Problem Set 4: Subcloning and DNA Sequencing of Immunoglobulin Genes

1.)

2.) Yes. The following plates had non-recombinant transformants:

- the insert control ligation (plate #5) had 109 colonies
-the no ligation control (plate #6) had 1 colony

3.) The insert control ligation (plate #5) had 109 colonies. These were likely the result of
vector re-ligation. The no ligation control (plate #6) had 1 colony. This was probably a
contaminant.

4.) Uncut Bluescript dilution 1 (plate #7) gave 86 colonies. This dilution had approximately
0.25x10-10 g of DNA or 2.5x10-5 g of DNA. (it was the stock concentration of 0.25g/L
diluted 10-fold 4 times)
86 colonies/2.5x10-5 g of DNA = 3.44x106 colonies/g of DNA
This result is slightly lower than the 107 or 108 colonies that were expected.

5.) There seemed to be 4 nucleotides that were deleted (5-CGAC-3) from the end of the DH
coding sequence and 7 that were added (5GGGAAAA-3)
5CAGTGNTGATGNTAGGAANNNTAAGTTAAAAGNAANCATGNTNNCAGGATTGCCTCTCANTGAACTTCAAAACAAGCAAAATTCAA
TCTNTCTGTTAAGGATATGAGAAGAGATNTNTGAACCCAGTGTTGAAGTNCCAGGACCCCACTACCAGGTCCCCACTNCCAGGCTGGGT
GAAATATCAGAGCAATCACCAGGAACAAAGACTAGGGTGAAGAGGGTTAGGAAACAACTGTCACGACCTCACACTAGTGCACCTGAAGG
AAAAACAAGAACTTGTAAAGAGCAGCAGAAAAATAAGTACACGGCCAGTCTTAAAGGATCTGCATCGTCTGTGAGGCCATCAAAGAGGA
AAGGAAAAGCATGTCTCAAAGCACAATGCCTGGCTTGCGATGCTGTCTGCAGCTTCTGCCCTAGATCCTCTCACTCTACATGTAAAGGGC
TCAAGGCATCAACCTAGAACTTCCCAGGAAGGAGGAAGGAAGGCAGCATGTTGGTCAGGAAGTCATCCAGAAACAGACCTCTCCAGTAT
TTCTTATGACCCCTCCCACAGCAGCCACTGTCCAGGCACTCAGAGAGCAAGGGATGTTGGGAAGTCAGGCTTGTGACAGCCCCAGGTATA
TTTACTTATATAGGACCTCCCTGGGGAGATAGAATCCCAGGAGTAAAAAGATTGGATGTATATTAAGGATGGCCCCTGACACTCTGCAC
TGCTACCTCTGGCCCTACCAGACAATGTTCCTGCAGAACCTGTTACCTTACTTGGCAGGGATTTTTGTCAAGGGATCTACTACTGTGCCT
ACTATGGTAAGGGAAAACCTGGTTTGCTTACTGGGGCCAAGGGACTCTGGTCACTGTCTCTGCAGGNGAGTCCTAACTNTC 3

Legend
Upstream sequence of RSS DSP2.7 sequence
9mer upstream of DH IgH J3 sequence
12 bp repeat N nucleotides added by TdT
7mer upstream of DH

6.) There were 4 nucleotides deleted and 7 added by TdT. This is an addition of +3
nucleotides which would keep the sequence in the correct reading frame. Therefore, it is
possible for this sequence to become functional if V-DJ rearrangement continues and the
RSS and intervening sequences are spliced out.

7.) Yes there is some evidence for somatic hypermutation in this VDJ rearrangement.
IgHD5-24*01, IgHD3-16*02, and IgHD3-16*01 are all a 100% match. IgHJ2*01, IgHJ4*02,
IgHJ4*03 are also all a 100% match. However, there is no 100% matching V segment. The
closest matching segments are 83.1% (IgHV4-59*01) or 82.7% (IgHV4-59*02/07). This
significant amino acid difference among the central regions (not terminal regions) of the V
locus is evidence of somatic hypermutation.

Are 2/3 of rearrangements really trash or is there a bias towards the number of
additions at DJ, VDJ rearranagments. V-n-D-n-J