Anda di halaman 1dari 126

UNIVERSIDADE DO ESTADO DE SANTA CATARINA

CENTRO DE CINCIAS AGROVETERINRIAS

EXERCCIOS DE GENTICA

Professor ALTAMIR FREDERICO GUIDOLIN


Geneticista, Doutor

Lages - Santa Catarina


2017
NDICE
1 INTRODUO .................................................................................................................................. 1

2 GENTICA MOLECULAR ................................................................................................................ 3


2.1 Estrutura do material gentico........................................................................................................3
2.2 Replicao do DNA (Duplicao) ...................................................................................................7
2.3 Transcrio do DNA .......................................................................................................................7
2.4 Cdigo gentico ..............................................................................................................................8
2.5 Sntese protica (traduo) ............................................................................................................9
2.6 Organizao do material gentico ............................................................................................... 11
2.7 Regulao da expresso gnica ................................................................................................. 12
3 MUTAES NO MATERIAL GENTICO E TERATOGNESE .................................................... 13

4 BASES CITOLGICAS DA HERANA ......................................................................................... 15


4.1 Diviso celular ............................................................................................................................. 15
4.2 Gametognese ............................................................................................................................ 21
5 GENTICA MENDELIANA ............................................................................................................. 22

6 BIOMETRIA .................................................................................................................................... 39

7 GENES LETAIS E FENOCPIAS.................................................................................................. 44

8 INTERAES ALLICAS, ALELISMO MLTIPLO E PLEIOTROPIA .......................................... 45


8.1 Interaes allicas ....................................................................................................................... 45
8.2 Alelismo mltiplo .......................................................................................................................... 47
8.3 Pleiotropia .................................................................................................................................... 51
9 INTERAES GNICAS ............................................................................................................... 53

10 CRUZAMENTO CONTROLADO - UMA FERRAMENTA PARA ESTUDOS GENTICOS ......... 58

11 LIGAO GNICA, PERMUTA E MAPAS GENTICOS ............................................................ 60

12 ABERRAES CROMOSSMICAS ........................................................................................... 71

13 EFEITOS DO AMBIENTE NA EXPRESSO GNICA ................................................................ 80

14 GENTICA QUANTITATIVA ........................................................................................................ 85


14.35 Herdabilidade........................................................................................................................... 94
14.36 Componentes da varincia ...................................................................................................... 95
15 GENTICA DE POPULAES ................................................................................................... 97

16 EVOLUO, COM NFASE NA TEORIA SINTTICA DA EVOLUO ................................ 103

17 DETERMINAO DO SEXO E HERANA RELACIONADA AO SEXO ................................... 106

18 SISTEMAS DE ACASALAMENTO ............................................................................................. 109

19 IMUNOGENTICA ..................................................................................................................... 111

20 EFEITO MATERNO E HERANA EXTRACROMOSSMICA .................................................. 112

21 TCNICAS BIOTECNOLGICAS E APLICAES AOS ESTUDOS GENTICOS. ............... 118


21.1 Tcnicas de apoio biotecnologia .......................................................................................... 118
21.2 Cultura de tecidos vegetais ..................................................................................................... 119
21.3 Transformao gentica .......................................................................................................... 119
II

21.4 Marcadores moleculares ......................................................................................................... 120


21.5 Tcnicas associadas ao aumento da capacidade reprodutiva (Inseminao artificial, super
ovulao, ....). .................................................................................................................................... 122
EXERCCIOS DE GENTICA
ATENO: Os exerccios apresentam somente a resposta final ou parte do
desenvolvimento da resposta e tem a finalidade de facilitar o entendimento do exerccio, e
em momento algum de dar uma resposta completa. O complemento das respostas fica a
cargo do acadmico.

Instrues a serem observadas durante as avaliaes da disciplina de gentica:


1) Leia as questes com ateno para interpret-las corretamente. 2) No caso de dvida,
pea esclarecimentos at 10 minutos a partir do incio da avaliao. Aps este prazo
no faa perguntas. 3) Responda apenas o que solicitado. 4) Use os dados fornecidos.
5) Use o verso da(s) folha(s) impressa(s) como rascunho. 6) Responda a(s) questo(es)
integralmente na folha de papel almao, na ordem em que esto formuladas. O rascunho
(verso da(s) folha(s) impressa(s)) no ser considerado na avaliao. 7) Escreva somente
com caneta azul ou preta e letra legvel. 8) Assine todas as folhas. 9) As respostas
devem limitar-se a 01 folha de papel almao (4 pginas). 10) Todas as questes tem o
mesmo peso (excees constaro peso no incio da questo). 11) A avaliao dar-se-
com base no desenvolvimento, at a resposta final, por isto apresente o desenvolvimento
na folha de almao. 12) No perca tempo respondendo alm do que solicitado;
efetuando clculos desnecessrios ou cujos resultados so fornecidos; fazendo
rascunhos desnecessrios ou escrevendo a lpis para depois passar a limpo. 13) Assine
a lista de presenas, antes de sair da sala. 14) Entregue a avaliao (todo o material
fornecido) no prazo estabelecido. 15) Durante a avaliao proibido o uso de
equipamentos eletrnicos que armazenem, transmitam ou recebam som e/ou caracteres
alfanumricos, os quais devem permanecer desligados e guardados. Se estiver usando
bon, vire a aba para traz.

1 INTRODUO

1.1 Indique se cada uma das seguintes proposies so verdadeira (V) ou falsa (F).
( ) Nas espcies de reproduo vegetativa no ocorre variabilidade gentica, porque no
ocorre interao gnica. ( ) A variabilidade gentica, em organismos de reproduo
assexuada, ocorre durante as divises mitticas e so causadas pela recombinao
gentica. ( ) Variabilidade gentica a variao entre os seres vivos, seja pelo ambiente
ou pelos genes, e caracterstica de cada espcie.

1.2 Faa um histrico da gentica, comentando os passos mais importantes, mostrando


conhecimento de quais foram e como se sucederam os fatos, at o que hoje conhecemos
como a tecnologia do DNA recombinante.

1.3 H relatos de inmeros pesquisadores que antecederam Mendel, na tentativa de


elucidar as bases genticas da hereditariedade, sem contudo obterem sucesso. Quais as
razes que levaram Mendel a obter sucesso na elucidao das bases da hereditariedade?
Resposta: H algumas razes para o xito de Mendel, entre elas: a) A escolha dos
gentipos utilizados no experimento (escolha do material experimental). Ele trabalhou
com ervilha, uma planta de ciclo curto, descendncia numerosa e que ocupa pequeno
espao (em comparao com outros estudos da poca); b) Estudou vrios caracteres da
2

ervilha, em realidade sete, visando ter certeza dos resultados obtidos; c) Foi persistente
em conduzir o trabalho e em defender suas idias, que eram diferentes de tudo que
ocorria na poca.

1.4 Quais as principais contribuies da gentica para a agricultura?

1.5 Como a variabilidade gentica pode ser preservada?

1.6 Porque importante a conservao da variabilidade gentica?

1.7 A variabilidade gentica importante para os estudos de herana. Caracterize e


comente esta importncia.

1.8 Em que situaes mais indicado a conservao in situ quando comparamos com a
conservao ex situ? Comente sob todos os aspectos, desde a manuteno do
germoplasma at os aspectos evolutivos envolvidos, justificando-os.

1.9 Diferencie variao gentica de variao ambiental?

1.10 Quais os tipos de variao que podem ser encontrados nos organismos vivos? Qual
a importncia de cada uma delas sob o ponto de vista gentico?

1.11 Disserte em 30 linhas o tema variabilidade gentica.

1.12 Quais as vantagens da conservao de recursos genticos in situ quando


comparamos com a conservao ex situ?

1.13 O Brasil apresenta uma das maiores reservas de biodiversidade do mundo.


Comente como tem sido conservada a variabilidade gentica de interesse para a
agropecuria brasileira.

1.14 O que variabilidade gentica? Como pode ser comprovado que a variabilidade
observada em uma determinada populao realmente devido a causas genticas.
Fundamente a sua resposta sob todos os aspectos (desde a gentica molecular,
mendeliana, citolgica at os aspectos evolutivos envolvidos).

1.15 Comente a importncia da conservao da variabilidade gentica, sob o ponto de


vista ambiental e do melhoramento gentico?

1.16 Como diferenciar variao gentica de variao ambiental?


3

2 GENTICA MOLECULAR

2.1 Estrutura do material gentico

2.1.1 Indique se cada uma das seguintes proposies sobre a estrutura do DNA
verdadeira (V) ou falsa (F). (Cada letra usada para referir-se concentrao da base
correspondente no DNA): a) ( ) A + T = G + C; b) ( ) A = G; C = T; c) ( ) A/T = C/G;
d) ( ) T/A = C/G; e) ( ) A + G = C + T; f) ( ) G/C = 1; g) ( ) A = T dentro de cada fita nica;
h) ( ) As pontes de hidrognio fornecem estabilidade dupla hlice em citoplasma
aquoso; i) ( ) As ligaes hidrofbicas fornecem estabilidade dupla hlice em
citoplasma; j) ( ) Quando separadas, as duas fitas de uma dupla hlice so idnticas;
k) ( ) Uma vez que a sequncia de bases de uma fita da dupla hlice conhecida, a
sequncia de bases da outra fita pode ser deduzida; m) ( ) A estrutura de uma dupla
hlice de um DNA totalmente conservada durante sua replicao; n) ( ) Cada par de
nucleotdeos contm dois grupamentos fosfato, duas molculas de desoxiribose e duas
bases. o) ( ) O pareamento das bases nitrogenadas garante a diferenciao celular de
forma estvel.
Resposta:
(E); (E); (C); (C); (C); (C); (E); (C); (C); (E); (C); (E); (C).

2.1.2 O Cdigo Gentico universal por ser praticamente o mesmo em todos os seres
vivos, embora existam rarssimas excees a esta universalidade. Ele tambm
chamado de degenerado, porque para a codificao de quase todos os aminocidos
existem mais de um cdon, conforme mostrado na Tabela do Cdigo Gentico, a seguir:
Ao final da traduo de um RNA mensageiro foi formado um polipeptdio que apresenta
os seguintes aminocidos em suas posies relativas:
1 Base do 2 Base do Cdon 3 Base do
Cdon Cdon
U C A G
Fenilalanina Serina Tirosina Cistena U
Fenilalanina Serina Tirosina Cistena C
U
Leucina Serina Parada(Stop) Parada(Stop) A
Leucina Serina Parada(Stop) Triptofano G
Leucina Prolina Histidina Arginina U
Leucina Prolina Histidina Arginina C
C
Leucina Prolina Glutamina Arginina A
Leucina Prolina Glutamina Arginina G
Isoleucina Treonina Asparagina Serina U
Isoleucina Treonina Asparagina Serina C
A
Isoleucina Treonina Lisina Arginina A
Metionina Treonina Lisina Arginina G
Valina Alanina Ac. Asprtico Glicina U
Valina Alanina Ac. Asprtico Glicina C
G
Valina Alanina Glutamina Glicina A
Valina Alanina Glutamina Glicina G

Metionina 1 Triptofano 2 Triptofano 3 Arginina 4 Lisina 5 Cistena 6 Fenilalanina 7


4

Indique o somatrio da(s) proposio(es) abaixo que esto CORRETA(S) ( ).


01. O RNA mensageiro que forma este polipeptdio apresenta 7 (sete) pares de bases
nitrogenadas.
02. Se o cdon do RNA mensageiro que codifica o segundo aminocido for modificado
na sua terceira base (de G para A), a cadeia polipeptdica ser formada faltando um
aminocido.
04. Existem no total 16 sequncias possveis de RNA mensageiro para formarem este
polipeptdio.
08. Os aminocidos da primeira e da segunda posio so exemplos da razo pela qual
o cdigo gentico chamado de degenerado.
16. A presena do cdon UAA no RNA mensageiro faz com que a maquinaria de
traduo (ribossomo + RNA mensageiro) seja desmontada.
32. Pela anlise da tabela do cdigo gentico podemos afirmar que o aminocido da 7
(stima) posio pode ser codificado por apenas um cdon.
64. Uma mutao no DNA pode ou no levar a modificaes na sequncia dos
aminocidos deste polipeptdio.

2.1.3 R2-1) A composio de bases de vrios cidos nuclicos de algumas espcies


fornecido a seguir:
ESPCIE BASES (%)
A C G T U
1 20 30 30 20 --
2 40 10 10 40 --
3 30 30 20 -- 20
4 40 10 40 -- 10
5 30 30 20 20 --
Para cada espcie, caracterize o cido nuclico encontrado (se DNA fita simples ou
dupla, RNA fita simples ou dupla) justificando as respostas (resposta sem justificativa no
ser avaliada).
Resposta:
1-DNA dupla fita; 2-DNA dupla fita; 3-RNA; 4-RNA;
5-DNA fita simples (quando desnaturado por calor, concentraes salinas baixas, etc.).

2.1.4 R2-2) O DNA de uma clula haplide da galinha contm 1,3 x 10-12 g e 28% de
suas bases adenina.
a) Qual a proporo de citosina esperada nesse DNA?
b) Qual o nmero esperado de nucleotdeos numa clula somtica?
c) Qual o comprimento total do DNA de uma clula haplide, se todos os seus
cromossomos fossem unidos?
d) Considerando que o ncleo de uma clula tem 3 micrometros de dimetro, qual a
implicao biolgica/gentica dessa dimenso em relao ao comprimento do DNA?
OBS.: Considere que o peso molecular mdio de um nucleotdeo de 330 Dalton, 1
Dalton equivale a 1,67 x 10-24 g, 1 ngstrm equivale a 10-4 micrometros e a distncia
entre um par de bases 3,4 ngstrm.
Resposta:

a) 28% A - 28% T ===> 56% 100% - 56% = 44% / 2 = 22%


22% C - 22% G
5

b) 1 nucleotdeo ------- 330 Daltons


1 Dalton ------ 1,67 x 10-24g
1 nucleotdeo --- (330 x 1,67 x10-24g) = 5,511 x 10-22g
X ----------------------------------------- 1,3 x 10-12g
= 2 358 918 527 nucleotdeos (haplide - n)
= 4 717 837 053 nucleotdeos (2n)
c) 2.358.918.527 nucleotdeos (n) --- 1.179.459.263 pb1 (n)
Distncia entre 1 par de bases ------- 3,4 ngstrm
1.179.459.263 pb ------------------- X ngstrm
1.179.459.263 4.010.161.494 ngstrm
1 ngstrm ---------------- 10-4 micrometros
4.010.161.494 ngstrm --- X = 401.016 micrometros
1 ngstrm ---------------- 10-10 metros
4.010.161.494 ngstrm --- X = 0,40 metros
d) CLULA HAPLIDE DE GALINHA:
Comprimento do DNA -------- 401.016 micrometros
Dimetro do ncleo -------------- 3 micrometros
Considerando estes fatos, qual a concluso?

2.1.5 R2-3) Considerando ainda o DNA de uma clula haplide da galinha, quantos tipos
de molculas de DNA so possveis? Qual a implicao biolgica/gentica desse
resultado?
Resposta:
41 179 459 263 tipos de DNA

2.1.6 R2-5) Uma fita da molcula de DNA contm a seguinte proporo de bases
nitrogenadas: 20% A, 30% C, 40% G e 10% T. Quais so as propores dessas mesmas
bases esperadas na hlice dupla desse DNA?
Resposta:
20% A, 30% C, 40% G e 10% T = 100% TOTAL FITA SIMPLES
20% T, 30% G, 40% C e 10% A = 100% TOTAL FITA SIMPLES
Clculo:
(20% A + 10% A)/2 = 15% A (30% C + 40% C)/2 = 35% C
(20% T + 10% T)/2 = 15% T (40% G + 30% G)/2 = 35% G
(100% FITA SIMPLES + 100% FITA SIMPLES)/2 = 100% FITA DUPLA

2.1.7 R2-6) O genoma haplide do bicho-da-seda tem apenas uma cpia do gene da
fibroina (protena da seda). Durante a produo da seda, cada clula produz 109
molculas dessa protena, sendo que o gene transcrito 104 vezes. Quantas vezes uma
mesma molcula do mRNA traduzida?
Resposta:
O gene transcritos 104 vezes. Ento temos 104 mRNA
Regra de trs 104 mRNA 109 protenas
1 mRNA X X = 100.000 protenas

2.1.8 R2-9) Num dos genes dos bovinos, que codifica para uma determinada enzima
existem 1.212 bases nitrogenadas nos seus exons. Considerando que na cadeia
polipeptdica codificada por esse gene o primeiro aminocido a metionina, pergunta-se:

1 pb pares de base
6

a) Qual o nmero de aminocidos dessa protena?


b) Qual o nmero de bases nitrogenadas do mRNA?
c) Qual o nmero de tRNAs envolvidos na sntese de uma molcula?
d) Para sintetizar cada cadeia polipeptdica, quantos ribossomos so necessrios?
Resposta:
a) 1212 bases nitrogenadas nos exons do DNA
606 pb nitrogenadas nos exons do DNA, sendo que destes, 3 pb so o cdon
de finalizao.
3 pb ---> 1 Ac.
603 pb ---> X = 201 Ac.
b) 606 pb nos exons = 606 bases no mRNA
c) Um tRNA para cada aminocido = 201 tRNA.
1 ribossomo para cada cadeia polipeptdica.

2.1.9 Utilizando os conhecimentos da Gentica Molecular explique: a) Como


armazenada a informao gentica de um determinado organismo; b) Como possvel
existir tantos organismos diferentes, desde bactrias, plantas at animais superiores, e
mesmo dentro de cada uma destas espcies existir tanta variabilidade gentica se o
material que compe o DNA o mesmo para todas as espcies; e c) Como surgem
organismos diferentes, mesmo dentro de uma determinada espcie?

2.1.10 Descreva as principais diferenas entre DNA e RNA: a) quimicamente,


b) funcionalmente e c) pela localizao na clula.

2.1.11 Explique como Meselson e Sthal, em 1958, demonstraram que a duplicao do


DNA semiconservativa.

2.1.12 Em 1958 Meselson e Sthal demonstraram que a duplicao do DNA


semiconservativa. Quais caractersticas que a duplicao semiconservativa confere ao
material gentico? Comente detalhadamente estas caractersticas e sua importncia.

2.1.13 Como foi provado que o DNA o material gentico?

2.1.14 Questionado por um leigo a cerca do DNA (Ser que o DNA realmente existe?)
como proceder para provar a existncia do DNA e que ele o responsvel pelo
armazenamento da informao gentica.

2.1.15 Em 1944, Avery MacLeod e McCarty comprovaram que o DNA o material


gentico, isolando as diferentes classes de molculas encontradas dos detritos de clulas
Lisas de bactrias mortas pelo calor. Com o conhecimento atual, em gentica molecular,
surgiram outras maneiras de comprovar que o DNA o material gentico. Descreva uma
maneira de comprovar que o DNA tambm o material gentico nos seres superiores.

2.1.16 Quais as caractersticas que tornam os vrus e bactrias material atrativo para os
estudos genticos?
Resposta:
Entre outras caractersticas, destacam o ciclo reprodutivo muito curto e o fcil manuseio
em laboratrio de um grande nmero de descendentes, associados menor
complexidade e arranjamento do material gentico.
7

2.1.17 Descreva o tRNA estruturalmente e funcionalmente considerando cada uma de


suas partes?

2.1.18 Descreva o modelo da dupla hlice, conforme proposto por Watson e Crick (1953).

2.2 Replicao do DNA (Duplicao)

2.2.1 O que a origem de replicao?

2.2.2 Relacione as regies regulatrias (como o tata Box) e a definio do nmero de


genes?

2.2.3 Descreva o processo de replicao (duplicao) do DNA.

2.2.4 Demonstre que o processo de duplicao do DNA semiconservativo.

2.2.5 O processo de duplicao do DNA chamado de semiconservativo porque: (a) O


DNA formado por molculas complementares; (b) Em cada dupla hlice que se forma,
uma faz parte da molcula me e outra totalmente sintetizada; (c) As bases
nitrogenadas se ligam duas a duas; (d) Uma molcula de DNA origina duas de RNA;
(e) As duas hlices da nova molcula tero, alternadamente, pedaos da molcula me. A
resposta correta a letra ( ).

2.2.6 Em procariontes (Escherichia coli) a replicao do DNA ocorre a uma velocidade de


850 nucleotdeos por segundo, quando em condies ideais de crescimento. A bactria
gasta 40 minutos para replicar seu cromossomo. Nos eucariontes, devido associao do
DNA com as histonas, a velocidade de replicao cerca de dez vezes mais lenta do que
nos procariontes. A menor velocidade de replicao do DNA nos eucariontes, associada
ao fato deles possurem muito mais DNA do que as bactrias, permitiu estimar que uma
clula eucarionte gastaria mais de dois meses para replicar o DNA de seus cromossomos
a esta velocidade. No entanto, sabemos que a fase S do ciclo celular gasta em torno de
seis horas para replicar todos os cromossomos. Diante desses fatos, como ocorre a
replicao nos eucariontes?

2.2.7 Niremberg e Leder (1964) desenvolveram um mtodo eficiente para determinao


dos 64 cdons envolvidos na sntese protica (traduo), aps descobrirem que
molculas de tRNA carregadas com seu aminocido especfico se ligam ao complexo
ribossomo-mRNA. Explique como eles procederam para decifrar o cdigo gentico?
Quantos cdons codificam todos os 20 aminocidos? Que papel desempenham os
demais cdons?

2.3 Transcrio do DNA

2.3.1 Indique se cada uma das seguintes proposies so verdadeira (V) ou falsa (F).
( ) O hnRNA tem por funo primordial a degradao dos introns. ( ) O cdigo gentico
transcrito para mRNA. ( ) Os introns so genes inativos. ( ) O iniciador (primer) faz com
que a dupla fita se abra, deixando a DNApolimerase ligar-se-o DNA. ( ) Aps o trmino
o iniciador passa para outro ponto da fita, recomeando o processo de duplicao. ( ) A
funo do iniciador (primer) separar as fitas do DNA. ( )
8

2.3.2 Os processos que culminam com a formao de um mRNA so diferentes entre os


organismos procariontes e os eucariontes. Descreva estas diferenas.

2.3.3 Processamento do RNA: a) Descreva o processo, b) Quais as contribuies deste


processo, sob o ponto de vista evolutivo, c) Onde, na clula, ocorre este processo, d)
Quando ocorre o processamento.

2.3.4 Diferencie os tipos de RNA quanto a funo, a estrutura, o local de atuao na


clula, etc.

2.3.5 Descreva o processo de transcrio do DNA.

2.3.6 Diferencie INTRON e EXON?

2.3.7 Com base na fita de DNA fornecida a seguir:


fita sense 5'AATGCGACTGATCTAACAGCTAC3'
3'TTACGCTGACTAGATTGTCGATG5'

a) Esquematize a estrutura plana da dupla fita do DNA (posio dos grupos fosfato, do
acar, das bases nitrogenadas), utilizando os primeiros 4 pares de base a partir da
posio 3' da fita sense.
b) Qual a sequncia de bases no mRNA? (no esquea de observar os cdons de incio e
fim do mRNA).
c) Comente as funes do DNA, identifique os trs principais tipos de RNA e d as
principais funes, caractersticas e localizao de cada um na clula viva.
d) Comente a respeito das principais enzimas envolvidas na duplicao e na transcrio
do DNA (DNA e RNA polimerases), abordando pontos como funes, modo de atividade,
entre outros.

2.3.8 Quais as diferenas entre o mRNAs de procariontes e eucariontes.

2.4 Cdigo gentico

2.4.1 O cdigo gentico no tem virgulas. Quais as implicaes deste fato para a leitura
do RNA, frente a alteraes na sequncia de bases do material gentico.

2.4.2 Diz-se que o cdigo gentico no ambguo e que o cdigo gentico


degenerado. Diferencie estas duas propriedades do cdigo gentico.

2.4.3 O que o cdigo gentico?

2.4.4 Que um cdon?

2.4.5 O cdigo gentico universal. Qual a contribuio deste fato na explicao da


evoluo da vida na terra? Quais so as implicaes deste fato, quanto ao melhoramento
gentico (em especial para a transgenia). Quais so as implicaes deste fato, tanto para
a gentica, quanto ao melhoramento de plantas.
9

2.5 Sntese protica (traduo)

2.5.1 Indique se cada uma das seguintes proposies so verdadeira (V) ou falsa (F).
( ) Uma das diferenas entre a traduo em procariontes e a traduo em eucariontes
que os procariontes possuem ncleo e portanto o RNA transportador j o mensageiro.
( )

2.5.2 Os organismos procariontes e eucariontes apresentam uma srie de diferenas que


os caracterizam. Dentre as diferenas entre procariontes e eucariontes destaque as
relacionadas com a sntese protica traduo.

2.5.3 Diferencie o mRNA encontrado nas clulas procariontes do mRNA encontrado nas
clulas eucariontes.

2.5.4 Descreva o processo de sntese protica (traduo).

2.5.5 Comente: a) Onde ocorre a sntese protica (traduo), na clula; como a


informao chega no local da sntese protica e; b) As fases do processo de sntese
protica.

2.5.6 Comente:
a) Cada uma das regras do cdigo gentico;
b) Onde ocorre a sntese protica (traduo), na clula;
c) Como a informao chega no local da sntese protica e;
d) As fases do processo de sntese protica.

2.5.7 Com base nos conhecimentos da gentica molecular, explique detalhadamente


como a informao gentica armazenada nos organismos vivos.

2.5.8 Em relao ao metabolismo celular, trs processos se destacam: a duplicao, a


transcrio e a traduo. De acordo com estes processos, responda: a) Que molculas
so formadas em cada processo?; b) A que tipo de cido nuclico refere-se a fita
apresentada a seguir? Justifique a resposta.
...ACGGTCTTTCCAACCAAACGGGCATTTCCC...; c) Quantos aminocidos seriam
codificados se todo o trecho da fita acima fosse lido? d) Se essa fita fosse lida da
esquerda para a direita, mencione quais seriam o segundo e o quarto cdons e os
respectivos aminocidos que a eles se ligariam. Utilize a tabela do cdigo gentico.

2.5.9 Comete a fase ps-sntese protica (enrolamento e processamento dos


polipeptdios, inclusive estrutura terciria e quaternria).

2.5.10 A ligao peptdica, que ocorre durante a sntese protica, se d entre o grupo
carboxlico do primeiro e o grupo amnico do segundo aminocido. catalisada pela
enzima peptidiltransferase, uma enzima que parte integrante da subunidade maior do
ribossomo. Quais as condies para que a enzima peptidiltransferase realize a ligao
peptdica, durante a sntese protica?

2.5.11 R2-4) O gene da ovoalbumina da galinha possui 8 exons e 7 introns. a) A primeira


sequncia na posio 5' um exon. Considerando que os exons e introns esto
numerados em ordem crescente da posio 5' -> 3', esquematize a estrutura do hnRNA
transcrito desse gene. b) Suponha que a cadeia polipeptdica codificada pelo gene da
10

ovoalbumina possua 200 aminocidos. Sabendo-se que o primeiro a lisina e que o gene
possui 2.016 nucleotdeos, quantos pares de bases constituem os introns?
Resposta:
200 Ac. x 3 = 600 nucleotdeos
+ 3 metionina que foi retirado enzimaticamente
+ 3 Cdon de finalizao
Total do mRNA = 606 nucleotdeos (bases)
2.016 nucleotdeos no DNA = 1.008 pares de bases no DNA
606 bases do mRNA = 606 pares de bases no DNA para codifica-lo
1.008 pb (GENE) - 606 (EXONS) = 402 pb (INTRONS)

2.5.12 R2-7) Considere as 60 protenas diferentes, de uma espcie animal, cada uma
com tamanho mdio de 120 aminocidos. Qual o nmero de nucleotdeos dos exons
relacionados com a sntese dessas protenas? Admita que o primeiro aminocido de
todas as protenas no seja a metionina.
Resposta:
1 protena 120 Ac.
1 Ac. 3 pares de base no DNA
120 Ac. x 3 = 360 pb
1 metionina = 3 pb
1 cdon final = 3 pb
TOTAL = 366 pb para formar uma protena
366 pb X 60 protenas = 21960 pb ou 43920 nucleotdeos.

2.5.13 R2-8) O gro de milho pode ser liso ou enrugado. O liso devido a um alto
contedo de amido no endosperma, e o enrugado devido presena de acares
solveis em gua no lugar do amido. Sabe-se que o tipo de reserva (amido ou acares
solveis) do endosperma controlado por um par de alelos, e que cada um codifica uma
cadeia polipeptdica. Qual seria a explicao bioqumica para formar amido ou acares
solveis em gua?

2.5.14 R2-10) No gato, um determinado alelo apresenta a seguinte sequncia de bases:


----EXON 1---|INTRON1|EXON 2|INTRON2|---- EXON 3 --------------
5'ATG CAC CGA|AAT GAT|AGA ATT|ACG CCC|CCA CCA CCA CCA CAA TAG A 3'
3'TAC GTG GCT|TTA CTA|TCT TAA|TGC GGG|GGT GGT GGT GGT GTT ATC T 5'
A fita anti-sense dessa molcula tem a timina como primeira base na posio 3'. A
partir desse alelo pergunta-se:
a) Qual a sequncia de bases no mRNA?
b) Qual o nmero de aminocidos que faro parte da protena codificada por esse alelo?
c) Se forem sintetizadas 10 molculas de protena, qual o nmero total de tRNA e de
ribossomos que iro participar?
d) Qual a sequncia de aminocidos na protena?
e) Considerando a fita sense a partir da extremidade 5' se ocorrer a deleo da quinta
base (T) e a adio de uma citosina aps a 18 base, qual ser a sequncia de
aminocidos na cadeia polipeptdica mutante?
Resposta:
a) mRNA = 5'AUG CAC CGA AGA AUU CCA CCA CCA CCA CAA UAG3'
b) 10 Ac. c) 100 tRNA e 10 ribossomos.
d) mRNA = 5'AUG CAC CGA AGA AUU CCA CCA CCA CCA CAA UAG 3'
11

Polipeptdeo = Met His Arg Arg Ile Pro Pro Pro Pro Gln
e) ---EXON 1--|INTRON1|EXON 2 |INTRON2|---- EXON 3 -------------
5'ATG CAC CGA|AAT GAT|AGA ATT|ACG CCC|CTCA CCA CCA CCA CA TAG A3'
3'TAC GTG GCT|TTA CTA|TCT TAA|TGC GGG|GCGT GGT GGT GGT GT ATC T5'

mRNA 5'AUG CAC CGA AGA AUU CUC ACC ACC ACC ACA UAG3'
Polip. Met His Arg Arg Ile Arg Tre Tre Tre Tre
Concluso: Modificou a sequncia de Ac. aps a mutao e surgiu um cdon de
finalizao, tornando a cadeia polipetdica mais curta.

2.5.15 O que um poliribossomo?

2.5.16 Em eucariontes as protenas so sintetizadas no citoplasma, mais especificamente


no ergastoplasma rugoso, onde esto os ribossomos. Como este fato foi ou como este
fato pode ser provado?

2.5.17 A transcrio (DNA <-> RNA) reversvel, mas a traduo (RNA -> pp) no
reversvel. Explique porque.

2.6 Organizao do material gentico

2.6.1 Indique se cada uma das seguintes proposies so verdadeira (V) ou falsa (F).
( ) A finalidade da organizao (compactao) do material gentico reduzir o seu
comprimento para caber dentro da clula. ( )

2.6.2 Quais os principais passos da condensao do DNA (empacotamento).

2.6.3 No processo de condensao do DNA a clula consome quantidade considervel


de energia. Qual a importncia do processo de condensao do DNA para a clula?

2.6.4 Leia as afirmaes abaixo e: a) Reescreva a(s) resposta(s) correta(s) e; b)


Identifique, justificando a(s) resposta(s) incorreta(s).
1) Denominamos caritipo ao conjunto de cromossomos de uma clula diplide
caracterstico de uma espcie.
2) Os cromossomos so estruturas formadas exclusivamente de DNA.
3) O DNA responsvel pela produo dos genes.
4) Alelos dominantes so os que esto presentes em maior quantidade em um ser.

2.6.5 O que so as histonas? Qual a relao das histonas com a regulao da expresso
gnica?

2.6.6 O material gentico dos eucariontes est organizado, dentro do ncleo da clula.
Descreva o primeiro nvel de organizao do material gentico - a formao do
nucleossomo?

2.6.7 Sob o ponto de vista molecular, como o material gentico organizado para formar
um cromossomo? Qual a importncia desta organizao para o mecanismo da herana
gentica?

2.6.8 Comente as relaes entre a regulao da transcrio e a condensao do


material gentico.
12

2.7 Regulao da expresso gnica

2.7.1 Indique se cada uma das seguintes proposies so verdadeira (V) ou falsa (F).
( ) Na regio regulatria do Operon Lac temos o sitio operador. O stio operador onde
se liga a lactose, para ser degradada. ( ) Em presena de glicose, a protena repressora,
produzida pelo gene i, liga-se ao stio, deixando a lactose livre, iniciando-se a degradao
da glicose. ( )

2.7.2 Marque: V para a sentena verdadeira ou F para falso. Se falso justifique:


( ) O cdigo gentico a sequncia de bases que est armazenada no DNA.
( ) Cdon a sequncia de trs bases que define um aminocido.
( ) A herana de uma caracterstica determinada atravs da herdabilidade (h2).
( ) O cdigo gentico onde esto todas as informaes de um indivduo.
( ) O mRNA transporta o cdigo gentico do ncleo para o citoplasma.
( ) Se o cdigo gentico no fosse universal no poderamos nos alimentar de vegetais
ou de outros animais.
( ) S possvel nos alimentar de animais e vegetais porque o cdigo gentico
universal.

2.7.3 Quais os dois principais tipos/grupos de genes quanto a regulao da expresso?


Exemplifique, utilizando o sistema de regulao da expresso gnica que regula a sntese
do triptofano em Escherichia coli. (A citao dos grupos no ser avaliado e sim a
exemplificao).

2.7.4 Quais os dois principais tipos/grupos de genes quanto a regulao da expresso?


Exemplifique, utilizando o sistema de regulao da expresso gnica OPERON LAC em
Escherichia coli. (A citao dos grupos no ser avaliado e sim a exemplificao).

2.7.5 O que ribosima?

2.7.6 Em meio de cultura onde estejam presentes duas fontes de carbono como a glicose
e a lactose, a Escherichia coli d preferncia para o uso da glicose (fonte de energia
mais barata), reduzindo a sntese das enzimas responsveis pela degradao da
lactose. O sistema de regulao da expresso gnica responsvel por esta regulao o
OPERON LAC. Descreva o funcionamento, ao nvel molecular, do sistema de regulao
da expresso gnica OPERON LAC em Escherichia coli, salientando os mecanismos
moleculares da regulao.

2.7.7 Descreva o funcionamento, ao nvel molecular, do sistema de regulao da


expresso gnica que regula a sntese do triptofano em Escherichia coli, salientando os
mecanismos moleculares da regulao.

2.7.8 Nveis de regulao gnica nos Eucariontes: a) Cite-os e b) Comente cada um


deles, evidenciando a regulao da expresso gnica.

2.7.9 Comente detalhadamente o processamento do hnRNA (transcrito primrio),


evidenciando a regulao da expresso gnica.

2.7.10 Como ocorre a regulao da expresso gnica pelo processamento dos


transcritos primrios em eucariotos?
13

2.7.11 Descreva os principais nveis de regulao da expresso gnica em eucariontes?

2.7.12 Qual o principal nvel de regulao gnica nos eucariontes? Justifique a sua
resposta e explique por que.

2.7.13 O que diferencia duas espcies, como por exemplo, o homem e o co: a) A
sequncia de bases do DNA, b) A sequncia de genes, c) O nmero de genes, d) Ambas
as espcies apresentam os mesmo genes, porm numa espcie se expressa um conjunto
de genes e em outra espcie se expressa outro conjunto de genes e e) Diferenas na
quantidade de protena produzida por genes idnticos em ambas as espcies. Marque as
respostas corretas e justifique (comente) as respostas erradas.

2.7.14 O que so ribozimas?

2.7.15 O que necessrio para os genes eucariontes se expressarem? Resposta: De


uma forma geral podemos afirmar que, inicialmente, os genes devem ser expostos, pois
esto complexados com as histonas nos cromossomos. Para isso, ocorre a influncia de
fatores como os do ambiente externo ou do tecido em que se encontram. Aps os genes
estarem livres das histonas eles so transcritos em hnRNA, os quais so processados a
mRNA. Estes so transportados para o citoplasma, onde so traduzidos. Os polipeptdios
formados so tambm processados at chegarem ao local onde iro atuar.

2.7.16 A duplicao do DNA extremamente precisa. Comente, sob todos os aspectos, o


que garante a duplicao extremamente precisa do DNA.

2.7.17 Qual a funo da sequncia lder no Operon do triptofano? Explique seu


funcionamento.

3 MUTAES NO MATERIAL GENTICO E TERATOGNESE

3.1 Indique se cada uma das seguintes proposies so verdadeira (V) ou falsa (F).
( ) Novos genes surgem devido as mudanas ambientais (temperatura, nutrientes,
umidade, etc.). ( ) A mutao no uma fonte importante de gerao de variabilidade
gentica. ( ) . ( ) A mutao uma mudana que ocorre no indivduo durante o
paquteno, devido a combinao gentica. ( ) A mutao a variabilidade gentica que
ocorre durante o encontro dos gametas e culmina com a formao do zigoto.

3.2 A mutao extremamente rara, casual e, na grande maioria das vezes no traz
benefcios. Comente a importncia da mutao como mecanismo de gerao de
variabilidade gentica.

3.3 O que so bases tautomricas?

3.4 a) Qual a importncia de se conhecer como surgem as mutaes? b) Quais os


fatores que causam as mutaes?
14

3.5 O Sr. Joo da Silva morava prximo a casa onde ocorreu o acidente com Csio, em
1987, em Goinia. O Sr. Joo tinha uma pequena criao de porcos. Um ano aps o
acidente com o material radioativo, nasceram, em uma ninhada de nove, dois leites com
hidrocefalia (herana autossmica recessiva). Como geneticista consultado, possvel
acreditar-se, como o Sr. Joo, que a hidrocefalia dos dois animais possa ter sido
consequncia do acidente? Por qu?
Resposta:
No. Duas mutaes, no mesmo locus, em dois indivduos diferentes, na mesma poca,
tm uma probabilidade quase zero de ocorrer. mais provvel que o gene mutante j
existisse na criao.

3.6 Em um rebanho de carneiros normais (todos normais), nasceu um nico animal com
pernas curtas. Como se pode testar se ele foi resultado de uma mutao dominante? Ou
de um efeito de teratgenos? E de mutao recessiva?
Resposta:
a) Cruzando-o com um normal, 1/2 dos descendentes ter pernas curtas, se foi mutao
dominante; b) Cruzando-o com um normal, nenhum descendente ter pernas curtas, se
foi teratognese; c) Se foi mutao recessiva, um dos pais j seria heterozigoto e, neste
caso, 1/2 dos descendentes tambm heterozigota. Cruzando-o com irmos, pais e
sobrinhos, deve aparecer outro afetado.

3.7 Comente o tema mutaes (No esquecendo a importncia, os tipos, a frequncia


ou taxa, o modo de ocorrncia, os fatores que causam e as aplicaes).

3.8 A maioria dos tipos de cncer so provenientes de mutaes somticas. A correlao


entre mutagenicidade e carcinogenicidade de mais de 90%. Baseando-se neste fato o
teste idealizado por AMES, o qual detecta produtos mutagnicos, utilizado na triagem
de produtos potencialmente carcinognicos. Explique o princpio do teste de AMES.
Resposta: Uma estirpe de salmonela (his-) cultivada em extrato de fgado, com e sem o
aditivo. Quando a estirpe cultivada em meio de cultura sem aditivo ocorrem poucos
revertentes naturais para hist+. Se o meio de cultura com o aditivo apresentar nmero de
revertentes significativamente maior do que a quantidade de revertentes naturais, significa
que o aditivo tem capacidade mutagnica.

3.9 Uma clula tem a capacidade de duplicar o seu material gentico, perpetuando-se de
gerao a gerao. Qualquer alterao que eventualmente modifique algum gene ser,
tambm, transmitida de gerao para gerao. Explique como ocorre o fenmeno da
mutao gnica e como pode ser transmitida para as futuras geraes.

3.10 Diferencie mutao de teratognese.

3.11 Classifique as mutaes ao nvel fenotpico e exemplifique.

3.12 Quando consideramos produtos mutagnicos, uma dosagem aguda (dose nica)
mais mutagnica do que uma dosagem crnica (distribuda ao longo do tempo). Explique
por que.
15

3.13 Indique se as afirmaes a seguir so verdadeiras (V) ou falsas (F), justificando sua
resposta: a)__ Uma dose crnica de mutagnico (ao longo do tempo) menos
mutagnica porque o organismo se acostuma com o produto mutagnico. b)__ Uma dose
crnica de mutagnico (ao longo do tempo) menos mutagnica porque com o tempo
possvel a regenerao e o restabelecimento da sequncia de bases do DNA.

3.14 Comente as relaes entre: mutao variabilidade gentica herana gentica.

4 BASES CITOLGICAS DA HERANA

4.1 Diviso celular

4.1.1 A mitose e a meiose so dois tipos de diviso celular. Com relao a esses
processos, assinale a(s) proposio(es) verdadeira(s). (01) A mitose uma diviso do
tipo equacional. (02) A meiose ocorre em quatro etapas sucessivas. (04) A meiose ocorre
na linhagem germinativa, quando da produo dos gametas. (08) A mitose ocorre nas
clulas somticas. (16) O nmero de cromossomos das clulas resultantes de ambos os
processos igual ao das clulas que lhes deram origem, porm somente as clulas que
sofreram meiose podem apresentar recombinao gentica. (32) Ambos os processos
ocorrem em todos os seres. (64) Em alguns organismos a mitose utilizada como forma
de reproduo. O somatrio das respostas corretas ( ).

4.1.2 Indique se cada uma das seguintes proposies so verdadeira (V) ou falsa (F).
( ) Quando sofre mutaes, estas so do tipo somticas e induzem a clula apoptose.
( ) Garante a manuteno das caractersticas genticas ao longo dos anos. ( ) Garante a
variabilidade gentica da espcie, atravs do crossing over. ( ) Reduz as caractersticas
genticas do indivduo pela metade, ou seja, incompletas. e. ( ) Reduz as caractersticas
da clula, por isso requer uma nova duplicao do material gentico. f. ( ) A dupla
fecundao dos vegetais quando ocorrem simultaneamente duas fecundaes, cada
uma gerando um zigoto. g. ( ) A dupla fecundao dos vegetais quando uma planta se
autofecundada e fecunda outra planta simultaneamente. h. ( ) A dupla fecundao dos
vegetais ocorre quando dois gros de plen germinam em um mesmo estigma.

4.1.3 O eucalipto uma espcie que pode ser multiplicada assexuada e sexuadamente.
Quais as diferenas e as consequncias genticas desses dois processos de
multiplicao? Justifique a sua resposta.

4.1.4 R3-2) Porque a meiose importante para a gentica e para o melhoramento de


plantas e animais? Fundamente e Justifique detalhadamente sua resposta.

4.1.5 R3-3) Sessenta clulas de um vegetal (ou animal) com a


constituio gentica AaBbDd representada a seguir sofrem B a
meiose: A partir destas 60 clulas pergunta-se:
b A
a) Represente uma destas clulas, em metfase I, destacando
d
cada uma das duplas fitas e sua constituio gentica.
b) Qual o nmero de orientaes possveis na metfase I? D
b) Quantas clulas so esperadas apresentando uma mesma
orientao?
16

c) Quantos gametas so esperados apresentando a constituio ABD?


d) Quantos tipos de gametas diferentes so esperados?

Resposta:
a) 2n-1 = 23-1 = 4 orientaes possveis na metfase I.
b) 60 clulas 4 orientaes
1/4 de cada orientao 60/4 = 60 x 1/4 = 15
c) 1 clula ---> meiose ---> 4 gametas
60 clulas --------------> X = 240 gametas
Cada orientao forma 2 tipos de gametas diferentes,
4 orientaes possveis = 8 tipos de gametas diferentes.
Ento 240 gametas / 8 tipos = 30 gametas de cada tipo.
So esperados 30 gametas do tipo ABD.
d) 8 tipos de gametas diferentes.

4.1.6 Determinada espcie vegetal (ou animal) apresenta quatro pares de cromossomos.
Considere em cada par de cromossomos um gene em heterozigose. A partir de 100
clulas que passam por meiose pergunta-se: a) Qual o nmero de orientaes possveis
na metfase I? b) Quantas clulas so esperadas apresentando uma mesma orientao?
c) Quantos gametas so esperados apresentando a constituio ABCD? d) Quantos tipos
de gametas diferentes so esperados?

4.1.7 R3-4) O alho (Allium sativum L.) uma espcie que s se reproduz por via
assexuada. Que implicao biolgica/gentica tem esse fato?

4.1.8 R3-5) Um citologista estudando a meiose de uma dada espcie identificou 2048
orientaes diferentes na metfase I.
a) Qual o provvel nmero de cromossomos no genoma dessa espcie?
b) Desconsiderando a ocorrncia de permuta gentica, qual o nmero esperado de
gametas diferentes?
Resposta:
a) O nmero de orientaes 2n-1, onde n o nmero de pares de cromossomos. 2n-1 =
2048, n = 12 cromossomos.
b) O nmero de gametas diferentes 2n, ou seja, 212 = 4096 gametas diferentes.

4.1.9 R3-6) Em citricultura comum enxertar-se borbulha de uma planta matriz de boa
qualidade em um cavalo de limo cravo. Porque a planta obtida continua produzindo
frutos s de boa qualidade como os da planta matriz?

4.1.10 R3-7) Um criador de sunos comprou um reprodutor da raa Duroc de excelentes


qualidades, e deseja que ele produza espermatozides idnticos ao que lhe originou.
a) Qual a probabilidade de que esse fato ocorra?
b) Qual a probabilidade de um de seus espermas apresentar cinquenta por cento dos
cromossomos provenientes do gameta que lhe deu origem? (Desconsidere a ocorrncia
de permuta gentica e lembre-se de que em sunos 2n=40)
Resposta:
a) 2n=40, n=20 (1/2)20
b)
17

20!
P10 pai = --------- (1/2)10 (1/2)10 = 184756 (1/2)20 = 0,1761
10 me
10! 10!

4.1.11 Um criador de bovinos comprou um reprodutor da raa Charolesa de excelentes


qualidades, e deseja que ele produza espermatozides idnticos ao que lhe originou.
a) Qual a probabilidade de que esse fato ocorra? b) Qual a probabilidade de um de seus
espermas apresentar cinquenta por cento dos cromossomos provenientes do gameta que
lhe deu origem? (Desconsidere a ocorrncia de permuta gentica e lembre-se de que em
bovinos 2n=60)

4.1.12 R3-8) O burro um excelente animal de trao, sendo um hbrido interespecfico


entre o jumento (Equus asinus, 2n=62) e a gua (Equus caballus, 2n=64). Apesar de seu
vigor fsico, ele no produz descendentes. Sugira algumas explicaes sob o ponto de
vista citolgico para a sua esterilidade.

4.1.13 O cavalo apresenta 2n=64. Faa um paralelo da variao no nmero de


cromossomos, nmero de cromtides e quantidade de DNA (C), por ncleo, durante todas
as fases da meiose, no cavalo.
Resposta: 2n = 64
NMERO DE
NMERO DE CROMTIDES DNA
FASES DA MEIOSE CROMOSSOMOS
POR NCLEO (C)
POR NCLEO
Interfase G1 64 (32pai + 32me) 64 (32pai + 32me) 2C
S* 64 (32pai + 32me) 128 (64pai + 64me) 4C
G2 64 (32pai + 32me) 128 (64pai + 64me) 4C
Prfase I
Leptteno 64 128 4C
Zigteno 64 128 4C
Paquteno 64 128 4C
Diplteno 64 128 4C
Diacinese 64 128 4C
Metfase I 64 128 4C
Anfase I 64 128 4C
Telfase I 32 64 2C
Intercinese 32 64 2C
Prfase II 32 64 2C
Metfase II 32 64 2C
Anfase II 32 64 2C
Telfase II 32 32 1C
Gametas 32 32 1C
* Considera-se o final da fase de duplicao do DNA.

4.1.14 O burro um excelente animal de trao, sendo um hbrido interespecfico entre o


jumento (Equus asinus, 2n=62) e a gua (Equus caballus, 2n=64). Apesar de seu vigor
fsico, ele no produz descendentes. H ou no algum problema nas divises mitticas
das clulas do epitlio e da epiderme do burro? Explique porque. (Resposta no
justificada adequadamente no ser avaliada).
18

4.1.15 Faa um paralelo entre a mitose e a meiose, comentando as principais diferenas.


Considere as diferenas nos mecanismos, assim como nos resultados finais e em que
tipo de clula ocorre.
Resposta:
Consulte SUZUKI et al. 1992, Figura 3.5 Comparao das principais caractersticas da
mitose e da meiose (Pgina 38).

4.1.16 Em qual dos organismos seria esperado maior variabilidade [entre os de


reproduo assexuada, entre os autgamos (reproduzem-se preferencialmente pela
autofertilizao) ou entre os algamos (reproduzem-se preferencialmente pela fertilizao
cruzada)]; Explique como pode surgir a variabilidade, considerando cada um dos tipos de
reproduo. OBS.: A avaliao dar-se- baseada na explicao.

4.1.17 Explique o que e quais as consequncias da segregao independente dos


cromossomos durante a meiose; Em que fase da meiose ocorre?

4.1.18 Quais so os principais eventos que ocorrem na prfase I e quais suas


consequncias para os descendentes?

4.1.19 Quais as consequncias genticas/funes da meiose?


Resposta: Reduo do nmero de cromossomos para n, o que mantm o nmero de
cromossomos constante no decorrer das geraes e promove a recombinao dos
cromossomos e das cromtides.

4.1.20 Comente as principais diferenas entre as seguintes fases dos ciclos celulares
mittico e meitico: a) metfase e metfase I, b) Anfase I e Anfase II e, c) Anfase e
Anfase II.

4.1.21 Permuta gentica: Demonstre o que , quando e em que fase da diviso celular
ocorre. Qual a importncia e finalidades desta, sob o ponto de vista celular e da gerao
de variabilidade gentica.

4.1.22 A reproduo sexuada dos seres vivos superiores foi o principal mecanismo
responsvel pela exploso de variabilidade gentica na terra, permitindo o surgimento de
milhares de espcies adaptadas aos mais remotos ecossistemas. Comente como surge a
variao gentica durante o ciclo de reproduo sexuada, salientando os principais
pontos.

4.1.23 Descreva maneiras de provar que a Primeira Lei de Mendel verdadeira.

4.1.24 Quais so os mecanismos que geram variabilidade durante a formao dos


gametas? Explique como ocorre e diferencie estes mecanismos.

4.1.25 Qual o processo fundamental para que genes situados em cromossomos


diferentes se distribuam independentemente uns dos outros.
Resposta: A orientao ao acaso de cada bivalente, quando da sua migram para a placa
equatorial, durante a metfase I (meiose I). Esta a base citolgica da 2o lei de Mendel, a
lei da distribuio independente.

4.1.26 Durante a diviso celular (meiose) o nmero de cromossomos reduzido pela


metade, resultando em clulas n. Descreva a fase da diviso celular e qual o mecanismo
19

(durante esta fase) o responsvel pela formao de gametas com o nmero de


cromossomos reduzidos pela metade (n).

4.1.27 Qual a funo do telmero (durante as divises celulares)?

4.1.28 Diferencie metfase de metfase I?

4.1.29 O que o nuclolo e qual a sua relao com o ciclo de diviso celular?

4.1.30 Como surge a variabilidade gentica na metfase I?

4.1.31 As clulas provenientes da mitose apresentam a mesma constituio gentica.


Explique este fato?
Resposta: A identidade em constituio gentica das clulas filhas pode ser notada
comparando-se com a constituio da clula me na fase G1, e consequncia da
replicao semiconservativa dos cromossomos na fase S e tambm da separao das
cromtides irms para os plos opostos na anfase.

4.1.32 Uma clula me produz por meio da mitose duas clulas idnticas geneticamente.
Isto significa que todas as clulas que compem o indivduo foram derivadas da clula
ovo ou zigoto, via processo mittico, e portanto so idnticas a ela. J que as clulas
somticas so todas iguais, como explicar a formao dos diferentes rgos neste
indivduo? Por que esses rgos ocorrem sempre no local certo e com suas
caractersticas?
Resposta: As respostas a estas indagaes so obtidas conhecendo-se o processo de
diferenciao celular. Considerando que todas as clulas so totipotentes, isto , contm
informaes suficientes para originar um indivduo completo, idntico quele ao qual elas
pertencem, pode-se dizer, de um modo muito simplista, que a diferenciao celular nada
mais do que o ato de ligar e desligar os genes no local certo e no momento certo.
Assim, nos tecidos que constituem um determinado rgo s esto ligados aqueles
genes que condicionam as caractersticas associadas a ele.

4.1.33 Descreva os mecanismos responsveis pela gerao de variabilidade gentica e


qual sua importncia no surgimento de indivduos adaptados a diferentes ambientes.

4.1.34 Quais os momentos fundamentais, durante a diviso celular, para que ocorra: a) A
recombinao gentica e; b) A ampliao da variabilidade gentica.

4.1.35 Quais os momentos mais importantes que ocorrem na Profase I e quais suas
consequncias?

4.1.36 A existncia de variao gentica comum a todas as espcies biolgicas e


ocorre praticamente para todas as caractersticas de uma espcie. Nos organismos de
reproduo sexuada existem fases, durante o ciclo vital, as quais permitem o surgimento
de variao gentica. Cite todas estas fases e descreva cada uma delas, evidenciando
como surge a variao gentica.

4.1.37 4. Demonstre citogeneticamente a formao dos gametas (meiose), salientando


os tipos de gametas que podem ser formados por centenas de clulas em diviso,
desconsiderando a permuta gentica e considerando a distribuio independente de dois
genes, em cada uma das situaes a seguir: a) Os genes A e B esto em homozigose
20

recessiva, b) Os genes A e B esto em heterozigose e, c) O gene A em homozigose


dominante e o gene B em heterozigose. OBS.: Nas representaes da meiose utilize a
fase de mxima condensao dos cromossomos, a metfase.

4.1.38 Durante o ciclo de reproduo sexual, quais os momentos em que pode correr
variabilidade gentica? Explique detalhadamente como surge a variabilidade em cada um
destes momentos.

4.1.39 Explique como ocorre a segregao independente dos cromossomos durante a


meiose (utilize-se da citogentica, mostrando as possibilidades de segregao
representando os cromossomos).

4.1.40 Porque o caritipo definido e estudado na metfase?

4.1.41 A A figura representa o ciclo celular e um diagrama da durao das diferentes


etapas desse ciclo em determinadas clulas.

Quanto tempo necessrio para que essas clulas dupliquem o seu DNA?
a) 2 horas e 30 minutos.
b) 3 horas.
c) 4 horas.
d) 6 horas e 30 minutos.
e) 9 horas.

4.1.42 A associao correta, de cima para baixo, entre as fases da mitose e os


fenmenos que nelas ocorrem
1. Telfase - 2. Prfase - 3. Metfase - 4. Interfase
( ) Cromossomos na placa equatorial
( ) Formao do fuso mittico
( ) Desaparecimento da membrana nuclear
( ) Duplicao do DNA
( ) Citocinese

a) 3, 1, 2, 4, 4.
b) 1, 2, 4, 3, 3.
c) 3, 2, 2, 4, 1.
d) 4, 4, 3, 2, 1.
e) 1, 3, 2, 1, 2.

4.1.43
21

4.2 Gametognese

4.2.1 Marque as afirmativas verdadeiras com (C) e as falsas com um (E): .( ) As clulas
da pele e os gametas do mesmo animal contm o mesmo nmero de cromossomos;
.( ) Um cromossomo pode parear-se com qualquer outro cromossomo na mesma clula
em meiose; .( ) Os gametas de um animal podem conter mais cromossomos maternos
que as clulas do seu corpo; .( ) De 10 cromossomos num espermatozide maduro, cinco
so sempre de origem materna; .( ) De 22 cromossomos contidos num ovcito primrio,
15 podem ser de origem paterna; .( ) Partes homlogas de dois cromossomos colocam-se
em posio oposta, uma em relao outra, durante o pareamento; .( ) Num mesmo
animal, um espermatozide tem a metade dos cromossomos (ps-mitticos) de uma
espermatognia; .( ) Na mitose ocorre o pareamento de cromossomos.
Resposta:
(E); (E); (E); (E); (E); (C); (C); (E).

4.2.2 Se a espermatognese normal e todas as clulas sobrevivem, quantos


espermatozides resultaro a partir de a) 50 espermatcitos primrios; b) 50
espermtides; e se a ovognese normal e todas as clulas sobrevivem, quantos vulos
resultaro a partir de 12 ovcitos primrios?

4.2.3 No homem, um tipo de miopia (uma anormalidade nos olhos) dependente de um


gene (alelo) dominante (M). a) Represente diagramaticamente (nos cromossomos) um
cruzamento entre uma mulher com miopia que heterozigota (Mm) e um homem normal
(mm). Indique os tipos de gametas que cada um dos pais pode produzir e os resultados
esperados a partir do cruzamento. a) Comeando com a mulher mope, faa um diagrama
do processo de ovognese que origina o vulo envolvido na produo de um criana com
miopia. Indique os estgios.

4.2.4 Esquematize a ovognese, indicando todos os estgios. Comente a importncia de


cada uma das fases da ovognese.
Resposta:
Consulte GARDNER et al. 1986 Figura 3-6, Sequncia mitica de um macho e uma
fmea animal (Pgina 36).

4.2.5 Cite e comente as diferenas entre espermatognese e a ovognese nos


mamferos.

4.2.6 Utilizando os conhecimentos genticos descreva e/ou comente:


a) Megasporognese (vegetais); b) Microsporognese (vegetais); c) Como ocorre a dupla
fertilizao nos vegetais; d) O destino dos ncleos do vulo e do gro de plen e;
e) Xenia.

4.2.7 Comente a relao entre a durao das fases haplide e diplide no ciclo vital das
algas e fungos em geral e dos grandes grupos vegetais com a sua sequncia evolutiva.

4.2.8 Considere uma espcie animal em que o nmero haplide de cromossomos de


40. Durante o processo de espermatognese normal, um macho dessa espcie produzir:
a) espermatognias com 40 cromossomos;
b) espermtides com 20 cromossomos;
c) espermatcitos secundrios com 40 cromossomos;
22

d) espermatcitos primrios com 20 cromossomos;


e) espermatozides com 10 cromossomos.

4.2.9 Diferencie a mitose da meiose II, especialmente quanto aos mecanismos que
propiciam a criao de variabilidade gentica.

4.2.10 Quantos tipos de gametas diferentes so possveis a partir de um nico meicito


(a partir de uma nica clula), demonstre a sua afirmao e argumente sob todos os
aspectos que julgar necessrio (avaliao ser baseada na demonstrao e
argumentao).

4.2.11 Considerando a citogentica e a gentica mendeliana: A) Represente


citogeneticamente as trs metfases {metfase da mitose, metfase da meiose I e
metfase da meiose II}, considerando dois pares de cromossomos (um metacntrico e um
telocntrico); B) Represente todas as possibilidades de orientaes metafsicas
considerando dois pares de cromossomos, desconsiderando a permuta gentica e,
comente qual o resultado esperado quando considerada a permuta gentica; C) Faa
uma generalizao para numero de orientaes metafsicas e nmero de gametas
diferentes, considerando a meiose sem permuta gentica para n pares de cromossomos e
D) Desenvolva um raciocnio associando estas representaes com a Primeira Lei de
Mendel e a Segunda Lei de Mendel.

5 GENTICA MENDELIANA

5.1 Considere que, em humanos, a capacidade de enrolar a lngua em U, covas na face


e pigmentao normal de pele so caracteres mendelianos dominantes, enquanto que a
incapacidade de enrolar a lngua em U, a ausncia de covas na face e o albinismo so
caracteres recessivos. Qual o percentual de indivduos homozigotos para os trs
caracteres, nascidos do cruzamento de um homem homozigoto dominante com uma
mulher homozigota recessiva? Marque seu resultado no carto-resposta. ( )

5.2 Marque verdadeiro ou falso. Se falso justifique: ( ) Na metfase I ocorre o


pareamento ao acaso dos cromossomos. ( ) Na metfase I ocorre a separao ao acaso
dos cromossomos. ( ) Na metfase I ocorre o pareamento dos cromossomos, que pode
ser aleatrio. ( ) Segregao independente dos cromossomos a separao dos
cromossomos, produzindo alelos distintos. ( ) Segregao independente dos
cromossomos significa que os alelos se distribuem ao acaso durante a fecundao.
( ) Segregao independente a probabilidade dos alelos se unirem aleatoriamente.
( ) Segregao independente quando um gene no depende do outro para se
expressar. ( ) Segregao independente dos cromossomos quando cada alelo
responsvel por uma caracterstica independe do outro que responsvel por outra
caracterstica. ( ) A variabilidade gentica gerada durante o ciclo da reproduo sexuada
resultado do cruzamento de alelos portadores de caractersticas. ( ) Com sucessivas
autofecundaes ocorre aumento da homozigose e reduo da variabilidade gentica.
( ) Durante as geraes de autofecundao surge variabilidade gentica, ocorre somente
variao ambiental. ( ) A variabilidade gentica no herdvel. ( ) Os novos alelos se
forma pelas interaes gnicas e pela ligao gnica. ( ) A multiplicao assexuada
uma autofecundao. ( ) .
23

5.3 Em determinada espcie dioica existem dois genes situados em cromossomos


autossmicos no homlogos; cada um dos genes possui dois alelos, com interao
allica de dominncia completa. Foi cruzado um indivduo duplo homozigoto dominante
com um duplo homozigoto recessivo, obtendo-se a gerao F1. Esta foi intercruzada e
obtiveram-se 352 descendentes. Qual o nmero esperado de descendentes que sero
machos com o mesmo fentipo de seus pais [(Demonstre o desenvolvimento de sua
resposta] ( ).

5.4 A variao fenotpica observada em uma caracterstica pode ser atribuda a fatores
genticos e ambientais. Como pode comprovar que a variao observada em uma
caracterstica (como por exemplo a variao na altura em plantas de eucaliptus)
apresenta variao gentica.

5.5 Considere que o mosquito asitico apresenta 2n = 4, com 5 genes em cada par de
cromossomos e com dois alelos em cada um dos genes. Baseado nos dados fornecidos
discuta os mecanismos de gerao de variabilidade gentica e a importncia relativa de
cada um deles, nesta espcie.

5.6 Considere que o mosquito asitico apresenta 2n = 4, com 1 gene em cada par de
cromossomos e com dois alelos em cada um dos genes. Com base nestes dados
demonstre citogeneticamente a Segunda Lei de Mendel.

5.7 Considere que o mosquito asitico apresenta 2n = 4, com 3 genes em cada par de
cromossomos e com dois alelos em cada um dos genes. Com base nestes dados
demonstre citogeneticamente: a) a Segunda Lei de Mendel e b) a permuta gentica.

5.8 Demonstre citogeneticamente a primeira Lei de Mendel (Lei da segregao) e a


segunda lei de Mendel (Lei da segregao independente). Somente sero consideradas
as ilustraes, ou seja, a demonstrao citogentica.

5.9 Demonstre citogeneticamente a) a Primeira Lei de Mendel e b) a Segunda Lei de


Mendel; evidenciando os tipos e propores de gametas formados.
(Demonstrar citogeneticamente representar a clula, enfatizando os cromossomos e a
representao de genes, durante as diversas fases do ciclo celular, evidenciando o
comportamento dos genes e consequncias em termos de tipos e propores de clulas
ou gametas formados).

5.10 Represente citogeneticamente a hiptese das frequncias genotpicas esperadas no


RC2, considerando um gene com dominncia completa.

5.11 Represente citogeneticamente a hiptese das frequncias genotpicas esperadas na


gerao F2, considerando dois genes com dominncia completa (Represente os pais e
demais geraes necessrias para obter a gerao F2, os tipos e frequncias de gametas
formados e demonstre as frequncias genotpicas esperadas para a gerao F2,
explicadas pela hiptese citogentica apresentada).
24

5.12 R4-1) No milho a semente pode ser lisa (endosperma com amido) ou enrugada
(endosperma com acar solvel em gua). A partir do cruzamento de dois cultivares
puros, sendo um com sementes lisas e outro com sementes enrugadas (milho doce),
obtiveram-se os seguintes resultados:
Populaes Fentipos das sementes (nmero)
Lisa Enrugada
P1 400 --
P2 -- 320
F1 560 --
F2 370 125

a) Fornea uma provvel explicao para a herana do carter.


b) Se uma das espigas F2 no apresentar a proporo fenotpica 3 lisa : 1 enrugada, qual
seria a explicao?
c) Quantas sementes lisas da gerao F2 deveriam ser semeadas para originar 300
plantas puras?
d) H outra maneira de comprovar que ocorreu segregao, alm do resultado observado
na F2?
e) Se plantas provenientes de sementes lisas da gerao F2 forem autofecundadas, qual
seria o resultado genotpico e fenotpico esperado?
Resposta:
a) Herana monognica, havendo dominncia do alelo que controla semente lisa em
relao ao alelo que condiciona semente enrugada.
c) 900 sementes lisas
d) Atravs do cruzamento teste
e) 1/2 SuSu : 1/3 Susu : 1/6 susu; 5/6 lisas : 1/6 enrugada

5.13 R4-2) Considerando o carter textura da semente do milho, relatado no problema


anterior, o que ocorreria se o campo de plantas F1 recebesse 30% dos gros de plen de
uma plantao prxima, homozigota para sementes lisas?
Resposta:
0,5 Su + 0,5 su = 1,0 ou 100%
H duas possibilidades de adicionarmos 30%. Uma delas adicionarmos 30% ao total
dos gros de plen, isto aos 100%. A outra possibilidade adicionarmos os 30% aos
50% Su. No primeiro caso a resposta 80,77% lisas : 19,23% enrugadas e no segundo
caso a resposta 82,5% lisas : 17,5 % enrugadas.
O problema claro na pergunta, referindo-se ao primeiro caso, mas ser resolvido
tambm o segundo caso, o qual no est sendo questionado neste problema, ou seja, se
adicionarmos 30% de plen Su aos 50% Su j existentes.
Primeira Interpretao: (0,5 + 0,3) Su + 0,5 su = 1,3 ou 130%
Para voltarmos aos 100% dividimos os dois lados da igualdade pelo valor 1,3 ou 130%.
(0,5 + 0,3) Su + 0,5 su = 1,3 ou 130%
----------------------- ---
1,3 1,3
0,6154 Su + 0,3846 su = 1,0 ou 100%
25

Gametas Masculino
SuSu = 0,3077 Lisa 80,77%
0,6154 0,3846 Susu = 0,5000
Su su
Feminino

0,5 Su 0,3077 0,1923 susu = 0,1923 Rugosa 19,23%


SuSu Susu
1,00 100%

0,5 su 0,3077 0,1923


Susu susu

Segunda Interpretao -------------------------------------------


0,5 + 30% = 0,65 Su O restante dos 100% su
1,0 - 0,65 = 0,35 su

Gametas Masculino
0,65 0,35 SuSu = 0,325 Lisa 82,5%
Su su Susu = 0,500
0,5 Su 0,325 0,175
Feminino

SuSu Susu
susu = 0,175 Rugosa 17,5%

0,5 su 0,325 0,175


Susu susu
1,00 100%

5.14 No milho a semente pode ser lisa (endosperma com amido) ou enrugada
(endosperma com acar solvel em gua). As sementes da gerao F1 so todas lisas.
Quais seriam as frequncias genotpicas e fenotpicas esperadas para a prxima gerao
se o campo de plantas F1 recebesse 38% dos gros de plen de uma plantao prxima,
homozigota para sementes lisas?

5.15 R4-3) Em galinhas a ausncia de penas no pescoo devida ao alelo dominante N,


e a presena de penas, ao alelo recessivo n. Qual o procedimento para a seleo mais
rpida, a partir de uma populao F2, de galinhas homozigotas com pescoo pelado?
Resposta:
Cruzar machos e fmeas de pescoo pelado da gerao F2 com fmeas e machos de
pescoo normal. Observar a descendncia de cada cruzamento, aquelas que no
segregam so provenientes de indivduos da F2 de gentipo NN, que o desejado.

5.16 R4-4) Um touro mocho (sem chifres fentipo dominante) foi cruzado com trs
vacas. Com a vaca A, aspada, foi obtido um descendente mocho. Com a vaca B, tambm
aspada obteve-se um descendente aspado. Com a vaca C, mocha, obteve-se um
descendente aspado.
a) Qual o provvel gentipo dos animais envolvidos nos cruzamentos?
26

b) Como proceder para obter um plantel com pelo menos 20 animais mochos
homozigotos, a partir do cruzamento do touro com a vaca C?
Resposta:
a) Touro Mm, vaca A mm; vaca B mm e vaca C Mm.
b) Cruzar os descendentes machos e fmeas mochos com animais aspados. As
descendncias destes cruzamentos que no segregam identificam os machos e fmeas
homozigotos mochos (MM). Estes devero ser intercruzados at se obter os 20 animais
desejados.

5.17 R4-5) Em alface o alelo C condiciona folha crespa e o recessivo c, folha lisa. A partir
do gentipo Cc:
a) Quais as propores genotpicas e fenotpicas esperadas aps a terceira gerao de
autofecundao?
b) Qual seria o resultado esperado na quarta gerao, se as plantas fossem cruzadas
aleatoriamente, em vez de autofecundadas?
Resposta:
a) A cada gerao de autofecundao o nmero de heterozigotos diminui 50%.
Proporo fenotpica
Gerao Proporo genotpica Total
Recortada Lisa
Planta 1 Aa =1 100%
original 100% =100%
Primeira 1/4 AA 2/4 Aa 1/4 aa =1 75% 25%
25% 50% 25% =100%
Segunda 3/8 AA 2/8 Aa 3/8 aa =1 62,5% 37,5%
37,5% 25% 37,5% =100%
Terceira 7/16 AA 2/16 Aa 7/16 aa =1 56,25% 43,75%
43,75% 12,5% 43,75% =100%
b) 1/4 CC : 2/4 Cc : 1/4 cc; 3/4 crespa : 1/4 lisa

5.18 Qual a frequncia esperada aps sucessivas geraes de autofecundao, a partir


de um heterozigoto para um gene (Aa). Demonstre sua resposta.

5.19 R4-7) No tomateiro a folha pode ser normal (bordos recortados) ou batata (bordos
lisos). Foram realizadas vrios cruzamentos envolvendo estes dois fentipos e obtidos os
seguintes resultados:
Fentipo das plantas Fentipo dos descendentes (nmero)
envolvidas nos cruza- ----------------------------------------
mentos Normal Batata
-----------------------------------------------------------------
1) Normal X Batata 92 0
2) Normal X Normal 155 52
3) Batata X Batata 0 83
4) Normal X Batata 47 43
5) Normal X Normal 85 0
a) Fornea uma provvel explicao para a herana do carter.
b) Especifique o gentipo das plantas envolvidas nos cruzamentos.
Resposta:
27

a) Herana monognica, havendo dominncia do alelo que controla folha normal em


relao ao alelo que condiciona folha batata. b) BB x bb, Bb x Bb, bb x bb, Bb x bb, BB x
B_.

5.20 R4-8) Em um trabalho para estudar a herana da poca de florescimento em


pepino, foram obtidos os seguintes resultados:
Nmero de plantas em florescimento
Populaes ------------------------------------------
Precoce Tardio
------------------------------------------------------------------
P1 50 --
P2 -- 50
F1 50 --
RC1 (F1 X P1) 195 --
RC2 (F1 X P2) 101 91
F2 281 80
a) Fornea todas as interpretaes genticas e estatsticas para estes resultados.
b) Quantas sementes F2 necessitariam ser semeadas para se obter 150 plantas com
florescimento tardio?
Resposta:
a) X2 F2 = 1,55 n.s. Herana monognica havendo dominncia do alelo que controla
florescimento precoce em relao ao alelo que controla florescimento tardio. Utilize esse
resultado e explique os dados das demais populaes.
b) 600 sementes.

5.21 R4-9) No cruzamento entre os cultivares de tomateiro Santa Cruz (P1), que possui
hipoctilo roxo e folha normal, com o cultivar Folha Batata (P2), que apresenta hipoctilo
verde e folha batata, foram obtidos os seguintes resultados:
Geraes
Fentipos
P1 P2 F1 F2 RC1 RC2
Hip. roxo Folha normal 1 25 238 163 45
Hip. roxo Folha batata 75 43
Hip. verde Folha normal 80 39
Hip. verde Folha batata 1 26 44
a) Interprete geneticamente esses resultados.
b) Esquematize os cruzamentos realizados.
c) Quais os resultados que indicam a ocorrncia da distribuio independente?
d) Em que fase da meiose e em qual gerao ocorreu a distribuio independente para
produzir esses resultados?
e) Formule a hiptese da frequncia esperada em F2, considerando a presena de um
gene letal para a caracterstica cor do hipoctilo, teste e interprete esta hiptese frente
aos dados observados acima (X2T (p=0,05) GL=1 = 3,84; X2T (p=0,05) GL=2 = 5,99; X2T (p=0,05) GL=3 =
7,82 e X2T (p=0,05) GL=4 = 9,49).
f) Formule a hiptese da frequncia esperada em F2, considerando a presena de um
gene pleiotrpico para a cor do hipoctilo e tipo de folha, teste e interprete esta hiptese
frente aos dados observados acima (X2T (p=0,05) GL=1 = 3,84; X2T (p=0,05) GL=2 = 5,99; X2T (p=0,05)
2
GL=3 = 7,82 e X T (p=0,05) GL=4 = 9,49).
Resposta:
28

a) Cada carter apresenta herana monognica com dominncia completa dos alelos que
condicionam hipoctilo roxo(A) e folha normal(C). A distribuio destes genes
independente.
b) F1: AACC x aacc F2: AaCc x AaCc
RC1: AaCc x AACC RC2: AaCc x aacc
c) F2 e RC2
d) Metfase I e Anfase I dos meicitos da gerao F1

5.22 No cruzamento entre dois cultivares de eucalipto Horiz (P1), que possui hipoctilo
roxo e folha normal, com a cultivar Rispid (P2), que apresenta hipoctilo verde e folha
oval, foram obtidos os seguintes resultados:
Fentipos Gerao Cruzamento teste
------------------------------- (F1 x testador)
P1 P2 F1 F2-Fe
Cor Hip. Tipo folha CT-Fo CT-Fe
Hip. roxo Folha normal 1 ___ 45 ___
Hip. roxo Folha oval 25 ___ 43 ___
Hip. verde Folha normal ___ 39 ___
Hip. verde Folha oval 1 ___ 44 ___
Total 1,00 171 1,00
a) Formule a hiptese de frequncias esperadas em F2 (F2-Fe), considerando dois genes
(um para cor do hipoctilo e outro para tipo de folha) com distribuio independente.
Demonstre citogeneticamente sua hiptese e apresente as frequncias esperadas para
cada um dos fentipos acima.
b) Para o cruzamento teste (F1 x testador), formule a hiptese de ligao gnica,
considerando que o gene da cor do hipoctilo est distanciado de 15 unidades mapa do
gene do tipo de folha: Apresente a frequncia esperada para cada um dos fentipos (CT-
Fe) e demonstre citogeneticamente sua hiptese. Com base nos dados observados para
o cruzamento teste (CT-Fo), teste a hiptese formulada e apresente as interpretaes
genticas. (X2T (p=0,05) GL=1 = 3,84; X2T (p=0,05) GL=2 = 5,99; X2T (p=0,05) GL=3 = 7,82 e X2T (p=.0,05)
GL=4 = 9,49).

5.23 R4-11) O arroz possui 2n=24 cromossomos. Considere que em uma planta ocorra
um alelo dominante em cada cromossomo e o alelo recessivo correspondente no seu
homlogo, isto , a planta heterozigota para esses doze genes. Se essa planta for
autofecundada, pergunta-se:
a) Qual a frequncia esperada dos descendentes com o fentipo condicionado pelo alelo
recessivo dos doze genes?
b) Qual a frequncia esperada dos descendentes com o mesmo gentipo da planta
autofecundada?
c) Qual a frequncia esperada dos descendentes com o mesmo fentipo da planta
autofecundada?
d) Quais seriam esses resultados se estas plantas fossem autofecundadas por mais uma
gerao?
Resposta:
|-------------------------|
a) a(1/2)12 * a(1/2)12 = (1/4)12; | (1/4)12 aa |A |a | |
b) (1/2)12 ou Aa(1/4)12 + aA(1/4)12 | (1/2)12 Aa -+--+--| |
c) (3/4)12 | (3/4)12 AA+Aa A|AA|Aa| |
29

d) (3/8)12, (1/4)12, (5/8)12 | a|Aa|aa| |


AA Aa aa | ------- |
3/8 1/4 3/8 |-------------------------|

5.24 R4-12) Na mandioca, razes marrons so devidas ao alelo dominante B e razes


brancas devidas ao alelo recessivo b. Fololos estreitos so devidos ao alelo dominante L
e fololos largos devidos ao alelo recessivo l. Uma planta de razes marrons e fololos
estreitos foi cruzada com outra de razes brancas e fololos largos, e produziram 40
descendentes com razes marrons dos quais a metade tinha fololos estreitos e a outra
metade fololos largos. Quais os gentipos dos genitores e a proporo genotpica dos
descendentes?
Resposta:
BBLl x bbll 1/2 BbLl e 1/2 Bbll

5.25 R4-13) Em equinos o alelo dominante T responsvel pelo trote e o alelo recessivo
t responsvel pela marcha. Para a cor de pelagem o alelo A responsvel pelo fentipo
baio e o alelo recessivo a pelo fentipo preto. Um criador possui um cavalo marchador e
preto e vrias guas puras para o trote e baias (homozigotas para as duas
caractersticas). Como o criador deseja obter animais puros marchadores e baios, qual
deve ser seu procedimento? Explique.
Resposta:
Cruzar o cavalo com todas as guas. Cruzar os descendentes da F1 machos e fmeas e
obter na gerao F2 os animais marchadores e baios (ttA_). Esses animais devero ser
cruzados com testadores (fentipos marchador e preto), para identificar os marchadores e
baios homozigotos.

5.26 R4-14) Uma planta de pepino de gentipo BBCCTTWW foi cruzada com outra de
gentipo bbccttww para produzir a gerao F1, a qual foi autofecundada para obteno da
gerao F2. Assumindo que esses genes controlam as seguintes caractersticas: B
espinhos pretos, b espinhos brancos; C resistncia ao vrus do mosaico, c suscetibilidade
ao vrus do mosaico; T presena de gavinhas, t ausncia de gavinhas; W fruto imaturo de
cor verde, w fruto imaturo de com branca.
a) Que proporo da F2 apresentar o fentipo espinhos brancos, suscetibilidade ao vrus
do mosaico, ausncia de gavinhas e fruto de cor branca?
b) Que proporo da F2 apresentar o fentipo espinhos pretos, resistncia ao vrus do
mosaico, presena de gavinhas e fruto imaturo de cor verde?
c) Que proporo da F2 genotipicamente semelhante gerao F1?
d) Quais seriam as respostas dos itens anteriores se os genitores apresentassem
gentipos BBCCttww e bbccTTWW?
e) Quais seriam as respostas se as plantas F2 fossem autofecundadas at a gerao F4?
Resposta:
a) 1/256; b) 81/256; c) 1/16; d) as mesmas; e) 7/164; 9/164; 1/4096

5.27 Explique como proceder para determinar a herana de uma certa caracterstica
desconhecida at o momento, como por exemplo a cor da flor da jurubeba?

5.28 Explique como proceder para determinar a herana de uma certa caracterstica
desconhecida at o momento, como por exemplo o comprimento dos pelos da capivara?
30

5.29 Quais so as leis de Mendel? (Explique detalhadamente cada uma delas).

5.30 Sugira uma maneira de provar a ocorrncia da primeira lei de Mendel?

5.31 Uma mulher apresenta uma anormalidade rara nas plpebras chamada ptose, que a
impossibilita abrir completamente os olhos. Descobriu-se que esta condio
determinada por um nico gene dominante (P). O pai da mulher tinha ptose, mas sua me
tinha plpebras normais. a) Quais so os provveis gentipos da mulher, de seu pai e de
sua me? b) Que proporo de seus filhos espera-se que tenha ptose se ela casar com
um homem com plpebras normais?
Resposta:
(a) mulher, Pp; pai dela, Pp; me dela, pp. (b) Espera-se que a metade de seus filhos
tenham ptose.

5.32 Em camundongos, o alelo C para pelagem colorida dominante sobre o alelo c para
pelagem branca. O alelo para comportamento normal V dominante sobre o alelo para
comportamento valsador v. D os provveis gentipos dos camundongos parentais
(cada par foi acasalado repetidamente e produziu os seguintes resultados):
a) Camundongo colorido normal cruzado com camundongo branco normal produziu 29
camundongos coloridos normais e 10 camundongos coloridos com comportamento
valsador; b) Camundongos coloridos normais cruzados com camundongos coloridos
normais produziu 38 camundongos coloridos normais; 15 camundongos coloridos com
comportamento valsador; 11 camundongos brancos normais; e 4 camundongos brancos
com comportamento valsador; c) Camundongos coloridos normais cruzados com
camundongos brancos com comportamento valsador produziu 8 camundongos coloridos
normais; 7 camundongos coloridos com comportamento valsador; 9 camundongos
brancos normais; e 6 camundongos brancos com comportamento valsador.
Resposta:
a) C_V_ x ccV_ b) C_V_ x C_V_ c) C_V_ x ccvv
29 C_V_ 38 C_V_ 8 C_V_
10 C_vv 15 C_vv 7 C_vv
CCVv x ccVv 11 ccVV 9 ccV_
4 ccvv 6 ccvv
CcVv x CcVv CcVv x ccvv

5.33 Em coelhos, a pelagem preta condicionada por um gene dominante (B) e a


pelagem marrom pelo alelo recessivo (b). A pelagem de comprimento normal
determinada pelo gene dominante (R) e a pelagem curta (rex) pelo alelo recessivo (r).
a) Esquematize os resultados obtidos na F1 e F2 de um cruzamento entre um coelho
homozigoto preto com pelagem de comprimento normal e um coelho marrom, rex. b) A
partir do cruzamento acima, que proporo de coelhos pretos com pelagem normal da F2
espera-se que seja homozigota para ambos os pares de genes? c) Faa um diagrama de
um cruzamento teste, em que o indivduo a ser testado seja a F1.
Resposta:
b) 1/16 c) BbRr x bbrr
31

5.34 Em uma espcie animal o gene A controla a presena ou a ausncia de cauda. O


alelo A determina presena e o alelo a determina ausncia de cauda. Foram realizadas
vrios cruzamentos envolvendo estes dois fentipos e obtidos os seguintes resultados:
-----------------------------------------------------------------
Fentipo dos indivduos Fentipo dos descendentes (nmero)
envolvidas nos cruza- ----------------------------------------
mentos Com cauda Sem cauda
-----------------------------------------------------------------
1) Com cauda X Sem cauda 92 0
2) Com cauda X Com cauda 155 52
3) Sem cauda X Sem cauda 0 83
4) Com cauda X Sem cauda 47 43
5) Com cauda X Com cauda 85 0
a) Fornea uma provvel explicao para a herana do carter.
b) Especifique o gentipo dos animais envolvidas nos cruzamentos.

5.35 De posse de um indivduo com fentipo A, que teste deve-se fazer para determinar
se o seu gentipo AA ou Aa? Explique como.

5.36 A audio normal depende da presena de pelo menos um dominante de cada um


dos dois genes, D e E. Examinando-se a prole coletiva de um grande nmero de
casamentos DdEe X DdEe, qual a proporo fenotpica seria esperada?

5.37 Duas cobaias pretas foram cruzadas, e em vrios anos produziram 29 filhos pretos e
9 brancos. Explique estes resultados, dando os gentipos dos pais e da prole.

5.38 O gado Holstein normalmente preto e branco. Um touro preto e branco, Soberbo,
foi comprado por um fazendeiro por 100.000 dlares. A prole originada de Soberbo era
toda de aparncia normal. Contudo, alguns pares de sua prole, quando intercruzados,
produziam prole vermelha e branca com frequncia em torno de 25%. Soberbo foi logo
removido das listas genealgicas dos criadores de gado Holstein. O criador agiu
corretamente? Explique porqu (use smbolos).
Resposta:
Pp (Soberbo) X PP ==> F1 (PP ou Pp) ou PP (Soberbo) X Pp ==> F1 (PP ou Pp)
Indivduos com o ultimo gentipo (Pp) quando intercruzados produziro prognie com
25% de gentipo pp (vermelho branco).
Se a prole F2 vermelha e branca fosse de mais de uma parceira de Soberbo, ento
o fazendeiro agiu corretamente. Contudo, se a prole F2 veio s de uma fmea, o
fazendeiro pode ter agido com muita precipitao.

5.39 Considere trs ervilhas amarelas redondas A, B e C. Cada uma foi cruzada com
uma planta originada de uma ervilha verde rugosa. Exatamente 100 ervilhas oriundas de
cada cruzamento foram classificadas quanto s classes fenotpicas com segue:
A ==> 51 amarelas redondas C ==> 24 amarelas redondas
==> 49 verdes redondas ==> 26 amarelas rugosas
==> 25 verdes redondas
B ==> 100 amarelas redondas ==> 25 verdes rugosas
32

Quais eram os gentipos de A, B e C?


(use os smbolos gnicos de sua escolha)
Resposta:
A => YyRR, B => YYRR e C => YyRr

5.40 Os quatro heredogramas seguintes representam quatro cruzamentos diferentes,


onde aparece a mesma doena:
a) b)???
c) d)
mais provvel que a herana desta doena seja autossmica dominante, ou
autossmica recessiva? Justifique sua resposta.
Resposta:
Autossmica recessiva. Nos casos b e c, os afetados so filhos de pais normais.

5.41 Um nico carneiro de pernas curtas ocorreu em um rebanho. Sugira experimentos


para determinar se ele o resultado de uma mutao ou de uma modificao ambiental, e
se mutao, ela dominante ou recessiva?
Resposta:
Os carneiros com pernas curtas podem ser cruzados com carneiros de pernas longas
(normais). Se a caracterstica se expressa na primeira gerao, presume-se que ela seja
hereditria e dependente de um gene (alelo) dominante. Por outro lado, se ela no
aparece na primeira gerao, os carneiros F1 podem ser retrocruzados com um dos
genitores de pernas curtas. Se a caracterstica se expressa em metade da prognie do
retrocruzamento, presume-se que ela seja herdada como um recessivo simples. Se
podemos obter carneiros de pernas curtas de sexos diferentes, eles podem ser cruzados
repetidamente para testar a hiptese de dominncia. Nos casos em que a caracterstica
no transmitida para a prognie que resulta desses cruzamentos, isto pode ser devido
ao ambiente ou dependente de algum mecanismo gentico complexo que no pode ser
identificado pelo teste simples utilizado nesses experimentos.

5.42 Um nico indivduo alto ocorreu em uma populao grande. Descarte qualquer
possibilidade de contaminao com sementes ou plen estranho a esta populao. Sugira
experimentos para determinar se ele o resultado de uma mutao ou de uma
modificao ambiental, e se for mutao, ela dominante ou recessiva?

5.43 Um nico indivduo baixo ocorreu em uma populao grande e de fecundao


predominantemente cruzada. Sugira experimentos para determinar se ele o resultado
de uma mutao ou de uma modificao ambiental, e se for mutao, ela dominante ou
recessiva?

5.44 Em uma lavoura de milho surgiu uma nica planta com a palha roxa. Descarte
qualquer possibilidade de contaminao com sementes ou plen estranho. Sugira
experimentos para determinar se esta planta o resultado de uma mutao ou de uma
modificao ambiental; e se mutao como proceder para identificar se esta
dominante ou recessiva?
33

5.45 Uma nica planta baixa ocorreu em uma grande rea cultivada. Descarte qualquer
possibilidade de contaminao com sementes ou plen estranho. Sugira experimentos
para determinar se ela o resultado de uma mutao ou de uma modificao ambiental, e
se mutao, ela dominante ou recessiva?

5.46 Qual a frequncia genotpica esperada em F2 quando so considerados dois genes


(gene A e gene B), com dois alelos cada gene, com interao allica de dominncia
completa e com distribuio independente? Demonstre que a sua resposta verdadeira.

5.47 Considerando o carter chifres em bovinos, controlado pelo gene M, com


dominncia completa, em que M-Mocho e m-Aspado, pergunta-se: Qual a proporo
esperada em F2 se ao semem dos animais F1 (mochos) for adicionado 20% de semem de
touros mochos homozigotos?

5.48 Considere dois genes, em heterozigose e situados em cromossomos diferentes.


Demonstre citogeneticamente e explique como podem surgir quatro gametas diferentes a
partir da meiose. Faa uma generalizao do que pode acontecer quando temos n genes
tambm em heterozigose e situados em cromossomos diferentes.

5.49 Demonstre citogeneticamente a Primeira e a Segunda Lei de Mendel.

5.50 Em humanos a polidactilia e o albinismo so condicionados por um genes diferentes


e com interao allica de dominncia completa. Os indivduos homozigotos recessivos
so portadores de ps e mos normais e albinos. Joo, com ps e mos normais, porm
albino, casa-se com Maria que normal para o albinismo e polidctila cujo pai era
homozigoto e normal para os dois caracteres e a me albina e polidctila. A partir das
informaes acima marque a alternativa correta:
a) No existe qualquer chance de nascer um filho polidctilo dessa relao.
b) A me de Maria , obrigatoriamente, homozigota para as duas caractersticas.
c) Joo poder produzir dois tipos de gametas diferentes para essas caractersticas.
d) Maria produzir gametas de quatro tipos diferentes para essas caractersticas.
e) Todos os filhos desse casal devero ser albinos.Resposta:
P - polidactilo p - Ps e mos normais
A - Normal a - Albinos
Joo: ppaa Maria: P_A_ (Pai: ppAA e Me: P_aa)
Concui-se que Maria PpAa
a) 50% Pp e 50% pp - Errado
b) Pode ser heterozigoto - Errado
c) S um tipo - Errado
d) PA Pa pA pa - Correto
e) Somente 50% - Errado

5.51 Qual a relao entre a segunda lei de Mendel e as leis de probabilidade? Explique.

5.52 Explique e exemplifique o que um gene, o que um alelo e o que um locus.


34

5.53 O fator Rh condicionado por um gene autossmico, sendo o alelo Rh+ dominante
sobre o alelo Rh-. Um homem Rh+ e a mulher Rh- tiveram dois filhos Rh-. Isto foi possvel
porque: (1) a mulher homozigota para este carter; (2) a mulher heterozigota para
este carter; (3) o marido homozigoto para este carter; (4) o marido heterozigoto
para este carter; (5) a mulher foi imunizada pela gamaglobulina. As alternativas corretas
so (__ e __).

5.54 Os estudos de gentica mendeliana iniciam com genitores homozigotos. Como


proceder para assegurar-se de que os gentipos disponveis so homozigotos?

5.55 Comente os passos utilizados para o estudo do controle gentico de um carter


(Passos baseados nos procedimentos empregados por Mendel no estabelecimento dos
princpios do controle gentico).

5.56 Construa um heredograma cuja me seja heterozigota para um alelo letal e o pai
normal. Um dos filhos (macho) cruzado com uma fmea, a qual produz quatro
descendentes (dois machos e duas fmeas), sendo que o letal se manifeste, matando um
dos descendentes.

5.57 Construa um heredograma de uma famlia constituda por: primeiro filho macho,
segundo filho macho afetado, terceira filha fmea, quarto filho macho falecido.

5.58 Construa um heredograma cujo pai seja heterozigoto para um alelo letal e a me
normal. Um dos filhos (macho) cruzado com uma fmea, a qual aborta dois fetos de
sexo indefinido e produz quatro descendentes, sendo que o letal se manifeste, matando
um dos descendentes aps o nascimento.

5.59 Que caracterstica deve apresentar os gentipos a serem utilizados na determinao


do tipo de herana (controle gentico) de um carter?

5.60 Quais as relaes entre as leis de Mendel e o comportamento dos cromossomos na


metfase?

5.61 Demonstre citologicamente a Primeira Lei de Mendel?

5.62 Demonstre citologicamente a Segunda Lei de Mendel?

5.63 Responda: a) O que so alelos dominantes e alelos recessivos? b) Um casal de


animais (pai preto e me cinza) produziu descendentes pretos, cinzas e albinos. O
controle gentico da cor, nessa espcie, determinado pelo gene A. Estabelea os
gentipos dos pais e a proporo que se poderia esperar para os diversos filhos nascidos.

5.64 Os mecanismos de herana e de variao gentica podem ser fundamentados em


trs vertentes de conhecimentos, os quais so complementares: 1) Gentica molecular,
2) Bases citolgicas da herana e 3) Matemtica.
35

5.65 Esquematize os cruzamentos necessrios para determinar a herana de um


caractere, segundo os preceitos Mendelianos. Caracterize os gentipos utilizados para os
cruzamentos. Demonstre citogeneticamente a formao de gametas (tipos e propores)
nos pais, gerao filial 1 e retrocruzamentos.
Resposta: O parental 1 (P1) e o parental 2 (P2) so gentipos homozigotos e
contrastantes, ou seja, P1 AA e P2 aa, a gerao filial 1 (F1) heterozigota Aa. Na
gerao filial 2 (F2) sero observadas as seguintes propores genotpicas: 1/4 de AA, 2/4
de Aa e 1/4 de aa. No retrocruzamento 1 (RC1) sero observados os seguintes
propores genotpicas 1/2 AA e 1/2 Aa, enquanto que no RC2 sero observados os
seguintes propores genotpicas 1/2 Aa e 1/2 aa.
Esquema de cruzamentos para estudos de herana
gentica, segundo os preceitos de MENDEL

P1 P2

F1 F1

RC1 RC2

F2

5.66 Como podemos diferenciar Herana Citoplasmtica de Herana Mendeliana,


quando observamos a prole de um cruzamento envolvendo um carter em que os pais
so contrastantes?

5.67 Considerando os preceitos Mendelianos, envolvendo dois genes com distribuio


independente e dominncia completa (genes A e B): a) Demonstre citogeneticamente a
formao de gametas pelo P1, P2 e F1, representando os cromossomos em sua mxima
condensao (metfase), salientando os tipos de gametas formados e suas propores;
b) Com base na resposta ao item a) explique o que a segregao independente dos
cromossomos; c) Utilizando os tipos e as propores de gametas formados na
demonstrao do item a) formule as hipteses de propores genotpicas e fenotpicas
esperadas para as geraes F2, RC1 e RC2 e; d) Se os dados observados na gerao F2
no seguirem as propores clssicas esperadas para a segregao independente,
conforme formuladas no item c, o que pode estar acontecendo?

5.68 Durante o ciclo sexual, quais os momentos/fases/estdios em que pode surgir


variabilidade gentica?
36

5.69 Como surgem novos alelos e como surgem novos genes?

5.70 O que variabilidade gentica e como surge?

5.71 Estudos moleculares, citolgicos e fenotpicos elucidam e explicam os mecanismos


da herana e da variao gentica. Descreva/Demonstre: a) os mecanismos da herana e
da variao. b) Como estes mecanismos contribuem para o desenvolvimento, evoluo e
adaptao dos organismos vivos na terra.
OBS. 1: No para fazer um histrico e sim explicar os mecanismos.
OBS. 2: A profundidade da resposta deve envolver todo o contedo programtico
referente a esta avaliao.
Molecular

Mecanismos da
herana e da
variao
Fenotpico
Citolgico

5.72 Uma grande empresa do ramo florestal est interessada em conhecer a herana
gentica de uma caracterstica (cor da flor) de uma planta ornamental de reproduo
sexuada. Estudos preliminares revelaram plantas com flores brancas e plantas com flores
vermelhas. A empresa solicitou que se apresente um projeto detalhado para o estudo da
herana desta caracterstica. O autor do melhor projeto (mais completo, com mais
detalhes, com maior rigor cientfico, etc) ser contratado pela empresa. OBS.: O projeto
deve limitar-se a quatro pginas de papel almao fornecidas e o autor pode simular
possveis resultados a serem obtidos, a fim de demonstrar suas hipteses. Com base no
enunciado acima e no contedo referente a esta avaliao, demonstre como estudada a
herana de uma caracterstica.

5.73 Considerando os mecanismos da herana e da variao, explique como dois irmos


germanos (irmos de mesmo pai e mesma me) podem apresentar constituio gentica
variando desde completamente iguais at completamente diferentes.

5.74 Aps conduzir um experimento, segundo os preceitos Mendelianos, considerando 2


genes, espera-se que os dados observados na gerao F2 assumam as propores
clssicas esperadas para a segregao independente. Se isto no acontecer, qual a
explicao?

5.75 A Jorubeba serrana apresenta um gene A que controla a cor da folhagem (Alelo
dominante resulta na folhagem preta e Alelo recessivo resulta em folhagem vermelha) e
outro gene B que controla o comprimento das folhas (Alelo dominante resulta em folhas
37

longas e Alelo recessivo que resulta em folhas curtas) Esses dois genes esto ligados.
feito um cruzamento entre um indivduo homozigoto para as duas caractersticas
dominantes e um indivduo homozigoto para as duas caractersticas recessivas.
Cruzamento-teste: Cruzamento entre um indivduo de interesse com um indivduo
testador (indivduo homozigoto recessivo para o carter em questo).
a) Determine o fentipo e o gentipo de todos os possveis tipos de indivduos a serem
encontrados nos descendentes do cruzamento proposto acima.
b) Quantos tipos de gametas podem ser produzidos considerando todos os indivduos
listados no item a?
c) Quais seriam os possveis fentipos dos descendentes de um cruzamento-teste
envolvendo os descendentes do item a? Faa esse cruzamento e considere que no
houve permuta gentica.
d) Faa o mesmo que o solicitado no item c, porm agora d os possveis fentipos
considerando que houve permuta gentica.
R: Tanto a cor da folhagem quanto o comprimento das folhas apresentam dominncia
completa, porm so genes ligados. Como os dois genes esto ligados, para calcular a
probabilidade com que so formados os gametas deve-se considerar que estes no
segregam independentemente.
O cruzamento realizado AB/AB x ab/ab, que resulta em AB/ab Todos os indivduos
apresentaro este gentipo.
a) Ser produzido um nico gentipo e um nico fentipo AB/ab folhagem preta com
folhas longas.
b) Dois tipos de gametas AB e ab, porque os alelos dominantes e recessivos esto em
cromossomos separados e os genes esto ligados (considerou-se ausncia de
recombinao gentica).
c) O cruzamento-teste de AB/ab (gametas: 1/2 AB e 1/2 ab) x ab/ab (gametas: 1 ab) sem
permuta gentica produz dois fentipos: Preto Longo (gentipo AB/ab) e Vermelho Curto
(ab/ab).
d) O cruzamento-teste de AB/ab (gametas: 1/4 AB, 1/4 Ab, 1/4 aB e 1/4 ab) x ab/ab
(gametas: 1 ab) considerando permuta gentica produz quatro fentipos: Preto Longo
(gentipo AB/ab), Preto Curto (gentipo Ab/ab), Vermelho Longo (gentipo aB/ab) e
Vermelho Curto (ab/ab).
Observao: possvel que quando hajam poucos descendentes e os genes em questo
estiverem muito prximos no surjam indivduos recombinantes. Nesse caso apenas os
fentipos relatados no item c seriam observados na descendncia, porm a resposta deve
contemplar todos os descendentes possveis, mesmo que alguns destes sejam muito
raros.

5.76 Represente os cruzamentos necessrios para o estudo da herana gentica de uma


caracterstica, na forma de um heredograma?

5.77 Quais os tipos de gametas formados pelo indivduo AaBBCcDdff, considerando a


distribuio independente entre todos os genes considerados?

5.78 Anlise de pedigree. Qual o controle gentico envolvido no carter em questo, no


heredograma abaixo.
38

5.79 Demonstre citogeneticamente como obtida a frequncia clssica da gentica


mendeliana 9:3:3:1, em uma populao segregante. Em que situaes a frequncia
clssica da gentica mendeliana 9:3:3:1 no ocorre? Explique detalhadamente como isto
acontece, em uma destas situaes. Descreva como obter uma generalizao dos
resultados genotpicos esperados na gerao F2, quando considerados mais de dois
genes com segregao independente.

5.80 5. O ciclo de reproduo sexual importante tanto para as espcies animais


quanto vegetais. O ciclo sexual compreende uma srie de mecanismos que permitem o
surgimento de variao gentica. Possivelmente no tenha existido nenhum ser humano
geneticamente igual ao outro, pela reproduo sexuada, desde o surgimento da espcie
humana at os dias atuais (Gmeos univitelinos so geneticamente iguais porque se
originam a partir de um nico zigoto). Descreva todos os mecanismos que permitem o
surgimento de variao gentica durante o ciclo sexual. Comente a importncia destes
mecanismos para o melhoramento gentico.

5.81 Suponha um estudo de herana de dois caracteres (cor e textura). Foi selecionado
aleatoriamente um conjunto de indivduos, sendo 268 Amarelos e Lisos, 86 Amarelos e
Enrugados, 97 Brancos e Lisos e 29 Brancos e Enrugados. a) Formule e teste a hiptese
de segregao independente dos dois caracteres. b) Formule e teste a hiptese de
que os valores observados se ajustam a proporo esperada de 12:2:1:1.
(X2calculado = Somatrio (Fo-Fe)2/Fe; X2Tabelado (p=0,05) GL=1 = 3,84; X2Tabelado (p=0,05) GL=2 = 5,99;
X2Tabelado (p=0,05) GL=3 = 7,82 e X2Tabelado (p=0,05) GL=4 = 9,49).
39

6 BIOMETRIA

6.1 Relacione a lei do produto das probabilidades com a Segunda Lei de Mendel.

6.2 R6-1) Na raa holandesa de bovinos os animais podem ser preto-branco devido ao
alelo dominante V, e vermelho-branco devido ao alelo recessivo v. Do cruzamento de um
touro heterozigoto com uma vaca vermelha-branca, determine as seguintes
probabilidades:
a) Do primeiro descendente ser preto-branco?
b) Dos dois primeiros serem preto-brancos?
c) Dos dois primeiros terem a mesma cor de pelagem?
d) Dos dois tipos de pelagem ocorrerem nos dois primeiros descendentes?
Resposta:
Preto-branco - V
Vermelho-branco - v
Cruzamento: vv (vaca) x Vv (touro)
a) EI n = 1
ED a - Preto-branco Pa = 1/2
b - Vermelho-branco Pb = 1/2
1!
Pa=1 = ------ (1/2)1 (1/2)0 = (1/2)1 = 0.50
b=0 1! 0!
b) EI n = 2
ED a - Preto-branco Pa = 1/2
b - Vermelho-branco Pb = 1/2
2!
Pa=2 = ------ (1/2)2 (1/2)0 = (1/2)2 = 1/4
b=0 2! 0!
c) 1 e 2 Preto-branco ou
1 e 2 Vermelho-branco

EI n = 2
ED a - Preto-branco Pa = 1/2
b - Vermelho-branco Pb = 1/2
2!
Pa=2 = ------ (1/2)2 (1/2)0 = (1/2)2 = 1/4
b=0 2! 0!
2!
Pa=0 = ------ (1/2)0 (1/2)2 = (1/2)2 = 1/4
b=2 0! 2!
1 1 1
4 4 2
1 2 2 1 2
d) Pab11 2! 1
1!1! 2
1 1 2
1
2

6.3 R6-2) Em um cruzamento em galinhas obteve-se uma ninhada com 12 pintinhos.


Determine as seguintes probabilidades:
a) Dos 12 pintinhos serem do sexo masculino;
40

b) De todos possurem o mesmo sexo;


c) De ocorrer 6 fmeas;
d) De ocorrer pelo menos 6 fmeas.
Resposta:
EI = 12 pintinhos
ED = sexo = a - macho Pa = 1/2
B - fmea Pb = 1/2
a) P
a 12
b 0

12! 1
12! 0! 2
1 2 1 2
12 0 12

P = (1/2)12, 2,44 x 10-4 ou 1 em 4096


a 12 a 0
b) P b 0 P b 12 1
2
12
1
2
12

2 1
2
12

P2 1
2
12
, 4,88 x 10
4
ou 1 em 42048

c) a 6
P
b 6

12! 1
6! 6! 2
12 924 1 2
6 6 12

a 6 a 7 a 8 a 9 a 10 a 11 a 12
d) P P P P P P P

P 924 1 2 12
792 1 2 12
495 1 2 12
220 1 2 12
2
66 1
12
2 1 1 2
12 1
12 12
2
2510 1
12

6.4 R6-3) Numa determinada espcie 2n=14. Do cruzamento entre uma raa brasileira e
uma raa europia, dessa espcie, obteve-se a gerao F1. Considerando a meiose dos
indivduos da gerao F1, pergunta-se:
a) Qual a probabilidade de ocorrer um espermatozide com todos os centrmeros
provenientes da raa brasileira?
b) Qual a probabilidade de um espermatozide ser portador de um centrmero da raa
brasileira e os demais da europia?
c) Qual a probabilidade de um espermatozide ser portador de pelo menos trs
centrmeros de origem da raa brasileira?
Resposta:
2n = 14
EI = 7
ED = Par de cromossomos a - Brasileiro Pa = 1/2
B - Europeu Pa = 1/2
a) Pab70 7! 1
7! 0! 2
12 11 2
7 0 7
1
128

b) Pab16 7! 1
1! 6! 2
1 2 7 1 2
1 6 7
7
128

c) Pa 3 Pa 4 Pa 5 Pa 6 ... 99 1
2
7 99

128
6.5 R6-4) Em bovinos o fentipo mocho devido a um alelo dominante. O alelo recessivo
confere o fentipo aspado. Um touro mocho foi cruzado com 10 vacas sabidamente
heterozigotas e todos os descendentes foram mochos. Qual a probabilidade do touro ser
homozigoto?
Resposta:
41

mocho - M aspado - m
Mm x M_ (macho) |
Mm |
Mm |-> 100% dos descendentes Mochos
Mm |
: |
Mm |
EI = 10 cruzamentos
ED = chifres = a - mocho Pa = 3/4
b - aspado Pb = 1/4
P b0
a 10
1 4
10! 3
10! 0! 4
10 0
4
1 3
10
0,05631 (Probabilidade de ser heterozigoto)

(P de ser homozigoto) + (P de ser heterozigoto) = 1


(P de ser homozigoto) = 1 - (P de ser heterozigoto)
(P de ser homozigoto) = 1 - 0,05631
(P de ser homozigoto) = 94,37%

6.6 R6-5) Em coelho a cor branca devida ao alelo recessivo c e a himalaia ao alelo
dominante ch. Um macho heterozigoto foi cruzado com uma fmea de mesmo gentipo e
produziu 8 descendentes. Qual a probabilidade de que a prognie apresente exatamente
a proporo esperada de 3 himalaia : 1 branco?
Resposta:
31,15%

6.7 R6-7) Em caf a planta pode apresentar altura normal (bourbon) devido ao gentipo
nana, as plantas de gentipo nn so ans (nana) e as plantas de gentipo nan
apresentam altura intermediria (murta). Do cruzamento entre duas plantas murta foram
obtidas 12 sementes. Determine as seguintes probabilidades:
a) De todas as sementes produzirem plantas do tipo murta?
b) De todas as plantas serem nana?
c) De que a descendncia seja exatamente a esperada de 3 bourbon : 6 murta : 3 nana?
Resposta:
a) 12!/12! * (1/2)12 b) 12! / 12! * (1/4)12
c) {12! / (3! 6! 3!)} * (1/4)3 * (1/2)6 * (1/4)3

6.8 R6-7) Em ovelha a ausncia de orelhas devido ao gentipo E1E1, as orelhas curtas
ocorrem devido ao gentipo E1E2 e as orelhas longas so determinadas pelo gentipo
E2E2. Nestes animais a cor da gordura pode ser branca, devido ao alelo dominante F, e
amarela, devido ao alelo recessivo f. Determine os tamanhos das descendncias, para se
conseguir 12 animais sem orelhas e que produzam gordura amarela, com 95% e 99% de
probabilidade, a partir dos seguintes cruzamentos:
a) E1E2Ff X E1E2Ff 557 e 856
1 2 1 1
b) E E Ff X E E Ff 269 e 414
c) E1E1ff X E1E2Ff 124 e 192
Resposta:
E1E1 SEM ORELHA F - Gordura BRANCA
E1E2 ORELHAS CURTAS f - Gordura AMARELA
E2E2 ORELHAS LONGAS
42

n para 12 animais sem orelha e gordura amarela


a) E1E2Ff X E1E2Ff (1/2 * 1/2) * (1/2 * 1/2) = 1/16
Ou ento utilize o quadro de Punnet:

Fmea\Macho E1F E1f E2F E2f


E1F E1E1FF E1E1Ff E1E2FF E1E2Ff
E1f E1E1Ff * E1E1ff E1E2Ff E1E2ff
E2F E1E2FF E1E2Ff E2E2FF E2E2Ff
E2f E1E2Ff E1E2ff E2E2Ff E2E2ff

log (1 - 0,95)
n = -------------- = 46,41 x 12 = 557
log (1 - 1/16)
log (1 - 0,99)
n = -------------- = 71,355 x 12 = 856
log (1 - 1/16)

6.9 R6-8) Em bovinos, mocho devido ao alelo dominante M e com chifres devido ao
alelo recessivo m. A pelagem normal definida pelo alelo dominante A e a pelagem
arrepiada pelo alelo recessivo a. Analise os resultados dos seguintes cruzamentos, estime
o valor do X2 e interprete aos resultados (X2T (p=0,05) GL=1 = 3,84; X2T (p=0,05) GL=2 = 5,99; X2T
2 2
(p=0,05) GL=3 = 7,82, X T (p=0,05) GL=4 = 9,49 e X T (p=0,05) GL=5 = 11,07).
NMERO DE DESCENDENTES
CRUZAMENTOS -------------------------------------------------
NORMAL NORMAL ARREPIADO ARREPIADO
MOCHO ASPADO MOCHO ASPADO
-------------------------------------------------------------
a) AaMm x AaMm 41 15 8 2
b) AaMm x aaMm 321 101 310 107
c) AaMm x Aamm 219 207 64 71
d) AAMm x aaMm 722 231 0 0
e) AaMM x aamm 404 0 387 0
f) Aamm x aaMm 70 91 86 77
Resposta:
a) Qui-quadrado = 3,60 n.s. b) Qui-quadrado = 0,38 n.s.
c) Qui-quadrado = 0,95 n.s. d) Qui-quadrado = 0,29 n.s.
e) Qui-quadrado = 0,36 n.s. f) Qui-quadrado = 3,23 n.s.

6.10 Explique qual a finalidade do teste do qui-quadrado quando analisamos


segregaes fenotpicas e quais os cuidados na utilizao deste teste.

6.11 Dispondo-se de trs dados, um vermelho (V), um branco (B) e um azul (A). Quando
todos os trs dados so lanados ao mesmo tempo, calcule a probabilidade dos seguintes
resultados:
a) 6V, 6B, 6A Resposta: (1/6)3
b) 6V, 5B, 6 A Resposta: (1/6)3
c) 6V, 5B, 4A Resposta: (1/6)3
d) Nenhum seis Resposta: (5/6)3
43

e) Dois seis e um cinco em qualquer dado Resposta: 3(1/6)3


f) Trs seis ou trs cincos Resposta: 2(1/6)3
g) O mesmo nmero em todos os dados Resposta: (1/6)2 = 6(1/6)3
h) Um nmero diferente em cada dado Resposta: 5/9

6.12 A fenilcetunuria (PKU, do ingls PhenylKetonUria), uma doena hereditria


humana, que impede o organismo de processar a substncia fenilalanina, que contida
na protena que ingerimos. a PKU manifesta-se em lactentes e se no for tratada,
geralmente causa retardamento mental. A PKU causada por um alelo recessivo
mendeliano simples. Um casal pretende ter filhos. O marido tem uma irm com PKU e a
mulher tem um irmo com PKU. No ha outros casos conhecidos em suas famlias. Este
casal pede que determine-se a probabilidade de o seu primeiro filho ter PKU. Se houver,
qual a probabilidade?
Resposta:
H, 4/36 2/3 * 2/3 = 4/9 ==> (4/9 * 1/4) = 4/36

6.13 No tomateiro 2n=24. Do cruzamento entre uma cultivar brasileira e uma europia
obteve-se a gerao F1. Considerando a meiose das plantas da gerao F1, pergunta-se:
a) Qual a probabilidade de ocorrer um gro de plen com todos os centrmeros
provenientes da cultivar brasileira?
b) Qual a probabilidade de um gro de plen ser portador de um centrmero da cultivar
brasileira e os demais da europia?
c) Qual a probabilidade de um gro de plen ser portador de pelo menos trs centrmeros
de origem da cultivar brasileira?

6.14 No milho a textura da semente pode ser rugosa, devido ao alelo recessivo su ou
lisa, devido ao alelo dominante Su. Uma planta heterozigota foi autofecundada e produziu
uma espiga com 400 gros. Qual a probabilidade de que na espiga os gros apresentem
exatamente a proporo esperada de 3 liso : 1 rugoso?
Resposta:
4 gros ------ 3 LISO 4 ----- 1 RUGOSO
400 gros ------ x = 300 400 ----- x = 100
400!
Pa=300 = --------- (3/4)300 (1/4)100
b=100 300! 100!

Pa=300 = 2,241854 1096 (3/4)300 (1/4)100


b=100

Pa=300 = 0,046024 ou 4,6%


b=100

6.15 Um gene dominante W produz a textura plo-de-arame em ces; seu alelo


recessivo, w, produz plos macios e lisos. Qual a probabilidade de:
a) Nascer um co com pelagem lisa e macia, de pais heterozigotos?
b) Nascerem dois ces com pelagem lisa e macia, de pais heterozigotos?
c) Nascer toda uma ninhada, de seis ces, com pelagem lisa e macia, de pais
heterozigotos?
d) Nascer uma ninhada de seis ces, onde cinco so heterozigotos como os pais e um
tem a pelagem lisa e macia?
44

Resposta:
a) c) 1/4096
b) 1/16 d) (6! / 5! 1!) X (1/2)5 (1/4)1

6.16 Relacione o que acontece com os cromossomos durante a meiose I (metfase I)


com as leis da probabilidade.

6.17 Em milho a semente lisa devido a um alelo dominante. O alelo recessivo confere o
fentipo rugoso. Uma planta de milho proveniente de uma semente lisa, foi utilizada para
polinizar 10 outras plantas, sabidamente heterozigotas. Todos os descendentes foram
lisos (considere que o nmero total de descendentes foi igual a 10). Qual a probabilidade
da planta polinizadora ser homozigota?

6.18 R10-4) De uma vaca de excelentes qualidades h possibilidade de se obter cinco


descendentes.
a) Qual a probabilidade de todos serem do sexo feminino?
b) Se quatro descendentes forem do sexo feminino, qual a probabilidade do ltimo
tambm ser do sexo feminino?
Resposta:
a) 1/32 b) 1/2

7 GENES LETAIS E FENOCPIAS

7.1 Comente: Os genes letais podem representar perdas econmicas considerveis.

7.2 Qual a importncia dos genes letais?

7.3 O que so genes letais condicionados?

7.4 Em camundongos, o gentipo yy responsvel por pelagem aguti, o Yy amarela e


o YY, letal ( os vulos so fecundados e no se desenvolvem). Que descendncia se
espera do cruzamento entre um camundongo amarelo e um aguti? E entre dois
amarelos? Em qual dos dois tipos de cruzamento se espera a maior ninhada? por qu?
Resposta:
1/2 amarelo: 1/2 aguti; 2/3 amarelos: 1/3 aguti. No primeiro tipo, pois no segundo, 1/3 dos
vulos fecundados no se desenvolvem.

7.5 A intensidade da pigmentao da pelagem de camundongos devida a trs alelos: D


= cor normal; d = cor diluda; dl = letal, em homozigose. A sequncia de dominncia : D
> d > dl. Um camundongo de cor normal, heterozigoto para o gene letal, cruzado com
outro de cor diluda, tambm heterozigoto para o alelo letal. Os descendentes obtidos so
retrocruzados com o genitor de cor diluda. Qual a proporo fenotpica da prognie vivel
de cruzamento?
Resposta:
4/10 normais: 6/10 diludos
45

7.6 Dentre os diferentes tipos de genes letais os genes de efeito letal recessivo
predominam. Explique porque.
Porque a grande maioria de genes letais so de efeito recessivo?

7.7 Como os genes letais podem interferir na proporo macho : fmea?


Resposta:
a) Gene letal recessivo no cromossomo sexual, quando no sexo heterogamtico, funciona
como dominante.
b) Letal limitado ao sexo, s manifestvel num dos sexos.

8 INTERAES ALLICAS, ALELISMO MLTIPLO E PLEIOTROPIA

8.1 Indique se cada uma das seguintes proposies so verdadeira (V) ou falsa (F). ( ) A
autoincompatibilidade ocorre quando um esporo ou um gameta no se autofecundam.
( ) Autoincompatibilidade gametoftica mais eficiente porque a planta no aceita
gametas de outras plantas. ( ) Dominncia completa quando em F2 se expressa
somente a caracterstica de um dos pais. ( ) Na dominncia incompleta o alelo dominante
no produz enzima suficiente para inibir o recessivo.

8.2 Interaes allicas

8.2.1 R5-1) Em galinhas os indivduos com penas normais so de gentipo ff, os


indivduos FF apresentam penas acentuadamente onduladas e quebradias e o
heterozigoto apresenta as penas medianamente onduladas. A partir do cruzamento de um
galo com penas medianamente encurvadas com trs fmeas, foram produzidos 12
descendentes por ninhada. Dos 36 descendentes, 18 apresentaram penas medianamente
encurvadas, 15 penas acentuadamente encurvadas e apenas 3 foram normais. Quais os
provveis gentipos das trs fmeas?
Resposta:
FF, FF, Ff
Macho Macho Macho
\ |1/2 F|1/2 f| \ |1/2 F|1/2 f| \ |1/2 F|1/2 f|
-----+-----+-----| -----+-----+-----| -----+-----+-----|
F 1/2 |1/4 |1/4 | F 1/2 |1/4 |1/4 | F 1/2 |1/4 |1/4 |
F |FF |Ff | F |FF |Ff | F |FF |Ff |
m-----+-----+-----| m-----+-----+-----| m-----+-----+-----|
e 1/2 |1/4 |1/4 | e 1/2 |1/4 |1/4 | e 1/2 |1/4 |1/4 |
a F |FF |Ff | a F |FF |Ff | a f |Ff |ff |
----------------- ----------------- -----------------
12 x 2/4 FF + 12 x 2/4 FF +12 x 1/4 FF = 15 FF
12 x 2/4 Ff + 12 x 2/4 Ff +12 x 2/4 Ff = 18 Ff
12 x 0 ff + 12 x 0 ff +12 x 1/4 ff = 3 ff

8.2.2 R5-2) Em bovinos a presena de chifres governada pelo alelo recessivo m,


enquanto o alelo dominante M confere ausncia de chifres (mocho). A cor da pelagem
vermelha fornecida pelo gentipo RR, cor branca por rr e vermelho-branco (ruo) por
Rr.
46

a) Determine a proporo fenotpica de F2 proveniente do cruzamento de um touro


vermelho, com chifres, com vacas brancas e mochas, homozigotas.
b) Quantos animais da gerao F2 sero necessrios para se selecionar 20 animais
homozigotos de pelagem vermelha e mochos?
c) Qual a proporo fenotpica esperada se os animais ruo e mochos da gerao F2
forem acasalados entre si?
Resposta:
a) 3/16 mochos vermelhos : 6/16 mochos ruos : 3/16 mochos brancos : 1/16 aspados
vermelhos : 2/16 aspados ruo : 1/16 aspados brancos.
b) 320
c) 4/18 mochos vermelhos : 8/18 mochos ruos : 1/18 aspados ruos : 4/18 mochos
brancos : 1/36 aspados brancos : 1/36 aspados vermelhos.
Os marcados com * na resposta da letra a) apresentam fentipo mocho ruo. Destes 6/12
R e 6/12 r para o gene da cor da pelagem e 8/12 M e 4/12 m para o gene chifres.
C O R P E L A G E M C H I F R E S
\ |6/12R|6/12r| \ |8/12M|4/12m|
-----+-----+-----| -----+-----+-----|
6/12|1/4 |1/4 | 1/4 RR 8/12| 4/9 | 2/9 | 4/9 MM
R |RR |Rr | 2/4 Rr M |MM |Mm | 4/9 Mm
-----+-----+-----| 1/4 rr -----+-----+-----| 1/9 mm
6/12|1/4 |1/4 | 4/12| 2/9 | 1/9 |
r |Rr |rr | m |Mm |mm |
----------------- -----------------
RRMM=1/4*4/9=1/9 RrMM=2/4*4/9=2/9 rrMM=1/4*4/9=1/9
RRMm=1/4*4/9=1/9 RrMm=2/4*4/9=2/9 rrMm=1/4*4/9=1/9
RRmm=1/4*1/9=1/36 Rrmm=2/4*1/9=1/18 rrmm=1/4*1/9=1/36

\ 1/4 MR 1/4 Mr 1/4 mR 1/4 mr

1/4 1/16 1/16 * 1/16 1/16 *


MR MM RR MM Rr Mm RR Mm Rr

1/4 1/16 * 1/16 1/16 * 1/16


Mr MM Rr MM rr Mm Rr Mm rr

1/4 1/16 1/16 * 1/16 1/16


mR Mm RR Mm Rr mm RR mm Rr

1/4 1/16 * 1/16 1/16 1/16


mr Mm Rr Mm rr mm Rr mm rr

8.2.3 Os efeitos dos genes, para formar os fentipos, dependem de sua ao e de sua
interao. Comente detalhadamente esta afirmao.

8.2.4 4.a) Diferencie os tipos de interaes allicas; 4.b) Cite quais so as frequncias
genotpicas e fenotpicas esperadas em F2, de cada uma das interaes allicas,
considerando um gene com dois alelos? 4.c) Qual a frequncia esperada em F2,
47

considerando dois genes, sendo um com dominncia incompleta e um com


sobredominncia?

8.2.5 Explique como proceder para identificar o tipo de interao allica, ao nvel
fenotpico.

8.2.6 R5-3) No estudo da herana da forma da raiz do rabanete, e tambm da cor da raiz,
obteve-se na F2 a seguinte proporo fenotpica: 11 vermelhos e esfricos; 20 vermelhos
e ovais; 9 vermelhos e alongados; 21 rosa e esfricos; 39 rosa e ovais; 19 rosa e
alongados; 10 brancos e esfricos; 22 brancos e ovais e 11 brancos e alongados.
a) Quais as interaes allicas para os dois caracteres?
b) Esse tipo de interao facilita ou dificulta o trabalho do pesquisador?
c) Quais os gentipos dos genitores para possveis cruzamentos que produziram a F2
fornecida?
d) Qual o tamanho da F2 para se obter 50 plantas com raiz branca e alongada?
Resposta:
a) Dominncia incompleta
b) Facilita porque pode-se identificar qualquer gentipo atravs de seu fentipo.
c) r1r1v1v1 x r2r2v2v2 ou r1r1v2v2 x r2r2v1v1
d) 800 plantas

8.2.7 Relacione os tipos de interaes allicas com as frequncias genotpicas e


fenotpicas esperadas em F2.

8.3 Alelismo mltiplo


-Nmero de Combinaes Genotpicas possveis = m2
-Nmero de Gentipos Diferentes = (m + 1) m / 2
-Nmero de Gentipos Homozigotos = m
-Nmero de Gentipos Heterozigotos = (m - 1) m / 2
-Nmero de Fentipos Diferentes Quando Dominncia Completa igual ao nmero
de alelos = m
-Nmero de Fentipos Diferentes Quando a Interao allica for Diferente da
Dominncia Completa = Nmero de gentipos Diferentes = (m + 1) m / 2

8.3.1 Indique se cada uma das seguintes proposies sobre a estrutura do DNA
verdadeira (V) ou falsa (F). (Cada letra usada para referir-se concentrao da base
correspondente no DNA): a) ( ) O sistema mais eficiente de autoincompatibilidade o
esporoftico, pois no permite a formao de indivduos homozigotos e nem com gentipo
igual ao da me.

8.3.2 R7-1) Suponha um carter, em uma dada espcie vegetal diplide, seja controlada
por um gene (o gene para as tonalidades de cor da flor), com dois alelos.
a) Qual o nmero de gentipos diferentes, esperado na populao?
b) Quantos fentipos so possveis considerando a presena de dominncia completa?
c) Quantos fentipos so possveis considerando a dominncia incompleta?
d) Quantos gentipos homozigotos seriam encontrados na populao?
e) Se o referido gene tivesse 10 alelos, qual seria a resposta para os itens a, b, c e d?
g) Qual o nmero mnimo de indivduos (diplides) necessrio para conter todos os 10
alelos?
Resposta:
48

a) 3 b) 2 c) 3 d) 2 e) 55, 10, 55, 10 g) 5

8.3.3 R7-2) Por que o alelismo mltiplo no tem importncia para um nico indivduo de
uma espcie diplide?
Resposta:
Porque sendo o indivduo diplide s pode possuir no mximo dois alelos.

8.3.4 R7-4) No caupi (Vigna unguiculata) a cor da vagem imatura controlada por um
gene com 5 alelos, com a seguinte ordem de dominncia: pg - vagem prpura com
suturas verdes > ps - vagem verde com suturas prpuras > po - vagem verde com sutura
ventral prpura > pt - vagem com extremidade prpura > p - vagem verde.
a) Numa populao contendo todos os alelos, quantos gentipos homozigotos e
heterozigotos so esperados?
b) Quantos fentipos so esperados e quais as constituies genotpicas possveis dos
indivduos para cada fentipo?
Resposta:
a) 5 gentipos homozigotos e 10 gentipos heterozigotos
b) 5 fentipos
pg pg, pg ps, pg po, pg pt, pg p Vagem prpura com suturas verdes
ps ps, ps po, ps pt, ps p Vagem verde com suturas purpuras
o o o t
p p , p p, p p o Vagem verde com sutura ventral prpura
pt pt, pt p Vagem com extremidade prpura
p p Vagem verde

8.3.5 R7-5) Um determinado gene A possui 3 alelos (A1, A2, A3) e a ordem de dominncia
: A1 = A2 > A3 (> interao allica de dominncia completa, = interao allica diferente
da dominncia completa).
a) Qual o nmero de gentipos heterozigotos e homozigotos possvel na descendncia?
b) Qual o nmero esperado de fentipos?
c) Se for includa mais a seguinte srie allica A4 > A5 = A6, sendo que todos estes
dominam os alelos de menor expoente, quais as novas respostas para as perguntas
formuladas anteriormente?
Resposta:
a) 3 gentipos heterozigotos e 3 homozigotos
b) 4 fentipos
c) 15 gentipos heterozigotos, 6 homozigotos e 8 fentipos

8.3.6 R7-6) Na alface a presena de antocianina na folha condicionada por um gene


com trs alelos. O alelo R responsvel pela cor vermelha, r' por manchas avermelhadas
e r por vermelho-claro. A ordem de dominncia R > r' > r. Em um campo foram
semeados trs cultivares homozigotas, sendo 35% vermelhos, 20% com manchas
avermelhadas e 45% vermelho-claros, os quais cruzaram-se livremente. Se o agricultor
plantar uma amostra das sementes colhidas no campo, qual ser a proporo genotpica
e fenotpica nesse novo plantio?
49

Resposta: \ 0,35 R 0,20 r 0,45 r


RR - 12,25% vermelha
Rr' - 14,00% vermelha 0,35 0,1225 0,07 0,1575
Rr - 31,50% vermelha R RR Rr Rr
r'r' - 4,00% manchas
avermelhadas 0,20 0,07 0,04 0,09
r'r - 18,00% manchas r Rr rr rr
avermelhadas
rr - 20,25% vermelho 0,45 0,1575 0,09 0,2025
claro r Rr rr rr

8.3.7 Em lantal (espcie arbrea de reproduo sexuada, algama) a presena de


antocianina na folha condicionada por um gene com trs alelos. O alelo A responsvel
pela cor vermelha, a1 por manchas avermelhadas e a por vermelho-claro. A ordem de
dominncia A > a1 > a. Em uma rea experimental foram transplantadas trs cultivares
homozigotas, sendo 30% vermelhas, 25% com manchas avermelhadas e 45% vermelha-
claras, os quais cruzaram-se livremente. Ao plantar uma amostra das sementes colhidas
no campo, qual ser a proporo genotpica e fenotpica nesse novo plantio?

8.3.8 R7-7) Na ameixeira ocorre incompatibilidade gametoftica. Dois agricultores


resolveram formar um pomar de ameixeiras. O primeiro desejando uniformidade plantou
apenas um cultivar no seu pomar. J o outro utilizou 5 cultivares para formar o seu pomar.
Considerando que as condies ambientais sejam as mesmas, qual dos dois agricultores
ter mais sucesso? Justifique sua resposta.
Resposta:
O agricultor que plantou os cinco cultivares ter mais sucesso porque haver no pomar,
por ocasio da polinizao, plens com diferentes alelos, o que ir permitir a produo de
frutos. Aquele que plantou apenas um cultivar no ter frutos no seu pomar, porque ter
apenas dois alelos diferentes da srie S.

8.3.9 R7-8) Em fumo ocorre incompatibilidade gametoftica. Foi obtida um novo cultivar
com 6 alelos (S1, S2, S3, S4, S5 e S6) que controlam a incompatibilidade.
a) Quantos gentipos para essa srie allica so esperados nesse cultivar?
b) Se em um campo ocorrem todos esses gentipos com a mesma frequncia, qual a
proporo de gametas abortados, considerando que os cruzamentos ocorram
inteiramente ao acaso?
Resposta:
a) Combinao de 6 tomados 2 a 2 = 6!/2! * 4!=15 gentipos
b) Das 90 combinaes possveis 30 so incompatveis.
30/90= 0,3333 = 33,33%
macho
Fmea
S1 S2 S3 S4 S5 S6
S1S2 - -
S1S3 - -
S1S4 - -
S1S5 - -
S1S6 - -
S2S3 - -
S2S4 - -
50

S2S5 - -
S2S6 - -
S3S4 - -
S3S5 - -
S3S6 - -
S4S5 - -
S4S6 - -
S5S6 - -

8.3.10 R7-9) Demonstre que em uma espcie que possui incompatibilidade gametoftica
a proporo de gametas abortados fornecida por 2/m, onde m o nmero de alelos de
incompatibilidade existente na espcie.
Resposta:
Observando na tabela acima, na fmea podem cair 6 tipos diferentes de gros de plen e
2 destes so incompatveis. Se tivssemos m alelos em cada fmea 2 gametas seriam
incompatveis e os demais no (2/m).

8.3.11 R7-10) No repolho ocorre incompatibilidade esporoftica. Em uma populao que


est sendo melhorada ocorrem os gentipos S1S2, S2S3, S3S4 em igual frequncia.
a) Admitindo que a ordem de dominncia S1 > S2 > S3 > S4, qual a proporo de
acasalamentos incompatveis?
b) Como proceder, utilizando esse fenmeno, para obter um cultivar hbrido de repolho, a
partir de duas linhagens provenientes dessa populao?
Resposta:
b) Obter linhagens que sejam S1S1, S2S2, S3S3 ou S4S4. Semear no campo
alternadamente duas dessas linhagens que tenham boa capacidade combinatria. Toda
semente produzida ser hbrida, pois dentro da mesma linhagem no tem possibilidade
de ocorrer cruzamentos. O mais difcil manter as linhagens. Existem para isto duas
alternativas, fazer a autofecundao no estdio de boto, quando provavelmente ainda
no se formou a substncia de incompatibilidade no pistilo ou ento utilizar a cultura de
tecidos para propagar as plantas vegetativamente.

8.3.12 a) Descreva o que autoincompatibilidade e como controlada geneticamente em


plantas; b) Diferencie os sistemas de autoincompatibilidade gametoftica e
autoincompatibilidade esporoftica e c) Cite o sistema de autoincompatibilidade mais
eficiente, justificando a sua resposta?

8.3.13 Numa srie allica com 8(oito) alelos, quantos gentipos diferentes podem ser
obtidos? e destes quantos seriam homozigotos?

8.3.14 Explique o que autoincompatibilidade em plantas. Quais os tipos de


autoincompatibilidade e suas diferenas, se um dos tipos de autoincompatibilidade for
mais eficiente, cite e justifique. Comente a utilizao agronmica/florestal da
autoincompatibilidade.

8.3.15 Sob o ponto de vista evolutivo, quais so os objetivos dos mecanismos de


autoincompatibilidade (gametoftica e esporoftica) nos vegetais?
Resposta:
51

Favorecem cruzamentos de gentipos diferentes, promovendo a diversidade gentica e


reduzindo a frequncia de homozigotos, que podem ser prejudiciais para a adaptao de
uma espcie, quando unem em um nico gentipo alelos deletrios ou letais.

8.3.16 Qual a importncia das sries allicas?

8.3.17 Como surgem as sries allicas? (Explique detalhadamente).

8.3.18 Quando ocorre uma mutao (substituio, adio ou deleo de bases), a


probabilidade que o novo alelo seja funcional baixa. Explique porque.

8.3.19 Como a autoincompatibilidade pode contribuir para facilitar a produo de


sementes hbridas?

8.3.20 Qual o tipo de autoincompatibilidade que permite a produo de hbridos a partir


de linhagens, sem interferncia direta na polinizao? (Justifique a sua resposta).

8.3.21 Diferencie autoincompatibilidade gametoftica de autoincompatibilidade


esporoftica.

8.3.22 Qual a importncia de se conhecer os sistemas de autoincompatibilidade para a


produo de frutas e para a produo de sementes hbridas.

8.3.23 Em uma populao de indivduos de uma dada espcie foram identificados quatro
genes e cada gene apresenta quatro alelos. Considerando estes quatro genes, com os
respectivos alelos; quantos indivduos diferentes podem existir nesta populao?
Demonstre o desenvolvimento de sua resposta.

8.4 Pleiotropia

8.4.1 Indique se cada uma das seguintes proposies so verdadeira (V) ou falsa (F).
Sobre pleiotropia e a importncia deste fenmeno para o melhoramento gentico
correto afirmar: ( ) o fenmeno em que somente uma caracterstica afetada por um
gene, mas que no influencia no melhoramento gentico baseado na seleo de
idetipos. ( ) o fenmeno em que mais de uma caracterstica afetada por um gene,
mas que no influencia no melhoramento gentico baseado na seleo de idetipos. ( )
o fenmeno em que somente uma caracterstica afetada por um gene. s vezes, uma
caracterstica considerada boa apresenta-se ligada geneticamente a outra que no
apresenta uma caracterstica desejvel do ponto produtivo. Neste caso, deve-se observar
se a introduo da caracterstica de interesse compensar a introduo da caracterstica
indesejvel. ( ) o fenmeno em que mais de uma caracterstica afetada por um gene.
s vezes, uma caracterstica considerada boa apresenta-se prxima geneticamente de
outra que no apresenta uma caracterstica desejvel, do ponto de vista produtivo. Neste
caso, deve-se observar se a introduo da caracterstica de interesse compensar a
introduo da caracterstica indesejvel.

8.4.2 No estudo da herana de duas caractersticas (Cor da flor, com dominncia


completa e cor do ramo com dominncia incompleta), tem-se a hiptese de que
apresentem controle gentico pleiotrpico. Qual a proporo genotpica e fenotpica
esperada na gerao F2. Formule uma hiptese, representando citogenticamente as
52

metfases I e II, os tipos e propores de gametas formados pelos pais e F1. Justifique
sua resposta.

8.4.3 Quais so as vantagens e desvantagens dos genes pleiotrpicos e em que


situaes podem ser utilizados?

8.4.4 Pleiotropia: Comente um exemplo e como podemos fazer uso da pleiotropia.


53

9 INTERAES GNICAS

RESUMO DAS PROPORES DIHBRIDAS NO CRUZAMENTO AABB x aabb


-----------------------------------------------------------------
|AABB|AABb|AaBB|AaBb|AAbb|Aabb|aaBB|aaBb|aabb|
-----------------------------------------------------------------
A e B com | | | | | | | | | |
dominncia | 1 | 2 | 2 | 4 | 1 | 2 | 1 | 2 | 1 |
incompleta | | | | | | | | | |
-----------------------------------------------------------------
A com dominncia | | | | | | |
incompleta; | 3 | 6 | 1 | 2 | 3 | 1 |
B com dominncia | | | | | | |
completa | | | | | | |
-----------------------------------------------------------------
A e B, ambos com | | | | |
dominncia completa| 9 | 3 | 3 | 1 |
(Propor. Clssica) | | | | |
-----------------------------------------------------------------
aa episttico ao B | | | |
e ao b | 9 | 3 | 4 |
(Epistasia | | | |
recessiva) | | | |
-----------------------------------------------------------------
A episttico ao B e| | | |
ao b | 12 | 3 | 1 |
(Epist. Dominante) | | | |
-----------------------------------------------------------------
A episttico ao B e| | | |
ao b; bb episttico| 13 | 3 | |
ao A e ao a | | | |
(Epistasia dominan-|(O 13 composto das 12 clas-| | |
te recessiva) |ses + aabb da ltima coluna) | | |
-----------------------------------------------------------------
aa episttico ao B | | |
e ao b; bb epist- | | |
tico ao A e ao a | 9 | 7 |
(Epistasia reces- | | |
siva dupla) | | |
-----------------------------------------------------------------
A episttico ao B | | |
e ao b; B epistti-| | |
co ao A e ao a | 15 | 1 |
(Epistasia dominan-| | |
te dupla) | | |
-----------------------------------------------------------------
Interao dupla | 9 | 6 | 1 |
-----------------------------------------------------------------

9.1 As principais causas da correlao gentica entre caracteres so: ( ) Ligao gnica
e dominncia; ( ) Ligao gnica e pleiotropismo; ( ) Pleiotropismo e dominncia;
( ) Pleiotropismo e penetrncia. A resposta correta ( ).
54

9.2 R5-4) Em abbora, a cor do fruto pode ser branca, amarela e verde. Do cruzamento
de plantas homozigotas de frutos brancos com plantas de frutos verdes foi obtida uma
gerao F1 com todos os indivduos de frutos brancos. Na gerao F2 foram obtidas 45
plantas com frutos brancos, 13 com frutos amarelos e 3 com frutos verdes.
a) Qual a explicao para a herana desse carter?
b) Cruzando-se uma planta de frutos amarelos com outra de frutos brancos obtiveram-se
27 plantas com frutos brancos, 16 com frutos amarelos e 16 com frutos verdes. Quais os
gentipos das duas plantas que foram cruzadas?
Resposta:
a) A segregao fenotpica da F2 de 12:3:1, indicando que o carter controlado por
dois genes com distribuio independente, os quais apresentam a interao do tipo
epistasia dominante. Admitindo, por exemplo, os loci A e B e o alelo B o episttico em
relao aos alelos A e a.
b) Gentipo da planta de frutos amarelos: Aabb
Gentipo da planta de frutos brancos: aaBb

9.3 R5-5) Do cruzamento entre duas linhagens de ervilha de cheiro (Lathyrus


odonratus) de flores brancas foram obtidas plantas com 100% de flores de cor prpura.
Dos 245 descendentes provenientes da autofecundao destas plantas, 110
apresentaram flores brancas e as demais prpuras. Determine o tipo de herana do
carter e o provvel gentipo dos genitores, demonstrando todos os passo preceituados
pela gentica mendeliana..
Resposta:
A segregao fenotpica da F2 de 9:7 indicando que o carter controlado por genes
com distribuio independente, os quais apresentam a interao do tipo epistasia
recessiva dupla. No caso, podemos adotar como exemplos os loci L e H, sendo os
epistticos os alelos recessivos l e h.
Gentipos genitores: LLhh x llHH

9.4 R5-6) Em alguns cultivares de cebola, a cor do bulbo pode ser amarela, roxa ou
branca. Do cruzamento entre um cultivar de cor roxa com outro de cor branca, foi obtido
na gerao F2 a segregao de 9 roxos : 3 amarelos : 4 brancos.
a) Qual a explicao gentica para esse resultado?
b) Estabelea um esquema que explique bioquimicamente esse resultado.
Resposta:
a) O carter apresenta epistasia recessiva, isto , apenas o alelo recessivo de um dos loci
episttico.
b) Considerando os loci C e B e como episttico recessivo o alelo c, a via metablica ser:
Alelo C ---- Alelo B ----
Enzima C <-- Enzima B <--
Substrato ---------> Pigmento roxo ---------> Produto final
(Branco) (amarelo)

9.5 R5-8) Do cruzamento da uma planta A com uma B, de feijo, foram obtidos 510
descendentes de flores brancas e 176 de flores prpura. Quando a planta A foi
autofecundada ela produziu 76 descendentes com flores prpuras e 58 com flores
brancas.
a) Quais so os gentipos das plantas A e B?
55

b) Qual a proporo genotpica e fenotpica esperada da planta B quando ela for


autofecundada?
Resposta:
a) Planta A: AaBb
Planta B: aabb
b) 100% aabb brancas

9.6 R5-7) Um determinado tecido pode apresentar-se incolor, vermelho ou prpura. A


formao destes fentipos controlada pelos seguintes passos metablicos:
I
substrato 1
{ --> substncia incolor

{
i A M
--> substrato 1
(incolor)
--> substrato 2

a
(vermelho)

-->substncia
{ --> prpura
m
--> vermelho

incolor
Admitindo-se que ocorra dominncia completa em todos os locos, pergunta-se: a) Quais
os fentipos dos seguintes gentipos?
IiAAMm; IiaaMM; IIAAmm; iiAAMM; iiAAmm.
b) Qual a proporo fenotpica em F2 do cruzamento entre dois indivduos, sendo um de
gentipo IIAAMM e o outro de gentipo iiaamm?
Resposta:
a) Branco, branco, branco, prpura, vermelho
b) 52/64 branco : 9/64 prpura : 3/64 vermelha

9.7 R5-9) No caupi, um alelo C responsvel pela resistncia raa 1 de ferrugem e seu
alelo c, resistente raa 2. Plantas Cc so resistentes s duas raas. A altura da planta
devido ao de 2 genes, sendo A_B_ e A_bb responsveis por planta alta, aaB_
responsvel por planta com altura mdia e aabb, planta baixa. O cruzamento entre uma
planta alta e resistente s duas raas com outra baixa e tambm resistente s duas raas
forneceu o seguinte resultado: 205 altas e resistentes raa 1; 394 altas e resistentes s
duas raas; 195 altas e resistentes raa 2; 98 mdias e resistentes raa 1; 202 mdias
e resistentes s duas raas; 97 mdias e resistentes raa 2; 102 baixas e resistentes
raa 1; 206 baixas e resistentes s duas raas; 101 baixas e resistentes raa 2.
a) Quais os gentipos das plantas que foram cruzadas?
b) Quais os tipos de interaes envolvidas em cada carter?
Resposta:
a) Planta alta e resistente s duas raas: AaBbCc
Planta baixa e resistente s duas raas: aabbCc
b) Reao ao patgeno: Herana monognica com interao allica do tipo
codominncia. Porte da Planta: Herana dignica com distribuio independente e
interao gnica do tipo epistasia dominante, sendo o alelo episttico o A, por exemplo.

9.8 R5-10) Em galinhas, observaram-se os seguintes resultados para cor de plumagem a


partir dos cruzamentos entre as raas Wyandotte branca, W, Leghorn branca, L e Silkie
Branca, S: o cruzamento das raas W x L produziu em F1 100% branco e em F2 a
56

Proporo fenotpica dos descendentes foi 13 brancos : 3 coloridos. No cruzamento W x


S, o F1 foi tambm 100% colorido, porm na F2 foram produzidos 9 coloridos : 7 brancos.
a) Fornea as explicaes genticas para os resultados obtidos.
b) Quais as propores fenotpicas esperadas, nas geraes F1 e F2, do cruzamento L x
S?
Resposta:
-----------------------------------------------------------------
W (branca) X L (branca) W (branca) X S (branca)
_ _ _ _ x _ _ _ _ _ _ _ _ x _ _ _ _
F1 100% branca F1 100% colorida
_ _ _ _ _ _ _ _
F2 13 brancas : 3 coloridas F2 9 coloridas : 7 brancas
A_B_ aaB_ B_C_ B_cc
A_bb bbC_
aabb bbcc
-----------------------------------------------------------------
A_ ep. B e b aa ep. B e b
bb ep. A e a bb ep. A e a
Epistasia dominante Epistasia recessiva
recessiva dupla
-----------------------------------------------------------------
a) A cor da plumagem controlada por trs genes sendo os seguintes os gentipos das
trs raas:
Wyandotte branca: iiccRR ou aabbCC
Leghorn branca: IICCRR ou AABBCC
Silkie branca: iiCCrr ou aaBBcc
Para ocorrer a cor da plumagem podem atuar trs genes epistticos, sendo um dominante
I (ou A) e dois recessivos c e r (ou b e c), os quais condicionam plumagem branca. Em
qualquer outra combinao genotpica a ave ser colorida.
b) F1: 100% brancas; F2: 13/16 brancas : 3/16 coloridas

9.9 Explique, atravs de um exemplo hipottico, o que interao gnica?

9.10 Explique epistasia dominante recessiva e por interao dupla?

9.11 Explique epistasia dominante recessiva e interao dupla utilizando uma rota
metablica.

9.12 No estudo de um carter, como por exemplo a colorao dos pelos em soja (cinza,
marrom claro e marrom escuro), qual o procedimento deve ser utilizado para verificar se
este carter controlado por uma srie allica (um gene) ou por mais de um gene
(interao gnica)? E a qual resultado atribudo ao carter ser governado por mais de
um gene?

9.13 No estudo de um carter, como por exemplo a colorao da pelagem em coelhos


(aguti, chinchila, himalaia e albino), qual o procedimento deve ser utilizado para verificar
se este carter controlado por uma srie allica (um gene) ou por mais de um gene
57

(interao gnica)? E a qual resultado deve-se atribuir ao carter ser governado por mais
de um gene?

9.14 Qual a diferena entre fenocpia e heterogeneidade gentica?


Resposta:
Fenocpia: Caracterstica resultante de causa ambiental, indistinguvel de caracterstica
com causa gentica;
Heterogeneidade Gentica: Caractersticas indistinguveis, com causas genticas
diferentes.

9.15 Qual a proporo genotpica e fenotpica esperada em F2 quando esto envolvidos 2


genes (A normal, a arrepiada e R1 vermelho, R2 branco, Heterozigoto ruo),
sendo um com dominncia completa (A) e um com codominncia (R).

9.16 Analisando as rotas metablicas apresentadas a seguir, para cada caso, responda:
a) Esta ocorrendo interao gnica (Justifique)?; b) Se estiver ocorrendo interao gnica,
que tipo? (Justifique sua resposta) e c) Qual a proporo esperada de cada um dos
fentipos?
a) B_ b) B_
A_ --- O A_ ---
-- O -| -- O -|
| |bb | |bb
| --- O | --- O
| |
O -| B_ O -| B_
| --- | --- O
|aa | |aa |
-- O -|bb -- O -|bb
--- O --- O

9.17 A independncia na distribuio dos genes no necessariamente implica numa


independncia de ao gnica. Comente esta afirmao.

9.18 Explique como funciona ao nvel bioqumico a interao allica de codominncia?

9.19 Demonstre bioquimicamente, utilizando uma rota metablica, o controle gentico de


um carter que apresente interao episttica duplo dominante. Considere dois genes A e
B, com dois alelos, dominncia completa e distribuio independente.

9.20 Interao gnica: regra ou exceo no comportamento dos genes, na manifestao


genotpica. Justifique a sua resposta (a avaliao ser baseada na justificativa).
58

10 CRUZAMENTO CONTROLADO - Uma ferramenta para estudos


genticos

10.1 Indique se cada uma das seguintes proposies so verdadeira (V) ou falsa (F).
( ) Com sucessivas geraes de autofecundao a descendncia de um cruzamento
aumenta a homozigose e diminui a variabilidade gentica. ( ) Os mecanismos que geram
variabilidade gentica podem ser ambientais. ( )

10.2 Quais as consequncias e usos de cruzamentos endogmicos?

10.3 Em aves os hbridos so utilizados na produo comercial de frangos para o abate e


para a postura. Um dos primeiros passos no desenvolvimento de um hbrido a produo
de linhagens. Descreva como proceder para obter uma linhagem em aves (descreva os
cruzamentos a serem realizados e demonstre o que acontece com o decorrer das
geraes utilize um caractere qualitativo em sua explicao).

10.4 Quais so os procedimentos para a realizao do teste de alelismo e quais so as


suas finalidades.

10.5 Como proceder para obter uma linhagem homozigota em organismos diicos
(Organismo com rgos reprodutores masculinos e femininos em indivduos distintos,
unissexuais). Descreva detalhadamente este procedimento.

10.6 Considerando as hipteses abaixo a respeito do controle gentico de duas


caractersticas (Cor do hipoctilo e cor da flor):

Hiptese 1 (2 genes) Hiptese 2 (um gene para as duas caractersticas)


gene A Cor do hipoctilo Gene A | Cor do hipoctilo
gene B Cor da flor |Cor da flor

Defina os cruzamentos necessrios para elucidar o controle gentico destes dois


caracteres. A que resultado seria atribudo: a) o controle gentico de apenas um gene
pleiotrpico, b) Cada caractere controlado geneticamente por um gene e estes se
distribuem independentemente e c) Cada caractere controlado geneticamente por um
gene e estes genes esto ligados fisicamente.

10.7 As principais etapas no estudo do controle gentico de um carter so: A) a escolha


dos genitores, B) a conduo do experimento, C) a proposio de hipteses, D) o teste
das hipteses e E) a interpretao gentica dos resultados. A formulao de hipteses
baseia-se em conhecimentos prvios, dentre os quais se destacam o conhecimento do
comportamento dos cromossomos durante as divises celulares e as leis mendelianas.
Considerando o exposto acima:
a) O que so genes mendelianos.
b) Considerando-se segregao independente e dominncia completa: Demonstre
citogeneticamente os tipos e as propores de gametas formados pelas geraes P1, P2
e F1, para um e para dois genes e; Demonstre as propores genotpicas e fenotpicas
esperadas na gerao F2 e no cruzamento teste (F1 x testador), para um e para dois
59

genes.
c) Considerando-se indivduos heterozigotos para dois genes { gene A (A Liso e a
rugoso) e gene B (B amarelo e b no amarelo)} com distribuio independente, sendo
que o gene B apresenta um de seus alelos com letalidade recessiva, represente os tipos e
as frequncias de gametas formados, bem como as frequncias genotpicas e fenotpicas
esperadas a partir deste intercruzamento.

10.8 As principais etapas no estudo do controle gentico de um carter so: A) a escolha


dos genitores, B) a conduo do experimento, C) a proposio de hipteses, D) o teste
das hipteses e E) a interpretao gentica dos resultados. A formulao de hipteses
baseia-se em conhecimentos prvios, dentre os quais se destacam o conhecimento do
comportamento dos cromossomos durante as divises celulares e o conhecimento das
leis mendelianas. Na tabela abaixo esto os resultados parciais, referentes ao estudo do
controle gentico da cor do fruto (C) e do formato do fruto (F).
Cruzamento teste
Fentipos Gerao
(F1 x testador)
Cor Formato P1 P2 F1 F2 Frequncias Gentipo
Vermelho Alongado ___ ___ ___ ___ ___ ____\____
Vermelho Discide 65 ___ ___ ___ ___ ___ ____\____
Vermelho Redondo 05 ___ ___ ___ ___ ___ ____\____
Branco Alongado 05 ___ ___ ___ ___ ___ ____\____
Branco Discide ___ ___ ___ ___ ___ ____\____
Branco Redondo ___ ___ ___ ___ ___ ____\____
Total 960 480
a) Considerando a hiptese de pleiotropia e os dados da tabela acima: Represente
citogeneticamente as clulas em metfase I nas geraes P1, P2 e F1, com os
respectivos tipos e propores de gametas formados em cada gerao; Demonstre quais
so as frequncias genotpicas e fenotpicas esperadas na gerao F2 e no Cruzamento
teste (F1 x testador).
b) Considerando a hiptese de dois genes com distribuio independente e os dados da
tabela acima: Represente citogeneticamente as clulas em metfase I nas geraes P1,
P2 e F1, com os respectivos tipos e propores de gametas formados em cada gerao;
Demonstre quais so as frequncias genotpicas e fenotpicas esperadas na gerao F2 e
no Cruzamento teste (F1 x testador).
c) Considerando a hiptese de interao gnica duplo recessiva e os dados da tabela
acima: Represente citogeneticamente as clulas em metfase I nas geraes P1, P2 e
F1, com os respectivos tipos e propores de gametas formados; Demonstre quais so as
frequncias genotpicas e fenotpicas esperadas na gerao F2 e no Cruzamento teste
(F1 x testador).
d) Se considerarmos a hiptese de que os carteres C e D sejam governados cada um
por um gene mendeliano clssico, distanciados de 15 cM e os dados da tabela acima:
Represente citogeneticamente clulas em metfase I nas geraes P1, P2 e F1, com os
respectivos tipos e propores de gametas formados em cada gerao; Demonstre quais
so as frequncias genotpicas e fenotpicas esperadas na gerao F2 e no Cruzamento
teste (F1 x testador).
60

11 LIGAO GNICA, PERMUTA E MAPAS GENTICOS

11.1 Considerando dois genes ligados (A e B), com frequncia de recombinao de 20%.
Demonstre citogeneticamente qual a percentagem de clulas que apresentam quiasmas
envolvendo a regio entre os genes A e B e a frequncia de gametas parentais e
recombinantes (Utilize 10 clulas, representando os genes citados e os resultados
esperados para a situao descrita acima, demonstrando a percentagem de clulas que
apresentam quiasmas e a frequncia de gametas recombinantes e parentais).

11.2 Considere dois genes ligados [Gene A (A1 - preto, A2 - branco) e gene B (B1 - liso,
B2 - arrepiado)], com frequncia de recombinao de 30%. O fentipo da F1 preto liso.
Demonstre citogeneticamente a proporo esperada (hiptese) num cruzamento teste (F1
x testador), considerando estes dois genes. Apresente, em forma de tabela, o fentipo
dos genitores, da F1 e as respectivas propores esperadas em F2 e no cruzamento teste
(F1 x testador).

11.3 R8-1) No tomateiro a altura da planta devida a um gene com dominncia do alelo
D, que condiciona planta alta em relao a d para planta an. A presena de pilosidade
no fruto depende do alelo recessivo p, enquanto o alelo P condiciona frutos lisos. Foi
realizado um cruzamento teste e obtido o seguinte resultado: an lisa 5; an pilosa 118;
alta e pilosa 5; alta e lisa 161.
a) Qual a frequncia esperada de cada fentipo, no cruzamento teste, se os genes
apresentassem distribuio independente?
b) De acordo com a resposta no item a qual a explicao para os resultados obtidos?
c) Esquematize as situaes que ocorrem no diplteno, metfase I e telfase II, dos
meicitos do indivduo da gerao F1.
d) Considerando 100 meicitos, qual o nmero de clulas em que foi observada cada uma
dessas situaes?
Resposta:
a) 72,25 de cada fentipo; b) Os genes no apresentam distribuio independente
portanto eles esto situados no mesmo cromossomo.
b) Aproximadamente 7 meicitos apresentam quiasmas entre os dois genes considerados
e 93 no apresentaram.

11.4 Numa espcie florestal a altura da planta controlada por um gene com dois alelos
(R - planta alta e r - planta an), enquanto que a pilosidade da folha controlada por outro
gene (Q - folha lisa e q - folha pilosa). Foi realizado um cruzamento teste (F1 x testador) e
obtido o seguinte resultado: an lisa 118 plantas; an pilosa 5 plantas; alta e pilosa 161
plantas; alta e lisa 6 plantas. a) Qual a frequncia esperada de cada fentipo, no
cruzamento teste, se os genes apresentassem distribuio independente? b) De acordo
com a resposta no item a qual a explicao para os resultados obtidos? c) Esquematize
citogeneticamente o que ocorre no diplteno, na metfase I e na telfase II, dos meicitos
do indivduo da gerao F1. d) Considerando 1000 meicitos, qual o nmero de clulas
em que foi observada cada uma dessas situaes? Argumente/demonstre de forma
consistente cada uma das respostas. (X2T (p=0,05) GL=1 = 3,84; X2T (p=0,05) GL=2 = 5,99; X2T
2
(p=0,05) GL=3 = 7,82 e X T (p=0,05) GL=4 = 9,49). A avaliao ser baseada na
argumentao/demonstrao de cada resposta.
61

11.5 R8-3) No caupi, o alelo I, dominante, responsvel pela resistncia ao vrus da


mancha anelar e est ligado ao alelo C, tambm dominante, que confere resistncia ao
vrus do mosaico. O cruzamento de uma planta resistente s duas doenas com outra
suscetvel produziu a seguinte descendncia:
145 plantas resistentes aos dois vrus;
151 plantas suscetveis aos dois vrus;
450 plantas resistentes apenas ao vrus da mancha anelar;
440 plantas resistentes apenas ao vrus do mosaico.
a) Qual a distncia entre os genes?
b) Indique os gentipos dos pais e dos descendentes do cruzamento.
c) Qual a fase de ligao dos genes, no genitor resistente?
Resposta:
a) 24,96 cM; b) genitores: Tc/tC e tc/tc, Descendentes: TC/tc, tc/tc, Tc/tc e tC/tc,
c) Repulso

11.6 R8-4) Em soja o alelo dominante R confere nodulao normal e seu alelo recessivo r
restringe a nodulao. O alelo F, tambm dominante, responsvel por caule cilndrico e
seu alelo f, por caule fasciolado. O cruzamento entre o cultivar Clark e o T248 produziu os
seguintes resultados:
FENTIPOS
-----------------------------------------------------------------
Ndulo Ndulo Ndulo Ndulo
NORMAL NORMAL REDUZIDO REDUZIDO
GERAES Caule Caule Caule Caule
CILNDRICO FASCIOLADO CILNDRICO FASCIOLADO
-----------------------------------------------------------------
P1 40 -- -- --
P2 -- -- -- 20
F1 25 -- -- --
F2 820 228 227 52
RC1 250 -- -- --
RC2 102 68 72 108
a) Fornea a interpretao gentica desses resultados.
b) Determine a fase de ligao desses resultados.
c) Determine a distncia entre os genes.
Resposta:
a) A partir do resultado do RC2 identifica-se mais facilmente que os genes esto ligados.
b) Atrao; c) 40 cM

11.7 R8-5) A cor do aqunio em alface controlada por um gene com dominncia do
alelo que condiciona aqunio preto (W) sobre o branco (w). A ocorrncia de folhas com os
bordos ondulados condicionada por um alelo recessivo (fr) e o alelo dominante
condiciona folha lisa (Fr). Considerando que estes dois genes esto situados no mesmo
cromossomo a 34 cM, pergunta-se:
a) Qual a proporo fenotpica esperada na gerao F2 do seguinte cruzamento?
P1 X P2
Aqunios Pretos e Folhas Aqunios Brancos e Folhas
Onduladas Lisas
34% de gametas recombiantes (WFr e wfr) e 66% de gamestas parentais (Wfr e wFr).
62

b) Se fosse realizado o cruzamento teste, qual seria a proporo esperada?


Resposta:
a) 52,89% aqunios pretos e folhas lisas
22,11% aqunios pretos e folhas onduladas
22,11% aqunios brancos e folhas lisas
2,89% aqunios brancos e folhas onduladas
\ | 0,17 WF | 0,33 Wf | 0,33 wF | 0,17 wf |
-----+----------+----------+----------+----------|
0,17 | 0,0289 | 0,0561 | 0,0561 | 0,0289 |
WF | WW FF | WW Ff | Ww FF | Ww Ff |
-----+----------+----------+----------+----------|
0,33 | 0,0561 | 0,1089 | 0,1089 | 0,0561 |
Wf | WW Ff | WW ff | Ww Ff | Ww ff |
-----+----------+----------+----------+----------|
0,33 | 0,0561 | 0,1089 | 0,1089 | 0,0561 |
wF | Ww FF | Ww Ff | ww FF | ww Ff |
-----+----------+----------+----------+----------|
0,17 | 0,0289 | 0,0561 | 0,0561 | 0,0289 |
wf | Ww Ff | Ww ff | ww Ff | ww ff |
-------------------------------------------------
b) 17% aqunios pretos e folhas lisas
33% aqunios pretos e folhas onduladas
33% aqunios brancos e folhas lisas
17% aqunios brancos e folhas onduladas

11.8 R8-6) Pericarpo vermelho no milho devido ao alelo dominante P, enquanto


pericarpo incolor condicionado pelo alelo recessivo p. Sementes no pendo so devidas
ao alelo recessivo ts2, enquanto pendo normal depende do alelo Ts2. Os resultados
obtidos nos cruzamentos teste envolvendo duas plantas heterozigotas foram os
seguintes:
Descendentes
Fentipos
Planta 1 Planta 2
1 - pericarpo vermelho - semente pendo 15 580
2 - pericarpo incolor - pendo normal 14 610
3 - pericarpo incolor - semente pendo 1174 8
4 - pericarpo vermelho - pendo normal 1219 9
a) Quais os gentipos das plantas 1 e 2?
b) Qual a frequncia de recombinao entre os genes P e Ts2?
c) Se as plantas 1 e 2 forem cruzadas, qual a frequncia esperada de plantas com
pericarpo incolor e sementes no pendo?
d) Estes genes esto ligados ou distribuem-se independentemente? Explique.
Resposta:
a) Planta 1: P Ts2 / p ts2 Planta 2: P ts2 / p Ts2 b) 1,3% em mdia; c) 0,32%

11.9 R8-7) Uma linhagem de melo, homozigota para trs alelos recessivos, q, c, f que
condicionam, respectivamente, polpa verde, casca verde e fruto liso, foi cruzada com
outra linhagem homozigota para os alelos dominantes. A F1 foi retrocruzada com a
linhagem recessiva dando os seguintes resultados:
63

-----------------------------------------------------------------
DESCENDENTES
-----------------------------------------------------------------
FENTIPO NMERO
-----------------------------------------------------------------
Polpa verde, casca verde, fruto liso 422
Polpa salmo, casca amarela, fruto rendilhado 418
Polpa verde, casca amarela, fruto liso 424
Polpa salmo, casca verde, fruto rendilhado 416
-----------------------------------------------------------------
a) Estes genes esto ligados ou distribuem-se independentemente?
Explique.
b) Caso estiverem ligados, estimar a frequncia de recombinao.
Resposta:
a) Os genes q e f esto situados no mesmo cromossomo e so independentes de c.
b) A frequncia de recombinao entre os genes q e f nula porque no ocorreram
descendentes com fentipo recombinante, como por exemplo Polpa verde, casca verde e
fruto rendilhado.

11.10 R8-8) No cromossomo 1 do algodoeiro ocorrem os genes que afetam o


comprimento e o tipo de folha L e Cu a 16 cM de distncia. O alelo L confere folha
estreita e l folha larga. O alelo Cu condiciona folhas normais e cu folhas onduladas. O
gene para a reao ao fusarium encontra-se no cromossomo 2, sendo o alelo dominante
W responsvel pela resistncia.
a) Qual o resultado esperado do cruzamento teste sendo a fase de ligao de repulso?
b) Qual a proporo esperada de plantas com folhas largas e onduladas e suscetveis ao
fusarium, provenientes da autofecundao da planta heterozigota utilizada no cruzamento
teste?
Resposta:
a)
4% folhas estreitas, normais e resistentes ao fusarium
4% folhas estreitas, normais e suscetveis ao fusarium
21% folhas estreitas, onduladas e resistentes ao fusarium
21% folhas estreitas, onduladas e suscetveis ao fusarium
21% folhas largas, normais e resistentes ao fusarium
21% folhas largas, normais e suscetveis ao fusarium
4% folhas largas, onduladas e resistentes ao fusarium
4% folhas largas, onduladas e suscetveis ao fusarium
b) 0,16%

11.11 R8-9) No estdio de plntula, uma planta de milho homozigota para todos os alelos
recessivos apresenta fentipo folhas brilhantes, virescente e sem lgula. Essa planta foi
cruzada com outra heterozigota para as trs caractersticas produzindo a seguinte
proporo de descendentes: (Obs.: Folhas brilhantes = gl, virescente = v, sem lgula = lg).
64

-----------------------------------|---------------|------------|
FENTIPOS | GENTIPO |N Descentes|
-----------------------------------|---------------|------------|
F. sem brilho, verde, com lg.| _ _ _ / _ _ _ | 28 |
F. sem brilho, verde, sem lg.| _ _ _ / _ _ _ | 179 |
F. sem brilho, virescente, com lg.| _ _ _ / _ _ _ | 69 |
F. sem brilho, virescente, sem lg.| _ _ _ / _ _ _ | 250 |
F. brilhantes, verde, com lg.| _ _ _ / _ _ _ | 198 |
F. brilhantes, verde, sem lg.| _ _ _ / _ _ _ | 70 |
F. brilhantes, virescente, com lg.| _ _ _ / _ _ _ | 183 |
F. brilhantes, virescente, sem lg.| _ _ _ / _ _ _ | 23 |
-----------------------------------|---------------|------------|
TOTAL -----------------------------------> 1000 |
----------------------------------------------------------------|
a) Determinar a ordem dos genes e construir o mapa gentico envolvendo estes trs loci.
b) Calcular o coeficiente de interferncia e interpretar o resultado.
c) Qual o gentipo da planta heterozigota usada no cruzamento teste?
Resposta:
a)
v 42,8 cM gl 19,0 cM lg
--+------------------+----------------------+---
b) 37,28% dos gametas duplo recombinantes (originados por duplas permutas) esperados
no ocorreram.
c) v Gl lg / V gl Lg

R8-10) No cromossomo 5 do milho esto localizados os seguintes genes e suas


respectivas frequncias de recombinao:
lu - gl = 5 cM gl - ps = 5 cM lu - ps = 10 cM
lu - vp2 = 9 cM gl - bv = 13 cM vp2- bv = 9 cM
ps - bm = 2 cM bv - ps = 8 cM bm - bv = 6 cM
a) Construa o mapa gentico mostrando a posio desses 6 genes.
b) Quais as distncias entre os genes lu - bm; lu - bv; gl - vp2; gl - bm; vp2 - ps; vp2 - bm?
Resposta:
a)
lu gl vp2 ps bm bv
-+---------------+------------+---+------+-----------------+
5 cM 4 cM 1 cM 2 cM 6 cM
b) 12 cM, 18 cM, 4 cM, 7 cM, 1 cM, 3 cM.

11.12 A partir dos dados a seguir construa o mapa de ligao dos genes a, b, c e d.
d c = 10 um c a = 13 um a d = 3 um
b c = 18 um b d = 8 um
Resposta:
b a d c
-+-------------+------+--------------------------+
5 um 3 um 10 um
+--------------- 13 um -----------+
-+-------------------- 18 um -------------------+
65

11.13 R8-11) Em tomate os seguintes genes esto localizados no cromossomo 2, como


mostra o mapa:
m d p
--+-----------------+-----------------+----
17 21,5 26
Onde: m - folhas manchadas; d - planta an; p - fruto piloso a) A partir do cruzamento
MDP/MDP x mdp/mdp, qual a proporo em F2 de indivduos puros e de fentipo:
1-Folhas verdes, planta alta e fruto liso;
2-Folhas verdes, planta an e fruto liso.
b) Quais seriam as respostas para o item a se o F1 apresentasse a constituio
mDP/Mdp?
Resposta:
a) 1 - 20,79%, 2 - 1,26 x 10-4%; b) 1 - 0,046%, 2 - 0,046%
FDR = 0,045 * 0,045 = 0,002025 MDP 0,4560125 MDp 0,0214875
FR(m-d) = 0,045 - 0,002025 mdp 0,4560125 mdP 0,0214875
FR(d-p) = 0,045 - 0,002025 Mdp 0,0214875 MdP 0,0010125
mDP 0,0214875 mDp 0,0010125

11.14 R8-12) Howes e Lachman, 1974 (The journal of Heredity, 65:313-4), verificaram
que os alelos recessivos id, a e h que condicionam os fentipos flores indeiscentes,
plantas sem antocianina e sem plos, respectivamente, esto situados no cromossomo 11
do tomateiro, conforme o seguinte mapa gentico: (obs.: I = 0,2).
h a id
--+-----------------+-----------------+----
37 57 74,4
a) Esquematize um cruzamento teste envolvendo os trs genes em fase de atrao.
b) Considere que 1000 indivduos foram obtidos nesse cruzamento teste, qual o nmero
esperado de cada fentipo?
Resposta:
a) H A Id / h a id x h a id / h a id
b)
327 pilosa, com antocianina e flores deiscentes
73 pilosa, com antocianina e flores indeiscentes
14 pilosa, sem antocianina e flores deiscentes
86 pilosa, sem antocianina e flores indeiscentes
86 sem pelos, com antocianina e flores deiscentes
14 sem pelos, com antocianina e flores indeiscentes
73 sem pelos, sem antocianina e flores deiscentes
327 sem pelos, sem antocianina e flores indeiscentes

11.15 R8-13) No cromossomo 3 do milho ocorrem trs genes conforme o seguinte mapa
gentico:
Cr1 d1 a
--+-----+-----------------------------+----
0 18 111
a) Quais as propores genotpicas esperadas a partir do cruzamento Cr1 d1 a / cr1 D1 A
x cr1 d1 a / cr1 d1 a?
66

b) Qual o tamanho da descendncia do item a para se obter 50 descendentes do gentipo


Cr1 D1 A / cr1 d1 a, com 95% de probabilidade?
Resposta:
a)
20,5% Cr1 d1 a 20,5% cr1 D1 A
4,5% Cr1 D1 A 4,5% Cr1 D1 a
4,5% cr1 d1 A 4,5% cr1 d1 a
20,5% Cr1 d1 A 20,5% cr1 D1 a
b) 3253 plantas

11.16 R8-14) Um cultivar de caupi, resistente ao fusarium e aos nematides que causam
galha, foi cruzado com outro cultivar suscetvel tanto ao fusarium quanto aos nematides.
Todas as plantas F1 mostraram-se resistentes aos dois organismos e o retrocruzamento
da F1 com o cultivar suscetvel produziu 128 plantas resistentes aos dois organismos e
132 suscetveis aos dois organismos.
a) Formule uma hiptese para explicar a herana desses caracteres.
b) Sugira um procedimento para testar essa hiptese.
Resposta:
a) Existem duas hipteses para explicar o resultado: A primeira a existncia de dois
genes muito prximos num cromossomo e em consequncia no foram produzidos
descendentes recombinantes. A segunda a reao do caupi aos dois organismos ser
controlada por apenas um gene e nesse caso ele pleiotrpico.
b) Para discriminar as hipteses deve-se realizar um cruzamento teste ou obter uma
gerao F2. Em ambos os casos necessrio utilizar uma populao de maior tamanho
possvel, a fim de se incrementar a chance de ocorrerem recombinantes, cuja estejam
envolvidos dois genes.

11.17 A partir do cruzamento de indivduos homozigotos para os trs genes (A, B e C)


obteve-se a F1, a qual foi cruzada com um testador. O resultado do cruzamento teste
envolvendo os trs genes so apresentados a seguir:
GENTIPO FREQUNCIA OBSERVADA
-----------------------------------------------------------
ABC/abc (_ _ _ / _ _ _) 60
Abc/abc (_ _ _ / _ _ _) 7
ABc/abc (_ _ _ / _ _ _) 40
aBc/abc (_ _ _ / _ _ _) 235
abc/abc (_ _ _ / _ _ _) 62
AbC/abc (_ _ _ / _ _ _) 270
abC/abc (_ _ _ / _ _ _) 48
aBC/abc (_ _ _ / _ _ _) 4
-----------------------------------------------------------
TOTAL 726
a) Qual o gentipo dos pais e da F1?
b) Qual a ordem dos genes? Reescreva os genes, na ordem correta, dentro dos
parnteses.
c) Construa o mapa gentico envolvendo os trs loci.
d) Calcule o coeficiente de interferncia e interprete o resultado.
67

11.18 Uma linhagem, de uma espcie de aves, homozigota para trs alelos recessivos, a,
b, c que condicionam, respectivamente, crista simples, plumagem branca e porte
normal, foi cruzada com outra linhagem homozigota para os alelos dominantes. A F1 foi
retrocruzada com a linhagem recessiva dando os seguintes resultados:
DESCENDENTES
-----------------------------------------------------------------
FENTIPO NMERO
-----------------------------------------------------------------
Plumagem BRANCA, Crista SIMPLES, porte NORMAL 211
Plumagem COLORIDA, Crista ROSA, porte RASTEIRA 209
Plumagem BRANCA, Crista ROSA, porte RASTEIRA 212
Plumagem COLORIDA, Crista SIMPLES, porte NORMAL 208
a) Estes genes esto ligados ou distribuem-se independentemente?
Explique (Resposta no justificada no ser avaliada).
b) Caso estiverem ligados, estimar a frequncia de recombinao.

11.19 No tomateiro a altura da planta devida a um gene com dominncia do alelo D,


que condiciona planta alta em relao a d para planta an. A presena de pilosidade no
fruto depende do alelo recessivo p, enquanto o alelo P condiciona frutos lisos. Foi
realizado um cruzamento teste e obtido o seguinte resultado: an e lisa 5; an e pilosa
118; alta e pilosa 5; alta e lisa 161.
a) Qual a frequncia esperada de cada fentipo, no cruzamento teste(F1 com testador), se
os genes apresentassem distribuio independente?
b) De acordo com a resposta no item a qual a explicao para os resultados obtidos?

11.20 Em galinhas o tipo de crista pode ser dupla, condicionada pelo alelo dominante D,
enquanto crista normal condicionada pelo alelo d. Espora mltipla devido ao alelo
dominante M, enquanto espora simples devido ao alelo recessivo m. Os resultados
obtidos nos cruzamentos teste envolvendo duas aves heterozigotas foram os seguintes:
FENTIPOS DESCENDENTES
CRISTA ESPORA Ave 1 Ave 2
1 DUPLA SIMPLES 170 34
2 NORMAL SIMPLES 38 124
3 NORMAL MLTIPLA 166 28
4 DUPLA MLTIPLA 46 127
a) Estes genes esto ligados ou distribuem-se independentemente? Explique.
b) Quais os gentipos das aves 1 e 2?
c) Caso estiverem ligados estime a frequncia de recombinao entre estes dois genes?

11.21 Explique esquematicamente e descreva o que ligao e o que permuta.

11.22 Quando dois genes esto ligados prximos, h uma tendncia de as


caractersticas controladas por esses genes serem herdadas em conjunto, isto , os dois
genes comportam-se como se fossem apenas um e neste caso podem ser confundidos
com um exemplo de pleiotropia. Quando houver dvida sobre o verdadeiro controle
gentico, qual o melhor procedimento para verificar se estas caractersticas so
governadas por genes ligados ou por um gene pleiotrpico? Explique.
68

11.23 Qual a relao entre a frequncia de recombinao (frequncia de gametas


recombiantes) e a frequncia de quiasmas (frequncia de clulas que apresentam
quiasmas), considerando dois genes A e B. Demonstre
citogeneticamente/matematicamente esta relao.

11.24 A frequncia de recombinao a metade da frequncia de clulas que


apresentam quiasmas. Explique detalhadamente como este fato ocorre e quais as
implicaes prticas deste fato.

11.25 Explique detalhadamente como se constri um mapa gentico e; Quais so as


suas finalidades?

11.26 Considere dois genes ligados (gene A e gene B) com distancia de 25 unidades
mapa (Configurao CIS). Qual a frequncia dos gametas produzidos pela F1? Quais as
frequncias genotpicas em F2?

11.27 Explique porque:


a) Quando dois genes esto muito prximos eles podem ser confundidos como um gene
pleiotrpico.
b) Quando dois genes esto distantes 50 ou mais unidades mapa eles se distribuem
independente.

11.28 Porque se ocorresse permuta gentica entre duas cromtides irms a permuta no
poderia ser geneticamente identificadas?

11.29 Diferencie ligao completa, ligao parcial e segregao independente.

11.30 O que a frequncia de recombinao gentica e quais as suas consequncias e


aplicaes?

11.31 Como possvel prever o resultado de um cruzamento envolvendo genes ligados


(Explique, sugerindo experimentos)?

11.32 Considerando o mapa gentico fornecido a seguir h i j


pergunta-se: a) Qual a proporo esperada de gametas quando
muitas clulas (heterozigotas, em CIS para os trs genes) se
dividem? b) Qual a proporo de clulas que sofrem permutas H I J
simples (H-I e I-J) e de clulas que sofrem permutas duplas (H-I 15 um 20 um
e I-J)?
Resposta:
69

a) GAMETAS b) CLULAS (100 clulas aps a meiose =


400 gametas)
Tipos Clculo Tipo Clculo
(0,20 * 0,15) h i j 0,03 * 400=12 (DR)
H i J = 0,03 ou 3 % 0,03 * 400=12 (P)
h I j ____________
0,06 ou 6% das
Duplos H I J clulas com esta
Recombinantes(DR) conformao.
0,20-(0,20 * h i j 0,17 * 400=68 (DR)
H I j 0,15) 0.17 * 400=68 (P)
h i J = 0,17 ou 17% ____________
0,34 ou 34 % das
Recombinantes H I J clulas com esta
simples I-J (RS) conformao.
0,15-(0,20 * h i j 0,12 * 400=48 (DR)
H i j 0,15) 0.12 * 400=48 (P)
h I J = 0,12 ou 12 % ____________
0,24 ou 24 % das
Recombinantes H I J clulas com esta
Simples H-I (RS) conformao.
1-(0,03 + 0,17 h i j 1 - (0,06 + 0,34 +
H I J + 0,12) 0,24)
h i j = 0,68 ou 68 % ____________
0,36 ou 36 % das
Parentais (P) H I J clulas com esta
conformao.

11.33 Qual a relao entre a frequncia de recombinao gentica e a distncia entre


genes? Qual a sua utilidade sob o ponto de vista gentico?

11.34 Porque quando esperamos duas permutas muito prximas (duplas permutas) uma
destas tem grande probabilidade de no ocorrer?

11.35 Porque utilizamos trs genes (teste de trs pontos) e no dois genes no
mapeamento gentico?

11.36 O ndice de frequncia de recombinao proveniente de dupla permuta observadas


e esperadas so iguais? Justifique sua resposta.

11.37 Demonstre, citogeneticamente, como proceder para identificar a ordem correta dos
genes, durante o mapeamento gentico em um teste de trs pontos?

11.38 Demonstre citogeneticamente a permuta gentica.

11.39 Explique esquematicamente, utilizando os genes A, B e C o que um duplo


recombinante.

11.40 O que o teste de trs pontos e qual a sua finalidade?


70

11.41 As afirmaes a seguir so verdadeiras (V) ou falsas (F)? Justifique suas


respostas. a) __ Um quiasma simples, visvel durante a meiose, forma 4 gametas
recombinantes e 0 gametas no recombinantes; b) __ A permuta gentica ocorre durante
a profase I da meiose; c) __ Na ausncia de permuta gentica no h produo de
gametas recombinantes; d) __ Se os genes A e B no esto ligados ao gene C, ento o
gene A no est ligado ao gene B e e) __ A frequncia de recombinao entre dois genes
varia entre 0 e 100%.

11.42 A pleiotropia e a ligao gnica podem ser confundidas entre si quando se observa
uma descendncia. Explique porque podem ser confundidas e como diferenci-las.

11.43 Quais as principais causas da correlao gentica? Explique como cada uma delas
atuam. Qual a causa de correlao gentica mais efetiva e porque?

11.44 Como pode ser calculada a frequncia de recombinao entre dois genes (A e B).

11.45 Porque importante conhecer a frequncia de recombinao entre dois ou mais


genes? Exemplifique um uso da frequncia de recombinao.

11.46 Qual a relao entre a frequncia de recombinao e a distncia entre dois genes.

11.47 O que um mapa gentico? Qual a utilidade de um mapa gentico?

11.48 Explique como pode ser estimada a distncia entre dois genes?

11.49 Diferencie um mapa gentico de um mapa citogentico (mapa fsico), no que se


refere a maneira de se construir um mapa e quanto as possibilidades de utilizao.

11.50 O que seleo indireta de um carter e quando possvel. Exemplifique.


R: ... possvel sempre que houver ligao gnica entre o gene de interesse e o gene
utilizado como marcador. Uso de marcadores moleculares ligados a caracterstica de
interesse, uso da cor da semente de feijo (caracterstica qualitativa) para selecionar para
o tamanho de semente (caracterstica quantitativa).

11.51 As afirmaes a seguir so verdadeiras (V) ou falsas (F)? Justifique suas


respostas. a) __ A frequncia de recombinao importante, pois explica a variabilidade
gentica.

11.52 O que segregao transgressiva e em que situaes ela ocorre?

11.53 Qual a frequncia na gerao F2, de indivduos com o gentipo Lmn/lMn,


considerando os pais em configurao CIS e o mapa gentico fornecido a seguir:
L M N
|-----------------|-----------| I = 50
20 15
71

11.54 Explique, utilizando um exemplo (a seu critrio), os procedimentos para determinar


a ordem dos genes, no procedimento de mapeamento gentico utilizando o teste de trs
pontos.

11.55 Quais as informaes fornecidas pela frequncia de recombinao?

11.56

12 ABERRAES CROMOSSMICAS

12.1 As clulas que possuem 2n cromossomos so chamadas: (a) haplides;


(b) haplontes; (c) diplides; (d) bipolares; (e) haplodiplontes. A resposta correta a
letra ( ).

12.2 Aneuplides so poliplides que tm alteraes no nmero de cromossomos e


resultam de: (A) Quebras cromossmicas; (B) No disjuno de cromossomos de clulas
somtica; (C) No disjuno de alguns cromossomos na meiose; (D) Inverses
cromossmicas ou (E) Segregao ao acaso dos cromossomos. A resposta correta ( ).

12.3 R13-1) Em espcies do gnero Fragaria (Moranguinho) o nmero de cromossomos


x=7. Existem morangos diplides, tetraplides, hexaplides e octaplides.
a) Qual o nmero somtico de cromossomos destas espcies?
b) Como proceder para determinar se essas espcies so auto ou alopoliplides?
Resposta:
a) 2n=14, 2n=28, 2n=42, 2n=56
b) Uma das maneiras atravs da anlise meitica das espcies, procurando identificar a
ocorrncia de multivalentes. Em caso positivo teramos um autopoliplide e em caso
negativo teramos um alopoliplide.
Porque? Porque se for um alopoliplide no temos cromossomos homelogos, isto , s
temos um par de cada cromossomo.

12.4 R13-2) Uma espcie diplide 2n=2x=18 foi tratada com colchicina para obteno de
autopoliplides. a) Quantos cromossomos so esperados na clula somtica dos
poliplides resultantes de uma, duas e trs mitoses sucessivas na presena desse
alcalide? b) Como atua a colchicina?
Resposta:
a) 2n =36, 2n=72, 2n=144
b) Impedindo a formao do fuso acromtico.

12.5 R13-3) O trigo comum (Triticum aestivum L.) uma espcie alohexaplide, 2n = 6x
= 42(AABBDD). Ela foi obtida naturalmente a partir do cruzamento de trs espcies de
gramneas diplides. a) Qual o nmero de cromossomos nas clulas gamticas e nas
clulas somticas de cada uma dessas espcies diplides? b) Esquematize os provveis
cruzamentos que ocorreram para se obter o trigo cultivado.
Resposta:
a) 7 nas clulas gamticas e 14 nas clulas somticas.
72

b) T. monococum (genoma A) X Aegilops speltoides (genoma B)


Anfidiplide AB (estril)
Duplicao com colchicina AABB
Do cruzamento de AABB com Aegilops squarrosa (genoma D) e aps a duplicao
dos cromossomos foi obtido o Triticum aestivum com a constituio AABBDD.

12.6 Descreva o processo de formao de um alohexaplide, incluindo os cruzamentos e


passos intermedirios (sugere-se que a descrio seja baseada na evoluo do trigo). .

12.7 R13-4) Melhoristas de plantas conseguiram obter melancias triplides, as quais


apresentam a vantagem de no possuir sementes. a) Sugira metodologia que possibilite a
obteno desse triplide. b) Qual a razo desta melancia no produzir sementes
(Explique detalhadamente)?
Resposta:
a) A partir de uma espcie diplide comum duplicou-se os cromossomos com colchicina,
obtendo-se uma planta tetraplide (2n=4x), a qual frtil. Para obter-se o triplide cruzou-
se a espcie 2n=2x comum com o tetraplide 2n=4x, desta forma temos uma planta
triplide, ou seja, x + 2x = 3x.
b) Devido ao alto grau de esterilidade dos triplides e formao de gametas no
balanceados quanto ao nmero de cromossomos.

12.8 R13-5) Existem vrias espcies diplides do gnero Brassica que diferem no
nmero bsico de cromossomos, como, por exemplo, B. nigra (mostarda preta) x=8, B.
oleracea (repolho) x=9 e B. campestris (nabo) x=10. Vrios anfidiplides podem ser
obtidos a partir destas espcies diplides.
a) Qual o nmero somtico de cromossomos das espcies diplides mencionadas?
b) Qual o nmero somtico de cromossomos do hbrido F1 proveniente do cruzamento
B.oleracea X B. campestris?
c) Ao se proceder uma anlise citolgica das anteras desse hbrido, o que ser
observado: univalentes, bivalentes, trivalentes ou tetravalentes? Por qu?
d) Essas plantas F1 sero frteis ou estreis? Se as plantas F1 forem tratadas com
colchicina durante um ciclo celular, quantos cromossomos so esperados nas clulas
somticas?
e) O alopoliplide obtido ser frtil ou estril? Porqu?
f) Quando se cruza o alopoliplide referido no item e com a espcie B. nigra;
f1) Qual o nmero de cromossomos nas clulas somticas do anfidiplide obtido?
f2) O que se espera na meiose deste anfidiplide?
f3) Que tipo de alopoliplide ser obtido tratando-se o anfidiplide com colchicina?
Resposta:
a) B. nigra 2n =2x1 = 16 b) 2n = x2 + x3 = 19
B. oleracea 2n =2x2 = 18
B. campestris 2n =2x3 = 20
c) Principalmente univalentes, devido a falta de homologia entre os cromossomos das
duas espcies.
d) Estreis 2n = 2x2 = 38
e) Frtil, porque cada genoma ser constitudo por duas cpias de cada cromossomo, o
que permitir uma meiose normal.
f1) 2n = x1 + x2 + x3 = 27
73

f2) Dever ser anormal devido falta de homologia entre os cromossomos das trs
espcies.
f3) Alohexaplide sendo 2n = 2x1 + 2x2 + 2x3 = 54

12.9 R13-7) O endosperma da semente de milho um tecido triplide formado pela fuso
dos dois ncleos polares do saco embrionrio com um ncleo generativo do gro de
plen. Quais as constituies genticas dos endospermas das sementes descendentes a
partir dos cruzamentos seguintes?
a) YY (Fmea) x yy (Macho)
b) yy (Fmea) x YY (Macho)
c) Yy (Fmea) x yy (Macho)
d) Yy (Fmea) x Yy (Macho)
Resposta:
a) YYy b) Yyy c) 50% YYy e 50% yyy
d) 25% YYY; 25% YYy; 25% Yyy e 25% yyy.

12.10 R13-8) No milho o alelo dominante Y condiciona endosperma amarelo e y


responsvel por endosperma branco. No entanto, em razo de as clulas do endosperma
serem triplides, ocorrem os fentipos alaranjado, amarelo, amarelo-claro e branco, em
funo do nmero de alelos Y. Quais as propores fenotpicas das sementes
descendentes a partir dos cruzamentos seguintes?
a) YY (Fmea) x yy (Macho)
b) yy (Fmea) x YY (Macho)
c) Yy (Fmea) x yy (Macho)
d) Yy (Fmea) x Yy (Macho)
Resposta:
a) Amarelo b) Amarelo claro c) 50% amarelo e 50% branco
d) 25% alaranjado, 25% amarelo, 25% amarelo-claro e 25% branco.

12.11 R13-9) Suponha que uma espcie diplide apresente em suas clulas somticas 8
cromossomos. Alguns indivduos foram tratados com uma substncia qumica produzindo
descendentes com ampla variao no nmero de cromossomos. Fornea os nomes
corretos dos descendentes representados a seguir:
74

a) ==o== ==o== ==o== ==o== f) ==o== ==o== ==o==


==o== ==o== ==o== ==o==
b) ==o== ==o== ==o== ==o== g) ==o== ==o== ==o== ==o==
==o== ==o== ==o== ==o== ==o== ==o== ==o== ==o==
==o== ==o== ==o== ==o== ==o==

c) ==o== ==o== ==o== ==o== h) ==o==


==o== ==o== ==o== ==o== ==o== ==o== ==o== ==o==
==o== ==o== ==o== ==o== ==o== ==o== ==o== ==o==
==o== ==o== ==o== ==o== ==o==
d) ==o== ==o== ==o== i) ==o== ==o== ==o== ==o==
==o== ==o== ==o== ==o== ==o== ==o== ==o==
==o== ==o==
e) ==o== ==o== j) ==o== ==o== ==o==
==o== ==o== ==o== ==o== ==o== ==o== ==o==
==o== ==o==
Resposta:
a) haplide b) triplide c) tetraplide
d) nulissmico e) monossmico-trissmico f) monossmico
g) trissmico h) tetrassmico
i) trissmico-duplo j) monossomico duplo

12.12 A descendncia dos cruzamentos teste de dois animais heterozigotos apresentou


diferentes frequncias de recombinao entre os genes mb e pz. No animal A (normal) a
frequncia de recombinao foi de 15% e no animal B (anormal) a frequncia de
recombinao foi de 2%. Os animais A e B no apresentam nenhuma alterao
fenotpica. Esta diferena nas frequncias de recombinao ocorreu devido a uma
deficincia ou a uma inverso? Justifique sua resposta.
Resposta:
Inverso. Este tipo de aberrao reduz sensivelmente a frequncia de permutao entre
genes situados na regio invertida ou prxima a ela, devido formao de uma ala
durante o paquteno.

12.13 R13-10) A descendncia dos cruzamentos testes de duas plantas heterozigotas de


milho apresentou diferentes frequncias de recombinao entre os genes ts e su. Na
planta A (normal) a frequncia de recombinao foi de 15% e na planta B (anormal) a
frequncia de recombinao foi de 2%. Esta diferena nas frequncias de recombinao
ocorreu devido a ima inverso ou a uma deficincia? Justifique sua resposta.
Resposta:
Inverso. Este tipo de aberrao reduz sensivelmente a frequncia de permutao entre
genes situados na regio invertida ou prxima a ela, devido formao de uma ala
durante o paquteno.

12.14 R13-11) O cromossomo 10 do milho de uma planta normal possui, entre outros, os
seguintes genes:
75

r n | w o s i | k
----------o-----------------------------------
----------o-----------------------------------
R N W O S I K
Suponha que ocorreu uma quebra entre o centrmero e w e outra entre i e k, dando
origem a uma inverso.
a) Ilustre o pareamento dos cromossomos na meiose representando as quatro
cromtides;
b) Considerando a ocorrncia de uma permuta entre os genes O e S, esquematize a
anfase I e a anfase II;
c) Qual percentagem dos gametas seria funcional?
Resposta:
a) e b) Respostas na pagina 336 Ramalho 1990, c) 50%

12.15 R13-12) O cromossomo 10 do milho de uma planta normal possui, entre outros, os
seguintes genes:
r n | w o s i | k
----------o-----------------------------------
----------o-----------------------------------
R N W O S I K
Se ocorrer uma quebra entre r e n e entre o e s, ter origem uma inverso pericntrica.
a) Ilustre o pareamento dos cromossomos na meiose, representando as quatro
cromtides;
b) Considerando a ocorrncia de uma permuta entre os genes W e O, esquematize a
anfase I e a anfase II;
c) Qual percentagem dos gametas seria funcional?
Resposta:
a) e b) Respostas na pagina 337 Ramalho 1990, c) 50%

12.16 R13-13) No cultivar Santa Cruz de tomate, os genes A e C afetam a cor do


hipoctilo e o formato da folha, respectivamente, e apresentam distribuio independente.
No entanto, algumas plantas desse cultivar apresentaram frequncia de recombinao de
12% entre os genes mencionados. Que tipo de aberrao cromossmica estrutural
poderia explicar esse resultado? Justifique.
Resposta:
Translocao. Este tipo de aberrao cromossmica envolve a quebra de dois
cromossomos no homlogos e a subsequente unio dos segmentos aos cromossomos
no correspondentes.

12.17 R13-14) Suponha que o melhorista de tomate tenha decidido cruzar os dois tipos
de plantas do problema 13 com a finalidade de comprovar o tipo de aberrao ocorrida.
Esquematize o tipo de pareamento que dever ser observado no paquteno do
descendente deste cruzamento.
Resposta:
Pareamento em forma de cruz.

12.18 R13-15) A partir do cruzamento de uma linhagem de cenoura de raiz amarela (yy)
com outra de raiz branca (YY), a qual foi submetida a radiaes ionizantes, foram
76

observadas na F1 algumas plantas de raiz amarela. Que tipo de aberrao cromossmica


estrutural poderia explicar esse resultado? Justifique.
Resposta:
Deficincia. As radiaes ionizantes podem provocar quebras cromossmicas e perda do
segmento se este no possuir centrmero. No caso de ter ocorrido quebra no segmento
onde se encontrava o alelo Y, o fentipo da F1 poder ser o correspondente ao alelo y.

12.19 Qual a importncia do estudo citogentico (estudo dos cromossomos) quando h


problemas de reproduo em pequenas populaes de animais, em cativeiro?

12.20 A) Comente a importncia do estudo das aberraes cromossmicas em animais?


B) As translocaes cromossmicas, especialmente as translocaes recprocas, so
bastante frequentes em bovinos e provocam a esterilidade parcial nestes animais.
a) Demonstre citogeneticamente uma translocao recproca, b) Explique porque ocorre
esterilidade e, em que situao ocorre a formao de gametas frteis?

12.21 Quais so os tipos de aberraes cromossmicas numricas e de que forma


podem ser utilizadas pelo homem?

12.22 A esterilidade nos poliplides com 3x (triplides) sempre alta enquanto nos 4x
(tetraplides) mais baixa. Devido a esta alta esterilidade est se utilizando a triploidia e
casos como por exemplo na produo de melancia sem sementes. Explique como ocorre
esterilidade nos poliplides e; Porque a esterilidade muito alta nos triplides e no to
alta nos tetraplides.

12.23 Quais os tipos de aberraes cromossmicas estruturais e qual a importncia


destas alteraes sob o ponto de vista evolutivo?

12.24 Os esquemas a seguir representam os cromossomos de sete indivduos de uma


mesma espcie. Indique os nomes corretos para cada um deles (trissmico, tetrassmico,
triplide, haplide, nulissmico e monossmico):
a) ==o== ==o== ==o== ==o== b) ==o== ==o== ==o== ==o==
==o== ==o== ==o== ==o==
==o==
c) ==o== ==o== ==o== d) ==o== ==o== ==o== ==o==
==o== ==o== ==o== ==o== ==o== ==o== ==o== ==o==
==o== ==o== ==o== ==o==
e) ==o== ==o== ==o== ==o== f) ==o== ==o== ==o==
==o== ==o== ==o== ==o== ==o== ==o== ==o==
==o== ==o== ==o== ==o==
==o== ==o== ==o== ==o==
g) ==o== ==o== ==o== ==o==
==o== ==o== ==o== ==o==
==o==
==o==
Resposta:
77

a) Trissmico, b) Haplide, c) Monossmico, d) Triplide, e) Tetraplide, f) Nulissmico,


g) Tetrassmico.

12.25 Em um animal doador de smen da raa Red Poll, foi diagnosticada uma
translocao entre os cromossomos n 1 e n 29 (caritipo = 59, XY, t (1;29). Quais as
consequncias para o rebanho bovino brasileiro se for permitido que este animal continue
a fornecer smen?
Resposta:
Disseminao da diminuio da fertilidade

12.26 Seria possvel estudar os cromossomos de um bovino se voc tivesse esquecido a


cultura de linfcitos de sangue perifrico deste animal na soluo hipotnica por algumas
horas? Por qu?
Resposta:
No. As membranas celulares arrebentariam e os cromossomos se espalhariam no meio

12.27 Estudando os cromossomos de uma co macho, com distrofia muscular (gene


recessivo, ligado ao X), descobriu-se que ele tinha um cromossomo Y e dois
cromossomos X (caritipo 79,XXY). Seus pais eram normais (78,XX e 78,XY e sem
distrofia muscular). Qual foi o erro que deu origem a este animal? Em qual de seus pais
ocorreu este erro? Explique.
Resposta:
No-disjuno, na anfase II. Na me: o pai era XDY e a me poderia ser XDXd

12.28 Um gato, macho, de cor laranja (gene para cor da pelagem ligado ao cromossomo
X, dominante) tem 39 cromossomos, ou seja, um cromossomo a mais em cada clula.
Seus pais so normais, com 38 cromossomos, sendo o pai de cor laranja (XOY) e a me,
laranja e preta (XOXo). Qual foi o erro que deu origem a este gato com 39 cromossomos?
possvel identificar se este erro foi mittico ou meitico? Se foi meitico, possvel
saber se ocorreu na me ou no pai? Explique.
Resposta:
a) No-disjuno
b) Provavelmente meitica, pois o animal no mosaico
c) No. Pai XOY e a me XOXo, logo poderia ter sido em qualquer um dos dois.

12.29 Qual o risco de um chimpanz portador de translocao equilibrada entre dois


cromossomos nmero 22 vir a ter um filhote com trissomia do cromossomo nmero 22?
Por qu?
Resposta:
100%. Todos os seus gametas tero o cromossomo translocado 22/22

12.30 Os chimpanzs normais tm 48 cromossomos. Um mesmo casal de animais desta


espcie, ambos fenotipicamente normais, teve trs filhotes: uma fmea fenotipicamente
normal, mas com 47 cromossomos e dois machos com 48 cromossomos, sendo um
normal e outro com sinais clnicos da trissomia do cromossomo 22 (retardo de
desenvolvimento neuromotor, hipotonia, fissura palpebral oblqua e lngua protrada). Qual
78

a explicao mais provvel para os diferentes nmeros de cromossomos dos filhotes e


sua correlao com os fentipos dos animais mencionados?
Resposta:
Um dos membros do casal portador equilibrado de translocao 22/13; a descendente
fmea tambm portadora normal como os pais, um dos machos normal e o outro
trissmico 22

12.31 As fmeas de mamferos heterozigotas para um gene patognico com dominncia


completa, situado no cromossomo X, tm uma forma mais suave da doena, quando
comparadas com as fmeas homozigotas dominantes. Como se explica esse fato?
Resposta:
Em mais ou menos 1/2 de suas clulas funciona o gene normal

12.32 Uma cadela com caritipo 78, XX (normal para o sexo feminino, em ces)
apresenta sinais clnicos de distrofia muscular progressiva, doena causada por um gene
recessivo localizado no cromossomo X. Como se explica esse fato, sabendo que a
doena se manifesta antes da idade reprodutiva (isto , se seus pais fossem afetados, j
era possvel o diagnstico clnico antes do cruzamento que deu origem fmea afetada)?
Resposta:
A cadela deve ser heterozigota XDXd e deve ter um desvio na inativao, isto , mais
clulas com o Xd ativo do que clulas com o XD ativo.

12.33 Um vulo normal de mamfero foi fecundado por um espermatozide cujo


cromossomo Y tinha uma deleo a qual incluiu o gene TDF (Fator de diferenciao
testicular). Este zigoto vivel, mas vai crescer com a genitlia interna feminina,
masculina ou ambgua? Explique.
Resposta:
Feminina. Na ausncia dos hormnios produzidos pelos testculos, o desenvolvimento
no sentido feminino

12.34 Um camundongo tem caritipo 40,XY (normal para a espcie) e possui testculos
normais. As clulas de seus diferentes tecidos, no entanto, apresentam problemas nos
receptores e, como consequncia, no respondem ao da testosterona que
produzida pelos testculos. Neste caso, a genitlia externa deste animal ser masculina,
feminina ou ambgua? Por qu?
Resposta:
Feminina. Sem a ao da testosterona, o desenvolvimento no sentido feminino

12.35 As fmeas de mamferos heterozigotas para um gene patognico com dominncia


completa, situado no cromossomo X, tm uma forma mais suave da doena, quando
comparadas com as fmeas homozigotas dominantes. Como se explica esse fato?

12.36 Nos gatos, o gene O determina a pelagem laranja e seu alelo recessivo, o, a
pelagem preta. Os genes O e o esto localizados no cromossomo X. As fmeas
heterozigotas (XOXo) tm pelagem preta e laranja, em decorrncia da inativao ao acaso
de um dos cromossomos X, em cada clula. Os poucos machos descritos com pelagem
preta e laranja, quando se estudam seus cromossomos, descobre-se que so 39,XXY, ou
79

quimeras 38,XX/38,XY, ou ento mosaicos 38,XY/39,XXY, ou seja, sempre tm pelo


menos uma linhagem de clulas com dois cromossomos X (um com o gene O e o outro
com o gene o), o que explica as duas cores de pelagem. Entretanto, j foram descritos
raros machos 38,XY com pelagem preta e laranja. Qual seria a explicao para este fato?
Resposta:
Quimeras 38,XOY/38,XoY

12.37 Para restabelecer a fertilidade em um hbrido interespecfico necessrio a


duplicao cromossmica. Explique detalhadamente porque.

12.38 As aneuploidias so alteraes numricas de um ou mais cromossomos de um


genoma. Uma das formas mais comuns de aneuploidia na espcie humana a Sndrome
de Down (mongolismo) ou trissomia do 21. Em relao a este fato de que maneira,
citologicamente, surge um indivduo trissmico, para qualquer par cromossmico (ou seja,
demonstre citogeneticamente o que um trissmico e exemplifique como pode surgir).

12.39 As afirmaes a seguir so verdadeiras ou falsas? Justifique sua resposta.


___Um anfidiplide derivado de um cruzamento entre dois indivduos diplides um
tetraplide.

___Quando um indivduo monossmico produz gametas, cada clula que passa pela
meiose produz 4 gametas aneuplides.
Resposta:
No, 1/2 dos gametas produzidos haplide normal e 1/2 dos gametas produzidos no
apresenta o cromossomos em questo e aneuplide.

12.40 Explique as consequncias meiticas de uma permuta gentica em um indivduo


heterozigoto para uma inverso paracntrica.

12.41 A forma mais comum de poliploidia na espcie humana a triploidia. Humanos


triplides so inviveis. Aproximadamente 18% dos abortos espontneos so de fetos
triplides. A maioria dos fetos triplides resulta da fertilizao simultnea do vulo por dois
espermatozides haplides (OBS: Em humanos 2n=46). Qual dos seguintes caritipos
triplides mais comum na espcie humana: 69, XXX; 69, XXY OU 69, XYY? (Justifique
sua resposta).
Resposta:
69, XXY

12.42 Em que situaes um estudo citogentico importante (Comente algumas


situaes e importncia de seu uso)?

12.43 O trigo (Triticum aestivum L.) um alohexaploide. Estudos de evoluo do trigo


permitiram conhecer as espcies que deram origem ao trigo atual. A partir destes estudos
determinou-se o nmero de cromossomos de cada uma das espcies afins ao trigo
(espcies que deram origem ao trigo). Qual a importncia de se conhecer a origem e
evoluo desta espcie, em especial no que se relaciona ao melhoramento gentico do
trigo.
80

12.44 Comente a importncia das aberraes cromossmicas, sob o ponto de vista


evolutivo.

12.45 Diferencie: a) autopoliploidia de alopoliploidia, b) euploidia de aneupolidia e


c) triplide de trissmico.

13 EFEITOS DO AMBIENTE NA EXPRESSO GNICA

13.1 Correlaes genticas, fenotpicas e ambientais podem ser calculadas para todos os
casos em que gentipos testados em diferentes ambientes so observados para
diferentes caracteres. A presena de uma correlao gentica significativa entre
gentipos em diferentes ambientes significa:
( ) Que o comportamento desses gentipos determinado por genes que interagem com
o ambiente;
( ) Que o comportamento desses gentipos determinado por genes de grupos distintos
nos diferentes ambientes;
( ) Que o comportamento desses gentipos determinado nos diferentes ambientes por
genes com efeito pleiotrpico;
( ) Que o comportamento desses gentipos nos diferentes ambientes controlado pelos
mesmos genes ou grupo de genes.

13.2 Explique como proceder para quantificar a interao gentipo x ambiente, frente
variao fenotpica total.

13.3 Interao gentipo x ambiente: Defina e exemplifique graficamente.

13.4 R9-1) No coelho himalaia, os animais so brancos com as extremidades escuras


devido presena de melanina no plo. Se for retirado o plo branco do dorso do animal,
por exemplo, e esse animal for colocado em um local com temperatura baixa, o novo plo
que ir crescer na regio depilada ser escuro como nas extremidades do corpo. Sugira
uma explicao para esse fenmeno.
Resposta:
O gene influenciado pelo ambiente. No caso o alelo responsvel pela produo da
enzima tirosinase s se manifesta em temperaturas baixas.

13.5 R9-2) Quando se corta a grama e se amontoa o material cortado em um


determinado local desse gramado por algum tempo, nota-se que sob o material cortado a
grama que se desenvolve albina.
a) Como pode ser explicado esse fato?
b) Se for encontrado nesse mesmo gramado algumas plantas albinas, mesmo expostas
ao sol, qual a explicao para esse fato? c) Como se denominam as plantas albinas por
ausncia de luz?
Resposta:
a) Os genes responsveis pela produo de clorofila so influenciados pelo ambiente e s
se manifestam em presena de luz.
b) Deve ser algum mutante do alelo que condiciona a produo de clorofila.
81

c) Fenocpia de alelo mutante.

13.6 R9-3) Os resultados mdios obtidos em kg.ha-1 para cinco cultivares de feijo,
avaliadas em quatro localidades do Estado de Minas Gerais, no perodo de 1985/86,
foram os seguintes:
----------------------------------------------------------------
LOCAIS
CULTIVARES ---------------------------------------------------
Caldas Ponte Nova Machado Gov. Valadares Mdias
----------------------------------------------------------------
ESAL 502 1825 2193 169 1729 1479
ESAL 505 2329 1807 281 2086 1626
ESAL 506 2216 1709 449 2188 1640
ESAL 508 2199 1575 429 1704 1477
CARIOCA 1774 1675 347 1948 1436
----------------------------------------------------------------
MDIA 2069 1792 335 1931 1532
----------------------------------------------------------------
a) Quais resultados indicam a existncia do efeito do ambiente na expresso do gentipo
para a produo de gros?
b) Quais resultados indicam a existncia do efeito do gentipo?
c) Esses resultados indicam a existncia de interao cultivares X locais? Justifique sua
resposta.
d) Qual a importncia para os melhoristas de feijo da avaliao de cultivares em mais de
um local?
Resposta:
a) As mdias dos locais;
b) As mdias dos cultivares;
c) O comportamento dos cultivares nos vrios locais no foi consistente. Observe, por
exemplo, que o cultivar com maior mdia em Ponte Nova (ESAL 502) foi o que
apresentou o pior rendimento em Machado;
d) Devido ocorrncia de interao, para cada local deve-se identificar o cultivar mais
apropriado.

13.7 R9-4) Utilizando os dados do problema anterior (R9-3), sugira valores para a
produtividade mdia dos cultivares em Machado, de modo que no ocorra interao
gentipo X ambiente, com a localidade de Caldas. Considere que no h alterao das
mdias de produo destas duas localidades.
Resposta:
CULTIVARES Machado Caldas
----------------------------------
ESAL 502 91 1825
ESAL 505 595 2329
ESAL 506 482 2216
ESAL 508 465 2199
CARIOCA 40 1774
----------------------------------
MDIA 335 2069
----------------------------------
82

13.8 R9-5) Nos grficos so representadas as produtividades de gros em t.ha-1, de dois


cultivares de arroz (Alto Paranaba e IAC 47), cultivados em trs localidades.
t ha-1 t ha-1 t ha-1
4 | x o 4 | 4 |
| x o | o | o
3 | x o 3 | o x 3 | o x
| x o | ox x | o x
2 |x o 2 |x x o 2 |x xo x
| o | o | o x
1 | 1 |o 1 |o
+----+-----+-- -+-----+-----+ -+------+------+---
1 2 3 1 2 3 1 2 3
Local Local Local
-------------------------------------------------
Legenda --> | x x x x IAC 47 o o o o o Alto Paranaba |
-------------------------------------------------
Interprete os trs grficos, independentemente, considerando a ocorrncia ou no de
interao cultivares X locais.
Resposta:
a) No ocorreu interao.
b) Houve interao.
c) Houve interao entre os locais 1 e 2 e no houve interao dos locais 2 e 3.

13.9 Em um experimento conduzido na ESAL em 1981/82, foram avaliados alguns


cultivares de feijo em consrcio com o milho e em monocultivo. As produtividades
mdias de gros, em kg.ha-1, de oito cultivares nos dois sistemas de plantio foram as
seguintes:
SISTEMA DE PLANTIO
CULTIVARES --------------------------------------------------
Monocultivo (M) Consrcio(C) C/M %
----------------------------------------------------------------
Venezuela 63 1413 502 35.5
Muruna 828 322 38.9
ESAL 1 958 374 39.0
Carioca 831 292 35.1
Roxo PV 807 601 74.5
Linea a 1584 671 42.4
Pintado 630 515 81.7
IPA 1300 950 73.1
----------------------------------------------------------------
MDIA 1043.875 528.375
a) Esses resultados indicam a existncia de interao cultivares x sistemas de cultivo?
Justifique sua resposta.
b) Qual a implicao prtica desses resultados? Justifique sua resposta.
Resposta:
a) Sim.
b) Que a recomendao dos cultivares de feijo deve considerar o sistema de plantio.
83

13.10 R9-7) As produtividades mdias de gros de caf beneficiado em kg.ha-1, de duas


prognies obtidas durante o perodo de 1954 a 1959, em Campinas, So Paulo foram as
seguintes:
Ano de colheita
PROGNIES -------------------------------------------- MDIA
1954 1955 1956 1957 1958 1959
----------------------------------------------------------------
C 848 229,6 879,2 841,1 1535,2 1688,8 2887,5 1343,7
C 376-1 706,4 818,3 1158,1 1152,7 1983,8 2134,4 1325,7
MP 376-4 589,8 897,2 1195,8 2936,9 1935,7 5080,1 2105,8
a) Ocorreu interao prognies X anos? Justifique sua resposta.
b) Como pode ser interpretado esse resultado, em termos de recomendao para os
cafeicultores?
Resposta:
a) Sim. Observe que a melhor prognie em 1954 (C 376-1) foi a pior no ano de 1959.
b) A recomendao de cultivares de caf no deve ser baseada no desempenho de um
ou poucos anos. Na realidade, a mdia de vrios anos fundamental para uma espcie,
perene, como o caso do cafeeiro.

13.11 R9-8) Quando se estudou a herana do vrus do mosaico da ervilha, verificou-se


que ela monognica, sendo a resistncia devida ao alelo recessivo. No entanto, nestes
estudos, sempre era verificado um nmero de plantas suscetveis menor do que o
esperado na F2.
a) Qual seria a explicao para este resultado da F2?
b) Posteriormente, foi verificado que, se a F2 fosse inoculada e mantida numa temperatura
de 18 oC ou menos, a resistncia mostrava-se controlada por um alelo dominante. Porm,
se a F2 fosse mantida temperatura de 27 oC, a resistncia era controlada pelo alelo
recessivo. Quais as concluses sobre estes fatos? Qual a nova concluso sobre o item a?
Resposta:
a) O alelo que controla resistncia deve apresentar penetrncia incompleta.
b) O alelo em questo apresenta expressividade varivel. Nesse caso o alelo deve
apresentar penetrncia incompleta e expressividade varivel.

13.12 R9-9) O cultivar de feijo pintado apresenta gros de cor creme com manchas
vermelhas. No entanto, as sementes apresentam normalmente uma certa variao no
padro de manchas e at mesmo a sua ausncia. Essa variao na expresso fenotpica
s vezes responsvel pela eliminao do lote de semente, com o argumento de que se
trata de uma mistura varietal. Como se proceder para verificar se o caso considerado foi
devido a penetrncia incompleta e expressividade varivel ou uma mistura de gentipos?
Resposta:Tomar um certo nmero de sementes, de cada tipo, e plant-las em uma
mesma condio ambiental, porm isoladas e de preferncia em um local que no havia
sido cultivado com feijo anteriormente. Se dentro de cada lote ocorrerem os mesmos
padres de variao das manchas, um caso de expressividade varivel. Se por outro
lado as manchas forem distintas para cada lote, deve ser um caso de alelos diferentes
(variao gentica), sendo provavelmente devido mistura varietal.
84

13.13 Comente cada um dos fatores que compe a varincia fenotpica total e qual a
importncia da decomposio dos fatores que compes a varincia fenotpica total, para a
gentica e para o melhoramento gentico?

13.14 Diferencie penetrncia e expressividade.

13.15 Um pesquisador estudou uma caracterstica gentica que se comportava do


seguinte modo:
????
O pesquisador no conseguiu concluir se o gene responsvel pela caracterstica em
estudo era autossmico dominante com penetrncia incompleta ou se era autossmico
recessivo. Explique porque o pesquisador ficou na dvida.
Resposta:
Porque o gene pulou geraes

13.16 Cite e comente um exemplo de como o ambiente pode interferir na expresso


gnica.

13.17 Comente Interao gentipo X ambiente. Qual a importncia de se conhecer a


interao do gentipo com o ambientes, quando se fala em melhoramento gentico?

13.18 Exemplifique o que a interao gentipo X ambiente.

13.19 Qual a importncia da interao gentipo X ambiente para o melhorista?

13.20 Demonstre, utilizando grficos: a) Efeito de ambiente; b) Efeito de gentipo;


c) Efeito da interao gentipo X ambiente e; d) Efeito conjunto de ambiente, de gentipo
e da interao gentipo x ambiente. OBS: Utilize temperatura (10 a 30 oC) no eixo X e
produo (1000 a 3000 kg.lactao-1) no eixo Y.

13.21 As produtividades mdias de madeira aps 5 anos de cultivo em m3.ha-1, de seis


gentipos obtidos em trs locais, foram as seguintes:
GENTIPO
LOCAL -------------------------------------------- MDIA
G1 G2 G3 G4 G5 G6
----------------------------------------------------------------
Local-01 229 897 1195 2936 1935 5080 2045
Local-02 589 879 841 1535 1688 1187 1160
Local-03 706 818 1158 1152 1983 3134 1468
----------------------------------------------------------------
MDIA 508 865 1065 1874 1869 3134 1558
a) Quais resultados indicam a existncia do efeito do ambiente na expresso do gentipo
para a produo de madeira? Explique porque.
b) Quais resultados indicam a existncia do efeito do gentipo? Explique porque.
c) Esses resultados indicam a existncia de interao gentipos X locais? Justifique sua
resposta.
d) Qual a importncia para o melhorista, a avaliao de gentipos em mais de um local?
85

e) Como pode ser interpretado esse resultado, em termos de recomendao para os


reflorestadores?

13.22 .

14 GENTICA QUANTITATIVA

14.1 Marque: V para a sentena verdadeira ou F para falso. Se falso justifique: ( ) A


herdabilidade o estudo da estimativa dos caracteres herdveis oriundos do ganho pela
seleo, mesmo antes que esta seja efetuada. ( ) A autofecundao seleciona os
indivduos, restando somente indivduos com alta adaptabilidade. ( ) Herdabilidade um
parmetro da gerao em F2. ( ) Herdabilidade um parmetro da populao. ( ) A
Herdabilidade permite antever o efeito da seleo genotpica. ( ) Quando um indivduo
apresenta mais de um gene em seu DNA dito que este indivduo apresenta poligenes.

14.2 A existncia de muitos genes envolvidos na determinao de uma caracterstica


altera as propores mendelianas esperadas e resulta na ausncia de classes fenotpicas
definidas. Por isso, diz-se que: (A) A seleo para esta caracterstica dever mostrar
progresso rpido; (B) A caracterstica no herdvel; (C) A caracterstica quantitativa;
(D) A caracterstica qualitativa; (E) A seleo para esta caracterstica no dever
mostrar progresso gentico;. A resposta correta ( ).

14.3 Marque: V para a sentena verdadeira ou F para falso. Se falso justifique: ( ) A


herdabilidade a proporo gentica da variabilidade total. ( ) A herdabilidade no sentido
restrito a mais importante do que a herdabilidade no sentido amplo, pois quantifica a
proporo aditiva da varincia gentica que pode ser transmitida prxima gerao.

14.4 Quais os requisitos para estimar o nmero de genes de um carter utilizando o


mtodo de Sewall Wright (1934)?

14.5 R11-1) Na espcie de Eucaliptus grandis a altura do fuste (=altura da arvore) aos
sete anos varia de 12,00 m a 20,00 m. Procurou-se determinar a herana deste carter
atravs do cruzamento de plantas de 12,00 m com plantas de 20,00 m, ambas puras, e
obtiveram-se as geraes F1 e F2. A altura mdia do fuste nestas duas geraes foi de
16,00 m. Na gerao F2 observou-se 0,4% de plantas com 12,00 m e 0,4% de plantas
com 20,00 m, sendo que as demais plantas da F2 apresentaram alturas de fustes entre
estes extremos. Desconsiderando os efeitos ambientais e os genes com efeitos desiguais,
determine:
a) Qual o nmero de genes que controla a altura do fuste?
b) Qual a contribuio de cada alelo efetivo? Quais os gentipos dos genitores e de F1?
Qual a heterose da F1 e F2?
c) Quantas rvores com fuste igual ao da F1 ocorrem entre 20 mil plantas F2?
d) Quantas rvores com fuste de 18,00 m so esperadas entre 20 mil plantas F2?
e) Duas rvores puras com 16,00 m de fuste foram cruzadas e observou-se na F2 o
mesmo resultado da F2 apresentado anteriormente. Quais so os gentipos das rvores
genitoras?
86

f) Se na F2, referida no item e, as rvores com fuste de 12,00 m e de 20,00 m tivessem


ocorrido na frequncia 0,024% cada, qual seria o nmero de genes e a contribuio de
cada alelo efetivo?
g) Qual a concluso quando se comparam os resultados dos itens a e b com o resultado
do item f?
Resposta:
a) 4 genes (0,4 em 100, 4 em 1000 = 1 em 250)
b) Contribuio de cada alelo efetivo 1 m;
Gentipos dos genitores P1 (A1A1B1B1C1C1D1D1) = 12 m,
P2 (A2A2B2B2C2C2D2D2) = 20 m,
F1 (A1A2B1B2C1C2D1D2)
A heterose nula.
c) a - alelos efetivos, b - alelos no efetivos e n - nmero total de alelos que contribuem
para o carter. A distribuio completa dos descendentes pode ser observada a partir da
decomposio do binmio (a + b)n. Todas as plantas que tiverem 4 alelos efetivos e 4
alelos no efetivos tero fuste igual ao da me (F1), ento C84 a4b4 = 70 a4b4 de um total de
256 combinaes genotpicas possveis (16 tipos de gameta na F1) - (70/256 * 20000 =
5 468,75 rvores).
d) 2187,50 rvores (28/256 * 20000)
e) A1A1B1B1C2C2D2D2 X A2A2B2B2C1C1D1D1
f) 6 genes. A contribuio de cada alelo efetivo 0,6667.
g) medida que se aumenta o nmero de genes, h uma diminuio na contribuio de
cada alelo efetivo.

14.6 R11-2) Considerando os resultados do problema 1 e a presena de dominncia


completa em todos os locos com efeitos iguais:
a) Qual a contribuio de cada loco com alelo dominante e de cada loco homozigoto
recessivo?
b) A partir do cruzamento (P1) AAbbccDD X (P2) aaBBCCdd qual a altura do fuste de P1,
P2 e F1 e o nmero de fentipos esperados na F2 com a respectiva amplitude de
variao?
c) Qual a heterose das geraes F1 e F2?
Resposta:
a) Contribuio de cada loco recessivo aa = bb = cc = dd = 3 m (12 m / 4 genes = 3 m /
gene), Contribuio de cada loco dominante A_ = B_ = C_ = D_ = 5 m (20 m / 4 genes = 5
m / gene)
b) Altura ^P1 = ^P2 = 16 m; ^F1 = 20 m. O nmero de fentipos esperados em F2 ser de 5
com uma amplitude de variao de 12 a 20 m. Heterose F1 = 4 m h = ^F1 - (^P1 -
^P2)/2, h = 20 - (12+20)/2). Heterose F2 = 2 m Perde 50% da heterose a cada gerao.

14.7 R12-3) A partir do cruzamento de animais da raa Nelore com os da raa


Holandeza, foram obtidos os seguintes resultados para o nmero de carrapatos por
animal:
Raa NELORE X Raa HOLANDESA
(2 carrapatos por animal) (30 carrapatos por animal)
MESTIOS
(16 carrapatos por animal)
BIMESTIOS
87

(16 carrapatos por animal)


2/2000 1996/2000 animais 2/2000 animais
(2 carrapatos por animal) (de 3 a 29 carrapatos por animal) (cerca de 30 carrapato por animal)

Desconsiderando o efeito do ambiente na expresso do carter, pergunta-se:


a) Qual o tipo de interao gnica predomina no controle gentico deste carter?
b) Qual o nmero de genes que controla o carter?
c) Qual a contribuio de cada alelo efetivo? Qual o gentipo dos genitores e dos
mestios?
d) Identifique todos os fentipos possveis entre os bimestios colocando a frequncia de
cada um deles?
e) Quantos animais com o mesmo nmero de carrapatos dos mestios ocorrem entre os
2000 descendentes?
Resposta:
a) Interao aditiva
b) 5 genes
c) 2,8 carrapatos por animal (30 - 2 = 28 / 10 alelos = 2,8
Gentipos dos genitores: Nelore A1A1 B1B1 C1C1 D1D1 E1E1, Holands A2A2 B2B2 C2C2
D2D2 E2E2 e Mestios: A1A2 B1B2 C1C2 D1D2 E1E2.
d) P = C 10
10 . (1/2)
10 . (1/2)0 = 1/1024

Fentipos (carrapatos por animal) Proporo fenotpica


2,0 10 10 0
C 10 a b 1/1024
4,8 9
C 10 a9b1 10/1024
7,6 8
C 10 a8b2 45/1024
10,4 7
C 10 a7b3 120/1024
13,2 6
C 10 a6b4 210/1024
16,0 5
C 10 a5b5 252/1024
18,8 4
C 10 a4b6 210/1024
21,6 3
C 10 a3b7 120/1024
24,4 2
C 10 a2b8 45/1024
27,2 C 110 a1b9 10/1024
30,0 0
C 10 a0b10 1/1024
Total 1024/1024
e) 492 individuos

14.8 R11-3) Considerando que a produo de leite em bovinos seja controlada por 10
genes (na realidade esse nmero deve ser bem maior), qual seria o nmero mnimo de
descendentes necessrios na gerao F2 para se obter 20 fmeas com mxima
produo, a partir do seguinte cruzamento, considerando que ocorre apenas interao
aditiva?
Touros Vacas
AABBccddeeFFgghhIIjj X aabbCCDDEEffGGHHiiJJ
Resposta:
88

41 943 040 animais (1024 tipos de gametas no pai F1 * 1024 tipos de gametas na me F1
= 1 048 576 combinaes genotpicas possveis - somente uma a desejada, com 50%
de probabilidade de ser fmea, ento multiplica-se por dois e, para ter as 20 fmeas
multiplica-se por 20)

14.9 R11-4) Em frangos de corte, uma linhagem A apresenta ganho de peso 30 g.dia-1,
enquanto a linhagem B apresenta ganho de peso de 50 g dia-1. Se a diferena dos
ganhos de peso se deve a 8 genes de efeitos iguais, pergunta-se:
a) Qual a proporo de cada fentipo na gerao F2 proveniente do cruzamento das duas
linhagens, admitindo que a interao allica seja somente aditiva?
b) Qual seria a resposta do item a se a interao allica fosse somente dominncia?
c) Represente graficamente as distribuies fenotpicas da gerao F2 para os dois tipos
de interaes allicas.
Resposta:
a) 0.0015% (50.00g) : 0.02% (48.75g) : 0.18% (47.50g) :
0.85% (46.25g) : 2.78% (45.00g) : 6.67% (43.75g) :
12.22% (42,50g) : 17.46% (41.25g) : 19.64% (40.00g) :
17.46% (38.75g) : 12.22% (37.50g) : 6.67% (36.25g) :
2.78% (35.00g) : 0.85% (33.75g) : 0.18% (32.50g) :
0.02% (31.25g) : 0.0015% (30.00g).
C n (a)i . (b)n-1, onde: n = nmero total de alelos que contribuem para o carter, i = nmero
i

de alelos efetivos e a=1/2 e b=1/2 (Probabilidades dos alelos efetivos (a) e no efetivos
(b)).
b) 10.01 % (50.00g) : 26.67 % (47.50g) : 31.15 % (45.00g) :
20.76% (42.50g) : 8.65 % (40.00g) : 2.31 % (37.50g) :
0.38 % (35.00g) : 0.04 % (32.50g) : 0.001% (30.00g).
Cin (a)i . (b)n-1, onde: n = nmero de genes, i = nmero de lcus contendo o alelo
dominante, a = 3/4 e b = 1/4 (Probabilidades dos gentipos com fentipo dominante (a) e
Adiviv o

recessivo(b)).
Alelos Efetiv os 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1 0 SO MA
combinaes 1 16 120 560 1820 4368 8008 11440 12870 11440 8008 4368 1820 560 120 16 1 65536
xx x 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17
prob 0,000015 0,000244 0,001831 0,008545 0,027771 0,066650 0,122192 0,174561 0,196381 0,174561 0,122192 0,066650 0,027771 0,008545 0, 001831 0,000244 0,000015 1
N de comb 1,52588E-05 1, 52588E-05 1, 52588E-05 1,52588E -05
Peso 50 48, 75 47,5 46,25 45 43, 75 42,5 41,25 40 38, 75 37,5 36,25 35 33,75 32, 5 31,25 30
Dominante
Genes 8 7 6 5 4 3 2 1 0 SO MA
combinaes 1 8 28 56 70 56 28 8 1 256
xx x 1 2 3 4 5 6 7 8 9
prob 0,100113 0,266968 0,311462 0,207642 0,086517 0,023071 0,003845 0,000366 0,000015 1
N de comb 0, 100112915 0, 033370972 0,011123657 0,003707886 0, 001235962 0,000411987 0,000137329 4,57764E-05 1,52588E -05
Peso 50 47,5 45 42,5 40 37,5 35 32,5 30

14.10 R11-5) Suponha que a produtividade de gros em arroz seja devida a 6 genes
aditivos e o teor de protena do gro devido a 4 genes tambm aditivos. Considere o
cruzamento de um cultivar A com a mxima produtividade e o menor teor de protena,
com outro B que apresenta a mnima produtividade, porm, com o maior teor de protena
conhecido.
a) A partir deste cruzamento, qual a proporo esperada de plantas na F2 com os maiores
valores para a produtividade de gros e teor de protena?
b) Qual seria esta proporo se a produtividade de gros fosse devida a 60 genes e o teor
de protena devido a 40 genes?
c) Quais as implicaes das respostas dos itens a e b para o melhorista?
d) Qual o nmero de linhagens esperado aps atingida a homozigose completa, aps
sucessivas geraes de autofecundao considerando 10 genes no controle de ambos os
caracteres?
Resposta:
a) 1 planta em 1048576 plantas da gerao F2.
b) 1 planta em 1,606938 x 1060
c) Quanto maior o nmero de genes controlando o carter, maior deve ser a populao
para se selecionar o fentipo desejado. Observe que com o aumento do nmero de
89

genes, alm da necessidade de uma populao enorme h uma grande dificuldade em


identificar o fentipo desejado, na populao de plantas obtidas.
d) 1024 linhagens.

14.11 Suponha que a produtividade de gros em soja seja devida a 5 genes aditivos e o
teor de protena do gro devido a 6 genes tambm aditivos. Considere o cruzamento de
um cultivar A com a mxima produtividade e o menor teor de protena, com outro cultivar
B que apresenta a mnima produtividade e o mximo teor de protena. a) A partir deste
cruzamento, qual a proporo esperada de plantas na F2 com os maiores valores para a
produtividade de gros e teor de protena? b) Qual o nmero de linhagens diferentes
esperado quando atingida a homozigose completa, aps sucessivas geraes de
autofecundao, considerando um total de 20 genes no controle de ambos os caracteres?
c) Considerando estes fatos (nmero de linhagens possveis, frequncia de linhagens
com valores extremos de produtividade, etc.), quais as implicaes para quem trabalha
com melhoramento gentico?
Resposta: a)

14.12 R11-6) No estudo da herana da porcentagem do contedo de leo da semente de


girassol foram obtidos os seguintes resultados por Fick, 1975 (Crop Science 15:77-78).
----------------------------------------------------------------
POPULAO NMERO DE INDIVDUOS MDIA VARINCIA
----------------------------------------------------------------
P-21 VR 1 (P1) 30 39.5 8.10
MENN RR-18-1 (P2) 30 27.7 4.34
F1 21 34.7 3.83
F2 145 33.4 21.43
RC1 107 38.6 13.45
RC2 81 35.0 16.43
----------------------------------------------------------------
a) Por que a varincia da gerao F2 a maior de todas?
b) Por que as varincias dos retrocruzamentos so de valores intermedirios?
c) Qual o tipo de ao gnica predominante?
d) Qual o provvel nmero de genes envolvidos no controle do carter?
Resposta:
a) Porque nessa gerao, alm da variao ambiental, ocorre a maior variao gentica,
devido segregao e recombinao dos genes.
b) Nos dois retrocruzamentos ocorre tambm variao ambiental e gentica, porm a
variao gentica menor que a da gerao F2.
c) Como (^P1 + ^P2)/2 semelhante a ^F1 que semelhante a ^F2, a ao gnica deve
ser aditiva.
d) 1 gene.

14.13 R11-7) Utilizando os dados do problema anterior (R11-6) estime:


a) A herdabilidade no sentido amplo;
b) A herdabilidade no sentido restrito;
c) O ganho esperado com a seleo entre plantas da gerao F2 considerando que foram
selecionados indivduos cuja mdia foi de 38%;
90

d) Por que a mdia da populao melhorada menor do que a mdia dos indivduos
selecionados?
Resposta:
a) Herdabilidade no sentido amplo = 74.69%
b) Herdabilidade no sentido restrito = 60.57%
c) Ganho esperado com a seleo = 2.79%
d) Porque a herdabilidade no sentido restrito do carter no de 100%

14.14 R11-8) O peso final de abate aos 33 meses para novilhos das raas Santa
Gertrudis e Hereford e de seu mestio esto apresentados no quadro a seguir:
----------------------------------------------------------------
RAAS PESO (kg)
----------------------------------------------------------------
Santa Gertrudis (SG) 175.34
Hereford (H) 177.89
Mestio (SG x H) 216.67
----------------------------------------------------------------
a) Qual ser o peso mdio esperado em animais bimestios?
b) Se um melhorista desejasse fazer seleo de animais visando a obteno de rebanhos
com maior peso de abate aos 33 meses; o que seria prefervel, partir do plantel mestio
ou bimestio? Justifique.
c) Quais cruzamentos deveriam ser realizados para se obter planteis (3/4H 1/4SG); (5/8H
3/8SG) e (7/8H 1/8SG)?
d) Quais seriam os pesos mdios esperados para os animais desses planteis?
Resposta:
a) 196,6425 kg
b) Partir do plantel bimestio onde ocorre a maior variao gentica.
c) Cruzando-se (1/2H 1/2SG) x (H), obtm-se o plantel (3/4H 1/4SG); cruzando-se (1/2H
1/2SG) x (3/4H 1/4SG) ou (3/4SG 1/4H) x (H), obtm-se o plantel 5/8H 3/8SG e
Cruzando-se (3/4H; 1/4SG) x (H), obtm-se (7/8H; 1/8SG).
d) Plantel (3/4H; 1/4SG) mdia esperada = 197,28 kg; Plantel (5/8H 3/8SG) mdia
esperada no cruzamento (1/2H 1/2SG) x (3/4H 1/4SG) = 196,96 kg e no cruzamento
(3/4SG 1/4H) x (H) a mdia ser = 206,975 kg e plantel (7/8H 1/8SG) mdia esperada =
187,585 kg.

14.15 R11-9) A capacidade de expanso no milho pipoca uma medida dada pela
relao entre o volume da pipoca expandida e o volume de gros. Em um trabalho
realizado por Sawazaki et al. 1984, foram cruzadas, duas a duas, 6 variedades de milho
pipoca e avaliada a capacidade de expanso dos hbridos e das respectivas variedades.
Os resultados obtidos foram os seguintes:
91

----------------------------------------------------------------
VARIEDADE V1 V2 V3 V4 V5 V6
----------------------------------------------------------------
V1 21.7 26.6 26.8 28.2 25.1 22.0
V2 28.3 28.6 28.9 28.7 26.2
V3 28.9 28.5 27.4 27.4
V4 27.1 29.7 28.5
V5 25.6 27.9
V6 18.8
----------------------------------------------------------------
a) Estimar a heterose do hbrido V4 x V5 e V5 x V6.
b) Qual a mdia esperada para a gerao F2 desses hbridos?
c) Qual a explicao gentica para a ocorrncia da heterose?
d) Estime a mdia da gerao F1 e F2 do hbrido triplo (V1 x V2) x V3 e (V4 x V5) x V3.
e) Estime a mdia das geraes F1 e F2 do hbrido duplo (V1 x V2) x (V5 x V6).
Resposta:
a) Heterose V4 x V5 = 3.35, Heterose V5 x V6 = 5.70
b) ^F2 hbrido V4 x V5 = 28.025, ^F2 hbrido V5 x V6 = 25,05
c) O carter deve ser controlado por genes cuja interao allica predominante de
dominncia e/ou sobredominncia.
d) Mdia hbrido (V1 x V2) x V3 = ^F1 = 27,7; ^F2 = 27,525
Mdia hbrido (V4 x V5) x V3 = ^F1 = 27,95; ^F2 = 28,206
e) Mdia do hbrido duplo ^F1 = 25,5; ^F2 = 25,4625

14.16 R11-10) Seis linhagens de milho foram intercruzadas e obtiveram-se quinze


hbridos. As produes mdias de gros (t ha-1) de cada hbrido simples e de cada
linhagem obtida em experimento apropriado foram as seguintes:
----------------------------------------------------------------
LINHAGENS A B C D E F
----------------------------------------------------------------
A 1.40 7.12 6.35 4.50 6.14 4.95
B 1.26 6.80 5.20 6.85 5.40
C 1.35 5.80 6.40 5.60
D 1.70 5.95 4.40
E 1.30 6.20
F 1.55
----------------------------------------------------------------
a) Qual o nmero de hbridos duplos possveis de serem sintetizados a partir dessas seis
linhagens?
b) Quais os hbridos simples que devem ser intercruzados para a obteno do melhor
hbrido duplo.
c) Se o agricultor utilizar as sementes F2, provenientes desse melhor hbrido duplo, qual
ser a reduo esperada na produo? Por que ocorre esta reduo?
d) Considerendo o item c, quantas vezes deve ser superior o custo da semente hbrida
em relao ao custo do gro produzido, para compensar a utilizao da semente de paiol
(Considere um gasto de 20 kg de sementes por hectare).
Resposta:
a) 45 hbridos duplos
b) (B x C) x (A x E)
92

c) A reduo ser de 20,8%. Essa reduo ocorre porque na gerao F2 h segregao e


recombinao dos genes, e a frequncia de locos em heterozigose reduzida metade.
Em consequncia a heterose manifestada na gerao F1 reduzida tambm em
cinquenta por cento.
d) 69,5 vezes

14.17 Cinco linhagens de aves de corte de uma empresa de melhoramento foram


cruzadas duas a duas em todas as combinaes, sendo obtidos os resultados dos pesos
dos animais (g/animal) aos 50 dias apresentados a seguir, pergunta-se:
Linhagens A B C D E F
A 1,40 7,12 6,35 4,50 6,14 4,95
B 1,26 6,80 5,20 6,85 5,40
C 1,35 5,80 6,40 5,60
D 1,70 5,95 4,40
E 1,30 6,20
F 1,55
a) Qual o nmero possvel de hbridos duplos com essas linhagens?
b) Quais linhagens devem ser cruzadas para se obter o melhor hbrido duplo?
Resposta:
a) 15 hbridos duplos
b) (AD) x (BC)

14.18 Um agricultor que cultiva determinada espcie de planta em ambiente natural,


observou que suas plantas apresentavam uma altura mdia de 100 3,16. Um outro
agricultor cultiva a mesma espcie de planta, s que em estufa (onde as condies
ambientais so perfeitamente controladas) e observou uma mdia de altura de 100
2,61. Um terceiro agricultor tambm cultiva esta espcie de planta, s que utiliza a
autofecundao em descendentes de uma planta geneticamente homozigota e ele
observou uma mdia de altura de 100 1,79. Qual a herdabilidade (h2) da caracterstica
altura nesta espcie de planta?
Resposta: Varincia (s2) = desvio padro (s) x desvio padro (s)
Varincia total (Gentica + ambiental) = 3,16 x 3,16 = 9,9856
[(9,9856 + (6,8121 + 3,3041)]/2= 10,0509
Varincia gentica = 2,61 x 2,61 = 6,8121
Varincia ambiental = 1,79 x 1,79 = 3,3041
Herdabilidade = Varincia gentica / Varincia total = 6,8121 / 10,0509 = 0,68

14.19 Os registros anuais de produo de l, de uma amostra de 10 carneiros, deram


uma mdia de 10,2 0,503kg. Se a varincia gentica aditiva de 0,20 e as varincias
genticas de dominncia e interao so 0,0; qual ser a herdabilidade (h2) da produo
de l nesta raa?
Resposta: Varincia (s2) = desvio padro (s) x desvio padro (s)
VTotal= 0,5032 = 0,253, VGA= 0,20, h2= 0,20 / 0,253 = 0,79

14.20 Relacionados abaixo esto os pesos, em centigramas, de uma amostra de


sementes da variedade de feijo denominada Princesa.
Ela autofecundada e, portanto, esta variedade uma linhagem pura:
19 - 31 - 18 - 24 - 27 - 28 - 25 - 30 - 29 - 22 - 29 - 26 - 23 - 20 - 24 - 21 - 25 - 29
93

Calcule o componente ambiental (VE) da varincia.


Resposta:
15,53

14.21 Quando se divide o desvio-padro pela mdia, obtm-se um coeficiente de


variao, que independe das unidades de medida. A mdia de peso da l tosquiada de
uma amostra de carneiros era 10,3 1,5 libras. A qualidade da l foi calculada
estatisticamente (em uma escala de 0 a 10) em 5,1 0,7 unidades. Qual destas duas
caractersticas relativamente mais varivel? Demonstre a sua resposta.
Resposta:
peso da l tosquiada

14.22 Duas linhagens de ratos foram testadas em relao suscetibilidade a uma droga
carcinognica. A linhagem suscetvel mostrou uma mdia de 75,4 ndulos de tumores nos
pulmes, enquanto que a linhagem resistente no desenvolveu nenhum tumor. A F1 do
cruzamento destas duas linhagens apresentou uma mdia de 12,5 ndulos como desvio-
padro de 5,3. A F2 apresentou 10,0 9,2 ndulos. Faa uma estimativa do nmero de
pares de genes que contribuem para a suscetibilidade a tumores.
Resposta:
~13 pares de genes

14.23 Em caracteres quantitativos, quando se objetiva selecionar indivduos superiores e


predominam as interaes allicas no aditivas (dominncia e ou sobredominncia, bem
como interaes gnicas) normalmente no se obtm sucesso. Explique detalhadamente
por que.

14.24 Em caracteres quantitativos o melhorista geralmente no utiliza a mxima


intensidade de seleo (selecionar somente uma planta). Explique porque, salientando o
que pode acontecer em caso de utilizar a mxima intensidade de seleo.

14.25 Quais os tipos de interaes allicas e suas caractersticas quando consideramos


caracteres quantitativos?

14.26 Qual a importncia de se conhecer quanto cada um dos componentes contribui


para a varincia fenotpica total?

14.27 Qual a importncia de se conhecer o tipo de interao allica predominante em


um carter quantitativo?

14.28 Descreva o que poligene e comente a importncia do estudo dos poligenes. Cite
alguns exemplos de caracteres governados por poligenes.

14.29 Considerando caracteres quantitativos, diferencie as interaes allicas aditiva,


dominante e sobredominante e comente as suas caractersticas.
94

14.30 Diferencie um carter quantitativo de um carter qualitativo. Descreva qual ou


quais as caractersticas (caracteres) que comumente apresentam herana quantitativa e
como que os dados referentes a caracteres quantitativos so estudados (com base em
que tipo de anlise).

14.31 Comente a hiptese dos fatores mltiplos. Explique porque difcil avaliar
caracteres quantitativos. Quais as consequncias destas dificuldades, ao pesquisador que
trabalha com estes caracteres?

14.32 Diferencie um carter quantitativo de um qualitativo tanto ao nvel fenotpico como


genotpico. Explique porque difcil avaliar caracteres quantitativos. Quais as
consequncias destas dificuldades, ao pesquisador que trabalha com estes caracteres?

14.33 Qual o procedimento deve-se utilizar para identificar o tipo de interao allica
predominante para um carter quantitativo. Se necessrio, faa um esquema.

14.34 Em caracteres quantitativos, qual o tipo de interao allica predominante facilita a


seleo de gentipos superiores? Qual ou quais os tipos de interaes predominantes
devem apresentar os gentipos utilizados na produo de hbridos (F1 com heterose)?
Justifique suas respostas.

14.35 O que a interao gentipo X ambiente e porque importante identificar a


presena ou no, quando trabalhamos com melhoramento gentico?

14.36 Em 1910 Nilsson-Ehle e East propuseram a hiptese dos fatores mltiplos


(poligenes), que explica a herana dos caracteres que apresentam distribuio contnua.
Descreva, detalhadamente, os fundamentos desta hiptese.

14.37 Demonstre a hiptese dos fatores mltiplos proposta por Nisson-Ehle e East, em
1910, para explicar a herana dos caracteres que apresentam distribuio contnua.

14.38 Quando trabalha-se com a poro aditiva da varincia gentica, a seleo dos
melhores indivduos para compor a prxima gerao propicia ganhos genticos. Como
definido o nmero/proporo de indivduos que sero selecionados para compor a
prxima gerao?

14.39 Herdabilidade

14.39.1 Marque verdadeiro ou falso. Se falso justifique: ( ) A herdabilidade o quanto os


filhos herdam dos pais. ( ) A herdabilidade constante em plantas autgamas. ( ) O valor
desejvel de herdabilidade dependente do resultado que se espera do carter. Se o
objetivo for a seleo de indivduos com a mesma caracterstica dos pais, o desejvel
que a herdabilidade seja alta.

14.39.2 Como se pode estimar a herdabilidade?

14.39.3 Qual a importncia de se conhecer a herdabilidade de um determinado carter.


95

14.39.4 Quais os procedimentos que podem ser utilizados para aumentar a herdabilidade
de um determinado carter? Em que situaes pode-se lanar mo destes procedimentos
e quais so os inconvenientes.

14.39.5 O que herdabilidade? Qual a diferena entre herdabilidade no sentido amplo e


no sentido restrito. Qual a importncia do estudo da herdabilidade, no melhoramento
gentico?

14.39.6 Quais so os componentes da varincia fenotpica total? Descreva o que


herdabilidade e qual a importncia do estudo deste parmetro gentico?

14.39.7 a) Em Eucaliptus observaram-se variaes quanto a altura do fuste. Indique as


possveis causas e explique as bases da variao fenotpica.
b) Em um rebanho bovino observaram-se variaes quanto ao ganho de peso. Indique as
possveis causas e explique as bases da variao fenotpica.

14.39.8 A grande maioria dos caracteres de importncia econmica apresentam controle


gentico quantitativo. Diz-se que os genes que controlam os caracteres quantitativos so
altamente influenciados pelo ambiente, apresentam distribuio contnua e so
controlados por genes mendelianos. Demonstre como genes mendelianos podem
produzir efeitos quantitativos em um caractere como o rendimento de gros.

14.39.9 A herdabilidade funo do carter e da populao em questo. a) Descreva


quais fatores podem alterar a herdabilidade de um carter e b) Como pode-se aumentar a
herdabilidade de um carter.

14.39.10 Quais as maneiras (mtodos) de se estimar o nmero de genes que controlam


um carter quantitativo. Cite as vantagens e desvantagens de cada mtodo.

14.39.11 A herdabilidade um parmetro gentico imutvel? Justifique/explique porqu?


(A avaliao ser baseada na justificativa/explicao).

14.39.12 Qual a importncia de se conhecer a h2 (Varincia gentica / Varincia total) de


um carter (quando /onde / como utilizada)?

14.40 Componentes da varincia

14.40.1 Comente, sob todos os aspectos, a importncia de se conhecer a magnitude dos


componentes da varincia fenotpica, em uma populao segregante.

14.40.2 Diferencie um gene de um poligene.

14.40.3 Em um carter quantitativo, como surge a variabilidade gentica, como a


variabilidade gentica pode ser mediada, como se pode estimar os componentes da
varincia fenotpica e quanto desta varincia total gentica?

14.40.4 Como a estimativa dos componentes da varincia contribuem para o


direcionamento de um programa de melhoramento gentico?

14.40.5 Um pesquisador obteve uma amostra de plantas, sendo que ele dividiu
homogeneamente esta amostra duas partes. Uma parte da amostra ele cultivou em
96

ambiente natural obtendo altura de plantas (100 cm) e varincia (3,10) e a outra amostra
em casa de vegetao (ambiente uniforme), obteve altura de plantas (100 cm) e varincia
(1,8). a) Qual a herdabilidade da altura de plantas? b) Qual o objetivo de estimar a
herdabilidade para a seleo de plantas? c) Caracterize e diferencie caracteres
quantitativos e qualitativos? d) Discorra sobre as interaes allicas aditiva, dominante e
sobredominante, em caracteres quantitativos.
R: Em condio controlada ambiente uniforme tem-se as diferenas genticas (VG)
como principal componente responsvel pela variao e em condies naturais tem-se,
alm das diferenas genticas, um efeito pronunciado do ambiente (VG + VE).
Assim, VF = VG + VE - 3,10 = 1,8 + VE - 1 = 0,58 + 0,42

14.40.6 A partir de um experimento onde foram observadas as seguintes varincias no


carter produo: var(P1)= 500, var(P2)= 400, var(F1)= 450, var(F2)= 900, var(RC1)= 980,
var(RC2)= 702.
a) Calcule as varincias ambiental, gentica, gentica aditiva e gentica no aditiva.
b) Calcule herdabilidades no sentido amplo e restrito.
c) Comente a importncia de se conhecer a herdabilidade de um carter.
d) Sabendo que a mdia de F2 = 1800 kg ha-1 e a mdia de F2 selecionadas = 1930 kg ha-
1. Qual o ganho de seleo?

e) As mdias de produo do P1 = 2000 kg ha-1, P2 = 1600 kg ha-1 e F1 = 1800 kg ha-1.


Qual o tipo de interao gnica predominante? Comente sobre a interao predominante
e mostre em que pontos ela pode ser diferenciada de outras interaes gnicas.

14.40.7 Quais as teorias que explicam a heterose?

14.40.8 Para escolha do mtodo de seleo deve-se levar em conta o valor da


herdabilidade PORQUE a herdabilidade a proporo de variao fenotpica determinada
pelos efeitos de dominncia, os quais se manifestaro na descendncia. A esse respeito,
pode-se concluir que (A) as duas afirmativas so verdadeiras e a segunda justifica a
primeira. (B) as duas afirmativas so verdadeiras e a segunda no justifica a primeira. (C)
as duas afirmativas so falsas. (D) a primeira afirmativa verdadeira e a segunda falsa.
(E) a primeira afirmativa falsa e a segunda verdadeira.

14.40.9 Na obteno de cultivares transgnicos pelo uso da tcnica do DNA


recombinante, necessrio que a espcie doadora do gene seja prxima, do ponto de
vista filogentico, espcie receptora PORQUE nem todos os genes se expressam,
quando transferidos para outra espcie. A esse respeito, pode-se concluir que (A) as duas
afirmativas so verdadeiras e a segunda justifica a primeira. (B) as duas afirmativas so
verdadeiras e a segunda no justifica a primeira. (C) as duas afirmativas so falsas. (D) a
primeira afirmativa verdadeira e a segunda falsa. (E) a primeira afirmativa falsa e a
segunda verdadeira. A manuteno da biodiversidade um dos requisitos do
desenvolvimento sustentvel, visando a garantir as poss- veis necessidades das
geraes futuras em termos de recursos genticos. reas de floresta tropical apresentam
maior diversidade que reas de floresta temperada PORQUE a maioria dos solos das
regies tropicais tem maior disponibilidade de nutrientes que solos de regies
temperadas. A esse respeito, pode-se concluir que (A) as duas afirmativas so
verdadeiras e a segunda justifica a primeira. (B) as duas afirmativas so verdadeiras e a
segunda no justifica a primeira. (C) as duas afirmativas so falsas. (D) a primeira
afirmativa verdadeira e a segunda falsa. (E) a primeira afirmativa falsa e a segunda
97

verdadeira.

15 GENTICA DE POPULAES

A nica coisa invarivel em biologia a presena de variao.

15.1 Marque verdadeiro ou falso. Se falso justifique:


Considerando que o objetivo da gentica de populaes compreender a composio
gentica de uma populao e as foras que determinam e mudam essa composio.
( ) A frequncia de um alelo igual soma da frequncia de seu homozigoto mais a
soma das frequncias de todos os heterozigotos nos quais ele aparece.
( ) Em uma populao em equilbrio de Hardy-Weinberg, na ausncia de seleo,
migrao e mutao, a variao permanece constante gerao aps gerao.
( ) Uma medida da variao gentica a intensidade da heterozigose em cada locus em
uma populao, que dada pela frequncia total de heterozigotos em cada locus.
( ).
( )

15.2 Marque verdadeiro ou falso. Se falso justifique: Para uma populao atingir
equilbrio de Hardy-Weinberg para todos os genes, necessrio:
( ) Ausncia de mutao e de migrao, frequncia gnica igual a 1/2, ou seja, p=q=1/2;
( ) Cruzamentos ao acaso, frequncia gnica igual a , ou seja, p=q=1/2;
( ) Cruzamentos ao acaso, populao grande, ausncia de mutao, de migrao e de
seleo;
( ) Ausncia de mutao e migrao, populao grande.
( ) Que o nmero de indivduos descendentes seja igual a frequncia mdia populacional.

15.3 R12-1) Em 6 mil animais da raa shorthorn de bovino foram identificados os


seguintes nmeros, segundo a cor da pelagem:
-----------------------------------------------------------------
FENTIPO GENTIPO NMERO DE ANIMAIS
-----------------------------------------------------------------
Branco B1B1 516
Vermelho-branco BB1 2 2.628
Vermelho B2B2 2.856
-----------------------------------------------------------------
Total 6.000
-----------------------------------------------------------------
Pergunta-se:
a) Determinar as frequncia genotpicas e allicas nesta populao;
b) Verifique se esta populao est em equilbrio de Hardy-Weinberg.
Resposta:
a) Frequncias genotpicas:
B1B1 = 0.086, B1B2 = 0.438, B2B2 = 0.476
Frequncias allicas: B1 = 0.305, B2 = 0.695
b) O qui-quadrado foi significativo, portanto a populao no est em equilbrio.
98

15.4 R12-2) Na planta conhecida como Maravilha, a cor da flor pode ser vermelha (V1V1),
rosa (V1V2) ou branca (V2V2). Em uma populao panmtica composta por 2 mil plantas
foram encontradas 125 com flores brancas.
a) Quais as frequncias dos alelos V1 e V2 nessa populao?
b) Entre os 2000 indivduos, quais os nmeros esperados de plantas com flores
vermelhas e rosas?
Resposta:
a) V1 = 0.75, V2 = 0.25
b) Vermelhas = 1125; Rosas = 750

15.5 R12-3) Utilizando os dados do problema anterior (R12-2), se o jardineiro coletar


sementes apenas das plantas de flores rosas para formar um novo jardim, qual dever
ser a proporo fenotpica esperada?
Resposta:
Este problema pode ter duas respostas:
a) Eliminando as plantas de flores vermelhas e brancas antes da polinizao: Vermelhas
= 1/4, Rosas = 1/2 e Brancas = 1/4
b) Coletando as sementes sem haver eliminao das plantas de flores vermelhas e
brancas:
Vermelhas = 3/8, Rosas = 1/2 e Brancas = 1/8

15.6 R12-4) Num plantel com 1200 animais da raa holandesa, em equilbrio de Hardy-
Winberg, 48 apresentam pelagem vermelha-branca, os demais animais so preto-branco.
Sabendo-se que a pelagem vermelha-branca devido ao alelo recessivo b, pergunta-se:
a) Qual a frequncia do alelo B nesse plantel?
b) Se os indivduos vermelho-branco forem eliminados, qual ser o nmero de animais
com esse fentipo aps atingir o equilbrio e mantendo-se o plantel com 1200 animais?
c) Tomando-se ao acaso dois animais preto-branco do plantel mencionado, antes de
sofrer a seleo, qual a probabilidade de se obter um descendente vermelho-branco?
Resposta:
a) B = 0,80, b) 33 animais, c) 2,78%

15.7 Numa populao com 2400 indivduos, em equilbrio de Hardy-Winberg, 48


apresentam fentipo vermelho, os demais indivduos so pretos. Sabendo-se que o
fentipo vermelho devido ao alelo recessivo b, pergunta-se: a) Qual a frequncia do
alelo B nessa populao? b) Se os indivduos vermelhos forem eliminados, qual ser o
nmero de indivduos com esse fentipo aps atingir o equilbrio e mantendo-se a
populao com 2400 indivduos? c) Tomando-se ao acaso dois indivduos pretos da
populao mencionada, antes de sofrer a seleo, qual a probabilidade de se obter um
descendente vermelho?

15.8 R12-6) Em cebolas, a cor do bulbo pode ser roxa devido ao alelo dominante A e
amarela devido ao alelo recessivo a. Numa populao com 10 mil plantas, em equilbrio
de Hardy-Weinberg, ocorrem 1600 plantas com bulbos amarelos.
a) Qual a frequncia do alelo a nessa populao?
b) Qual o nmero de plantas com bulbos roxos e gentipo homozigoto que ocorre entre as
10 mil plantas?
99

c) Se o agricultor realizar cinco geraes de seleo visando a obteno de um cultivar


que produza apenas bulbos roxos, qual a proporo esperada de plantas que ainda
apresentaro bulbos amarelos na populao descendente, em equilbrio?
d) Partindo-se da populao melhorada do item c, quantos ciclos de seleo ainda
devero ser realizados para se obter uma nova populao em que apenas 0,49% das
plantas possuem bulbos amarelos?
e) Considerando todas as populaes de cebola citadas, em qual delas a autofecundao
contribuir para a eliminao mais rpida do alelo em questo?
Resposta:
a) 0,4, b) 3600 plantas, c) 1,78%, d) 7 ciclos de seleo e e) Na populao onde apenas
0,49% das plantas ainda apresentam bulbos amarelos.

15.9 R12-9) No milho, a textura do gro pode ser lisa (Su_) ou enrugada (susu). A cor
amarela do gro devido ao alelo Y e a branca ao alelo y. Em uma populao em
equilbrio foi tomada uma amostra de 2400 gros, sendo 816 lisos e amarelos, 776 lisos e
brancos, 408 enrugados e amarelos e 400 enrugados e brancos.
a) Quais as frequncias dos alelos Su e Y nessa populao?
b) Qual a frequncia esperada de indivduos homozigotos lisos e amarelos?
c) Quais sero as novas frequncias allicas para os dois caracteres se forem eliminadas
todas as sementes enrugadas ou brancas?
d) Qual ser a frequncia de sementes lisas e amarelas aps a populao atingir
novamente o equilbrio?
Resposta:
a) Su = 0.4198 e Y = 0,30, b) 71,84%, c) Su = 0.6328, su = 0.3672; Y = 0.5882, y =
0.4118, d) 71,84%.

15.10 R12-11) A cor da raiz da cenoura controlada por um gene, sendo o alelo Y
responsvel pela cor branca e seu recessivo y por cor amarela. Um agricultor colheu 20
mil sementes de uma populao panmtica que apresentava 64% de plantas com razes
brancas. Como de seu interesse aumentar a proporo de plantas com razes amarelas,
posteriormente ele misturou s suas sementes outro lote de 5 mil sementes de um cultivar
homozigoto para razes amarelas. Qual a frequncia esperada de plantas com razes
amarelas na nova populao aps e equilbrio?
Resposta: Y Branca y amarela
Gerao 0 Sementes iniciais, em equilbrio de Hardy-Weinberg
0,64 YY e Yy + 0,36 yy = 1
2
p (YY) + 2pq (Yy) + q2 (yy) =1
2
q (yy) = Raiz quadrada de 0,36 = 0,60, como p + q = 1, logo p = 0,40
(0,40)2 YY + 2 x 0,40 x 0,60 Yy + (0,60)2 =1
3.200 YY + 9.600 Yy + 7.200 yy = 20.000
Gerao 0, aps a adio das 5 mil sementes para raiz amarela
3.200 YY + 9.600 Yy + 7.200 yy + 5.000 yy = 25.000
Dividindo-se cada uma das partes da equao por 25.000, teremos:
0,128 YY + 0,384 Yy + 0,488 yy = 1
p = X + Y/2 e q = Z + Y/2
onde: X - frequncia do gentipo homozigoto dominante,
Y - frequncia do gentipo heterozigoto e,
Z - frequncia do gentipo homozigoto recessivo.
p = 0,128 + 0,384/2 = 0,32, q = 0,488 + 0,384/2 = 0,68
100

Gerao 1 Aps uma gerao, nas condies propostas por Hardy-Weinberg


p2 (YY) + 2pq (Yy) + q2 (yy) = 1
0,1024 YY + 0,4352 Yy + 0,4624 = 1
46,24% de plantas yy (Raiz amarela)

15.11 Um determinado criador possui um rebanho bovino, o qual est em equilbrio de


Hardy-Weinberg.
a) Em cada 100 animais 15 apresentam chifres (mm). Qual a frequncia genotpica e
allica para este gene, nesta populao? b) O que quer dizer estar em equilbrio de
Hardy-Weinberg?

15.12 Comente os fatores que alteram as frequncias allicas e genotpicas de uma


populao.

15.13 Comente os fatores que determinam as propriedades genticas das populaes, a


lei de Hardy-Weinberg, os fatores que alteram as frequncias allicas e genotpicas de
uma populao e suas relaes com o estudo da gentica de populaes.

15.14 Considerando a lei de Hardy-Weinberg, em que condies as frequncias allicas


e genotpicas se mantm constantes de gerao a gerao. Em que condies as
frequncias allicas se modificam. Comente detalhadamente cada uma estas condies.

15.15 O que diz a lei de Hardy-Weinberg? Qual a importncia do conhecimento desta lei,
no que se refere ao comportamento dos genes nas populaes?

15.16 Comente os fatores que determinam as propriedades genticas das populaes, a


lei de Hardy-Weinberg, os fatores que alteram as frequncias allicas e genotpicas de
uma populao e a importncia do estudo da gentica de populaes, na Agropecuria.

15.17 Explique o que significa dizer que uma populao est em equilbrio de Hardy-
Weinberg; Comente os fatores que afetam este equilbrio.

15.18 Explique como proceder para verificar se uma determinada populao est ou no
em equilbrio de Hardy-Weinberg.

15.19 Em um plantel constitudo por 100 bovinos, verificou-se que nove indivduos tinham
chifres (gentipo mm) e 91 eram mochos. Quais as frequncias de heterozigotos e
homozigotos dominantes nesta amostra?
Resposta:
Heterizigotos = 42%
Homozigotos dominantes = 49%

15.20 Em uma populao constituda por 100 indivduos em equilbrio de Hardy


Weinberg, verificou-se que 19 indivduos eram altos (homozigotos recessivos - aa) e 81
baixos. Quais as frequncias de heterozigotos e homozigotos dominantes nesta amostra?
Demonstre todos os clculos.
101

15.21 Em bovinos um gene mutante, autossmico recessivo, faz com que os bezerros
homozigotos nasam com os pr-molares inclusos na mandbula, que reduzida em
comprimento e largura, dando ao animal uma aparncia de boca-de-papagaio. Estes
bezerros morrem na primeira semana aps o nascimento. Estudos de uma populao
mostraram que dois em cada 200 cruzamentos produziam um animal com a caracterstica
de molares inclusos. Qual a frequncia de indivduos heterozigotos nesta populao?
Resposta:
aa 2 indivduos e AA + Aa 198 indivduos.
A frequncia genotpica do aa (q2) 2/200 = 0,01, tirando a raiz quadrada temos o valor
de q = 0,1 e como p + q = 1 temos que p = 0,9.
Ento, como p2 + 2pq + q2 = 1, a frequncia do heterozigoto 2pq = 2x0,9x0,1 = 0,18 ou
18%.

15.22 A cor da plumagem das corujas-do-campo est sob o controle de uma srie de
alelos mltiplos: Gr (vermelho) > gi (intermedirio) > g (cinza). As frequncias destes
genes so: Gr = 0,1; gi = 0,6 e g = 0,3, em uma determinada populao, onde os
cruzamentos so ao acaso. Quais as frequncias de indivduos vermelhos, intermedirios
e cinzas nesta populao?
Resposta:
Vermelho = 19%. Intermedirio = 72%, Cinza = 9%

15.23 De 6 mil bovinos escolhidos ao acaso, de uma populao em equilbrio de Hardy


Weinberg, 516 eram brancos, 2.856 vermelhos e 2.628 rues. Estes dados condizem com
a hiptese de que o ruo heterozigoto? Por qu?
Resposta:
Sim. Pois segundo a lei de Hardy-Weinberg as frequncias genotpicas em populaes
panmticas de p2 + 2pq + q2 = 1. Desta forma Ruo = 43,8% 2pq = 0,4239, Vermelho =
8,6% p2 = 0,093, Branco = 47,6% q2 = 0,4830

15.24 Em uma populao de ratos selvagens, encontra-se a seguinte distribuio de


gentipos para os alelos S e s, localizados no cromossomo X:
--------------------------------------------
XsXs XsXS XSXS XsY XSY
--------------------------------------------
Masculino -- -- -- 32 40
Feminino 17 22 26 -- --
--------------------------------------------
Quais so as frequncias de Xs e de XS?
Resposta:
XS = 56%, Xs = 44%

15.25 A autofecundao uma ferramenta muito importante para o geneticista e para o


melhorista e pode contribuir em duas situaes principais: a) Na produo de linhagens e
b) No incremento do progresso gentico com a seleo. Explique como se d a
participao da autofecundao no trabalho do melhorista, nas duas situaes citadas
acima.
102

15.26 A autofecundao pode incrementar o progresso gentico com a seleo. Em que


situaes isto pode ocorrer e porque?

15.27 Com o progresso gentico, pela seleo, o ganho gentico tende a ser menor a
cada gerao. Explique porque.

15.28 Dispe-se de 5 linhagens de galinhas. Sabe-se que uma linhagem no apresenta


variabilidade gentica, pois todos os indivduos que compe uma linhagem so
geneticamente idnticos e homozigotos. Partindo-se deste material gentico, explique
como proceder para ampliar a variabilidade gentica.

15.29 Diferencie autoincompatibilidade de incompatibilidade gamtica. Comente o


controle gentico destes dois sistemas.

15.30 Comente uma situao em que seria possvel a aplicao dos conhecimentos da
lei de Hardy-Weinberg.

15.31 Explique o que acontece com as frequncias allicas em uma populao quando
se seleciona a favor do fentipo dominante (isto , quando elimina-se os indivduos com
fentipo recessivo e mantm-se os indivduos com fentipo dominante), durante
sucessivas geraes de interacasalamento ao acaso.

15.32 Explique/exemplifique como a seleo pode romper o equilbrio proposto por


Hardy-Weinberg.

15.33 Demonstre como a seleo pode romper o equilbrio proposto por Hardy-Weinberg
e, Quais as consequncias no decorrer das geraes se a seleo persistir?

15.34 Como as aberraes cromossmicas podem contribuir para ampliar a variabilidade


gentica?

15.35 Como proceder para provar que uma populao est realmente em equilbrio de
Hardy-Weinberg?

15.36 Quais as contribuies que os conhecimentos propostos por Hardy-Weinberg


trouxeram gentica, que inferncias so possveis a partir da Teoria de Hardy-
Weinberg?

15.37 Demonstre que a seleo modifica as frequncias allicas no decorrer das


geraes, em uma populao que esta em equilbrio de Hardy-Weinberg.

15.38
103

16 EVOLUO, com nfase na Teoria Sinttica da Evoluo

16.1 Um dos fatores que altera as frequncias gnicas de uma populao a migrao.
Sobre esse fenmeno, CORRETO afirmar que: (01) A passagem de genes de uma
populao para outra, atravs de migrao, conhecida como fluxo gnico. (02) Pela
migrao, novos alelos podem ser introduzidos em uma populao anteriormente isolada.
(04) No um fator evolutivo. (08) Em humanos, a migrao nunca influenciou a evoluo
das populaes. (16) Pela migrao, ocorre a quebra dos isolados, quando populaes
que estavam evoluindo em separado so miscigenadas. (32) Atravs da emigrao pode
haver perda de variabilidade gentica para a populao original. A soma das corretas
( )

16.2 O russo Oparin, em 1936, props um modelo de como a vida poderia ter surgido.
interessante notar que, naquela poca, no se conhecia ainda a relao entre os cidos
nuclicos e o material gentico. (SILVA JR., C.; SASSON, S. Biologia 1. Saraiva, So
Paulo, 1996, p. 243). Assinale a(s) proposio(es) que corresponde(m) a(s) idia(s)
propostas por Oparin. (01) A Terra tem mais de 4,5 bilhes de anos. (02)A atmosfera
primitiva tinha uma composio muito semelhante atual. (04) O calor das rochas fazia
com que as substncias reagissem entre si, possibilitando a formao de molculas
maiores, pela juno de molculas pequenas. (08) Os coacervados eram grupos de
molculas orgnicas unidas e tinham grande estabilidade. (16) Os coacervados foram os
primeiros seres vivos primitivos. O somatrio das proposies corretas ( ).

16.3 Segundo a Teoria Sinttica da Evoluo o processo original responsvel pela


criao de variabilidade gentica em uma populao :
( ) Hibridao; ( ) Recombinao gentica; ( ) Mutao; ( ) Migrao; ( ) Mutao e
recombinao gentica. A resposta correta ( ).

16.4 O conhecimento dos mecanismos evolutivos das plantas cultivadas importante


para o melhoramento gentico de plantas. Discuta os principais mecanismos evolutivos e
sua aplicao no desenvolvimento de variabilidade gentica de uma determinada espcie
cultivada.

16.5 Quais os mecanismos que amplificam a variabilidade gentica? Como estes


mecanismos contribuem para a evoluo?

16.6 Quais os mecanismos que orientam a populao para maior adaptao? Como
estes mecanismos contribuem para a evoluo?

16.7 Comente os principais mecanismos de isolamento reprodutivo e a importncia


destes mecanismos na formao de novas espcies.

16.8 Comente a importncia dos mecanismos de isolamento reprodutivo na evoluo.

16.9 Qual fato tornou Lamarck um evolucionista conhecido? Comente.


104

16.10 Darwin, comentando sobre a seleo natural dizia que ela a luta pela
sobrevivncia. O que significa sobreviver?

16.11 Sob o ponto de vista evolutivo o mais importante ser o mais forte e o mais hbil
ou deixar mais descendentes? Justifique a resposta.

16.12 Comente os processos que ampliam a variabilidade gentica nas populaes e sua
importncia para a evoluo.

16.13 Diferentes teorias explicam a evoluo dos seres vivos. Darwin, em seu livro Teoria
das espcies (1859), props a Teoria da seleo natural, conhecida como Darwinismo. J
no sculo XX, uma nova teoria toma corpo, a Teoria sinttica da evoluo. Sobre a
evoluo biolgica (evolucionismo), responda: a) Qual o objeto de estudo da evoluo
biolgica? b) No que a Teoria sinttica da evoluo difere do Darwinismo?

16.14 Discuta: Quanto mais efetivo inicialmente for o mtodo escolhido de combate a
parasitas ou microrganismos (carrapatos, infeces, etc.), mais rapidamente aparecero
os parasitas resistentes. Sugira alternativas para o combate dessas pragas e doenas
evitando o aparecimento de resistentes.
Resposta:
Quanto mais efetiva for a seleo, mais rapidamente as mutaes se estabelecero

16.15 O que controle biolgico de parasitas?


Resposta:
Mtodo que no envolve drogas e sim, por exemplo, animais estreis da mesma espcie
dos parasitas, para competir na reproduo

16.16 Descreva o fenmeno da especiao (como surge uma nova espcie), baseando-
se na teoria sinttica da evoluo.

16.17 O que a Teoria Sinttica da Evoluo? Descreva os processos que


fundamentam esta teoria.

16.18 Comente os processos que orientam as populaes para uma maior adaptao.

16.19 Comente a cerca da importncia da seleo natural na formao de uma nova


espcie?

16.20 Sabe-se que h milhes de anos atrs no havia tanta variabilidade gentica como
atualmente. Explique como surgiram tantas espcies (organismos pluricelulares e
extremamente complexos, adaptados a diferentes ambientes), a partir das primeiras
espcies de organismos unicelulares.

16.21 Comente detalhadamente como a seleo natural pode modificar as frequncias


allicas de uma populao e quais as consequncias destas mudanas nas frequncias
allicas provocadas pela seleo natural.
105

16.22 Os achados arqueolgicos indicam que os primeiros seres vivos que existiram na
terra, h aproximadamente 3 bilhes de anos eram procariontes extremamente simples.
Explique como, a partir destes seres vivos to simples, surgiu a diversidade de seres
vivos, extremamente complexos e evoludos, observada hoje.

16.23 Comente os princpios (fundamentos) da Teoria Sinttica da Evoluo.

16.24 Sabendo que atualmente grande parte da sociedade defende a teoria criacionista,
com base nos conhecimentos de gentica e evoluo, quais argumentos podem ser
utilizados para defender que houve evoluo da vida na terra. Justifique adequadamente
cada um dos argumentos.
Resposta: evidencias de que houve evoluo nos seres vivos:
a) Mecanismos da meiose so conservados em todos os organismos de reproduo
sexuada.
b) As protenas que participam do primeiro passo do empacotamento do DNA, as
histonas, so amplamente conservadas entre as espcies.
c) A universalidade do cdigo gentico.
d) Manifestao atvica reaparecimento de algumas caractersticas de
antepassados da espcie, devido a genes raros, importantes no passado e ainda
presentes na populao (Exemplo: aparecimento de listras, como as das zebras,
em potros; excesso de pelos em crianas).
e) rgos rudimentares persistncia de rgos vestigiais, que perderam
importncia para a espcie na atualidade (Exemplo: o apndice do seco intestinal
humano e o segundo e quarto dedos em cavalos).
f) Anatomia comparada ocorrncia de um plano estrutural comum nos rgos de
diferentes espcies (Exemplos: esqueleto nos vertebrados, como no homem
jacar, na r e em pombos).
g) Embriologia comparada semelhanas de embries de diferentes organismos
(Exemplo: fendas branquiais, notocorda e arcos rticos dos embries dos
vertebrados).
h) Recapitulao filognica reproduo das principais etapas da ovulao da
espcie atravs da embriognese (Exemplo: clula-ovo notocorda
caractersticas da prpria espcie).

16.25 Ao longo do tempo, com a aplicao de agroqumicos podem surgir gentipos


resistentes (devido a recombinao gentica a partir da variao gentica pr-existente
ou de novas mutaes), necessitando de aumento da dosagem para o controle eficiente
destes. O que pode ser feito para impedir que plantas ou insetos desenvolvam resistncia
gentica a produtos qumicos (herbicidas, inseticidas, etc). Embase cientificamente cada
uma das aes a serem tomadas.

16.26 Como surge uma nova espcie? Em sua explicao descreva todos os possveis
mecanismos envolvidos na formao desta nova espcie, bem como estes mecanismos
conduzem a formao de novas espcies.
106

17 DETERMINAO DO SEXO E HERANA RELACIONADA AO SEXO

17.1 Diferencie sexo homogamtico de sexo heterogamtico.

17.2 Sexo uma caracterstica que surgiu durante a evoluo da vida na terra. Qual a
funo e importncia desta caracterstica, sob o ponto de vista evolutivo?

17.3 R10-1) Em sunos, o nmero diplide de cromossomos 40. A partir desta


informao, pergunta-se:
a) Qual o nmero de autossomos em um espermatozide de um cachao?
b) Qual a constituio cromossmica do sexo masculino e feminino?
c) Uma porca produziu uma leitegada com 12 leites; qual a probabilidade de todos serem
do sexo feminino?
Resposta:
a) 19 autossomos
b) Macho 38 A + XY e a fmea 38 A + XX
c) 1/4096

17.4 R10-2) Qual o animal (inseto) que tem av, mas no tem pai? Explique.
Resposta:
O macho, em abelhas (Zango).

17.5 R10-3) Setenta e oito cromossomos so encontrados nas clulas somticas de uma
galinha. a) Qual o nmero de autossomos e o tipo de cromossomo sexual encontrado nas
clulas somticas de uma fmea e de um macho?
b) Numa ninhada foram obtidos 14 pintinhos. Qual a probabilidade de pelo menos sete
serem do sexo feminino?
Resposta:
a) Macho 76 A + ZZ e fmea 76 A + ZW
b) 60,47%

17.6 R10-5) Um criador deseja eliminar um touro de excelentes qualidades, por que os
seus seis primeiros descendentes foram todos do sexo masculino. A deciso do criador
est certa ou errada? Justifique sua resposta.
Resposta:
A probabilidade de que esse fato ocorra de 1,6%. Essa probabilidade, apesar de baixa,
perfeitamente vivel. Sendo assim, aconselhvel obter mais alguns descendentes
antes de tomar a deciso de sacrificar o touro.

17.7 R10-6) Em aves o macho ZZ e a fmea ZW. Em galinhas a altura controlada


por um gene ligado ao cromossomo Z. O alelo dominante D confere altura normal e o d
altura an. Do cruzamento de um macho normal com uma fmea an foram obtidos 10
descendentes. Qual a condio e a probabilidade de que os 10 pintinhos sejam do sexo
feminino e anes?
Resposta:
107

A condio que o macho seja ZDZd, ou seja, heterozigoto. Tendo ele este gentipo, a
probabilidade de se obter o fentipo desejado em todos os 10 descendentes ser: 1 em
1.048.576.

17.8 R10-7) Chifres so ausentes na raa de carneiro Suffolk, mas todos os animais so
aspados na raa Dorset. Quando uma fmea Suffolk sem chifres cruzada com machos
Dorset aspados, as fmeas F1 so todas sem chifres, mas os machos so todos aspados.
Resultados idnticos ocorrem quando uma fmea Dorset aspada cruzada com macho
Suffolk sem chifres. Do cruzamento de animais F1, obtida a seguinte descendncia:
fmeas 3/4 sem chifres e 1/4 com chifres; machos 3/4 com chifres e 1/4 sem chifres. Qual
a explicao gentica para esses resultados?
Resposta:
Esse um carter cuja herana influenciada pelo sexo. Observe que o alelo para
ausncia de chifres funciona como dominante nas fmeas e recessivo nos machos, e o
alelo para a presena de chifres atua como recessivo nas fmeas e dominante nos
machos.

17.9 R10-8) Nas aves a cor da pele um carter de grande importncia, uma vez que
interfere na aceitao do produto pelo consumidor. Foi observado que o macho pode
apresentar pele preta, intermediria ou amarela, e a fmea apenas as cores intermediria
ou amarela. Qual a explicao gentica para esse carter?
Resposta:
O carter tem a expresso fenotpica condicionada por um gene ligado aos cromossomos
sexuais. A interao allica nesse caso dominncia incompleta; assim o macho, por ser
o sexo homogamtico, pode conter os dois alelos, nos cromossomos Z e portanto pode
ter uma das trs cores da pele. A fmea s possui um cromossomo Z e portanto no pode
apresentar a cor preta, que depende do gentipo homozigoto para o alelo que condiciona
pele preta.

17.10 R10-9) Foi verificado em gatos que a cor branca da pelagem devida a um gene
autossmico e que as cores laranja (XO) e preta (Xo) so devidas a dois alelos ligados ao
sexo. A partir dessas informaes, porque apenas as fmeas podem apresentar as trs
cores? Explique como nas fmeas surgem as trs cores.
Resposta:
As fmeas nos gatos, por serem XX, podem carregar os alelos B1 e B2, que conferem as
cores amarela e preta ao mesmo tempo. O macho, por ser XY, s pode ser preto ou
amarelo.
Um dos cromossomos X (O cromossomo de origem materna ou o de origem paterna) se
de descondensa tardiamente formando o corpusclo de bar.

17.11 R10-10) Os pecuaristas sempre se preocupam em selecionar touros visando uma


maior produo de leite. Como sabido, apenas as fmeas produzem leite, dessa forma,
qual a razo para esse comportamento dos pecuaristas?
Resposta:
O touro no produz leite, mas transmite os alelos para essa caracterstica aos seus
descendentes do sexo feminino.
108

17.12 Sabe-se que os cromossomos sexuais controlam a determinao do sexo e que


existem genes masculinizantes e feminilizantes localizados nos autossomos. Comente um
exemplo da utilizao prtica de controle gentico do sexo.

17.13 Quais as funes biolgicas do sexo? Quais os sistemas de determinao


genotpica do sexo? Comente a utilizao econmica da determinao do sexo em
plantas.

17.14 Diferencie, comente a importncia e exemplifique Herana ligada aos


cromossomos sexuais, Herana influenciada pelo sexo e Herana limitada pelo sexo.

17.15 Como se da a determinao sexual nos mamferos? Onde atuam os genes do


cromossomo Y, durante a diferenciao sexual?

17.16 Quais os estgios do processo da diferenciao sexual nos mamferos e como


atuam os genes dos cromossomos sexuais, neste processo?

17.17 O que entende-se por genes ligados ao sexo (herana ligada aos cromossomos
sexuais). Comente um dos modos de determinao do sexo.

17.18 Os carneiros da raa Suffolk no tm chifres e os da raa Dorset, todos tm.


Quando uma fmea Suffolk cruzada com um macho Dorset, todas as fmeas de F1 so
sem chifres, mas os machos todos tm chifres. Os mesmos resultados so obtidos
quando se cruza machos Suffolk com uma fmea Dorset. Do cruzamento entre animais
da F1, obtida a seguinte descendncia: fmeas = 3/4 sem chifres e 1/4 com chifres;
machos = 3/4 com chifres e 1/4 sem chifres. Qual a explicao gentica para estes
resultados?
Resposta:
A caracterstica com chifres recessiva nas fmeas e dominante nos machos.

17.19 Uma fmea afetada por uma caracterstica recessiva foi cruzada com um macho
normal para esta caracterstica. Deste cruzamento nasceu um macho normal. O gene
responsvel por esta caracterstica pode estar no cromossomo X? Justifique sua
resposta.
Resposta:
No. Os machos recebem seu nico cromossomo X de suas mes e, no caso, a me era
homozigota recessiva, afetada.

17.20 Examinando o heredograma seguinte, poderia-se concluir que a caracterstica


presente nos indivduos cujos smbolos foram escurecidos, tem herana ligada ao X,
recessiva ou, ento, autossmica dominante, limitada ao sexo masculino? Explique.
????
Resposta:
No. Em ambos os casos, 1/2 dos filhos machos de uma fmea heterozigota seriam
afetados.
109

17.21 Um pecuarista e um geneticista viram pela janela da sala da fazenda, uma vaca da
raa Ayrshire de cor mogno, com um bezerro recm-nascido, de cor vermelha. O
pecuarista quis saber o sexo do bezerro e o geneticista falou que era fcil, s pela cor do
animal. Explicou que, nesta raa, o gentipo AA cor mogno e o gentipo aa cor
vermelha, mas que o gentipo Aa cor mogno nos machos e vermelho nas fmeas. Qual
era, ento, o sexo do bezerro?
Resposta:
Fmea.

17.22 Em gatos as fmeas podem apresentar trs cores (branco, preto e amarelo)
enquanto que os machos s podem apresentar duas cores. Explique detalhadamente
porque.

18 SISTEMAS DE ACASALAMENTO

18.1 O proprietrio de um animal que resultou de inbreeding est solicitando


informaes. Represente o pedigree deste animal, mostrando, em quatro geraes, o que
inbreeding.
Resposta:
Por exemplo:
Corn Flake

Toty de Laupo
Pinky Jr
{ Princess Diana
{
Silver Dollar

Princess Soraya

{
Silver Dollar

Billie
Bruma { Prince Albert

Betty Blue
Princess Soraya

18.2 A produo de sementes (sacas por acre) e a altura da planta (cm) foram medidas
em trs populaes de milho:
------------------------------------------
Produo de sementes Altura da planta
-----------------------------------------------------------------
Variedade 1 73,3 265
Variedade 2 25,0 193
Hbridos de F1 71,4 257
Qual das caractersticas estudadas apresentou maior porcentagem de heterose?
Resposta:
Produo de sementes

18.3 Calcule o coeficiente de endocruzamento (Fx) do animal X:


110

{ 1
3
S
{ { 4
1

6
X

{ 1
2

D { 3

{ 5
7

8
E se o animal n1 tivesse um Fa = 0,25, qual seria, ento o Fx do animal X?
Resposta:
a) Fx = 0,1875
b) Fx = 0,2344

18.4 Calcule o coeficiente de endocruzamento (Fx) do animal X:

{
4

{
1
5
S

2
{ 4

5
X
{ 4

{
1
S 5

{ {
4
D 2
5
3
Resposta:
Fx = 0,3125

18.5 Em que casos estaria indicada a seleo:


a) individual? b) pelo pedigree? c) pela famlia?
Resposta:
a) HE mdia - alta, b) Caracterstica que se manifestam apenas em um sexo, ou que tm
manifestao tardia, ou ento com HE baixa, c) HE baixa

18.6 Ao se estudar a qualidade e o peso da l em carneiros, foram obtidos os seguintes


valores de varincia:
111

----------------------------------------------------------------
Peso Qualidade
----------------------------------------------------------------
Varincia de interao 20,00 151,8
Varincia aditiva 127,51 128,6
Varincia dominante 51,79 150,0
Varincia ambiental 32,10 107,3
Varincia gentica 199,30 430,4
----------------------------------------------------------------
Pretende-se realizar um trabalho de seleo com base nos fentipos dos animais, qual
destas duas caractersticas apresentar resultados mais rpidos? Por qu?
Resposta:
Peso de l, porque tem HE mais alta

18.7 Como planejar um programa de controle gentico das doenas oculares hereditrias
(atrofia progressiva de retina e catarata, por exemplo), cuja incidncia est bastante alta
em ces das raas Cocker Spaniel e Poodle, no Brasil?
Resposta:
No cruzar afetados (aa) e no cruzar pais de afetados (Aa)

19 IMUNOGENTICA

19.1 Assinale a alternativa que completa corretamente as afirmativas abaixo: As


___________ so protenas especiais que ___________ reaes qumicas que ocorrem
no ___________ das clulas. Quando o organismo aquecido demasiadamente, elas so
_______________.
a) gorduras, catalisam, interior, desnaturadas;
b) molculas, aceleram, exterior, recriadas;
c) enzimas, retardam, exterior, derretidas;
d) gorduras, alteram, limite, destrudas;
e) enzimas, catalizam, interior, desnaturadas.

19.2 Uma gua que teve doena hemoltica do recm-nascido cruzada com um
garanho que no teve a doena, mas que tem dois irmos mais velhos que tiveram o
problema.
a) Quais so os gentipos da gua, do garanho e de seus pais?
b) Qual a probabilidade de o potro resultante deste cruzamento vir a ter a doena?
Explique.
OBS: indivduo A_ = produz antgeno; indivduo aa = no produz antgeno; Nenhum
destes animais mencionados recebeu tratamentos especiais aps seu nascimento.
Resposta:
a) [A_]--[aa] [Aa]--[aa]
| |
[Aa]----------[aa]
b) Zero. A gua A. Suponha que, em bovinos, os antgenos do grupo sanguneo P
sejam determinados por trs alelos P1, P2 e p. Os genes P1 e P2 so co-dominantes, mas
112

ambos so dominantes em relao ao gene p. Os grupos sanguneos determinados por


estes genes so:
P* (P1); P** (P2); P*** (P1 P2) e P**** (pp)
Em uma mesma noite, quatro vacas deram luz, no pasto, quatro bezerros, cujos grupos
sanguneos eram P*, P**, P*** e P****. O criador sabe os grupos sanguneos dos quatro
pares de genitores, que so:
a) o P**** x P****
b) o P*** x P****
c) o P* x P**
d) o P** X P**
Ajude-o a identificar os pais dos quatro bezerros.
Resposta:
a) Bezerro P****
b) Bezerro P*
c) Bezerro P***
d) Bezerro P**

20 EFEITO MATERNO E HERANA EXTRACROMOSSMICA

20.1 O que cruzamento recproco? Exemplifique. Cite um possvel uso em estudos


gentico dos cruzamentos recprocos.

20.2 R15-1) Em caramujo das espcie Limnaea peregra o enrolamento da concha pode
ser para a direita, devido ao alelo dominante R, ou para a esquerda, condicionado pelo
recessivo r. Dois caramujos foram cruzados e produziram um descendente com concha
enrolada para a esquerda. Este descendente foi autofecundado e produziu uma prognie
com todos os indivduos apresentando a concha enrolada para a direita.
a) Quais os gentipos do pai, da me e de todos os descendentes obtidos?
b) Se a prognie com a concha enrolada para a direita for autofecundada, quais as
propores genotpicas e fenotpicas esperadas?
Resposta:
a) Pai=> RR, Me=> rr, F1=> Rr, F2=> 1/4 RR : 1/2 Rr : 1/4 rr
b) 3/8 RR : 1/4 Rr : 3/8 rr, 3/4 enrolada para a direita : 1/4 enrolada para a esquerda.

20.3 R15-2) Suponha que em arroz ocorra uma determinada anormalidade, qual
procedimento deve ser adotado para verificar se a anormalidade devida a genes
nucleares, citoplasmticos, efeito materno ou simplesmente algum efeito ambiental?
Resposta:
O procedimento consiste em cruzar plantas normais com anormais e analisar os
descendentes. Se os genes forem nucleares, temos duas situaes e necessitamos obter
pelo menos as geraes F1 e F2: a primeira situao a mais comum e neste caso os
genes se expressam apenas nos indivduos que os possuem; na segunda temos o
fenmeno denominado efeito materno, no qual o fentipo do filho ser sempre idntico ao
da me, independente do seu gentipo. Se a anormalidade foi devida a genes
citoplasmticos, temos de obter pelo menos at a gerao F3 e o fentipo de todas as
geraes descendentes ser idntico ao do genitor feminino. Porm, se se tratar de efeito
113

ambiental, o procedimento dispensa o cruzamento. Basta avaliar a planta anormal ou


seus descendentes em outro ambiente e anormalidade desaparecer.

20.4 R15-3) Em soja foi realizado o cruzamento entre duas linhagens visando o estudo
da herana do teor de leo, sendo obtido o seguinte resultado:
-----------------------------------------------------------------
POPULAES TEOR DE LEO (%)
-----------------------------------------------------------------
Linhagem A 15
Linhagem B 25
F1 - A(feminino) X B(masculino) 15
F1 - B(feminino) X A(masculino) 25
F2 - A(feminino) X B(masculino) 20
F2 - B(feminino) X A(masculino) 20
-----------------------------------------------------------------
Qual a concluso sobre a herana do carter? Comente a respeito.
Resposta:
A herana do teor de leo explicada pelo efeito materno, porque o fentipo de qualquer
descendente a expresso do gentipo da me.

20.5 Como a herana ligada ao sexo (Herana ligada aos cromossomos sexuais) pode
ser diferenciada da herana extracromossmica?
Resposta:
A partir de um cruzamento de genitores puros contrastantes para um determinado carter,
se o fentipo do pai no ocorrer em nenhuma gerao descendente, trata-se de herana
extracromossmica. Porm, se o fentipo do genitor masculino ocorrer pelo menos at a
segunda gerao, porque se trata de genes ligados os cromossomos sexuais.

20.6 R15-5) No tremoo, uma leguminosa forrageira, o cruzamento de uma linhagem


amarga com outra doce produziu todos os descendentes F1 doce; o seu recproco
apresentou todos os descendentes amargos. Esse resultado s foi observado nas plantas
jovens da F1, quando atingiram o estdio adulto todas apresentaram folhas amargas.
a) Sugira uma provvel explicao para esses resultados.
b) Quais so as constituies genticas dos genitores masculinos e femininos envolvidos
nos cruzamentos, admitindo que o carter monognico?
c) Quais os resultados esperados na gerao F2 para ambos os cruzamentos, no estdio
de plantas jovens e tambm adultas?
Resposta:
a) um caso de efeito materno em que o gentipo da me expressa apenas na fase
juvenil dos filhos.
b) 1. (Fmea) dd x DD (macho) e (Fmea) DD x dd (Macho)
c) 1. Jovens: 100% amargos
Adultos: 3/4 amargos : 1/4 doces
2. Jovens: 100% amargos
Adultos: 3/4 amargos : 1/4 doces

20.7 R15-6) No cruzamento de dois cultivares de feijo, contrastantes com relao ao


peso das sementes, foram obtidos os seguintes resultados:
114

----------------------------------------------------------------
POPULAES PESO DE 100 SEMENTES (g)
----------------------------------------------------------------
P1 Small Write (S) 18
P2 Diacol Calima (D) 50
F1 S (fmea) X D (macho) 18
F1 D (fmea) X S (macho) 50
----------------------------------------------------------------
a) A herana extracromossmica uma hiptese plausvel para explicar esses
resultados?
b) Sugira os cruzamentos necessrios para comprovar sua hiptese.
Resposta:
a) Sim
b) Obtm-se a gerao F3. Se ocorrer apenas o fentipo do genitor feminino, a hiptese
sugerida fica comprovada.

20.8 R15-7) A cor amarela numa planta pode ser causada por um alelo recessivo
cromossmico e/ou por um fator citoplasmtico. Quais resultados seriam esperados nos
seguintes casos:
a) Cruzamentos recprocos de uma linhagem verde com outra amarela;
b) Retrocruzamentos entre o produto de cada um desses cruzamentos para as linhagens
paternais;
c) Autofecundao dos F1s dos cruzamentos recprocos;
Cruzamentos dos dois F1s.
Resposta:
a) As possibilidades seriam: 1. Fmea VV(N) x vv(A) Macho
2. Fmea vv(A) x VV(N) Macho
Nestes casos os resultados seriam 100% verdes e 100% amarelas, respectivamente.
b) Utilizando as F1 como fmeas nos retrocruzamentos, so esperados:
1) RC1 100% verdes e RC2 1/2 verdes : 1/2 amarelas.
2) RC1 e RC2 100% amarelas.
c) 1) 3/4 verdes : 1/4 amarelas 2) 100% amarelas.
d) 3/4 verdes : 1/4 amarelas ou 100% amarelas, dependendo de qual F1 foi a me.

20.9 R15-8) Uma linhagem de cevada com folhas amareladas e aristas longas recebeu
plen de outra linhagem que possua folhas normais e aristas curtas. As plantas F1 foram
de folhas amareladas e aristas longas, na F2 foram obtidas 309 plantas com folhas
amareladas e aristas longas e 98 plantas de folhas amareladas e aristas curtas. O
cruzamento recproco entre essas duas linhagens produziu, na F1, plantas com folhas
verdes e aristas longas e, na F2, 328 plantas com folhas verdes e aristas longas e 107
plantas com folhas verdes e aristas curtas. Qual a explicao do controle gentico desses
dois caracteres?
Resposta:
A cor da folha controlada por gene citoplasmtico. O comprimento da arista um
carter monognico, sendo dominante o alelo para arista longa e recessivo o alelo para
arista curta.
115

20.10 R15-9) Na cevada, a cor das folhas pode ser devida a um gene citoplasmtico (L1
= folhas normais e L2 = folhas amarelas), ou a um gene nuclear (V), sendo o alelo
recessivo o responsvel por folhas amareladas. Possuindo o citoplasma L2 a cor ser
amarela, independente do gentipo do ncleo. Quais as propores fenotpicas
esperadas a partir dos seguintes cruzamentos?
a) Linhagem normal (Fmea) x (Macho) L1 vv (amarelado);
b) L1 vv (amarelado) (Fmea) x (Macho) Linhagem normal;
c) Linhagem normal (Fmea) x (Macho) L2 vv (amarelado);
d) L2 vv (amarelado) (Fmea) x (Macho) Linhagem normal;
e) F1 do cruzamento a (Fmea) x (Macho) F1 do cruzamento d;
f) F1 do cruzamento d (Fmea) x (Macho) F1 do cruzamento a.
Resposta:
a) 100% normais; b) 100% normais; c) 100% normais; d) 100% amareladas; e) 3/4
normais : 1/4 amarelados; f) 100% amarelados.

20.11 R15-10) Na planta ornamental conhecido por maravilha, as ramificaes podem


ser verde, variegada e branca. A gerao F1, proveniente do cruzamento de flores
femininas presentes em ramos verdes ou brancos, possui o mesmos fentipos maternos,
independente do genitor masculino. Isto se verifica tambm para a gerao F1 de
qualquer retrocruzamento. Em qualquer cruzamento em que a flor feminina encontra-se
num galho variegado, a prognie apresenta plantas verdes, variegadas e brancas,
independente do fentipo do genitor masculino.
a) Qual a explicao para a herana da cor da folha?
b) Qual o resultado esperado dos seguintes cruzamentos?
----------------------------------------------------------------
GENITOR FEMININO GENITOR MASCULINO
----------------------------------------------------------------
1. Galho branco Galho verde
2. Galho verde Galho branco
3. Galho variegado Galho branco
4. Galho branco Galho variegado
----------------------------------------------------------------
Resposta:
a) devida a gene citoplasmtico.
b) 1. 100% brancos 2. 100% verdes
3. Verdes, variegados e brancos 4. 100% brancos

20.12 R15-11) Um pesquisador descobriu uma planta de cebola macho-estril em sua


plantao. a) Como proceder para verificar se a esterilidade masculina devida genes
nucleares ou citoplasmticos? b) Supondo que a macho-esterilidade referida acima seja
devida a um gene mitocondrial, como proceder para introduzir este gene em uma
linhagem que ser usada na produo de hbridos, de modo que ele mantenha as
mesmas caractersticas da linhagem original?
Resposta:
a) Cruza-se a planta macho-estril com outra planta normal. Se todas as geraes
descendentes desta planta apresentarem somente indivduos macho-estreis, porque o
carter devido a gene citoplasmtico. Por outro lado, se ocorrerem segregaes de
indivduos macho-frteis e macho-estreis, porque trata-se de gene nuclear.
116

b) Atravs de retrocruzamentos sucessivos, utilizando-se sempre a linhagem desejada


como genitor recorrente. Maiores informaes so fornecidas no texto.

20.13 R15-13) Uma das causas de macho-esterilidade no milho devido a um gene


mitocondrial. Existe tambm um alelo dominante (Rf) nuclear, que restaura a fertilidade,
isto , plantas Rf__ so frteis independentes do citoplasma.
a) Qual a constituio gentica de uma planta que ao ser autofecundada produz 75% de
descendentes frteis e 25% de descendentes macho-estreis?
b) Qual a constituio gentica de uma planta que usada como genitor masculino e que
produza uma fmea macho-estril, os descendentes so sempre macho-frteis?
c) Estabelea um esquema de cruzamentos para a produo de milho hbrido duplo
utilizando o macho-esterilidade.
d) Se for obtida uma linhagem promissora, como proceder para torn-la macho-estril?
Uma vez obtida essa linhagem, como mant-la?
Resposta:
a) Rfrf(E)
b) RfRf independente do citoplasma
c) Obteno dos hbridos simples (HS):
1. rfrf(E) x Rfrf(E) = Rfrf(E) - HS Macho-frtil
2. rfrf(E) x rfrf(N) = rfrf(E) - HS Macho-estril
Obteno do hbrido duplo:
rfrf(E) x Rfrf(E) = 1/2 Rfrf(E) = Macho-frtil
1/2 rfrf(E) = Macho-estril
d) A linhagem promissora macho-frtil, se obtida de populao sem o alelo restaurador, a
sua constituio deve ser rfrf(N). Atravs de retrocruzamentos sucessivos com uma planta
macho-estril, transfere-se o gentipo da linhagem desejada para o citoplasma macho-
estril. Desse modo, consegue-se a linhagem desejada com a constituio macho-estril.
O cruzamento delas ir produzir sempre a linhagem macho-estril.

20.14 Esquematize o cruzamento de duas linhagens de milho, mostrando a transferncia


do citoplasma T causador da macho-esterilidade, presente na linhagem B, para uma
linhagem A.

20.15 Dispe-se de duas linhagens de milho (linhagem A e linhagem B) cuja F1


apresenta excepcional vigor hbrido (heterose). Para evitar o despendoamento (retirada
manual do pendo) da linhagem A, que ser utilizada como genitor feminino, deve-se
transferir a macho-esterilidade citoplasmtica para esta linhagem. Esquematize a
transferncia da macho-esterilidade citoplasmtica da linhagem macho-estril T (Texas)
para a linhagem A.

20.16 Diferencie efeito materno de herana extracromossmica.

20.17 Explique como proceder para verificar se um determinado carter apresenta efeito
materno, herana extracromossmica ou um carter mendeliano comum?

20.18 Explique em que situaes os cruzamentos recprocos apresentam resultados


diferentes.
117

20.19 Suspeita-se que um determinado carter apresente herana extracromossmica.


Sugira um experimento para elucidar o controle gentico deste carter. Explique que tipo
de resultado confirmaria: a) A hiptese inicial de herana extracromossmica, b) A
hiptese de efeito materno, c) A hiptese de ser um carter mendeliano comum, d) A
hiptese de o carter ser controlado por um gene relacionado ao sexo (Herana ligada
aos cromossomos sexuais), e) A hiptese de ser um gene letal e, f) A hiptese de
pleiotropia.

20.20 Sugira um experimento e que resultados deste experimento confirmam a hiptese


de controle gentico: a) Herana extracromossmica, b) Efeito materno, c) Carter
mendeliano comum, d) Carter ser controlado por um gene relacionado ao sexo (Herana
ligada aos cromossomos sexuais). e) Gene letal, f) Pleiotropia, g) Interao gnica
(epistasia dominante recessiva) e h) Ligao gnica (dois genes parcialmente ligados,
com frequncia de recombinao de 15%).

20.21 Demonstre o que so cruzamentos recprocos utilizando um exemplo e; em que


situaes os cruzamentos recprocos podem ser utilizados para elucidar a herana de um
carter?

20.22 2. Suspeita-se que um determinado carter quantitativo apresente efeito materno.


Sugira um experimento para elucidar o controle gentico deste carter. Explique que tipo
de resultado confirmaria: a) A hiptese inicial de efeito materno, b) A hiptese de herana
extracromossmica e c) A hiptese de ser um carter quantitativo comum.

20.23 A presena de folhas brancas ou variegadas em uma planta pode ter vrias
origens. As folhas brancas herdadas so oriundas de mutaes em genes do ncleo da
clula, das mitocndrias ou dos plastos. Tais mutaes resultam, direta ou indiretamente,
na incapacidade de acumular pigmentos fotossintticos.

20.24 Com base no texto e em seus conhecimentos, analise as seguintes afirmativas.

20.25 I. Os cloroplastos, organelas que apresentam DNA, podem sofrer mutao


gentica que acarreta a incapacidade de acumular clorofila pigmento encontrado nos
tilacides inviabilizando o processo fotossinttico.

20.26 II. Os plastos so formados a partir de protoplastos, em que cada clula


especializada origina um tipo de plasto diferente, o qual incapaz de se transformar em
outro tipo de plasto. Ocorrendo a mutao, cloroplastos no so formados, o que torna as
folhas brancas.

20.27 III. O cloroplasto envolto por duas membranas lipoproticas e possui


internamente um elaborado sistema de bolsas membranosas interligadas. Em folhas
verdes, no interior dessas bolsas existe DNA, RNA e ribossomos; j nas folhas brancas
no ocorrem ribossomos, o que ocasiona a no produo de clorofila.
118

20.28 IV. Nas regies brancas das folhas no ocorre a etapa fotoqumica, que
compreende a fotofosforilao e a fotlise da gua. Nas folhas verdes, a clorofila, ao
receber energia da luz, emite eltrons energizados, os quais so captados e
transportados por uma cadeia de substncias presentes na membrana do tilacide,
liberando gradativamente sua energia.
Esto corretas apenas as afirmativas:
a) II e III.
b) I e III.
c) II e IV.
d) I e IV.
e) I e II.
Os plastos so capazes de se autoduplicar. Quando uma clula vegetal divide-se em
duas clulas-filhas, cada uma delas recebe aproximadamente metade do nmero de
plastos existentes na clula me. medida que as clulas filhas crescem, os plastos se
autoduplicam, restabelecendo sua quantidade original nas clulas.Os plastos apresentam
DNA prprio, RNA e ribossomos, sendo capazes de produzir diversas protenas. As
afirmativas I e IV (que so as corretas), tratam mais aprofundadamente do processo
fotossinttico, onde lembram que a clorofila est localizada nos tilacides, e que a etapa
fotoqumica compreende a fotofosforilao e a fotlise da gua. A afirmativa II erra em
suas consideraes sobre o protoplasto (na verdade o termo correto seria proplasto, pois
protoplasto todo contedo vivo de uma clula), que no so clulas especializadas, e,
que um tipo de plasto pode transformar-se facilmente em outro; por exemplo, leucoplastos
podem se transformar em cromoplastos e vice-versa. A afirmativa III necessita de uma
anlise mais apurada. A mutao que deixa a folha branca acontece no DNA do
cloroplasto, fazendo com que produza uma protena defeituosa, ou ainda que no
produza protena alguma. Mas no interior do cloroplasto, os ribossomos continuam a
existir.

20.29

21 TCNICAS BIOTECNOLGICAS E APLICAES AOS ESTUDOS


GENTICOS.

21.1 Tcnicas de apoio biotecnologia

21.1.1 As enzimas de restrio so enzimas que: (Marque V para a sentena verdadeira


ou F para falso. Se falso justifique).
a) ( ) Impedem que os alelos se expressem.
b) ( ) Duplicam o DNA.
c) ( ) Impedem a duplicao gnica.
d) ( ) Identificam a fita velha e percorrem a fita nova para corrigir possveis erros.

21.1.2 Fuso de protoplastos e cultura de tecidos so tcnicas biotecnolgicas que no


envolvem manipulao de DNA, apenas de clulas e tecidos. Um protoplasto :
( ) Uma clula da qual foi removida a parede e a membrana celular;
( ) Uma na qual foi introduzido um segundo ncleo;
( ) Uma clula sem cloroplasto ou mitocndria;
119

( ) Uma clula da qual foi removida a parede celular;


( ) Uma clula da qual foi removido o ncleo;

21.1.3 De maneira geral, os programas de melhoramento de plantas autgamas visam a


obteno de linhagens, ou seja, gentipos com a maioria dos loci em homozigose, isto ,
geralmente conseguidos atravs de sucessivas autofecundaes, por seis a oito
geraes. Portanto, esse um processo demorado. Para reduzir esse tempo, pode-se
utilizar uma tcnica biotecnolgica. Qual esta tcnica biotecnolgica?

21.1.4 (A) Cultura de embrio; (B) DNA recombinante; (C) Fuso de protoplastos;
(D) Cultura de anteras ou; (E) Resgate de embries. A resposta correta ( ).

21.1.5 Descreva a tcnica da eletroforese e suas aplicaes em gentica e


melhoramento de plantas.

21.1.6 Comente as enzimas de restrio (Importncia, caractersticas, utilizao e modo


de atuao, sob o ponto de vista da biologia molecular).

21.1.7 Comente o uso e a importncia das enzimas de restrio na tecnologia do DNA


recombinante.

21.1.8 O que so enzimas de restrio? Como atuam? e Quais as suas caractersticas de


atuao.

21.2 Cultura de tecidos vegetais

21.2.1 Demonstre seus conhecimentos em Cultura de tecidos vegetais, discorrendo


sobre: a) condies de cultivo, b) meios de cultura, c) tipos de explantes, d) variabilidade
gentica e e) aplicaes em gentica e melhoramento.

21.2.2 Comente as aplicaes da cultura de tecidos vegetais na agricultura.

21.2.3 A cultura de tecidos tem inmeras aplicaes na agricultura, dentre elas destaca-
se a limpeza viral. Descreva como realizada a limpeza viral, qual o explante utilizado
e porque possvel obter explante sem vrus.

21.2.4 Diferencie: Variao fenotpica, Variao gentica, Variao epigentica e


Variao somaclonal.

21.3 Transformao gentica

21.3.1 Comente as aplicaes da tecnologia do DNA recombinante aos animais


domsticos: a) Produo de vacinas, b) Melhoramento gentico, c) Alterao do potencial
gentico de clulas e organismos, d) Recuperao de espcies em extino e,
e) Identificao individual atravs do DNA (DNA fingerprinting).
Resposta:
OTTO (2000), p.228-239

21.3.2 Quais os problemas que podem advir do uso de plantas transgnicas?


120

21.4 Marcadores moleculares

21.4.1 Marcadores moleculares so importantes para o melhoramento gentico porque


esto presentes em todas as espcies e podem ser utilizados como auxiliares de seleo,
clonagem, etc. Caracteres moleculares so :
( ) Caracteres visveis em organismos;
( ) Caractersticas bioqumicas dos organismos;
( ) Caractersticas mensurveis;
( ) Caractersticas novas e desconhecidas.

21.4.2 Marcadores genticos podem ser classificados em morfolgicos, fisiolgicos e


bioqumicos. Identifique o conjunto em que todos os seus componentes sejam
marcadores genticos. (A) Isoenzimas, genes maiores, cloroplastos, RAPDs;
(B) Isoenzimas, protenas, genes maiores, RFLPs; (C) Protenas, ribossomos, lipdeos,
cloroplastos; (D) Ribossomos, plastdeos, enzimas, RFLPs. A resposta correta ( ).

21.4.3 Um determinado gene hipottico possui dois alelos denominados A e a. Uma


enzima de restrio capaz de clivar (quebrar) o segmento de DNA que corresponde ao
alelo A em duas partes de diferentes tamanhos medidos em pares de bases (pb). A
mesma enzima no capaz de clivar o segmento de DNA do alelo a. Foram colhidas
clulas de trs indivduos (1, 2 e 3) e obtido o trecho do DNA que corresponde ao gene
citado. Estes fragmentos foram ento misturados com a enzima de restrio, e aps o
procedimento, o material foi submetido a uma eletroforese em gel de agarose. O resultado
da digesto revelado pela eletroforese representado esquematicamente abaixo. As
faixas claras horizontais representam o tamanho dos fragmentos de DNA obtidos.

Indivduos
1 2 3

800 -
Nmero de pares de base (pb)
(Representao sem Escala)

400

300
Sentido da migrao do DNA
na eletroforese
220

170

+
Com base no resultado, some o valor de cada uma da(s) proposio(es) CORRETA(S)
( ).
121

01. O indivduo 01 possui duas cpias do alelo A.


02. O indivduo 02 possui duas cpias do alelo a.
04. O indivduo 03 possui um alelo A e um alelo a.
08. O indivduo 02 possui um alelo A e um alelo a.
16. O alelo A quando clivado origina 2 fragmentos com cerca de 700 pb.
32. O alelo a possui um tamanho de aproximadamente 300 pb.
64. Os fragmentos maiores do gene A ficam mais prximos do polo positivo.

21.4.4 Indique se cada uma das seguintes proposies so verdadeira (V) ou falsa (F).
( ) A respeito da tcnica da PCR, que consiste na amplificao enzimtica de uma
sequncia de DNA de interesse. Os iniciadores (primers) so desenhados de modo tal
que um deles seja complementar a um pequeno segmento da fita de DNA da sequncia
de interesse e o outro iniciador, complementar a um pequeno segmento intermedirio da
sequencia de interesse.

21.4.5 A variao ambiental mascara o gentipo dificultando sua avaliao. A avaliao


baseada em marcadores moleculares permite o acesso direto informao gentica
contida no gene. Comente o princpio de deteco de polimorfismos, a base gentica e as
aplicaes dos principais marcadores genticos moleculares.

21.4.6 Descreva a tcnica de AFLP e comente seus usos.

21.4.7 O que so marcadores? Quais os tipos e aplicaes dos marcadores moleculares


de DNA? O que so marcadores moleculares dominantes e marcadores moleculares
codominantes.

21.4.8 Quais marcadores, dentre os quatro tipos principais, so dominantes e quais so


codominantes?

21.4.9 Explique o princpio de funcionamento da tcnica de PCR (amplificao de DNA


atravs da reao em cadeia da polimerase) e descreva todos os passos da tcnica.

21.4.10 Descreva como definido o fragmento de DNA que sofrer a amplificao


exponencial na PCR (reao em cadeia da polimerase).

21.4.11 Comente as aplicaes da reao em cadeia da polimerase PCR.

21.4.12 Os marcadores baseados em PCR so dominantes, codominantes ou podem


variar conforme a situao? Argumente o porque de sua resposta (A avaliao ser
baseada na argumentao).

21.4.13 O que so marcadores fenotpicos? O que so marcadores genticos? O que


so marcadores moleculares?

21.4.14 Quais so os principais tipos de marcadores utilizados em estudos genticos e


quais so suas restries ou vantagens?

21.4.15 Explique detalhadamente o que um marcador molecular.

21.4.16 Marcadores moleculares baseados em PCR (Reao em cadeia da polimerase):


Descreva o princpio de funcionamento e os passos da tcnica, a base gentica (como o
122

polimorfismo gentico detectado e se este polimorfismo mostra-se dominante,


codominante ou pode variar conforme a situao) e as principais aplicaes dos
marcadores moleculares baseados em PCR, em gentica animal.

21.4.17 O encarquilhamento causado pelo vrus ABC e manifestam-se somente quando


a planta est na fase adulta. O plantio de mudas contaminadas, embora no apresentem
os sintomas, comprometero a produo, sendo necessrio a eliminao das plantas
contaminadas. Um produtor esta interessado em adquirir mudas sadias, sem o vrus.
Como pode-se utilizar a PCR para verificar a presena dos vrus nestas plantas. Descreva
todo o princpio da metodologia, desde a tcnica de PCR at a interpretao dos
resultados.
O site http://pcrfilme.vilabol.uol.com.br auxiliar na resposta desta questo.

21.4.18 A videira (Vitis vinifera) quando afetada pelo vrus GLRaV (Grapevine leafroll-
associated virus) apresenta reduo na produo de uva. Uma das maneiras de implantar
um pomar com potencial de alto rendimento a aquisio de mudas livres de vrus,
porem os sintomas so latentes na fase vegetativa (sintoma latente - quando os sintomas
aparecem somente em determinadas fases do ciclo da planta. Esta virose se manifesta
somente aps a implantao do pomar, quando iniciar a produo de uvas). O produtor
est disposto a pagar mais por mudas livres do vrus GLRaV, porem quer garantias de
que as mudas estejam realmente livres deste vrus. Como proceder, utilizando tcnicas
moleculares, para verificar se as mudas a serem adquiridas possuem ou no o vrus
GLRaV? Descreva todo o princpio da metodologia, desde a tcnica at a interpretao
dos resultados.

21.4.19 Seu Joo da Silva, avicultor, tem observado perdas frequentes em seu avirio
devido ao alto ndice de mortalidade de aves. O avicultor desconfia que o alto ndice de
morte de aves em seu avirio seja devido a uma virose chamada de Vvtc432Ag, que
ocorreu na dcada de 1970. Como proceder, utilizando tcnicas moleculares, para
verificar se as aves mortas possuem ou no o vrus Vvtc432Ag? Descreva todo o princpio
da metodologia, desde a tcnica at a interpretao dos resultados.

21.5 Tcnicas associadas ao aumento da capacidade reprodutiva (Inse minao


artificial, super ovulao, ....).

21.5.1 Comente as tcnicas biotecnolgicas aplicadas aos animais domsticos


(importncia, aplicaes).

21.6 Questoes certo x errado


O que conservao ex situ?
a conservao das espcies cultivadas a campo.
Interao gnica: a interao entre dois ou mais gentipos diferentes onde se herdam
caractersticas tanto do pai quanto da me, fazendo com que esse novo gene possua
ambas caractersticas. a interao entre dois ou mais fentipos diferentes onde se
herdam caractersticas tanto do pai quanto da me, fazendo com que esse novo gene
possua ambas caractersticas. Interao dos genes para formao dos alelos.
123
Anexos

22.1 Tabela do cdigo gentico


1 Base do 2 Base do Cdon 3 Base do
Cdon Cdon
U C A G
Fenilalanina Serina Tirosina Cistena U
Fenilalanina Serina Tirosina Cistena C
U
Leucina Serina Parada(Stop) Parada(Stop) A
Leucina Serina Parada(Stop) Triptofano G
Leucina Prolina Histidina Arginina U
Leucina Prolina Histidina Arginina C
C
Leucina Prolina Glutamina Arginina A
Leucina Prolina Glutamina Arginina G
Isoleucina Treonina Asparagina Serina U
Isoleucina Treonina Asparagina Serina C
A
Isoleucina Treonina Lisina Arginina A
Metionina Treonina Lisina Arginina G
Valina Alanina Ac. Asprtico Glicina U
Valina Alanina Ac. Asprtico Glicina C
G
Valina Alanina Glutamina Glicina A
Valina Alanina Glutamina Glicina G

22.2 Valores de 2 para diferentes nveis de probabilidade.


Probabilidades
GL1
0,95 0,90 0,80 0,70 0,50 0,30 0,20 0,10 0,05 0,01 0,001
1 0,004 0,02 0,06 0,15 0,46 1,07 1,64 2,71 3,84 6,64 10,83
2 0,10 0,21 0,45 0,71 1,39 2,41 3,22 4,60 5,99 9,21 13,82
3 0,35 0,58 1,01 1,42 2,37 3,66 4,64 6,25 7,82 11,34 16,27
4 0,71 1,06 1,65 2,20 3,36 4,88 5,99 7,78 9,49 13,28 18,47
5 1,14 1,61 2,34 3,00 4,35 6,06 7,29 9,24 11,07 15,09 20,52
6 1,63 2,20 3,07 3,83 5,35 7,23 8,56 10,64 12,59 16,81 22,46
7 2,17 2,83 3,82 4,67 6,35 8,38 9,80 12,02 14,07 18,48 24,32
8 2,73 3,49 4,59 5,53 7,34 9,52 11,03 13,36 15,51 20,09 26,12
9 3,32 4,17 5,38 6,39 8,34 10,66 12,24 14,68 16,92 21,67 27,88
10 3,94 4,86 6,18 7,27 9,34 11,78 13,44 15,99 18,31 23,21 29,59
No significativo Significativo
1 Grau de liberdade.

Probabilidade de que o erro amostral explique as diferenas.


Probabilidade de que os erros (desvios) sejam devidos ao acaso.
Quanto maior a probabilidade, maior as chances de que as diferenas entre a Fo e a
Fe sejam devidas ao acaso.
NS grande chance do acaso explicar as diferenas entre Fo e a Fe.
S pequena chance de somente o acaso explicar as diferenas entre Fo e a Fe.