Anale GBM F1 2014

ANALELE TIINIFICE
ALE
UNIVERSITII ALEXANDRU IOAN CUZA
DIN IAI
(SERIE NOU)
SECIUNEA II
a. GENETIC I
BIOLOGIE
MOLECULAR
TOMUL XV, fascicula 1 2014
Editura Universitii ALEXANDRU IOAN CUZA Iai

FOUNDING EDITOR
Professor Ion I. BRA, PhD
EDITOR IN CHIEF
Professor Vlad ARTENIE, PhD University Alexandru Ioan Cuza, Iai
vartenie@uaic.ro
ASSISTANT EDITOR
Assistant professor Lucian HRICU, PhD University Alexandru Ioan Cuza, Iai
hritcu@uaic.ro
PRODUCTION EDITOR
Lecturer Eugen UNGUREANU, PhD University Alexandru Ioan Cuza, Iai
aeu@uaic.ro
EDITORS
Academician Professor Octavian POPESCU, PhD Babe Bolyai University, Cluj Napoca, Romania
Professor Roderich BRANDSCH, PhD Albert Ludwigs University, Freiburg, Germany
Professor HuiGen FENG, PhD University XingXiang, China
Professor Gogu GHIORGHI, PhD University Bacu, Romania
Professor Didier GUILLOCHON, PhD Universit de Sciences et Technologies de Lille, France
Professor Peter LORENZ, PhD University of Applied Sciences, Saarbrucken, Germany
Professor LongDou LU, PhD University XingXiang, China
Professor Toshitaka NABESHIMA, PhD Meijo University, Nagoya, Japan
Professor Janos NEMCSOK, PhD University Szeged, Hungary
Professor Alexander RUBTSOV, PhD M.V. Lomonosov State University, Moscow, Russia
Assistant professor Costel DARIE, PhD Clarkson University, USA
Assistant professor Mihai LESANU, PhD State University, Chisinau, Republic of Moldova
Lecturer Harquin Simplice FOYET, PhD University of Maroua, Cameroon
Christian GAIDDON, PhD INSERM U1113, Strasbourg, France
Cristian ILIOAIA, PhD Ecole Normale Suprieure, Cachan, France
Andrew Aaron PASCAL, PhD CEA-Saclay, France
ASSOCIATE EDITORS
Professor Dumitru COJOCARU, PhD University Alexandru Ioan Cuza, Iai
Professor Costic MISIL, PhD University Alexandru Ioan Cuza, Iai
Professor Ovidiu TOMA, PhD University Alexandru Ioan Cuza, Iai
Assistant professor Simona DUNCA, PhD University Alexandru Ioan Cuza, Iai
Assistant professor Anca NEGUR, PhD University Alexandru Ioan Cuza, Iai
Assistant professor Zenovia OLTEANU, PhD University Alexandru Ioan Cuza, Iai
Lecturer Csilla Iuliana BRA, PhD University Alexandru Ioan Cuza, Iai
Lecturer Elena CIORNEA, PhD University Alexandru Ioan Cuza, Iai
Lecturer Cristian CMPEANU, PhD University Alexandru Ioan Cuza, Iai
Lecturer Mirela Mihaela CMPEANU, PhD University Alexandru Ioan Cuza, Iai
Lecturer Lucian GORGAN, PhD University Alexandru Ioan Cuza, Iai
Lecturer Marius TEFAN, PhD University Alexandru Ioan Cuza, Iai
Lecturer Cristian TUDOSE, PhD University Alexandru Ioan Cuza, Iai
Lecturer Lcrmioara OPRIC, PhD University Alexandru Ioan Cuza, Iai
SECRETARIATE BOARD
Lecturer Clin MANIU, PhD University Alexandru Ioan Cuza, Iai
Lecturer Marius MIHAN, PhD University Alexandru Ioan Cuza, Iai
EDITORIAL OFFICE
Universitatea Alexandru Ioan Cuza, Facultatea de BIOLOGIE
Laboratorul de Biochimie i Biologie Molecular
Bulevardul Carol I, Nr. 20A, 700506, Iai, Romnia
www.gbm.bio.uaic.ro / gbmpapers@yahoo.com
Analele tiinifice ale Universitii Alexandru Ioan Cuza, Seciunea Genetic i Biologie Molecular, TOM XV, 2014
CONTENT
Oana Constantin, Marius Mihan Gene cloning of

a putative periplasmic sugar-binding protein from 1
the pAO1 megaplasmid of Arthrobacter
nicotinovorans
Corneliu Tanase, Valentin I. Popa Peroxidase,
superoxide-dismutase and catalase activity in corn
plants developed under the influence of 7
polyphenolic compounds and deuterium depleted
water
Diana Batr - Rusu The influence of the
conservation period on the activity of mycological 13
flora on Zea mays seeds from Suceava Genebanks
collection
Marcel Avramiuc The influence of some storage
conditions upon ascorbic acid content in white and 21
red cabbage
Laura-Iuliana Vasile, Eugen Ungureanu, Vlad Artenie
The activity of cytolysis enzymes in acute coronary 27
syndromes
Eduard Crauciuc, Diana Popovici, Mariana Bratu,
Ovidiu Toma, Drago Crauciuc Breast cancer and 35
the histopathologic type case studies
Mihai Emil Cplna, Simona Cristina Rusu, Janos
Becsi, Monica Andra CosteaNedelcu, Claudiu Ion
Puiac, Eduard Crauciuc, Ovidiu Toma, Drago 39
Crauciuc, Bella Szabo Prevalence of groin lymph
nodes metastases in clinically stages IB and II
cancer of the vulva
Constantin Toma review on GOGU GHIORGHI -
Moartea celular programat i mecanismele ei. 43
Editura Academiei Oamenilor de tiin, Bucureti,
2012
Vlad Artenie review on GHEORGHE HRINC -
Grupele sanguine la ovine, Editura Agata, 45
Botoani, 2012
GENE CLONING OF A PUTATIVE PERIPLASMIC SUGAR-BINDING

PROTEIN FROM THE pAO1 MEGAPLASMID OF ARTHROBACTER
NICOTINOVORANS
OANA CONSTANTIN1, MARIUS MIHAN1*
Keywords: Arthrobacter, catabolic megaplasmid, xylose, ABC-type transport system

Abstract: D-xylose is a very important fraction of lignocellulose and it provides a promising renewable resource for
production of bio-ethanol or other various chemicals. Recently, the pAO1 megaplasmid of Athrobacter nicotonovorans
has been linked with the ability of this microorganism to metabolize D-Xylose through a less common oxidative pathway.
The operon encoding the A. nicotinovorans oxidative xylose-catabolic pathway has been identified and some enzymes
have been isolated and characterized. So far, the mechanisms underlaying operon activation and xylose transport have
been neglected. The xyl operon contains all the components of a ABC-type transport system that must be involved in
cross-membrane transport of D-Xylose. In this work, a PCR protocol for the isolation of the putative periplasmic binding
protein (ppl) component of the ABC-type system has been established and the DNA fragment containing the ppl gene has
been cloned into the pH6EX3 expression vector.
INTRODUCTION
Xylose, as the main component of the hemicellulose xylan, is a rather abundant pentose, comprising up to
20% of some plants biomass (Aristidou and Penttil, 2005). Although a very important resource in terms of availability,
D-xylose has found very few bio-technological uses: production of bioethanol, xylitol (Ko et al., 2006) or production of
tricarboxylic-acid (TCA)-cycle-derived chemicals (e.g. C4 building blocks (Meijnen et. al., 2009). This situation is due to
the lack of suitable enzymes that can be applied into biotechnological and industrial process.
Recently, we have shown that the soil bacteria Arthrobacter nicotinovorans is able to degrade D-Xylose due to
the presence of a xyl operon on the 165 kb megaplasmid pAO1 (Mihasan et al., 2013). It seems that the pathway is not
unique to this species, as its existence has also been inferred from the DNA sequence of A. phenanthrenivorans (Mihasan
and Brandsch, 2013). The degradation pathway consists of an oxidative stepped-mechanism similar to the Weimberg
pathway, in which D-Xylose is oxidized by a xylose-dehydrogenase (XDH) to D-xylonate, which is dehydrated to 2-
ketoglutarate semi-aldehyde and further oxidized to 2-ketoglutarate by an aldehyde-dehydrogenase. Part of the xyl-operon
is also a ABC-type transport system, involved most probably in the ATP-dependent transport of D-xylose across the
membrane into the bacterial cell. The ABC-type transport system genes cluster contains all the components of a typical
class 3 ABC system (Davidson AL et all. 2008) (Figure 1): a putative ATP binding protein gene (ATP-bind), two genes
for pore-forming membrane proteins (perm) and a periplasmic sugar binding protein gene (ppl).
Figure 1. The xyl operon in pAO1 of Arthrobacter nicotinovorans. ATP-bind - a putative ATP binding protein , perm -
pore-forming membrane proteins, ppl - periplasmic sugar binding protein , hypo hypothetical protein, unknown
function, gdh putative keto-gluconate dehydrogenase, sdh semi-aldehyde dehydrogenase, xdh xylose-
dehydrogenase, gck putative glicerate-kinase.
A BLAST search using the aminoacid sequence of the periplasmic sugar binding protein (PSBP) indicates that
the protein is part of the type I periplasmic binding protein superfamily and that it contains the cd06300 conserved
domain (Marchler-Bauer et al. 2013) Members of this group are predicted to be involved in the transport of sugar-
containing molecules across cellular and organellar membranes; however their substrate specificity is not yet known in
detail (Davidson et. al., 2008). A putative model for the 3D structure of the PSBP protein has been previously generated
using homology modeling. The overall structure of the model follows well the characteristics of the bacterial PBP
structural superfamily: a bilobate structure known as Venus flytrap (Acher and Bertrand, 2005) formed by two pseudo-
symmetric domains linked by a hinge. In-silico docking experiments have shown that the protein is able to bind not only
1
Oana Constantin et al Gene cloning of a putative periplasmic sugar-binding protein from the pAO1 megaplasmid of
Arthrobacter nicotinovorans
xylose and its derivatives, but also other less common sugars and derivatives such as: tagatose, xylulose or trehalose
(Mihasan, 2010).
Figure 2. The 3D model of the PSBP showing

characteristics of bacterial PBP structural
superfamily protein: a bilobate structure
formed by two pseudo-symmetric domains
linked by a molecular hinge. Image generated
with PyMol molecular modeling and
visualization software (Schrdinger, 2010).
The PSPB is thereby a rather interesting protein from several points of view. Despite the fact the in-silico
experiments have shown that the best ligand is tagatose, its localization in the xyl-operon would indicate that the
physiological substrate is xylose. No signature sequence for protein export has been detected on PSPB, but for sure the
protein is exported outside the cell in order to fulfill its role in sugar transport. The lack of fully characterized protein
family members is also intriguing. Thereby, the current work focuses on the isolation and molecular cloning of the ppl
gene in a suitable vector for simple downstream over-expression and purification of this protein.
MATERIAL AND METHODS

Chemicals. All chemicals used were of highest purity available. Ampicillin and kanamycin was from Sigma-Aldrich,
Germany. HEPES, yeast extract, peptone from caseine, EDTA and DTT were from Carl Roth, Germany. All restriction
enzymes were from NEB, U.K.
Strains and growth conditions. For all recombinant DNA-techniques and plasmids harvesting, E. coli XL1 Blue
(Stratagene) was grown on LB-nutrient broth (Mihasan et al., 2012) with appropriate antibiotics (ampicline 50 g/ml).
Arthrobacter nicotinovorans pAO1+ was a kind gift from prof. Dr. Brandsch R and was grown an citrate minimal
medium (Brhmller et al., 1972) supplemented with 0,05% nicotine and 70 g/ml kanamycin.
Plasmids and primers. The ppl gene was isolated by PCR using the primers in table 1 and a suspension of
Arthrobacter nicotinovorans pAO1+ cells as template. Directional cloning (Sambrook et al., 1989) of the ppl fragment
was achieved using the pH6EX3 expression vector (Berthold et. al., 1992). PCR clean-up, plasmid mini-preps and DNA-
gel extraction were performed with the kits from Zymo Research, Germany. All DNA separations were performed using
standard horizontal agarose-gel electrophoresis (Sambrook et al., 1989). The DNA was visualized using etidium-bromide
and a Biorad Gel-Doc system.
Table 1. Oligo-nucleotides used for isolation of ppl

Oligo's name Sequence*
ForPplBam 5'GCGGTACTAGGATCCGCCGCCATG'3
RevNDHlxba 5'CCCTGTGCGCTCGAGAATGACC'3
*nucleotides written in italics indicate mutated nucleotides, underlined nucleotides denote the engineered restriction sites,
Ligation, transformation and clone selection. Competent E. coli XL1 blue cells were prepared using the standard Ca2+-
method as described by (Sambrook et al., 1989). Following digestion, the vector and amplified fragment were ligated
using the Rapid DNA ligation Kit, Roche, Germany and directly used for the transformation reaction. The putative clones
were selected on plates containing ampicillin 50 g/ml and the recombinant plasmid was checked for the presence of
insert by restriction enzyme digestion.
2
RESULTS AND DISCUSSIONS
Sequence-inferred properties of PSPB. As shown previously (Igloi and Brandsch, 2003), the
ppl gene is placed on the direct strand, with the START codon at the position 32506 and the
STOP codon at the position 33684. The gene has 1,2 kb and it encodes 292 aminoacids.
According to ProtParam on the ExPASy server (Gasteiger et al., 2005) the computed molecular
weight of PSPB is 42.2 kDa and the theoretical pI is 4.63. The instability index (II) was
calculated to be 36.42 which classifies the protein as stable and makes PSBP a suitable candidate
for overexpression and purification.
PCR isolation and amplification of the ppl fragment. Using the primers indicated in table 1
and a PCR cycle consisting of denaturation 950C, 30 s; annealing variable temperature, 45 s;
synthesis 720C, 1.5 min repeated 30 times, the whole approx. 1.4 kb DNA fragment was
successfully amplified (figure 3A). Despite all efforts, a very specific amplification was not
possible and a supplementary DNA purification was required. The DNA fragment corresponding
to the expected molecular weight was excised from the gel and extracted.
Figure 3. Isolation of the ppl- containing fragment. A. Unspecific amplification of the ppl-
containing fragment. On top, the temperature gradient used in the annealing step of the PCR-
program.
B. v linear pH6EX3 vector and ppl- DNA fragment containing the ppl gene after digestion with
the restriction enzymes specified in the main text and purification.
Digestion, ligation and transformation. After the successful amplification and isolation of the
ppl gene, the fragment was digested using the enzyme pair BamHI/XhoI in Neb buffer 3
following the indications of the producer. The pH6EX3 vector was also digested with the enzyme
pair BamHI/XhoI which leads to compatible ends and assures a precise orientation of the
fragment (Mihasan et al., 2010). Following ligation and transformation, a number of only 3
colonies were obtained on ampicillin containing plates. The plasmid DNA from these colonies
was isolated and analyzed by agarose gel electrophoresis (figure 4, A).
3
Oana Constantin et al Gene cloning of a putative periplasmic sugar-binding protein from the pAO1 megaplasmid of
Arthrobacter nicotinovorans
Figure 4. Screening of the putative colonies harboring the recombinant pH6EX3ppl plasmid.
A. Circular plasmid DNA isolated from transformed colonies. M 1kb DNA ladder, further lanes
- plasmid DNA from the indicated colonies, 4 circular pH6EX3 vector. Colony 1 and 3 run
differently than the circular pH6EX3 indicating a recombinant plasmid molecule.
B. Controlled enzymatic digestion of the isolated plasmid DNA using PstI/XhoI. M - 1kb DNA
ladder, 1, 2 digested pH6EX3ppl recombinant vector; 1`, 2` - circular pH6EX3ppl recombinant
vector; 3 - digested pH6EX3 vector ; 3` - circular pH6EX3 vector.
Cloning verification. Although the best way of checking a positive clone is by sequencing, a
controlled enzymatic digestion which would take advantage of an cutting site existing only on the
cloned fragment is as well as relevant Chiribau et al., 2004). In order to check the isolated
colonies, a double digest was performed using PstI/XhoI enzyme pair. As shown in figure 4, B,
the plasmid DNA from the two tested colonies an approx. 1.4 kb fragment could be identified.
This indicated that both of the tested colonies are harboring the recombinant pH6EX3ppl
plasmid.
CONCLUSION
The ppl gene from pAO1 was isolated and cloned in pH6EX3. The recombinant vector
will be further used in downstream applications to over-express and purify the PSBP protein.
REFERENCES
Acher FC, Bertrand H-O: Amino acid recognition by Venus flytrap domains is encoded in an 8-residue motif.
Biopolymers 2005, 80:35766.
Aristidou A, Penttil M: Metabolic engineering applications to renewable resource utilization. Curr Opin Biotechnol
2000, 11:187198.
Berthold H, Scanarini M, Abney CC, Frorath B, Northemann W: Purification of recombinant antigenic epitopes of
the human 68-kDa (U1) ribonucleoprotein antigen using the expression system pH6EX3 followed by metal chelating
affinity chromatography. Protein Expr Purif 1992, 3:506.
Brhmller M, Mhler H, Decker K: Covalently bound flavin in D-6-hydroxynicotine oxidase from Arthrobacter
oxidans. Purification and properties of D-6-hydroxynicotine oxidase. Eur J Biochem 1972, 29:14351.
Chiribau CB, Sandu C, Fraaije M, Schiltz E, Brandsch R: A novel gamma-N-methylaminobutyrate demethylating
oxidase involved in catabolism of the tobacco alkaloid nicotine by Arthrobacter nicotinovorans pAO1. Eur J Biochem
4
2004, 271:46774684.
Davidson AL, Dassa E, Orelle C, Chen J: Structure, function, and evolution of bacterial ATP-binding cassette systems.
Microbiol Mol Biol Rev 2008, 72:31764, table of contents.
Gasteiger E, Hoogland C, Gattiker A, Duvaud S, Wilkins M., Appel RD, Bairoch A: Protein Identification and
Analysis Tools on the ExPASy Server. In Proteomics Protoc Handb. Edited by Walker J. Humana Press Inc.; 2005:571
607.
Igloi GL, Brandsch R: Sequence of the 165-kilobase catabolic plasmid pAO1 from Arthrobacter nicotinovorans and
identification of a pAO1-dependent nicotine uptake system. J Bacteriol 2003, 185:19761986.
Marchler-Bauer A, Zheng C, Chitsaz F, Derbyshire MK, Geer LY, Geer RC, Gonzales NR, Gwadz M, Hurwitz DI,
Lanczycki CJ, Lu F, Lu S, Marchler GH, Song JS, Thanki N, Yamashita RA, Zhang D, Bryant SH: CDD:
conserved domains and protein three-dimensional structure. Nucleic Acids Res 2013, 41(Database issue):D34852.
Ko BS, Kim J, Kim JH: Production of xylitol from D-xylose by a xylitol dehydrogenase gene-disrupted mutant of
Candida tropicalis. Appl Environ Microbiol 2006, 72:420713.
Meijnen J-P, de Winde JH, Ruijssenaars HJ: Establishment of oxidative D-xylose metabolism in Pseudomonas putida
S12. Appl Environ Microbiol 2009, 75:278491.
Mihasan M, Stefan M, Hritcu L, Artenie V, Brandsch R: Evidence of a plasmid-encoded oxidative xylose-catabolic
pathway in Arthrobacter nicotinovorans pAO1. Res Microbiol 2013, 164:2230.
Mihasan M, Brandsch R: pAO1 of Arthrobacter nicotinovorans and the Spread of Catabolic Traits by Horizontal Gene
Transfer in Gram-Positive Soil Bacteria. J Mol Evol 2013:19.
Mihasan M: In-silico evidence of a pao1 encoded tagatose-derivate catabolic pathway in Arthrobacter nicotinovor . In
FEBS J. Volume 277 ; 2010:290.
Mihasan M, Stefan M, Artenie V, Brandsch R: Cloning and purification of a repressor protein from Arthrobacter
nicotinovorans pAO1. Analele Stiint ale Univ Alexandru Ioan Cuza; din Iasi Sec II a Genet si Biol Mol Vol 12, No 3
2010:13-15.
Mihasan M: Megaplasmidul pAO1 - Structura Si Functie. Editura Universitatii Alexandru Ioan Cuza din Iasi ; 2011:125.
Mihasan M, Stefan M, Zenovia O: Biologie Moleculara - Metode Experimentale. Iai: Editura Univ. Al. I. Cuza Iasi;
2012:350.
Schrdinger, LLC: The {PyMOL} Molecular Graphics System, Version~1.3r1. 2010.
Sambrook J, Fritsch EF, Maniatis T: Molecular Cloning: A Laboratory Manual (3 Volume Set). Cold Spring Harbor
Laboratory Pr; 1989.
1. Al I Cuza University of Iasi, Romania

* marius.mihasan@uaic.ro
5
6
PEROXIDASE, SUPEROXIDE-DISMUTASE
AND CATALASE ACTIVITY IN CORN PLANTS DEVELOPED UNDER
THE INFLUENCE OF POLYPHENOLIC COMPOUNDS
AND DEUTERIUM DEPLETED WATER
CORNELIU TANASE1,2*, VALENTIN I. POPA1
Keywords: polyphenolic compounds,deuterium depleted water, peroxidase, superoxide-dismutase, catalase
Abstract: In this experiment we studied the role of deuterium depleted water and spruce bark (Picea abies L.)
polyphenolic extracts in the activity of some enzymatic systems involved in the metabolism of plants of maize (Zea mays
L.). Thus, we evaluated the activity of peroxidase, catalase and superoxide dismutase in the leaves and roots of maize,
developed in the different experimental variants. It was found that the peroxidase activity decreases in the roots treated
with deuterium depleted water and increases when the plants are treated with the polyphenolic extract derived from
spruce bark. Also, it was observed an increase in catalase activity in maize plants treated with polyphenolic extract from
spruce bark.
INTRODUCTION
Polyphenolic compounds are the must important classes of secondary metabolites that play an important role in
the biosynthesis process. Natural bioactive compounds have a broad spectrum of both the plant as a whole and on tissues
and organs, interfering in the metabolic processes.
Since plant activity is intimately correlated with the biochemical processes taking place in the all vegetative organs, a
series of experiments in the literature aimed at studying the influence of polyphenolic products of enzymatic systems
involved in carbohydrate metabolism and cellular respiration (Anghel, 2004; Tudose, 2002). Thus, for seedlings of
Phaseolus vulgaris L, in the concentration range of 50-100 mg / L bioactive polyphenolic compounds, were found to
increase germination capacity and yield of plant biomass biosynthesized correlated with increased activity of amylase,
polyphenol oxidase and ascorbatoxidase on average 15-25% compared with control, while decreasing catalase activity
(Anghel, 2004). From the results obtained in the study of the influence of global polyphenolic extract of vine wood,
which contains biologically active principle, the activity of some enzymes of carbohydrate metabolism was found and
polyphenolic extract positively affects the germination process in general. There is a major action on -amylase activity
in the first 24 hours of germination process. Also, there was an intense activity of enzymes (-amylase, -amylase,
catalase, peroxidase and protease) involved in the germination process that is an argument of a normal functioning of the
process. Moreover, it was found that the sequence of enzymes in the germination proces was kept (Tudose, 2002).
Through, the characteristic biological activity, natural polyphenols are essential compounds in the stimulation of plants
growth and development. The stimulation or inhibition capacities on the plant growth and development is closely
correlated with concentrations of polyphenolic compounds applied and activities of enzymatic systems (Tanase et al.
2013).
The changes that occur in normal water characteristics lead to significant changes in the fundamental processes
of the cells and therefore, DDW was used as tracer to characterize wholetree water transport and storage properties in
individual trees belonging to the coniferous species. The use of DDW appears suitable for answering some questions
regarding relative differences in water use among trees, water redistribution among neighbours and internal water
transport and storage processes in plants. Recent research has shown that spruce bark extract and DDW have a great
influence on plant growth and development. through studies carried out (Tanase et al. 2013).
By the studies carried out it has been found thart enzymatic activity of peroxidase was found to be higher in the
maize callus developed in the presence of DDW and polyphenolic extract. Intensity changes of the enzyme activity in the
presence of DDW and polyphenolic extract from spruce bark show their involvement in the regulation of metabolic
processes in cells and the role of the tested solutions in maintaining the balance between the resulted and depleted free
radicals (Tanase et al. 2013).
The aim of this study was to evaluate the effect of spruce bark aqueous extract and deuterium depleted water
(DDW) as bioregulators on the activities of enzymatic systems such as peroxidase, superoxide dismutase and catalase.
7
Corneliu Tanase et al Peroxidase, superoxide-dismutase and catalase activity in corn plants developed under the
influence of polyphenolic compounds and deuterium depleted water
MATERIALS AND METHODS
Deuterium depleted water or light water is a microbiological pure distilled water, with an isotopic concentration
of 25 ppm, obtained by isotopic distillation in vacuum of natural water with an isotopic concentration of 145 ppm D / (D
+ H). Deuterium depleted water (DDW) was purchased from Romag Prod, Severin (Halanga), a manufacturer of heavy
water used for the reactors of the Cernavoda nuclear power plant. Spruce bark (Picea abies L.) was purchased from the
Alpine LTD Timber Company, Vatra Dornei. The bark was dried at room temperature under normal aeration conditions,
grounded and subjected again to a drying process.
Maize seeds were purchased from Unisem Company, Romania. Germination tests were carried out going through
a standard procedure, using increments of 5 petri dishes for each solution studied (Table 1). On a filter paper were placed
every five soybean seeds, carefully selected to no present major damage. For starters, the vegetal material has undergone
a process presterilizare, which consisted of submerged seed absolute ethanol for 10 seconds, following the sterilization in
the presence of sodium hypochlorite 10% for 20-30 minutes (Cachita et al., 2004). The volume of solution added was 10
mL / dishes. Petri dishes thus prepared were incubated in the dark in a thermostat set at 27 C. After a period of seven
days Petri dishes were taken out and the roots, stems and leaves are separated for enzymatic analyzes.
The spruce bark aqueous extracts were characterized from the point of view of dry matter content, total
polyphenolic content, total content of tannins, flavonoids, flavonols and antocyanins using selected samples with about
the same content in total polyphenols. These results as well as the extraction method were published in our previous work
(Tanase et al. 2013).
Thus, by using standard methods we evaluated the activity of peroxidase, catalase and superoxide dismutase in
the leaves and roots of maize developed in the 8 experimental versions, shown in Table 1.
Table 1 - Experimental variants
Experimental variant Abbreviation Total polyphenolic content

(mg GAE/L)
Control Control -
Deuterium depleted water DDW -
Deuterium depleted water and spruce bark polyphenolic
extract (1:1) DDW+M1 96
Spruce bark polyphenolic extract M1 191
Spruce bark polyphenolic extract M2 130
Enzyme activity assays

The radicle and leaves resulted after 8 weeks of germination were suspended in 5 mL of cold 50 mM phosphate
buffer (pH 7.8) and sonicated three times for 30 sec (Ultrasonic Processor CPX130, Cole-Palmer, Instruments, Illinois,
USA). The slurry was then centrifuged for 10 min at 5000 rpm. The supernatant was used further for enzyme activity
assays.
Peroxidase activity assay (EC 1.11.1.7)

The activity of peroxidase was monitored using hydrogen peroxide as substrate acceptor and o-dianisidine as
donor. The absorption was recorded at 436 nm (Tanase et al. 2013).
SOD activity assay (EC 1.15.1.1)

Activity of superoxide dismutase (SOD) was determined by measuring its ability to inhibit photochemical
reduction of nitro blue tetrazolium (NBT) (Artenie et al. 2008; Dhindsa et al. 1981).
Catalase activity assay (CAT, EC 1.11.1.6)

The activity of catalase was assayed by the method of Sinha (1972). Catalase was allowed to split H2O2 for
different periods of time. The reaction was stopped at different time intervals by the addition of dichromate and acetic
acid mixture and the remaining peroxide was determined by measuring chromic acetate amount, at 570 nm, after heating
8
the reaction mixture. The activity of catalase was expressed as M H2O2/g protein/min. One unit of catalase activity (U)
was defined as the amount of enzyme that converts one micromole of substrate to product in one minute (Tanase et al.
2013).
Quantitative determination of proteins using Bradford assay

In order to calculate the enzymatic specific activities of extracts, the total protein concentration was estimated
(Artenie et al. 2008). All UV-Vis absorption spectra were recorded using a Libra single beam Spectrophotometer
(Biochrom, UK) and quartz cuvettes (Hellma/Mllheim).
RESULTS AND DISSCUSSIONS
Determination of total protein. It was found that the total protein concentration is the
same for all experimental variants. Given these observations it was concluded that the enzyme
activity will have the same trend as that of the specific activity (ratio of enzyme activity
calculated the total amount of protein). Thus, the total enzyme activity was calculated only for
the three enzymes analyzed.
Peroxidase activity. By determination of the enzymatic activity of peroxidase, the roots of
maize plants we found that it is reduced in the presence of deuterium depleted water up to 21%
compared to the control (Figure 1). A reduction in the activity of peroxidase was recorded in
variants when in growth medium was added DDW in combination with the spruce bark
polyphenolic extract (DDW+M1) or spruce bark polyphenolic extract with concentration of 191
mg GAE / L (M1). A small increase in enzymatic activity of peroxidase in roots of maize was
recorded for M2 variant.
As concerning the enzymatic activity of peroxidase in maize leaves, there is a reduction as
compared to the roots of all the variants analyzed. Compared to the control there is an increase in
peroxidase activity (over 10%) in the leaves of maize plants that have been developed in the
presence of deuterium depleted water in mixture with spruce bark polyphenolic extract
(DDW+M1). For the other alternatives do not have significant differences compared with the
control.
100 Root
90 Leaves
80
10 6 uM o-dianisidin
70
60
50
40
30
20
10
0
Control DDW DDW + M1 M1 M2
Figure 1 - Variation of peroxidase activity in the roots and

leaves of maize depending on growth conditions
9
Superoxide dismutase activity. By analyzing the figure 2 we can see that in the roots of
maize takes place an inhibition of the activity of superoxide dismutase, as compared with the
activity in leaves. Regarding the enzymatic activity of SOD in plants developed in the different
experimental variants we didnt find significant differences compared with the control samples
(Fig. 2). In the case of variant M1 there is an increase in enzymatic activity compared to the
control (15% to 12% for roots and leaves). For other variants is a slight reduction in superoxide
dismutase activity in both roots and the leaves.
Root
110 Leaves
100
%inhibition/g protein/min
90
80
70
60
50
40
30
20
10
0
Figure 2 - Variation of superoxide dismutase activity in the roots and

leaves of maize depending on growth conditions
Catalase activity. The observations made in the maize plants show the action of the
enzymatic activity of catalase added to the solution to increase (Fig. 3). Thus, there is an increase
in catalase activity in leaves compared with the control. Significant differences were recorded in
DDW variants (103%) and M1 (122%). In case of the root it was observed a decrease in the
enzymatic activity for the plants developed in the variants DDW and DDW + M1, and a slight
increase in M2 and M1 variants plants.
10
1
Root
0,9 Leaves
uM H2O2/g protein/min
0,8
0,7
0,6
0,5
0,4
0,3
0,2
0,1
0
Figure 3 - Variation of catalase activity in the roots and leaves of

maize depending on growth conditions
CONCLUSIONS
It was found that the total protein concentration is the same for all experimental variants. By
analyzing the enzymatic activity of peroxidase in the roots of maize plants, we found that it is
reduced in the presence of deuterium depleted water and extract obtained from the spruce bark.
Compared to the control an increase in peroxidase activity in the leaves of maize plants were
developed in the presence of deuterium depleted water mixed with polyphenolic extract from
spruce bark. The observations made in the maize plant for the enzymatic activity of catalase,
showing the action of the solutions added to the growth medium. Thus, there is an increased
activity of catalase in leaves compared with control in the presence of deuterium depleted water
and spruce bark polyphenolic extract. At the root is a decrease in the enzymatic activity of
catalase variants DDW and DDW + M1 and its slight increase in M2 and M1 variants plants.
REFERENCES
Anghel N., 2004, Contributions to the chemical modification of polyphenolic products for obtaining biologically active
compounds. PhD thesis, Technical University "Gheorghe Asachi" Iasi, Faculty of Industrial Chemistry, 64-131.
Bradford K., Nonogaki H., 2007, Seed Development, dormancy and Germination, Blackwell Publishing Ltd, Oxford, UK.
Cachia-Cosma D., Deliu C., Rakosy-Tican L., Ardelean A., 2004, Tratat de biotehnologie vegetal. Vol I, Ed. Dacia,
Cluj-Napoca, 103-105.
Dhindsa, R.H., R. Plumb-Dhindsa and T.A. Thorpe: Leaf senescence correlatedwith increased level of membrane
permeability, lipid peroxidation and decreased level of SOD and CAT. J. Exp. Bot., 32, 93-101 (1981)
Sinha, A.K. "Colorimetric Assay of Catalase". Analytical Biochemistry 47, 389-394 (1972)
Tanase C., Volf I., Vintu S., Grdinaru R., Popa I. V., 2013, Potential applications of wastes from energy and forestry
industry in plant tissue culture, Cell. Chem. Tech. Vol. 47, 7-8, 553-563.
Tudose I., 2002, Dynamic accumulation of polyphenolic compounds in Vitis vinifera and some aspects of their bioactive
properties. PhD Thesis, Univ. "Gh Asachi "Iasi, Faculty of Industrial Chemistry, 136-160.
11
1
Gheorghe Asachi Technical University, Faculty of Chemical Engineering and Environmental Protection, 73 Prof.
Dr. Doc. Dimitrie Mangeron Street, 700050, Iasi, Romania
2
Al. I. Cuza University, Faculty of Biology, Vegetal Biology Department, Bulevardul Carol I, Nr. 11, 700506, Iasi,
Romania,
* tanase.corneliu@yahoo.com
12
THE INFLUENCE OF THE CONSERVATION PERIOD ON THE

ACTIVITY OF MYCOLOGICAL FLORA ON ZEA MAYS SEEDS FROM
SUCEAVA GENEBANKS COLLECTION
DIANA BATR RUSU1*
Keywords: micromycetes, CGA medium, blotting paper

Abstract: The purposes of the study were to establish the influence of the conservation period on the activity of
micromycetes placed on stored seeds and to settle the influence of the substrate type - CGA medium (potato - dextrose -
agar) and blotting paper - on the development of fungal pathogens.
This study consisted in a phytopathological evaluation of epiphyte and endophyte mycological flora which appeared on
Zea mays seeds placed on two types of substrates (CGA medium and blotting paper). The 30 populations of corn
resulted from the active collection of Suceava Genebank and conserved for different time intervals (8 and 17 years), in
controlled atmosphere storages (T=+40C; relative air humidity = 30 - 40%).
Seeds studied, placed on CGA medium and blotting paper substrate, after incubation, showed a different degree of
infection by fungal pathogens, depending on the type of substrate and the age of seeds.
Micromycetes were evaluated by counting the infected seeds and the attack frequency was expressed as a percentage, by
visual estimation of seeds surface.
The conservation period influenced fungal pathogens longevity, meaning that the more its higher, the level of infection
is reduced.
On CGA medium, compared with blotting paper substrate, after incubation period, was isolated a greater diversity of
fungal pathogens.
The experimental results of this study answered the following objectives:
- identification of fungal microorganisms according to storage period of seeds;
- identification of fungal genera depending on the type of substrate used;
- setting of correlations between micromycetes identified evolution, seed storage periods and the type of substrate
used.
INTRODUCTION
The transmission of fungal pathogens by seeds has always been the most rapidly spreading of diseases from one
region to another and therefore its need to know the symptoms, the biology and mode of transmission of pathogens, for
once reported to be ensured effectively preventing and fighting them (Baker K.F., 1966).
Generally, the correlation between inoculum (spores load/seed) and colony size (the amount of mycelium)
developed on CGA medium (potato - dextrose - agar) is very significant.
Viability of inoculum seed - borne is in some cases directly related to interspace, harvesting - storage - analysis.
Some fungal pathogens are present and can be found in high percentages in freshly harvested seeds, but their infection
its reducing significantly after one year of storage (Hulea, A., Negru, Al., Severin, V. 1973).
Micromycetes existing on stored cereals seeds can cause during storage a wide range of changes, with negative
consequences from a technological, nutritional, hygienic and commercial point of view (Nagy, E., Trif, V., 1998).
Beratlief and collaborators, in a study concerning the deposit ecosystem characteristics, revealed the mycological
flora evolution and sequence on cereals seeds stored with high moisture content (Beratlief, C., Oprea, M. 1994).
The purposes of this study are:
- to establish the influence of the conservation period on the activity of micromycetes placed on stored seeds;
- to settle the influence of the substrate type - CGA medium (potato - dextrose - agar) and blotting paper - on the
development of fungal pathogens;
- to establish the complementary action of identified micromycetes on Zea mays seeds in two storage periods, by
determining the correlation coefficients between the action of fungal pathogens identified on the samples taken in
study.
13
Diana Batr - Rusu The influence of the conservation period on the activity of mycological flora on Zea mays seeds
from Suceava Genebanks collection
It was performed the phytopathological characterization of local germplasm represented by 30 populations of

Zea mays, conserved for 8 and 17 years at T = +4C, which come from collecting expeditions realized by the collecting
department from Suceava Genebank during a term of 10 years (1993-2010).
Lab experiments were carried on Suceava Genebank by using the genetic seminal material from the active
collection of the institution, which was placed on the CGA medium and blotting paper.
To make possible the assessment of the micromycetes present on Zea mays seeds, It was implemented the
following research methods :
- macroscopic analyses of the seeds;
- Ulster method (Malone, J.P., Muskett, A.E., 1941) on CGA medium (potato - dextrose - agar).
Interpretation of results concerning identified micromycetes evolutions on corns seeds taken in study was
achieved by analyzing correlations and regressions accordingly with experimental factors (Ceapoiu, N., 1968).
The seeds of Zea mays, placed on CGA medium and blotting paper, presented after the
incubation period the following characteristics concerning the presence of fungal
microorganisms:
a) CGA medium (potato - dextrose - agar)

On CGA medium, the presence of deposit mycoflora on the 30 samples of Zea mays
seeds conserved at +4 0C temperature, for 8 and 17 years was different, as follows:
On the samples stored for 8 years at +4 0C temperature, we identified 9 fungal
pathogens (Penicillium sp., Aspergillus sp., Rhizopus sp., Mucor sp., Cladosporium herbarum,
Alternaria alternata, Trichothecium roseum, Fusarium moniliforme, Oedocephalum sp.) which
showed a different attack degree on each sample of the 5 analyzed, registering an infection rate
of 75 % (112 infected seeds of 150 analyzed) (table 1).
On 25 samples stored at +40C temperature, for a period of 17 years we identified 9
fungal pathogens (Penicillium sp., Aspergillus sp., Rhizopus sp., Mucor sp., Cladosporium
herbarum, Alternaria alternata, Trichothecium roseum, Fusarium moniliforme, Chaetomium
sp.). The 750 seeds submitted to macroscopic and microscopic analysis presented an infection
rate of 59 %, being infected 443 seeds. In these storage conditions, the species Oedocephalum
sp. not expressed at all.
Table 1. Proportion of micromycets isolated on Zea mays seeds placed on CGA

medium
Seeds stored at T + 40C, Seeds stored at T + 40C,

Experimental conditions for 8 years for 17 years
Isolated micromycets
Attack frequency (%)
Penicillium sp. 32 20,5

Aspergillus sp.
4 3,1
Rhizopus sp. 11,3 23,2
Mucor sp. 4 2
14
Seeds stored at T + 40C, Seeds stored at T + 40C,

Experimental conditions for 8 years for 17 years
Cladosporium herbarium 2 1,5

Alternaria alternata 2 1,5
Trichothecium roseum 2 1,1
Chaetomium sp. 0 1,5
Fusarium moniliforme 14,6 4,8
Oedocephalum sp. 2,6 0
TOTAL 74,5 59,2
Proportion of micromycets isolated on 30 seeds samples of Zea mays placed on CGA medium
stored at + 4 0C temperature for 8 and 17 years is represented in figure 1:
100%
80%
60%
40%
20%
0%
SVGB-11265
SVGB-11267
SVGB-11255
SVGB-13769
SVGB-13797
SVGB-7249
SVGB-7902
SVGB-3714
SVGB-3773
SVGB-1667
SVGB-1685
SVGB-3553
SVGB-1660
SVGB-1629
SVGB-1789
SVGB-1695
SVGB-1658
SVGB-3681
SVGB-3611
SVGB-1600
SVGB-5191
SVGB-1226
SVGB-3829
SVGB-5397
SVGB-5465
SVGB-5220
SVGB-1627
SVGB-1594
SVGB-1654
SVGB-1784
+ 40C - 8 ani + 40C - 17 ani
Penicillium sp. Aspergillus sp Rhizopus sp. Mucor sp. Cladosporium herbarum

Alternaria alternata Trichothecium roseum Chaetomium sp. Fusarium moniliforme Oedocephalum sp.
Fig.1. Infection percentages of fungal pathogens isolated on Zea mays seeds placed on
CGA medium in controlled atmosphere conditions
b) blotting paper
For emphasing the role of substrate used for analysis of micromycetes occuring on Zea
mays seeds after different periods of storage, we used also blotting paper substrate.
Analyzing the 30 seed samples of Zea mays stored at +40C temperature for 8 and 17 years
it was identified the following infection percentages caused by fungal pathogens.
On the samples stored for 8 years at +40C temperature was identified 5 fungal pathogens
(Penicillium sp,. Rhizopus sp., Aspergillus sp., Cladosporium herbarum, Alternaria alternata,)
15
which had a different attack degree on each sample of the 5 analyzed registering an infection rate
of 20,4 % (table 2).
On 25 samples conserved at +40C temperature for a period of 17 years it was identified 6
fungal pathogens (Penicillium sp., Aspergillus sp., Rhizopus sp., Cladosporium herbarum,
Alternaria alternata, Trichothecium roseum). The 1250 seeds submitted to macroscopic and
microscopic analysis presented an infection rate of 9,12 %.
Table 2. Proportion of micromycets isolated on Zea mays seeds placed on blotting paper
Seeds stored at Seeds stored at T + 40C,
Experimental conditions T + 40C, for 17 years
for 8 years
Isolated micromycets Attack frequency (%)

Penicillium sp. 8,4 2,8
Aspergillus sp. 2,4 0,7
Rhizopus sp. 3,2 3,6
Cladosporium herbarium 2 0,9
Alternaria alternata 4,4 0,7
Trichothecium roseum 0 0,4
TOTAL 20,4 9,1
Proportion of micromycets isolated on 30 seeds samples of Zea mays placed on blotting

paper stored at + 4 0C temperature for 8 and 17 years is represented in figure 2:
100%
80%
60%
40%
20%
0%
SVGB-11265
SVGB-11267
SVGB-11255
SVGB-13769
SVGB-13797
SVGB-7249
SVGB-7902
SVGB-3714
SVGB-3773
SVGB-1667
SVGB-1685
SVGB-3553
SVGB-1660
SVGB-1629
SVGB-1789
SVGB-1695
SVGB-1658
SVGB-3681
SVGB-3611
SVGB-1600
SVGB-5191
SVGB-1226
SVGB-3829
SVGB-5397
SVGB-5465
SVGB-5220
SVGB-1627
SVGB-1594
SVGB-1654
SVGB-1784
+ 40C - 8 ani + 40C - 17 ani
Penicillium sp. Aspergillus sp. Rhizopus sp.

Cladosporium herbarum Alternaria alternata Trichothecium roseum
Fig.2. Infection percentages of fungal pathogens isolated on Zea mays seeds placed on
blotting paper in controlled atmosphere conditions
16
For establishment complementary action of micromycetes identified on Zea mays seeds

in two storage periods (8 and 17 years), it was determined correlation coefficients between fungal
pathogens action identified on samples taken in study.
In the analyzed samples of Zea mays, the results from the table related a lower number
of statistical correlations in both storage periods.
After 8 years of storage of Zea mays seeds at +4C temperature, its noticed that there is
no one significant positive correlation between micromycetes action (table 3).
Table 3. Correlation coefficients between micromycets action identified on Zea mays samples
stored at +4C, for 8 years
Trichothecium roseum
Caracterele corelate
Alternaria alterrnata
Oedocephalum sp.
Penicillium sp.
Aspergillus sp.
Cladosporium
moniliiforme
Rhizopus sp.
Mucor sp.
Fusarium
herbarum
Penicillium sp. 1
Aspergillus sp. 0.485822 1
Rhizopus sp. -0.50563 -0.59789 1
0.57209
Mucor sp. -0.81918 -0.4901 9 1
Cladosporium 0.30012
herbarum -0.38361 3 -0.43579 -0.10206 1
0.72886
Alternaria alternata 0.206558 9 -0.43579 -0.61237 0.6875 1
0.61237
Trichothecium roseum -0.45246 -0.08575 -0.29052 2 0.25 -0.375 1
0.18049 0.30942 -
Fusarium moniliiforme 0.353052 -0.19458 -0.21857 -0.71583 9 6 0.56728 1
0.34299
Oedocephalum sp. -0.15738 7 -0.29052 -0.40825 0.875 0.875 -0.25 0.46414 1
After 17 years of storage of Zea mays seeds at +4C temperature, there is only two
significant positive correlation between fungal pathogens action Mucor sp. x Aspergillus sp. and
Cladosporium herbarum x Penicillium sp. (table 4).
17
Table 4. Correlation coefficients between micromycets action identified on Zea mays samples
stored at +4C temperature, for 17 years
Trichothecium roseum
Caracterele corelate
Alternaria alternata
Chaetomium sp.
Penicillium sp.
Aspergillus sp.
Cladosporium
Rhizopus sp.
moniliforme
Mucor sp.
Fusarium
herbarum
Penicillium sp. 1
-
Aspergillus sp.
0.28225 1
- -
Rhizopus sp.
0.22519 0.13888 1
- 0.53386 -
Mucor sp.
0.24304 * 0.11112 1
Cladosporium 0.58568 - -
herbarum * 0.08949 0.40892 0.07932 1
- - - - -
Alternaria alternata
0.00921 0.21802 0.14088 0.24396 0.12164 1
-
Trichothecium roseum - - 0.23368 0.20170 - 0.1853
0.17687 0.10722 1 9 0.27657 4 1
- -
Chaetomium sp. - 0.18085 - - 0.1854 0.1602
0.08823 6 0.05727 0.21671 0.17026 3 8 1
- - -
Fusarium moniliforme - - 0.16336 - 0.00281 0.1291 0.2254 0.161
0.06373 0.16521 4 0.30488 5 1 9 5 1
CONCLUSIONS
Deposit mycoflora developed on corn seeds taken in this study was analyzed according to
genotype period of seed conservation and type of substrate used.
From this study resulted the following conclusions :
The seeds samples of Zea mays stored in 2 experimental conditions placed on CGA
medium, were infected in different proportions by fungal pathogens. The species Oedocephalum
sp. was identified only on the samples conserved for 8 years at + 40C temperature and
Chaetomium sp. was detected only on the samples conserved for 17 years.
By placing the same seed samples of Zea mays in 2 experimental conditions on blotting
paper, we observed that samples were infected in a smaller proportion compared to CGA
medium. The fungal pathogens Mucor sp., Fusarium moniliforme, Oedocephalum sp.,
Chaetomium sp. identified on CGA medium were not isolated on blotting paper.
Zea mays seeds stored for 17 years at +4C temperature presented an additional infections
with the species Chaetomium sp.
In all storage conditions, after 8 and 17 years storage of Zea mays seeds at +4C
temperature, there is a strong attack of Penicillium sp., Rhizopus sp, Aspergillus sp.
The fungal pathogens Alternaria alternata and Cladosporium herbarum were detected in
18
all storage conditions, on a lower number of samples and also the infection degree was observed
in a small number of seeds.
After 17 years of storage of Zea mays seeds at +4C temperature, there are two strong
attack between Mucor sp. x Aspergillus sp. and also between Cladosporium herbarum x
Penicillium sp. being a very significant correlation between the action of these fungal pathogens.
REFERENCES
Baker K.F., (1966). Dynamics of seed transmission of plant pathogens. Ann. Rev. Phytopathol.. 4. 311
Beratlief, C., Oprea, M. (1994), Ecosystem characteristics of agricultural products storages and health
implication, Plant Protection issues, Bucharest, 13, 22, 44
Ceapoiu, N., (1968), Statistical methods applied in agricultural and biological experiments, Agro-Forestry
Publishing, Bucharest
Hulea, A., Negru, Al., Severin, V. (1973), Main Seed Crop Diseases, Ceres Publishing, Bucharest, 35-70
Malone, J.P., Muskett, A.E., (1941), The Ulster method for the examination of flax seed for the presence of seed
borne parasites, Annals Appl. Biol.. 8-13, 28
Nagy, E., Trif, V., (1998), Research regarding prevention and control of seed borne diseases at cereals in terms of
Transylvania, Plant Protection issues, Bucharest, 26, 48-53
1
Banca de Resurse Genetice Vegetale Suceava
* dia_sv@yahoo.com
19
20
THE INFLUENCE OF SOME STORAGE CONDITIONS UPON

ASCORBIC ACID CONTENT IN WHITE AND RED CABBAGE
MARCEL AVRAMIUC1*
Keywords: ascorbic acid, cabbage, oxygen, pH, storage, temperature.

Abstract: In this work it has searched the influence of storage conditions upon ascorbic acid content in cabbage. The
ascorbic acid content and pH evolution for 16 weeks has been carried out using, as biological material, cabbage samples
from two varieties: white cabbage (Brassica oleracea var. capitata L. f. alba DC.) and red cabbage (Brassica oleracea var.
capitata L. f. rubra (L.) Thell). The cabbage samples were kept in containers of glass and wood, constituting, for each
sample, variants of experiences, in the presence and in the absence of oxygen, at following thermal thresholds: 4C, 8C
and 15C. The ascorbic acid content of cabbages was determined through a method based on reduction by the ascorbic
acid of 2.6-Dichlorphenol-indophenol (2.6-DCFIF) to the corresponding leucoderivate. The investigations have been
carried out on freshly harvested material (week 0) and then every two weeks, for a total of 16 weeks. Compared to fresh
harvested cabbage, at the end of the analysed interval (after 16 weeks of storage), the ascorbic acid content has registered
different rates of diminution in the both varieties, depending on storage temperature, on storage length, and on variety.
The ascorbic acid in white cabbage has registered losses, compared to red variety, so much the bigger as the temperature
was higher and the storage duration was longer.
INTRODUCTION
The risk of cancer and cardiovascular illnesses can be reduced by consumption of fruit and vegetables, rich in
antioxidant compounds such as: vitamins C and E, carotenoids and phenolic compounds (Corts et al., 2007; Block et al.,
2001; Burns et al., 2003; Gardner et al., 2000; John et al., 2002; Snchez-Moreno et al., 2003).
The storage conditions can influence the level of vitamines in some raw material causing, sometimes, significant
decrease in the concentration of these biocompounds within finished product (Banu et al., 2003).
According to Ball (2006), drying methods, exposing the food to air lead to the loss of vitamin C because of
oxidation. But, the freeze drying, which is carried out in the absence of oxygen, does not cause loss of vitamin C.
The loss of acid ascorbic is fast in the early stage of fruits juice storage, coincides with the consumption of
dissolved oxygen, and then becomes gradual (Zerdin et al., 2003; Ball, 2006).
The concentration of ascorbic acid decreases during storage, depending on storage conditions, such as temperature,
oxygen content and light (Alwazeer et al, 2003; Blasco et al., 2004; Del Caro et al., 2003; . Esteve et al., 1995; Murata et
al., 2002; Polydera et al., 2003; Torregrosa et al., 2006; Zerdin et al., 2003; Corts et al., 2007).
In this paper it has studied the influence of temperature and storage length upon ascorbic acid content in white and
red cabbage.
In this paper, the biological material was represented by two types of cabbage (white and red), coming from a
small vegetable farm around Suceava town, selected to meet the quality parameters necessary to storage, such as: well
made, with a head weight between 0.7-1.5 kg, no damage and no attack by insects or parasites, clean, odorless and taste.
Fresh raw material was analyzed, determining the pH (6.95 in white cabbage, and 7.15 in red cabbage), and the
content of ascorbic acid (34.7 mg % in white cabbage, and 56.2 mg % in red cabbage).
It has studied the evolution of ascorbic acid content and pH during 16 weeks. The both cabbage types were kept in
containers of glass and wood, constituting, for each sample, variants of experiences, in the presence and in the absence of
oxygen, at following thermal thresholds: 4C, 8C and 15C.
In order to keep the samples in the presence of oxygen, they were placed in wooden boxes. To store cabbages in an
oxygen-free environment, it used glass containers where the samples were introduced along with a small candle lit, and
then the lid of the container was tightly closed. The extinguish of the candle has confirmed that the oxygen in the
container was used.
The chemical investigations have been carried out on freshly harvested material (week 0) and then every two
weeks, for a total of 16 weeks.
The ascorbic acid content of cabbages was determined through a method based on reduction by the ascorbic acid of
2.6-Dichlorphenol-indophenol (2.6-DCFIF) to the corresponding leucoderivate (Artenie and Tnase, 1980; Indyk and
Konings, 2000).
21
Marcel Avramiuc The influence of some storage conditions upon ascorbic acid content in white and red cabbage
The pH values were determined with a digital pH-meter type Hanna.

Four replicates for each determination represented the data of experiments, which were statistically processed, the
analysis of variance being used to calculate differences between results. The differences at p < 0.05 were considered
significant.
Table 1 plays the ascorbic acid and pH values during storage of white cabbage samples
under certain conditions.
Table 2. Ascorbic acid and pH values in white cabbage

Determination Ascorbic acid (mg/100g) pH
Storage T=4C T=8C T=15C
temperature
Test variants +O2 * O2** +O2* O2** +O2* O2** +O2*
Week 0 34. 7 6.95
Week II 34.70 33.70 30.58 32.60 25.85 25.85 -
Week IV 31.50 32.64 29.00 31.50 22.70 20.74 6.82
Week VI 30.65 31.75 27.10 31.50 20.35 19.30 -
Week VIII 27.60 31.60 24.50 30.33 18.30 18.76 6.50
Week X 26.85 30.33 23.00 28.00 17.95 18.20 -
Week XII 24.40 26.80 22.80 24.16 15.30 17.45 6.43
Week XIV 22.90 24.20 18.15 21.30 13.04 15.44 -
Week XVI 21.34 23.86 17.15 20.70 9.73 14.60 6.10
+O2 *=storage in the presence of oxygen; O2** =storage in the absence of oxygen
As seen in the Table 1, at temperature of 4C in the presence of oxygen, the ascorbic

acid content in white cabbage has recorded different decreases, depending on storage length.
Thus, the greatest reductions of acid ascorbic concentration were registered between
weeks VI-VIII (10%), followed by weeks II-IV (9.23%), and X-XII (9.13%). At the same
temperature of storage, but in the absence of oxygen, the greatest reduction in the content of
ascorbic acid was between weeks X-XII (11.64%), followed by XII-XIV (9.71%), and VIII-X
(4,02%).
At the end of the analysed interval (after 16 weeks of storage) the ascorbic acid content
has decreased by 38.5%, compared to the blank (week 0), in white cabbage stored at 4C in the
presence of oxygen, and by 31.3%, compared to blank, in white cabbage kept at the same
temperature, but in the absence of oxygen.
At temperature of 8C, in the presence of oxygen, the largest reduction of ascorbic acid
content was within the range XII-XIV weeks (20.4%), followed by ranges 0-II (11,88%), and VI-
VIII weeks (9.6%). At temperature of 8C, but in the absence of oxygen, the biggest reductions
of the ascorbic acid content were within the interval X-XII weeks (13.72%), followed by interval
XII-XIV weeks (11.04%) and VIII-X weeks (7.69%).
At the end of the analysed interval (after 16 weeks of storage) the ascorbic acid content
has decreased by 50.6%, compared to the blank (week 0), in cabbage stored at 8C in the
presence of oxygen, and by 40.4%, compared to the blank, in cabbage kept, at the same
temperature, but in the absence of oxygen.
22
At temperature of 15C, in the presence of oxygen, the greatest reduction of the ascorbic
acid content was in the range 0-II weeks (25.51%), followed, in order, by the range XIV-XVI
(25.39%) and the ranges X-XII weeks (14.77%) and II-IV weeks (12.19%). At the same
temperature, but in the absence of oxygen, the biggest reductions in the levels of ascorbic acid
content were within intervals 0-II weeks (25.51%), II-IV weeks (19.77%) and XII-XIV weeks
(11.52%).
At the end (after 16 weeks of storage), the ascorbic acid content has decreased by 72%,
compared to the blank (week 0), in white cabbage stored at 15C, in the presence of oxygen, and
by 58%, compared to the blank, in white cabbage kept, at the same temperature, but in the
absence of oxygen.
In the Table 2 are reproduced the ascorbic acid and pH values of red cabbage samples
during storage.
Table 2. Ascorbic acid and pH values in red cabbage

Determination Ascorbic acid (mg/100g) pH
Storage T=4C T=8C T=15C
temperature
Test variants +O2 * O2** +O2* O2** +O2* O2** +O2*
Week 0 56.2 7.15
Week II 54.20 54.00 51.80 52,60 45.45 46.60 -
Week IV 51.40 53.40 49.10 48.50 42.00 44.92 7.15
Week VI 49.24 51.80 47.20 46.80 37.30 43.10 -
Week VIII 47.08 48.56 43.60 44.80 36.90 39.20 7.10
Week X 47.08 47.20 44.20 44.20 34.75 38.50 -
Week XII 45.90 45.90 42.00 43.15 32.40 37.45 6.89
Week XIV 42.20 44.20 39.30 41.25 30.50 37.05 -
Week XVI 38.60 41.30 33.50 40.10 28.42 36.60 6.70
+O2 *=storage in the presence of oxygen; O2** =storage in the absence of oxygen
As seen in the Table 2, at temperature of 4C in the presence of oxygen, the ascorbic

acid content in red cabbage has recorded different decreases, depending on storage length.
Thus, the greatest reductions of acid ascorbic values were registered between weeks XIV-
XVI (8.54%), followed by weeks XII-XIV (8.07%), and II-IV (5.17%). At the same temperature of
storage, but in the absence of oxygen, the greatest reduction of the ascorbic acid content was
between weeks VI-VIII and XIV-XVI (over 6.2%), followed by 0-II (4%), and IV-VI (3%).
After 16 weeks of storage, the ascorbic acid content has decreased by 31.3%, compared
to the blank (week 0), in red cabbage stored at 4C in the presence of oxygen, and by 26.5%,
compared to blank, in red cabbage kept at the same temperature, but in the absence of oxygen.
At temperature of 8C, in the presence of oxygen, the largest reduction of ascorbic acid
content was within the range XIV-XVI weeks (14.76%), followed by ranges 0-II and VI-VIII
(over 7.6%), and XII-VIV weeks (6.43%). At temperature of 8C, but in the absence of oxygen,
the biggest reductions of the ascorbic acid content were between weeks II-IV (7.8%), followed
by interval 0-II weeks (6.41%), and VI-VIII and XII-XIV weeks (over 4.3%).
23
After 16 weeks of storage, the ascorbic acid content has decreased by 40.4%, compared to
the blank (week 0), in red cabbage stored at 8C in the presence of oxygen, and by 28.7%,
compared to the blank, in red cabbage kept, at the same temperature, but in the absence of oxygen.
At temperature of 15C, in the presence of oxygen, the greatest reduction of the ascorbic acid
content was in the range 0-II weeks (19.13%), followed, in order, by the range IV-VI (11.2%) and the
ranges II-IV weeks (7.6%) and X-XII and XIV-XVI weeks (over 6.7%). At the same temperature, but
in the absence of oxygen, the biggest reductions in the levels of ascorbic acid content were within
intervals 0-II weeks (17.1%), VI-VIII weeks (9.05%) and IV-VI weeks (4.06%).
After 16 weeks of storage, the ascorbic acid content has decreased by 49.4%, compared to
the blank (week 0), in red cabbage stored at 15C, in the presence of oxygen, and by 36.8%,
compared to the blank, in red cabbage kept, at the same temperature, but in the absence of oxygen.
The pH of the white cabbage has recorded a variable diminution during storage (Tab. 1,
Fig. 1). Thus, in the range 0-IV weeks the pH decreased by 1.88% (0.13 units), within IV-VII
weeks by 4.7% (0.32 units), within VIII-XII weeks by 1.08% (0.07 units), and within XII-XVI
weeks by 5.14% (0.33 units). After 16 weeks of storage, the pH of white cabbage has decreased
by 12.24% (0.85 units), compared to fresh raw material.
Like in white variety, the pH of red cabbage has recorded some diminutions during
storage (Tab. 2, Fig. 1). Thus, in the range 0-IV weeks of storage the pH has not suffered any
change, compared to the blank sample (fresh raw material). Between IV-VIII weeks the pH has
decreased by 0.7% (0.05 units), between VIII-XII weeks by 3% (0.21 units), and between XII-
XVI weeks by 2.76% (0.19 units). After 16 weeks of storage, the pH of red cabbage has
decreased by 6.3% (0.45 units), compared to fresh raw material.
Week 0
7
6.8
6.6
6.4
6.2
Week XVI 6 Week IV
5.8
5.6
5.4
Week XII Week VIII
pH of white cabbage pH of red cabbage
Fig. 1. The comparative evolution of pH values in white

and red cabbage, depending on storage time
In the table 3 there are reproduced the r2 values for correlations between ascorbic acid
contents and storage lengths.
Table 3. Correlations between ascorbic acid contents at 4,8 and 15C, and storage lengths
Storage 4C (+O2) 4C (O2) 8C(+O2) 8C(O2) 15C(+O2) 15C(O2)
temperature
r2 WC 0.9853 0.9251 0.9748 0.9358 0.9035 0.7659
r2 RC 0.9650 0.9871 0.9555 0.9324 0.8862 0.8175
24
WC = white cabbage; RC = red cabbage; +O2 = storage in presence of oxygen; O2 =storage in absence
of oxygen
As seen from Table 3, the biggest r2 values were, both in white and in red cabbage, at
4C and 8C (in presence of oxygen) and at 4C in red cabbage (in absence of oxygen). The
lowest values of r2 were at 15C in the both varieties (in absence of oxygen).
Analysing and comparing the data in the previous tables, one can see that, both in white
and in red cabbage, the greatest reductions of acid ascorbic content have been in the presence of
oxygen at 15C, followed, in order, by 8C, and by 4C. It also notices that, after 16 weeks of
storage, the acid ascorbic percentage reductions were bigger in white cabbage samples compared
to red ones, in the three intervals and temperature thresholds analysed, as follows:
- at 4C, by 7.2% in the presence of oxygen, and by 4.8% in the absence of oxygen;
- at 8C, by 10.2% in the presence of oxygen, and by 11.7% in the absence of oxygen;
- at 15C, by 22.6% in the presence of oxygen, and by 21.2% in the absence of oxygen.
According to Kennedy et al. (1992), in some juices the decomposition of ascorbic acid
occurs in the presence of dissolved oxygen, being predominantly aerobic, but can continue in the
absence of dissolved oxygen, by an anaerobic pathway, mainly influenced by temperature. The
ascorbic acid is unstable at alkaline pH, and its stability is higher in the pH range 3.04.5 than in
the range 5.07.0 (Borenstein, 1965; Ball, 2006).
In the present paper, both in white and red cabbage before storage (freshly harvested
material) and during storage, the pH values were in the range 7.156.1.
Stored 90 days under house cellar conditions (whose mean temperature values has
decreased from 17.3C to 10.8C), the acid ascorbic content in potato tubers was reduced by over
60% in tubers stored in wooden boxes, and by 20% in tubers stored in tightly closed glass jars
(Avramiuc et al., 2008). Within experiments from this work, 12 weeks of cabbage storage at
15C (84 days) has led to a reduction by 56% in the presence of oxygen, and by 49.8% in the
absence of oxygen, in white variety, and by 42.4% in the presence of oxygen, and by 33.5% in
the absence of oxygen, in red variety.
According to Banu et al. (2003), the addition of anthocians, sugars and even starch
seems to have a protecting action on vitamin C.
Knowing that the red variety contains anthocians, it can explain why the ascorbic acid in
white cabbage has registered losses, compared to red variety, so much the bigger as the
temperature was higher and the storage duration was longer.
CONCLUSIONS
The storage of white and red cabbage under certain conditions of temperature and aeration,
has influenced the content of ascorbic acid.
At the end of the analysed interval (after 16 weeks of storage), the ascorbic acid content has
registered different rates of diminution, depending on storage temperature and length, as well as
on variety (anthocians presence).
In white cabbage samples, the greatest decrease of ascorbic acid content has registered after
16 weeks of storage at 15C: by 72% (compared to the blank - week 0) in cabbage stored in the
presence of oxygen, and by 58% in cabbage kept in the absence of oxygen.
In red cabbage samples the greatest decrease of ascorbic acid content has registered after 16
weeks of storage at 15C: by 49.4% (compared to the blank - week 0) in cabbage stored in the
presence of oxygen, and by 36.8% in cabbage kept in the absence of oxygen.
25
The ascorbic acid in white cabbage has registered losses, compared to red variety, so
much the bigger as the temperature was higher and the storage duration was longer.
REFERENCES
Alwazeer D., Delbeau C., Divies C., Cachon R., 2003 - Int J Food Microbiol 89:2129
Artenie V., Tnase E, 1980 - Practicum de biochimie general. Centrul de Multiplicare al Universitii Al. I. Cuza Iai.
Avramiuc M., Frti L., Herghelegiu Ioana, 2008 - The ascorbic acid content variation in potato tubers, during storage
under house cellar conditions. Cercetri Agronomice n Moldova, Vol. XLI, No. 4 (136), 2008
Ball G.F.M., 2006 - Vitamins in Foods, Analysis, Bioavailability, and Stability. CRC Press, Taylor & Francis Group
6000, Broken Sound Parkway NW, Suite 300, Boca Raton, FL 33487-2742, p. 292-305
Banu C., Iordan M., Nour V, Mustea G., 2003 - The processing of raw materials and the loss of biologically active
substances. Ed. TEHNICA UTM. Chiinu, p. 91-93
Blasco R., Esteve M.J., Frgola A., Rodrigo M., 2004 - Lebens Wissen Technol 37:171175
Block G., Norkus E., Hudes M., Mandel S., Helzlsouer K., 2001 - Am J Epidemiol 154:11131118
Borenstein, B., The comparative properties of ascorbic acid and erythorbic acid, Food Technol., 19 (11), 115, 1965
Burns J, Frase P.D., Bramley P.M., 2003 - Phytochem 62:939947
Corts Clara , Esteve J. Mara, Frgola Ana, 2007 - Effect of refrigerated storage on ascorbic acid content of orange juice
treated by pulsed electric fields and thermal pasteurization, European Food Research and TechnologyZeitschrift fr
Lebensmittel- Untersuchung und -Forschung A Springer-Verlag 200710.1007/s00217-007-0766-x Original Paper
Del Caro A., Piga A., Vacca V., Agabbio M., 2003 - Food Chem 84:99105
Esteve M.J., Farr R., Frgola A., 1995 - J Agric Food Chem 43:20582061
Gardner P.T., White T.A.C., McPhail D.B., Duthie G.G., 2000 - Food Chem 68:471474
Indyk, H. and Konings, E., Eds, 2000 - Official Methods of Analysis of AOAC International, 17th ed., AOAC
International, Gaithersburg, MD, p. 45-60
John J.H., Ziebland S., Yudkin P., Roe L.S., Neil Haw, 2002 - Lancet 359:19691974
Kennedy, J.F., Rivera, Z.S., Lloyd, L.L., Warner, F.P., and Jumel, K., 1992 - L-Ascorbic acid stability in aseptically
processed orange juice in TetraBrik cartons and the effect of oxygen, Food Chem., 45, 327
Murata M., Shinoda Y., Homma S., 2002 - Int Congr Ser 1245:459460
Polydera A.C., Stoforos N.G., Taoukis .PS., 2003 - J Food Eng 60:2129
Snchez-Moreno C., Plaza L, de Ancos B., Cano P., 2003 - J Sci Food Agric 83:430439
Torregrosa F., Esteve M.J., Frgola A., Corts C., 2006 - J Food Eng 73:339345
Zerdin K., Rooney M.L., Vermu J., 2003 - Food Chem 82:387395
1. Faculty of Food Engineering, Stefan cel Mare University of Suceava

* avramiucm@fia.usv.ro
26
THE ACTIVITY OF CYTOLYSIS ENZYMES

IN ACUTE CORONARY SYNDROMES
LAURA-IULIANA VASILE1, 2*, EUGEN UNGUREANU1, VLAD ARTENIE1
Keywords: acute coronary syndrome (ACS), lactate dehydrogenase, aminotransferases, creatine kinase, gamma-
glutamyltranspeptidase.
Abstract: The determination of enzyme activity in the organisms humours or in different tissues is an important means
of detecting and following the evolution of numerous pathological states. In our study we have determined the activity of
some cytolysis enzymes (lactate dehydrogenase, LDH; alanine-aminotransferase or glutamic-pyruvic transaminase, GPT;
aspartate aminotransferase or glutamic-oxaloacetic transaminase, GOT ; creatine kinase, CK and gamma-
glutamyltranspeptidase, GGT) on patients with acute coronary syndromes : angina pectoris (AP), chronic painful
ischemic heart disease (CPIHD), arterial hypertension (HTN), arterial hypertension with chronic painful ischemic heart
disease (HTN+CPIHD) and acute myocardial infarction (AMI). The results show that the levels of activity of cytolysis
enzymes are different in patients with acute coronary syndromes (ACS). The activity of LDH, GPT, GOT, CK and GGT
do not have the same values for one and the same coronary disease measured in patients from different groups of age and
sexes (male and female).
INTRODUCTION
The data gathered form medical literature show that acute coronary syndromes [ angina pectoris(AP), chronic
painful ischemic heart disease (CPIHD), arterial hypertension (HTN), arterial hypertension with chronic painful
ischemic heart disease (HTN+CPIHD) and acute myocardial infarction (AMI) ] are currently in third place for cause of
death.
The metabolic changes that are specific for acute coronary syndromes (ACS) are reflected in the activity of
different enzymes, such as lactate dehydrogenose ( E 1.1.1.27, LDH ), alanin-aminotransferase or glutamic-pyruvic
transaminase ( EC 2.6.1.2 , GPT ), aspartate aminotransferase or glutamic oxaloacetic transaminase ( EC 2.6.1.1, GOT ),
creatine kinase or creatine phosphokinase ( EC 2.7.3.2, CK ) and gamma-glutamyltranspeptidase or gamma-
glutamyltransferase ( EC 2.3.2.2, GGT ).
Lactate Dehydrogenose (LDH) is a cytoplasmatic enzyme which participates in the anaerobe glycolysis and
catalyzes the interconversion of lactic acid in pyruvic acid [ Selwood et al., 2011 ]. LDH is a marker of tissue damage.
LDHs activity is higher in striated muscles, the liver, the myocardium, kidneys and lymph nodes and lower in the
pancreas, erythrocytes and lungs. LDH can be separated through electrophoresis in 5 fractions which contain a different
proportion from the two types of monomers, H (heart) and M (muscle) :LDH1 ( H4 ) - LDH5 ( M4 ).
L-Alanine 2-oxoglutarate aminotransferase (alanine transaminase or glutamic-pyruvic transaminase, GPT)
is found in larger quantities in the cytoplasm of hepatic cells and in smaller quantities in the myocardium, the kidneys and
pancreas. The variations of the enzymes activity are important for the hepatic pathology [ Popescu i colab., 1991].
L-Aspartate-2-oxoglutarate aminotransferase (aspartate aminotransferase or glutamic-oxaloacetic
transaminase, GOT) is found in the liver, myocardium and striated muscles. In kidneys, the pancreas, lungs and
erythrocytes it is found in smaller quantities.
Creatine kinase (CK) catalyses the transfer of phosphate from phospho-creatine to adenosine diphosphate.
CK is found as three different isoenzymes: MM, BB and MB. In cases of myocardial necrosis, the levels of CK-MB go
up in 4-6 hours, reaching its peak at 24 hrs. The elevation recurs earlier with the reperfusion of the myocardium with
thrombolytics, angioplasty or spontaneous lysis. CK levels stay elevated for 2-3 days. CK can be elevated in other
pathological states, heart interventions, myocarditis, muscular trauma and others. There is a link between the levels of
CK-MB in the plasma and myocardial necrosis. It is effective in the diagnostication of non Q-AMI and in AMI with Q
waves, for prognosis and duration. Dosing CK can differentiate unstable angina, whether it is normal or elevated by non
Q-AMI [ Carp,2003 ]. Because the most elevated CK level is after 24 hours and it persists two days, the dosage of
myoglobin which rises early on in blood and urine can be useful. After this period, it is necesary to determinate the
activity of lactate dehydrogenase(LDH). LDH can be found as the isoenzymesLDH1 i LDH2 ( H3M1 ). The first of these
isoenzymes, reaches the highest level in AMI after 72 hours and it stays elevated for 7-10 days. The elevated input in
favour of LDH1 is an indicator of AMI [ Carp, 2003 ].
Although elevated levels of LDH1 and CK-MB are more common in AMI, lately cardiac troponins ( cTn ), T (
cTnT ) and I (cTnI) are being given much more attention. Cardiac troponins have a regulator role in the muscle
contraction of the cardiac muscle. The rise of these troponins has a specific value as a prognosis and diagnostic in AMI.
The rise of cTnT and cTnI is considered as a new golden standard in the diagnostic of myocardial necrosis [ Hamm et
27
Laura-Iuliana Vasile et al The activity of cytolysis enzymes in acute coronary syndromes
al.., 1997 ]. The rise of cTnT and cTnI in AMI appears in 3-4 hours and it lasts up to 3-4 weeks [ Antman et al.,
1996 ]. There is a moderated rise of cTnT or cTnI in unstable angina, in about 20-40% of the patients. For those who did
not have elevated levels of CK-MB, it shows a great sensibility [ Lindahl, 1996 ].
In our studies, modifications of the cardiac troponin I (cTnI) concentration appeared based on the sex and age
of the patients with myocardial infarction [ Vasile et al., 2012 ].
Gamma-glutamyltransferase (GGT) can be found in the liver, kidneys, pancreas and the prostate. GGT is
the most sensitive marker for alcoholism, being the enzyme which elevated levels exceed the others hepatic
enzymescurent [ Leschke, 2008 ]. GGT is a biomarker fordiseases of the liver, biliary system, and pancreas and also
alcohol ingestion.The rising mechanisms of this serum enzyme vary [ Deac i colab., 2010 ]. More data show that the
enzyme participates in the pathophysiologic mechanisms of some affections: acute cardiovascular syndromes,
hyperglycemia, metabolic syndrome, inflammatory diseases, malignanttumour. In these cases, risen GGT is due to
oxidative stress[ Emdin et al., 2002 ].
The aim of our study is to highlight the variations in the activity of some cytolysis enzymes ( LDH, GPT,
GOT, CK and GGT) sampled from the blood of patients with different ages and sexes, suffering from acute coronary
syndromes : angina pectoris ( AP ), acute myocardial infarction ( AMI), chronic painful ischemic heart disease (CPIHD),
arterial hypertension ( HTN ) and arterial hypertension with chronic painful ischemic heart disease (HTN+CPIHD).
The biochemical investigations were performed in the Medical Analysis Laboratory from the Bacau County
Hospital on a number of 925 subject, from 2008 to 2012 years. The subjects were grouped by sexes and in the following
age groups:
Group I : 21-35 years ;
Group II : 36-50 years ;
Group III: 51-65 years and
Group IV: >65 years.
In the blood sampled from this studys subjects, we determined the activities of the 5 mentioned cytolysis
enzymes ( LDH, GPT, GOT, CK and GGT), using a automatic biochemical analyserCobas Integra 400 Plus-Germany.
The determination of enzymes activities were achieved with chemical agents kits, acquired through Roche Romania
company for Cobas Integra 400 Plus.
The trial data acquired were statistically processed with the help of Student test [ Vleanu i colab., 1990 ].
RESULTS AND DISCUSSION
From the total of 925 patients (male and female), 122 (13%) were patients diagnosed
with angina pectoris, 155 (17%) had AMI, 102 (11%) patients with chronic painful ischemic
heart disease; 376 (41%) had arterial hypertension ( HTN ) and 170(18%) suffered from arterial
hypertension with chronic painful ischemic heart disease. For every syndrome, the patients were
distributed on sexes (female-F and male-M) and age group as show in Table 1.
Table 1 The distribution of patients on sexes (female-F and male-M) and age group for the 5
coronary syndromes.
Acute coronary AGE GROUPS

syndromes 21-35 years 36-50 years 51-65 years >65 years
925 patients F M F M F M F M
Angina pectoris( AP ) n 0 4 7 8 49 50 2 2
122 de patients
AMI n 0 5 2 19 25 78 8 18
155 de patients
CPIHD n 0 0 6 12 33 35 9 7
28
102 de patients
HTN n 4 0 46 30 107 125 38 26
376 de patients
HTN associated with n 0 0 16 13 44 80 7 10
CPIHD
170 patients
The trial data acquired by us show that the activities of the 5 cytolysis enzymes ( LDH,
GPT, GOT, CK and GGT), have varied levels in female and male subjects from the same age
group, as well as from a syndrome to another.
From fig. 1 it can be determined that the activity of LDH is between 229,5 U/L on
female patients from the age group 21-35 years with HTN and 387,5 U/L on female patients from
the age group 36-50 years, diagnosed with AMI. For men, LDH activity varies from 229,5 U/L
for 21-35 years age group suffering from angina pectoris ( AP ) and 359,1 U/L on patients <65
years age group suffering from HTN associated with CPIHD. We mention that the referential
value for LDH activity is 130-225 U/L.
Comparing the numbers of the LDH activity in female patients with male patients, it is
determined that LDH activity passes the superior referential limit (225 U/L) on females
diagnosed with CPIHD (age group >65 years), HTN+CPIHD (age group >65 years), angina
pectoris (age group 36-50 years) and CPIHD (age group 36-50 years). For males the levels pass
on patients with HTN+CPIHD (age group 36-50 years ), CPIHD ( age group >65 years),
AMI(age group 21-35 years) and CPIHD (age group 51-65 years).
Fig. 1. LDH activity (U/L) ( the average and standard error - ES ) on female
and male patients diagnosed with coronary syndromes.
29
Entire unspecific LDH elevated levels can be found in myocardial infarction, acute viral
hepatitis, pernicious anaemia, neoplastic states, acute leukosis [ Mihele, 1997 ].
From the data in fig. 2 it is obvious that aspartate aminotransferase (GOT) activity
passes the superior referential value (0-38 U/L) in cases of female patients with AMI (age group
>65 years and 51-65 years) and with CPIHD (age group >65 years). In males, elevated levels can
be found in patients suffering from AMI (age groups >65 years, 36-50 years, 21-35 years and 51-
65 years) and HTN (age group 51-65 years).
As pathological variations, elevated leveles cand be found in myocardial infraction in
the first 24-48 hours, with annealing in the first 4 up to 6 days, as well as in hepatopathy and
hemolytic states [ Mihele, 1997 ].
Fig. 2. GOT activity(U/L) on male and female patients diagnosed with

coronary syndromes.
Alanine transaminase activity (GTP), shown in fig. 3, has slightly elevated values
above the superior referential one (0-41 U/L) in females with AMI (age group 51-65 years),
angina pectoris (age group 51-65 years) and HTN (age group 36-50 years). Found also for males
with angina pectoris (age group 36-50 years), with AMI (age group 21-35 years) and
HTN+CPIHD (age group >65 years)
30
Fig. 3. GPT activity(U/L) on male and female patients diagnosed with

coronary syndromes.
Creatine kinase levels raise in myocardial infraction [ Lindahl, 1996 ; Carp, 2003 ].
But, our data show that CK activity does not pass the superior referential value (0-190 U/L) for
both female and male patients (fig 4).
Fig. 4. CK activity (U/L) on male and female patients diagnosed with

coronary syndrome.
31
More epidemiological observations come to support the bond between the activity of
gamma-glutamyltransferase(GGT) and general death, death caused by cardiovascular events
and death caused by hyperglycemia, mentioning the implication of oxidative stress in the
pathological mechanisms [ Emdin et al., 2005 ; Paolicchi et al., 2004].
For healthy people the GGT activity varies from 3-61 U/L. According to our results,
shown in fig.5, it can be seen that the GGT activity does not pass the superior referential values
for females. On the other hand, on males the GGT activity passes the superior referential values
for patients with CPIHD (age group >65 years and 51-65 years), with HTN+CPIHD (age group
51-65 years and 36-50 years), with angina pectoris (36-50 years), with AMI (21-35 years) and
with CPIHD (age group 36-50 years)
Fig. 5. GGT activity (U/L) on male and female patients diagnosed with
coronary syndrome
Based on the results shown in fig.5, we can say that the GGT activity is higher for males
diagnosed with acute coronary syndromes than females who suffer from the same coronary
affections.
CONCLUSIONS
Our research highlighted different levels of cytolysis enzymes on patients with acute
coronary syndromes (angina pectoris, AMI, HTN, HTN associated with CPIHD and CPIHD )
hospitalized in Bacau County Hospital, in the time period 2008-2012
32
The activities of LDH, GPT, GOT, CK and GGT have different values in females
diagnosed with acute coronary syndromes, compared to the enzymes values in males suffering
from the same coronary syndromes.
On patients from the same sex, the LDH, GPT, GOT, CK and GGT activities have
different values from a age group to another, in the case of every coronary syndrome studied.
REFERENCES
Antman E. M., Tanasijevic M.J., Thompson B., Schactman M., McCabe C.H., Cannon C.P., Fischer G.A., Fung A.Y.,
Thompson C., Wybenga D., Braunwald E., 1996 - Cardiac-specific troponin I levels to predict the risk of mortality in
patients with acute coronary syndromes. N Engl J Med,335 (18):1342-1349
Carp Costin, Tratat de Cardiologie, Vol. II, Editura Medical Naional, Bucureti, 2003, p. 259
Deac M., Mihil R. G.,2010 - Gamma-glutamiltranspeptidaza-indicator diagnostic dar i enzim implicat n patologie,
Medicin intern, Vol. VII, nr. 3, 39-41
Emdin M., Passiono C., Donato L., Paolicchi A., Pompella A., 2002 - Serum gamma-glutamyltransferase as a risk factor
of ischemic stroke might be independent of alcohol consumption. Stroke, 33:1163-1164.
Emdin M., Pompella A., Paolicchi A., 2005 - Gamma-glutamyltransferase-atherosclerosis and cardiovascular disease:
triggering oxidative stress within the plaque, Circulation, 112 (14): 2078-2080.
Hamm C. W., Goldmann B.U., Heeschen C., Kreymann G., Berger J., Meinertz T., 1997 - Emergency room triage of
patients with acute chest pain by means of rapid testing for cardiac troponin T or troponin I. N. Engl. J. Med., 337 (23)
:1648-1653.
Leschke M., 2008 - Leber und Herz: Kardiale Interactionen bei Leberkrankungen. XII Gastroeneterologie-
Seminarwoche., Titisee, 98-99.
Lindahl B., 1996 - Biochemical markers of myocardial damage forearly diagnosis and prognosis in patients with acute
coronary syndromes. Minireview based on a doctorial thesis, Upsala Journal of Medical Sciences, Vol. 101, No. 3: 193
232
Mihele Denisa, - Biochimie clinic.Compendiu, Editura Medical, Bucureti, 1997, p. 105.
Paolicchi A., Emdin M., Ghliozeni E., Ciancia E., Passino C., Popoff G., Pompella A., 2004 - Images in cardiovascular
medicine. Human atherosclerotic plaques contain gamma-glutamyltranspeptidase enzyme activity, Circutation, 109(11) :
1440.
Popescu Aurora, Zamfirescu-Gheorghiu Marcela - Tratat de Biochimie medicali, Vol.II, Editura Medical, Bucureti,
1991, pp. 67-68, 80-84, 110.
Selwood T., Jaffe E. K., 2011 - Dynamic dissociating homo-oligomers and the control of protein function". Archives of
Biochemistry and Biophysics 519 (2): 13143.
Vleanu I.,Hncu M., Elemente de statistic general, Editura Litera, Bucureti, 1990, pp. 25, 66-71, 74.
Vasile Laura, Artenie Vlad, Lazr Iuliana Mihaela, 2012 The risk of myocardial infarction revealed by variation of
cardiac troponin I levels with age and gender: a case study in the Bacau County, Environmental Engineering and
Management Journal, Vol.11, No. 12, pp. 2285-2292.
1
Alexandru Ioan Cuza University, Iai
2
Bacau County Hospital, Romania
2*
vasilelauraiuliana@yahoo.com
33
34
BREAST CANCER AND THE HISTOPATHOLOGIC TYPE

CASE STUDIES
EDUARD CRAUCIUC1*, DIANA POPOVICI1, MARIANA BRATU2,
OVIDIU TOMA3, DRAGO CRAUCIUC1
Keywords: breast cancer, carcinoma, mastectomy

Abstract. The early detection of breast neoplasia, using mammography as a screening method, is important because it is
capable to change the natural progression of the disease and it allows the conservative surgery, leading to a decrease of
the mortality by breast cancer. There are 3 study cases presented here, women aged 48, 56 and 64 years old respectively,
diagnosed with breast cancer by mammography in Elena Doamna Clinical Hospital of Obstetrics Gynecology Iai. The
diagnostic was confirmed anatomo-pathologically. Invasive ductal carcinoma can be found in all ages; invasive lobular
carcinoma shows an increase in the incidence over the age of 55, and carcinomatous mastitis is frequent for the patients
over 60 years old. Here are the main risk factors for breast neoplasia: obesity, late menopause, lack of breast-feeding,
early menarche and breast neoplasia in the family history. Radical surgical treatment is a first-line therapy, the post-
operatory evolution being favourable regardless of age.
INTRODUCTION
Breast cancer represents the most frequent neoplasia for women. Age is one of the most important risk factors for breast
cancer. The risk of developing breast cancer is less than 0.5% for a woman under 40 years old, but this risk is over 20
times higher for women over 60 years old (Cobbs et al 1998, Johnston et al 1998, Wallis 1998).
The early detection of breast neoplasia by using the mammography as a screening method would reduce the stage of
breast neoplasia considerably in the moment of its diagnosing. Mortality by breast cancer 10 years after the diagnostic
was set would be reduced with 25-30%. Unfortunately, even in the developed countries, screening by mammography in
breast cancer is poor for the elderly. In USA over 50% of the women aged over 60 years old have never had a
mammography (Faulk et al 1995, Tabar et al 2002).
Mammography, as a unique exploratory screening method, cannot diagnose about 10-15% of breast cancers (Nystrom et
al 2002, Olsen et al 2001, Vartej et al 2001).
The American Geriatric Association recommends mammography and the clinical examination of the breast as screening
methods that have to be performed every year up to the age of 75; after this age it is recommended that mammography
should be performed every 2 years, and the clinical examination of the breast every year (Am Ger Soc 2002, Balducci et
al 2004).
The objective of this study was to determine breast cancer is the main oncologic cause of death for the feminine gender.
The early detection of breast neoplasia, using mammography as a screening method, is important because it is capable to
change the natural progression of the disease and it allows the conservative surgery, leading to a decrease of the mortality
by breast cancer.
After we had studied the cases from Elena Doamna Clinical Hospital of Obstetrics Gynecology Iai, in the period of
time between 2012 and 2013, we chose 3 patients aged 48, 56 and 64 respectively. They had been diagnosed with breast
cancer after having a mammography followed by the histo-pathologic examination of the resected sample, so they could
be presented as case studies for the malignant pathology of the breast. The surgical treatment of the breast neoplasia has
the same indications, regardless of the patients age, but the doctors have to be extremely careful with the existent co-
morbidities when it comes to geriatric age (cardiovascular, respiratory, metabolic problems etc).
Surgical treatment of first choice is preferred to the hormone treatment that used to be recommended for the women over
60 years old with breast tumours that are still in surgical stage, with positive hormone receptors (Costachescu et al 2007).
35
Eduard Crauciuc et al Breast cancer and the histopathologic type case studies
RESULTS
Case 1. Invasive ductal carcinoma.

(Collection of Elena Doamna Hospital Iai - Anatomopathologic Laboratory)
Female F.B. aged 48, coming from the countryside

Associated pathology: stadium III high blood pressure and type 2 diabetes
Risk factors: IIIrd grade obesity, early menarche
Heredocolateral history: mother breast neoplasia
Hormone treatment: estrogen-progestogen on a period of time longer than 5 years
Surgical treatment: Pattey modified radical mastectomy - with axillary lymphadenectomy will be
performed.
Post-operatory complications: subcutaneous hematoma that did not require another surgical
procedure and fluid and electrolyte imbalance.
Days of hospitalization: 14
Chemotherapy: in the absence of major contraindications, chemotherapy is well tolerated, the
incidence of acute complications (alopecia, nausea, vomiting) being low.
Evolution: favourable after 6 months.
Case 2. Invasive lobular carcinoma.

Female A.M. aged 56, coming from the countryside

Associated pathology: atrophic cervicitis - vaginitis
Risk factors: IInd degree obesity, early menarche, nulliparous
Hormone treatment: estrogenic derivatives on a period of time of 3 years
Surgical treatment: Madden radical mastectomy with axillary lymphadenectomy will be
performed.
36
Post-operatory complications: discrete lymphedema of the arm

Evolution: favourable after 6 months.
Case 3. Carcinomatous mastitis.

Female T.C. aged 64, coming from the urban area

Associated pathology: high blood pressure, cervico-vaginal inflammatory pathology,
varicose legs.
Risk factors: lack of breast-feeding, late menopause
Surgical treatment: apply simple cleaning mastectomy.
Post-operatory complications: labile hypertension appeared 3 days after the surgery and d
fluid and electrolyte imbalance
Evolution: favourable when leaving the hospital.
DISCUSSIONS
Invasive ductal carcinoma is the most common breast cancer about 80% of the total breast
cancers. It invades the skin and spreads towards the lymph nodes. It is sometimes called
infiltrating ductal carcinoma; the terminvasive shows the fact that cancer cells have spread in
the breast tissues around.
Invasive lobular carcinoma, also called infiltrating lobular carcinoma, is the second on the list of
the most widely spread types of cancer, after the invasive ductal carcinoma. Although the
invasive lobular carcinoma can affect women of any age, it is most often met in older women.
According to the American Cancer Society, about two thirds of the women diagnosed with this
type of cancer are over 55 years old. some studies suggested that the use of hormone replacement
therapy during or after menopause can increase the risk of developing invasive lobular carcinoma
(Am Ger Soc 2002, Balducci 2004, Miron et al 2012).
Cervico-vaginal inflammatory pathology appeared on an atrophic background and also cardio-
vascular diseases are the most frequent pathologies that are associated with breast cancer that
appears over the age of 55 (Miron et al 2012).
Obesity, as a risk factor for most gynecological neoplasias, is frequently associated with breast
pathology. Obesity is associated with an increase of mortality and morbidity, in general, for older
37
Eduard Crauciuc et al Breast cancer and the histopathologic type case studies
women with a body mass index over 29 kg/m2, and the risk of developing breast cancer increases
with 20-40% for these women. The mechanism by which obesity increases the risk of breast
neoplasia is the increase in the storage of adipose tissue estrogen precursors (Balducci 2004,
Muss et al 2004).
The prognostic for the patients with breast cancer who received hormone replacement therapy is
good. The explanation consists in the fact that this therapy causes the appearance of some forms
that are highly differentiated histologically, with a net response that is more favourable to therapy
than the forms with a low degree of differentiation (Balducci 2004, Chlebowski et al 2003).
The decompensation of pre-existing medical pathology, especially the cardiovascular diseases, is
more frequent in for older patients and needs complex clinical evaluations and an intensive and
early treatment (Costachescu et al 2007).
CONCLUSIONS
Breast cancer represents the most frequent malignant condition for the women in the developed
countries and it is the second cause of mortality for the women over 60 years old.
Surgical treatment, when there are no other severe co-morbidities and when the stage of the
disease allows it, remains the main therapeutic sequence, as the age factor does not forbid its
application.
REFERENCES
American Geriatrics Society. Geriatric Review Syllabus (2002). 5th ed. Malden, Mass: Blackwell Publishing.
Balducci L, Lyman GH, Ershler WB et al (2004). eds. Comprehensive Geriatric Oncology , 2nd ed. Philadelphia,
Lippincott Williams and Wilkins.
Chlebowski RT, Hendrix SL, Langer RD et al (2003). Influence of estrogen plus progestin on breast cancer and
mammography in healthy postmenopausal women: the Womens Health Initiative Randomized Trial. JAMA; 289:3243-
3253.
Cobbs EL, Ralapati AN (1998). Health of older women. Med Clin North Am;82:127-144.
Costachescu Gh, Costachescu G, Popovici R (2007). Patologia tumorala a sistemului reproductiv feminin. Al II-lea
Congres National de Menopauza si Anti-ageing Bucuresti.
Faulk RM, Sickels EA, Sollitto RA et al (1995). Clinical efficacy of mammographic screening in the
elderly. Radiology;194:193-197.
Johnston SC, Pfeifer MP (1998). End-of-Life Study Group. Patient and physician roles in end-of-life decision
making. J Gen Intern Med;13:43-45.
Miron L, Marinica M (2012). Oncologie generala, ed. II.
Muss HB, Longo DL (2004), eds. Cancer in the elderly. Semin Oncol;31:125-296.
Nystrom L, Andersson I, Bjurstam N et al (2002). Long-term effects of mammography screening: updated overview of
the Swedish randomised trials. Lancet;359:909-919.
Olsen O, Gotzsche PC (2001). Cochrane review on screening for breast cancer with mammography
[letter]. Lancet;358:1340-1342.
Tabar L, Smith RA, Duffy SW (2002). Update on effects of screening mammography [letter]. Lancet.;360:337.
Vartej Petrache (2001). Ginecologia, ed. All.
Wallis LA (1998), ed. Textbook of Womens Health. Philadelphia, Pa: Lippincott-Raven Publishers :43-51 (Galindo DJ,
Ciocon JO), 87-92 (Welner SL), 93-96 (Geissler LJ, Braucht GN), 125-132 (Romans SE), 161-166 (Wallis LA), 175-184
(Galindo DJ, Mintzer MJ).
1
Gr.T.Popa University of Medicine and Pharmacy, Iasi, Romania, Elena Doamna Iai Clinical Hospital
2
Emergency Hospital Sf. Apostol Andrei Galai
3
Alexandru Ioan Cuza University, Iai, Romania
* crauciuc@yahoo.com
38
PREVALENCE OF GROIN LYMPH NODES METASTASES IN

CLINICALLY STAGES IB AND II CANCER OF THE VULVA
MIHAI EMIL CPLNA1*, SIMONA CRISTINA RUSU1, JANOS BECSI1,
MONICA ANDRA COSTEANEDELCU1, CLAUDIU ION PUIAC2, BELLA SZABO1,
EDUARD CRAUCIUC3, OVIDIU TOMA4, DRAGO CRAUCIUC3
Keywords: vulva cancer, lymphadenectomy, radiotherapy

Abstract. Sixteen patients with IB-II FIGO stages vulvar cancer with no clinically and imagistic evidence of nodes
metatases were operated during a 34 months period (January 2011-October 2013). The surgical procedures consisted in
radical vulvectomy plus uni- (2 patients) or bilateral (14 patients) inguino-femoral lymphadenectomy (depending on the
primary lesion localization). The final pathological result was squamous carcinoma in 15 patients and carcinosarcoma in
one. The prevalence of positive lymph nodes was 43.7%, (between 1 and 5 positive nodes per groin). The median number
of harvested lymph nodes was 12.6 per groin (between 4 and 27). Ten patients developed some wound complications
(infections, dehiscence, lymphocele etc.), but all were solved. At the present time, 14 patients are alive and with no
evidence of disease, one died of disease and one had a groin relapse and followed radiotherapy. The prevalence of groin
metastases in stages IB-II vulvar cancer is high. A thorough inguino-femural dissection seems necessary, despite the high
incidence of wound complications.
INTRODUCTION
Vulvar cancer is a rare disease with an incidence of 2 per 100,000 women per year (1). It is the fourth most common
gynecologic malignancy in USA (Milam et al 2012). The most frequent histologic subtype is squamous cell cancer with a
frequency of 70% (Hacker 2004). A clinical staging system was used until 1988. The recognition of the importance of
pathologic lymph node status for survival and the inability to predict lymph node status accurately by physical
examination urged the International Federation of Gynecology and Obstetrics (FIGO) in 1989 and later in 2009 to convert
the staging system into a surgical pathologic system (Pecorelli 2009, Mutch 2009). Based on this staging system,
approximately 40% of patients have stage III/IV disease at first presentation (Hopkins et al 1992, Fons et al 2009).The
presence of nodal involvement was introduced into stage III or IV. Stage III entails tumors of any size with positive
inguino-femoral lymph nodes. Stage IVA entails both patients with tumor which invades other regional structures (2/3
upper urethra, 2/3 upper vagina), bladder mucosa, rectal mucosa, or fixed to pelvic bone, or with fixed or ulcerated
inguino-femoral lymph nodes. Stage IVB includes any distant metastasis including pelvic lymph nodes (Pecorelli 2009,
Mutch 2009). The aim of the current study was, first, to analyze the prevalence of inguino-femoral lymph nodes
metastases in clinically early stages of vulva cancer. Second was to evaluate the morbidity of groin and vulva surgery and
to determine the benefit of the radical surgery in the sentinel node concept era for this type of cancer.
Objective. We analyzed the prevalence of inguino-femoral lymph nodes metastases in clinically early stages of vulvar
cancer.
The databases of the First Clinic of Obstetrics and Gynecology, University of Medicine and Pharmacy Targu-Mures,
Romania, were reviewed retrospectively.
Sixteen patients with IB-II FIGO stages vulva cancer with no clinical or imagistic (ultrasound or computed-tomography
scan) evidence of nodes metatases were treated in our clinic during a 34 months period (January 2011-October 2013). The
surgical procedures consisted in radical vulvectomy plus uni- (2 patients) or bilateral (14 patients) inguino-femoral
lymphadenectomy (depending on the primary lesion localization), by the well-known three incisions technique. In 2
patients we performed also a distal urethral resection (10-15 mm), in 7 a partial colpectomy and in one a unilateral
extraperitoneal pelvic lymphadenectomy. Because of a large perineal defect, a V-flap unilateral (in one patient) or
bilateral (in 3) vulva reconstruction was performed.
39
Mihai Emil Cplna et al Prevalence of groin lymph nodes metastases in clinically stages IB and II cancer of the vulva
Fig. 1. Bilateral "V-flap" vulva reconstruction. Fig. 2. Bilateral "V-flap" vulva reconstruction.
Intraoperative aspect. Postoperative aspect.
RESULTS
Patients age was between 42 and 74 years old (median 62.3).

The final pathological result was squamous carcinoma in 15 patients and carcinosarcoma in one.
The median number of harvested lymph nodes was 12.6 per groin (between 4 and 27). Positive
lymph nodes were found in 7 out of 16 patients (43.7%). The number of positive nodes varied
between 1 and 5 per groin, and the metastases were present bilaterally in 3 patients and
unilaterally in 4. These 7 patients were up-staged because of positive inguino-femoral lymph
nodes as follows: 5 in stage IIIA, one in stage IIIB and one in stage IIIC because of extracapsular
spread. All these patients received adjuvant pelvic radiotherapy.
Ten (62.5%) patients developed some inguinal and/or perineal wound complications (infections,
dehiscence, lymphocele etc.), which necessitate re-suturing, but all were solved. The
hospitalization was quite long for all patients; they were discharged home after 11 to 47 days
(median 22). At the present time, 14 patients are alive and with no evidence of disease, but the
follow-up period is short; one died of disease and one had a groin relapse and followed salvage
radiochemotherapy, but her condition is critical.
DISCUSSION
The most important prognostic factor in vulvar cancer is the status of the groin lymph nodes (1).
Patients with negative nodes have a 5-year survival of about 90%, while for patients with positive
nodes, survival falls significantly to 2960%(Hacker 2004, Hyde et al 2002, Van der Valden et al
1995, Van der Valden et al 1996).
Raspagliesi (2006) considered that lymph node status and nodal features, such as extracapsular
spread and nodal replacement rate, were shown to be independent prognostic factors. These
factors should be considered to identify high risk patients and in planning further adjuvant
therapy.
Similar conclusions resulted from Fons et al. study (Fons et al 2009), who showed that bilateral
presence of lymph node metastases is not an independent factor for survival when the number of
lymph node metastases is taken into account. The presence of extracapsular growth is the single,
poorest prognostic marker of lymph node metastases.
Within the group of patients with positive nodes, the number of involved nodes, the diameter of
the largest metastatic deposit, and the presence or absence of extracapsular spread are all of
40
prognostic significance. Patients with palpably enlarged, positive groin nodes are a particularly
high-risk group, because of the large volume of metastatic carcinoma present, and the greater
degree of extracapsular nodal involvement. Such patients are also at increased risk of having
positive pelvic nodes (Hyde et al 2007).
Complete inguinal-femoral lymphadenectomy is associated with a high incidence of lymphocele
formation and wound complications. Also, a frequent late complication is lymphedema, and its
incidence is further increased with the addition of postoperative groin irradiation. In our study, in
16 patients with IB-II FIGO stages vulva cancer with no clinical or imagistic evidence of nodes
metatases, we found a high incidence of groin lymph nodes metastases (43.7%). These 7 patients
were up-staged and received adjuvant radiotherapy. Regarding the important prognostic value of
positive lymph nodes for staging and future therapies, we consider mandatory a thorough groin
dissection, including both inguinal and femoral lymph channels. For these tumours larger then 2
cm, the sentinel node concept is not applicable.
CONCLUSIONS
The prevalence of groin metastases in stages IB-II vulvar cancer is high. A thorough inguino-
femural dissection seems necessary, despite the high incidence of wound complications.
REFERENCES
Fons G, Hyde SE; Buist MR et al (2009). Prognostic value of bilateral positive nodes in squamous cell cancer of the
vulva. Int J of Gynecol Cancer. 19(7):1276-1280.
Hacker NF (2004). Vulvar cancer. In: Berek JS, Hacker NF, eds. Practical Gynecologic Oncology. 3rd ed. Philadelphia,
PA: Lippincott Williams & Wilkins; p. 543-582.
Hopkins MP, Reid GC, Johnston CM, et al (1992). A comparison of staging systems for squamous cell carcinoma of
the vulva. Gynecol Oncol.;47:34-37.
Hyde SE, Ansink AC, Burger MP et al (2002). The impact of performance status on survival in patients of 80 years and
older with vulvar cancer. Gynecol Oncol;84:38893.
Hyde SE, Valmadre S, Hacker NF et al (2007). Squamous cell carcinoma of the vulva with bulky positive groin
nodesnodal debulking versus full groin dissection prior to radiation therapy. Int J Gynecol Cancer; 17, 154158.
Milam M, Levenback CF (2012). Vulvar cancer. In: Karlan BY, Bristow RE, Li AJ. Gynecologic Oncology. Clinical
Practice & Surgical Atlas. The Mc Graw Hill Companies; p. 173-186.
Mutch DG (2009). The New FIGO staging system for cancers of the vulva, cervix, endometrium, and sarcomas. Gynecol
Oncol; 115:325-328.
Pecorelli S (2009). Revised FIGO staging for carcinoma of the vulva, cervix, and endometrium. Int J Gynaecol Obstet,
105(2):103-4.
Raspagliesi F, Hanozet F, Ditto A, et al (2006). Clinical and pathological prognostic factors in squamous cell carcinoma
of the vulva. Gynecol Oncol;102:333-337.
Van der Velden J, Hacker NF (1996). Prognostic factors in squamous cell cancer of the vulva and the implications for
treatment. Curr Opin Obstet Gynecol 1996;8:37.
Van der Velden J, van Lindert AC, Lammes FB et al (1995). Extracapsular growth of lymph node metastases in
squamous cell carcinoma of the vulva. The impact on recurrence and survival. Cancer;75:288590.
1
First Clinic of Obstetrics and Gynecology, University of Medicine and Pharmacy Targu-Mures, Romania
2
Clinic of Anesthesiology and Intensive Care, University of Medicine and Pharmacy Targu-Mures, Romania
3
Gr.T.Popa University of Medicine and Pharmacy, Iasi, Romania, Elena Doamna Iai Clinical Hospital
4
Alexandru Ioan Cuza University, Iasi, Romania
mcapilna@gmail.com
41
42
Constantin Toma
Review on GOGU GHIORGHI - Moartea celular programat i mecanismele ei
Editura Academiei Oamenilor de tiin, Bucureti, 2012
La nceputul anului 2013 a aprut n Editura At the beginning of 2013 there was published
Academiei Oamenilor de tiin din Romnia o (courtesy of the Romanian Academy of Scientists
carte cu un titlu extrem de incitant i actual Publishing House) a book with a very exciting and
Moartea celular programat i mecanismele ei, up-to-date title: Programmed Cell Death and its
semnat de profesorul Gogu Ghiorghi. Cartea se Mechanisms, written by professor Gogu
ntinde pe 202 pagini, este structurat pe 11 capitole, Ghiorghi. The book comprises 202 pages, it is
din care 2 introductive, 7 dedicate apoptozei structured on 11 chapters, among which two
moartea celular programat (MCP) la animale i intoductory chapters, 7 subunits describing
om, un capitol mare alocat morii celulare apoptosis programmed cell death (PCD) in
programate la plante i un capitol special n care animals and in humans, a large chapter on
autorul face o paralel ntre MCP la animale i programmed cell death in plants, and a special
plante. Lucrarea este nsoit de un glosar de termeni chapter in which the author comparatively has
specifici, de o bibliografie la zi selectiv (cu peste uncovered the PCD in animals and plants. This
200 de titluri) i de un rezumat amplu (12 pagini) n scientific book includes a glossary of terms, an
limba englez. updated selective reference list (of more than 200
Dei fenomenul de dispariie a unor celule prin titles), and a large summary (of 12 pages) written in
moarte natural, n cursul dezvoltrii organismelor, English.
a fost semnalat nc din a doua jumtate a secolului Although the process of natural cell death during
al XIX-lea, el a primit confirmare de abia n urma ontogenesis was signaled since mid 19th century, it
experienelor efectuate ntre 1965-1972 de ctre was confirmed as a consequence of the experiments
KERR i colaboratorii si pe ficatul de obolan i a effected by KERR and collaborators on rat liver
fost acceptat ca modalitate distinct i important de between 1965 and 1972, and was considered a
moarte celular programat la animale n 1999, cnd distinct and major method of programmed cell death
HORVITZ a publicat rezultatele studiilor lui de in animals in 1999, when HORVITZ published the
acest gen pe nematodul Caenorhabditis elegans. results of his studies effected on the nemotode
Spre deosebire de necroza celular, care este un Caenorhabditis elegans. Opposite to the cell
proces pasiv i o form patologic de moarte necrosis, that is a passive process and a pathological
celular, apoptoza este un fenomen fiziologic form of cell death, the apoptosis is a normal, active
normal, activ, prin care un organism pluricelular physiological phenomenon, by means of which a
elimin unele celule nedorite, realizndu-i n acest multicellular organism eliminates some unwanted
fel homeostazia celular. Este un fenomen complex, cells, achieving cell homeostasy. It is a complex
prezent att n procese fiziologice normale, ct i n phenomenon, present both in normal, and in
procese patologice. Mai mult, apoptoza celular este pathological processes. Furthermore, the apoptosis
controlat genetic, dereglarea ei n sensul reducerii is under genetic regulation; its alteration (either by
sau intensificrii, ducnd la stri patologice. n diminishing or intensifying this process) triggers
lucrare sunt prezentate modificrile morfologice i pathological states. This book displays all the
biochimice celulare prezente n apoptoz, factorii biochemical and morphological cell alterations
care o induc i inhib, mecanismele ei moleculare present in apoptosis, the inducing and inhibitory
(genele, proteinele i enzimele implicate), cile de factors, its molecular mechanisms (genes, proteins,
realizare, reglarea fenomenului, modul cum and enzymes), the paths of achievement, the
acioneaz apoptoza n unele procese fiziologice regulation of this phenomenon, the apoptotic
normale i n unele procese patologice, importana mechanisms in some normal physiological
ei etc. processes, and in some pathological processes, its
Interesant este faptul c moartea celular importance etc.
programat joac un rol important i n economia An interesting fact is that programmed cell death
plantelor, fiind prezent din momentul germinrii plays an important role in plant turnover, as it is
seminelor i pn la maturarea i senescena present since seed germination until plant maturity
43
plantelor. Dei are unele asemnri cu apoptoza, and senescence. Although it resembles apoptosis,
MCP la plante difer n multe privine, ntruct PCD in plants is different under many aspects, as
plantele nu dispun de un sistem imun, nu conin the plants do not own an immune system, do not
fagocite, iar peretele celular specific lor nu permite contain fagocytes, and their cell wall does not allow
formarea corpilor apoptotici. O alt diferen major the formation of apoptotic bodies. Another major
o reprezint faptul c enzimele cu rol esenial n difference is that the enzymes essential to apoptosis
realizarea apoptozei la animale - caspazele, la plante in animals the caspases, are absent in plants. In
lipsesc. n schimb, plantele sunt echipate cu o serie exchange, plants are equipped with a series of
de proteaze ancestrale implicate n MCP ancestral proteases involved in PCD the
metacaspazele, enzime prezente la toate eucariotele metacaspases enzymes present in all eukaryots
lipsite de caspaze i care execut, alturi de deprived of caspases, that are responsible with
enzimele de procesare vacuolar (VPE), unele caspase-like activities, together with the vacuole
activiti de tip caspazic (caspase-like). Spre processing enzymes (VPE). Despite animals, there
deosebire de animale, la plante par s existe mai appears to be a multitude of operating systems of
multe sisteme operaionale ale MCP, niciunul din PCD, none of which endowed with any traits
aceste sisteme neavnd ns toate trsturile specific to animal apoptosis. The book presents the
specifice apoptozei de la animale. Cartea prezint action of PCD during the vegetative plant growth,
modul cum intervine MCP pe parcursul creterii the reproductive development, in case of plant
vegetative a plantelor, a dezvoltrii lor reproductive, interaction with some factors of the biotic and
n cazul interaciunii dintre plante i unii factori ai abiotic environment, as well.
mediului biotic i abiotic. Although several years ago there were published a
Dei, cu ani n urm, au mai fost publicate n series of papers on apoptosis in Romania, while
Romnia unele lucrri ce vizeaz apoptoza, reading the book authored by professor Ghiorghi I
lecturnd cartea publicat de profesorul Ghiorghi was deeply impressed by his conciseness, the ability
am fost plcut impresionat de capacitatea de sintez to synthesize, by the effort to render available many
a autorului, de concizia sa, de efortul de a face of the knowledge and information to the reader
accesibile cititorului cunotine i informaii extrem (many of which are extremely complex and intricate
de complexe i complicate - cum sunt cele specifice such as the data on apoptosis), by the structure and
apoptozei, de modul cum au fost structurate i display of scientific content in a coherent, logical,
prezentate informaiile - ntr-o nlnuire coerent, convincing linkage. The book bears the authors
logic i convingtoare. Cartea poart amprenta stamp, his capacity to process scientific data; its
autorului, tiina de a prelucra date i informaii, novelty resides in its structure and in the ample
fiind inedit prin modul n care a fost conceput, dar comments on the ways and mechanisms that ensure
i prin aceea c, alturi de apoptoz, sunt amplu the dissolution of many cells in plants (a subject less
comentate i cile i mecanismele care asigur approached and debated in the scientific literature of
dispariia fr urme a unor celule la plante, domeniu our country). I consider that the issue of this
mai puin abordat i discutat n literatura de profil de scientific contribution is more than welcome in the
la noi. Consider c apariia aceastei lucrri este Romanian scientific field, and I warmly recommend
binevenit n peisajul tiinific romnesc i o it to whom it may concern, novices in this domain
recomand clduros tuturor celor ce vor s se (covered by mystery until recently), and also to
introduc n acest domeniu, misterios pn nu master and PhD students, to researchers interested in
demult, dar i masteranzilor, doctoranzilor i this type of approaches. I congratulate the author for
specialitilor care vor s abordeze cercetri de acest this new and intriguing editorial accomplishment,
gen. Felicit autorul pentru aceast nou i wishing him many similar achievements, as exciting
interesant realizare editorial, urndu-i la mai and useful for the specialists-to-be, and to all people
multe asemenea reuite, la fel de incitante i utile interested in the progress of various scientific areas.
pentru cei ce se formeaz ca specialiti, dar i pentru
cei ce urmresc progresele nregistrate ntr-un Professor Constantin Toma, PhD
domeniu sau altul al tiinei. Member of the Romanian Academy
Prof. univ. dr. Constantin Toma
Membru al Academiei Romne
44
Vlad Artenie
Review on GHEORGHE HRINC - Grupele sanguine la ovine
Editura Agata, Botoani, 2012
La sfritul anului 2012, Editura Agata din At the end of 2012, Agata Publishing House of
Botoani a publicat o carte de o valoare tiinific Botosani published a book of great scientific value,
deosebit, purtnd titlul GRUPELE SANGUINE entitled BLOOD GROUPS IN SHEEP. The author
LA OVINE. Autorul acestei cri remarcabile este of this remarkable book is Gheorghe Hrinc, Ph.D.
doctorul n biologie (n principal n biochimie i in Biological Sciences (with concentrations in
genetic), Gheorghe Hrinc, pasionat i perseverent Animal Biochemistry and Genetics), a passionate
cercettor tiinific principal gradul I la Staiunea de and tenacious senior scientific researcher within the
Cercetare-Dezvoltare pentru Creterea Ovinelor i Research and Development Station for Sheep and
Caprinelor Popui din Judeul Botoani. Acest Goat Breeding Popui in Botosani County. This
jude a dat Romniei i lumii numeroase same county has given Romania and the world
personaliti n diverse domenii : social, tiinific i many personalities in various social, scientific, and
cultural. cultural fields.
Sintetiznd rezultatele cercetrilor proprii i Summarizing the results of their own research and
utiliznd o bogat literatura de specialitate conex using a rich specialty literature related to the
cu problematica abordat, dr. Gheorghe Hrinc - questions approached, Ph.D. Gheorghe Hrinc -
cunoscut ca un excelent specialist n genetica, known as a great specialist in the genetics,
imunogenetica, biochimia i fiziologia ovinelor immunogenetics, biochemistry and physiology of
reuete s trateze n aceast apariie editorial, ntr- sheep - succeeds to treat this editorial in an
o manier inteligent i clar, principalele noiuni, intelligent and clear manner, outlining and detailing
concepii, caracteristici definitorii i direcii de the main notions, concepts, defining characteristics
cercetare privind grupele sanguine la ovine. and research directions concerning blood groups in
Cartea, care se ntinde pe 391 pagini, are o sheep.
structur judicioas, dup un plan bine elaborat, The book, which spans 391 pages, is well
cuprinznd mai multe seciuni majore. Textul este organized and has a clear developed plan,
redactat ntr-un stil concis, coerent i fluent, comprising several major sections. The text is
reflectnd o abordare complex, interesant, written in a concise, coherent and fluent style,
competent i analitic a temei propuse de carte, reflecting a complex, interesting, competent and
care este prezentat ntr-un spirit accesibil i cu analytical approach to the proposed themes of the
profesionalism. Grafica beneficiaz de o iconografie book, and is presented in an accessible spirit with
sugestiv ilustrat n 89 de figuri color/alb-negru i professionalism. The text is richly illustrated with
17 tabele. 89 colour or black-and-white figures and 17 tables.
Grupele sanguine la ovine abordeaz i "Blood groups in sheep" approaches and
interpreteaz ntr-o manier modern concepte din interprets, in a modern manner, the concepts of
cele mai diverse domenii ale biologiei teoretice i various fields of theoretical biology and its applied
ale ramurilor ei aplicative: imunologie, biologie branches including immunology, cellular biology,
celular, genetic, biochimie, biofizic, fiziologie genetics, biochemistry, biophysics, normal and
normal i patologic, modelare experimental, pathological physiology, experimental modelling,
zootehnie, medicin veterinar etc. animal husbandry, and veterinary medicine.
Omul i animalele si-au perfectat un complex Humans and animals have evolved a complex
sistem de aprare mpotriva factorilor biotici i defence system to protect them from both biotic and
abiotici din mediul nconjurtor. Acest sistem de abiotic factors in the surrounding environment. This
aprare (sistemul imun) acioneaz la diverse defence system (the immune system) works at
niveluri, ncepnd de la organe i esuturi pn la multiple levels ranging from organs and tissues to
celule i molecule. Reglarea proceselor imune se cells and molecules. The regulation of immunity is
afl sub un control de nalt finee i complexitate. under tight and complex control at multiple levels.
Pentru a introduce cititorul n sfera imunitii, To introduce the reader to the field of immunity, the
autorul ofer n Prefaa crii i n Note author provides in the Preface of the book and also
45
preliminare de imunogenetic animal, noiuni in Preliminary notes an overview of animal

referitoare la imunitate ca funcie de aprare a immunogenetics including the history of
organismelor vii, la istoricul imunogeneticii, cmpul immunogenetics, recent research in the field, and the
de aciune a imunogeneticii i componentele basic components of the immune system.
sistemului imunogenetic. Throughout his approach, Ph.D. Gheorghe Hrinc
n tot demersul su, dr. Gheorghe Hrinc makes an intelligent arrangement of knowledge and
realizeaz o ealonare inteligent a prezentrii information, describing in the first four chapters the
cunotinelor i informaiilor, etalnd n primele theoretical basis for understanding the complexity
patru capitole baza teoretic pentru nelegerea and multiple implications of blood groups in sheep.
complexitii i implicaiilor multiple ale grupelor Chapter I, entitled Antigens (52 pages), is
sanguine la ovine. primarily intended for the description of erythrocyte
Capitolul I, intitulat Antigenii ( 52 pag.) este antigens. Among other topics covered are antigen
destinat n principal descrierii antigenilor structure, antigenic determinants, antigen properties,
eritrocitari. Se trateaz, ntre alte aspecte, structura conditions and factors that determine antigenicity,
antigenelor, determinanii antigenici, proprietile and classification of antigens depending on various
antigenelor, condiii i factori care determin factors are treated. Attention is paid to the
antigenitatea, clasificarea antigenelor n funcie de lymphocyte antigens, structures that are highly
diveri factori. O atenie meritat se acord involved in the Major Histocompatibility Complex
antigenelor limfocitare, structuri care sunt foarte (MHC) in humans and all animals. In sheep, the
implicate n Complexul Major de MHC becomes of increasing importance and is
Histocompatibilitate (CMH) la oameni i la toate called the OLA system (Ovine Lymphocyte
animalele. La ovine CMH are o importan tot mai Antigens system).
crescnd, el fiind denumit sistemul ALO (sistemul Chapter II, Antibodies (61 pages), makes a
Antigenelor Limfocitare la Ovine). detailed description regarding the peculiarities of
n capitolul II, Anticorpii ( 61 pag.), se detaliaz immunoglobulins G, M, A, D and E and relates
elemente importante referitoare la particularitile these to the biochemical structure of antibodies,
imunoglobulinelor G, M, A, D i E care sunt antibody topography, binding sites of antibodies
corelate cu structura biochimic a anticorpilor, with antigens, general classification of antibodies,
topografia anticorpilor, situs-urile de legare a biological properties and functions of antibodies,
anticorpilor cu antigenul, clasificarea general a and antibody metabolism.
anticorpilor, proprietile i funciile biologice ale The next chapter (III), Complement (30 pages),
anticorpilor, metabolismul anticorpilor etc. constitutes a successful synthesis of the current data
Capitolul urmtor, cu titlul Complementul ( 30 concerning the definition and structure of
pag.), constituie o sintez reuit a datelor actuale complement, proteinaceous subunits that make up
privind definirea i structura complementului, the complement, the complement functions and
subunitile proteinice care compun complementul, biosynthesis of components of this homeostasis
funciile complementului i biosinteza system.
componentelor acestui sistem de homeostazie. Building from the materials treated in Chapters I, II
Pe baza problemelor tratate n capitolele I, II i III, and III, Ph.D. Hrinc turns to Chapter IV (59 pages)
dr. Hrinc trece n capitolul IV (59 pagini) al crii of the book where he approaches in a complex
la o abordare complex a Interaciunii antigen- manner the Antigen-antibody interaction and the
anticorp i a rezultatului acestei complicat proces outcome of this complex cellular process. In this
celular. n acest context, autorul evideniaz context, the author highlights the structural-
particularitile structural-funcionale i biochimico- functional and biophysical-biochemical
biofizice definitorii ale interaciunii antigen- particularities which are crucial for the antigen-
anticorp, tipurile de interaciuni antigen-anticorp, antibody interaction, types of antigen-antibody
contribuia complementului n fenomenul hemolizei, interactions, the contribution of complement in
cile de activare a sistemului complement, grupele phenomenon of haemolysis, the activation pathways
de proteine constitutive ale cascadei of the complement system, the constituent protein
complementului (convertaze, anafilatoxine, groups of complement cascade (convertases,
opsonine) i mecanismele de reglare a anaphylatoxins, and opsonins) and the regulatory
complementului. mechanisms of complement.
46
Capitolul V ( 57 pag.) prezint Sistematica Chapter V (57 pages) presents the Genetic system
genetic a grupelor sanguine la ovine. Dup of blood group in sheep. After specifying the
precizarea noiunilor despre factorii de grup concepts about the blood group factor, blood group
sanguin, despre grupa sanguin i sistemul de and blood group system, Ph.D. Hrinc proceeds to
grup sanguin, dr. Hrinc trece la discutarea celor discuss the seven systems of blood groups (A, B, C,
apte sisteme de grupe sanguine ( A, B, C, D, M, R- D, M, R-O and X-Z) found in sheep, describing the
O i X-Z ) ntlnite la ovine, fiind descrise blood factor phenotypes of each system and the
fenotipurile sanguine din fiecare sistem i alelele alleles under whose control they are expressed. To
sub a cror control ele se exprim. De reinut c note, the R-O system is the only system in sheep in
sistemul R-O este singurul sistem de la ovine n care which the antigenic substances are initially
substanele antigenice se gsesc iniial dizolvate n dissolved in plasma and later are fixed in the
plasm i mai trziu se fixeaz pe/n membrana erythrocyte membrane. Further, in this chapter there
eritrocitar. Mai departe n acest capitol se are related aspects regarding the red cell factors of
abordeaz factorii eritrocitari la ovine, fenogrupele sheep, blood phenogroups in sheep, the detection of
sanguine la ovine, detectarea factorilor de grup blood group factors, identification of lymphocyte
sanguin, identificarea factorilor antigenici antigenic factors, inheritance of blood groups in
limfocitari, ereditarea grupelor sanguine la ovine (pe sheep (by dominance, codominance, epistasis and
calea dominanei, codominanei, epistaziei i polyallelism) and the genetic determinism of
polialelismului) i determinismul genetic al lymphocyte antigens. This chapter concludes with a
antigenelor limfocitare. Acest capitol se ncheie cu o problem of practical importance regarding the
problem de importan practic viznd structura genetic structure at the determinant loci of
genetic la locii determinani ai factorilor eritoritari erythrocyte factors in sheep populations depending
ai populaiilor de ovine n funcie de vrst, sex, on age, gender, breed, genealogical or zootechnical
ras, linie zootehnic sau genealogic, condiii line, geographical and climatic conditions, selection
agroclimatice, sisteme de selecie i exploatare and breeding systems used.
folosite. The last chapter of the book, Chapter VI,
Ultimul capitol din carte, al VI-lea, Aplicaii ale Applications of blood group in sheep is strongly
grupelor sanguine la ovine, este puternic ancorat n anchored in the practice of animal husbandry,
practica creterii animalelor, abordnd : asocierea including association of blood groups with other
grupelor sanguine cu alte sisteme biochimice, biochemical, immunogenetic or genetic systems,
imunogenetice sau genetice, corelaii sau asocieri correlations or associations of blood groups with
ale grupelor sanguine cu nsuirile economico- economic and production traits, reproduction indices
productive, indici de reproducie i status-ul and the health status of sheep. A special approach is
sanatorial ale ovinelor. O abordare special o represented by the comparative immunogenetics in
reprezint imunogenetica comparat la ovine; ovine species; the genetic distances among the sheep
distanele genetice dintre rasele de ovine n spaiul breeds into the study of blood groups are presented
grupelor sanguine sunt prezentate cu exemple with edifying examples. The study and knowledge
edificatoare. Studiul i cunoaterea grupelor of blood groups in sheep gains an increasing
sanguine la ovine capt o importan tot mai mare importance due to their usefulness in determination
datorit utilitii lor n selecie, pentru stabilirea of the improvement and degree of breeds, ecotypes,
gradului de ameliorare a raselor, ecotipurilor, varieties, lines and families, in establishing animal
varietilor, liniilor i familiilor, pentru stabilirea identity, and paternity.
identitii animalelor i paternitii lor. The six chapters of the book are substantiated on a
Cele ase capitole ale crii sunt fundamentate pe comprehensive and current overview of the
o ampl i actual documentare din literatura de speciality literature based on the research results
specialitate care se bazeaz pe utilizarea rezultatelor conducted by experts from different countries and
cercetrilor efectuate de specialitii din diferite ri Romania. In preparing the book the author used
i din Romnia. n elaborarea crii au fost utilizate many of his own research results presented in his
numeroase rezultate obinute n cercetrile doctoral thesis, or part of scientific papers published
ntreprinse de autor, ntre care pot fi incluse o parte after 2000. Many of these results were presented at
din datele tezei de doctorat, precum i lucrri different national and international scientific
tiinifice proprii publicate dup anul 2000. Multe meetings, where they were received with interest,
47
din aceste rezultate au fost prezentate la diferite appreciated by the experts, and published in
manifestri tiinifice naionale i internaionale, prestigious journals.
unde au fost receptate cu interes i apreciate The book concludes with four pages of General
favorabil de specialiti i au fost publicate n reviste conclusions representing a summary of the issues
de prestigiu. contained in its pages. On the whole, this book is an
Cartea se ncheie cu patru pagini de Concluzii original and modern work, with rich scientific
generale care reprezint un rezumat al problematicii content, written by a diligent researcher, with
cuprins n paginile ei. n ansamblu, aceast carte mature and profound thought, which selected and
este o lucrare original, modern, cu un bogat systematized logically and with professionalism the
coninut tiinific, scris de un cercettor essential aspects of many results accumulated over
srguincios, cu gndire matur i profund, care a the years.
selectat i a sistematizat logic, cu profesionalism, At the end of the book there is the References
aspectele eseniale din numeroasele rezultate section, citing the 322 bibliographical titles
acumulate n decursul anilor. consulted by the author.
La sfritul crii se afl tronsonul documentar, Given that the study of blood groups in sheep is a
indicnd cele 322 de titluri bibliografice consultate more recent one and less thorough in comparison to
de autor. other species of farm animals, we find that through
Avnd n vedere c studiul grupelor sanguine la this book, Ph.D. Gheorghe Hrinc provides to a
ovine este de dat mai recent i mai puin wide circle of readers a scientific work of real utility
aprofundat comparativ cu alte specii de animale that offers an extensive range of information on a
domestice, considerm c dr. Gheorghe Hrinc very current topic. Through its thematic approach,
pune, prin aceast carte, la dispoziia unui cerc larg the book Blood groups in sheep should garner the
de cititori o lucrare de cert utilitate care ofer o attention of researchers in immunogenetics, animal
vast palet de informaii asupra unui subiect husbandry and veterinary medicine, as well as of
deosebit de actual. Prin spectrul su tematic, cartea specialists in the field of animal breeding, especially
Grupele sanguine la ovine se impune ateniei of sheep.
cercettorilor din imunogenetic, zootehnie,
medicin veterinar, precum i specialitilor din Professor Vlad ARTENIE, Ph.D.
domeniul creterii animalelor, n special a ovinelor.
Profesor univ. Emeritus dr. Vlad ARTENIE
48

Anale GBM F1 2014

Diunggah oleh

Informasi Dokumen

Judul Asli

Hak Cipta

Format Tersedia

Bagikan dokumen Ini

Bagikan atau Tanam Dokumen

Opsi Berbagi

Apakah menurut Anda dokumen ini bermanfaat?

Apakah konten ini tidak pantas?

Hak Cipta:

Format Tersedia

Anale GBM F1 2014

Diunggah oleh

Hak Cipta:

Format Tersedia

ANALELE TIINIFICE

TOMUL XV, fascicula 1 2014

Editura Universitii ALEXANDRU IOAN CUZA Iai

Oana Constantin, Marius Mihan Gene cloning of

GENE CLONING OF A PUTATIVE PERIPLASMIC SUGAR-BINDING

Keywords: Arthrobacter, catabolic megaplasmid, xylose, ABC-type transport system

Figure 2. The 3D model of the PSBP showing

MATERIAL AND METHODS

Table 1. Oligo-nucleotides used for isolation of ppl

RESULTS AND DISCUSSIONS

1. Al I Cuza University of Iasi, Romania

MATERIALS AND METHODS

Table 1 - Experimental variants

Experimental variant Abbreviation Total polyphenolic content

Enzyme activity assays

Peroxidase activity assay (EC 1.11.1.7)

SOD activity assay (EC 1.15.1.1)

Catalase activity assay (CAT, EC 1.11.1.6)

Quantitative determination of proteins using Bradford assay

RESULTS AND DISSCUSSIONS

Figure 1 - Variation of peroxidase activity in the roots and

Figure 2 - Variation of superoxide dismutase activity in the roots and

Figure 3 - Variation of catalase activity in the roots and leaves of

THE INFLUENCE OF THE CONSERVATION PERIOD ON THE

Keywords: micromycetes, CGA medium, blotting paper

MATERIALS AND METHODS

It was performed the phytopathological characterization of local germplasm represented by 30 populations of

RESULTS AND DISCUSSIONS

a) CGA medium (potato - dextrose - agar)

Table 1. Proportion of micromycets isolated on Zea mays seeds placed on CGA

Seeds stored at T + 40C, Seeds stored at T + 40C,

Penicillium sp. 32 20,5

Seeds stored at T + 40C, Seeds stored at T + 40C,

Cladosporium herbarium 2 1,5

+ 40C - 8 ani + 40C - 17 ani

Penicillium sp. Aspergillus sp Rhizopus sp. Mucor sp. Cladosporium herbarum

Isolated micromycets Attack frequency (%)

Proportion of micromycets isolated on 30 seeds samples of Zea mays placed on blotting

+ 40C - 8 ani + 40C - 17 ani

Penicillium sp. Aspergillus sp. Rhizopus sp.

For establishment complementary action of micromycetes identified on Zea mays seeds

THE INFLUENCE OF SOME STORAGE CONDITIONS UPON

Keywords: ascorbic acid, cabbage, oxygen, pH, storage, temperature.

MATERIALS AND METHODS

The pH values were determined with a digital pH-meter type Hanna.

RESULTS AND DISCUSSIONS

Table 2. Ascorbic acid and pH values in white cabbage

As seen in the Table 1, at temperature of 4C in the presence of oxygen, the ascorbic

Table 2. Ascorbic acid and pH values in red cabbage

As seen in the Table 2, at temperature of 4C in the presence of oxygen, the ascorbic

Week XII Week VIII

pH of white cabbage pH of red cabbage

Fig. 1. The comparative evolution of pH values in white

1. Faculty of Food Engineering, Stefan cel Mare University of Suceava

THE ACTIVITY OF CYTOLYSIS ENZYMES

MATERIALS AND METHODS

RESULTS AND DISCUSSION

Acute coronary AGE GROUPS

Fig. 2. GOT activity(U/L) on male and female patients diagnosed with

Fig. 3. GPT activity(U/L) on male and female patients diagnosed with

Fig. 4. CK activity (U/L) on male and female patients diagnosed with

BREAST CANCER AND THE HISTOPATHOLOGIC TYPE

Keywords: breast cancer, carcinoma, mastectomy