Anda di halaman 1dari 53

LAS LEGUMINOSAS EN UN MUNDO SOSTENIBLE

ALFONSO CLEMENTE

LES LLEGUMINOSES: UNA REVOLUCI GASTRONMICA PENDENT?


Barcelona , 24 de Mayo 2016

alfonso.clemente@eez.csic.es
e-mail: info@leguminosas.es www.leguminosas.es
Grupos de trabajo dentro de la AEL

CONSEJOS
ADMINISTRACIN REGULADORES,
ASOCIACIONES Y
EMPRESAS

CONSUMIDORES

AGRICULTURA
NUTRICION
MEDIO AMBIENTE
Miembro de COSCE y Red Rural Nacional

Reuniones sectoriales del MAGRAMA

Contactos con el sector productivo

Asesora (MNCN, Univ. Granada, colegios.)

Stakeholders FP7: Legato


H2020:Protein2Food
Actividades de la AEL
Convenios de colaboracin

Organizacin y participacin en Jornadas y Conferencias


Publicaciones CSIC

Coleccin Divulgacin
Revista Arbor
Diego Rubiales (IAS) Alfonso Clemente (EEZ)
Antonio M. De Ron (MBG)
Divulgacin
Gincana Gastronmica (Crdoba, 30 de septiembre 2016)

Ciudad Real, 16 Junio Salamanca, 23 Septiembre


Lucia de la Rosa (IRF-INIA) Teresa Milln (UCO) Ana M. Torres(IFAPA)
LAS LEGUMINOSAS EN UN MUNDO SOSTENIBLE

ALFONSO CLEMENTE

LES LLEGUMINOSES: UNA REVOLUCI GASTRONMICA PENDENT?


Barcelona , 24 de Mayo 2016

alfonso.clemente@eez.csic.es
Leguminosas vs. legumbres
BOTANICA
Leguminosa: planta de la familia Papilionaceae (Fabaceae)
mas de 600 gneros y 19.000 especies
Legumbre: las semillas secas, limpias, sanas y separadas
de la vaina, procedentes de leguminosas

La FAO considera legumbres:

La FAO no considera legumbres las especies utilizadas como hortalizas (por


ejemplo, los guisantes verdes o judas verdes), para la extraccin de aceite (como
por ejemplo, soja o cacahuete) u otras con fines de siembra (es el caso del trbol y
la alfalfa).
Legumbres y sostenibilidad
Las leguminosas son cultivos claves para
la agricultura
el medio ambiente
la nutricin
la cultura
Las leguminosas y el ciclo del nitrgeno

EL nitrgeno es muy abundante en la Tierra y esencial para la


vida

La mayor parte de los seres vivos no pueden utilizar nitrgeno


directamente de la atmsfera

El nitrgeno atmosfrico debe ser convertido en nitrgeno


disponible (NH4+, NO3- ) (Fijacin biolgica del nitrgeno) por
microorganismos diazotrficos que contienen la enzima
nitrogenasa

Nitrogenasa

N2 + 8 e- + 8 H+ + 16 ATP 2NH4+ + H2 + 16 ADP + 16 Pi


Las legumbres y el ciclo del nitrgeno
SIMBIOSIS RIZOBIOS/LEGUMINOSA

Los rizobios forman ndulos donde fijan el nitrgeno atmosfrico en el amonio asimilable
por la planta para sintetizar protenas y otros componentes vitales para las clulas. A
cambio, la planta proporciona a las bacterias azcares que les aportan la energa necesaria
para fijar el nitrgeno.

Eulogio Bedmar (EEZ-CSIC)


PRINCIPALES COMPUESTOS NITROGENADOS EN EL
XILEMA DE LEGUMINOSAS
LEGUMINOSA COMPUESTO
Arachis ASN, ALN, ALC
Cicer ASN, ALN, ALC
Glycine ALN, ALC
Lens ASN, GLN
Lupinus ASN, GLN
Medicago ASN, GLN
Phaseolus ALN, ALC
Pisum ASN, GLN
Trifolium ASN, GLN
Vicia ALN, ALC
Vigna ASN, GLN
AMIDAS: glutamina (GLN) y asparragina (ASN)
UREIDOS: alantona (ALN) y cido alantoico (ALC)
Eulogio Bedmar (EEZ-CSIC)
SIMBIOSIS RIZOBIO/LEGUMINOSA

Eulogio Bedmar (EEZ-CSIC)


Eulogio Bedmar (EEZ-CSIC)
La co-evolucin de las leguminosas con bacterias endosimbiticas
fijadores de nitrgeno atmosfrico permite la seleccin de pares
planta-bacteria eficientes y aumentar el rendimiento de los cultivos

La relacin rizobio-leguminosa es especfica:


- cada rizobio nodula un nmero de especies de leguminosas
- cada leguminosa nodula con un nmero de rizobios.

Eulogio Bedmar (EEZ-CSIC)


Efecto de la inoculacin en ausencia de nitrgeno combinado

Eulogio Bedmar (EEZ-CSIC)


Nitrgeno fijado por leguminosas
cultivadas

Leguminosa kg N/ha/ao

Trbol 45-670

Alfalfa 90-340

Soja 60-300

Lenteja 50-150

Haba 100-300

Altramuz 140-200

Eulogio Bedmar (EEZ-CSIC)


Importancia de las leguminosas en el medio ambiente
Cantidades significativas de nitrgeno permanecen en el suelo
favoreciendo la rotacin de cultivos (cereales)

Favorece un desarrollo rural sostenible


- Coste econmico y medioambiental de abonos nitrogenados*

Las leguminosas mejoran la estructura del suelo

Capaces de romper ciclos de enfermedades y plagas

Cambio climtico: mayor asimilacin de CO2 cuando el N2 es


fijado simbiticamente

Favorecen la biodiversidad*
El Nitrgeno en la agricultura

Eulogio Bedmar (EEZ-CSIC)


Impacto medioambiental del uso excesivo de fertilizantes
Importancia de las leguminosas en el medio ambiente
Cantidades significativas de nitrgeno permanecen en el suelo
favoreciendo la rotacin de cultivos (cereales)

Favorece un desarrollo rural sostenible


- Coste econmico y medioambiental de abonos nitrogenados*

Las leguminosas mejoran la estructura del suelo

Capaces de romper ciclos de enfermedades y plagas

Cambio climtico: mayor asimilacin de CO2 cuando el N2 es


fijado simbiticamente

Favorecen la biodiversidad*
La biodiversidad como instrumento diferenciador en
la comercializacin de legumbres
Los cultivos extensivos de cereal y leguminosas han
creado un hbitat muy propicio para especies de aves
esteparias ya desaparecidas prcticamente de las grandes
estepas naturales centroeuropeas. Muchas de estas aves,
como es el caso de las avutardas, utilizan de manera
continua y muy selectiva los cultivos de leguminosas,
especialmente alfalfas de secano, por encontrar ah una
fuente importante de protenas. Por su valor nico, buena
parte de estas superficies de cultivo estn declaradas
como Zonas de Especial Proteccin para las Aves dentro
de la Red Natura 2000 promovida por la Unin Europea.

avutarda alcaravn Eduardo de Miguel (Fundacion Global Nature)


Recursos genticos de leguminosas grano en
colecciones espaolas

Luca de la Rosa (CRF-INIA)


Luca de la Rosa (CRF-INIA)
Colecciones de leguminosas grano en instituciones de la Red del PCURF

Luca de la Rosa (CRF-INIA)


Mejora vegetal en leguminosas grano
Con objeto de mejorar la productividad de las variedades de leguminosas-grano actuales, se plantea la
obtencin de variedades mejoradas siguiendo las siguientes estrategias:

Mejora de caracteres adaptativos (fecha de floracin, dehiscencia de las vainas, porte)

Mejora de la resistencia a enfermedades y plagas

Roya (Uromyces), jopo (Orobanche), rabia


(Aschochyta), oidio (Erysiphales), Botrytis,
Fusarium

Diego Rubiales (IAS, CSIC)

Mejora para la resistencia a stress abitico (fro, sequa)

Mejora nutricional mediante la reduccin de compuestos antinutricionales (alcaloides en altramuz,


inhibidores de proteasas en guisante o taninos y vicina/convicina en haba

Otros aspectos de inters (color, sabor)


Tendencia en el cultivo, la produccin y la importacin de
leguminosas grano en Espaa en los ltimos 50 aos

Mayor demanda interna pero menor produccin

Gonzlez & Rubiales, 2016, Arbor (en prensa)


Tendencia en el cultivo de leguminosas grano en Espaa en los
ltimos 50 aos

Gonzlez & Rubiales, 2016, Arbor (en prensa)


Produccin media de legumbres en
Espaa (2009-2014)
Legumbre Produccin (Tm) Principales zonas % produccin UE
Guisante 177.500 Castilla-La Mancha, Castilla-Len 12 %
Habas 32.800 Andaluca 9%
Garbanzo 26.120 Andaluca, Castilla-Len 60 %
Lentejas 22.160 Castilla-La Mancha 80 %
Judas secas 11.160 Castilla-Len, Galicia 8%
Altramuz 3.600 Castilla-Len -
TOTAL 273.340
Fuente: MAGRAMA

Importamos 340.000 Tm
(datos no incluye soja)
Habas de soja: 3.5 Mt
Torta de soja: 2 Mt
El consumo de legumbres en Espaa ha descendido
drsticamente en las ltimas dcadas
10

9 8,76

8
7,37
7
Consumo de legumbres
(kg/habitante/ao)

5 4,38

4
3,20 3,11
3

0
1981 1991 2001 2011 2014

Fuente: Series estadsticas del MAGRAMA


PON LEGUMBRES DE CALIDAD DIFERENCIADA

Co-finaciada: UE, MAGRAMA y COAG

OBJETIVOS DE LA CAMPAA DE LEGUMBRES DE CALIDAD DIFERENCIADA


(Espaa, Francia y Portugal)
CONOCIMIENTO IGP Y DOP LEGUMBRES
FOMENTAR CONSUMO
LEGUMBRES DE CALIDAD DIFERENCIADA

Phaseolus vulgaris Cicer arietinum Lens culinaris


Alubias Garbanzos Lentejas

Figuras de calidad Europeas

DOP IGP

Javier Alonso (IGP Tierra de Campos)


Denominacin de origen protegida (DOP)

La produccin, transformacin y elaboracin del producto deben realizarse en una zona


geogrfica protegida determinada, con unos conocimientos especficos reconocidos y
comprobados. El producto demostrar tener unas caractersticas que slo son posibles gracias
al entorno natural y a las habilidades de los productores de la regin con la que est asociado

Indicacin geogrfica Protegida (IGP)

El vnculo del producto con el medio geogrfico sigue presente en al menos una de las etapas
de produccin, transformacin o elaboracin, llevando este logotipo siempre que renan unas
determinadas condiciones de calidad.

De las 10 figuras de calidad de legumbres que hay en Espaa, 2 son


DOP y 8 son IGP. En ellas, la calidad la proporciona el medio
geogrfico donde se produce. Al ser legumbres secas no influye para
nada el lugar del envasado. Por tanto, no existe diferencia entre ser
una DOP o una IGP. Javier Alonso (IGP Tierra de Campos)
Diez legumbres espaolas de calidad diferenciada
PRODUCCIN DE LEGUMBRES DE CALIDAD DIFERENCIADA

Judas

9 % Produccin nacional

Javier Alonso (IGP Tierra de Campos)


PRODUCCIN DE LEGUMBRES DE CALIDAD DIFERENCIADA
Garbanzo

2.5 % Produccin nacional

Lentejas

7.7 % Produccin nacional Javier Alonso (IGP Tierra de Campos)


Las leguminosas en la nueva PAC

Prcticas agrcolas beneficiosas para el clima y


el medio ambiente (greening): superficie de
inters ecolgico-cultivos fijadores de N2

Ayuda asociada voluntaria aplicada en


Espaa: legumbres de calidad.
Calidad nutricional de las legumbres
Las legumbres como fuente de nutrientes (protenas, vitaminas y minerales)

Sparvoli et al. (2015). En: Grain legumes (AM de Ron, Ed.)

Sustancias bioactivas con efectos beneficiosos en salud (hipocolesterolmicos, CVD,


diabetes, obesidad, salud gastrointestinal)

Mercedes Martn Pedrosa (INIA)


Legumbres y salud
ENFERMEDAD EVIDENCIAS CIENTIFICAS

CARDIOVASCULAR Disminucin de presin sangunea


Reduccin de tejido adiposo
Disminucin de colesterol y TG en sangre

Disminucin riesgo CVD 22%

OBESIDAD Incremento periodo de saciedad


Regulacin hormonas digestivas

SALUD GASTROINTESTINAL Efecto bifidognico


anti-inflammatorio y anti-cancergeno

DIABETES Bajo ndice glicmico


Disminucin resistencia a insulina
LEGUMBRES Y CARBOHIDRATOS

LAS LEGUMBRES PRESENTAN UN INDICE GLICEMICO BAJO,


EFECTO SACIANTE Y BIFIDOGNICO

Mercedes Martn Pedrosa (INIA)

Los niveles de fibra soluble (pectinas, gomas, muclagos) son superiores a los encontrados en
cereales y tubrculos. Resistente al proceso digestivo, escapa a la absorcin intestinal y es
fermentada en intestino grueso. Se forman metabolitos con efectos fisiolgicos a nivel local y/o
sistmico.

La fibra insoluble (celulosa y lignina) sufren una menor fermentacin intestinal, siendo
excretada en heces, regulando el trnsito intestinal.
LEGUMBRES Y PROTENAS

El contenido proteico de legumbres es 2-3 veces superior al de cereales.

Alto contenido en Lys/ bajo en azufrados. Complementario a cereales.

Globulinas 7S de soja y lupino disminuyen los niveles de colesterol y triglicridos.

Menor digestibilidad que las procedentes de protenas animales (estructura,


inhibidores de proteasas).

Lectinas e inhibidores de proteasas, de ser considerados antinutrientes a compuestos


bioactivos.
LEGUMBRES Y SALUD GASTROINTESTINAL
PROTENAS

PLANT PROTEASE INHIBITORS OF THE BOWMAN-BIRK FAMILY

T - Serine protease inhibitors


- Leguminosae, Gramineae
C
- Seeds and vegetative organs
- Low-molecular-weight (6-9 kDa)
- Form stable stoichiometric complexes
- Inhibit digestive proteases
- Double headed (T/T, T/C, T/E)
- 7 disulphide bridges

Protease inhibitor TI1 from pea (Pisum sativum)

Clemente & Domoney (2006) Curr Prot & Pept Sci 7, 201-216
Identification of a TI1/TI2 double null mutant in a pea germplasm collection

A B
GTTTTCCTCTTGAGCTTCGCCGCAAA--------------GTTTTGATTCAACTTCCTTC
ATAACTCAAGTGCTCTCCAATGGTGATGATGTCAAATCAGCATGTTGTGATACCTGCCTT
TGCACAAAATCAAACCCTCCTACCTGTCGCTGTGTTGATGTTGGAGAAACTTGTCACTCA
GCATGCAACAGTTGCATTTGTGCACTATCTTATCCTCCCCAGTGTCAGTG

C
JI262_TI2 MELMNKKAMMKLALMVFLLSFAAKF*---FDSTSFITQVLSNGDDVKSACCDTCLCTKSN 56
TI2_X83210 MELMNKKVMMKLALMVFLLSFAANVVNARFDSTSFITQVLSNGDDVKSACCDTCLCTKSD 60
JI262_TI1 MELMNKKAMMKLALMVFLLSFAAKF*---FDSTSFITQVLSNGDDVKSACCDTCLCTKSN 56
TI1_AJ276900 MELMNKKAMMKLALMVFLLSFAANVVNARFDSTSFITQVLSNGDDVKSACCDTCLCTKSN 60
*******.*************** ******************************:

JI262_TI2 PPTCRCVDVGETCHSACNSCICALSYPPKCQCFDTQKFCYKACHNSELEEVIKN86
TI2_X83210 PPTCRCVDVGETCHSACDSCICALSYPPQCQCFDTHKFCYKACHNSEVEEVIKN 114
JI262_TI1 PPTCRCVDVRETCHSACDSCICAYSNPPKCQCFDTHKFCYKACHNSEVEEVIKN86
TI1_AJ276900 PPTCRCVDVRETCHSACDSCICAYSNPPKCQCFDTHKFCYKACHNSEVEEVIKN 114
********* *******:***** * **:******:***********:******

Clemente et al. (2015) PLoS ONE 10: E0134634


Pea (Pisum sativum L.) seed albumin extracts show anti-inflammatory effect in the DSS
model of mouse colitis

All treated groups showed anti-


inflammatory effect, evidenced by
reduced microscopic histological
damage in comparison to untreated
colitic mice.

The treatments ameliorated the colonic


mRNA expression of different pro-
inflammatory markers.

All treated groups showed an


improvement in the intestinal barrier
function. As a result, restoration of
bacterial populations to values in
healthy mice was observed.

Utrilla et al. (2015). Mol Nutr Food Res 59, 807-819


THE ANTI-PROLIFERATIVE EFFECT OF TI1B, A MAJOR BOWMAN-BIRK ISOINHIBITOR FROM PEA (Pisum sativum L.),
ON HT29 COLON CANCER CELLS ARE MEDIATED THROUGH PROTEASE INHIBITION

HT29 cells
120 d
de

e
100
relative cell growth (% of value with no TI1B)

80 a

60 b

40
c

20

0
15 M 31 M 61 M

rTI1B Inactive rTI1B

IC50 = 31 7 M
Clemente et al., (2012) Br J Nutr 108, S135-S138
Situacin actual del sector: amenazas
Menor produccin nacional/ Mayor importacin/ Precio

Menor consumo (cambio hbitos sociales, estilo de vida)

Desaparicin del pequeo comercio

Mejorar la calidad estandarizada de nuestros productos (color,


tamao, integridad, calidad organolptica)

Evitar fraude en el etiquetado Origen: Canad

Desconexin entre sector productivo y acciones I+D

Resumen mesa conclusiones Foro INIA 2016


Situacin actual del sector: posibles soluciones
Mejora vegetal

Fomentar productos de calidad (IGP, DOP)

Llevar a cabo reuniones y acciones coordinadas (administracin,


agricultores, cooperativas, envasadores, consumidores, divulgadores,
etc.)

Resumen mesa conclusiones Foro INIA 2016


Situacin actual del sector: posibles soluciones

Coordinacin entre sector productivo y acciones I+D

Lograr un mayor reconocimiento social de las legumbres

Fomento del consumo de productos locales

Forman parte de la cocina tradicional espaola. Fomentar


actuaciones en restauracin

Industria agroalimentaria: creacin de productos atractivos ready


to eat como los envasados y alimentos fortificados con legumbres
(snacks, cereales de desayuno), gluten free, colesterol free
Resumen mesa conclusiones Foro INIA 2016