Anda di halaman 1dari 24

See

discussions, stats, and author profiles for this publication at: http://www.researchgate.net/publication/277952758

INHIBISI REPLIKASI VIRUS RABIES MELALUI


RNA INTERFERENCE (RNAi)

RESEARCH JUNE 2015


DOI: 10.13140/RG.2.1.2289.9368

READS

157

All in-text references underlined in blue are linked to publications on ResearchGate, Available from: Vidya Irawan
letting you access and read them immediately. Retrieved on: 26 October 2015
INHIBISI REPLIKASI VIRUS RABIES MELALUI
RNA INTERFERENCE (RNAi)

Vidya Irawan, DVM, M.Sc

Pendahuluan

Rabies merupakan penyakit zoonosis yang berbahaya dikarenakan dapat


menyebabkan kematian pada hewan dan manusia. Rabies disebabkan oleh virus
rabies yang tergolong dalam famili Rhabdoviridae dan genus Lyssavirus. Virus ini
bersifat neutrotrofik dimana neuron merupakan target seluler utamanya dan
infeksi virus ini bersifat fatal pada hewan berdarah panas (Kristensson et al.,
1996).
Di Indonesia, penyakit rabies dilaporkan pertama kali terjadi pada kuda di
bekasi oleh Schorl tahun1884. Tahun 1889 Esser melaporkan kejadian rabies pada
kerbau. Tahun 1980 Penning melaporkan kasus rabies pada anjing di Tangerang.
Kemudian kasus pada manusia di Cirebon oleh de Haan tahun 1894 (Hadjosworo,
1984). Pada tahun 2000-2004, beberapa provinsi di Indonesia masih dinyatakan
tertular rabies, yaitu Sumatra Utara dan Nanggroe Aceh Darussalam (Balai
Penelitian Penyakit Hewan Wilayah I, 2000), Sumatera Barat, Riau, Jambi (Balai
Penelitian Penyakit Hewan Wilayah II, 2000); Bengkulu, Lampung, dan Sumatera
Selatan (Marfiatiningsih dan Hassan, 2000), Kalimantan Tengah dan Kalimantan
Timur (Hadi et al., 2003), Sulawesi Selatan dan Sulawesi Utara (Faizal et al.,
2004), serta di Bali (Central for Disease Control, 2008).
Prevalensi rabies di Indonesia yang terus meningkat dan bersifat sebagai
re-emerging disease diperlukan perhatian yang lebih baik dari segi penanganan
dan kontrolnya. Kejadian rabies dimana hewan dan manusia terlambat untuk
dilakukan post eksposure vaksinasi ataupun pemberian serum anti rabies dapat
menyebabkan kematian. Hal ini memacu untuk ditemukan antiviral yang dapat
mengatasi kejadian rabies post eksposur yaitu dengan cara menghambat replikasi

1
virus yang tentunya didukung dengan pencegahan apoptosis sel neuronal untuk
mengatasi disfungsi neuronal itu sendiri. Salah satu cara untuk menghambat
replikasi virus adalah dengan teknik RNA interference (RNAi) dimana terjadi
proses ikatan molekul efektor pasangan yang mRNA yang komplemen,
menyebabkan degenerasi gene target atau mencegah translasi sehingga tidak
terjadi sintesis protein.

Virus Rabies

Virus rabies merupakan virus single-stranded RNA negatif, linear,


berukuran 75 x 180 nm, ukuran genome RNA yaitu 11 kb (van del Pol, 2006).
Virus rabies memiliki virion beramplop, berbentuk batang dan memiliki lima
protein yaitu nukleoprotein N (50 kDa) yang menyelubungi RNA yang berbentuk
heliks berfungsi sebagai nukleocapsid dan berasosiasi dengan large protein yaitu
RNA-dependent RNA polymerase L (220 kDa) dan co-faktor phosphoprotein P
(33kDa). Diantara nukleocapsid dan amplop yang berupa membran lipoprotein
terdapat matrix protein M (22 kDa) dan di amplop terdapat glycoprotein G (62
kDa) yang membentuk spike (gambar 1) (Gaudin, 2000; Carter dan Saunders,
2007).

Gambar 1. Komponen virion rabies. Virus berbentuk batang, memiliki amplop,


dengan genome RNA berbentuk simentris heliks, dan memiliki
komponen virion yang mengandung lima protein yaitu nukleoprotein (N),
phosphoprotein (P), large protein (L), matrix protein (M), dan
glycoprotein (G) (Carter dan Saunders, 2007).
2
Tabel 1. Strain pada virus rabies berdasarkan sequence genome (Wunner, 2007).

Patogenesis Rabies

Infeksi rabies dapat terjadi akibat gigitan hewan seperti anjing, kucing,
kelelawar dan lain-lain yang salivanya mengandung virus rabies. Setelah
terinfeksi virus rabies, hewan akan meperlihatkan gejala klinisnya yang dapat
dibagi menjadi tiga stadium, yaitu prodromal, eksitasi, dan paralisis. Pada stadium
prodromal, hewan mulai mencari tempat yang dingin, gelap, menyendiri, refleks
kornea berkurang, pupil melebar, dan hewan terlihat acuh dengan tuannya. Pada
stadium eksitasi, hewan mulai agresif, menyerang hewan lainnya atau manusia
yang dijumpainya, dan hipersalivasi. Pada stadium paralisis, hewan mengalami
kesulitan menelan, sempoyongan, lumpuh,dan akhirnya mati (Sidharta dan
Serosa, 1995).
Melalui gigitan hewan yang terinfeksi rabies, virus memiliki akses untuk
masuk dari saliva ke dalam muskulus ditempat gigitan. Virus akan mengalami
replikasi di sel otot sampai dapat memenuhi konsentrasi yang cukup untuk
mencapai ujung saraf motoris terdekat (Lewis et al., 2000). Protein G pada virus
berikatan dengan reseptor nikotinik asetilkolin, neural cell adhesion molecule
3
(NCAM) reseptor, dan p75 neurotrophin reseptor pada neuromuscular junction
dan menginfeksi sistem nervus (Jackson, 2007). Menurut Etessami et al. (2000)
glycoprotein virus rabies berperan penting dalam infeksi virus ke neuron.
Saat menginfeksi sistem nervus, pergerakan virus terjadi secara ascending
dan descending. Infeksi neuronal secara ascending terjadi saat virus bergerak ke
sistem saraf pusat yaitu menuju medula spinalis kemudian ke otak (Jackson,
2007). Penyebaran virus dari sistem saraf perifer ke sistem saraf pusat melalui
transport akson yang cepat dengan kecepatan 12-100 mm per hari (Tsiang et al.,
1991) melalui ikatan protein P virus rabies dengan transport neuron yang bersifat
retrograde yaitu LC8 Dynein light chain (Raux et al., 2000).

A B

+ -

dynein

Gambar 2. Gambaran transport axonal virus rabies secara retrograde melalui LC8
Dynein di dalam neuron. (A) secara normal transport LC8 Dynein
melalui mikrotubulus berperan mengangkut mitokondria (Cai dan
Sheng, 2009), (B) bentuk Dynein dan bagian LC8 (Hirokawa et al.,
2010) dan (C) transport virus rabies secara retrograde dengan LC8
Dynein (Sodeik, 2000).

Saat virus mencapai sistem limbik di otak, virus mengalami replikasi


secara ekstensif dan menyebabkan timbulnya gejala klinis berupa perilaku yang
ganas. Virus menyebar dari sistem limbik secara descending dari sistem saraf
pusat ke nervus perifer menuju beberapa organ seperti korteks adrenal, pankreas,

4
dan pada sel mukosa glandula saliva. Saat virus telah menyebar dan berreplikasi
di neokorteks menyebabkan terjadi perubahan perilaku menjadi depresi, koma,
dan mati biasanya akibat gangguan respirasi. Dari neokorteks kemudian virus
akan mengalami pergerakan secara descending ke glandula saliva dan bila hewan
yang terkena rabies menggigit manusia atau hewan lain maka manusia atau hewan
tersebut terinfeksi rabies (Murphy et al., 1999)

Gambar 3. Gambaran singkat patogenesis rabies. Anjing yang menderita rabies


dapat menualarkan ke manusia taua hewan lain melalui gigitan (Jackson, 2007).

Gejala klinis yang muncul pada penderita rabies diduga akibat adanya
down-regulasi maupun up-regulasi dari ekpresi protein pada hospes akibat
aktivitas virus rabies di neuron baik bersifat menguntungkan bagi virus maupun
sebagai mekanisme pertahanan dari sel itu sendiri dalam menghadapi virus
(Prosniak et al., 2000). Melalui gambaran patohistologi, infeksi rabies
menyebabkan perivasculer cuff, terdapat inclution bodies, apoptosis maupun

5
degenerasi neuronal (Jackson dan Rossiter, 1997; Theerasurakarn dan Ubol, 1998;
Li et al., 2005).
Tabel 3. Gene CNS hospes yang terinduksi virus rabies (Prosniak et al., 2000).

Siklus Replikasi Virus Rabies

Virion akan berikatan dengan reseptor di permukaan sel dan masuk ke


dalam sel melalui clathrin-mediated secara endositosis. Protein G atau spike pada
virus berperan penting dalam ikatan terhadap reseptor dan fusi pada membran.
Setelah endositosis, nucleocapsid dibebaskan ke sitoplasma melalui fusi antara
membran dan endosom (Finke dan Conzelmann, 2005).

6
Gambar 4. Perlekatan dan masuknya virion rabies ke dalam sel. Virus rabies
masuk ke dalam sel melalui clathrin-mediated secara endositosis, kemudian RNA
yang berasosiasi dengan nukleocapsis, phosphoprotein dan large protein
dibebaskan ke sitoplasma setelah terjadi fusi antara membran virus dan endosom
(Carter dan Saunders, 2007).

Genome virus mulai ditranskripsi setelah RNA yang berasosiasi dengan


nukleocapsis (N), phosphoprotein (P) dan large protein (L) bebas di sitoplasma.
Kompleks RNA-dependent RNA polymerase protein L dan P bergerak pada
template RNA virus rabies strand negatif dari 3 menuju 5 dan mensintesis
molekul RNA baru yaitu mRNAs. Setiap mRNA akan dipoliadedenilasi dengan
poly(A) polymerase dan di capping dengan enzim-enzim yang berasal dari
nukleus sel hospes. Polimerase dan enzim lainnya (tabel 1) akan berasosiasi
dengan protein L dan hanya aktif bila kompleks protein L dan P memiliki rasio
1L:3P (Carter dan Saunders, 2007).

Gambar 5. Organisasi genome dan transkripsi RNA. Genome RNA negatif


ditrasnkripsi menjadi enam RNA strand positif yang terdiri dari satu leader RNA
dan lima mRNAs. Transkriptase merupakan komplek protein L dan P (Carter dan
Saunders, 2007).
7
Tabel 2. aktivitas enzim yang berasosiasi dengan protein L virus rabies (Carter
dan Saunders, 2007).
Enzim Fungsi
RNA-dependent RNA polymerase Transkripsi dan Replikasi RNA
Methyl transferase Capping mRNAs
Guanylyl transferase Capping mRNAs
Poly(A) polymerase Poliadenilasi mRNAs
Kinase Fosforilasi P

Genome dengan strand negatif juga akan direplikasi dengan kompleks


enzim protein L dan P dan tersintesis komplemennya yang berupa RNA positif.
Saat replikasi, enzim berasosiasi dengan template dan memproduksi genome
positif sehingga sel-sel yang terinfeksi dapat terdeteksi sebagai virus strand
positif. Inisisasi sintesis RNA ini tidak memerlukan primer. RNA positif yang
baru disintesis akan secara cepat terselubungi oleh protein N sehingga diproteksi
dari aktivitas ribonuklease, berbeda dengan mRNA yang tidak terselubungi
dengan protein N. Kemudian akan direplikasi lagi sehingga terbentuk template
RNA negatif. Beberapa kopi RNA negatif ini akan digunakan sebagai template
untuk transkripsi tahap kedua (Carter dan Saunders, 2007).

Gambar 6. Replikasi genome dan transkripsi tahap kedua (Carter dan Saunders,
2007).
8
Protein virus akan ditranslasi di ribosom bebas kecuali protein G yang
ditranslasi di retikulum endoplasma kasar. Protein P dan G akan mengalami
modifikasi post-translasi. Protein P akan mengalami fosforilasi oleh aktivitas
enzim kinase dan protein G akan mengalami penambahan monosakarida dan
menjadi komplit di kompleks golgi (Carter dan Saunders, 2007).

Gambar 7. Translasi dan modifikasi protein post translasi. Hasil translasi berupa
protein N, P,M, L, dan G. Pada protein P dan G terjadi modifikasi Carter dan
Saunders, 2007).

Genome RNA strand negatif yang disintesis akan langsung diselubungi


oleh protein N. RNA dengan protein N dan telah memiliki kompleks protein L
dan P akan mendapat menambahan protein M dan menyelubungi nucleocapsid.
Perlekatan protein M pada protein membran sel hospes berperan penting dalam
proses keluarnya virion dari membran plasma sel. Bagian tempat virion menempel
dan akan keluar juga telah mengalami modifikasi dengan adanya penyisipan
protein G di membran sel (Carter dan Saunders, 2007).

Gambar 8. Perakitan virus rabies yang terdiri dari genome hasil replikasi berupa ss
RNA (-) dan protein N, P,L dengan diselubungi protein M dan saat keluar

9
medapatkan amplop dari lipoprotein membran serta protein G yang telah
terekpresi di permukaan membran sel (Carter dan Saunders, 2007).

Gambar 9. Gambaran singkat proses masuk, replikasi dan keluarnya virus rabies
di dalam neuron dan bergerak secara retrograde dari perifer ke sistem syaraf pusat
(van den Pol, 2006).

RNA Interference (RNAi)

RNA interference merupakan suatu mekanisme yang terjadi secara alami


dan normal di dalam tubuh yang berhubungan terhadap suatu proses proteksi
secara genomik dengan menghambat sintesis suatu protein. Mekanisme ini
dikenal dengan post-transcriptional gene silencing dan dikembangkan menjadi
suatu metode terapi gene yang potensial, selain itu juga digunakan untuk
mempelajari fungsi dan regulasi gene (David et al., 2010).

10
RNAi pathway

Jalur RNAi berlokasi di sitoplasma sel dan dapat dibagi menjadi 2 tahap
yaitu: tahap inisiasi (pembentukan molekul efektor) dan tahap subsequence
efektor (mekanisme RNAi yang sebenarnya). Molekul efektor pada RNAi terbagi
menjadi 2 grup yaitu small interfering RNA (siRNA) yang terdiri dari 21-23
segmen nukleotida dsRNA dengan 3 nukleotida yang overhang, dan micro RNA
(miRNA) yang terdiri dari 22 segmen nukleotida dsRNA (Bartel, 2004; Meister
dan Tuschl, 2004; Tang, 2005; Aiger, 2007; Lu dan Woodle, 2008)
Pembentukan siRNA dimulai disitoplasma yang membelah menjadi
dsRNA yang panjang oleh Dicer (multidomain enzim dari family RNase III).
Sedangkan pembentukan miRNA dimulai di nucleus dimana secara endogenous
dikode primer transkripsi awal miRNA (pre-miRNA) yang kemudian ditransport
ke sitoplasma dan dipecah oleh Dicer. Pada tahap efektor, siRNA atau miRNA
akan dirakit menjadi RNA-inducing silencing complexes (RICS). Aktivasi RICS
mengandung satu single-standed (antisense) siRNA atau miRNA, yang memacu
RISC ke mRNA target yang komplemen dengannya dan menginduksi pembelahan
pada sisi spesifik pada mRNA. Sedangkan miRNA tidak menyebabkan degradasi
pada gene komplemennya namun menyebabkan translation repression. Namun
baik siRNA mauapun miRNA menghambat sintesis protein (Bartel, 2004; Meister
dan Tuschl, 2004; Tang, 2005; Aiger, 2007; Lu dan Woodle, 2008)
Tabel 3. Perbedaan antara siRNA dan miRNA (Love et al., 2008).

11
Gambar 10. Biosynthetic pathway short hairpinRNA dan microRNA. Dalam proses ini
dibantu oleh enzim seperti Drosha (RNAseIII family), Exportin 5Ran-GTP, dan Dicer
(RNAseIII family). miRNA dan shRNA ditrankripsi di nucleus. miRNA diproduksi dari
pri-pre-miRNA dan diproses oleh RNaseIII Drosha menjadi pre-miRNA. Kemudian pre-
miRNA mapun shRNA akan diekpor ke luar menuju sitoplasma melalui pori nucleus
melalui kompleks exportin 5-Ran-GTP. Setelah bebas ke sitoplasma, akan diproses lagi
oleh RNase III lain yaitu Dicer. Dicer menyebabkan terbaginya bentukan double stranded
menjadi single dalam bentuk miRNA atau siRNA. Kemudian miRNA atau siRNA yang
berikatan dengan sequencenya sebagai RNA-inducing silencing complexes (RICS)
(Pekarik, 2005).

Gambar 11. Endogenous dan exogenous RNAi. Endogeous diperankan oleh pri- miRNA
yang disintesis genome pol II yang akhirnya menjadi miRNA, sedangkan eksogenous
oleh shRNAmiR atau shRNA yang diintesis pol II arau pol III, yang mimic dengan pri-
miRNA dan pre-miRNA yang akhirnya menjadi siRNA. Keduanya bersifat silencing (Lee
dan Kumar, 2009).
12
Gambar 12. Cara kerja RNAi sebagai silencing. (A) siRNA yang awalnya double
stranded (ds) akan menjadi single stranded (ss) dan menempel pada komplemennya dan
menyebabkan mRNA yang ditembelin terpecah sehingga sinteisis protein tidak terjadi.
siRNA memiliki kemampuan endonucleolytic cleavage. (B) miRNA juga bersifat
silencing dengan berikatan pada mRNA yang komplemen sehingga tidak dapat ditranslasi
dan tidak terjadi sintesis protein (Love et al., 2008).

Strategi untuk aplikasi RNAi

Terdapat beberapa cara untuk aplikasi RNAi yaitu (1) tranfeksi RNAi ke
sel, dan RNAi yang ditranfeksi diharapkan akan menjadi RISC yang dapat
mendegradasi mRNA target, (2) melalui vektor plasmid, pada nukleus
diharapkan terjadi trankripsi shRNA atau pre-miRNA dan akan diproses dan
diekpor ke sitoplasma menjadi RISC, (3) dengan vektor viral DNA (Davidson
dan Paulson, 2004).

Gambar 13. Strategi aplikasi RNAi melalui tranfeksi ke sel, vektor plamid, dan vektor
viral (Davidson dan Paulson, 2004).

13
Dalam sistem aplikasi RNAi baik melalui siRNA maupun miRNA
terdapat faktor-faktor yang harus diperhatikan yaitu dari ukuran RNAi, ukuran
vektor, vektor yang digunakan, cara aplikasi, sistem proteksi agar siRNA yang
dibawa tidak di degradasi, eliminasi, distribusi yang tidak spesifik, serta
internalisasi (David et al., 2010).

Gambar 14. Gambaran umum aplikasi RNAi melalui vektor virus yang
dimasukkan secara intra parentral melalui darah menuju ke organ target, virus
mengalami internalisasi, ditrankripsi siRNA di inti, ditranfer ke sitoplama,
kemudian menjdai RISC yang komplemen dengan mRNA targetnya, sehingga
terjadi silencing (David et al., 2010).

Penghambatan replikasi virus rabies dengan RNAi

Penghambatan replikasi virus rabies dengan RNAi merupakan suatu


strategi terapi yang sangat potensial terutama akibat kegagalan tindakan vaksinasi
rabies post ekposure. Namun dengan otak sebagai targetnya, faktor seperti blood
barrier brain (BBB) harus diperhatikan. Aplikasi dsRNA tidak dapat melewati
BBB, sehingga dikembangkan metode baru dengan artificial miRNA (amiRNA)
yang ukurannya lebih kecil (Israsena et al., 2009).

14
Gambar 15. Gambaran ideal aplikasi RNAi dengan organ target otak. Melalui miRNA
diharapkan dapat menghambat sintesis suatu protein dari mRNA (Boudreaua dan
Davidson, 2010).

Penghambatan Replikasi melalui artificial miRNA secara in vitro


Protein N merupakan protein yang penting dalam melindungi genome
virus saat replikasi agar tidak didegradasi oleh RNase. Dengan menghambat
sintesis protein N diharapkan replikasi dapat terhambat. Oleh karena itu, mRNA
protein N dapat meruapakan target yang potensial dapat aplikasi artificial miRNA.
Berikut adalah metode penelitian tentang penghambatan replikasi
virus rabies melalui artificial miRNA secara invitro oleh Israsena et al.
(2009). Dengan metode ini masih terus dapat dikembangkan misalnya dengan
pemilihan vektor yang tepat yang sesuai bagi hospes dan mampu menembus BBB
melalui penelitian secara in vivo.

Materi dan metode (oleh Israsena et al., 2009)


1. Sel dan virus
Sel yang digunakan untuk kultur yaitu sel Neuro2A (ATCC cat no. CCL-
131), dengan media HyQ MEM/EBSS (Hyclone) yang ditambahkan 10% fetal
bovine serum, 2mM L-glutamine, 1,5 g/l NaHCO3, 1 Mm Sodium Pyruvate, 1 x
Non-Essential Amino acid (NEAA), 100 U penicillin/ ml, dan 100 g
strptomycin/ml , yang diinkubasi pada suhu 37C, 5% CO2.

15
Virus rabies yang digunakan adalah RV challenge virus strandard (CVS)-
11, HEP flurry GFP fixed strain, dan street virus. Tissue Culture Infeksi Dose 50
(TICID50) yaitu 105, dalam penelitian digunakan 10 atau 100 TCID50.

2. Plasmid
Sequence gene target virus rabies dapat didesain menggunakan miRNA
design algorithm (http://rnaidesigner.invitrogen.com/rnaiexpress/).

Gambar 16. desain miRNA virus rabies. Lokasi artificial miRNA yang akan berasosiasi
dengan mRNA virus yang akan dikode (Israsena et al., 2009).

Komplementari ssDNA oligo yang mengkode pre-miRNA disintesis,


anneling, dan diklon menjadi pcDNA6.2-GW/EmGFP-miR (Invitrogen). Pol II
miR RNAi diekpresikan oleh vektor yang mengandung spesifik miR-155 flanking
sequence. Agar menghasilkan rantai miRNA dalam satu transkripsi awal, miRNA
cassettes dari plasmid donor dieksisi dengan enzim restriksi, BamH1 dan Xho1.

Gambar 17. Gigram skema tentang strategi kloning untuk kombinasi miRNA cassettes
menjadi satu pre-miRNA transkripsi (Israsena et al., 2009).
16
3. Transfeksi miRNA dengan plasmid ekpresi
Sebelum ditranfeksi, kultur Neuro2A ditumbuhkan selama 24 jam.
Kemudian baru ditranfer miRNA plasmid. Plasmid DNAs dicampurkan dengan
lipofectamine 2000 (Invitrogen) dengan rasio 1:1 (1l lipofectamine 2000 per 1g
DNA) dalam opti-MEM medium (Invitrogen). Campuran ini dirambahkan ke
dalam kultur Neuro2A (plated 1 x 105 sel per sumuran dalam 24 sumuran plate).

4. Viral challenges assay


12 jam setelah transfeksi, 10 atau 100 TCID50 dari stok virus ditambahkan
ke sel pada tiap sumuran. Perubahan pada media terlihat 6 jam inkubasi pada
37C. RNA diisolasi 24, 48, dan 72 jam setelah ditantang dengan virus.

5. Isolasi RNA
Total RNA diisolasi dari sel setelah 24, 48, dan 72 jam setelah infeksi
dengan menggunakan RNeasy mini kit (Qiagen). Supernatan kultur di panen
setelah 48 jam, dan RNA dari cairan supernatan dipurifikasi menggunakan
QIAamp viral RNA mini kit (Qiagen) berdasarkan petunjuk manufaktur.

6. Kuantifikasi genome virus dan trankrip


a. RT
Reverse transkripsi dilakukan menggunakan M-MLV reverse transcriptase
(Promega) dengan 4l dari toral RNA yang diisolasi dari sel/ supernatan yang
diinfeksi (20ng/l). Oligo dT digunakan sebagai primer RT untuk deteksi mRNA.
Primer RT yang digunakan untuk deteksi genome viral yaitu
5-AGAAGGATCGTGGAGCACCATACTCTCA-3'

b. Real-time PCR
4l cDNA ditambahkan ke dalam 10l QuantiTect SYBR green PCR
master mix (Qiagen), 0.5 l dari 20M forward primer, 0.5l dari 20 M reverse
primer, 5l RNase-free water. Profil thermal cycling yang digunakan yaitu 95C 1

17
menit, diikuti 40 siklus amplisikasi (95C 15 menit, 55C 20 detik, dan 72C
selama 30 detik). Untuk CVS gene N digunakan forward primer
5CTGGCAGACGACGGAACC-3 dan reverse primer 5-
CATGATTCGAGTATAGACAGCC-3. Untuk HEP-flurry gene N digunakan
forward primer 5-CTGGCAGATGACGGAACT -3 dan dan reverse primer 5-
CATGATTCGAGTATAGAC-AGCT-3. Untuk deteksi genome viral digunakan
forward primer 5-AGAAGGATCGTGGAGCACCATACTCTCA-3 dan reverse
primer 5-TACCAGCCCTGAACAGTCTTCA-3.

7. Kuantifikasi mature miRNA


a. Stem-loop RT-PCR
5l sampel RNA (2ng/l) dicampurkan dengan 7l RT master mix dari
Taq man Micro RNA Reverse Transcription kit (ABI) (1.5l 10 x RT buffer, 0.15
l 100 mM dNTPs, 0.19l dari 20U/l RNase Inhibitor, 1.0 l dari 50U/l
Multiscribe RT enzyme, 4.16 l RNase-free water), 3l spesifik loop-RT primer
(N1: CGACTCATGCTGACGAATTTTGAGTCGCAAA) ditambahkan ke
campuran. Reaksi RT dibiarkan pada suhu 16C 30 menit kemudian 42C 30
menit sebelum inkubasi terminal pada suhu 85C selama 15 menit.
5l cDNA dari reaksi PCR dicampurkan dengan 4.0l LightCycler
Taqman master mix (Roche), 0.4l dari 10M forward primer, 0.4 l dari 10M
reverse primer, o0.2l dari 10M Pprobe, 10l RNase-free water. Sequence dari
PCR primer dan probe adalah NP1 forward primer: CCGCCCTACATCATCCG,
NP2 forward primer: CCCCTAAAGATGCATGTTCAG,
reverse primer: GCGACTCATGCTGACGAA, NP1 probe 6FAM-
TTTGAG+TCGCAAAC+T+TGATCC-BBQ, NP2 probe: 6FAM-
TTTGAG+TCGCG+TC+TCTG-BBQ. Thermal cycling PCR yaitu 95C 5 detik,
55C 5 detik, dan 60C 5 detik.

18
8. Immunoflourescence
Untuk melihat keberadaan protein N virus rabies dapat dilakukan dengan
pewarnaan imunoflourescence menggunakan antibodi terhadap protein N virus
rabies yang telah dilabel dengan FITC (hijau). 48 jam setelah diinfeksi, sel
difiksasi dengan 80% acetone dan diwarnai dengan FITC-labeled virus rabies N
protein-spesifik antibodi.

Berdasarkan hasil penelitian Israsena et al. (2009) terlihat penurunan


jumlah genome virus dan mRNA protein N virus rabies secara spesifik pada sel
kultur yang ditranfeksi dengan miRNA (dengan vektor plasmid) dan ditantang
dengan virus rabies.
A B

Diagram 1. (A) level mRNA dari protein N virus rabies. Terlihat penurunan level mRNA
protein N pada sel yang ditransfeksi artificial miRNA (amirRNA) dibanding kontrol
(postitif rabies, tanpa amiRNA). (B) level genome virus. Terlihat Terlihat penurunan
level genome virus rabies pada sel yang ditransfeksi artificial miRNA dibanding kontrol
(postitif rabies, tanpa amiRNA) (Israsena et al., 2009).

Gambar 18. Hasil imunofluoresecence dengan antibodi terhadap protein N virus


rabies. (A) kontrol positif (postitif rabies, tanpa amiRNA), terlihat ekpresi protein
dengan intensitas yang tinggi. (B) sel yang ditransfeksi artificial miRNA (amirRNA), bila
dibanding kontrol, ekpresi protein N lemah atau tidak ada. Hal ini menunjukkan ekpresi
protein N pada rabies dapat dihambat oleh amiRNA. (Israsena et al., 2009).

19
Kesimpulan

Replikasi virus rabies dapat dihambat melalui pengembangan RNA


interference melalui artificial microRNA (amiRNA) terhadap protein N virus
rabies secara in vitro. Melalui dasar penelitian ini dapat dikembangkan lagi dalam
hal pemilihan vektor yang baik yang dapat diterima host secara baik, ramah
lingkungan (vektor yang digunakan tidak mengkontaminasi lingkungan akibat
eksresi maupun sekresi hospes) dan mampu menembus blood brain barrier untuk
menghambat replikasi virus rabies di otak secara in vivo. Selain itu dapat
dikembangkan dengan penggunaan strain virus rabies lapangan yang ada di
Indonesia.

Daftar Pustaka

Aigner A. 2007. Applications Of Rna Interference: Current State And Prospects


For Sirna-Based Strategies In Vivo. Appl Microbiol Biotechnol, 76:921.

Bartel, D.P., 2004.Micrornas: Genomics, Biogenesis, Mechanism, And Function.


Cell. 116:28197.

Boudreaua, R.L., dan Davidson, B.L., 2010. Rnai Therapeutics For CNS
Disorders . Brain research. 1338:112-121

Balai Penelitian Penyakit Hewan Wilayah I. 2000. Hasil pemeriksaan


laboratorium penyakit rabies Propinsi Sumatera Utara dan DI Aceh. Bulletin
Veteriner BPPH Wilayah I Medan 2: 1-4.

Balai Penelitian Penyakit Hewan Wilayah II. 2000. Program kerja surveilens,
monitoring, investigasi pelayanan aktif dan diagnosa penyakit hewan.
Bulletin Informasi Kesehatan Hewan. BPPH Wilayah II Bukit Tinggi 2(59):
1-5.

Cai, Q., dan Sheng Z-H., 2009. Mitochondrial Transport And Docking In Axons.
Experimental Neurology 218 (2009) 257267.

20
Carter, J.B., dan Saunders, V.A. 2007. Rhabdoviruses (and other minus-strand
RNA viruses) dalam Virology Principles and Applications. John Wiley and
Sons. England.

Central for Disease Control, 2008. Outbreak Notice, Rabies in Bali, Indonesia
This information is current as of today, December 27, 2010
http://wwwnc.cdc.gov/travel/content/outbreak-notice/rabies-bali-indonesia

DePaula, D., Bentley Mv, Mahato Ri. 2007. Hydrophobization And


Bioconjugation For Enhanced Sirna Delivery And Targeting. RNA, 13:431
56.

Davidson, B.L., dan Paulson, H.L., 2004. Molecular Medicine For The Brain:
Silencing Of Disease Genes With Rna Interference. Lancet Neurol , 3: 145
149

David, S., Pitard, B., Benot, J-P., Passirani, C., 2010. Non-Viral Nanosystems
For Systemic Sirna Delivery. Pharmacological Research. 62: 100114

Etessami, R., Conzelmann, K.K., Fadai-Ghotbi, B., Natelson, B., Tsiang, H.,
Ceccalsi, P.E. 2000. Spread and pathogenic characteristics of a G-deficient
rabies virus recombinant: an in vitro and in vivo study. J Gen Viirol.
81:2147-2153

Faizal, M., K. Benyamin, dan S. Ratna. 2004. Survei dan monitoring rabies di
Sulawesi Selatan dan Sulawesi Utara. Diag. Vet. Bulletin Informasi
Kesehatan Hewan dan Kesehatan Masyarakat Veteriner BPPH Regional VII
Maros 2 (1): 1 6.

Finke, S., dan Conzelmann, K-K., 2005. Replication strategies of rabies virus.
Virus Research 111 (2005) 120131

Gaudin, Y., 2000. Reversibility in fusion protein conformational changes. The


intriguing case of rhabdovirus-induced membrane fusion. Subcell. Biochem.
34, 379408.

Hadi, S. , D.M.N. Dharma, A. Supriyadi, dan J.S. Kalianda. 2003. Pengkajian


ulang pembebasan Kalimantan dari rabies. Dilavet. BPPV Regional V
Banjarbaru 13(2): 9-22.

Hardjosworo, S. 1984. Epidemiologi rabies di Indonesia. Kumpulan Makalah


Symposium Nasional Rabies. Persatuan Dokter Hewan Indonesia Cabang
Bali, Denpasar. hlm. 13-28.

21
Hirokawa,N., Niwa,S., dan Tanaka1, Y., 2010. Molecular Motors In Neurons:
Transport Mechanisms And Roles In Brain Function, Development, And
Disease Neuron 68: 610-638

Jackson, A.C., Rossiter, J.P., 1997. Apoptosis plays an important role in


experimental rabies virus infection. J. Virol. 71, 56035607.

Jackson, A., 2007. Pathogenesis, dalam Rabies, second edition. Edited by Alan
C. Jackson and William H. Wunner. Elsevier Inc.

Kristensson, K., Dastur, D.K., Manghani, D.K., Tsiang, H., dan Bentivoglio, M.
1996. Rabies: interactions between neurons and viruses. A review of the
history of negri inclusion bodies. Neuropathol. Appl. Neurobiol. 22:179-187

Lee, S-K., Dan Kumar, P., 2009. Conditional Rnai: Towards A Silent Gene
Therapy. Advanced Drug Delivery Reviews. 61:650664

Love, T.M., Moffett, H.F., Dan Novine, C.D., 2008. Not Mir-Ly Small Rnas: Big
Potential For Micrornas In Therapy. J Allergy Clin Immunol. 121( 2 ): 309-
319

Lu, PY., dan Woodle, MC., 2008. Delivering Small Interfering Rna For Novel
Therapeutics. Methods Mol Biol. 437:93107.

Li, X-Q., Sarmento, L., dan Fu, Z.F., 2005. Degeneration of neuronal processes
after infection with pathogenic, but not attenuated, rabies viruses. Journal of
virology. 79(15): 10063-10068.

Lewis,P., Fu,Y., Lentz T.L.,2000. Rabies Virus Entry At The Neuromuscular


Junction In NerveMuscle Cocultures. Mucle and Nerve. John Wiley &
Sons, Inc.

Murphy, F.A., Gibbs, E.P.J., Horzinek, M.C., Studdert, M.J. 1999. Veterinary
Virology 3rd eds. Academic Press. USA.

Marfiatiningsih, S. dan Z. Hassan. 2000. Tinjauan epidemiologi kasus rabies di


wilayah pelayanan BPPH III Tanjung Karang. Bulletin Laboratorium
Veteriner BPPH Wilayah III Tanjung Karang XV(1): 1-15.

Meister, G., dan Tuschl T., 2004. Mechanisms Of Gene Silencing By Double-
Stranded Rna. Nature. 431:3439.

Prosniak, M., Hooper, D.C., Dietzschold, B., dan Hoprowski, H., 2000. Effect of
rabies virus infection on gene expresiion in mouse. PNAS. 98(5): 2758-
2763.
22
Pekarik, V, 2005. Design Of Shrnas For RnaiA Lesson From Pre-Mirna
Processing: Possible Clinical Applications. Brain Research Bulletin 68:115
120

Raux, H., Flamand, A., Blondel, D., 2000. Interaction of the rabies virus P protein
with the LC8 dynein light chain. J. Virol. 74, 1021210216.

Sodeik, B., 2000. Mechanisms Of Viral Transport In The Cytoplasm. Trends In


Microbiology. 8(10):465-472

Sidharta, T., dan Sarosa, A. 1995. Petunjuk Teknis Penyakit Hewan. Balai
Penelitian Bogor. hlm. 126-131.

Tang G. Sirna dan Mirna, 2005, An Insight Into RICSs. Trends Biochem Sci.
30:10614.

Tsiang, H., Ceccaldi, P.E., dan Lycke, E. 1991. Rabies virus infection and
transport in human sensory dorsal root ganglia neuron. J Gen Virol.
61:1191-1194.

Theerasurakarn, S., dan Ubol, S., 1998. Apoptosis induction in brain during the
fixed strain of rabies virus infection correlates with onset and secerity
illness. Journal of Neurovirology, 4:407-414.

van den Pol, A.N., 2006. Viral infections in the developing and mature brain.
Trends in neurosciences. 29(7):398-406

Wunner, W.H., 2007. Rabies Virus, dalam Rabies, second edition. Edited by Alan
C. Jackson and William H. Wunner. Elsevier Inc.

23