Anda di halaman 1dari 7

Vox Sanguinis (2013)

2013 International Society of Blood Transfusion


ORIGINAL PAPER DOI: 10.1111/vox.12056

Hepatitis E virus in Scottish blood donors


A. Cleland,1 L. Smith,1 C. Crossan,2 O. Blatchford,3 H. R. Dalton,4 L. Scobie2 & J. Petrik1,5
1
Scottish National Blood Transfusion Service, Edinburgh, UK
2
Glasgow Caledonian University, Glasgow, UK
3
Health Protection Scotland, Glasgow, UK
4
Royal Cornwall Hospital Trust and European Centre for Environment and Human Health, University of Exeter, Truro, UK
5
University of Edinburgh, Edinburgh, UK

Background and Objectives Published prevalence figures for hepatitis E virus


(HEV) reveal significant regional differences. Several studies have reported virus
transmission via blood transfusion. The aim of this study was to establish HEV
seroprevalence and investigate a potential HEV RNA presence in Scottish blood
donors.
Materials and Methods IgG and IgM were determined in individual serum sam-
ples. HEV RNA was investigated in plasma mini-pools corresponding to 43 560
individual donations using nested PCR. Samples amenable to reamplification with
primers from a different region were considered confirmed positives, sequenced
and analysed.
Results A total of 73 of 1559 tested individual sera (47%) were IgG positive,
none tested positive for IgM. Plasma mini-pool testing revealed an HEV RNA fre-
quency of 1 in 14 520 donations. Three confirmed positives belonged, as
expected to genotype 3.
Conclusions HEV IgG and RNA figures in Scottish blood donors are lower than
those published for the rest of the UK, but sufficiently high to prompt further
studies on potential transmission rates and effects of HEV infection, especially
Received: 15 March 2013,
revised 7 May 2013,
for immunosuppressed individuals.
accepted 8 May 2013 Key words: blood donors, HEV, NAT testing, serological testing.

of HEV being a zoonosis [1, 2]. Infections caused by


Introduction
the consumption of undercooked pork, and game (wild
Hepatitis E virus (Hepevirus, Hepeviridae) has for a long boar, deer) products are well documented [36]. However,
time been considered a health problem restricted to devel- swine manure may be a source of contamination of irri-
oping countries. In this context, hepatitis E is caused by gation and drinking water, as well as of nearby rivers or
HEV genotypes 1 and 2, is oro-faecally transmitted via shellfish farms. Consumption of contaminated shellfish
infected water in areas with poor sanitation, and results has been implicated in sporadic cases of acute hepatitis
in epidemics involving thousands of cases. An increasing E [7, 8], and HEV RNA has been found in Scottish shell-
number of reports published recently have specified a dif- fish [9].
ferent transmission route in industrialized countries. In A wide variation in seroprevalence figures can be
this setting, autochthonous (locally acquired) cases are found in published HEV seroprevalence studies amongst
caused by HEV genotype 3 (and genotype 4 in Japan and both blood donors and the general population. Some of
China), and the closeness of sequenced porcine HEV and this variation is due to the varying sensitivity of kits used
autochthonous HEV in human cases supports the concept [3, 10], but many differences in seroprevalence between
countries and regions seem genuine, ranging from 18%
Correspondence: Juraj Petrik, Scottish National Blood Transfusion in western Japan and 4% in New Zealand to 32% in
Service, 21 Ellens Glen Road, Edinburgh EH17 7QT, UK China and 525% in south-western France [3, 1116]. In
E-mail: juraj.petrik@nhs.net the UK, seroprevalence figures between 10 and 16% have

1
2 A. Cleland et al.

published for England and Northern Wales [1719]. The sponding to 43 560 individual donations, were tested for
majority of the estimated 60 000 infections a year in HEV by PCR.
England [19] will involve infections in immunocompetent
individuals, which are frequently asymptomatic or cause Serology
a minor, self-limiting illness. However, chronic infections Anti-HEV IgM and IgG antibodies were studied using the
with potentially fatal outcome have been described in im- Wantai Hepatitis E Virus Diagnostic ELISA Kits (Beijing
munocompromized patients such as HIV-infected individ- Wantai Biological Pharmacy Enterprise Ltd) according to
uals [20] or transplant recipients [2124] and represent a the manufacturers instructions. Both the IgM and IgG
growing health concern. In this context, the possibility of assays use recombinant antigens corresponding to the
HEV contaminating donated blood and blood components structural regions of HEV ORF2.
is becoming an important issue, especially after several
reported transfusion-transmitted HEV cases [2528]. A
HEV RNA: screening
small number of studies published to date have shown
that HEV can be detected in donated blood much more To each of the mini-pools, 15 ll of bovine viral diarrhoea
frequently than anticipated, varying between approxi- virus (BVDV) was added as an internal control. It consists
mately 1 in 4500 in Germany to approximately 1 in of the reconstituted lyophilized cell-free BVDV culture
78000 in the UK, Sweden and Japan [2932]. supernatant, prepared at Moredun Research Institute,
Little is known about HEV in Scotland. The objective Edinburgh, as described previously [33]. Nucleic acid
of this study was to establish the anti-HEV IgG seropreva- extraction was carried out on a MagNA Pure LC extractor
lence and frequency of HEV RNA in Scottish blood using the LC total nucleic acid isolation kitLarge Vol-
donors. ume (Roche Diagnostics, Mannheim, Germany) according
to the manufacturers instructions, and eluted in 50 ll.
10 ll of nucleic acid was used to perform cDNA synthesis
Materials and methods using the SuperScript VILO cDNA synthesis kit (Life Tech-
nologies, Carlsbad, CA, USA). 50 pmol of both the HEV
Samples used to estimate HEV seroprevalence
and BVDV antisense primers (HE364, Z5392) (Table 1)
Samples were obtained from the Research Anonymous were added to the final cDNA reaction.
Archive, which consists of aliqouts of serum and periph- A nested PCR was used for the HEV screening assay. In
eral blood mononuclear cells (PBMC) from consented the first round, 10 ll of cDNA was added to 40 lL of mas-
Scottish blood donors. The Research Anonymous Archive termix containing 125 units of Go Taq polymerase (Pro-
is used for epidemiological studies on emerging and new mega, Madison, WI, USA), 02 mM of dNTP mix, 1 lM of
infections potentially threatening the blood supply. The each of the HEV primers (HE361, HE364) [34] and 200 nM
only retained information is age, sex, first (versus repeat) of each of the BVDV primers (Z5390, Z5392) [33]. Ampli-
donor and the first three letters of the postcode. In total, fication was carried out at 94C for 2 min followed by 35
1559 individual donor samples were tested for anti-HEV cycles at 94C for 30 s, 55C for 30 s and 72C for 90 s,
IgM and IgG: 283, 281, 283, 383 and 329, collected in with a final cycle of 72C for 6 min. A second, round of
years 20042008, respectively. amplification was real-time PCR on a 7500 Fast real-time
The preparation of Research Anonymous Archive sam- PCR machine (Life Technologies). 2 ll of primary product
ples involves processing and separation into aliquots of was amplified in a final volume of 20 ll, containing 10 ll
serum and PBMCs, and subsequent storage. To rule out of 29 Taqman Fast Advanced mastermix (Life Techno-
any possible effect of processing and/or long-term storage logies), 900 nM of each HEV primer (HE363, HE366),
on seroprevalence figures, sera from a further 528 donors 450 nM of each BVDV primer (Z5391, Z5395) and 250 nM
from 2012 (which had previously been used in routine of each TaqMan probe (HEV, BVDV). Amplification and
testing for mandatory markers) were studied. detection was performed over 40 cycles of 95C for 3 s
and 62C for 30 s. Serial dilutions of the WHO interna-
tional standard (WHO IS 6329/10; Paul Ehrlich Institute,
Samples tested for HEV by PCR
Langen, Germany) were used as positive control, and pre-
Anonymized, previously tested plasma mini-pools were viously tested negative plasma as a negative control.
studied. Two plasma mini-pools, consisting of 500 ll If a pool was shown to be positive in the initial screen-
aliqouts of 12 donations (used previously for routine ing, the remaining material (120 ll) of the original
nucleic acid testing of HCV, HIV and HBV), were com- 12-member mini-pool was retested as described above,
bined to construct 1 ml 24-member mini-pools (416 ll and if positive, it was subjected to confirmatory testing
from each donation). In total, 1815 mini-pools, corre- and sequencing.

2013 International Society of Blood Transfusion


Vox Sanguinis (2013)
HEV in Scottish blood donors 3

Table 1 PCR primers and probes

Primers Name 53 sequence Orientation References

HEV HE361 gcr gtg gtt tct ggg gtg ac Sense [34]
HE364 ctg ggm ytg gtc dcg cca ag Antisense
HE366X ggg ytg att ctc agc cct tcg c Sense Modified from [34]
HE363X gmy tgg tcd cgc caa ghg gar c Antisense
3156 aay tay gct cag tay cgz gtt g Sense [35]
3157 ccc ttr tcy tgc tgz gcr ttc tc Antisense
3158 gty atg cty tgy atz cay ggz t Sense
TAQ R gtc ggc tcg cca ttg gck gag Antisense This study
BVDV Z5390 cga agg ccg aaa aga ggc tag c Sense [33]
Z5392 ggc ccy ggy ttc agg tag at Antisense
Z5391 cat gcc ctt agt agg act agc a Sense
Z5395 ggc gac ccc cgc tca ggt ta Antisense This study

Probes 5 label Sequence 3 modification

HEV 6FAM cctatattcatccaaccaacc MGBNFQ This study


BVDV VIC aacagtggtgagttcgttggatggctt MGBNFQ This study

the governance of blood and tissue samples for nonthera-


HEV RNA: confirmatory testing, assay sensitivity
peutic use, and donor research (Ref. No10-23).
and sequencing
cDNA synthesis was performed using 10 ll of total
Statistics
nucleic acid used for the screening assay as described
above, except 50pmol of primer 3157 (Table 1) was added Statistical testing was performed with SPSS for Windows,
to each reaction. Primary and secondary PCR amplifica- version 14 using the chi-squared test and chi-squared test
tion was performed using the conditions described above for trend or Fishers exact test, as indicated to compare
for the initial primary PCR. Primers 3156 and 3157 [35] proportions of seropositive samples in different groups
were used for the primary reaction and 3158 [35], TAQR [36]. Confidence intervals were calculated using Confi-
for the secondary reaction, no BVDV primers were added. dence Interval Analysis [37].
Amplified DNA was visualized by agarose-gel electropho-
resis and gel red staining.
Results
Ten fold serial dilutions of the WHO standard (see
above) were used to evaluate the sensitivity of screening A total of 73 of 1559 donations (47%, 95% CI 3658)
and confirmatory PCR assays. The sensitivity of both from the Research Anonymous Archive tested positive for
assays was comparable, with detectable products in anti-HEV IgG, none for anti-HEV IgM. Of the 528 sera
1:10 000 dilution of the WHO standard. Probit analysis from 2012, none was anti-HEV IgM positive, and 30
for the screening assay revealed 95% detection limit of (57%, 95% CI 4080) were anti-HEV IgG positive
201 IU/ML. (Table 2). There was no difference in seroprevalence
Aliqouts of the amplification reactions providing the between these groups of samples (chi-square P = 036).
correct size band were sequenced by Eurofins MWG The annual seroprevalence in the Research Anonymous
Operon (Ebersberg, Germany). Sequence alignment was Archive samples ranged from 39% to 57%; this variation
carried out using Geneious Pro 5.6.2 software. GenBank was not significant (chi-square P = 088, Table 3). Anti-
accession numbers: KC477203-5. HEV IgG seroprevalence in these samples was associated
significantly with increasing age, ranging from 16%
amongst those aged 1524 years, to 98% amongst those
Ethics
older than 55 (chi-square for trend P = 0005). Amongst
Ethical approval for the Anonymous archive of Scottish women, 41 (57%) were anti-HEV IgG positive while 32
donations was granted by the West of Scotland Research men (38%) were IgG positive. This was a nonsignificantly
Ethics Service (10/S0704-0), and its particular use in this (chi-square P = 0069) higher seroprevalence amongst
project and the use of anonymized mini-pools for HEV women, due to an unexpectedly high proportion of sero-
PCR testing were approved by the SNBTS committee for positives amongst women in one age group. Five of 73

2013 International Society of Blood Transfusion


Vox Sanguinis (2013)
4 A. Cleland et al.

Table 2 HEV seroprevalence in blood donors Table 3 HEV seroprevalence in Scottish blood donors

No of IgG sero- Samples


tested prevalence ELISA kit HEV IgG
Country/region samples (%) used References Samples seropositive IgG seropositive
tested (n) (n ) [% (95% CI)]
Scotland 1559 47 Wantai This study
528 57 Wantai This study Total 1559 73 47 (3758)
England 262 10 Wantai [18] Age (years)*
England & Wales 2731a 13 Wantai [19] 1524 245 4 16 (0641)
England & Wales 595 16 Wantai [17] 2534 285 7 25 (1250)
France (North) 1998 32 Genelabs [38] 3544 405 19 47 (3072)
France 512b 166 Genelabs [39] 4554 338 15 44 (2772)
(south-west) 512b 525 Wantai [3] 55 and above 286 28 98 (69138)
Japan 12 600 34 In house [11] Sex
Eastern 56 Female 714 41 57 (4377)
Western 18 Male 845 32 38 (2753)
Japan 22 027a 53 In house [32] Year of donation
Northern 67 2004 283 11 39 (2268)
Southern 32 2005 281 12 43 (2573)
Switzerland 550 49 MP [13] 2006 283 16 57 (3590)
diagnostics 2007 383 19 50 (3276)
Germany 336 59 Mikrogen [14] 2008 329 15 46 (2874)
USA 400 18 In house [15] New/repeat donors
New Zealand 265 4 Wantai [12] New 96 5 52 (22116)
China 44 816 32 Wantai [16] Repeat 1463 68 46 (3759)

a
General population. *P = 00005 (chi-squared test for trend).
b
Identical samples. P = 0069 (chi-squared test).
P = 088 (chi-squared test).
anti-HEV IgG-positive samples were first time donors P = 047 (Fishers exact test).
(52%), not differing significantly from a proportion of
positive samples amongst repeat donors (42%, Fishers findings suggest that the levels of circulating HEV are
exact test P = 047). HEV seroprevalence in Scottish lower in Scotland than in the rest of the UK, and show
blood donors was shown to increase with age, from 18% that HEV seroprevalence can vary considerably within a
in amongst 1524 year olds to 98% in over 55 years country. These data confirm the findings of previous
donors. (Table 3). studies, which show that seroprevalence can vary sub-
Of the 1815 mini-pools tested (corresponding to stantially within countries. For example, in Japan, differ-
43 560 individual donations), 3 contained HEV RNA, as ences in HEV seroprevalence have been described
determined by the testing algorithm described above. This between eastern and western Japan (56 vs. 18%) [11], as
equates to 1 in 14 520 donations being HEV RNA posi- well as between northern and southern Japan (67 vs.
tive. The assay sensitivity was determined as 201 IU/ML 32%) [32]. An almost fivefold difference has been
at 95% detection limit. All three confirmed HEV positives reported between northern France [38] and south-western
were genotype 3 and differed from each other, as well as France [3, 39]. The serology samples used in the current
from the positive control, by several nucleotide changes study originated predominantly from the Edinburgh
(Fig. 1). The BLAST search revealed that most related region in south-east Scotland. The HEV seroprevalence in
sequenced (9798% homology) originated from Scottish other areas of Scotland is unknown; further studies to
patients (GenBank accession numbers JX516034-52). investigate this are planned.
The reasons for such variations in seroprevalence both
between and within developed countries remain unclear.
Discussion
The evidence suggests that in developed countries such as
This study has found an HEV seroprevalence in Scotland Scotland HEV is most frequently a locally acquired por-
of 47%, which is lower than the seroprevalences reported cine zoonosis [40]. Infection via consumption of infected
elsewhere using the same assay. In blood donors from food is thought to be an important route of infection.
south-west England, the seroprevalence was found to be Eating habits, including consumption of uncooked pork
16% [17] and in England and Wales 13% [19]. These and game products, could explain at least a proportion of

2013 International Society of Blood Transfusion


Vox Sanguinis (2013)
HEV in Scottish blood donors 5

Fig. 1 Sequence alignment of HEV-positive samples. Partial genome sequences derived from the HEV capsid protein (orf 2). Sequences of 3 confirmed
positive samples from plasma mini-pools of Scottish blood donors. WHO IS: corresponding sequence from the WHO International standard used as a
positive control for screening assay and for determination of assay sensitivity.

infections, as pig herds are known to have generally very dietary HEV exposures over time. Age-related increase in
high HEV infection rates. HEV was found in 8 of 18 seroprevalence was observed also in Scottish donors.
locally produced sausages in the Toulouse region [3], and Overall 47% seroprevalence is one of lowest results that
a direct link of HEV infections to eating air-dried liver has ever been documented in an adult population using
sausage in south-eastern France has been documented [4]. this assay, suggesting low levels of circulating HEV in
In the UK, 10% of pork sausages were contaminated at Scottish population (see Table 3).
the point of sale [41]. Genotype 3 HEV has also been 6798% of infections with HEV genotypes 3 and 4 are
found in a high proportion of Scottish shellfish, some of thought to be asymptomatic [8, 40]. This makes it possi-
which were harvested from an area adjacent to an out- ble for donors who have an asymptomatic HEV infection
flow pipe from a pig processing plant [9]. to donate blood containing HEV. A five-year screening
Some of these differing results can undoubtedly be programme for HEV RNA in Hokkaido identified 168 pos-
attributed to true geographical variations in seropreva- itives amongst 1 375 000 screened donors (1 in 8185)
lence. However, many of the previously published studies [31]. Samples collected from the general population in
have used anti-HEV IgG assays that have not been vali- Japan and tested in mini-pools yielded 3 RNA-positive
dated to accurately detect distant infection. For example, antibody-negative samples or 1 positive in 7342 individ-
one assay in common usage has been shown to under- ual samples [32]. In England, mini-pool testing identified
estimate the true seroprevalence by a factor of four [10]. 1 in 7000 HEV RNA-positive donations [30], a similar
In contrast, the assay used in the current study has been frequency was described for pools from Sweden (1 in
shown to have a sensitivity of 96% against a bank of 7986), and an even higher frequency was observed in
convalescent sera from PCR proven cases. When applied pools from Germany (1 in 4525) [29]. Using a highly
to a population of blood donors in south-west France, the sensitive assay, Vollmer et al. [14] described HEV RNA
insensitive assay gave a seroprevalence result of 16% presence 1 in 1240 donations. In contrast, 1 in 14 520
[39]. In contrast, when the more sensitive Wantai assay donations was positive in this study. The sensitivity of
was employed on the same samples, the seroprevalence our assay was lower than that of Vollmer et al. [14], but
result was 52% [3]. This indicates that HEV is hyperen- slightly higher than that used by Bayliss et al. [29]. We
demic in south-west France and suggests that much of used relatively strict criteria to consider a sample con-
the previously published data on HEV seroprevalence firmed positive. After being positive in an initial screen-
have significantly underestimated the true seroprevalence. ing, it had to be positive in a split pool, and then
Despite the high levels of circulating HEV in south-west reamplified using a different set of primers, producing a
France, the seroprevalence (determined by the Wantai larger fragment from a different region. The sensitivity of
assay) in children aged 24 years in the same community assays with the two sets of primers was similar, but there
is very low (2%). This may reflect a cumulative effect of is a slight possibility that certain templates would

2013 International Society of Blood Transfusion


Vox Sanguinis (2013)
6 A. Cleland et al.

amplify with the first, but not the second set of primers. [24]. Such patients develop chronic hepatitis often with
Although this was not the case for control samples, we rapidly progressive cirrhosis, with 10% becoming cir-
could not investigate such a possibility for some initially rhotic within 2 years [42]. It is unknown how many im-
positive samples due to the small volumes available. It is munosuppressed individuals have received HEV-
interesting to note that both observed seroprevalence and contaminated blood products, what the clinical conse-
frequency of HEV in mini-pools is lower in Scottish com- quences are and if the course of the disease differs for
pared with English donors, although the relationship parenteral and oro-faecal route of infection. This area
between HEV seroprevalence and viraemia in donors deserves further urgent study, but there are many other
remains to be established. research questions in this field that also deserve timely
The consequences of transfusing blood products that consideration, such as the reasons behind significant
are contaminated with HEV have been poorly docu- prevalence variation and a relation between seropreva-
mented, but are potentially of significant concern. There lence and a chance of blood donation being HEV RNA
have been only a small number of documented cases of positive.
symptomatic cases of HEV transfusion-related hepatitis In summary, we found an anti-HEV seroprevalence in
[2528]. Assuming there is no difference between the nat- Scottish blood donors of 47%. This figure was low com-
ural history of parenterally and oro-faecally HEV-infected pared with other countries and other areas of the UK,
individuals, immunocompetent recipients of HEV-contam- suggesting that the amount of circulating HEV in Scot-
inated blood products are likely to have an asymptomatic land may also be lower than in other communities in the
infection, or a mild self-limiting bout of hepatitis. The developed world. Despite this, 1 in 14 520 blood dona-
exception to this is immunocompetent patients who have tions was found to contain HEV. The clinical conse-
underlying chronic liver disease. Transfusing HEV-con- quences of the use of HEV-contaminated blood products
taminated blood products to such individuals may have require further urgent study, and measures to prevent
serious consequences including a substantial associated HEV transmission to immunosuppressed recipients should
mortality [23, 40]. be considered.
Chronic hepatitis E has been documented with HEV
genotype 3 in the immunocompromized. This includes
Acknowledgements
solid-organ transplant recipients, patients receiving che-
motherapy for haematological malignancy and individu- This work was supported by a grant (ref ETM/32) from
als with HIV infection [2024]. Transfusion of blood and the Chief Scientist Office Scotland (to LS, HD, OB, JP).
use of blood products are common in the immunosup- The authors wish to thank Lisa Jarvis for managing the
pressed. It is difficult to determine precisely what propor- Anonymous archive of Scottish blood donors, Tony Jor-
tion of blood and blood products is administered to dan and Tom Dunsford for help with anonymized routine
immunocompromized patients, but it is thought that in individual serum samples and plasma mini-pools.
the region of 5070% of platelets are destined for these
patient groups. The consequence of HEV infection can be
Source of Funding
severe amongst these patients, and 60% of immunosup-
pressed solid-organ transplant recipients will develop This work was supported by a grant (ref ETM/32) from
chronic HEV infection when exposed to HEV genotype 3 the Chief Scientist Office Scotland (to LS, HD, OB, JP).

hepatitis E virus transmission to 8 Said B, Ijaz S, Kafatos G, et al.: Hepa-


References
humans. J Infect Dis 2010; 202:825 titis E outbreak on cruise ship. Emerg
1 Balayan MS: Epidemiology of hepatitis 834 Infect Dis 2009; 15:17381744
E virus infection. J Viral Hepat 1997; 5 Li TC, Chijiwa K, Sera N, et al.: Hepa- 9 Crossan C, Baker PJ, Craft J, et al.:
4:155165 titis E virus transmission from wild Hepatitis E virus genotype 3 in shell-
2 Meng XJ, Purcell RH, Halbur PG, et al.: boar meat. Emerg Infect Dis 2005; fish, United Kingdom. Emerg Infect Dis
A novel virus in swine is closely related 11:19581960 2012; 18:20852087
to the human hepatitis E virus. Proc Natl 6 Tei S, Kitajima N, Takahashi K, et al.: 10 Bendall R, Ellis V, Ijaz S, et al.: A
Acad Sci USA 1997; 94:98609865 Zoonotic transmission of hepatitis E comparison of two commercially
3 Mansuy JM, Bendall R, Legrand-Abra- virus from deer to human beings. Lan- available anti-HEV IgG kits and re-
vanel F, et al.: Hepatitis E virus anti- cet 2003; 362:371373 evaluation of anti-HEV IgG seropreva-
bodies in blood donors, France. Emerg 7 Cacopardo B, Russo R, Preiser W, et al.: lence data in developed countries. J
Infect Dis 2011; 17:23092312 Acute hepatitis E in Catania (eastern Med Virol 2010; 82:799805
4 Colson P, Borentain P, Queyriaux B, Sicily) 19801994. The role of hepatitis 11 Takeda H, Matsubayashi K, Sakata
et al.: Pig liver sausage as a source of E virus. Infection 1997; 25:313316 H, et al.: A nationwide survey for

2013 International Society of Blood Transfusion


Vox Sanguinis (2013)
HEV in Scottish blood donors 7

prevalence of hepatitis E virus anti- transplant recipient. N Engl J Med 32 Takahashi M, Tamura K, Hoshino Y,
body in qualified blood donors in 2008; 358:859860 et al.: A nationwide survey of hepatitis
Japan. Vox Sang 2010; 99:307313 22 Peron JM, Mansuy JM, Recher C, et al.: E virus infection in the general popu-
12 Dalton HR, Fellows HJ, Gane EJ, et al.: Prolonged hepatitis E in an immuno- lation of Japan. J Med Virol 2010;
Hepatitis E in New Zealand. J Gastro- compromised patient. J Gastroenterol 82:271281
enterol Hepatol 2007; 22:12361240 Hepatol 2006; 21:12231224 33 Cleland A, Nettleton P, Jarvis L, et al.:
13 Kaufmann A, Kenfak-Foguena A, 23 Kamar N, Selves J, Mansuy JM, et al.: Use of bovine viral diarrhoea virus as
Andre C, et al.: Hepatitis E virus sero- Hepatitis E virus and chronic hepatitis an internal control for amplification of
prevalence among blood donors in in organ-transplant recipients. N Engl hepatitis C virus. Vox Sang 1999;
southwest Switzerland. PLoS ONE J Med 2008; 358:811817 76:170174
2011; 6:e21150 24 Kamar N, Garrouste C, Haagsma EB, 34 Inoue J, Takahashi M, Yazaki Y, et al.:
14 Vollmer T, Diekmann J, Johne R, et al.: Factors associated with chronic Development and validation of an
et al.: Novel approach for detection of hepatitis in patients with hepatitis E improved RT-PCR assay with nested
hepatitis E virus infection in German virus infection who have received universal primers for detection of hep-
blood donors. J Clin Microbiol 2012; solid organ transplants. Gastroenterol- atitis E virus strains with significant
50:27082713 ogy 2011; 140:14811489 sequence divergence. J Virol Methods
15 Meng XJ, Wiseman B, Elvinger F, 25 Mitsui T, Tsukamoto Y, Yamazaki C, 2006; 137:325333
et al.: Prevalence of antibodies to hep- et al.: Prevalence of hepatitis E virus 35 Gyarmati P, Mohammed N, Norder H,
atitis E virus in veterinarians working infection among hemodialysis patients et al.: Universal detection of hepatitis E
with swine and in normal blood in Japan: evidence for infection with a virus by two real-time PCR assays: Taq-
donors in the United States and other genotype 3 HEV by blood transfusion. Man and Primer-Probe Energy Transfer.
countries. J Clin Microbiol 2002; J Med Virol 2004; 74:563572 J. Vir Meth 2007; 146:226235
40:117122 26 Boxall E, Herborn A, Kochethu G, 36 SPSS Inc. SPSS for Windows, Version
16 Guo Q-S, Yan Q, Ge S-X, et al.: Preva- et al.: Transfusion-transmitted hepati- 14.0. Chicago, SPSS Inc. Released
lence of hepatitis E virus in Chinese tis E in a nonhyperendemic country. 2005
blood donors. J Clin Microbiol 2010; Transfus Med 2006; 16:7983 37 Altman DG, Machin D, Bryant TN,
48:317318 27 Matsubayashi K, Kang JH, Sakata H, et al.: Statistics with Confidence, 2nd
17 Dalton HR, Stableforth W, Thurairajah et al.: A case of transfusion-transmit- edn. London, BMJ Books, 2000
P, et al.: Autochthonous hepatitis E in ted hepatitis E caused by blood from a 38 Boutrouille A, Bakkali-Kassimi L, Cru-
Southwest England: natural history, donor infected with hepatitis E virus ciere C, et al.: Prevalence of anti-hep-
complications and seasonal variation, via zoonotic food-borne route. Trans- atitis E virus antibodies in French
and hepatitis E virus IgG seropreva- fusion 2008; 48:13681375 blood donors. J Clin Microbiol 2007;
lence in blood donors, the elderly and 28 Haim-Boukobza S, Ferey MP, Vetillard 45:20092010
patients with chronic liver disease. Eur AL, et al.: Transfusion-transmitted 39 Mansuy JM, Legrand-Abravanel F, Ca-
J Gastroenterol Hepatol 2008; 20: hepatitis E in a misleading context of lot JP, et al.: High prevalence of anti-
784790 autoimmunity and drug-induced toxic- hepatitis E virus antibodies in blood
18 Beale MA, Tettmar K, Szypulska R, ity. J Hepatol 2012; 57:13741378 donors from South West France. J Med
et al.: Is there evidence of recent hep- 29 Baylis SA, Koc O, Nick S, et al.: Wide- Virol 2008; 80:289293
atitis E virus infection in English and spread distribution of hepatitis E virus 40 Kamar N, Bendall R, Legrand-Abrava-
North Welsh blood donors? Vox Sang in plasma fractionation pools. Vox nel F, et al.: Hepatitis E. Lancet 2012;
2011; 100:340342 Sang 2012; 102:182183 379:24772488
19 Ijaz S, Vyse AJ, Morgan D, et al.: 30 Ijaz S, Szypulska R, Tettmar KI, 41 Berto A, Martelli F, Grierson S, et al.:
Indigenous hepatitis E virus infection et al.: Detection of hepatitis E virus Hepatitis E virus in pork food chain,
in England: more common than it RNA in plasma mini-pools from United Kingdom, 20092010. Emerg
seems. J Clin Virol 2009; 44:272276 blood donors in England. Vox Sang Infect Dis 2012; 18:13581360
20 Dalton HR, Bendall RP, Keane FE, 2012; 102:272 42 Kamar N, Abravanel F, Selves J, et al.:
et al.: Persistent carriage of hepatitis E 31 Kato T, Matsubayashi K, Sakata H, Influence of immunosuppressive ther-
virus in patients with HIV infection. N et al.: Five-year experience of NAT apy on the natural history of genotype
Engl J Med 2009; 361:10251027 screening for HEV in blood donors in 3 hepatitis-E virus infection after
21 Gerolami R, Moal V, Colson P: Chronic Hokkaido, Japan. Vox Sang 2010; 99 organ transplantation. Transplantation
hepatitis E with cirrhosis in a kidney- (Suppl. 1):72 2010; 89:353360

2013 International Society of Blood Transfusion


Vox Sanguinis (2013)