kontsruksi pNZ8148 slpA_sHSP (situs restriksi


Sal1-Bgl11). Hasil fusi slpA_sHSP sebesar 615 pb. Teknik PCR
overlapping digunakan dalam proses ini.

Promotor slpA dengan ukuran 192 pb dan untuk gen penyandi sHSP
berukuran 423 pb. Hasil fusi antara promotor slpA dan gen sHSP didapatkan ukuran
615 pb (Gambar 17a). Dari gambar tersebut terlihat bahwa hasil amplifikasi fusi
memiliki ukuran yang lebih tinggi apabila dibandingkan dengan masing-masing
fragmen. Hal ini menunjukkan bahwa fusi antara promotor slpA dan gen penyandi
sHSP telah berhasil diamplifikasi dengan teknik PCR Overlapping. Food grade
vector dibentuk dengan mengganti bagian antibiotik dari vektor ekspresi yang
digunakan. Pada penelitian ini vektor ekspresi yang digunakan adalah pNZ8148
dengan menghapus bagian gen yang menyandikan pendegradasi kloramfenikol.
Fusi antara promotor slpA dan gen penyandi sHSP kemudian disisipkan
pada vektor pNZ8148 pada bagian kloramfenikol yang telah dipotong dengan enzim
restriksi Sal1-BglII sehingga terbentuk plasmid pNZ8148 rekombinan pNZ8148-
slpA_sHSP. Plasmid rekombinan kemudian diintroduksikan ke inang L. lactis
(Gambar 17b). Bakteri L. lactis NZ3900 merupakan turunan dari L. lactis MG1363
yang diketahui tidak memiliki gen penghasil nisin (Kunji et al. 2003)
Vektor rekombinan pNZ8148-slpA_sHSP diintroduksikan ke dalam bakteri
inang L. lactis NZ3900 menggunakan teknik elektroporasi. Teknik ini digunakan
dalam menyisipkan DNA asing ke dalam inang bakteri Gram positif yang memiliki
karakteristik struktur membran sel yang cukup tebal. Teknik elektroporasi ini
mengaplikasikan tegangan listrik tinggi yang dilewatkan dalam waktu yang singkat,
22

sehingga membentuk pori pada dinding/membran sel yang dapat tersisipi DNA asing
(Rattanachaikunsopon dan Phumkachorn 2009). Penambahan sukrosa dan glisin
dapat membantu proses transformasi menjadi lebih efisien. Selain sukrosa sebagai
penstabil kondisi osmotik, glisin yang ditambahkan pada media pertumbuhan BAL
diketahui dapat melemahkan membran sel bakteri inang dengan cara menghambat
pembentukan ikatan silang yang akan memperkuat membran sel tersebut (Heravi et
al. 2012). Dalam penelitian ini, digunakan sebanyak 2.5% glisin untuk melemahkan
membran sel bakteri inang. Penggunaan glisin yang terlalu tinggi (lebih dari 8%)
akan berdampak pada menurunnya efisiensi transformasi, dikarenakan memicu
terjadinya autolisis bakteri (Kim et al. 2005).

a b
Gambar 17 a. Hasil amplifikasi fusi slpA dan sHSP. M: 100 pb Kappa
universal DNA ladder. 1: hasil amplifikasi promotor slpA (192
pb) , 2: hasil amplifikasi gen penyandi sHSP (423 pb) dan 3: fusi
slpA dan sHSP (615 pb)
b. Transformasi pNZ8148_slpA_ sHSP ke L. lactis

Hasil transformasi menunjukkan tingkat efisiensi transformasi yang


rendah. Hal ini dapat dikarenakan oleh karakteristik dari gen replikasi vektor
pNZ8148. Vektor ekspresi pNZ8148 diketahui tidak memiliki tingkat
replikasi/penggandaan vektor yang cukup tinggi, akan tetapi hal ini diimbangi
dengan adanya dua titik awal replikasi (repA dan repC) yang mudah dikenali inang
baik E. coli maupun L. lactis (de Ruyter et al. 1996). Koloni transforman yang
tumbuh dijadikan cetakan PCR koloni.
Hasil PCR koloni menggunakan primer F/R gen fusi slpA-sHSP (Gambar
18) pada L. lactis rekombinan menunjukkan bahwa dari empat koloni tranforman
yang tumbuh, hanya dua koloni yang positif membawa sisipan fusi promotor slpA
dan gen sHSP. Dari gambar tersebut terlihat bahwa L. lactis rekombinan memiliki
ukuran yang sama dengan kontrol positif gen fusi pGEM-slpA-sHSP (615 pb). Hal
ini dapat disimpulkan bahwa fusi gen telah berhasil disisipkan ke dalam vektor
pNZ8148 dan diintroduksikan ke dalam L. lactis. Selain itu konfirmasi vektor
ekspresi pNZ8148 yang berhasil diintroduksikan ke L. lactis NZ3900 juga
dilakukan dengan PCR koloni menggunakan primer promotor NisA dan teminator
pNZ8148 (Gambar 19) pada L. lactis rekombinan. Hasil PCR menunjukkan bahwa
pNZ8148 berhasil diintroduksikan ke dalam inang L. lactis dengan ukuran
promotor sampai terminator yang sama dengan kontrol positif. Kontrol positif pada
PCR dengan menggunakan plasmid pNZ8148.
23

Gambar 18 Hasil PCR koloni menggunakan primer F/R gen fusi pada L. lactis
rekombinan. 1 dan 3: L. lactis rekombinan fusi slpA-sHSP, 5:
kontrol positif (fusi). M: 100 pb Kappa universal DNA ladder.

Gambar 19 Hasil PCR koloni menggunakan primer F/R Pro NisA dan Term
pNZ8148. 1: kontrol positif (pNZ8148), 2 dan 4: L. lactis pNZ8148.
M: 100 pb Kappa universal DNA ladder.

Konstruksi vektor food grade penting untuk industri fermentasi makanan.


Gen sHSP dari L. plantarum U10 dapat digunakan sebagai penanda seleksi. Vektor
ini diyakini aman untuk makanan karena inang yang biasa digunakan dalam
fermentasi makanan. Selain itu gen sHSP dapat meningkatkan toleransi mikroba
terhadap tekanan panas dan membantu bakteri tetap hidup di bawah kondisi tekanan.
Skrining untuk transforman positif menjadi lebih sederhana dan mudah dengan
meningatkan suhu menjadi 42 C.
24

5 SIMPULAN DAN SARAN

Simpulan

Karakterisasi terhadap gen small Heat Shock Protein (sHSP) pada isolat L.
plantarum U10 yang diisolasi dari makanan tradisional Indonesia Tempoyak
dengan berat molekul 18,16 kDa. Protein ini diekspresikan dengan perlakuan kejut
panas pada perubahan suhu menjadi 42 C. Promotor slpA yang berukuran 192 pb
dengan gen sHSP yang berukuran 423 pb telah berhasil dikloning ke vektor pGEM-
T. Promotor slpA dengan ukuran 192 pb juga telah berhasil difusikan dengan gen
sHSP yang berukuran 423 pb sehingga diperoleh ukuran fusi 615 pb. Fusi promotor
slpA dan gen sHSP kemudian dikloning ke dalam vektor pNZ8148 dan
diekspresikan pada inang L.lactis NZ3900.

Saran

Hasil penelitian ini dapat dijadikan dasar untuk penelitian lanjutan dengan
menggunakan konstruksi yang telah didapatkan pada penelitian ini. Konstruksi
vektor food grade pada penelitian ini dapat digunakan untuk membawa atau
menyisipkan gen lain di daerah Multiple cloning site (MCS) dengan seleksi panas
(non antibiotik).
25

DAFTAR PUSTAKA
Boucher I, Parrot M, Gaudreau H, Moineau S. 2002. Novel food-grade plasmid
vector based on melibiose fermentation for the genetic engineering of
Lactococcus lactis. Appl Environ Microbiol. 68:6152-6161.
Bron PA, Benchimol MG, Lambert J, Palumbo E, Deghorain M, Delcour J, De Vos
WM, Kleerebezem M, Hols P. 2002. Use of the alr gene as a food-grade
selection marker in lactic acid bacteria. Appl Environ Microbiol. 68:5663-
5670.
Carvalho AS, Silva J, Ho P, Teixeira P, Malcata FX, Gibbs P, 2004. Relevant
factors for the preparation of freeze dried lactic acid bacteria. Int Dairy
J.14:835847.doi: 10.1016/j.idairyj. 2004.02.001.
Cavanagh D, Fitzgerald GF, McAuliffe O. 2015. From field to fermentation the
origins of Lactococcus lactis and its domestication to dairy environment.
Food Microbiol. 47:45-61.
Collada C, Gomez L, Casado R, Aragoncillo C. 1997. Purification and invitro
chaperone activity of a class I small heat-shock protein abundant chestnut
seeds. Plant Physiol. 115:7177.
De Angelis M, Gobbetti M. 2011. Stress responses of Lactobacilli. Springer New
York. 23:219249.
de Ruyter PG, Kuipers OP, de Vos WM. 1996. Controlled gene expression system
for Lactococcus lactis with the food grade inducer nisin. Appl Environ
Microbiol. 62:3662-3667.
Delmas, Francoise, Fabrice P, Coucheney, Charles D, Jean G. 2001. Biochemical
and physiological studies of the small heat shock protein Lo18 from the lacic
acid bacterium Oenococcus oeni. Microbiol Biotechnology. 3(4):601-610.
Dickely. 1995. Isolation of L. Lactis nonsense suppressors and construction of a
food grade cloning vector. Mol Microbiol.15:839-847.
Diep DB, Havarstein LS, Nes IF. 1996. Characterization of the locus responsible
for the bacteriosin production in Lactobacillus plantarum C11. J Bacteriol.
178:4472-4483.
Donkor ES, Bishop CJ, Antonio M, Wren M, Hanage WM. 2011. High levels of
recombination among Streptococcus pnemoniae isolates from the Gambia.
Microbiol. 3(9):602-615.
El Demerdash HAM, Heller KJ, Geis A. 2003. Application of the sHSP gene,
encoding a small heat shock protein, as a food-grade selection marker for
lactic acid bacteria. Appl Environ Microbiol. 69: 4408-4412.
El Demerdash HAM, Oxmann J, Heller KJ, Geis, A. 2006. Yoghurt fermentation
at elevated temperatures by strains of Streptococcus thermophilus
expressing a small heat shock protein application of a two-plasmid system
for constructing food-grade strains of Streptococcus thermophilus.
Biotechnol J.69:398-404.
Ehrnsperger M, Grber S, Gaestel M, and Buchner, J. 1997. Binding of non-native
protein to HSP25 during heats hock creates a reservoir of folding
intermediates for reactivation. EMBO J. 16: 221-229.
Felix Firyanto W, Lucyana AS, Sarwono W. 2009. Peran Heat Shock Protein
terhadap Resistensi Insulin. Maj kedokt Indon 59(3):121-128.
26

Guzzo J, Delmas F, Pieere F, Jobbin MP, Samyn B, Van Beeumen J, Cavin JF,
Divies C. 1997. A small heat shock protein from Leuconoctoc oenos
Iinduced by multiple stresses and during stationary growth phase.
Microbiol.24:393-396.doi:10.1046/j.1472-765x.1997.00042.
Hammes WP, Vogel RF. 1995. The genus Lactobacillus. Di dalam: Wood BJN,
editor. The Genera of Lactic Acid Bacteria. New York (US): Chapman &
Hall. 4(3):19-54.
Haslbeck, M. (2002). sHSP and their role in the chaperone network. Cell Mol Life
Sci. 59:1649-1657.
Herman RE, McKay LL. 1985. Isolation and partial characterization of plasmid
DNA from Streptococcus thermophilus. Appl Environ Microbiol. 50:1103-
1106.
Johansen E. 2003. Challenges when transferring technology from Lactococcus
laboratory strain to industrial strains. Appl Biotechnol. 2(1): 112-116.
Jorgensen CM, Madsen SM, Vrang A, Hansen OC, Johnsen MG. 2013.
Recombinant expression of Laceyella sacchari thermitase in Lactococcus
lactis. Protein Expression and Purification. 92:148155.
Kim, Rosalind, Kyeong Kyu Kim, Hisao Yokata, Sung-Hou Kim. 1998. Small heat
shock protein of Methanococcus jannaschii a hyperthermophile. Proc Natl
Acad Sci USA. 95:9129-9133.
Kim I, Rasmus L, Annette K, Mette P, Junge. 2002. A food grade cloning system
for Industrial Strains of Lactococcus lactis. Microbiol. 8(12):1253-1258.
Kunji ERS, Slotboom D, Poolman B. 2003. Lactococcus lactis as host for over
production of functional membrne proteins. Biochim Biophys Acta. 1610:
97-108.
Lages AC, Mustopa AZ, L Sukmarini, Suharsono. 2015. Cloning and Expression
of Plantaricin W Produced by Lactobacillus plantarum U10 Isolate from
Tempoyak Indonesian Fermented Food as Immunity Protein in
Lactococcus lactis. Appl Biochem Biotechnol. 38:126-
135.doi :10.1007/s12010-015-1786-9.
Le Roux NJ, Steel SJ, Louw N. 1997. Variable section and Error rate estimation in
discriminant analysis. J Statis Comput Simul. 99:195-219.
Lee GJ, dan Vierling E. 2000. A small Heat Shock Protein cooperates with Heat
Shock Protein 70 systems toreactivate a heat-denatured protein. Plant
Physiol. 122:189-198.doi: org/10.1104/pp.122.1.189.
Lelj Garolla B, Mauk AG. 20O6. Self-association and chaperone activity of HSP27
are thermally activaled. J Biol Chem. 281:8169-74.
Liang X, Sun Z, Zhong J, Zhang Q, Huan L. 2010. Adverse effect of nisin resistance
protein on nisin induced expression system in Lactococcus lactis. Microbiol
Research. 165:458-465.
Martn M, Gutirrez J, Criado R, Herranz C, Cintas LM, Hernndez PE. 2007.
Cloning, production and expression of the bacteriocin enterocin A produced
by Enterococcus faecium PLBC21 in Lactococcus lactis. Appl Microbiol
Biotechnol. 76:667675
Mayo B, Aleksandrzak-Piekarczyk T, Fernandez M, Kowalczyk M, Alvares-Martin
P, Bardowski J. 2010. Updates in metabolism of lactic acid bacteria. Di
dalam: Mozzi F, Raya RR, editor. Biotechnology of Lactic Acid Bacteria:
Novel appl Iowa (US): Wiley-Blackwell. 6(2):3-33.
27

McCracken Andrea, Peter Timms. 1999. Eficiency of transcription from promoter


sequence variants in Lactobacilus is both strain and context dependent. J
Bacteriol. 181:6569-6572.
Mierau I, Olieman K, Mond J dan Smid EJ. 2005. Optimization of the Lactococcus
lactis nisin-controlled gene expression system NICE for industrial
applications. Microbial Cell Factories. 68:705-717.
Mills S, Coffey A, OSullivan L, Stokes D, Hill C, Fitzgerald GF, Ross RP. 2002.
Use of lacticin 481 to facilitate delivery of the bacteriophage resistance
plasmid, pCBG104 to cheese starters. J Appl Microbiol. 92: 238-246.
Morelli L, FK Vogensen, AV. Wright. 2004. Genetics of lactic acid bacteria.
Dalam: Salminen S, A. Wright, A. Ouwehand (Eds.). 2004. Lactic acid
bacteria: Microbiological and functional aspects. 3rd ed. Marcel Dekker, Inc
New York: xiii.
Mustopa AZ. Fatimah. 2014. Diversity of lactic acid bacteria isolated from
Indonesian traditional fermented food. Microbiol Indones. 8:48-57.
Narberhaus, F. (2002). Crystallin-type heat shock proteins: socializing mini-
chaperones in the context of a multichaperone network. Microbiol Mol Biol
Rev. 66:64-93.
O'Sullivan T,Van Sinderen D, Fitzgerald G. 1999. Structural and functional
analysis of pCI65st, a 6.5kb plasmid from Streptococcus thermophilus NDI-
6. Microbiol. 145:127-134.
Rattanachaikunsopon P, Phumkhachorn P. 2009. Glass bead transformation method
for gram-positive bacteria. Braz J Microbiol. 40: 923-926
Sambrook J, Fritsch EF, Maniatis T. 2001. Molecular cloning: a laboratory
manual. New York: Cold spring harbor laboratory.
SchoffI Prendl, Reindl. 1998. A Regulation of the heat-shock response. Plant
Physio. 17:35-41
Siezen RJ, Van Hylckama, V lieg. 2011. Genomic diversity and versatility of
Lactobacillus plantarum, a natural metabolic engineer. Microb Cell Fact.
10(1):1-13.
Solow BT, Somkuti GA. (2000). Comparison of low-molecular weight heat stress
proteins encoded on plasmids in different strains of Streptococcus
thermophilus. Curr Microbiol. 41:177-181.
Spano G, Beneduce L, Perrotta C, Massa S. 2005. Cloning and characterization of
the HSP 18.55 gene, a new member of the small heat shock genes family
isolated from wine Lactobacillus plantarum. Research Microbiol. 156:219-
224.doi: 10.1016/j.resmic.2004.09.014.
Sugimoto, Shinya, Abdullah AM, Kenji, S. 2008. Molecular chaperon in lactic acid
bacteria physiological consequences and biochemical properties. J
Bioscience and Bioengineering. 106: 324-336.doi:10.1263/jbb.106.324.
Takala M, Saris PE. 2002. A food-grade cloning vector for lactic acid bacteria based
on the nisin immunity gene. Appl Microbiol Biotechnol.59:467-471.
Tian Hongtao, Jianxin Tan, Lifang Zhang,Yunbo Luo. 2012. Increase of stress
resistance Lactococcus lactis via a novel food grade vector expressing a sHSP
gene from Streptococcus thermophilus. Brazilian J Microbiol. 17:1157-1164.
Todorov SD, Leblanc JG, Franco BD. 2012. Evaluation of the probiotic potencial
and effect of encapsulation on survival for Lactobacillus plantarum ST16Pa
isolated from papaya. World J Microb Biot. 28:973-984.
28

Tsakalidou E, Papadimitriou K. 2011. Stress responses of lactic acid bacteria.


Springer New York. 28:973-984.
Urnemi, A Zaenal M, M Ridwan. 2010. Potensi bakteri asam laktat dari lempok
durian dalam menghasilkan bakteriosin sebagai biopreservatif pangan. Di
dalam: Hernaman I, Tanuwiria UH, Hendronoto A, Yurmiati LH, Sulistyati
M, Hidayati YA, Herlina L, Indrijani H, Sujana E, Putranto WS, Islami RZ,
Widiawati Y, Sofjan O, Syamsul JA, editor. Sistem Produksi Berbasis
Ekosistem Lokal. Seminar Nasional Peternakan Berkelanjutan; 2010
November 4; Bandung, Indonesia. Bandung (ID): Universitas Padjajaran.
679-685.
Veinger L, Diamant S, Buchner J, and Goloubinoff P. 1998. The small heat shock
protein IpbB from Escherichia coli stabilizes stress-denatured proteins for
subsequent refolding by a multichaperone network. J Biol Chem. 273: 11032-
11037.
Westerheide SD, Morimoto RI. 2005. Heat shock response modulators as
therapeutic tools for diseases of protein conformation. J Biol Chem.
280:33097-100.
Wu C, Juan Zhang J, Du G, Chen J. 2013. Heterologous expression of Lactobacillus
casei RecO improved the multiple stress tolerance and lactic acid production
in Lactococcus lactis NZ9000 during salt stress. Bioresource Tech. 143: 238
241.
Yuliana N, Garcia VV. 2009. Influence of Pediococcus acidilactici as a starter on
the flavor of tempoyak (fermented durian). Indian J Biotechnol. 8:304-310.
29

LAMPIRAN
30 2
7
Lampiran 1. Komposisi media pertumbuhan de Man, Rogosa, Sharpe (MRS)
(Oxoid)
Komposisi Media Jumlah

Peptom 10 g/L
Bubuk Lab-Lemco 8 g/L
Ekstrak Khamir 4 g/L
Sorbitan mono-oleat 1 g/L
Di-potasium hidrogen fosfat 2 g/L
Sodium asetat 5 g/L
Tri-ammonium sitrat 2 g/L
Magnesium sulfat 0.2 g/L
Mangan sulfat 0.05 g/L
31

Lampiran 2. Komposisi larutan elektroforesis SDS-PAGE


Medium dan larutan- Bahan-bahan Jumlah
larutan
Larutan gel separating 10%H2O 6.25 ml
1.5 M Tris-HCl pH 8.8 3.75 ml
containing 0.4% SDS
30% Akrilamid 5 ml
10% amonium Persulfat 0.05 ml
TEMED 0.01 ml
Larutan gel stacking 3.9% H2O 3.05 ml
1.5 M Tris-HCl pH 6.8 1.25 ml
containing 0.4% SDS
30% Akrilamid 0.65 ml
10% amonium Persulfat 0.025 ml
TEMED 0.005 ml
Buffer running (Loading 4x Tris-Cl/SDS pH 6.8 25 ml
Dye) Gliserol 20 ml
SDS 4 ml
-mercaptoethanol 2 ml
Bromophenol blue 1 ml
H2O 5 ml
Commasie Blue G-250 45% H2O 225 ml
staining 45% Metanol 225 ml
Solution (500 ml) 10% Asam asetat glacial 50 ml
0.05 Commasie brilliant 250 ml
blue
Commasie Blue G 250 50% H2O 500 ml
destaining 10% Asam asetat glacial 100 ml
Solution (1000 ml) 40% Metanol 400 ml
2
32
9

Lampiran 3. Metode Isolasi Total RNA (Ribo-Pure Kit Ambion)

1. Sampel dipanen dengan sentrifugasi 13000 x g selama 30-60 detik.


2. Tambahkan 350 l RNAwiz ke ke dalam tube sampel, kemudian vortex
selama 10-15 detik.
3. Siapkan tube yang telah diisi dengan Zirconia beads sampai garis batas isi
(250 l) pada tube.
4. Masukkan sample (no 2) pada tube yang sudah ada Zirconia beads,
kemudian vortex selama 10 menit.
5. Sentrifugasi 16000 g selama 5 menit pada suhu 4 C.
6. Pindahkan supernatan ke tube yang baru.
7. Tambahkan 0,2 volume kloroform, inkubasi 10 menit pada suhu ruang.
8. Sentrifugasi 16000 g selama 5 menit pada suhu 4 C.
9. Pindahkan supernatan ke tube yang baru.
10. Tambahkan 0,5 volume ethanol absolut, kemudian di mix.
11. Pindahkan sample ke filter cartridge, kemudian sentrifugasi selama 1 menit
16000 x g pada suhu 4 C.
12. Buang cairan di bawah filter.
13. Tambahkan Wash Solution 1 (panaskan pada suhu 37 C sebelum
digunakan) sebanyak 700 l, kemudian sentrifugasi selama 1 menit 16000
g pada suhu 4 C.
14. Buang cairan di bawah filter.
15. Tambahkan Wash Solution 2/3 sebanyak 500 l, kemudian sentrifugasi
selama 1 menit 16000 x g pada suhu 4 C.
16. Buang cairan di bawah filter.
17. Lakukan lagi tahap 15 dan 16
18. Sentrifugasi kering selama 1 menit 16000 x g pada suhu 4 C.
19. Pindahkan filter cartridge ke tube baru (collection tube)
20. Tambahkan 25-50 l Elution Solution (dipanaskan pada suhu 95-100C
sebelum digunakan), kemudian sentrifugasi selama 1 menit 16000 g pada
suhu 4 C.
21. Tambahkan DNase ke dalam RNA, kemudian inkubasi selama 30 menit
pada suhu ruang.
22. Inaktivasi DNase dilakukan dengan menambahkan Reagen DNase
Inactivation sebanyak 20% dari volume total RNA, kemudian vortex
biarkan selama 2 menit pada suhu ruang.
33

Lampiran 4. Komposisi media pertumbuhan bakteri Luria-Bertani (LB) (Oxoid)


Komposisi Media Gram

Tripton 10 g/L
Yeast extract 5 g/L
NaCl 10 g/L
34 3
1
Lampiran 5. Komposisi media pertumbuhan M17 (Oxoid)
Komposisi Media Jumlah

Tripton 5 g/L
Pepton soya 5 g/L
Meat digest 5 g/L
Ekstrak khamir 2.5 g/L
Asam askorbat 5 g/L
Magnesium sulfat 0.25 g/L
Di-sodium gliserol fosfat 19 g/L
3 35
2
Lampiran 6. Zona bening uji aktivitas chaperon
Sampel Zona Bening (cm)

1 1.30.011
2 3.10.011
3 1.060.011
4 0.730.011
5 3.360.011
36

Lampiran 7. Hasil pengurutan nukleotida pGEM-T slpA


37

Lampiran 8. Hasil pengurutan nukleotida pGEM-T sHSP


38

RIWAYAT HIDUP
Penulis dilahirkan dari pasangan Sarman, AmdPd dan Miharsyawati, AmdPd
di Tanjung Ganti II Kecamatan Kelam Tengah Kabupaten Kaur Bengkulu, pada
tanggal 19 Maret 1992. Penulis merupakan anak kelima dari lima bersaudara.
Pada tahun 2009 penulis menyelesaikan pendidikan Sekolah Menengah Atas
di SMA Plus Negeri 7 Kota Bengkulu dan pada tahun yang sama penulis
melanjutkan pendidikannya di Jurusan Pendidikan Biologi, Fakultas Keguruan dan
Ilmu Pendidikan, Universitas Bung Hatta Padang. Penulis mendapatkan gelar
Sarjana (S1) pada tahun 2013. Tahun 2013, penulis melanjutkan studinya di
Departemen Bioteknologi, Fakultas Multidisiplin, Institut Pertanian Bogor dan
lulus pada tahun 2015.
Selama mengikuti perkuliahan penulis sering mengikuti pelatihan dan
seminar yang diadakan baik di dalam kampus maupun di luar kampus. Selan itu,
penulis juga aktif dalam kegiatan organisasi kemahasiswaan UBH. Pengurus
Himpunan Mahasiswa Pendidikan Biologi (2010/2011, 2011/2012), Salah satu
anggota Himpunan Mahasiswa Islam (HMI) (2012/2013). Selama mengikuti
perkuliahan di Pascasarjana IPB, penulis pernah mengikuti kegiatan yang diadakan
oleh Forum Mahasiswa Pascasarjana (Forum WACANA) IPB dan menjadi
pengurus UKM HIMAWIPA (Himpunan Mahasiswa Wirausaha Pascasarjana IPB)
tahun 2013/2014 dan 2014/2015. Penulis juga menjadi pengurus di Koperasi
HIMAWIPA IPB.
Penulis melakukan penelitian yang berjudul Karakterisasi dan Konstruksi
Vektor Ekspresi Gen small Heat Shock Protein (sHSP) Lactobacillus Plantarum
sebagai Alternatif Penanda Seleksi Food Grade di Lactoccus lactis dan
dipublikasikan ke MI (Microbiology Indonesia). Sebagian dari data penelitian ini
sudah diseminarkan di Workshop Writing Clinic, ITB Bandung Tahun 2014.