Anda di halaman 1dari 268

UNIVERSIDAD CENTRAL DEL ECUADOR

FACULTAD DE CIENCIAS MDICAS

Laboratorio d e
HISTOLJOGIR

Dr. J o r g e W. Bez Pacheco Md.MSc.


Quito - E c u a d o r
UNIVERSIDAD CENTRAL D E L ECUADOR
F A C U L T A D D E C I E N C I A S MDICAS
CARRERA D E MEDICINA
CTEDRA D E HISTOLOGA

^ km--

2014^2015
A U T O R : Dr. J O R G E W A S H I N G T O N B A E Z P A C H E C O M D , M C S .

fn^ziOH. tida^ de. la ctedm- de Mlstoaga


II ^
LABORATORIO DE HISTOLOGA ^

UNIVERSIDAD CENTRAL DEL ECUADOR ^


FACULTAD DE CIENCIAS MDICAS ^
ESCUELA DE MEDICINA Y DE TECNOLOGA MDICA
CTEDRA DE HISTOLOGA ^

C. Jorge Washington Bez Pacheco \


Laboratorio de Histologa ISBN- 9978 - 41 - 147 - X
Registro Nacional de Derechos de Autor: en trmite ^
Depsito legal: en trmite
Derechos reservados. Prohibida la reproduccin total o parcial de esta obra por cualquier procedimiento, ya sea grfico, ^
electrnico, ptico, mecnico, fotocopia y el almacenamiento o transmisin de sus contenidos en soportes magnticos, ^
sonoros, visuales o de cualquier otro tipo, sin el permiso previo y por escrito del autor. Quien sea partcipe o colaborador a
la difusin ilegal de esta obra, ser sometido a penas impuestas en los artculos correspondientes del Cdigo Penal -.^
Ecuatoriano y la Ley de Derechos de Autor.

Primera edicin: Diciembre de 1998


Derechos reservados conforme a la ley
C. Jorge Washington Bez Pacheco

Pedidos al autor: Puembo, calle Santiago 563, Telf: 2390 237 ^


2390 096 ^
Celular 099 0800615

\^
III

PRLOGO A ESTA EDICIN

En 1996 inicie la escritura de una gua de "Laboratorio de Histologa, la primera


edicin solo tena indicaciones de los procesos a seguir en las clases prcticas,
pero entend que era mejor acompaar con breves explicaciones tericas la
prctica. Con el pasar del tiempo los apuntes iniciales se fueron convirtiendo en
una obra cada vez ms extensa y apegada ms a un libro que a una gua es por ello
que en cada nueva edicin, y en cada semestre se ha pulido paulatinamente este
libro, esperando llene las necesidades de mis estudiantes, para y por quienes he
dejado mi juventud pero muy feliz de haberlo hecho. Espero que esta obra les
sirva para poner las bases en el conocimiento biolgico e histolgico, hay mucho
camino por recorrer, muchas cosas para aprender, investigar, descubrir y as
entender la vida. Solo conociendo los procesos vitales en extensin y profundidad
y muchas otras cosas relacionadas a ella, se podr prevenir, curar y defender la
vida.

El Estado, la Universidad y todos los que hacemos la Facultad de Ciencias


Mdicas, profesores y alumnos, estamos dedicados a mejorar la educacin y el
aprendizaje, a alcanzar la excelencia, a seguir siendo referentes para otras
instituciones del pas. Pero esto no se logra con palabras lricas, con declaraciones
demaggicas. Los estudiantes deben COMPRENDER Y EMPODERARSE que
para adquirir conocimientos es necesario elaborar el suyo propio con inmenso
sacrificio, esfuerzo, dedicacin, lecturas extraordinarias etc. Solo se aprende lo
que se hace, lo que se experimenta. Por ello, el maestro ahora solo es un gua, un
tutor que ayuda y es responsabilidad de cada uno de vosotros contribuir hacia ese
xito

En la presente edicin he incorporado en cada uno de los captulos imgenes,


microfotografas, relatos tericos de la Histologa, divida bsicamente en un
captulo introductorio con Tcnicas Histolgicas, concepto. La Qumica de la vida
y la relacin con la estructura histolgica, el estudio de La Clula como elemento
primordial en el conocimiento de esta materia, los tejidos bsicos: epitelial,
conectivo, nervioso y muscular y por ltimo la descripcin de rganos y aparatos
del organismo humano.

M i deseo para que los pupilos a travs de estos consejos vayan formndose para
alcanzar una noble profesin como es la de ser mdico. No solo debe estudiar en
este libro, deben complementar con lecturas de muchos autores y probablemente
su esfuerzo se ver premiado, porque al comprender mejor estos mecanismos de
vida la puedan defender, prevenir, y curar.

Atentamente

El autor.
Octubre del 2014
IV

LABORA TORIO DE HISTOLOGA

Dedicatoria

A mis hijos, Juan Carlos, Jorge Gustavo y Jos Luis.

Que conocen del esfuerzo que se necesita en la realizacin de este libro,

que sirva como una gua y ejemplo de dedicacin, que emulen y me

superen.

Incluyo en esta dedicatoria a mis nietos Juan Sebastin, Jorge Nicols,

Melissa Isabella, Adrin Rafael y Jos Daniel.


1

UNIVERSIDAD C E N T R A L D E L E C U A D O R

F A C U L T A D D E CIENCIAS MDICAS
CTEDRA D E HISTOLOGA.

Autor: Dr. Jorge Washington Bez Pacheco.

CAPITULO I
ESTUDIO D E L A HISTOLOGA Y G E N E R A L I D A D E S
1.1. H I S T O L O G A

La H i s t o l o g a e s u n a c i e n c i a y r a m a d e las c i e n c i a s b i o l g i c a s Los histlogos prestan cada da mayor atencin a los problemas


q u e s e e n c a r g a d e l e s t u d i o d e los tejidos q u e c o n s t i t u y e n qumicos. As por ejemplo, cunde entre ellos la aspiracin a determi-
parte del organismo vivo. nar con exactitud la composicin qumica de determinadas estructu-
Si l o s tejidos d e s c r i t o s s o n v e g e t a l e s s e l l a m a H I S T O L O G A ras de la masa viva, al estudiar las enzimas, iones, protenas, hidratos
V E G E T A L . Si el e s t u d i o es d e tejidos a n i m a l e s s e llama H I S - de carbono, grasas y lipoides, fermentos, etc. en las clulas y en los
T O L O G A A N I M A L O C O M P A R A D A . P e r o si el e s t u d i o s e teiidos con el auxilio del microscopio. (Tomado del concepto de
realiza d e tejidos h u m a n o s s e llama H I S T O L O G A H U M A N A . histologa del internet Wikipedia)

E T I M O L G I C A M E N T E : Histologa viene del griego H I S T O S =


tejido y L O G O S = tratado, conocimiento o estudio.
T E J I D O S D E L ORGANISMO HUMANO
P o r ello H i s t o l o g a e s el e s t u d i o d e l o s t e j i d o s q u e c o n s t i t u -
y e n los o r g a n i s m o s v i v o s . S e le c o n s i d e r a a Bichat Mane
S o n c u a t r o t i p o s d e t e j i d o s b s i c o s , a t e n d i e n d o al o r i g e n
Francois Xavier, a n a t o m i s t a y f i s i l o g o f r a n c s c o m o el p a d r e
e m b r i o n a r i o , la m o r f o l o g a y la f u n c i n d e c a d a u n o d e ellos y
d e la H i s t o l o g a , s i n e m b a r g o d e q u e l d e s c r i b i m s d e 2 0
son:
t i p o s d e t e j i d o s y s i n el auxilio d e l m i c r o s c o p i o . O t r o c i e n t f i c o
> T e j i d o epitelial
i m p o r t a n t e c o n s i d e r a d o c o m o f u n d a d o r d e la H i s t o l o g a e s :
> Tejido conectivo
hAarcello Malphigio, Embrilogo y Microscopista alumno de
> Tejido muscular
Borelli, q u i e n utiliz el m i c r o s c o p i o para el e s t u d i o d e la
> Tejido nervioso
a n a t o m a a n i m a l y v e g e t a l , d e s c u b r i e n t r e o t r a s c o s a s los
c a p i l a r e s s a n g u n e o s , q u e h a b a n s i d o intuidos p o r H a r v e y ,
T e j i d o epitelial, tejido c o n e c t i v o o c o n j u n t i v o , tejido n e r v i o s o
p e r o q u e n o los h a b a p o d i d o d e m o s t r a r .
y tejido m u s c u l a r . C u a l q u i e r o t r o t i p o d e t e j i d o c o n o c i d o , s e
i n c l u y e d e n t r o d e e s t o s c u a t r o m e n c i o n a d o s , c o m o el tejido
La histologa (del griego toxc: hists "tejido" y -).oya -logia, a d i p o s o q u e e s u n tejido c o n e c t i v o , o el tejido s a n g u n e o u
tratado, estudio, ciencia) es la ciencia que estudia todo lo relacionado seo etc.
con los tejidos orgnicos: su estructura microscpica, su desarrollo y
sus funciones. La histologa se identifica a veces con lo que se ha El c a m p o d e e s t u d i o d e la H i s t o l o g a o los c a p t u l o s q u e e n
llamado anatoma microscpica, pues su estudio no se detiene en los ella s e e s t u d i a n s o n :
tejidos, sino que va ms all, observando tambin las clulas inte-
riormente y otros corpsculos, relacionndose con la bioqumica y la 1. Citologa o estudio d e las clulas
citologa. 2. Tcnicas histolgicas: c o m o tipos de corte y preparacin,
c o l o r a c i o n e s etc.
3. H i s t o l o g a o e s t u d i o d e los tejidos p r o p i a m e n t e d i -
Las primeras investigaciones histolgicas fueron posibles a partir del
chos.(epitelial, conectivo o conjuntivo, muscular y nervio-
ao 1600, cuando se incorpor el microscopio a los estudios anat-
so).
micos. Marcello Malpighi es el fundador de la histologa y su nombre
4. Organografa o estudio d e los rganos, aparatos y siste-
an est ligado a varias estructuras histolgicas. En 166S se descubre
m a s d e los o r g a n i s m o s v i v o s .
la existencia de unidades pequeas dentro de los tejidos y reciben la
5. Embriologa o estudio del desarrollo embrionario de cada
denominacin de clulas. En 1830, acompaando a las mejoras que
u n a d e l a s e s t r u c t u r a s , e s t u d i a d a s m e j o r e n la m a t e r i a d e
se introducen en la microscopa ptica, se logra distinguir el ncleo
Embriologa.
celular. En 1838 se introduce el concepto de la teora celular.
De este ltimo prrafo podremos decir q u e :

En los aos siguientes, Virchow introduce el concepto de que toda Histologa: es el estudio de las clulas, de los tejidos, de
clula se origina de otra clula (omanis cclliila ex celluid). los rganos, de los aparatos y sistemas, desde el punto de
vista: embriolgico, morfolgico, fisiolgico y bioqumico, a
travs del microscopio comn o de luz ylo microscopio
E! desarrollo tecnolgico moderno de las herramientas de investiga- electrnico, con la ayuda de tcnicas histolgicas como son:
cin permiti un enorme avance en el conocimiento histolgico. tipos de corte, coloraciones, inmunocitotcnicas, inmufluores-
Entre ellos podemos citar a la microscopa electrnica, la inmunohis- cencia, crofractura, radioautografia, etc.
toquimica, la tcnica de hibridacin in situ. Las tcnicas recientes
sumado a las nuevas investigaciones dieron paso al surgimiento de la
A n l i s i s d e l c o n c e p t o d e Histologa
biologa celular. Con la
Estudia D e s d e el p u n - A travs del
to d e v i s t a ayuda de
La histologa jams haba tenido la importancia en el plan de estudios Clulas Embrionario Microscopio Tcnicas
de medicina y biologa que ha alcanzado hoy da. La histologa es el Tejidos Morfolgico c o m n o de luz histolgicas
estudio de la estructura microscpica del material biolgico y de la rganos Fisiolgico Microscopio Ej.: T c n i c a s
foniia en que se relacionan tanto estmctural y funcionalmente los Aparatos i Bioqumico electrnico de colora-
distintos componentes individuales. Es crucial para la medicina y Sistemas cin, Inmuno
para la biologa porque se encuentra en las intersecciones entre la citoqumica,
bioqumica, la biologa molecular y la fisiologa por un lado y los criofractura
procesos patolgicos y sus consecuencias por el otro. etc.
C u a d r o 1.1. C o n c e p t o d e H i s t o l o g a
2

La histologa estudia la El apoyo a travs de Tcnicas Histolgicas es fundamental


en el estudio de esta ciencia. El desarrollo de la Histologa se
Clula: es la unidad estructural o anatmica, y funcional de hizo confonne se fueron descubriendo varios mtodos de
todo ser vivo. Todos los seres vivos tienen o estn compues- estudio como el descubrimiento y desarrollo de coloraciones,
tos de una o muchas clulas. Si no tiene clulas no es orga- o a travs de la Inmuno citoqumica o Inmunofluorescencia
nismo vivo. Por esta razn los virus no son considerados directa e indirecta, o el de la criofractura, o del simple hecho
enteramente como seres vivos, aunque cumplen con algunas de encontrar la forma de realizar cortes delgados que nos
caractersticas de los seres vivos. permitieron observar los tejidos, el aparecimiento del micrto-
mo permiti que los tejidos se hagan visibles al ojo humano a
Tejido: es un conjunto de clulas que pueden ser de igual tipo travs del microscopio. Cuando se invent el microscopio
o naturaleza, aunque podran ser morfolgicamente distintas, electrnico en 1932 no fue posible el uso en Histologa sino
pero que cumplen una misma funcin dentro de un organismo hasta los aos de 1950 en que aparece el ultra micrtomo que
vivo. En los animales incluidos el hombre solo hablamos de permitieron realizar cortes finsimos de apenas 80 nanme-
cuatro tipos de tejidos bsicos; epiteliales, conectivos, muscu- tros.
lares y nerviosos.
La Histologa es una ciencia bsica para iniciar la carrera
rgano: es un conjunto de tejidos de diferente origen y es- de mdico o de carreras afines a la medicina. Si usted,
tructura, que cumplen una misma funcin. Ejemplo: la lengua quiere tener amplio conocimiento cientfico y no tener
es un rgano que pertenece al aparato digestivo y tiene: tejido vacos, d a esta rama bsica toda la importancia en su
epitelial, conectivo, muscular y nervioso preparacin y estudio.

Aparato: es un conjunto de rganos que cumplen una misma En el estudio de la Histologa, es necesario el uso del micros-
funcin. Ejemplo el aparato digestivo fonnado por: boca, copio, sin el cual, esta ciencia no se hubiera desarrollado. El
laringe, esfago, estmago, intestino delgado e intestino Invento del microscopio de luz en 1590 y del microscopio
grueso. electrnico en 1932 marca dos hitos importantes en el cono-
cimiento biolgico. Sin el invento del microscopio de luz, no
Sistema: es tambin un conjunto de rganos que cumplen sera posible hablar de clulas, y si no se inventaba el micros-
una misma funcin, pero el tejido que se halla constituyendo el copio electrnico probablemente no estuviramos hablando
sistema es uno solo, de igual morfologa y origen embriolgico del genoma humano o de la ingeniera gentica. La Histologa
por eso el nico sistema verdadero del organismo es el Sis- actualmente se relacin ntimamente con la Biologa Molecular
tema Nervioso, ya que est formado solo de tejido nervioso y
no tiene tejido conectivo, ni muscular, ni tampoco epitelial. Sin 1.2. E L MICROSCOPIO
embargo en algunas ocasiones se describen algunos sistemas
del organismo, como: el sistema linftico, sistema osteomus- Concepto:
cular, sistema endocrino, etc. descritos desde el punto de vista El microscopio es un aparato ptico mecnico, que permite
fisiolgico ms que histolgico. observar estructuras pequeas que no se pueden ver a simple
vista con el ojo humano, lyicroscopio viene del griego "micro"
La denominacin de SISTEMA se hace en algunas ocasiones = pequeo, y "scopein" = observar.
en base a un denominador comn como es el caso del siste-
ma inmunolgico, donde el denominador comn son los linfo- Con el concepto etimolgico; microscopio es todo aparato
citos. ptico que permite observar estnjcturas pequeas, que son
difciles de ser observadas o miradas con el ojo, a simple
Desde el punto de vista: vista.
Como la mayor parte de las clulas y de sus estructuras estn
Morfolgico: o anatmico, es una descripcin como la geo- fuera del poder de resolucin del rgano visual, se necesita de
grfica, de la estructura de los organismos vivos, pero apoya- un aparto que nos permita escudriar, y este es el fin del
do con el microscopio, por esta razn, muchos autores llama- microscopio. La accin del microscopio est dado por una
ron a la Histologa, micro anatoma, pero no debemos tomar combinacin entre el poder de amplificacin y aumento en el
esta palabra como concepto de Histologa porque el campo de poder de resolucin. La amplificacin es el aumento aparen-
estudio no es una simple descripcin de la estructura micros- te del tamao de las estructuras, sin que necesariamente
cpica de los tejidos y/u rganos. aumenten los detalles, el aumento del poder de resolucin
"Considere a la microanatomia como una parte del estudio de no solo que aumenta el tamao de las cosas, sino que aumen-
la Histologa". ta los detalles, pennite visualizar estructuras que antes no
eran bien definidas, Al amplificar una imagen con aumento del
Fisiolgico: Es el estudio de la funcin o del trabajo que poder de resolucin se observarn las cosas con ms detalle,
realizan las clulas, los tejidos, los rganos, los aparatos, y los cada vez menor superficie, pero con ms detalles. Intentemos
sistemas del organismo, relacionados estrechamente con la comprender con el siguiente ejemplo; un Astronauta que
microestructura. Por esta razn el campo de estudio de la regresa del espacio hacia la tierra podra mirar en principio
Histologa, no solo, est relacionado con los departamentos toda la Amrica, al irse acercando solo ver el ecuador, luego
de Anatoma, sino que pueden estar en los departamentos de la provincia de Pichincha, luego Quito y por ltimo una casa
Fisiologa. en un barrio y podr distinguir claramente un habitante de esa
casa, al principio no lo vea luego pudo reconocer al individuo
Bioqumico: El uso de coloraciones especiales, nos permiten de ese inmueble que era usted. Al ir acercndose el Astronau-
distinguir la morfologa de las clulas, tejidos, rganos, etc. y ta puede distinguir mejor las cosas.
tambin podemos deducir la composicin qumica. Ya sean
estas; protenas, lpidos o grasas, carbohidratos y cidos El microscopio compuesto fue inventado por Zacaras y Fran-
nucleicos. cisco Janssen en 1590, al combinar dos lentes convexos en
un tubo opaco. Al principio no se entenda el uso que podra
Embriolgico: Es el estudio del desarrollo del organismo darse al invento y por ello es 20 aos ms tarde que se em-
humano desde la fecundacin hasta el nacimiento. pieza a ver estnjcturas biolgicas, se descubre la presencia
de clulas (se origina la teora celular; Todo ser vivo est
formado por una o ms clulas, las clulas son unidades
3

estructurales, funcionales, de todo ser vivo. "Por otro lado se


determina que las clulas se dividen y son capaces de decir Los microscopios fotnicos son aquellos que usan la luz solar
que toda clula proviene de otra clula. (Teora celular) o la luz producida por una batera o turbina, de ah que los
microscopios comunes que se usan en el laboratorio se los
Hitos en el conocimiento biolgico denomina microscopios fotnicos o de luz o a electricidad.
a) antes del invento del microscopio compuesto a) Microscopio simple es el fonnado por una sola lente. La
b) despus del invento del microscopio compuesto lupa es un microscopio simple, igual consideracin a una
c) despus del invento del microscopio electrnico lente de anteojos.

b) Microscopio compuesto es el que utiliza ms de una


Tipos de microscopios. Existen varios tipos de microscopios lente y pueden ser de varios tipos o categoras:
fotnicos: simples y compuestos. Y Microscopios electrnicos.

TIPOS DE MICROSCOPIOS PTICOS COMPUESTOS


1 .Microscopio fotnico de espejo 6. Microscopio de Polarizacin
2. Microscopio fotnico o comn (lmpara) 7. Microscopio de Interferencia
3. Microscopio de contraste de fase 8. Microscopio Estereoscpico
4. Microscopio de Fluorescencia 9. Microscopio de diseccin
5. Microscopio de fondo claro y oscuro

Tarea: Describa brevemente cada tipo y busque otros tipos de microscopio

Cuadro No1.2. Tipos de Microscopios

MiCliCSC10NOCU,AK

KNOCUJUHII

MCRSSCfflPIO TOWilOPARA EKIUSOH


- CftWWI*

LBUESOSJETTv'OS

rmm.
Dli. COK. ..._,

TOIiHll.10 tWCROHeTRKO

TWtSSTBIOOFUBfflE
tUWNOS*

Fig. 1.1. Microscopio compuesto con fuente luminosa de


lmpara de tungsteno y alimentacin de corriente
MICROSCOPIO FOTNICO O MICROSCO-
PIO PTICO O MICROSCOPIO DE LUZ O Unidades de medida utilizadas en microscopa.

MICROSCOPIO A ELECTRICIDAD La unidad de longitud es el metro (m), y este tiene mlti-


plos y submltiplos. Como las clulas son estructuras muy
Es un aparato ptico mecnico, que usa como fuente de pequeas, las unidades a mencionar son los submltiplos:
luz, las radiaciones de los espectros solares visibles y no
visibles. Es decir, aquellas luces que tienen una longitud Subunidad Smbolo Valoren Valor logart-
de onda que va desde el ultravioleta hasta el infrarrojo. metros mico
(380 nm violeta, a 780 nm rojo.)
Decmetro Dm 0.1 m ' 1 X 10-' m
Investigue las longitudes de onda diferentes de la luz Centmetro cm. 0.01 m 1 X lO'"^ m
blanca, al descomponerse en los diferentes colores. Milmetro Mm 0.001 m 1 X lO"' m

Los microscopios fotnicos u pticos son los ms comu-


nes, y es el microscopio que usaremos en el laboratorio.
Micrmetro \m 1 O.O000D1 m 1xl6-"m
Nanmetro Nm 0.000000001 1 x10'm
Microscopio compuesto: m

Cuadro No 1.4. Unidades de medida


A diferencia de la lupa que se considera como un micros-
copio simple, el microscopio compuesto es aquel que tiene
Las unidades ms utilizadas en citologa e histologa son
dos sistemas de lentes que forman el tubo ptico.
el micrmetro y el nanmetro
Unas lentes se denominan objetivos (por estar cerca o en
IMULTIPLOS DEL IMETRO
contacto con el objeto a observar), y otra u otras lentes
son el ocular o los oculares (por estar cerca del ojo del Yottmetro Ym 1 x 10-^"
observador). En un microscopio las lentes oculares son un Zeftmetro Zm 1 X 10'*''
conjunto de lentes, igual ocurre con las lentes objetivos. Exmetro Em 1 X O"
Petmetro Pm 1 X10"
Poder de resolucin. Termetro Tm 1 X 10'-^
Gigmetro Gm 1x10"
El poder de resolucin del microscopio fotnico es de Megmetro Mm 1 x10
aproximadamente 0.2 nm (micrmetros). Mirimetro Mam 1x10'
Kilmetro Km 1 xIO-*
Se llama "poder de resolucin" a la capacidad que tiene
Hectmetro , Hm Ixltf*
el ojo humano, o de ste a travs de un aparato ptico
como el microscopio, de poder distinguir perfectamente Decmetro Dm 1 x10'
la separacin mnima entre dos puntos.
SUBMULTIPLOS DEL METRO
Y se calcula con la siguiente frmula: Decmetro
KSSSBKKM Cm 1 X10'^
0.61/1
BII'MiitaiTBBWi (jm 1 x 10"^
nsen a Nm 1x10"^
A 1 X10
Pm 1x10"
En donde: Fm 1 X 10-'" 1
^ = lmite de resolucin Am 1 X 10""
X = longitud de onda de la luz incidente Zm 1 X 10-^' 1
= ndice de refraccin del medio Ym 1x10"^"
a = ngulo del cono luminoso que penetra en el objetivo.
Recuerde que existen otros sistemas de medidas,
El ojo humano en condiciones normales es capaz de ver muchas de ellas van cayendo en desuso, ejemplo: la
objetos que tengan una dimensin de 0,25 mm, es decir la YARDA, la VARA, los CODOS. Etc.
cuarta parte del milmetro.
Coja una regla graduada en centmetros y milmetros, El Angstrom A que corresponde a la dcima parte del
notar con claridad la separacin de las rayas entre un nanmetro es una medida que ya no se usa dentro del
milmetro y otro, pero mentalmente concientice que usted sistema mtrico decimal. La palabra miera no es co-
puede observar un objeto o una imagen que tenga hasta rrecta, lo correcto es micrmetro.
la cuarta parte del milmetro. Entienda que al mirar la
cuarta parte lo observar como un minsculo punto Analicemos la palabra miera vs micrmetro, verdad
que cuando se mencionan los submltiplos del metro
Poder de resolu- Del ojo humano 0.25 mm no se dice: deci, centi, mili, etc. Si no que se mencio-
cin nan como decmetro, centmetro, milmetro y conti-
Miaoscopio 0.2 un nuando la serie se debe decir micrmetro, nanmetro,
comn picmetro etc.
Microscopio 0.2 nm (alto
electrnico voltaje) Ntese que el angstrom es una medida que rompe el
1 nm (de sistema mtrico decimal
transmisin)
3 a 5 nm (de
barrido)
Cuadro 1.3. Poder de resolucin
5

Tamao de las clulas: e) Tornillo de desplazamiento del condensador o ac-


cionador del condensador, moviliza el porta conden-
La mayor parte de las clulas que pueblan la tierra se sadores.
mide en jxm (micrmetros), que es la milsima parte del f) Tornillo de desplazamiento del portaobjetos sujeto a
milmetro o 1 x 10'^ mm. O la millonsima parte del metro la platina, compuesto de un carro que transporta el
o 1 X 10"^m portaobjetos en movimientos horizontales o de dere-
Algunas clulas miden varios centmetros como los hue- cha a izquierda o viceversa y de adelante hacia
vos de las aves o de los reptiles (los huevos son clulas, atrs o de atrs hacia delante, con lmites de movi-
verdaderamente clulas). miento de 26 mm x 76 mm.
Otras clulas pueden ser muy grandes como el caso de la
acetabularia que mide entre 18 y 23 cm. de longitud, o II. Fuente luminosa.
inclusive alcanzar el tamao de hasta casi un metro, se la
confundi inicialmente con una alga y se la encontr en A.La fuente luminosa fijamente incorporada al pie del
los mares del Japn. Existen muchas variedades de ace- microscopio, est fonnada por:
tabularias como son la acetabularia acetbulum, acetabu-
laria caliculus, acetabularia crenulata del golfo de Mxico, a) Enchufe a la fuente elctrica, regulable a 110 V, 127
acetabularia mediterrnea en el mar mediterrneo. Etc. V, 220 V 240 Voltios. Generalmente el funciona-
Se describe a las acetabularias como algas verdes unice- miento se realiza en 110 Voltios.
lulares gigantes, marinas, con una forma de paraguas, se b) Fusible (No es de operacin, ni de control del
los describi en los aos de 1930, descubierta por alumno, pero debe conocer su existencia)
Joachim Hameriing. c) Transformador de la fuente luminosa, incorporado en
O como la neurona que puede alcanzar el metro de longi- el pie del microscopio.
tud. Pero en este caso no quiere decir que la neurona sea d) Lmpara de halgeno con filamento de Tungsteno.
visible a simple vista, pues el espesor del cuerpo o del e) Regulador de la tensin para trabajo de la lmpara
axn es en micrmetros y por lo tanto invisible al ojo en 3 6 voltios, el mismo que debe estar en la ten-
humano a simple vista. sin ms baja o en la mitad de la regulacin. La m-
xima regulacin debe ser usada en caso de contras-
Las clulas medidas en micrmetros son: te de fase, microscopio de campo oscuro o en mi-
crofotografa.
a) L a s bacterias que miden entre dcimas de micrmetro f) Colector esfrico.
y pocos micrmetros. (0,1 pm a 10 pm) g) Diafragma de campo luminoso con anillo moleteado.
b) L a s clulas sanguneas entre 4 micrmetros y 20 h) Espejo desviador con un par de placas cua con dos
micrmetros (plaquetas 4 micrmetros, glbulo rojo 7,2 anillos muleteados regulables entre s, de la que la
micrmetros, monocito 20 micrmetros, Etc.). superior se comporta como cojinete filtrante.
c) L o s hepatocitos miden entre 20 y 30 micrmetros. d) i) Fuente luminosa o fuente de energa elctrica. (Ge-
Los adipocitos o clulas grasas 20, 30, 50 y hasta 200 neralmente 110 voltios).
micrmetros.
e) L a s clulas musculares lisas entre 5, 20, 50, o Inclusi-
ve 250 a 500 micrmetros, esta ltima medida en el caso B. Condensador compuesto de:
de mujeres con tero grvido o en embarazo.
a) Porta condensador con el tornillo para desplazar este
La razn por la que la mayor parte de las clulas en nues- trompo hacia arriba o hacia abajo, lo que permite que el
tro planeta se midan en micrmetros, es porque al ser de cono de luz incida en diferente ngulo sobre la lente obje-
mayor tamao no tendran la misma capacidad para obte- tivo.
ner nutrientes y O2. Ya se explicar mas adelante sobre b) Lente de campo grande, intercalable.
Las teoras que explican por qu una clula entra en c) Diafragma de apertura
divisin por mitosis y se mantiene relativamente peque- d) Porta filtros.
as.
111 Parte ptica.
P A R T E S CONSTITUTIVAS DE UN MICROSCOPIO
FOTNICO, COMN, O MICROSCOPIO PTICO. Compuesto del tubo ptico con la presencia de dos lentes
o dos sistemas de lentes que forman el Ocular y el objeti-
El microscopio que usaremos, ser el Microscopio Labo- vo.
val 3 Cari Zeiss Jena que es un microscopio binocular. O
los ltimos microscopios adjudicados a la ctedra de A. El ocular: denominado as por estar cerca del ojo del
Histologa de marca MULTEC ME-400 A los que segn observador. Tiene varios tipos de amplificacin: 5 X, 10 X,
los fabricantes han sido diseados para exmenes clni- 15 X. Generalmente la lente ms usada es el de 10 X. De
cos, enseanza en laboratorios y en escuelas o colegios acuerdo con el nmero de oculares, el microscopio puede
de medicina. ser monocular o binocular.

Bsicamente los microscopios estn fomiados de tres B. E l Objetivo: denominado as porque la lente se encuentra
partes: a) Parte mecnica b) fuente luminosa y c) Tubo cerca o en contacto con el objeto de observacin del
ptico microscopio. Se encuentra dispuesto en un sistema de
revolver, que permite hacer el intercambio de lente para
I. Parte mecnica: Fonnada por: diferentes usos y amplificaciones.
Generalmente son de dos tipos:
a) El estativo formado por el pie y del porta tubos
b) Brazo del microscopio I. Lentes de Observacin normal o ms frecuente.
c) Platina con carro para desplazamiento del portaobje- a) Lentes panormicos o con aumentos que van entre 3.2
tos, descrito en el punto f. X, 4 X, o 5 X
d) Tornillo macromtrico y micromtrico o un solo Los microscopios Laboval 3 Cari Zeiss con 3.2 X y los
tornillo de enfoque de precisin, que tiene un mar- Multec ME 400 con 4.0 X
gen de desplazamiento de 0.1 pm (100 micrme- b) Lentes de Observacin media o lentes con 10 X, o 20 X
tros) de aproximadamente media vuelta del botn de c) Lentes de Observacin amplificada como el de 40 X.
pin y cremallera. El valor de la divisin de la gra- d) Lentes de inmersin
duacin es de 2 micrmetros. (2pm) Lente de 100 X
6

MICROSCOPIO ELECTRNICO
Granulos secreto-
Microscopio electrnico: Es un aparato que permite rios
aumentar las imgenes en aproximadamente 1'000.000
de veces, frente al aumento posible del microscopio co- Membrana
mn entre 1.000 y 1400 veces. celular

Pero el aumento real en imgenes de las micrografas de


estructuras biolgicas apenas si llega a 30.000 veces o en
el mejor de los casos a 200.000X a 300.000X, esto se
debe a que conjuntamente con el aumento del poder de
resolucin es necesario implementar otras tcnicas como
el que las muestras sean ms delgadas, o que se logre
inventar la fomna de observar las estructuras con colora-
ciones, recuerde que las observaciones al microscopio
electrnico son solo en blanco y negro
Figura No 1. 2. Micrografa electrnica de una clula
El funcionamiento del microscopio electrnico en esencia acinar del pncreas
es similar al microscopio comn, difiere que en vez de
fotones del microscopio de luz, utiliza emisin de rayos de
electrones con una longitud de onda de 0,005 nm, los
haces d electrones son captados por bobinas electromag- El microscopio electrnico fue inventado por los cientficos
nticas que son captados en una pantalla fluorescente y rusos Dr. Max Knoll y Ernst Ruska en 1932 (exactamente
se observan las imgenes en forma indirecta. publicaron los resultados el 10 de Septiembre de 1931.
Ruska es verdaderamente el inventor del microscopio
Tomada una imagen fotogrfica (en este caso llamada electrnico y recibe el premio nobel de Fsica por su inven-
micrografa) y plasmada en un libro es como estar obser- to, en 1986)
vando al microscopio electrnico.

TIPOS DE MICROSCOPIO ELECTRNICO

1. De transmisin (MET)
2. Microscopio electrnico de alto voltaje.
3. Microscopio electrnico de barrido.
4. Microscopio de transmisin y barrido
5. combinados.
6. Microanalizador de sonda de electrones.
7. Microscopio de fuerza atmica. Etc.

Figuras No 1.3 y 1.4 Microscopio electrnico inventado por


E Ruska y microscopio moderno
7

Cuadro 1.5 HISTORIA DE EVENTOS DE BIOLOGIA Y CITOLOGIA RELACIONADOS CON EL DESCUBRIMIENTO DEL
MICROSCOPIO.

1590 Z. Y H.Janssen Combinan dos lentes convexos en un tubo opaco y fabrican el


primer microscopio.
1610 Gatlleo Galile Utiliza e! telescopio, el microscopio y el tentimetro
1665 Roberto Hooke Describe las celdas o clulas vista en corcho
1667 A- Van Leeuwenhoek Observa espermatozoides humanos y de mamferos
1685 Cari Antn Tortaza Se le considera constructor de microscopios
1690 John Marshall Construye microscopios en serie, con varios objetivos de diferen-
te poder de amplificacin
1774 L. HellerY Fuss Construyen lentes acromticos para microscopios
1801 Marie Francols Bichat Describe la presencia de tejidos en el organismo
1831 Robert Brown Descubre los ncleos de las clulas vegetales
1838 G. J. Mulder Acua el nombre de protenas
1839 Schieiden y Schwann Desarrolla la teora celular
1845 A. Donne Utiliza la fotomicroscopa en los espermatozoides
1846 K. Nageli Descubre que las clulas vegetales nacen de otras clulas vege-
tales preexistentes
1858 R. Virchow Establece que toda clula proviene de otra clula
1860 T.A.E. Descubre el mtodo de inclusin en parafina
1863 W. Waldeyer Inicia el uso de hematoxilina para teir clulas tisulares y acua
el nombre de cromosomas
1866 Cari Zeiss Perfecciona y fabrica microscopios
1870 W. His Crea el primer micrtomo para obtener cortes seriados
1874 Franscois-VIncet Raspail Considerado como el inventor de la citoqumica e histoqumica
1877 E. Abbe Fabrica objetivos de inmersin con resolucin de 0.25 jim (mi-
crmetros)
1886 R. AItman Colorea algunos componentes granulares del citoplasma
1902 W.S.Sutton Sienta la teora cromosmica de la herencia
1903 E. Buctiner Descubre la primera enzima (premio novel)
1928 F. Wholer Logra la sntesis de la Urea, que es un producto metablico de
desecho, eliminada por la orina.
1932 M. Knoll y E. Ruzka Inventa el prototipo del microscopio electrnico moderno
1935 : F. Zernicke Introduce el principio de la microscopa de contraste de fase
1936 T. Caperson Utiliza mtodos electrofotomtrioos para investigar la composi-
cin qumica de las clulas
1946 H.J.Mller Realiza trabajos sobre radiaciones genticas
1953 Watson, Crick, Wiikins Proponen el modelo del ADN
1970 Gaspersson, Zech, Johansson Emplean quinacrina para la demostracin de bandas cromosmi-
cas fluorescentes
2004 Richard Axel, Linda B. Buck Descubrimiento de receptores odorantes y la organizacin del
sistema olfativo.
2005 Barry J. Marshall, J, Robin Warren Descubrimiento del "Helicobacter pylori"
2006 Andrew Z. Fire, Craig C. Mello Descubrimiento de la Ribo interferencia, el silenciamiento de
genes mediante ARN
2007 Mario R. Capecchi, Sir Martin J. Por sus trabajos sobre clulas madre y manipulacin gentica en
Evans, Oliver Smithies modelos animales.
2008 Haraid zur Hausen, Francoise Bar- Descubrimiento del virus del papiloma humano. Por el descubri-
r-Sinoussi, Luc Montagnier miento del virus de la Inmunodeficiencia humana
2009 Elizabeth H. Blackburn, Carol W. Por el descubrimiento de la enzima telomerasa y como los cro-
Greider, Jack W. Szostak mosomas estn protegidos por telmeros.
2010 Robert Edwards Fertilizacin "invitro"
2011 Ralph M. Steinmann, Bruce A. Como se active el Sistema inmunitario
Beutlery Jules A Hoffn\ann
2012 ^ Sir John B.Gurdon y Shinya Yama- Clulas Madre pluripotenciales inducidas
naka
2013 James E. Rothman, Randy w. Investigacin sobre transporte de molculas dentro de las clu-
Scherckman y Thomas C. Sdlof las, que han sido tiles para el tratamiento de ttanos, diabetes y
otras enfermedades. Mecanismo de entrada de los virus para
infectar las clulas. Determinacin de como las protenas perju-
dican la qumica cerebral y su relacin con el autismo y la esqu-
zofrenia

Cuadro N 1.5 Eventos Biolgicos relacionados con el microscopio


HISTORIA SOBRE EL INVENTO DEL MICROSCOPIO En 1860 se empieza a trabajar con inclusin en parafina,
en 1870 se inventa el primer micrtomo que sirve para
En 1590 Los hermanos Francisco y Zacaras Janssen, realizar cortes extremadamente finos y as permitir la
inventan el microscopio compuesto. Ellos se desempe- observacin de objetos. Otro xito es la utilizacin de
aban como vidrieros, y se le considera a Zacaras colorantes en 1863 por W. Waldeyer.
como un optmetro que se desempeaba en Midelbur-
go, el xito fue colocar dos lentes en un tubo opaco, y En 1931 es decir hace 81 aos Ernst Ruska public
hacer observaciones de objetos. como estudiante de la Escuela Tcnica Superior de
Berln, los primeros resultados sobre una investigacin
Aunque sobre el origen del invento; no estn de acuerdo que revolucionara los conocimientos biolgicos.
los cientficos, pues, se cree que desde el siglo XIII ya
se conocan las propiedades de las lentes, son los El invento del microscopio electrnico. Junto con su
hermanos Janssen quien presentan el invento, antes no maestro Max Knoll, construyeron un aparato que traba-
haban sido usados en forma prctica y apenas si era jaba con 75.000 voltios y que permiti disminuir la longi-
una novedad o considerados como experimentos de tud de onda y permiti hacer visibles objetos con un
magia. aumento de hasta 12.000 veces

Es Galileo Galilei quien en 1610 consigue observar En el ao de 1986 recin Ernst Ruska recibe el galardn
objetos pequeos con el uso adaptado del telescopio, del premio Novel, cuando ya estaba jubilado.
pero las observaciones debido a que las lentes presen-
tan aberracin cromtica y distorsiones su uso no fue El invento del microscopio electrnico revolucionara el
considerado til, y pronto pas al olvido. conocimiento biolgico y permitira llegar a obtener los
conocimientos actuales, creo que no habra sido posible
Recuerde que en 1665, Roberto Hooke descubre la hablar de clonacin o de genomas sin la presencia del
presencia de clulas muertas en el corcho y acua la microscopio electrnico
palabra cell o celda.

En 1666 Leeuwenhoek fue por decir as el primer cient-


fico que encontr placer, en observar estructuras biol-
gicas y as abrir el camino para la investigacin cientfi-
ca, Leeuwenhoek apenas si se desempeaba como
portero del municipio de Deft, pero su curiosidad y su
"hobby" hizo que se dedicase al pulido de lentes y as
consigui lentes de tres milmetros de dimetro, que no
tenan aberracin cromtica, luego coloc las lentes en
una armazn de cobre y observaba todo lo que se le
cruzaba por su camino, as observ las fibras muscula-
res de ballena, las escamas de su propia piel, la leche,
el semen, etc.

Al tpico microscopio de Leeuwenhoek, que en realidad


es un microscopio simple, pero que lleg a tener
aumentos de hasta 200X, su uso se extendi hasta la
primera mitad del siglo XIX en que se invent propia-
mente el microscopio compuesto. Fue tal el aporte
cientfico de Leeuwenhoek que se le considera como
Van Leeuwenhoek. (Van es un ttulo nobiliario alemn).

El xito en la construccin del microscopio esta dado


cuando se asocia su estructura a clculos matemti-
cos, se mejoran las lentes, se conoce mejor sobre
microscopa, se adaptan una serie de estructuras mec-
nicas, se adapta e incorpora el condensador, adaptacin
y movimiento de la platina, movimiento del tubo ptico
sobre un tornillo que permite alejar y acercar el objeto a
travs del tornillo macromtrico y micromtrico, el inven-
to del revlver que permite el cambio de las lentes con
diferente poder de observacin, la adaptacin de un
espejo y luego de una fuente luminosa con lmpara
abastecida con corriente elctrica, etc. 1.3 PREPARACIN DE PLACAS HISTOLGICAS
POR EL MTODO DE LA PARAFINA
Cari Zeiss, en1846 abre una tienda que reparaba y
fabricaba instrumentos pticos, es as, como daba servi- Para el estudio de la Histologa es necesario, la prepa-
cios a la universidad de Jena. En 1866 se asocia con racin de placas histolgicas, que consiste en obtener
Ernst KarI Abbe para que fuera su director de investiga- finas rebanadas de tejido con un espesor muy fino de 3
cin y ms tarde, ambos asociados perfeccionaron la a 5 pm, que permitan el paso de la luz emanada por el
elaboracin de microscopios para investigacin cientifi- microscopio de luz.
ca.
Mientras ms fino es el corte, ms clara ser la imagen
El uso del microscopio, fue teniendo xito cuando los que se observa. El introducir parafina en el interior de
investigadores y ante la necesidad de satisfacer la las clulas o de los tejidos permiti hacer cortes finos,
curiosidad del saber se trabaja sobre diversos tpicos sin este material (parafina) no habra sido posible obte-
necesarios para la observacin de los objetos al micros- ner cortes tiles para la observacin. Por ello fue nece-
copio, como la construccin de lentes acromticos en sario que la inteligencia humana haya buscado una
1774 por L. HelleryFuss.
9

e s t r a t e g i a para introducir p a r a f i n a e n el interior d e las c o s d e n t r o d e la c l u l a , para ello g e l i f i c a l o s s o l e s d e


clulas. protena y e n d u r e c e l o s g e l e s . La fijacin puede durar
e n t r e 16 y 4 8 h o r a s , d e p e n d i e n d o del e s p e s o r d e la
La p r e p a r a c i n d e u n a p l a c a por el m t o d o d e la p a r a f i - m u e s t r a (el fijador p e n e t r a a r a z n d e 1 m m por h o r a )
n a s e realiza c o n los s i g u i e n t e s p a s o s :
1 . O b t e n c i n d e la m u e s t r a E x i s t e n m u c h o s f i j a d o r e s utilizados e n la p r e p a r a c i n d e
2 . Fijacin t e j i d o s ; p e r o los m s utilizados s o n : el f o r m a l d e h i d o al
3. C o r t e 4 % , el g l u t a r a l d e h i d o y el t e t r a x i d o d e O s m i o . E n m i -
a) desiiidratacin c r o s c o p a e l e c t r n i c a s e usa el g l u t a r a l d e h i d o , el c i d o
b) a c l a r a m i e n t o t n i c o y el t e t r a x i d o d e O s m i o .
c) Inclusin
d) Corte c o n m i c r t o m o C u a l i d a d e s d e l fijador:
4. Montaje
5. C o l o r a c i n A c t u a r c o n r a p i d e z , p o s e e r alto p o d e r d e p e n e t r a c i n ,
a) Rehidratacin c o n s e r v a r los d e t a l l e s e s t r u c t u r a l e s , permitir la o b s e r -
b) C o l o r a c i n c o n h e m a l o x i l i n a y E o s i n a v a c i n posterior, i m p e d i r la p r d i d a d e e l e m e n t o s s o l u -
6. O b s e r v a c i n al m i c r o s c o p i o b l e s , n o p r o v o c a r e s t r u c t u r a s artificiales, n o retraer
e x c e s i v a m e n t e los tejidos
MTODO D E L A PARAFINA P A R A L A REALIZACIN
DE P L A C A S HISTOLGICAS F i j a c i n por c o n g e l a c i n
C o n s i d e r e m o s otro tipo d e f i j a c i n , q u e c o n s i s t e e n
1. O B T E N C I N D E L A M U E S T R A s o m e t e r a la m u e s t r a a c o n g e l a c i n , q u e p e r m i t e llevar
al m a t e r i a l o r g n i c o a una t e m p e r a t u r a inferior a la d e s u
La m u e s t r a s e o b t i e n e d e u n o r g a n i s m o v i v o o m u e r t o , p u n t o c r i o s c p i c o , es decir t e m p e r a t u r a s inferiores q u e
ya sea de animales de laboratorio o bien puede tratarse p e r m i t e n llevar al d i s o l v e n t e a la c o n g e l a c i n . P a r a ello
d e m a t e r i a l h u m a n o . C u a n d o s e o b t i e n e d e un o r g a n i s - e s n e c e s a r i o la utilizacin d e N i t r g e n o l q u i d o o ultra
m o v i v o el p r o c e d i m i e n t o s e lo h a c e e n un a c t o q u i r r g i - c o n g e l a d o r a s q u e llevan a t e m p e r a t u r a s d e - 3 0 C o
co y se denomina biopsia. C u a n d o se obtiene d e un incluso -80 C
organismo muerto se denomina necropsia. La autopsia
e s el e s t u d i o m a c r o s c p i c o , a n a t m i c o d e un c a d v e r o O t r a m a n e r a d e fijar los m a t e r i a l e s o r g n i c o s , lo h a c a n
e s t u d i o p o s t - m o r t e n , o b d u c c i n , lo realiza un m d i c o n u e s t r o s a n t e p a s a d o s , s o m e t i e n d o al tejido a m a n t e n e r
m e d i a n t e la d i s e c c i n c o n el fin d e o b t e n e r i n f o r m a c i n por largo t i e m p o , al h u m o del f o g n . E s t e p r i n c i p i o es
a n a t m i c a s o b r e la c a u s a , n a t u r a l e z a o e x t e n s i n y u s a d o e n la e l a b o r a c i n d e e m b u t i d o s .
c o m p l i c a c i o n e s d e la e n f e r m e d a d q u e p u d o s e r o n o la
c a u s a d e la m u e r t e .
Tipos de fijadores
La muestra d e b e o b t e n e r s e c o n todo el cuidado posi-
b l e , p a r a m a n t e n e r la e s t r u c t u r a d e las c l u l a s o t e j i d o s F i j a d o r e s s i m p l e s : F o r m a l d e h i d o al 4 % , a l c o h o l etlico
c u a n d o e s t o s f o r n i a n p a r t e del o r g a n i s m o , p a r a n o d a a r a b s o l u t o al 9 6 % , a l c o h o l metlico, c i d o s m i c o , b i c r o -
las e s t r u c t u r a s s e d e b e u t i l i z a r u n b i s t u r s u f i c i e n t e - m a t o d e p o t a s i o . O . J H - lA ,;( .
m e n t e filo, realizar u n c o r t e r e c t o y f i n n e , sin e s f a c e l a - F i j a d o r e s c o m p u e s t o s : Lquido d e Fleming (mezcla de
m i e n t o s o b o r d e s r u g o s o s . P o r e s o el uso d e tijeras c r o m o , osmio y actica); Lquido de Z e n k e r (mezcla de
d e b e e s t a r r e s t r i n g i d o e n el p r o c e d i m i e n t o . bicromato sublimado actica); Lquido de Helly (mezcla
de Z e n k e r y formaldehido); Lquido de Bouin (mezcla de
El tamao de la muestra n o d e b e s o b r e p a s a r los 4 m m , p c r i c o , f o r m o l , a c t i c a ) L q u i d o d e D u b o s q Brasil o
o e n el p e o r d e los c a s o s llegar a 1 c m , y n o d e b e s e r Bouin alcohlico)
m u y g r u e s a . C u a n d o la m u e s t r a e s m u y g r u e s a , s e F i j a d o r e s f s i c o s : desecacin, calor seco, calor h m e -
dificulta la fijacin d e l tejido. U n a m u e s t r a r e p r e s e n t a t i v a d o , fro.
sera c o m o m x i m o 1 c m ^
3. C O R T E D E L O S T E J I D O S

2. F I J A C I N El s i g u i e n t e p a s o c o n s i s t e e n realizar c o r t e s c o n el
m i c r t o m o (micro=pequeo, Tomo=corte), este aparato
La f i j a c i n t i e n e c o m o o b j e t i v o principal evitar la d e g e - utiliza u n a c u c h i l l a d e a c e r o y p e r m i t e realizar c o r t e s
neracin post mortem, q u e e s la a l t e r a c i n d e la e n t r e 5 a 8 m i c r m e t r o s , el corte f i n o p u e d e llegar a
m o r f o l o g a d e las c l u l a s y t e j i d o s , c u a n d o e s t o s s e tener 1 micrmetro de espesor.
p r i v a n d e n u t r i e n t e s y d e O x g e n o , por e s o , e s t e p r o c e -
d i m i e n t o d e b e r e a l i z a r s e lo m s t e m p r a n a m e n t e p o s i b l e , Si el e s p e s o r del tejido a o b s e r v a r e s m a y o r d e 10 m i -
a p e n a s s e retira el t e j i d o u r g a n o m e d i a n t e b i o p s i a o c r m e t r o s , interfiere el p a s o d e la l u z y las i m g e n e s n o
a p e n a s s e m u e r e el i n d i v i d u o . La f i j a c i n d e los t e j i d o s sern claras.
t a m b i n p e r m i t e que los colorantes usados posterior-
mente se fijen con ms intensidad, a d e m s es til el E n 1 8 7 0 W . His c r e a el p r i m e r m i c r t o m o p a r a realizar
fijador c o m o un a n t i s p t i c o y a q u e p u e d e m a t a r m i c r o - c o r t e s en s e r i e , p e r o 10 a o s a n t e s s e d e s c u b r i el
o r g a n i s m o s c o m o v i r u s , h o n g o s y b a c t e r i a s , lo q u e d a m t o d o para la i n c l u s i n e n p a r a f i n a .
cierta s e g u r i d a d e n el m a n e j o d e los e s p e c m e n e s -
La p a r a f i n a p e r m i t e realizar c o r t e s f i n o s p a r a q u e los
OBJETIVO DE LOS FIJADORES t e j i d o s s e a n v i s u a l i z a d o s al m i c r o s c o p i o d e luz, d e otra
1. E v i t a r la d e g e n e r a c i n post-morten m a n e r a s e r i a difcil a l c a n z a r p o c o s m i c r m e t r o s d e
2. Q u e los colorantes tian intensamente espesor y no seran visualizados.
3. Matar m i c r o o r g a n i s m o s e n la m u e s t r a
El i n v e n t o d e un ultra m i c r t o m o c o n c a p a c i d a d d e
realizar c o r t e s e x t r a f i n o s , d e 1 m i c r m e t r o o en na-
n m e t r o s , permite observar muestras biolgicas con
L a f u n c i n d e u n f i j a d o r e s realizar enlaces cruzados de
m i c r o s c o p i o e l e c t r n i c o . E n e s t e c a s o la i n c l u s i n s e
l a s p r o t e n a s , e v i t a n d o e l d a o d e las m e m b r a n a s c e l u -
realiza e n r e s i n a s sintticas d e e p n e p o x i o a r a l d i t e .
lares y e v i t a n d o la s a l i d a d e l i s o z i m a s q u e d i g i e r e n los
( R e s i n a s s i m i l a r e s al plstico)
tejidos, mantiene ciertos compuestos qumicos orgni-
10

El Autotecnicn es un aparato que de acuerdo a la


fotografa demostrada, presenta varios vasos de precipi-
tacin con alcoholes a diferente concentracin, adems
est provisto de unos brazos que levantan el tejido en
procesamiento y cambia a otro vaso con alcohol ms
concentrado. Al ser el Autotecnicn un aparato que usa
ia corriente elctrica, podra daar la muestra en proce-
so, al irse la corriente elctrica.

b) aclaramiento Debido a que el alcohol no es soluble


en parafina, se debe buscar una sustancia que sea
soluble en parafina y en alcohol, y ese es el xilol o
Toluol. Al proceso por el cual el tejido en preparacin se
le somete a la accin del xilol, se denomina aclaramien-
to. El aclaramiento saca el alcohol del interior de las
clulas y le introduce el xilol. Este paso tambin requiere
de un tiempo prudencial para que desplace el alcohol e
introduzca el Xilol.

Se puede obviar este paso con la utilizacin de dioxano


que es un ter cclico de frmula C4H8O2 es soluble en
agua y en grasas, por lo que puede ser til para evitar el
xilol.

a) Deshidratacin consiste en sacar el agua del interior c) Inclusin Consiste en introducir la parafina en el
de las clulas y por consiguiente del tejido. Si queremos interior de la clula, para lo cual se pone la muestra en
meter la parafina en el interior de la clula y/o tejidos, se un molde (molde de Leuckart) que puede ser de madera
busca una sustancia que desplace el agua, (la clula o de cartn, se pone la parafina lquida y se le mantiene
est compuesta principalmente de agua), por eso se en ese estado a 37 C por largo tiempo, hasta que la
utiliza el alcotiol metlico en concentraciones crecientes, parafina desplace el xilol del interior de la clula.
se inicia con alcohol al 5%, luego al 10%, 20%... hasta Al sacar de la estufa se deja solidificar la parafina en un
llegar a una concentracin de alcohol absoluto. Las refrigerador y as se obtiene un bloque que ser someti-
concentraciones crecientes de alcohol, desplazan el do a cortes en el micrtomo.
agua y algunos cristaloides como electrolitos, glucosa,
aminocidos y lpidos, por lo que, en cierto modo hay
modificacin de los componentes celulares.
La parafina es una grasa que normalmente est en
El tiempo que se demora en el proceso, para sacar agua estado slido, para poder desplazar el Xilol y meter la
y meter alcohol, con cada uno de los vasos con alcoho- parafina esta debe estar en estado lquido, lo que se
consigue cuando la parafina est a 37 C, Este paso
requiere de varias horas. Una vez terminado el proceso
se saca el molde de la estufa y se deja solidificar, cosa
que ocurre cuando la parafina se enfra, ver las fotogra-
fas siguientes

1. molde de Leuckart

les a concentracin especfica puede ser de varias horas


(no se puede introducir directamente en alcohol absoluto
porque la muestra literalmente se quema o produce
retraccin de los tejidos) por lo que este procedimiento
demora entre 24 a 48 horas, el tcnico debe estar pen-
diente del cambio de la muestra en cada uno de los
pasos. Por eso se invent un procesador automtico
denominado Autotecnicn que permite realizar el 2. Se Introduce la parafina
procedimiento en forma automtica. . Molde de parafina

Autotecnicn
q u e c o n s i s t e e n s a c a r la p a r a f i n a m e t i e n d o la
m u e s t r a e n Xilol, y l u e g o e n c o n c e n t r a c i o n e s d e a l -
c o h o l e n f o r m a d e c r e c i e n t e , h a s t a q u e a l final s e
pone en agua.

Molde d e Leuckart

La h i d r a t a c i n d e los tejidos e s n e c e s a r i a , y a q u e los


colorantes s o n solubles e n agua y no e n parafina. Por
o t r o l a d o e s i m p o r t a n t e s e a l a r , q u e a l d e v o l v e r el a g u a
a las c l u l a s , y a n o e s p o s i b l e d e v o l v e r m u c h a s s u s t a n -
c i a s q u e f u e r o n r e t i r a d a s al m o m e n t o d e la d e s h i d r a t a -
cin.
C o n s i d e r e q u e d e s p u s d e l arrastre d e lpidos y a n o e s
p o s i b l e d e v o l v e r y p o r lo t a n t o l o s e s p a c i o s o c u p a d o s
por la g r a s a , a h o r a s e llenan d e a g u a . L a g l u c o s a e s
m u y s o l u b l e e n a g u a y a l p r o d u c i r la d e s h i d r a t a c i n , e s t a
s u s t a n c i a s e p e r d e r , lo m i s m o o c u r r e c o n o t r o s c o m -
p u e s t o s s o l u b l e s e n a g u a u o t r a s s u s t a n c i a s q u e al
r e h i d r a t a r a la clula y a n o lo p o d e m o s d e v o l v e r c o m o
e s e l c a s o d e los electrolitos.

C o l o r e a d a la p l a c a , s e le c u b r e c o n un c u b r e o b j e t o s y
2 . O b s e r v e el m o l d e d e L e u c k a r t , e n p r o c e s o d e e n f r i a - e s t a lista p a r a s e r a n a l i z a d a a l microscopio.
miento.
3. L u e g o y a t e n e m o s el b l o q u e d e p a r a f i n a c o n el t e j i d o 1.4 C O L O R A C I N D E L A S C L U L A S
e n e l interior.
L a s c l u l a s s o n i n c o l o r a s , n o s e p u e d e n o b s e r v a r al

Obtencin de cortes propiamente dicho

El b l o q u e d e p a r a f i n a , s e i n t r o d u c e e n e l m i c r t o m o , y a
sea e n forma automtica o mediante una manivela el
b l o q u e gira y s e v a o b t e n i e n d o u n listn (tira d e p a r a f i n a
con el tejido cortado).El micrtomo, puede ser d e desli-
z a m i e n t o , c o m o e l d e la f o t o g r a f a , t i p o Minot, los c o r t e s
a o b t e n e r s e d e b e n s e r e n t r e 5 y 8 pm, pero s e p u e d e n
o b t e n e r c o r t e s d e 3 p m m i c r m e t r o s o d e 1 p m , las
imgenes son m s claras, pero su interpretacin e s m s
dificultosa
E n e l m t o d o d e la c o n g e l a c i n los c o r t e s s e r e a l i z a n e n
el c r i o s t a t o o c r i o t o m o , los c o r t e s q u e s e o b t i e n e n s o n
d e 10 p m , p o r ello las i m g e n e s s o n m e n o s c l a r a s y el
diagnstico puede tambin dificultarse,
Al realizar c o r t e s c o n el m i c r t o m o s e o b t i e n e n u n a cinta
o listn d e p a r a f i n a c o n e l tejido d e n t r o d e l .

e) M o n t a j e y T i n c i n A n t e s d e p r o c e d e r a la t i n c i n o
coloracin, recuerde q u e e s necesario devolver el
a g u a a la c l u l a , para lo c u a l , u n o d e los l i s t o n e s
m i c r o s c o p i o p o r q u e t i e n e n e l m i s m o ndice d e r e f r a c c i n
del corte, s e m o n t a a u n p o r t a o b j e t o s c o n e l calor.
d e l a g u a , p o r e s o la n e c e s i d a d d e h a c e r i a s v i s i b l e s
L u e g o s e s o m e t e al tejido a u n p r o c e s o i n v e r s o ,
12

mediante la utilizacin de colorantes que alteran el Los espacios blanquecinos en la clula coloreada con
ndice de refraccin de la luz incidente, algunas clulas hematoxilina eosina, sern grasas si presentan un con-
presentan coloraciones en forma natural como es el torno regular, generalmente circular. Si los bordes de los
caso de los glbulos rojos, porque contienen hemoglobi- espacios blanquecinos son irregulares se puede pensar
na, la misma que da una coloracin amarillenta pajiza. en carbohidratos como el Glucgeno o en Glucoprote-
Cuando se encuentran en masa (en un tubo de ensayo) nas o Glucosaminoglicanos etc. (moco, antiguamente
dan una tonalidad rojiza. Las clulas vegetales tienen denominado como mucopolisacrido).
una coloracin verdosa si contienen clorofila. La presen- La determinacin especfica de grasas y carbohidratos
cia de carbn en clulas pulmonares puede dar un color se realiza con las coloraciones de PAS o Pa-Schiff y
negruzco a macrfagos pulmonares. Sudn o Rojo Scarlach. Tambin se puede recun-ir a
coloraciones especiales como por ejemplo para demos-
trar la presencia de Hierro u otros elementos.

Luego de realizado el corte, se procede a rehidratarlo


para permitir que los colorantes sean incluidos en el
interior de la clula. Los colorantes son sustancias COLORACIN D E UNA CLULA POR E L MTODO
hidrosolubles, aninicas o catinicas que pueden confe- DE L A HEMATOXILINA EOSINA
rir color a estructuras celulares y algunas sustancias
Sus- Color Colorante Denomi-
qumicas en forma especfica, de esta manera se puede
tancia nacin
distinguir el citoplasma y el ncleo de la clula, se puede
determinar la presencia de organitos como el de riboso- N- DNA AZUL HEMATO- BASFI-
mas o retculo endoplasmtico rugoso por la basofilia CLEO RNA VIO- XlLliNA LO
que adquiere una parte o todo el citoplasma. Se puede LETA : (BStCO)
distinguir la presencia de protenas o en forma contraria, cito- prote- rosado eosina Acidofilo
distinguir la presencia de carbohidratos o grasas cuando plas- nas (cido)
quedan espacios blanquecinos al utilizar Hematoxilina ma
Eosina (H.E)
Acidos Carbohi- LIpI
Los colorantes se clasifican en:
Com- nuclel- dratos dos
Naturales: animales (carmn), vegetales: hematoxilina,
puesto ctei-
Orcena, azafrn.
celular cos
Artificiales: cidos o sales como la eosina o eosinato
de sodio, (son colorantes citoplasmticos) Hemato- Color
Bsicos: azul de metileno (son colorantes nucleares) xilina violeta
Neutros cuando tienen radicales que coloran tanto a Eosina Color
cidos como a bases rosado
Indiferentes: Sudn III, rojo escarlata Pa-Schiff Color ma-
Ortocromticas: los tejidos adquieren una coloracin OPAS - genta
igual a la del colorante
Rojo Color
Metacromticas: Una sustancia o componente celular
Congo 0 rojizo
se pigmenta de un color diferente al del colorante utili-
Scarlach
zado

Como se explic al inicio, la mayor parte de clulas del


organismo son incoloras. Por lo tanto, para la observa-
cin se necesitan colorantes que tian selectivamente
los diferentes componentes qumicos celulares, por ello,
estos mtodos se denominan mtodos histoqumicos,
citoqumica o histoqumica simplemente.

Mediante la histoqumica se puede demostrar la presen-


cia de un compuesto qumico orgnico especfico, as,
cidos nucleicos, protenas, carbohidratos y grasas o
lpidos.

Como las protenas son especficas para cada individuo,


se podr determinar selectivamente la presencia de un
tipo especial de protena, como las del tejido epitelial,
conectivo, muscular o nervioso. O si se quiere la pre-
sencia de un anticuerpo (anticuerpo es una protena)
presente en el organismo en forma natural o mediante la
reaccin antgeno anticuerpo. (Entender mejor cuando
se explique la inmunofluorescencia)

El mtodo de coloracin comn es la de la Hemato-


xilina Eosina. Se basa en la demostracin de sustan-
cias acidas como los cidos nucleicos y de sustancias
bsicas como las protenas en general. H y E

As, con la Hematoxilina, es fcil detennlnar la presencia


del ncleo y de ciertos organitos citoplasmticos que
contiene cidos nucleicos (DNA, RNA), se presentan un
color azul violeta.
Con la Eosina que tien las protenas de color rosado y
permite distinguir especialmente el citoplasma.
13

COLORACIN HEMATOXILINA EOSINA tisulares o celulares en fonna inespecfica, pero que


permiten distinguir IQS diferentes componentes.
LA HEMATOXILINA. / .'./j^ f"''^,''^''
Otro tipo de colorantes son los Metacromticos como el
Es un colorante bsico (catinico = que acepta proto- azul de Toluidina, el Hierro coloidal de Hale.
nes) obtenido de la corteza del rbol de Campeche,
pigmenta sustancias acidas como al cido desoxirribo- El principio es que al colorear a los tejidos especficos el
nucleico o ADN, presente en el ncleo. O al ARN o color natural de la sustancia cambia a otro color, como
cido ribonucleico presente tanto en el ncleo como en el azul de toluidina que al colorear a los glucosamlnogli-
el citoplasma. canos, fuertemente cidos, presentes en el cartlago; le
Los tejidos, las clulas o las partes de la clula pigmen- presentan de color rojo.
tadas con hematoxilina se ven de color azul violeta y se
denominan basfilos.
MTODO DEL CIDO PERIDICO MS REACTIVO
Campeche es una poblacin de Panam, que sobresali DE SCHIFF O COLORACIN DE RAS
durante la colonia espaola en los siglos XVI y XVII, ya
que sus pobladores utilizaban la corteza de un rbol Sirven para demostrar la presencia de Carbohidratos o
nativo para teir los tejidos o telares que fabricaban. Los Glucoprotenas tanto en el interior de las clulas o en los
europeos vieron la utilidad de este mtodo de tincin y lo componentes de los tejidos. Utiliza el cido perydico
exportaban a Europa. (HI04) que acta como un mordiente, ms el reactivo de
Schiff que es el colorante propiamente dicho y que es la
Los cientficos aprovecharon esta propiedad de teir y la fucsina bsica, que da un color magenta.
utilizaron para hacer visibles las clulas.
El mordiente sirve para transfonnar los carbohidratos de
LA EOSINA. forma cclica a la forma aldehdica, reaccin qumica
importante para la coloracin de carbohidratos como el
Es un colorante cido (aninico = elimina protones) glucgeno de las clulas.
derivado del xanteno, pigmenta sustancias bsicas
como las protenas. En realidad las protenas son anf- Las sustancias que se coloran con Pa-Schiff se denomi-
teras (es decir actan como cidos y como bases). Sin nan PAS positivas. Para diferenciar las Glucoprotenas
embargo las protenas en los tejidos y clulas suelen del Glucgeno se utiliza la amilasa salival ya que esta
pigmentarse de color rosado por el carcter bsico de ltima sustancia con la artiilasa se transforma en gluco-
estas protenas. sa, como la glucosa es escindida al lavar los tejidos, el
Toda sustancia que toma el color rosado o el color cido nico que persiste es la presencia de las Glucoprote-
de la eosina se denominan acidfilas o eosinfilas. nas, este procedimiento permite asegurar que la pre-
sencia de un color magenta en un tejido tratado con
amilasa y que se mantiene es glucoprotena.
cidoB;;UI[;>lo
Explicaremos la coloracin de PAS y como se va a
Base .:.:.r....C:ae -""^^^^i^ diferenciar el glucgeno y las glucoprotenas. El gluc-
geno y las glucoprotenas se pintan con PAS. Si tengo
La coloracin de las clulas no suele ser ni tan azul para dos placas el uno con glucgeno y otro con glucoprote-
teir el ncleo, ni tan rosado como para teir el cito- nas al colorear con PAS las dos sern positivas y se
plasma. Todo depende de sus componentes qumicos y vern de color magenta.
los colorantes actan como testigos de pH.
Un ejemplo para entender esta propiedad est en el Si se trata del epitelio superficial del estmago con H.E.
cambio que sufre el t en infusin al ser mezclado con el se ver el espacio que corresponde a las glucoprotenas
limn, el t va cambiando de un color caf a amarillo de color blanquecino, en realidad no se pinta si en otra
conforme se ponen en contacto las dos sustancias, es placa del mismo bloque de parafina le coloreamos con
decir, el t es un medidor indirecto de la acidez. PAS se observar las glucoprotenas de color magenta y
Cuando observa las clulas pigmentadas con hematoxi- en la superficie celular.
lina y eosina, en realidad est indirectamente, midiendo Al utilizar el mtodo de PAS en clulas hepticas tam-
la acidez de ella. Por esta razn al observar tejidos bin darn positividad.
usted mirar que se presentan entre el color azul violeta
a un rojo azulado, solo en algunas ocasiones se puede
mirar ntidamente color azul y rosado, adems, la colo-
racin de las placas depende de la tcnica usada, y del
operador en el momento de la coloracin. (As como el
panadero puede sacar el pan del horno casi blanquecino
o casi negruzco)

En la coloracin de las clulas se pueden utilizar otros Coloracin por la tcnica de PAS
mtodos como la coloracin tricrmica de Mallory con Clulas caliciformes PAS positivas
colorantes todos cidos que tien los componentes
14

MTODO DE FEULGEN

Es un nntodo especfico para la determinacin histo- Preparacin de una placa histolgica, lista para la ob-
qumica del DNA, sobre la base del contenido de desoxi- servacin
rribosa en el DNA y que es transfonnado de la forma
cclica a la forma aldehdica del azcar (que es una Etapas Finalidades Duracin
pentosa) por el cido perydico. Con el reactivo de
Fijacin: en un Conservar la Cerca de 12
Schiff el DNA toma un color prpura o magenta. El RNA
fijador simple o morfologa y la horas, depen-
al utilizar desoxirribonucleasa no resiste a la coloracin y
mezcla fijadora composicin de diendo de fijador
permite distinguir la presencia de DNA o RNA. los tejidos
(lquido de y del tamao de
Bouir, Helly, etc. la pieza
El mtodo consiste en coger el material fijado y someter- Deshidfatacin Eliminar el agua 6 a 24 horas
le a una hidrlisis acida, para eliminar los grupos de
en alcohol etlico de los tejidos o dependiendo del
purina de los residuos de desoxirribosa del DNA, con
de concentra- del interior de tamao de la
este mtodo se obtiene un grupo aldehidico en cada
ciones crecien- las clulas pieza
residuo de desoxirribosa, luego se detecta estos por el
tes, empezando
mtodo de PAS dando un color magenta. La especifici-
por el de 70% y
dad de la reaccin se obtiene cuando al RNA se le
teroiinando con
destruye con el uso de una enzima la desorribonucleasa
y adems porque la hidrlisis acida inicial es leve de tal el absoluto
manera que no fonna grupos aldehdicos de residuos de Aclaramiento: o Embeber a la 1 a 6 horas
ribosa. diafanizacin en pieza con ura dependiendo del
benzol, xilol o sustancia misci- tamao de la
toluol, solventes ble a la paraflna pieza
del alcohol y de
COLORACIN DE SUDAN
la parafina
Inclusin: con La parafina 30 minutos a 6
Colorea especficamente las grasas de color rojo. Para
parafina fundida ingresa al inte- horas depen-
poder colorear las grasas, los tejidos no pueden ser
generalmente rior de los va- diendo del
sometidos a la tcnica de Parafina ya que esta tcnica
realizada en sos, en los tamao de la
elimina los lpidos. Cuando se quiere demostrar la pre-
estufa a 60 C espacios irter- pieza
sencia de grasas en los tejidos o en las clulas el mto-
ceiuiares y
do a utilizarse es el mtodo de la congelacin en la
tambin en el


preparacin de tejidos.
interior de la
clula embe-
Los colorantes Sudn en concreto el Sudn I, II, III, y el biendo el tejido y
^ Sudn IV (o rojo escarlata) pertenecen a una familia de haciendo ms
colorantes industriales que normalmente se usan para fcil la obtencin
teir plsticos y otros materiales sintticos. de cortes en el
micrtomo
En Europa y en toda la unidad europea est restringida
la utilizacin de este colorante, se ha encontrado en Confeccin del Obtencin del
algunos alimentos como en la pimienta roja. El colorante bloque: La pieza bloque de para-
Sudn I se ha visto tiene efectos teratxicos, adems se coloca en un i n a de forma
todos ellos pueden tener efectos carcinognicos por lo molde rectangu- regular, para ser
que estos no se pueden utilizar para manipular alimen- lar que contiene cortado en el
tos. la parafina micrtomo
fundida
El Sudn iV se utiliza para colorear los lpidos, ya que es
ms soluble en estos compuestos. Por lo general el
Sudn IV est disuelto en alcohol/acetona o en al- PREPARACIN DE PLACAS HISTOLGICAS POR
cohol/agua EL MTODO DE LA CONGELACIN

El negro Sudn se utiliza en coloracin de vainas de La preparacin de una placa histolgica por el mtodo
mielina, esta tie los fosfolpidos que es parte de la de la parafina es buena, pero tiene una desventaja que
composicin de la membrana celular- es un mtodo demorado, se necesita entre 48 y 72
horas, por eso cuando el cirujano tiene una emergencia
TCNICA DE COLORACIN DE SUDN o en otros casos de urgencia, el mtodo para la prepa-
racin de placas histolgicas se la debe hacer por el
1. Colocar el corte en bicromato de potasio y po- mtodo de la congelacin, en donde aproximadamen-
ner sobre el portaobjetos te en el lapso de pocos minutos, el patlogo reportar el
2. Dejar secar al aire estudio, y el mdico podr actuar rpidamente.
3. Sumergir en alcohol a 70
4. Teir con Sudn durante 5 minutos si son cor- La tcnica de la congelacin, se la efecta rpidamen-
tes congelados y 30 minutos si son cortes en te porque, luego de la toma de la muestra, se procede a
parafina congelar el espcimen en vapor de Nitrgeno lquido,
5. Sumergir en alcohol 70 esto demora unos pocos segundos. Inmediatamente se
6. Lavar con agua destilada procede a cortar en el criostato que es un micrtomo
7. Contrastar con hematoxilina de Harris 30 s o 3 que mantiene la cuchilla y el tejido congelado.
minutos en Hematoxilina de Mayer
8. Lavar en agua destilada 10 minutos Como la clula no ha perdido su agua y sus componen-
9. Deshidratar con alcoholes, aclarar con xilenos tes, la muestra est lista para la coloracin. En el mto-
y montar do de la parafina, la clula pierde agua y muchos com-
ponentes histoqumicos.
La interpretacin es cuando al observar al microscopio El patlogo o el Histlogo puede hacer las observacio-
se ven estructuras de color rojo, quiere decir que hay nes al microscopio y reportar su investigacin. En estas
sustancia de naturaleza lipdica. circunstancias si el cirujano durante un acto quirrgico
15

estuvo esperando el resultado podr actuar de inmedia- Inmunofluorescencia Indirecta Consiste en reconocer
to y resolver el caso. el anticuerpo (protena) presente en un tejido investiga-
do. El procedimiento consiste en preparar un anti-
El mtodo de la congelacin no solo es til por la rapi- anticuerpo el mismo que se marca con la fluorescena
dez del reporte, sino tambin que al no tener que fijar y para lo cual es necesario inoculara un animal de labora-
luego deshidratar, poner xilol y parafina; sino que conge- torio un anticuerpo, el animal de laboratorio considerar
la y mantiene los compuestos orgnicos e inorgnicos a esta protena como un antgeno y elaborar un anti-
de la clula, permite descubrir sustancias que por el otro cuerpo (anti-anticuerpo), el mismo que es marcado con
mtodo no lo podra tiacer, como es mantener las gra- el colorante fluorescente, al poner el reactivo en un
sas y colorearlo con Sudn, de hecho la tcnica de tejido reconocer la presencia de un anticuerpo.
Sudn se realiza por el mtodo de la congelacin. Este procedimiento es ms fcil de demostrar ya que
cuando hablamos de un antgeno este podra encontrar-
Las desventajas del mtodo estn dadas en primer lugar se en un lugar determinado del cuerpo, pero el anticuer-
porque los cortes a realizar difcilmente alcanzan los 10 po estar ampliamente distribuido en todo el organismo.
micrometros, haciendo que estos cortes gruesos no Por esta razn la Inmunofluorescencia indirecta es de
sean tan claros como es en la preparacin por el mtodo mayor utilidad en el descubrimiento de un antgeno.
de la parafina. Otro obstculo es que, si bien la colora-
cin se realiza inmediatamente, no olvide que al utilizar Tambin se puede utilizar la lisamina rodamina, en este
el fijador, tambin daba mayor afinidad a los colorantes, caso la fluorescencia presenta un color rojizo. Otro tipo
por ello las imgenes no sern tan claras como el otro de investigacin se hace con oro coloidal y el procedi-
mtodo mencionado, por ltimo se debe considerar que miento se denomina investigacin inmunoarca y se
al congelarse el aua se producen cristales que son utiliza generalmente en investigaciones con microscopio
verdaderas agujas lo que podra distorsionar las imge- electrnico.
nes.
AUTORRADIOGRAFA
INMUNOFLUORESCENCIA
E s un mtodo de Investigacin histolgica o citolgi-
La inmunofluorescencia es un mtodo histoqumico, que ca que se basa en la utilizacin de sustancias radioac-
se utiliza para demostrar ciertas sustancias de naturale- tivas de baja intensidad, para descubrir la presencia de
za proteica en forma especfica. Se basa en la utilizacin una sustancia especfica como TImina, Uracllo, o tam-
de sustancias fluorescentes como la fluorescena, lisa- bin es til para etiquetar glucosa, protenas marcando
mlna rodamina. La fluorescena emite un color verde a la glicina, . Para ello se utiliza sustancias radioactivas
cuando se observa en un microscopio de fluorescencia de baja intensidad como es el caso del tritio o H3.
(que es un microscopio bsicamente igual al fotnico
con ciertas variedades, como es la utilizacin de filtros En este mtodo se usa al tritio que emite radiaciones de
especiales y un emisor de vapores de mercurio que baja intensidad de hasta 1 pm de longitud, al etiquetar
hacen posible observar la protena en cuestin. un componente de una sustancia especfica como la
Timina, en realidad la Timidina (timina ms desoxirribo-
El procedimiento puede ser de dos tipos: a) Inmunofluo- sa) para determinar la formacin de DNA o Uridina
rescencia directa y b) Inmunofluorescencia indirecta marcada con tritio para determinar la formacin de RNA,
o glucosa marcada con tritio para etiquetar el metabo-
lismo de la glucosa vs glucgeno, o la leucina para
determinar la presencia de protenas, en el caso de
investigar la formacin de colgena se usa la prolina
marcada con tritio.
Se usa al tritio porque emite radiaciones de baja intensi-
dad de 1 pm de longitud y la propiedad que tiene estas
radiaciones de velar una placa fotogrfica produciendo
granos de plata sobre una pelcula que contiene bromu-
ro de plata.
El mtodo consiste en colocar un marcador radiactivo a
una clula en actividad por ejemplo cuando esta est en
Inmunofluorescencia directa Permite etiquetar una una fase del ciclo celular como el de sntesis. Al poner la
protena especfica presente en un microorganismo Timidina marcada con tritio, cada vez que se fomie una
determinado, el mtodo consiste en que al conocer un molcula de DNA en que necesite incorporar a la Timi-
antgeno una bacteria, un hongo o un virus, este se na, utilizar el marcador y formar un compuesto estable
inocula en un animal de laboratorio para que produzca con emisin de radiaciones que se puede ver indirecta-
anticuerpos (que es una protena), este anticuerpo es mente, cuando sobre la clula se pone una pelcula
coloreado con la fluorescena. Al administrar a un indivi- fotogrfica. Al no utilizar el marcador y al lavar la placa
duo, el anticuerpo se pega al antgeno y se puede des- con agua corriente este saldr y no se podrn ver los
cubrir su presencia. Ejemplo: se quiere averiguar si un granos de Plata. Se utiliza la Timidina por la especifici-
individuo presenta treponema Palidum que es causante dad que tiene para determinar la formacin de DNA, o el
de la sfilis. Si se obtiene un tejido del investigado y le de la Uridina en el caso de querer demostrar la forma-
sometemos a una confrontacin con el anticuerpo anti- cin de RNA por la especificidad del RNA que contiene
treponema Palidum marcado con la fluorescena, al Uracllo.
observar en un microscopio de fluorescencia se obser-
var el treponema Palidum si el individuo presenta el En esta tcnica no se usa P32 o el Fe o el Ca puesto que
corinebacterium en el tejido investigado. Si no hay tre- la emisin de radiaciones son de alta intensidad y al
ponema la muestra no presentar inmunofluorescencia, poner una placa fotogrfica dara una imagen de vela-
pero si hay treponema si se lograr ver la inmunofluo- miento muy extenso, perdiendo especificidad en la
rescencia, e inclusive se reconocer el antgeno. demostracin de una sustancia formada.
Al lavar el tejido con agua corriente el marcador va a ser
eliminado, pero si se une el marcador al antgeno per-
manece en el tejido y no puede ser eliminado.
16

Placa fotogrfica
El sobrenadantMjpacsemBsr aleureBdiaiaraesentrifugacin
Placa portaobjetos 10.000 revoluciones por minuto por 20 minutos, el pallet
al fondo acumula mitocondrias. El pallet se somete a
100.000 revoluciones por minuto por 1 hora obtenindo-
se algunos organitos denominados con el genrico de
-o- microsomas, dentro de ellos como RE liso, aparato de
Golgi. Una ltima centrifugacin a 200.000 revoluciones
por minuto por 1 hora dejara un pallet con una concen-
OBSERVACIN EN F R E S C O DE CLULAS O TEJI- tracin importante de ribosomas.
DOS
En algunos casos es posible hacer observacin de PREPARACIN DE PLACAS PARA MICROSCOPA
clulas o de tejidos en fresco, para lo cual es necesario ELECTRNICA.
tomar la muestras en fomia directa y luego de hacer un
extendido en una placa portaobjetos, mirar directamente El microscopio electrnico utiliza lentes electromagnti-
al microscopio, un ejemplo de esto es hacer observacin cos para adaptar y enfocar una serie de haces de elec-
en fresco de fibras colgenas y elsticas, a las primeras trones, que disminuyen la longitud de onda y aumenta
se las ve blanquecinas y a las elsticas como amarillen- considerablemente el poder de resolucin, a 1 nm en
tas. muestras biolgicas, es decir 200.000 veces que au-
menta una estructura. Las imgenes del microscopio
CULTIVO DE CLULAS O TEJIDOS electrnico se proyectan en una pantalla fluorescente o
Se realiza cultivo "in vivo" tratando de mantenerlas con en una pelcula fotogrfica y a esto se llama micrografa
vida y consecuentemente manteniendo su estructura, electrnica. Una figura vista a travs de una cmara
las ms fciles de cultivar son las clulas sanguneas, fotogrfica se llama fotografa, Si se observa una foto
dentro de ellas se cultiva a los linfocitos con el objetivo obtenida con microscopio de luz se denomina microfoto-
de poder realizar otras investigaciones como HLA o grafa y las imgenes con microscopio electrnico se
tambin para la realizacin de pruebas genticas como denominan micrografas.
cariotipos u otros estudios. Las muestras obtenidas para microscopa electrnica,
Los cultivos "in vitro" se realizan en cajas de Petri, se procede de la siguiente manera:
frascos u otros objetos, se necesita encontrar un caldo
de cultivo adecuado, aunque este tipo de estudios se 1. Obtencin de la muestra. Solamente es necesario
realiza con mayor xito cuando se cultivan microorga- unos pocos milmetros de la muestra, no muestras de un
nismos como bacterias u hongos. El cultivo de clulas centmetro como en el caso de microscopio de luz.
eucariotas no son tan fciles, aunque si pensamos en
clulas embrionarias se podra tener xito en la experi- 2. Fijacin: Se fija con glutaraldehido pos fijacin de
mentacin. cido smico, a veces es necesario la utilizacin del
cido tnico. Cuando se quiere fijar enzimas se utiliza
METODOS DE FRACCIONAMIENTO C E L U L A R formaldehido.

Se procede a realizar un fraccionamiento celular me- 3. Inclusin: Se utiliza un material no polimerizado


diante la maceracin de clulas de un tejido cualquiera, como son las resinas sintticas (Epn Epoxi y Araldite),
se las coloca en un tubo de ensayo y con un mortero se que permite fomiar un bloque, de una dureza tal, para
da lugar a la formacin de pallet o grumo de clulas poder realizar cortes de un espesor entre 60 y 80 nan-
destruidas que son sometidos a una centrifugacin por metros La resina puede introducirse en el interior de
determinado tiempo y revoluciones por minuto, con este tejidos y de clulas, cuando mantenemos la resina a una
procedimiento se van separando diferentes fragmentos temperatura de 60 C
celulares, pedazos de membrana celular, mitocondrias,
ncleos celulares etc. 4- El corte se realiza con un aparto denominado UL-
Al destruir la membrana celular, los organitos citoplas- TRAIVIICRTOMO algunos de ellos, inclusive muy
mticos quedan libres nadando en la solucin salina del desarrollados que se encuentran computarizados El
tubo de ensayo donde se realiza el fraccionamiento espesor va entre 60 y 80 nanmetros. La cuchilla de
corte es el borde de un vidrio fracturado, o una cuchilla
de diamante. El corte queda nadando en agua y se
pesca con una rejilla de cobre, cubierta con una pelcula
de carbn o plstico. Los electrones pasan por la rejilla
de apoyo, a travs de sus perforaciones.

Se somete el pallet a un proceso de centrifugacin a


1.000 revoluciones por minuto por 10 minutos, fonnando
un sobrenadante y un pallete que se deposita en el
fondo del tubo de ensayo. El pallet tiene los ncleos de
clulas, y el sobrenadante contiene otros organitos que 5. Tincin: Aunque no hay observacin multicolor, en
no sedimentaron. microscopa electrnica, si se lo hace en blanco y negro,
17

por ello no se utilizan colorantes, sin embargo el uso de taja es que solo se pueden obtener unos 100.000 au-
sales metlicas, permite observar con mejores detalles, mentos.
estructuras descritas como estructuras electrnicamente
densas o menos densas.
6. El montaje se realiza en rejillas de metal cubiertas de INTERPRETACIN DE LA OBSERVACIN DE TEJI-
carbn DOS AL MICROSCOPIO

7. La observacin se realiza en forma indirecta a travs Cuando se ha obtenido el corte histolgico en forma
de una pantalla fluorescente o una placa fotogrfica. adecuada, con el espesor necesario, y se ha utilizado
Las imgenes de microscopio electrnico se denominan los colorantes adecuados, las clulas o tejidos debern
como micrografas. observarse en forma clara y adecuada.

Sin embargo existen algunos problemas que el estudian-


MICROSCOPIO ELECTRNICO DE ALTO VOLTAJE te debe tomar en cuenta, una de ellas son:

El microscopio electrnico de alto voltaje, en principio es A R T E F A C T O S O ARTIFICIOS


igual al funcionamiento del microscopio fotnico, solo
que l IVIE. Utiliza haz de electrones en vez de fotones Se denominan artefactos o artificios a ciertas condicio-
(luz), admite un poder de resolucin de 0,2 nm, o sea un nes, imgenes o estructuras que no permiten observar
poder 1000 veces mayor que el IVIF. (en total 1'000.000 en fonna adecuada las clulas y tejidos y pueden ser:
de aumentos). Pero esto es terico, pues los aumentos
reales solo llegan a 100.000 a 200.000 veces, siempre y a) Retraccin Se presentan imgenes en blanco gene-
cuando no sea la observacin de una clula completa, ralmente en espacios virtuales o reales como efecto de
pero presta mucha utilidad para ver estructuras muy la utilizacin de fijadores, ms retraccin si la concentra-
pequeas como ribosomas, mitocondrias, filamentos etc. cin del fijador es mayor. Ha visto usted que al poner la
Pero recuerde que a mayor poder de resolucin, menor carne en la sartn, disminuye de tamao, es decir se
es la superficie que se observa, y mientras ms peque- retrae. Entre las fibras musculares hay tejido conectivo
a es la superficie estudiada, aumenta el grado de laxo retrado y dan la apariencia de espacios vacos.
interpretacin de lo observado.
La utilidad del microscopio electrnico est en que ha
permitido descubrir estructuras que sin el concurso de
ste aparato, no hubiesen pasado de ser meras teoras.
En ME. no se utiliza placas portaobjetos de vidrio sino
que el montaje se hace en rejillas de cobre de pocos
milmetros y recubiertas de carbn. La observacin no
se hace en forma directa, sino a travs de una pantalla
que refleja la imagen observada. Al mirar una fotografa
de microscopio electrnico (micrografa), es como estar
viendo a travs de la pantalla del mismo ME.
Los cortes no se realizan con micrtomo comn, sino
con ultra micrtomo MT que los hay de varias genera-
ciones de fabricacin, y se alcanza cortes de un espesor
entre 60 nm y 80 nm (nanmetros).

La coloracin de muestras de microscopio electrnico,


no son posibles, se ve en blanco y negro y con varias
tonalidades de gris, las ms opacas o negras se deno-
minan estructuras electrnicamente opacas y las ms
claras o grises se las describe como electrnicamente
lcidas. Aunque no hay imgenes coloreadas, se utilizan
ciertas sales metlicas o substancias que permiten
mejor observacin como las sales de placa (impregna- Segn el diccionario de la Real Academia de la lengua:
cin argntica), el tetraxido de Osmio, sakes de Au, retraccin es accin de retraer// Mdico: reduccin
etc. persistente de volumen en los tejidos

MICROSCOPIO ELECTRNICO DE BARRIDO

El microscopio electrnico de barrido o tridimensional, b) Precipitados Generalmente los precipitados se


utiliza el haz de electrones para rastrear la superficie de refieren a precipitaciones de colorantes. La utilizacin de
estructuras biolgicas, por ejemplo la superficie de un colorantes para sangre que no han sido perfectamente
glbulo rojo o de una plaqueta o la superficie de linfoci- filtrados, dan imgenes a veces de formas caprichosas,
tos. Los electrones son reflejados y la seal es captada que los estudiantes novatos suelen dar una mxima
por una pantalla de televisin, la imagen se denomina importancia, pensando que son estructuras a veces
micrografa electrnica por barrido la ventaja es que fantasmales. No escapa de presentar precipitados en los
muestra imgenes tridimensionales. En la utilizacin del mtodos de Hematoxilina y Eosina.
microscopio electrnico de barrido no es necesario hace
cortes histolgicos, las clulas estn ntegras y por eso Precipitado; es materia que en virtud de reacciones
rastrea la superficie de estructuras, como es el caso de qumicas se separa del liquido en que estaba disuelta y
la observacin de plaquetas, glbulos rojos o cualquier se posa en el fondo de! recipiente.
otra estructura.
c) Plegamentos o dobleces Se refiere a que al montar
El poder de resolucin de este tipo de microscopio es de el corte histolgico en la placa portaobjetos, en muchas
3 nm y lo interesante es que la muestra no necesita ser ocasiones por lo fino del tejido este suele doblarse y
sometida a cortes, como el caso de microscopio electr- hacer pensar que la placa es patolgico. Con la obser-
nico de transmisin o el de alto voltaje. La nica desven- vacin permanente y las experiencias que vayan adqui-
18

riendo, los estudiantes podrn distinguirlos adecuada- muchas enzimas encerradas en los lisosomas, inician
mente. procesos de demolicin. Es casi como ver Paris des-
Plegar: hacer dobleces o pliegues pus de un bombardeo, las casas destruidas. Igual las
clulas en los casos de degeneracin post morten se
ven completamente alteradas.

Todos estos casos y muchos otros que podremos en-


contrar en la observacin de tejidos, son necesarios
temarios en consideracin, para diferenciar adecuada-
mente entre una imagen con artefactos y una placa que
demuestre patologa.

d) Esfacelamientos Son bordes irregulares en la ob-


servacin perifrica de los tejidos, producto a veces de
alteraciones en la cuchilla del micrtomo. Otras veces
resulta porque al realizar la toma, no se utiliz un bistur
perfectamente filo, o por el uso de tijeras en vez de
bistur.

e) Roturas Cuando por el uso de pinzas en la obten-


cin de la muestra, las clulas o alguna estructura se
rompe.

f) Degeneracin post morten En caso de que el tejido


no se haya fijado inmediatamente de separado del
cuerpo o luego de la muerte del individuo, las clulas
sufren un proceso de lisis causado por la anoxia de los
tejidos. Las membranas celulares se desestabilizan y

txmr MicnoscoPE TRANSMISSiON ELECTRON eCMtHlHQ ELECTRON


MiCR08CC>(Pe MICnOSCOPE
19

CAPTULO n

COMPOSICIN QUMICA DE L A MATERIA VIVA.

Elementos qumicos
Los compuestos orgnicos. Forman parte de los seres
Los seres vivos y todas las cosas que estn en la vivos, tienen como elemento Importante al carbono.
naturaleza estn formados de tomos, que se unen para
fonnar molculas o compuestos ms complejos. Compuestos qumicos orgnicos
Las leyes fsico qumicas, rigen para todos los constitu-
yentes de la naturaleza. Se denominan compuestos qumicos orgnicos, por-
Los 92 elementos qumicos naturales que van desde el que en un tiempo se pens que solo existan en los
ms liviano que es al hidrgeno tiasta el ms pesado organismos vivos, ahora se sabe que tambin pueden
que es el uranio, estn en la tabla peridica de los ele- formar parte de la materia inanimada.
mentos. Hasta el momento actual se han descrito 118 Como manifestamos anteriormente el Carbono es un
elementos qumicos, pero incluidos aquellos que se han elemento qumico ms importante, por las propiedades
creado en los laboratorios. qumicas que tiene este elemento para fonnar uniones
covalentes con otros tomos. Es probable que si hay
Los elementos qumicos forman compuestos, clasifica- vida en otro planeta del universo, est formado de la
dos como compuestos inorgnicos, y compuestos org- misma manera, con tomos de carbono. Aunque si hay
nicos. otros elementos qumicos con propiedades parecidas al
Dentro de los compuestos orgnicos el elemento ms carbono. Si no fuera el carbono es probable que el
importante es el carbono, debido a sus propiedades Silicio lo reemplazara.
fsicas y qumicas y se constituye en el esqueleto de
toda materia viva. En 1928 el qumico alemn Friedrich Whter, sintetiz la
Urea que es un producto de desecho metablico, y
Los tomos llamados Biogensicos son: El Carbono (0), consecuentemente orgnico. Desde ese momento se
el Hidrgeno (H), el Oxgeno (O) y el Nitrgeno (N) supo y se pudo sintetizar cualquier compuesto orgnico
CHON y constituyen el 96% de la materia viva que en el laboratorio.
forman los organismos vivos.
Otros elementos qumicos como el Calcio, Fsforo, Formacin del Universo
Potasio, Azufre, Sodio, Magnesio, Cloro, Hierro se
denominan oligoelementos (oligos = pequeo) Todava La edad del universo de acuerdo con la teora de Big
hay otro grupo de tomos que estn en cantidades Bang, es el tiempo transcurrido de este fenmeno hasta
mnimas, pero necesarios para formar parte de los seres el tiempo presente. Es de aproximadamente
vivos, y son el Yodo, Manganeso. Cobre, Zinc, Cobalto, 13.600.000.000 aos (trece mil seiscientos millones de
Flor, Molibdeno, Selenio, Boro, Silicio, Oro, etc. se aos.
denominan elementos huella o traza.
La edad de la tierra Los gelogos y geofsicos conside-
ran que esta se fonri aproximadamente hace 4.500
millones de aos, edad calculada mediante tcnicas de
ELEMENTOS QUMICOS CONSTITUYENTES DE LA medicin radiomtrica, se han realizado pruebas de la
MATERIA VIVA presencia de plomo en muestras minerales ricas en
uranio

Oligoeeinentos Elementos Aparicin de la vida Los clculos sobre la presencia de


Biogensicos vida sobre la tien-a, aproximadamente 4 a 3,5 mil millo-
huella
nes de aos. El aparecimiento de los mamferos se
Carbono Calcio Yodo
calcula en 180 millones de aos. Para los paleontlogos
Hidrgeno Fsforo Manganeso la aparicin de los primates debi ocurrir hace 85 millo-
Oxgeno Potasio Cobre nes de aos. Los primeros de ellos debieron ser unos
Nitrgeno Azufre Zinc pequeos seres que empezaron a vivir en rboles, en
vez de permanecer en el suelo como la mayora de los
Sodio Cobalto
mamferos. Durante el desarrollo evolutivo obtuvieron
Magnesio : Fluor rasgos especiales: buena visin, manos con las que
Cloro Molibdeno pueden sujetar firmemente objetos y un cerebro relati-
Hierro i Selenio vamente grande. Hace aproximadamente 6 o 7 millones
de aos se divide el ancestro comn con los homnidos
Boro
y aparece el hombre calculado en 2 millones de aos,
Silicio aparece el australopitecos, el homo hbilis, homo erec-
Oro tus.

Cuadro 2.1. Elementos qumicos constituyentes de la El homo sapiens neandertales es una especie humana
materia viva desaparecida, se calcula que vivi entre 250.000 aos y
28.000 aos, su cerebro desarrollado y su crneo dife-
rente al del homo erectus, su mentn estaba hundido y
COMPUESTOS QUMICOS su constitucin muy gruesa.

En la materia viva hay compuestos qumicos inorg- El homo Sapiens que es la especie a la cual pertenece-
nicos y orgnicos. mos los seres humanos modernos, fechados entre
Los compuestos inorgnicos son todos aquellos que 50,000 y 40,000 aos: unos suponen una antigedad de
forman parte de las cosas inanimadas, generalmente no 70.000 aos. Se han comprobado unos 32.000 aos
contienen carbono en su estructura. Ej. Agua, cloruro de como el hombre de Cro-Magnon. Para los bilogos
sodio, sulfato ferroso, cido ntrico, CO2, etc. todos los seres humanos formados de la misma especie.
20

aunque en distintas razas. Las lineas generales de


distribucin racial se iniciaron en la prehistoria. Lo que LISTA DE AMINOCIDOS P R E S E N T E S EN L SER
dio al hombre moderno su control sobre la tierra no fue HUMANO
su fsico, sino su capacidad de aprovechar y transmitir a
sus descendientes la Informacin cultural por medio del
desarrollo nervioso y su capacidad intelectual. Aminocidos no polares

LA ORGANIZACIN DE L O S S E R E S VIVOS 1. Glicina Gly HOOC-CHH-NHH


2. Alanina Ala HOOC-CHCH3-NHH 3
Constituye la estructura de un organismo vivo que es 3. Valina Val
capaz de cumplir con funciones de Nutricin, reproduc-
4 Leuolna Leu
cin y relacin.
Los organismos estn formados por sistemas y apara- 5. Isoleucina lie i H.a.f.jo-L
tos, estos a su vez formados por tejidos y estos a su vez 6. Triptfano Trip
por clulas. 7. Prolina Pro Cvi liviwi o i
Las clulas estn constituidas a su vez por compuestos
8. Cistetna Cys
qumicos orgnicos, e inorgnicos.
Los compuestos qumicos forman molculas DNA, 9. Metionina Met . 5 14 '^JJOt:,
protena, carbohidrato y estos a su vez formadas por 10 Fenilalanina Phe
tomos.

LOS COMPUESTOS QUMICOS ORGNICOS MS


Aminocidos Polares C^ / - / 1 ) A^C7i :
IMPORTANTES DE L O S S E R E S VIVOS 11 Asparagina ; Asp
12 Glutamina GIn CsHiQ ft'Dj
Son los compuestos orgnicos bsicos:
13 Tirosina tyr
a. Protenas
b. cido nucleicos 14 Serina Ser
c. Carbohidratos 15 Treonina Thr
d. Lpidos o grasas

LAS PROTENAS Con carga elctrica acida


16 cido aspr- Asp
Son los compuestos orgnicos ms importantes de los tico
seres vivos ya que representan el 10% de la masa total
17 cido glut- Glu
y se constituyen en la base estructural y funcional de CSHH/JO^/
mico
todo ser vivo. Son energticas ya que 1 g de protena
produce 4,4 Kcal. Son esenciales en la estructura celular
y en la estructuracin de los tejidos, as una protena Con carga elctrica bsici
abundante es la colgena.
18 Arginina Arg
Tanto es as que G. J. Mulder con razn, dijo que "sin
protenas la vida sera imposible" 19 Usina Lys
20 Histidina His
Algunas protenas son enzimas, que son sustancias que
C6/'^^3(2.L :
aceleran o retardan las reacciones qumicas, son impor-
tantes en los seres vivos, ya que su ausencia determina Cuadro No 2.3. Aminocidos presentes en el organismo
anormalidades y en ocasiones la falta de una enzima, humano
puede ser incompatible con la vida.
Una protena como la hemoglobina sirve para el trans- El alumno completar las frmulas desabolladas de
porte de O2, mientras que otras como las contrctiles de todos los aminocidos del organismo humano
aotina y miosina penniten el movimiento, otras protenas
constituyen el esqueleto de la materia viva. Aminocido:

Las protenas son especficas para cada especie e Frmula de un aminocido


inclusive para cada individuo, pues su formacin est
determinada por la estructura del DNA. Mientras ms H
cercano es el parentesco de familia o especie, ms
parecidas son las protenas, pero no hay dos seres con
I I
HOOC - C - N
una estructura igual de protenas exceptuando a los HOOC-C-NHH I
gemelos homocigticos. I H
R
A las protenas se los denomina compuestos cuaterna-
rios por estar formados de C, H, O, y N. adems presen- ENLACE PEPTDICO Glicina
ta S. frecuentemente se encuentra P, Zn, Fe, Co.
Estn constituidas de largas cadenas de aminocidos, H H
forman polmeros a manera de collares, que van desde
las protenas ms livianas con 49 aminocidos hasta los
HOOC-C-NH(H) + /H^OC-C-NHH =
ms pesados como la protena del virus del mosaico del
tabaco con 5.000 aminocidos.
H
H
I
I
Aminocido: H O O C - C - N H H HOOC - C - / ^ N H . C Q ^ - C - NHH +^20
I I
R
Cuadro No 2.4. Kepresentacin esquemtica de un enlace
Cuadro No 2.2. Estmctura qumica de un aminocido peptdico
21

E s q u e m a d e la e s t r u c t u r a d e u n a p r o t e n a : F i g u r a N o 2.1 E s t r u c t u r a c u a t e r n a r i a d e la h e m o g l o b i n a

DE LAS PROTEINAS
P r o t e n a s s i m p l e s f o r m a d a p o r alfa a m i n o c i d o s
Solu- Amino- Ejem
bili- cidos pos
dad
ALBMINAS Solu- Casi todos Ovoal Hue-
bles bmi- vo,
C u a d r o N 2.5 A m i n o c i d o s y enlace peptdico estruc- en na y suero
tura primaria ; agua seroal
roal-
f , . i Los aminocidos se unen mediante enlaces peptdicos, bmi-
/ a i b ( 3 , - > w j P t i M para f o r m a r pptidos, as d o s a m i n o c i d o s y un enlace na
-yt'o iP-ft J-d PP'''^' u n p p t i d o , si h a y d o s e n l a c e s peptdicos GLOBULI- Inso- Casi todos Lac- Le-
J T(i P f 'f " e s u n d i p p t i d o , t r e s e n l a c e s p e p t d i c o s es u n t r i p p t i d o , NAS lubles toglo- che
4^ pokfhds m u c h o s enlaces peptdicos es un polipptido. Cuando en bulina,
l ' j ^ m s d e 4 9 a m i n o c i d o s o 5 0 e n l a c e s p e p t d i c a s es agua, sero-
4?+ -> f^Oit.{)l . una protena. Las protenas se clasifican en protenas si sol. globu-
simples y protenas compuestas o conjugadas. Sali- lina
Las protenas simples pueden ser de estructura prima- nas
ria, s e c u n d a r i a , t e r c i a r i a y c u a t e r n a r i a . GLUTELINAS Solu- Casi todos Pro- Trigo
ciones tena
Estructura primaria de las protenas acidas del
y gluten
L a s p r o t e n a s t i e n e n u n a estructura primaria cuando del
alcali-
estn dispuestos los a- aminocidos en forma lineal,
nas trigo
p e r m i t e d e t e r m i n a r el t i p o , el n m e r o , d e a m i n o c i d o s y
PROLAMI- Solu- cido Glia- Maz
el o r d e n e n q u e e s t n c o l o c a d o s . Si la disposicin de un
NAS bles glutmico dina,
aminocido, falta o es reemplazado por otro, la protena
en zena
adquiere diferente estructura ylo funcin.
al-
U n e j e m p l o d e l c a m b i o d e las p r o p i e d a d e s d e las p r o t e -
cohol
n a s s e v e e n la d r e p a n o c i t o s i s , e n d o n d e hay una
HISTONAS Solu- Histidina y Nu- Clu-
s u s t i t u c i n e n la c a d e n a b e t a , p o s i c i n 6, d e la v a l i n a
bles lisina cleo- las
p o r el c i d o g l u t m i c o q u e e s el n o r m a l . El r e s u l t a d o e s
en pro-
u n a r e s i s t e n c i a a la m a l a r i a , o p a l u d i s m o . P e r o d a a l t e -
agua tenas
r a c i o n e s e n la c o n s t i t u c i n d e la h e m o g l o b i n a cuando
hay pobre tensin de O x g e n o , f o r m a n d o una sustancia : y
g e l a t i n o s a d e la h e m o g l o b i n a q u e d a al e r i t r o c i t o una - alcali-
f o r m a d e h o z . C o m o p r o d u c t o d e lo a n t e r i o r el e r i t r o c i t o nas
no circula y no puede transportar adecuadamente el PROTAMI- Solu- Arginina Sal-
oxgeno. NAS bles mina
en
Estructura secundaria agua
Esta dado porque lasjadenas l i n e a l e s ) l e aminocidos ESCLERO- Inso- Abundan Que- Co-
q u e f o r m ^ una proteina se unen m e d a n t e ( g u e n t e s de PROTENAS luble los de ratina,
h i d r g e n o j ^ a n d o l u g a r a c a d e n a s a l f a , c u a n d o la u n i n en estructura flbro-
es sencilla, generalmente forman protenas tensiles e n todos sencilla na,
f o r m a d e e s p i r a l e s , la u n i n e n f o r m a d e l m i n a s da los elastl-
lugar a cadenas beta. reacti- na
vos
E s t r u c t u r a terciara comu-
S e v u e l v e m s c o m p l e j a , c u a n d o las c a d e n a s alfa y b e t a ; mu-
se unen para formar estructuras tridimensionales, unidas \s
por puentes bisulfuro.
C u a d r o No 2.6. Clasificacin d e las protenas s i m p l e s
Estructura cuaternaria
Es t a m b i n estructura globular, c u a n d o varios complejos
terciarios se unen para formar una protena c o m o el CLASIFICACIN D E L A S P R O T E I N A S C O N J U G A -
c a s o d e la h e m o g l o b i n a , o d e las i n m u n o g l o b u l i n a s . DAS
Protenas conjugadas: protena simple ms g r u p o
prosttico
Grupo Ejemplo Bus-
prosttico car
otros
ejem
pos
FOSFOPRO- cido fosf- Casena,
TElNAS rico vitelina
GLUCOPRO- Carbohidra- Glucosami-
TENAS tos noglicanos
22

NUCLEOPRO- cidos Protenas Funcionales: al constituirse como enzimas o como


TENAS Nucleicos del RNA, inmunoglobulinas o protenas contrctiles que pro-
DNA ducen movimiento.
PORFIRINO- Metaloporfi- Clorocruori-
PROTENAS rinas nas a) Enzimas: se denominan tambin biocatalizadores,
HEMOPROTE- porque intervienen en las reacciones qumicas pro-
Hierroproto- Mioglobi-
duciendo retardo o aceleracin de los millares de
NAS ; poflrinas nas, henno-
procesos bioqumicos. La falta de una enzima pro-
globina
voca trastornos, como el caso de la enfermedad de
CLOROFILO Magnesio Citocromos Tay-Sachs en donde la falta de una enzima que es
PROTENAS porfirinas clorofilas la acetilhexosaminidasa especfica, provoca la
METALOPRO- Metal Insulina acumulacin de un ganglisido, las clulas afecta-
TENAS (Zn), arvhi- das dejan de funcionar y pueden morir por ejemplo
drasa car- las neuronas.
bnica (Zn),
hemociani- b) Inmunoglobulinas o anticuerpos, constituidas por
na (Cu), protenas encargadas de defender al organismo del
Ferritina ataque de antgenos o sustancias extraas, de na-
(Fe) etc turaleza tambin proteica. El papel es la defensa
LIPOPROTEl- Lpidos Lipoprote- del organismo al anular la accin del antgeno.
NAS nas sricas Pueden ser Usinas, precipitinas, opsoninas, etc.
PROTEO LPI-
DOS c) Protenas contrctiles: Como la miosina y la
actina en las clulas musculares, cuya interaccin
produce movimiento. Protenas como la hemoglo-
bina, son tambin funcionales, al transportar el
PROTENAS DERIVADAS DE DEgRAQAClN DE Oxgeno.
PROTENAS
d) Hormonas como las hormonas tiroideas, la adre-
PRIMA- Caractersti- Albmina de nalina y la noradrenalina,
RIAS cas de solubi- huevo coagulada, e) Neurotransmisores: como la serotonina
lidad diferente protenas desna- f) Pigmentos
turalizadas g) Vitaminas
SECUN- Producto de Proteosas, pep-
DARIAS hidrlisis tonas, polippti-
parcial de las dos
protenas

Cuadro No 2.7. Clasificacin de las protenas conjuga-


das

Funcin de las protenas:

Las protenas son degradadas en el tubo digestivo, <Sj


gracias a la presencia del jugo gstrico, jugo pancretico
y entrico, que contienen enzimas que rompen los
enlaces peptdicos y dejan los aminocidos libres y
fciles de absorberlos. Las protenas son asimilables si
estn cocidas, de otra manera se dificulta su asimila-
cin, por ejemplo la harina de soya es asimilable si es
calentada. Las protenas del huevo se utilizan mejor si el
huevo es cocinado.

Las protenas cumplen con las siguientes funciones:


1. Estructural es decir constituyen parte del citoes-
queleto, son sustancias importantes en la forma-
cin de las membranas celulares y constituyen par-
te del citosol. Se encuentran estructurando los teji-
dos, como la sustancia fundamental del tejido co-
nectivo. Los aminocidos obtenidos de los alimen-
tos deben ser reestructurados por el cdigo genti-
co, de ah la importancia de alimentarse con pro-
tenas que contengan todos los aminocidos sobre
todo lo relacionado con los aminocidos esencia-
les, que son aquellos que el organismo no puede
sintetizados, los aminocidos secundarios, pueden
ser convertidos por accin qumica del organismo.

2. Energticas: porque se pueden combustionar para


producir calor y por ende trabajo, pero son los car-
bohidratos quienes cumplen principalmente este
papel. El organismo utiliza las protenas como fuen-
te energtica solo en casos especiales
t
23

LOS CARBOHIDRATOS Cumplen funciones:

Los Carbohidratos o hidratos de carbono se denomi-


Energticas, uno de los carbohidratos m s aprovecha-
nan as porque presentan una frmula qumica global
ble es la glucosa. Su combustin produce 4 Kcal que es
que es Cn (H20)n, esto no quiere decir que estn consti-
menor que las caloras que producen las protenas o las
tuidas por agua y carbono, simplemente su frmula
grasas, sin embargo el organismo utiliza a los carbohi-
condensada indica que por cada molcula de carbono,
dratos (glucosa) como de primera lnea en el sentido
hay dos molculas de hidrgeno y una de Oxgeno. Se
energtico. Se debe fundamentalmente porque su com-
denominan tambin glcidos o azcares porque la
bustin es completa y se disipa en CO2 y H2O
mayora de ellos son dulces.
Reserva como el almidn en clulas vegetales y el
Se clasifican en carbohidratos simples o monosacri-
glucgeno en clulas animales.
dos y carbohidratos compuestos o polisacridos. Ade-
Estos carbohidratos compuestos se transforman en
ms hay carbohidratos complejos
carbohidratos simples (glucosa).
Los almidones abundan en gramneas como el maz, el
Los carbohidratos son compuestos terciarios porque
trigo, el frjol, etc.
estn formados principalmente por C, H y O; ocasional-
Los carbohidratos se consideran como de reserva debi-
mente se puede encontrar carbohidratos con Azufre y
do a que su principal representante, como es la glucosa,
Nitrgeno. Sus funciones son energticas, de reserva y
al llegar al organismo se acumula en el hgado en forma
estructurales
de glucgeno, cuando el organismo necesita de glucosa,
el glucgeno heptico se transforma nuevamente en
glucosa. El exceso de glucosa que no se puede acumu-
CLASIFICACIN DE L O S CARBOHIDATOS
lar como glucgeno, se transfonna en grasas y as se
1. Monosacridos acumula y se guarda, para nuevamente en determina-
Azcar Ejemplos Ejemplos dos casos, las grasas se transforman en carbohidratos,
Frmula Aldosas cetosas mediante un mecanismo de neoglucognesis.
qumica
Estructurales, ya que constituyen la quitina, el cido
Triosas C3H6O3 Glicerosa Dihidroxiace- cendro itin sulfrico, el cido hialurnico en algunos
tona tejidos que describiremos posteriormente, adems en la
Terro- C4HBO4 Eritrosa Eritrulosa clula fomna el glicocliz.
sas Siendo la glucosa, el carbohidrato ms importante lo
Rento- Ribosa Ribulosa que describiremos y a partir de ella, al resto de carbohi-
CSHMOS Y
sas Desoxirri- dratos.
CSHIQOA
bosa
La glucosa.
H exo- Glucosa Fructosa
sas Es el carbohidrato ms comn y el ms importante
Hepto- C7H14O7 Sedoheptulo- desde el punto de vista energtico, de frmula conden-
sas sa sada C6H12O6 Ce (H20)6. Se presentan en fnnula
2. M o n o s a c r i d o s derivados desarrollada como aldehido o como cotona. De la si-
guiente manera:
Azcares
aminados
Azcares
alcoholes

O O
Azcares
cidos
Esteres O:
3. O l i g o s a c r i d o s I
tDH- C- H
Disacri- C Sacarosa
dos (H20)-, Lactosa
I
C2 (H2O) l^yialtosa H- C- OH
I
d)H- C- H
4. P o l m e r o s de m o n o s a c r i d o s simples o P o l i s a c -
ridos I
Almidones (C6H12O6 (Glucosa)n DH- C- H
. )n ^ I
Glucgeno (C6H12O6 (Glucosa)n CH2OH
)n
5. P o i m e r o s de m o n o s a c r i d o s derivados o polisa-
c r i d o s complejos
cido hialurni-
co D-glucosa L-glucosa
Condroltin
Cuadro No 2 . 9 . Representacin qumica de varias hexo-
sulfato
sas, frmula aldehdica y esquemtica, los OH estn
representados por las barras horizontales.
Cuadro No 2.8. Clasificacin de los carbohidratos
24
Estructura c c l i c a de la glucosa
r CH20H
Los monosacridos que contienen ms de cinco tomos cmoH -1 n
de Carbono, estn formados por estructuras cclicas o
tautomricas (es decir guardan equilibrio o transforma-
cin reversible con ismeros de estructuras parecidas)
la glucosa se presenta en forma aldehidica como est
/r
representado amba, o tambin en forma cclica o tauto-
mrica

CH20H CH2OH CH20H


-1 o ^-1 o -J- o

I I

Cuadro No 2.11 Representacin esquemtica de un


disacrido y de un polisacrido.
H H OH
I
c=o C- ^
C L A S I F I C A C I N DE L O S CARBOHIDRATOS
I 1. Monosacri- Triosas Glicerosa C3H6O3
H C OH
HCOH dos
I
I
OH OH Tetrosas Eritrosa CHaO
OHCH
I
I Pentosas Ribosa Cs H10 O 5
H C H OH Hexosas Glucosa C6H12O6
HCOH
I galactosa
I
Fructosa
HCOH
I I Maosa
I
HCOH HC
I 2. Monosacri- Azcares
I
CH2OH dos derivados aminados
CH2OH
Azcares
Cuadro No 2.10 Estructura cclica de la glucosa alcoholes
Azcares
cidos
Esteres
3. oligosacri- Disacridos Maltosa,
Estereoisometria si se comparan las frmulas conden-
dos sacarosa
sadas de la glucosa, maosa, galactosa las tres tienen
Lactosa
la frmula C6H12O6, un grupo alcohlico, un grupo al-
Trisacridos
dehido CHO. Sin embargo las tres tienen diferentes
propiedades fsicas, qumicas y biolgicas. Esto ltimo
puede explicarse en la distribucin espacial de los OH y 4. Polisacridos Almidones
H en los cuatro carbones intermedios Glucgeno
celulosa
Por tener la misma frmula consensada a cada uno de 5. Polisacridos cido hialu-
los tres se les denomina estereoisomtricos complejos rnico
Acido condro
itin sulfrico
CH20H CH20H
LOS D I S A C R I D O S

Los disacridos se forman por la unin de dos azcares


simples por ejemplo la maltosa tiene 2 molculas de
glucosa, aunque la maltosa no existe libre en la natura-
leza, se fonna cundo la amilasa salival o pancretica
actan sobre el almidn en el momento de la digestin.
La lactosa es la unin de una glucosa con una galacto-
sa, se forma en las glndulas mamarias de los mamfe-
ros y por lo tanto se encuentra en la leche.
La glucosa puede unirse con otras molculas de glucosa La sacarosa es la unin de una glucosa m s fructosa,
u otras hexosas para formar disacridos (como la lacto- abunda en los jugos de plantas como la caa, la remola-
sa o azcar de leche, formado de una glucosa ms una cha, la pina. Desde el punto de vista Industrial tiene
galactosa. La sacarosa formada de glucosa m s fructo- importancia este conocimiento.
sa. La Maltosa fonnado de dos molculas de glucosa) o
polisacridos (como el glucgeno, el almidn, la celulo-
sa, etc. formado de muchas molculas de glucosa.)
25

LOS POLISACRIDOS glucosa a partir de lpidos o protenas el proceso se


Son azcares compuestos de muchas molculas de denomina gluconeognesis.
glucosa, entre los principales se encuentran los almido-
nes, el glucgeno y la celulosa La celulosa que tambin es un polmero de la glucosa,
no es aprovechada por el hombre por carecer de enzi-
Almidones mas que desdoblen la molcula, sin embargo una mi-
nscula parte puede ser desdoblada a glucosa en el
Los almidones son polisacridos formados por la unin intestino humano, pero esta accin se debe ms bien a
de muchas molculas de glucosa, se encuentra en los la accin bacteriana. En los animales herbvoros hay un
vegetales, tanto en la races como en los tallos y las gran desarrollo del ciego y del apndice cecal que con-
hojas, particularmente se encuentran en mayor cantidad juntamente con la flora bacteriana producen celulasas
en las semillas de los cereales Ejm. Maz, frjol, trigo que liberan el disacrido celobiosa y otros productos
Cebada etc. finales como cidos grasos de cadena corta como el
El almidn est formada por una fraccin denominada actico y el propinico y otros como el fnnico, butrico,
amilosa (10 a 20%) y otra fraccin denominada amilo- valrico, los cuales son absorbidos y utilizados. En el
pectina (75%) , dan colores caractersticos con solucio- hombre la celulosa al no ser degradada, forma parte del
nes de Yodo. bolo fecal y contribuye a una buena movilidad intestinal
La amilopectina es el ms compleja en vista de las y favorece el trnsito digestivo
ramificaciones cada 24 a 30 molculas se continan con
ramificaciones hasta de 300 a 350 unidades de glucosa La celulosa
y en forma helicoidal.
La amilosa es ms recta y con menor nmero de ramifi- Es un polmero de la glucosa, se forma de muchas
caciones, son desdobladas por la amilasa salival y la molculas o cadenas de glucosa no ramificantes, puede
pancretica tener entre 300 y 10.000 residuos pero metablicamen-
te el organismo humano no puede aprovechar la glucosa
por carecer de enzimas que las desdoble, si lo puede
hacer los animales vegetarianos

Glucgeno HETEROPOLISACRIDOS

Es un polmero de la glucosa, est fomiado por la unin Los polmeros formados por la unin de monosacridos
derivados constituye una serie de compuestos comple-
jos muy importantes en la estructura y composicin de la
materia viva, as por ejemplo tenemos aquellos que
contienen el cido urnico (como la goma arbiga) que
con el agua forma una solucin viscosa y adherente
que se usa como un coloide protector para preparados
medicinales y alimenticios.

En la materia orgnica viva hablaremos por ejemplo del


cido hialurnico que es un polisacrido muy importante
de molculas de glucosa, aproximadamente entre 125 y
en la composicin de la sustancia fundamental del tejido
22.000 residuos de glucosa. Constituye el principal
conectivo laxo, cuando el residuo contiene galactosami-
polisacrido que se acumula en las clulas animales
na forma el cido mucoitn sulfrico presente en el moco
como el hgado, msculo esqueltico, corazn etc. y
de las mucosas. Otros compuestos son los polisacridos
constituye una sustancia de reserva energtica, por lo
nitrogenados contienen glucosamina, maosa, galactosa
que constantemente se est fonnando a partir de la
y L-fructosa.
glucosa, y metabolizndose nuevamente en glucosa
cuando el organismo lo requiere. Se diferencia del almi-
dn por ser ms ramificado ya que cada 10 molculas
de glucosa se ramifica.
El glucgeno se acumula en las clulas hepticas y
musculares principalmente y se transforma en glucosa
por un proceso llamado glucogenolisis. El hgado es el
rgano ms importante en abastecer glucosa a la san-
gre sobre todo para mantener estables los niveles,
cuando este se ha consumido por efecto de los proce-
sos de combustin del organismo. Igualmente el hgado
es un rgano que capta glucosa y lo guarda en forma de
glucgeno, cuando los niveles de glucgeno se encuen-
tran altos, la insulina puede favorecer la transfonnacin
de carbohidratos en grasas. La acumulacin de gluc-
geno a partir de la glucosa que ingresa con los alimen-
tos, se denomina glucognesis. Si hay formacin de
26
LOSPIDOS un monoglicrido, si se une a dos cidos grasos forma
un diglicrido y si se une a tres cidos grasos fonna un
Denominados tambin grasas, son compuestos qumi- triglicrido.
cos orgnicos insoiubles en agua, son liidrfobos (hidro
= agua, tobos = miedo), son solubles en solventes para CIDOS G R A S O S SATURADOS P A R S
grasas como el ter, el cloroformo, el alcohol caliente, el Frmula qumica N Nombre Nombre siste-
bisulfuro de carbono, etc. Los lpidos ms importantes de comn mtico
en los seres vivos son: las grasas neutras, fosfolpidos, C
esteroides, carotenoides y ceras.
Su funcin es esencialmente energtica y estructural,
CH3COOH 2 cido
actico
Los esteroides que son hormonas, o las vitaminas,
cumplen un papel funcional. Los Lpidos cuando forman CH3(CH2)2COOH 4 cido
el tejido adiposo son amortiguadores fsicos y aisladores butrico
de la temperatura corporal, constituyen una reserva 6 cido n- hexanoico
energtica. Caproico
Con las protenas forman parte de las membranas celu- 8 cido n- octanolco
lares que separan el medio ambiente del interior del caprlico
protoplasma.
10 cido n- decanolco
A los lpidos se los denomina compuestos ternarios por
oprico
estar formados de C, H, y O. Las grasas neutras estn
formadas de una molcula de glicerol y tres cidos 12 cido n- dodecanoi-
grasos. Su frmula qumica es: larico co
14 cido n- tetradeoa-
H mirstico noico
I 16 cido n- hexadeca-
H- C - OH COOH-C-(CH2)-CH3 palmtico noico
I
18 cido n- octadeca-
H - C - OH
esterico noico
I
H - C - OH 20 cido n- eicosanoico
I araqudico
H
Cuadro 2.14 cidos grasos saturados pares

Glicerol cido graso


Los cidos grasos

La mayor parte de los cidos grasos son cidos mono-


Cuadro 2.12. Representacin del glicerol y un cido carboxlicos, cuyo radical alqulico representa una es-
graso tructura de hidrocarburo, en la mayor parte de casos es
lineal y sin ramificaciones. Los cidos grasos pares se
unen al glicerol para formar triglicridos o grasas neu-
tras, ya que los cidos grasos impares como el frmico,
solo existen excepcionalmente y en forma fugaz o en
H O caso del metabolismo Intermedio.
I II Los cidos grasos saturados tiene la frmula qumica
H - C - O - C O - C -(CH2) -Cl)i; CHs (CH2)2COOH.
I Los cidos grasos saturados corresponden a los que
I O presentan cadenas de Carbono (intermedios) unidos por
I II una simple valencia, con dos valencias para el Hidr-
H - C - O - CO - C - ( CH2) - cH geno
I
I o H HH HH H H H H H H H H HH
I II I I I I I I I I I I I I I I I
H - C - o - CO - C - ( CH2)- Clli: H-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-COOH
I I I I I I I I I I I I I I I I
H H H H H H H H H H H H H H H H

Cuando entre dos Carbonos existe una doble ligadura la


prdida de los tomos de Hidrgeno presenta una grasa
Cuadro 2.13 Frmula Del triglicrido y representacin no saturada
esquemtica del triglicrido
H H H H H H H
l i l i I I I
Los Lpidos Simples H-C-C-C =C - C - C - C - COOH
l i l i l
Grasas neutras Las grasas simples o glicridos, repre- H H H H H H
sentan la forma comn de los lpidos, son el resultado
de la esterificacin del glicerol con tres molculas de Los Lpidos se clasifican como se indica en la siguiente
cidos grasos, mediante uniones R-COOR', El glicerol tabla:
se une a tres cidos grasos a partir de los - O H . En
algunas ocasiones los tres cidos grasos son del mismo
tipo como la manteca de cerdo que es la estearina y
posee tres cidos grasos que son cido esterico o
puede estar combinado con otros cidos grasos que son
diferentes. Si el glicerol se une a un cido graso forma

6 t ic
27

etanolamina, e inositol. Los fosfolpidos contienen N y P


CLASIFICACIN DE LOS LPIDOS (Las grasas neutras no la poseen).
1 LIPIDOS SIM Grasas neutras Esteres de
PLES o triglicridos cidos grasos
con glicerol
Esteres de H O
Ceras
cidos grasos I II
con alcolioles H - C - O - C O - C - (CH2) - CH3
diferentes al
I O
glicerol (al-
II
coholes alifti-
H - C - O - CO - C - ( CH2) - CH3
cos, colesterol,
etc.)
I O.H
2 PIDOS Fosfolpidos Lecitinas I
COMPUES- (contienen N (fosfatidil CH2 O P = 0 - ( CH2) - CH2N(CH3)3
TOS P) colina) I
Cefalinas O
(fosfatidil
etanolamina) Represen-
Fosfatidil tacin esquemtica de un fosfolpido
inositoles
Plasmalge-
nos (aoetal
fosftidos)
Esfingomieli-
nas (esfingsi-
dos)
Cerebrsidos o
glucolpidos Glicerol + 2 cidos Grasos c o n inositol y cido
( contienen N fosfrico
pero no P)
Sulfolpidos y
anninolipidos El fosfolpido posee un polo hidrfobo y un polo hidrfilo
que corresponde al cido fosfrico. El fosfolpido se
Lipoprotenas
comporta como un detergente por lo que los polos hidr-
LPIDOS DE- cidos grasos
filos se localizan hacia el interior y el hidrfilo va hacia la
RIVADOS parte externa, con lo que tiene la misma accin de un
Glicerol detergente al formar las pompas de jabn y son esencia-
Aldehidos les para estructurar las membranas celulares.
grasos etc.
Serie del Ter- En las membranas celulares de las eucariotas, el estabi-
SUSTANCIAS Carotenos,
peno lizador de la membrana es el colesterol, las procariotas
ASOCIADAS vitamina A
carecen de l.
A LPIDOS
Serie de las Vitamina K y Los cidos grasos son precursores de muchos
naftoquinolo- tocoferoles lpidos celulares
nas (vitamina E)
Serie esteroi- Esterles. Muchos cidos grasos se acumulan en forma de triacil-
dales cidos biliares, gliceroles dentro del tejido adiposo, los cidos grasos
hormonas que no poseen dobles enlaces entre un Carbono y otro
corticales y Carbono se denominan saturados, aquellos cidos
sexuales etc. grasos que presentan por lo menos un doble enlace
entre los tomos de Carbono se denominan insaturados.
Cuadro 2.15 Clasificacin de los lpidos Muchos dobles enlaces da la caracterstica de cido
graso poliinsaturados. Dos cidos poliinsaturados esen-
ciales son el cido linoleico y el cido linolnico, no
LOS FOSFOLPIDOS pueden ser sintetizados por los mamferos y deben ser
suministrados en la dieta. Los mamferos son capaces
Los fosfolpidos son grasas complejas, fonnadas por de sintetizar cidos grasos comunes.
glicerol, 2 cadenas de cidos grasos y un tercer compo-
nente importante el inositol unido al cido fosfrico.
Son anfipticos (un extremo polar hidrfilo y otro extre-
mo no polar hidrfobo).

Son esenciales en la estructuracin de las membranas


celulares formando los sistemas unitarios de mem-
brana que rodean el protoplasma de la clula, como de
organitos citoplasmticos membranosos como las mito-
condrias, complejo de Golgi, retculo endoplasmtico liso
y rugoso, lisosomas, etc.
Un fosfolpido est formado de una molcula de glicerol
con dos cidos grasos y un grupo fosfato, enlazada a un
compuesto orgnico como por ejemplo la colina, serina.
28

LAS NUCLEOPROTENAS Y L O S CIDOS NUCLEI- azcar. Las bases nitrogenadas pueden ser purinas o
COS. pirimidinas. Las purinas son: la Adenina y la Guanina:
las pirimidinas son: la Timina, la Citosina y el Uracilo
LAS NUCLEOPROTENAS
Las Nucleoprotenas son protenas conjugadas, consti- Las Bases Prinicas o purinas formadas de dos anillos
tuidas por protenas y un ncleo prosttico de cido cclicos uno de
nucleicos. Son de inters primordial por su participacin 6 elementos de tipo pirimdinico y otro de cinco elemen-
en fenmenos de reproduccin celular y la transmisin tos de estructura imidazlica, cuya estructura qumica es
de caracteres hereditarios, as. como tambin en la la siguiente:
sntesis de protenas celulares. La importancia de estas
sustancias se hizo obvia al demostrar la presencia en
los genes que forman parte de los cromosomas. Los
virus filtrables productores de diversas enfermedades en
vegetales, animales y el hombre son estructuras forma-
das de nucleoprotenas, algunos virus son productores
de cncer y se supone que la manipulacin de las n-
cleo protenas podran orientar el tratamiento de esta
lacra.
Las protenas que forman parte de las nucleoprotenas
son del tipo de las Histonas de bajo peso molecular y la
fraccin nucleica de alto peso molecular.

L O S CIDOS NUCLEICOS

Los cidos nucleicos fueron reconocidas como part-


culas intranucleares hace ms de un siglo por Miescher,
quien utiliz glbulos blancos y aisl el material nuclear
que al anlisis qumico result ser una sustancia rica en
Fsforo que no corresponda a ninguno de los compues-
tos qumicos conocidos como protenas, carbohidratos o
grasas
o fosfolpidos, por lo que se le denomin inicialmente
como nuclena. Luego Kossel demostr que era un
compuesto formado por bases nitrogenadas, un
azcar y cido fosfrico. Luego se reconoci que no es
el ncleo el nico sitio en donde se encuentran estas
sustancias por lo que su nombre no es enteramente
exacto.
Pueden ser: la Adenina cuya representacin se hace
con la letra A mayscula, y la Guanina representada por
la G. Se encuentran formando parte del DNA y del RNA.
Otros compuestos purinicos son los derivados del caf,
t, y chocolate y son la cafena, la teofilina y la teobro-
mina.

Las bases pirimidnicas estn formadas de un anillo de


6 elementos, estructurados de la siguiente forma:

Pueden ser: La Citosina representada por la C presente


en el DNA y el RNA. La Timina representada por la T, y
es exclusiva del DNA y el Uracilo representado por la U,
exclusivo del RNA. A ms de las mencionadas podemos
decir que existen otras bases pirimdicas en barbitricos
y otras drogas como la aloxana (utilizada en tratamiento
de diabetes), el tiuracilo utilizada en tratamiento del
hipertiroidismo, y una parte de la molcula de la tiamina.

Bases menores: A ms de las cinco sealadas existen


otras bases nitrogenadas aisladas de diversas fuentes o
Los nucletidos a ms de formar parte de los complejos son derivados metilados de las anteriores como: la 5
cidos son importantes en la actividad celular, as en metil citosina, la 5 hidroximetilcitocina (tpica en algunos
activacin de metabolitos para la sulfatacin, la forma- bacterifagos), la 1 metilguanina, la 6 metiiaminopurina.
cin de CO2 activo, el transporte de metilos, etc.

Los cidos nucleicos estn formados por nucletidos Los azcares presentes en los cidos nucleicos son la
fomnados de un nuclesido ms cido fosfrico. Los ribosa (presente en el RNA) y la desoxirribosa (presente
nuclesidos estn formados de bases nitrogenadas ms en el DNA). Son azcares formados de cinco tomos de
carbono que forman con el oxgeno un anillo de cinco
29

elementos por lo que se les conoce como Rentosas. Al repartirse este material en las clulas hijas, es capaz
Cuya frmula qumica e la siguiente: de seguir manteniendo la misma carga gentica y por
ende la misma funcin.

La duplicacin del DNA se realiza durante el ciclo celu-


lar, en la fase de sntesis. La Adenina siempre se une o
la Timina y la Citosina a la Guanina o viceversa, ntese
que siempre una purina se une a una pirimidina, y en
ningn caso dos purinas o dos pirimidinas, solo puede
unirse la purina Adenina a la pirimidina Timina y la
purina Guanina a la pirimidina Citosina. Esto se debe a
que la Adenina con la Timina se unen mediante dos
puentes de Hidrgeno y la Citosina con la Guanina con
EL DNA Y RNA tres puentes de Hidrgeno, geomtricamente son com-
plementarios y no puede haber equivocacin en la unin
Son compuestos complejos moleculares que transmiten de estas bases nitrogenadas.
la informacin gentica de padres a hijos y son respon-
sables directos de la formacin de protenas en los Los cidos nucleicos:
seres vivos. Estn constituidos por molculas de azcar a) Contienen la informacin para determinar la se-
(la desoxirribosa o ribosa) unidos a molculas de cido cuencia de aminocidos, cuando estn formando
fosfrico y una base nitrogenada (purinas o pirimidinas). una protena
Segn el modelo de Watson, Krlck y Wlikins quienes b) Son parte de las estructuras celulares que selec-
en 1953 propusieron el modelo estructural del ADN, la cionan y alinean aminocidos en el orden correcto
molcula sera comparable a una escalera helicoidal, los a medida que sintetizan una cadena pollpeptdica
brazos de la escalera estaran formados por la desoxirri- c) Catalizan muchas reacciones qumicas fundamen-
bosa unido a una molcula de cido fosfrico. Y los tales, incluida la formacin de enlaces peptdicos
peldaos de la escalera formados por las bases nitroge- entre aminocidos durante la sntesis de protenas
nadas purinas o pirimidinas A, T, C, G.

El DNA es una doble cadena helicoidal, se encuentra Representacin geomtrica de la Adenina, Guanina y la
formando los cromosomas que son visibles durante la Timina y Citosina:
mitosis desde el final de la profase hasta la telofase en
que nuevamente este material gentico se despiriliza,
para formar la cromatina. La secuencia de las bases
nitrogenadas, es una cadena de millones de molculas,
son las que determinan las caractersticas especficas
de cada organismo vivo, estas son responsables de
mantener las caractersticas de una especie, o mediante
mutaciones dar lugar a nuevos organismos o variacio-
nes, lo que provoca el proceso de evolucin. La vida
comenz con seres unicelulares y se diversific en el
reino animal y vegetal y de ah nacieron los seres multi-
celulares dando lugar a la presencia de muchas espe-
cies, no todas han sobrevivido. A lo largo de la historia
de la vida sobre la faz de la tierra, algunas especies
como la de los dinosaurios, los Neandertales etc. Desa-
parecieron y han permitido que otras se adapten al
medio ambiente de la tierra y sobrevivan como el caso
de la especie humana o sapiens sapiens.
17

Siempre se unirn como en un rompecabezas

Para entender el proceso vamos a determinar una se-


cuencia de bases nitrogenadas:

Ejm:ATCGGAGCAATACCATGCGCGAA
TATG.
TAGCC TCGTTATGGTACGCGCTT
ATAC

Cada una de las secuencias de bases nitrogenadas al


romperse en dos tomar una cadena complementaria,
as:

El s - ^ * ^ - - = 2 ^ . - K ^ - - - - i ~ " ^ ^ DNA se ATCGGAGCAATACCATGCGCAATAT


duplica, gracias a que la doble cadena helicoidal se G.
fragmenta en dos, y cada hemiescalera, debe coger
especficamente un nucletido complementario, permi-
tiendo que se formen dos nuevas cadenas que son TAGCCTCGTTATGGTACGCGTTATA
exactamente guales. C...

El RNA a diferencia del DNA, est formado de una sola


cadena helicoidal, en vez de T (Timina) presenta U
30

(Uracilo) y en el mango de la escalera, en vez de desoxi- Formados por tripletos interpretados en la siguiente
rribosa presenta un azcar que es la ribosa, que aunque tabla
tiene cinco tomos de carbono, presenta una molcula
de O2 mas. La replicacion del RNA se realiza de una de AUG es el codn de iniciacin ms frecuente, GUG
las cadenas de DNA durante la interfase y es el respon- suele codificar valina y CUG leucina, pero rara vez estos
sable directo de la formacin de protenas. codones tambin pueden codificar metionina para iniciar
una cadena proteica.
Ejemplo: la primera cadena de DNA y la segunda cade-
na replicacion de RNA, as: LOS CODONES O TRIPLETOS

A T C G G A G C A A T C C A T G C G C A A T G.. Recuerde que existen 4 bases nitrogenadas en las


UAGCCUCGUUAGGUACGCGUUAC. molculas de RNA, que son: A (adenina), G (Guanina),
C (Citosina), y U (Uracilo)
Ejercicios de duplicacin y replicacion:
Las cuatro letras A, U, C, G forman un codn o tripleto
Si una cadena de DNA tiene ia siguiente secuencia formado de tres letras, de acuerdo con la ley de las
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA probabilidades las cuatro letras pueden formar 6 4 com-
Duplique la molcula (DNA) y como sera la rplica binaciones de 3 letras
(RNA)?
El RNAm porta las instrucciones del DNA que especifica Aplicando la frmula matemtica de la ley de Laplace:
el orden correcto de aminocidos, esto lo obtiene el
RNA el momento de traduccin. El RNA de transferencia Probabilidad = nmero de casos, elevado a nmero de
lleva al sitio de formacin proteica el aminocido correc- probabilidades
to. El RNA ribosomal forma parte de la maquinita que
sintetiza las protenas. Nmero de letras o casos 4 (A, U, 0 , G)
Probabilidad de tripletos = 3 (ejemplo AAA, AUC, etc.)
Cdigo gentico de RNA a aminocidos
P=N"' P = N " P=4^ P = 4X4X4 P= 64
Rena los tres tripletos Ejm. AAA y busque el tipo
de aminocido que enlaza, en este caso puede enla- Los codones en nmero de 6 4 , de acuerdo a la tabla
zar He, Thr, Asn, Ser anterior son capaces de unir un aminocido especfico,
cuando el RNAm, pasa por el ribosoma que tiene un
U C A G RNAr. El RNAt o cido Ribonucleico de transferencia,
lleva al aminocido especfico de acuerdo a la tabla
Fen Ser Tyr Cys U anterior.
Fen Ser Try Cys C
El anticodn se encuentra en el RNAt y debe ser com-
u Leu Ser Termina Termina A
Leu Ser Termina Trp G plementario al codn, as si el codn es AAA, el antico-
dn deber ser UUU. Si el codn es GGG el anticodn
ser GCC y as sucesivamente.
Leu Pro His Arg U
Leu Pro His Arg C El responsable de toda la cadena de sucesos, hasta la
Leu Pro Glu Arg A formacin de la protena es el DNA. El DNA replica una
c Leu Pro Glu Arg G molcula de RNAm, la cual sale del ncleo al citoplasma
Meti en forma de una hebra con los tripletos o codones de-
"11 Thr Asn Ser U terminados, la cadena de RNAm sufren un proceso de
lis Thr Asn Ser C depuraciones de intrones y exones a nivel del ncleo,
los exones salen con codones o tripletos que toman
lie Thr Lys Arg A especficamente un aminocido, para enlazarlo en forma
A Meti Thr Lys Arg G determinada y formar una protena especfica. El DNA
inicio es especfico para cada individuo, y por lo tanto forma
protenas especficas, de acuerdo al cdigo gentico.
Val Ala Asp Gly U
Val Ala Asp Gly C La traduccin consiste en el fenmeno descrito ante-
riormente, es decir tomar los aminocidos especficos
Val Ala Glu Gly A para formar una protena determinada que es propia de
G Val Ala Glu Gly G cada individuo.
Metioni-
na
31

CAPTULO III

LA CLULA

La clula es la unidad estructural y funcional de todo ser


vivo. De acuerdo con la teora celular de Schieiden y
Schwann en 1839, todo ser vivo proviene de otro ser
vivo y todo ser vivo o est formado por una o ms clu-
las. De aqu parte, una discusin sobre si los virus son
organismos vivos o no, ya que los virus no tienen una
estructura celular.

CLASIFICACIN DE L A S CLULAS

Aunque se puede encontrar muchos tipos de clasifica-


ciones de clulas, la primera, es clasificar a las clulas
en clulas procariticas y clulas eucariticas

LAS CLULAS PROCARITICAS

Las clulas procariticas son aquellas clulas que per-


tenecen a las bacterias y algas azul verdosas, es decir
son clulas primitivas, carecen de cubierta nuclear, por
lo tanto no tienen ncleo. El que carezcan de ncleo no
quiere decir que no tengan material gentico, si lo tie- Imagen de Schericha Coli
nen, pero este se encuentra repartido en el citoplasma.
Otra caracterstica importante de las clulas procariti- LAS CLULAS EUCARITICAS
cas es que no tienen todos los organitos citoplasmticos
sobre todo los membranosos, que mencionaremos en Son aquellas clulas que pueblan la tierra, y no pertene-
las clulas eucariticas: como ejemplo, carece de mito- cen a las algas azul verdosas o a las bacterias. Son
condrias. El carecer de mitocondrias, no equivale a decir clulas eucariotas casi todas las clulas de los organis-
que no tengan molculas que produzcan energa, en mos conocidos en la tierra. Por lo tanto todas las clulas
realidad hay enzimas en el citoplasma como citocromo del organismo humano son eucariticas (de EU= bueno,
oxidasas que elaboran energa, vital para poder vivir. y CARIN= ncleo).

Cuando se pintan a las bacterias mediante la tcnica de


GRAM, o AZUL DE METILENO o tcnicas especiales,
obviamente no se podr distinguir el ncleo y el cito-
plasma. Las bacterias se las ve coloreadas en forma citoplasma
uniforme ntegra, es decir no hay coloraciones bsicas y
acidas, como en la eucariticas. cromatina
Se presentan como cocos, bacilos, cocobacilos, vibrio-
nes, espiroquetas, etc.. cubierta nu-
Las clulas eucariticas poseen ribosomas, inclusiones clear
citoplasmticas etc. Las bacterias carecen de cloroplas- nuclolo
tos al igual que las algas azul verdosas, pero tienen
pigmentos fotosintticos localizados en las laminillas por
debajo de la membrana celular Ncleo

Presentan una cubierta nuclear (que es una doble


membrana que rodea al ncleo). Presentan un cito-
plasma y el ncleo en donde queda encerrado el mate-
rial gentico, fundamentalmente el DNA.

En el citoplasma se encuentran organitos membranosos


como: mitocondrias, retculo endoplasmtico, lisoso-
mas,, aparato de Golgi, etc. Algunas clulas eucariticas
tienen cloroplastos que encierran pigmentos fotosintti-
Pared celular Material nuclear cos.

El eritrocito o glbulo rojo que carece de ncleo en la


vida adulta, se la debe considerar como una clula
Cocos eucaritica y de ninguna manera es procaritica ya que
no pertenece ni a las bacterias ni a las algas azul verdo-
sas.

Bacilos Cuando se colorea a las clulas eucariticas se obser-


var el ncleo y el citoplasma. Dentro del citoplasma se

IM
encuentran organitos citoplasmticos como mitocon-
drias, ribosomas, retculo endoplasmtico, aparato de
Golgi, vesculas secretorias, lisosomas, peroxisomas, y
tambin la presencia de inclusiones citoplasmticas
32

como almacenamiento de glucgeno, lpidos, pigmentos alargado perpendicular a la membrana basal. La forma
etc. del ncleo es til para distinguir una clula normal de
otra que podra considerarse como patolgica o neopl-
sica. Tambin la forma disposicin, coloracin del n-
cleo nos permite distinguir la edad de una clula en
particular, as el eritroblasto basfilo ms primitivo pre-
senta un ncleo central, con cromatina condensada;
conforme la clula madura, el tamao del ncleo va
disminuyendo por que la cromatina sufre una condensa-
cin, la cromatina se ve como reticulada, es que la
clula realiza un proceso de picnocitosis, la basofilia del
ncleo es ms intensa. La estructura del ncleo permite
reconocer el estado de la clula durante el proceso de
mitosis, o si esta se encuentra en la fase de interinase
etc.

El ncleo de la clula podra considerarse como el que


comanda todas las actividades de la misma, durante el
perodo de interinase replica RNAm, RNAt y RNAr con lo
que es capaz de dirigir la produccin de protenas, la
clula crece y se encarga de una funcin determinada.
ESTRUCTURA DE L A S CLULAS EUCARITICAS
Durante la mitosis el ncleo duplica el DNA y forma dos
clulas hijas.
A. NCLEO
El ncleo estructuralmente presenta: la cubierta nuclear,
El ncleo debe considerarse como un organito citoplas-
la cromatina, la matriz nuclear vs el jugo nuclear y el
mtico especial, presente en clulas eucariticas y es el
nuclolo.
sector celular, donde se encuentra y mantiene el mate-
rial gentico (DNA), necesario para la trasmisin de
LA CUBIERTA NUCLEAR
caracteres genticos de clulas madres a clulas tiijas.
Est fonnada de una doble unidad de membrana celular,
El nmero de ncleos en una clula, es uno por clula,
la ms interna en relacin con la cromatina del ncleo o
sin embargo hay clulas que presentan varios ncleos
membrana nuclear y una ms externa que se relaciona
como es el caso de los hepatocitos que pueden tener
con el retculo endoplasmtico o cara citoplasmtica.
hasta dos ncleos por clula, igual nmero de ncleos
se encuentra en las fibras musculares cardacas. Las
Mide 7 a 8 nanmetros de espesor. Tanto la membrana
fibras musculares estriadas esquelticas presentan
interna como la membrana externa, con una separacin
varios ncleos y por ello se dice que las clulas son
de 25 nanmetros, por lo que el espesor total es de
multinucleadas. En el caso de los eritrocitos de mamfe-
aproximadamente 40 nanmetros, es decir est fuera
ros no presentan ncleo, porque en su desarrollo lo
del poder de resolucin del microscopio de luz y se
perdieron, al momento de salir por los sinusoides de la
observar en forma real solo con el microscopio electr-
mdula sea, pero las clulas ms primitivas de los
nico. Sin embargo, cuando observamos clulas con el
eritrocitos si tienen ncleo. El material gentico normal
microscopio de luz, podemos determinar con exactitud,
en las clulas es 2n o sea son clulas diploides, en
el sitio donde est localizada la cubierta nuclear y se
algunos casos el material gentico de las clulas es 4n,
debe a que el material gentico perifrico o cromatina
8n, 16n, 32n, o 64n; aunque puede mantener un solo
condensada que est unido a la cubierta nuclear, au-
ncleo. El aumento del nmero normal de cromosomas
menta el espesor y en forma indirecta se observa esta
46 en la especie humana, puede dar lugar a la poll-
estructura celular, adems la diferencia de coloracin
ploidia como es el caso de las clulas superficiales del
del ncleo con el citoplasma, cuando usamos hematoxi-
epitelio polimorfo, o el de los hepatocitos, las neuronas
lina y eosina nos permite delimitar con exactitud el
gigantes tambin presentan un ncleo agrandado y con
ncleo de la clula y el citoplasma.
pollploida, es normal que un megacarioblasto alcance
una pollploida de 64n, su ncleo es gigante. Se debe
La doble membrana de la cubierta nuclear, tiene una
considerar como normales a las clulas poliploides
separacin de 25 nm (nanmetros) y se denomina
descritas, pero en ocasiones ser signo de anormalidad, espacio pernuclear
como ocurre en ciertas clulas tumorales.
POROS NUCLEARES Son orificios especializados de la
El ncleo se localiza en el centro de la clula, pero hay
cubierta nuclear, de forma de tubos octogonales de 90 a
clulas que su ncleo se encuentra desplazado hacia la
100 nanmetros, con una separacin de 100 a 200
periferia, este es el caso de los adipocitos cuyo ncleo
nanmetros por lo que se contaran por miles alrededor
se localiza hacia la periferia, debido a que el gran lbulo
del ncleo. Permiten el intercambio de material entre el
de grasa lo desplaza, en el caso de las fibras muscula-
ncleo y el citoplasma o viceversa, como es el paso del
res estriadas esquelticas tambin el ncleo se localiza
RNA del ncleo al citoplasma o la entrada de purinas y
hacia la periferia.
pirimidinas del citoplasma al ncleo con el fin de propor-
cionar el material necesario para las sntesis de nuevas
La fonna del ncleo generalmente es esfrico, sin em-
molculas de DNA o la replicacin del RNA.
bargo algunas clulas presentan una forma distintiva,
cosa que permite el reconocimiento de esas clulas, as
Al observar al microscopio electrnico se ha visto una
el macrfago presenta un ncleo de forma arrionada, el
membrana o especie de diafragma que impide que el
ncleo de los neutrfilos es multi segmentado. Cuando
paso de sustancias se realice en forma indiscriminada.
observamos clulas al microscopio, es fcil distinguir el
Recuerde que una de las propiedades del sistema unita-
ncleo pero no se observa el citoplasma, un ejemplo de
rio de membranas es el de tener permeabilidad selec-
cmo distinguir los tipos de clulas es precisamente
tiva y no debe describirse como que las membranas
observando la forma del ncleo, as en los epitelios
tienen una semipermeabilidad.
planos el ncleo es aplanado o alargado, paralelo a la
membrana basal, las clulas cbicas presentan ncleo
redondeado y las clulas cilindricas presentan el ncleo
33

A l h a b l a r d e p e r m e a b i l i d a d s e l e c t i v a q u i e r e d e c i r q u e la indistinta e i n d i f e r e n c i a d a ; a la luz d e los c o n o c i m i e n t o s


c l u l a s o l o p e r m i t e el p a s o d e s u s t a n c i a s q u e t i e n e n actuales se cree que este esqueleto que es similar al
receptores especiales o protenas de transporte, no e s q u e l e t o del c i t o p l a s m a , e s t p e r f e c t a m e n t e d i s e a d o y
permite que cualquier sustancia por pequea que sea servira c o m o b a s e para la l o c a l i z a c i n d e los o r g a n i t o s
I n g r e s e a la c l u l a . El p a s o d e s u s t a n c i a s r e q u i e r e u n c i t o p l a s m t i c o s y n u c l e a r e s . C u a n d o un v e h c u l o a t r a -
t r a n s p o r t a d o r , un t a m a o a d e c u a d o y u n p H a d e c u a d o v i e s a la c i u d a d , lo d e b e h a c e r por las c a l l e s o a v e n i d a s ,
n o s a l e por d o n d e q u i e r a . U n o r g a n i t o o s u s t a n c i a s al ir
El p a s o d e las s u b u n i d a d e s d e R N A d e s d e el n c l e o al d e u n sitio a o t r o d e l n c l e o n e c e s i t a n h a c e r l o por e s p a -
c i t o p l a s m a e s p o s i b l e , d e b i d o a s u t a m a o p e q u e o , al cios definidos.
llegar al c i t o p l a s m a , las s u b u n i d a d e s f o n n a n u n i d a d e s El e s q u e l e t o del n c l e o p e r m a n e c e m s o m e n o s e s t a -
m s g r a n d e s 4 0 S Y 6 0 S y e s t r u c t u r a n los r i b o s o m a s . ble d u r a n t e la i n t e r f a s e c e l u l a r , p e r o c u a n d o e n t r a e n
L o s r i b o s o m a s n o p u e d e n r e g r e s a r del c i t o p l a s m a a l d i v i s i n c e l u l a r por m i t o s i s , e s t a s p r o t e n a s s e r o m p e n y
n c l e o , d e b i d o a s u t a m a o . C o m o los r i b o s o m a s s i n t e - p e r m i t e n la d e s a p a r i c i n d e la c u b i e r t a n u c l e a r y el
t i z a n p r o t e n a s , e s t a s s o l o s e p r o d u c e n e n el c i t o p l a s m a . n c l e o y el c i t o p l a s m a a p a r e n t e m e n t e m s libres p e r m i -
t e n la f o m n a c i n d e l a p a r a t o m i t t i c o a partir d e los
Estructura del ncleo en las clulas eucariticas centriolos

Poro nuclear
LA CROMATINA Y S U S COMPONENTES.

Membrana nu- La c r o m a t i n a c o n s t i t u y e t o d o el m a t e r i a l c o m p l e j o i n t e n -
clear s a m e n t e b a s f i l o q u e s e pinta d e c o l o r a z u l c u a n d o s e
^''^ romatina con- c o l o r e a la c l u l a c o n H e m a t o x i l i n a - E o s i n a ( H E ) , ( r e c u e r -
densada en d e q u e c r o m o q u i e r e d e c i r c o l o r ) . M e d i a n t e la r e a c c i n
V forma de granu- d e F e u l g e n s e p u e d e d e t e r m i n a r la p r e s e n c i a del D N A
los
La c o m p o s i c i n d e la c r o m a t i n a e s t d a d a p o r D N A ,
Cromatina perif- RNA, nucleoprotenas complejas llamadas Histonas y
otras protenas llamadas no histonas.

D u r a n t e la i n t e r f a s e c e l u l a r , la c r o m a t i n a p u e d e e s t a r
Nuclolo c o m o cromatina c o n d e n s a d a o c o m o cromatina despirili-
Cromatina extendida z a d a , p e r o e s t e m a t e r i a l d u r a n t e la m i t o s i s o d i v i s i n
celular cualquiera va sufriendo un proceso de c o n d e n -
sacin y aparecen estructuras filamentosas denomina-
El c o m p l e j o d e p o r o e s t f o r m a d o por los poros n u c l e a - d a s c r o m o s o m a s ( c r o m o = color, s o m a = c u e r p o , d e a h
res, la m e m b r a n a i n t e r n a y m e m b r a n a e x t e r n a n u c l e a r , y que c r o m o s o m a quiera decir cuerpos coloreados. La
las c o n d e n s a c i o n e s d e c r o m a t i n a y d e p r o t e n a s a u n o y c r o m a t i n a t a m b i n f o r m a el n u c l o l o q u e s e r d e s c r i t o
o t r o l a d o d e la c u b i e r t a n u c l e a r . mas tarde.
H a c i a el n c l e o , la c r o m a t i n a f o r m a u n a e s p e c i e d e
c a l l e j n o c a n a l y e n el lado d e l c i t o p l a s m a e x i s t e u n a L a c r o m a t i n a q u e e s p a r t e e s e n c i a l del n c l e o , p r i n c i -
c o n d e n s a c i n d e p r o t e n a s c i l o p l a s m t i c a s . H a r a lo p a l m e n t e c o n t i e n e el m a t e r i a l g e n t i c o D N A , s e clasifica
m i s m o q u e el p a s o d e u n ro a t r a v s d e un s i s t e m a e n c r o m a t i n a p e r i f r i c a , o libre e n el n c l e o , d e p e n d i e n -
m o n t a o s o , p e r m i t i e n d o el flujo d e un l a d o a o t r o , s o l o d o d e la l o c a l i z a c i n .
q u e e n el c o m p l e j o d e p o r o p u e d e h a b e r el p a s o d e
s u s t a n c i a s e n los d o s s e n t i d o s . A t r a v s d e l c o m p l e j o d e L a c r o m a t i n a p e r i f r i c a s e localiza e n e l interior d e la
p o r o p a s a n s u s t a n c i a s e n f o r m a s e l e c t i v a d e un d i m e - m e m b r a n a interna n u c l e a r . . L a c r o m a t i n a libre f o r m a
t r o m x i m o d e 15 n m . t o d o el r e s t o del n c l e o . L a c r o m a t i n a n u c l e o l a r e s t
c o n f o r m a n d o p a r t e del n u c l o l o
MATRIZ NUCLEAR
La cromatina se clasifica en eucromatina y heterocromati-
Denominado tambin esqueleto del ncleo, est consti- na. La Eucromatina o cromatina buena, o cromatina despi-
t u i d o por P r o t e n a s u n a d e ellas d e d i s p o s i c i n fibrilar rilizada o abierta o extendida, es el material gentico
q u e s e a n c l a n a la m e m b r a n a interna d e la c u b i e r t a funcionante, es de difcil observacin aun con el microsco-
n u c l e a r c o n o c i d a c o m o lmina fibrosa el otro c o m p o n e n - pio electrnico y se considera que son los espacios blan-
t e e s u n a p r o t e n a f i b r o - g r a n u l a r q u e llena t o d o e n c l e o quecinos presentes en el ncleo. La heterocromatina o
d e s d e la l m i n a f i b r o s a h a s t a el c e n t r o del n c l e o , el cromatina condensada no es que sea mala, solo que al estar
tercer c o m p o n e n t e es una protena q u e sostiene al espirilizada o plegada es una cromatina que no funciona,
n u c l o l o . D a r a la i m p r e s i n c o m o q u e e s t a m a t r i z h a c e cuando se quiere que la cromatina funcione se debe abrir o
lo m i s m o q u e el e s q u e l e t o d e a l a m b r e e n la c o n s t r u c c i n despirilizarse, es corno cuando uno tiene un libro cerrado
d e una figura cualquiera. no puede leer sus pginas, para poder leer una pgina de!
libro la debemos desplegar.

La c r o m a t i n a d u r a n t e la m i t o s i s , e s la r e s p o n s a b l e d e
f o r m a r los c r o m o s o m a s , q u e e n c i e r r a n el m a t e r i a l q u e
t r a s m i t e el c d i g o g e n t i c o , a las c l u l a s hijas. L a c r o -
m a t i n a a n t e s d e e n t r a r e n m i t o s i s y f o r m a r los c r o m o s o -
m a s , s e d u p l i c a (en la f a s e d e s n t e s i s ) .

LOS NUCLEOSOMAS

Constituyen pequeos cuerpos condensados de croma-


L o I n t e r e s a n t e del c o n o c i m i e n t o d e e s t a e s t r u c t u r a q u e t i n a , d e 10 n m u n i d o s c o n o t r o s s i m i l a r e s por f i n a s h e -
e s t f o r m a n d o el e s q u e l e t o d e l n c l e o , e s q u e i n i c i a l - bras de D N A de 2 n m y rodeados de protenas tanto
mente se pensaba que estaba formado por una trama h i s t o n a s c o m o n o h i s t o n a s , los n u c l e o s o m a s h a n s i d o
V

34

estudiados por mtodos de cristalografa y Rx y con


microscopio electrnico, se observan fibras de DNA con
un grado de helicacin (especie de espirales unidos
sobre s mismos) unidos mediante 2 protenas histonas
denominadas H2A, H2B, H3 y H4; la H1 es una histona
de enlace que une un nucleosoma con otro.

Esquema de cromosomas metacntrico, sub meta-


cntrico y acrocntrico

E L NUCLEOLO

El nuclolo es una masa de material gentico DNA y


RNA dentro del ncleo, visible en algunas clulas cuan-
do son indiferenciadas; cuando alcanzan un grado de
diferenciacin suelen ocultarse con el resto de material
gentico como en los Linfocitos. La observacin de
nuclolos en los linfocitos significa que estas clulas
estn activadas o son malignas. En las Neuronas clu-
las bien diferenciadas es casi siempre visible debido a
que la cromatina esta casi completamente extendida.
El material gentico del nuclolo es igual en todas las
clulas y tiene como funcin, formar el RNA ribosmico
y como los ribosomas son iguales en todas las clulas el
La cromatina, al tener diferentes grados de espirilamien- DNA fonnador tendr la misma secuencia de bases
to, paulatinamente fonna estructuras ms complejas que nitrogenadas.
terminarn formado la cromatina condensada e inclusive
los cromosomas que son observables en la clula desde El DNA nucleolar est dispuesto en largas tiras, de cada
el final de la profase hasta la telofase, cuando se realiza lado y conforme el estadio en el que se encuentren,
la mitosis. salen a cada lado hebras de RNA y forman una especie
de rbol de navidad, a esta unidad se denomina gen
nucleolar.

El nmero de nuclolos en las clulas es nico, sin


embargo suele esta masa partirse en varios fragmentos
y as determinar un nmero mayor de nuclolos. Los
segmentos de DNA nucleolar se ve durante la mitosis en
los cromosomas de los pares 13, 14, 15, 21 y 22 for-
mando los satlites de dichos cromosomas, por lo que a
estos satlites se les denomina organizadores nucleola-
res Al tenninar la mitosis los satlites son los que reor-
ganizan el nuclolo. / | - r , , ,

En este cuadro
1. U transcripcin de
se ve una micrografia electrnica del cromosoma hu- un on nuclear
mano perteneciente al par 12. Adems es un cromoso- comierua en este
ma sub metacntrico. punto y comienzOT a
matizarse las motcuU
Los cromosomas son dobles y estn unidos por un derRA V
punto central denomina centrmero, presentan brazos 2. La transcripcin del gen
cortos dispuestos hacia arriba (p) y brazos largos dis- nucleolar tennina en esta
puestos hacia abajo (q). En los cromosomas metacntri- punto y acaba la emesis
de las molculas de iflNA
cos los brazos son del mismo tamao. Los cromosomas 3. DNA espaciador entre e i ^
Submetacntricos tienen el centrmero por arriba del gen nudeotar y el siguiente
centro y los Acrocntricos presentan el centrmero 4. Comienza en este punto
cerca del fina. En un cariotipo siempre se disponen los si(iu<ente gen nucleolar
cromosomas con los brazos cortos o p hacia arriba y los
brazos largos o q hacia abajo. Un cromosoma Telocn-
trico, solo tiene brazos largos pero este tipo de cromo- Maduracin de rRNA.- El transcrito primario de RNA
soma no existe en las clulas humanas. ribosomal tiene un coeficiente de sedimentacin de 45 S
(unidad Svedberg) con 13.000 pares de bases nitroge-
nadas. La molcula se fragmenta en otras ms peque-
as de 28 S con 5.000 pares, otra de 18 S con 2.000 y
otras dos molculas ms pequeas que se unen a
35

protenas para formar rbonucleoprotenas. Al pasar el clulas de ratn, proceso que dura unas 8 horas cada
poro nuclear, en el citoplasma organizan el ribosoma ciclo.
con dos subunidades una pesada de 60 S y otra liviana
de 40 S Fase S o de sntesis. La clula entra en un perodo de
duplicacin del material gentico. El DNA es duplica-
Estructura Fina del nuclolo.- El nuclolo contiene a do ntegramente y as al trmino de este perodo la
ms del DNA y el RNA protenas fibrilares y globulares clula ser capaz de repartir el material gentico, en
que forman el esqueleto del nuclolo, estructuran una fomna igual a sus dos clulas hijas. En las clulas de
red esponjosa con espacios blanquecinos (vistos al ratn dura unas 7 u 8 horas.
microscopio electrnico) llenos de jugo nuclear. En el
interior se encuentran los organizadores nucleolares que Fase de G2. La clula est con el material gentico
son capaces de sintetizar el RNA ribosomal, al inicio de duplicado y se prepara para entrar en mitosis, durante
la mitosis conformarn los satlites de los cromosomas este corto perodo de aproximadamente 4 horas en las
mencionados y al trmino de la mitosis formarn nue- clulas en cultivo de ratn, podran prolongar el tiempo y
vamente el nuclolo. especializarse y producir sntesis de protenas. Algunas
clulas podran salir del ciclo celular y especializarse y
CAMBIOS MORFOLGICOS DEL NCLEO QUE IN- no terminar haciendo mitosis.
DICAN LA MUERTE DE LA CLULA.
La mitosis es el siguiente perodo y dura aproximada-
Son La picnocitosis o condensacin del ncleo en una mente 1 hora, en las clulas de ratn. En las clulas
masa cada vez ms pequea oscura y homognea humanas la mitosis dura 1 hora y media aproximada-
dentro del ncleo. La Cariollsis o disolucin del ncleo mente
y la Cariorrexis o destruccin con fragmentacin del
ncleo. Considerar estos cambios es til en la observa- Estado de GO, Se refiere a clulas que han entrado en
cin celular y de tejidos, por ejemplo cuando se obser- un estado de quiescencia o reposo y que han salido
van epitelios estratificados con queratina, las clulas del ciclo celular. Difcilmente estas clulas reinician la
superficiales condensan el ncleo y es indicativo de que mitosis, podran quedar como clulas madres dormidas
la clulas est condenada a morir, en el caso del eritro- e inclusive alcanzar un grado de diferenciacin celular.
cito el ncleo antes de ser expulsado debe condensarse No debe confundir con una clula que entra en una
paulatinamente, otra indicacin de que la clula est etapa de diferenciacin completa o clula especializada
condenada a morir. que ya no entrar en mitosis.

No confundir la picnocitosis con clulas en proceso de En todo caso se habla de ciclo celular a los cambios que
mitosis, en la profase temprana la cromatina se conden- ocurren en un clon de clulas, durante un determinado
sa para formar los cromosomas, pero las imgenes no perodo, quedando la clula lista para una nueva divisin
son regulares y homogneas, en este caso se ven celular. Cuando estas clulas entran en un proceso de
masas con espculas perifricas. diferenciacin las clulas se clasifican en clulas catego-
La desorganizacin del citoplasma tambin pudiera ra 1, 2 o 3.
indicar muerte de la clula.
CLASIFICACIN DE L A S CLULAS ESPECIALIZA-
CICLO CELULAR DAS SEGN LEBLOND

Cuando las clulas estn en divisiones mitticas cclicas Las clulas especializadas o diferenciadas segn Le-
y no han entrado en un estado de diferenciacin celular blond, colaborador de Ham, se clasifican en clulas
se habla de ciclo celular, la clula pasa de un estado de categora 1 o clulas sin capacidad de renovacin,
interfase a otro de mitosis y as sucesivamente. Cuando clulas categora 2 o clulas con poblaciones en cons-
tennlna la mitosis y ha formado dos clulas hijas, se dice tante renovacin y clulas categora 3 o clulas poten-
que est en fase de G 1 (G viene de GAP que en ingls clalmente renovables
significa estado)
CLULAS CATEGORIA 1

Son clulas que han alcanzado un alto grado de diferen-


ciacin celular, despus del nacimiento del nio, ya no
hay clulas madres y las clulas no se dividen. El ejem-
plo tpico de este tipo de clulas son las NEURONAS.
El hecho de que las neuronas no se dividan y que no
sean capaces de dividirse, permite que los procesos de
aprendizaje, queden grabadas en su interior; si las
neuronas se dividiesen el individuo tendra que estar
constantemente en un reaprendizaje.
En la actualidad y con nuevas experiencias sobre clu-
las y clonacin, este concepto puede cambiar, existen
por el momento esperanzas de poder Inducir a las neu-
ronas a un proceso de regresin y consecuentemente
de divisiones o de reemplazo de neuronas daadas con
Durante la fase de G1, la clula suele especializarse y implantes de clulas madres.
formar protenas, con lo que la clula podra aumentar Las neuronas al momento del nacimiento estn en un
de tamao. El DNA replica molculas de RNA y la clula nmero determinado, conforme pasa el tiempo y depen-
produce protenas especficas, pero este mecanismo diendo de factores deletreos, el nmero de neuronas
depende del tipo de clula por ejemplo capacidad para van disminuyendo. Ante la prdida de neuronas el indi-
formar hemoglobina. viduo va perdiendo capacidades y por ello no es lo
Si la clula est en un mecanismo de reproduccin mismo para el nio, para el joven, para el adulto o el
continua duplicando DNA, (fase S del ciclo celular) la anciano aprender un nuevo idioma. Al alcanzar una
clula tiene el doble del material gentico y puede entrar destruccin exagerada de neuronas, se cae en la de-
nuevamente en mitosis, como es el caso de cultivo de mencia senil, solamente amainada por la experiencia
que tiene el individuo.
36

inventarse el TNT, su inventor Novel, al mirar luego la


CLULAS CATEGORA 2 utilizacin de la dinamita, reneg haberla creado.

Son clulas altamente especializadas, no tienen capaci- PLURIPOTENCIALIOAD


dad de dividirse por si mismas, pero tienen clulas
madres que se dividen y reponen a las clulas viejas, a Es una clula que mantiene la capacidad de formar
las que desaparecen o mueren. Un ejemplo de clulas varios tipos de clulas o tejidos, puede ser similar a la
categora 2 son la mayor parte de las clulas especiali- palabra MULTIPOTENCIALIDAD, aunque en realidad la
zadas del organismo. Los glbulos rojos son clulas multipotencialidad puede ser ms restringida como la
categora 2, son tan especializadas que hasta han per- que ocurre con una clula madre de la mdula sea o
dido el ncleo para poder cumplir con su funcin que es Stem Cell, que puede formar todas las clulas de la
el transporte de Oxgeno, al no tener ncleo pierden sangre (Leucocitos, eritrocitos, plaquetas), y se la debe
totalmente la capacidad de dividirse, pero tienen clulas considerar como pluripotencial. La clula madre de la
madres, los eritroblastos, que estn en la mdula y que mdula sea no puede formar por ejemplo msculo u
son capaces de dividirse continuamente para remplazar otras clulas que no sean las sanguneas.
a los glbulos rojos envejecidos o daados, de tal mane- Un mieloblasto ser multipotencial, porque puede formar
ra que la cantidad de glbulos rojos es siempre constan- varios tipos de leucocitos solamente.
te.
UNIPOTENCIALIDAD
CLULAS CATEGORA 3
Es la capacidad que tiene una clulas de formar un solo
Son clulas altamente especializadas, no tienen clulas tipo de clula, ejemplo un eritroblasto que solo producir
madres, pero las clulas diferenciadas son capaces de eritrocitos.
entrar en un proceso de divisin celular por mitosis, en
casos especiales. El ejemplo de este tipo de clulas son Cuando una clula cualquiera se divide, las clulas hijas
las clulas glandulares endocrinas y como ejemplo tpico pueden ser a) Las dos quedar como indiferenciadas b)
las clulas hepticas. El hgado es un rgano noble con La una queda como clula madre indiferenciada y la otra
una capacidad de regeneracin. Si un individuo sufre un se especializa y c) Al tnnino de la divisin por mitosis
accidente con ruptura del hgado y entra a la sala de las dos clulas hijas quedan como clulas diferenciadas
operaciones, el cirujano puede extraer las partes lesio- o especializadas.
nadas y apenas dejar una veinteava parte del hgado.
En pocas semanas el individuo regenera el hgado al Papel del citoplasma en los procesos de diferenciacin
tamao original y seguramente con un nmero parecido celular
de clulas.
Otro ejemplo de clulas categora 3 son las clulas del Se han realizado muchos experimentos, en los que se
bazo o clulas esplnicas. Si por alguna razn un pa- supone que hay factores citoplasmticos que intervienen
ciente es sometido a una esplenectoma (extirpacin del en la adquisicin y mantenimiento de procesos de dife-
bazo) y tiene un bazo supernumerario, que a veces no renciacin celular. Al trmino de la mitosis las clulas
se le ve, por ser inclusive microscpico, en pocas sema- hijas no reciben exactamente la misma cantidad de
nas el individuo tendr un bazo del tamao del extirpa- citoplasma, esto induce a que las clulas hijas vayan
do, las clulas que son categora 3 proliferan y mediante tomando caminos diferentes. Un experimento en 1953
divisiones mitticas repetidas regeneran el bazo. por Carison en neuroblastos de grillos, determin que al
entrar en mitosis se formaban dos clulas una que se
mantena como neuroblasto y otra que se diferenciaba a
P R O C E S O S DE DIFERENCIACIN CELULAR neurona, cuando crey poder definir cual polo iba a
desarrollar el neuroblasto y cual polo la neurona, se le
TOTIPOTENCIALIDAD ocurri invertir el huso mittico y determin que la clula
formaba el neuroblasto y la neurona en los mismos
Una clula totipotencial es aquella que puede formar un sectores antes determinados, con lo que se puede
individuo completo, las clulas totipotenciales son los concluir que hay factores citoplasmticos que inducen o
huevos o cigotos, ya que a partir de esta clula inicial se no la diferenciacin celular.
puede formar un Individuo completo. En ocasiones se
considera a las clulas germinativas como el vulo como Los niveles hormonales y otras influencias micro am-
clulas totipotenciales, ya que en casos de teratomas bientales definen los procesos de diferenciacin celular.
(enfermedad maligna del vulo) se han visto crecimiento Las clulas capaces de diferenciarse con estos factores
desordenado y anrquico de diferentes tipos de clulas se denominan competentes, con el paso del tiempo una
como pelos, dientes, ojos, parte de tejido nervioso, piel clula puede perder su competencia y no diferenciarse.
etc.
Luego de la fonnacin del huevo o cigoto, las primeras Por ejemplo habr un perodo para formar una yema
clulas o blastmeras mantienen la totipotencialidad, en que forme una extremidad, si no se forma en el momen-
realidad esta caracterstica se la conserva hasta la to preciso, ya no se formar luego. Este fenmeno se
tercera divisin celular por mitosis. vio, en la utilizacin de la Talidomida, una tableta para
evitar la emesis de las mujeres embarazadas, el resulta-
Todas las clulas del organismo, tienen el mismo mate- do fue que dieron a luz hijos focomlicos, unos sin
rial gentico y podran desarrollar un organismo comple- brazos o piernas. La talidomida result ser una droga
to, sin embargo solo el cigoto lo puede hacer. teratognica, que impidi la competencia de unas clu-
las para producir las extremidades
En la actualidad se ha experimentado con la clonacin, y
supuestamente cualquier clula podra ser tomada para Algunas clulas pueden tener el perodo de competencia
producir este fenmeno, sin embargo est en fase inicial muy largo, como por ejemplo los linfocitos, que se dife-
de experimentacin y su procedimiento est en la etapa rencian a clulas plasmticas el momento que se en-
de discusin, tanto desde el punto de vista religioso, cuentran con un antgeno al que estuvieron programa-
poltico y filosfico. Lo cierto es que despus de la clo- dos, este encuentro puede ser al ao, 10 aos o 90
nacin de la oveja Doly las puertas estn abiertas y aos, si nunca se une al antgeno las clula puede
probablemente a futuro, se podr usar estas tcnicas quedar indiferenciada para siempre.
con fines mdicos o quien sabe con qu propsitos. Al
37

Por qu las clulas son diferentes y tienen el mis- factor de crecimiento de nen/ios NGF y factores de
mo material gentico? crecimer)to nsuliniformes. Otros factores de crecimien-
to conocidos son la accin de hormonas como la Soma-
Las clulas son de diferente funcin y morfologa muy a totropina, la Tiroxina, la Paratohormona etc.
pesar de que una clula pancretica, una neurona y una Lo interesante es conocer que ciertos segmentos de
clula heptica tienen el mismo material gentico, debi- DNA, que se consideraran como oncogenes, es la base
do a que no presentan el mismo material gentico despi- para la presencia de dichos reguladores o estimuladores
rilizado, es decir el material gentico funcionante es de la mitosis.
diferente, un hepatocito tiene el gen que forma hemo-
globina, pero este se encuentra condensado y no forma Entre los inhibidores de la mitosis se encuentra una
dicha sustancia, igual ocurre con la clula pancretica sustancia denominada chalona, la misma que fue des-
que est determinada para producir enzimas. crita por Ham, en una de sus ediciones, pero que luego
Cuando hay metstasis de clulas malignas, estas se no ha tenido todo el mpetu, en que inicialmente se
localizan en cualquier sitio, si son las pancreticas que mencion.
estn en el encfalo, podran producir enzimas que
mataran a las clulas vecinas. Las chalonas son sustancias inhibidoras de la mitosis,, y
que son capaces de mantener las poblaciones celulares,
REGULACIN DE LA PROLIFERACIN C E L U L A R por ejemplo en el caso del hgado. Si hay una poblacin
EN CLULAS MALIGNAS normal de hepatocitos, no hay formacin de nuevas
clulas, pero al disminuir su poblacin normal (en caso
Las clulas malignas aparentemente no tienen regula- de hgado graso o en camino a la cirrosis), la falta de
cin en la proliferacin y an ms son incapaces de clulas que producen la chalona, incita a la disminucin
mantener la diferenciacin celular. Esto provoca que de este inhibidor y las clulas empiezan a proliferar, esta
formen masas o tumores y que con el paso del tiempo es la razn por la que se considera al hgado como uno
se vuelvan indiferenciadas con mayor ndice mittico, lo de los pocos rganos que tiene capacidad de regenera-
que ocasiona mayores trastornos. cin. Igualmente se ha descrito una chalona epitelial que
sera capaz de regular las poblaciones de clulas epite-
ONCOGENES En la estructura normal del material liales.
gentico, y con el desarrollo de la vida en la tierra, exis-
ten segmentos de DNA que han sido copiados o transfe- MUERTE C E L U L A R
ridos de microorganismos como virus al infectar una
clula. Ese material viral en el proceso evolutivo fue Las clulas del organismo en general no viven todo el
incorporndose al genoma pre existente, quedando tiempo, son reemplazadas por clulas nuevas que se
muchas de las veces como material gentico condensa- producen por la presencia de clulas madres, en el caso
do, no funcionante. Cuando se descubri la capacidad de las neuronas muchas de ellas tendrn que vivir hasta
que tiene un virus de provocar un cncer y conocida la la muerte del individuo ya que no tiene clulas madres
secuencia de las bases nitrogenadas, se encontr que al que las reemplacen y estas no pueden dividirse por
interior de una clula normal, ya exista ese material, a mitosis.
los que se les llam oncogenes con capacidad de pro-
vocar un cncer en un individuo sin necesidad de la La muerte de una clula puede producirse por muchos
presencia del virus provocador factores, una de las causas es la falta de nutrientes y
Oxgeno, pero consideraremos la muerte de la clula por
Como este material queda oculto entre el material gen- factores genticos, es decir muerte programada de las
tico normal, no produce cncer a no ser de que ese clulas fenmeno llamado apoptosis
segmento quede al descubierto o se despirilice, cosa
que puede ocurrir el momento en que por radiaciones u La necrosis, es la muerte de la clula como respuesta a
otros factores, se produzca ruptura de cromosomas, una lesin, como podra ser que el organismo entero
aneuploidas, poploidas etc. Al estudiar las clulas haya muerto o fallecido, obviamente las clulas no
cancergenas, se ha visto cromosomas con traslocacio- reciben nutrientes ni Oxgeno. Igualmente se produce en
nes, delecciones, o tambin rupturas de cromosomas u caso de infartos, embolias en la que se pierde la llegada
otras aberraciones cromosmicas. de nutrientes y Oxgeno

Los oncogenes manifiestan su capacidad transformado- La apoptosis es la muerte de una clula, la misma que
ra en primer lugar, cuando un protooncogen antecesor est programada, se encuentra controlada por genes y
sufre una mutacin, que culminar con un cambio cuali- requiere de consumo de energa.
tativo crucial Ejemplo en la gnesis del cncer de vejiga En el desarrollo embrionario muchas de las clulas
del ser humano. En otras ocasiones se suscita un cam- realizan apoptosis, por ejemplo la extirpacin de las
bio cuantitativo, al producir mayor cantidad del produc- membranas que unen los dedos. Otro ejemplo de apop-
to gnico como es el caso de tumores de la lnea de los tosis es la muerte temprana de linfocitos T programados
linfocitos B, en este caso puede haber una explosin de para actuar contra detenninadas protenas, aquellos
la produccin del producto gnico revelado en mayor linfocitos que potencialmente podran daar las prote-
cantidad de una inmunoglobulina, cosa parecida se nas propias del organismo desaparecen por la presencia
produce en la leucemia promieloctica aguda. de la protena en cuestin, as en condiciones normales
no se acta contra las protenas propias del organismo,
REGULADORES DEL CRECIIVIIENTO si por alguna razn los linfocitos se reactivan, surge una
enfermedad denominada autoinmune. Otro ejemplo es
Son sustancias que se producen en el organismo con el la muerte programada de eritrocitos, los mismos que
fin de inducir mitosis y otros que provocan inhibicin de viven aproximadamente 120 das luego de salir desde la
la misma. mdula sea a la circulacin general. En general las
clulas que presentan apoptosis consumen energa y se
Entre los estimuladores de la mitosis y por lo tanto de la presenta cariolisis, el causante son endonucleasas.
proliferacin celular, estn algunos polipptidos y prote-
nas, como el factor de crecimiento epidrmico EGP y es
potenciada por la insulina. Otros estimuladores son: el
factor de crecimiento derivado de plaquetas PDGF. El
factor de crecimiento derivado de fibroblastos FDGF. El

f ' l ' l o c Q.c 0-n


^'7 '" i e
de ce, o a

I
38

REPRODUCCIN CELULAR, DIVISIN CELULAR, que mediante este mtodo, el material gentico trasplan-
REPRODUCCIN DE ORGANISMOS tado a una clula embrionaria, a la cual se le retir el
ncleo, induzca a la clula a entrar nuevamente a un
Fisin binaria proceso de mitosis.
rOIRECT/K Esporulacin
Gemacin TEORAS QUE EXPLICAN PORQUE LAS CLULAS
ASEXUACS
ENTRAN EN DIVISIN WIITSICA
MITOSIS
INDIRECTA 1. INDICE VOLUMEN SUPERFICIE
MEIOSIS
Las clulas no pueden crecer indefinidamente porque al
REPRODUCCION S E X U A L Y A S E X U A L ALTERNADA aumentar su volumen, la cantidad de nutrientes que
ingresan a la clula van disminuyendo y la clula SE VE
Isogmica
SEXUAL Heterogmica
OBLIGADA A FORMAR dos clulas hijas que tengan un
Partenogcntica tamao que le permita captar los nutrientes y Oxgeno
necesario para mantenerse con vida.
Estacas
MULTIPLICACION Acodos
VEGETATIVA Injertos

REPRODUCCION D E LAS C E L U L A S MEDIANTE


MITOSIS Y MEIOSIS

MITOSIS Si consideramos a la clula como un cubo perfecto, y


sacamos el volumen y la superficie, lo relacionamos y
La mitosis es un proceso de divisin celular asexual realizamos clculos matemticos observaremos que la
indirecto, a partir de una clula diploide (2n) y que forma relacin SuperficieA/olumen va disminuyendo paulati-
dos clulas hijas (2n) con un material gentico exacta- namente, por lo que la clula se ve obligada a dividirse.
mente igual, que se produce desde el momento en que Problema: sacar la relacin S/V si la clula es de 1
se fonna el huevo o cigoto, hasta la muerte del indivi- micrmetro de largo, si es de dos micrmetros de largo y
duo. si es de 3 micrmetros de largo
La mitosis es la responsable de la fomnacin de las dos Volumen del cubo es igual a lado x lado x lado (L x L x
primeras blastmeras, luego forma cuatro clulas, ocho L)L'
clulas, diecisis etc. Para fonnar la mrula, blstula, La superficie se calcula o es igual a Lado x Lado x 6 (L x
gstrula. ContiniJa durante el desarrollo embrionario y Lx6)L^x6
fetal, hasta el nacimiento. Contina durante el desarrollo
postnatal, infancia, adolescencia, juventud, adultez, Como se ve, al aumentar el volumen de la clula, la
vejez y hasta la muerte del individuo. Es discutible que superficie que abastece de nutrientes, es cada vez
el individuo despus de muerto pueda realizar mitosis, menor. Por eso la clula entra en un proceso de divisin,
ya que para que se produzca este proceso es necesario para recuperar la capacidad de recibir los nutrientes y el
que la clula tenga un buen aporte de nutrimentos y Oxgeno en forma adecuada.
Oxgeno.
2. PRODUCCIN DE DNA O RNA
La mitosis mantiene la capacidad de hacerio, cuando es
una clula embrionaria, clula madre o aquella que no Cuando la clula est en interfase y tiene un tamao
ha terminado su proceso de diferenciacin celular. adecuado, recibe la cantidad necesaria de Oxgeno para
fonnar RNA, que a su vez le pemnite producir protenas
Cuando una clula madre se divide por ejemplo el neu- y crecer.
roblasto, las clulas hijas podran tener los siguientes
acontecimientos a) que al trmino de la divisin por Al aumentar de tamao la cantidad de Oxgeno es cada
mitosis del neuroblasto se formen dos clulas que tam-
vez menor y la clula, en su afn de ahorrar Oxgeno se
bin sern neuroblastos. b) Que el neuroblasto al termi-
ve obligada a formar Desoxirribosa en vez de ribosa. (La
nar la mitosis una de ellas se diferencie a neurona y la
otra clula hija quede como neuroblasto. c) Que al ribosa tiene un Oxgeno ms que la desoxirribosa).
trmino de la mitosis las dos clulas se diferencien a
neuronas. El ejemplo anterior rige para entender lo que La formacin de desoxirribosa obliga a la clula a pro-
podra pasar con cualquier clula del organismo que ha ducir DNA. y esta duplica el material gentico, es decir
terminado una mitosis. entra en un estado de sntesis (duplicacin de DNA)
y consecuentemente en G2, que le permite hacer mito-
sis.
Las clulas pierden la capacidad de realizar mitosis,
cuando han alcanzado el ltimo grado de diferenciacin Esta es una de las teoras que se explica, en la necesi-
o en casos especiales, cuando ya el camino que les dad que tiene la clula, de dividirse para que su superfi-
queda es simplemente completar su desarrollo; por cie sea capaz de recibir la cantidad suficiente de O2 y
ejemplo el eritroblasto basfilo todava puede dividirse, otros materiales necesarios para la sntesis de RNAr.
pero el eritroblasto acidfilo ya no se dividir por mitosis,
simplemente terminar siendo un eritrocito. Las clulas Por lo tanto al dividirse mantiene la relacin Superfi-
con un alto grado de diferenciacin celular como son las cie/volumen en condiciones ptimas para continuar
neuronas, pierden totalmente la capacidad de hacer recibiendo suficiente cantidad de nutrientes y O2.
mitosis, por lo que hay una regla que dice "a mayor
diferenciacin, menor capacidad de realizar mitosis". Por
el momento esta regla podra romperse, cuando se
habla de clonacin, se ha determinado la posibilidad de
39

ETAPAS DE LA MITOSIS COMT, o centro organizador de micro tbulos, que tiene


el centriolo.
La mitosis es un proceso continuo, pero didcticamente
se la divide en fases, perodos o momentos, que son: El centrmero tambin posee COMT y dar lugar a la
Profase, Metafase, Anafase y Telofase. formacin de microtbulos cromosmicos que se dispo-
nen en entre los pasillos que fonnan el huso acromtico,
PROFASE el resultado es que los cromosomas igual que bombe-
ros, abriendo una escalera, dentro de un pasillo, quedan
El material gentico, DNA principalmente que ta com- el centro de este corredor, por lo que los cromosomas
pletado su duplicacin, inicia un proceso de condensa- se disponen en el ecuador de la clula y es la caracters-
cin paulatino que terminar formando unas estructuras tica de la Metafase.
filamentosas que se colorean fcilmente con Orcena.
(Mitosis = Mito: filamento; Osis: proceso, de ah que METAFASE
mitosis quiera decir proceso filamentoso; Cromosoma
= cromo: color soma: cuerpo. El cromosoma es un Lo ms caracterstico de esta fase es la ubicacin de los
cuerpo que se colorea) Estos hilos, se van enrollando cromosomas en el ecuador de la clula, y es la etapa
cada vez ms y en la siguiente fase sern muy visibles, ms fcil de distinguir, ya que la profase se confunde
mucho ms cuando la clula ha recibido colchicina, con una clula en interfase. En esta fase, los cromoso-
(colchicina = inhibidor de la mitosis por interferencia en mas son ms visibles, por su mayor enrollamiento o
la produccin de dmeros de tubulina y la formacin del condensacin del materia! gentico.
aparato mitsico) por lo que se llaman en este caso Los centriolos llegan a los polos y terminan formando el
cromosomas en metafase C, (c por la colchicina). Al aparato mitsico, estructura importante para la separa-
hacerse visible los cromosomas, como estructuras con cin de los cromosomas d en cromosomas s, cuando se
dos brazos superiores llamados p y dos brazos inferio- utiliza la colchicina o la vincristina o la vinblastina, sus-
res llamados q, unidos por un centrmero. El centrmero tancias que interfieren en la formacin de los dmeros de
puede estar en el centro de los brazos y se llaman tubulina, no se forma el huso acromtico y la mitosis se
cromosomas Metacntricos, si el centrmero est por detiene, en el caso de la colchicina hasta que se meta-
fuera del centro, los cromosomas se llaman Submeta- bolice la droga, y el caso de la vincristina y vinblastina
cntricos y tienen dos brazos cortos (p) y dos brazos por su efecto duradero, es usado en el tratamiento del
ms largos (q). Si el centrmero esta cerca de un extre- cncer.
mo los cromosomas se denominan cromosomas Acro-
cntricos. Un cromosoma con el centrmero en el
extremo toma el nombre de cromosoma Telocntrico,
pero, estos ltimos no existen en los cromosomas hu-
manos.


Ptofase

ANAFASE

La cubierta nuclear (doble membrana que rodea al Los cromosomas homlogos que son dobles y presen-
ncleo) se desorganiza y aparentemente desaparece. tan cuatro hemicromtides, se separan a nivel del cen-
(Debera decirse siempre que la cubierta nuclear se trmero, y cada cromosoma simple con solo dos hemi-
desorganiza). Igual proceso ocurre con el nuclolo, que cromtides, migran hacia polos diferentes. De tal mane-
contiene material gentico, responsable de la formacin ra que sern 23 pares migrando a cada uno de los polos
del RNA ribosomal. Al trmino de la profase, el material celulares.
gentico que constituye el nuclolo, va a formar parte de
los satlites de los cromosomas de los pares 13, 14, 15,
21 y 22. Al terminar la mitosis este material se reestruc-
tura y forma el nuclolo de las nuevas clulas, por ello,
los satlites se les conoce como organizadores ncleo-
lares, pero en una clula en profase el nuclolo aparen-
temente desaparece.

Otro evento importante de la Profase, es que el centriolo


que es un organito cltoplasmtico y que se encuentra en
forma de cuatro microestructuras, se separan de dos en
dos, a cada lado de los polos de la clula con el fin de
formar el aparato mitsico, que est formado por hebras
acromticas, porque no se colorean igual que los cro-
mosomas. El huso acromtico est formado por dmeros
de una protena llamada tubulina y que aparece del
40

En la anafase se produce un estrechamiento a nivel de sin meitica de 23 cromosomas dobles recibe 23 cro-
las zonas interzonales. En este sitio se forma el "cuerpo mosomas simples.
de empuje de Balar" y permite la migracin hacia los
polos de los cromosomas hijos resultantes. La meiosis o proceso de divisin reduccional de una
clula 2n a una clula n cromosomas, en las algas,
TELOFASE musgos y en los hongos se denomina Inicial o Tigtica
ya que el organismo adulto es haploide, al unirse las
Los cromosomas llegan a los polos y el material genti- clulas sexuales se forma un cigoto diploide que iniciar
co, comienza un proceso de despirilizacin o devana- una meiosis para formar una clula adulta n cromoso-
miento que hacen que aparentemente estas estructuras mas. En las angiospermas la meiosis es intermedia o
filamentosas desaparezcan, se forma nuevamente la Esprica ya que el individuo adulto o esporofito u orga-
cromatina de una clula en interfase. Los organizadores nismo adulto es diploide y forma clulas gemninales
nucleolares (satlites de los cromosomas de los pares diploides que se llaman microesporocitos o macroespo-
13, 14, 15, 21 y 22) se agrupan en una o ms masas, lo rocitos y que al realizar meiosis dan lugar a gametos
que da como resultado que reaparezca el nuclolo. La haploides. De la unin de los gametos se vuelve a for-
cubierta nuclear se reorganiza y encierra el material mar un esporofito. La meiosis Terminai o Gamtica es
gentico en una bolsa que es el ncleo. El centriolo que comn en los metazoarios, la clulas somticas 2n
era doble (1 par) se divide en dos pares (4 centriolos) y forman los gametos masculinos y femeninos, al formar
asi permanecer hasta el nuevo ciclo con una nueva el cigoto 2n, este contina femando por mitosis clulas
mitosis. En algunas clulas que no continan el ciclo y somticas 2n.
dependiendo de su especializacin, este organito forma
los cilios o flagelos. PASOS DE LA IVIEiOSIS

La meiosis es un doble proceso de divisin celular,


Tolofaso denominadas meiosis I y meiosis II, cada una de ellas al
igual que la mitosis, tiene las mismas etapas de Profase
I, IVIetafase I, Anafase I y Telofase I. Al iniciar la segunda
divisin se forman las fases de Profase II, IVIetafase II,
Anafase II y Telofase II. La Profase I es el evento ms
largo e importante de este proceso y se subdivide en: a)
Leptotene o Leptonema b) Zigonema o Zigotene c)
Paquinema o Paquitene d) Diplonema o Diplotene y e)
Diakinesis

Al igual que la mitosis, la meiosis s un proceso conti-


nuo, pero que dura mucho ms tiempo, en la esperma-
tognesis se ha visto que se desarrolla en aproximada-
mente 64 das, hasta completar la espermiognesis 10
das ms, es decir un total de 74 das +/- 5 das. La
meiosis para la formacin de vulos en la mujer, es un
proceso ms largo ya que este mecanismo de divisin
se detiene en Profase I en una fase llamada de dic-
tioteno. La meiosis en la mujer se inicia antes del naci-
Los organitos citoplasmticos de diversa naturaleza, y miento de la nia, y las clulas quedan en fase de dic-
que estaban en el citoplasma de la clula madre, se tioteno, es durante la adolescencia y gracias a la estimu-
reparten, aunque no lo hacen en forma equitativa por lacin de una hormona hipofisaria (FSH) que reinicia la
ejemplo, mitocondrias, cuerpos de Golgi- Esto establece meiosis I, y solamente si existe embarazo, se completa
una teora por la que las nuevas clulas podran tener la meiosis II. Podramos decir que la meiosis en la mujer
un proceso de diferenciacin- dura aproximadamente entre 12 y 50 aos.

Cariocinesis En el ecuador de la clula se establece Siendo la meiosis en la mujer de un perodo tan largo,
una constriccin paulatina que terminara estrangulando las clulas en dictioteno podran en este lapso de tiempo
el citoplasma celular y formando dos clulas hijas. ser sometidas a factores adversos y provocar lesiones
que solo se manifestarn, si esa clula al terminar la
meiosis I forma un cigoto y si termina formando un
MEIOSIS nuevo ser. Es este el motivo por el que se considera que
la mayor parte de los casos de nios con Sndrome de
La meiosis es un proceso de divisin celular asexual, Down tienen origen materno.
indirecto en el que una clula diploide 2 n, entra en un
doble proceso de divisin celular para formar cuatro CUADRO ESQUEMTICO DE LA MEIOSIS
clulas haploides o n cromosomas, que se constituyen
en gametos masculinos llamados espermatozoides o en
gametos femeninos llamados oocitos u vulos. La es-
permatognesis (formacin de espermatozoides en el
varn) forma cuatro clulas diferentes entre si, y la
ovognesis (formacin de oocitos en la mujer) forma una
clula llamada vulo que aleatoriamente o en forma
fortuita recibe informacin gentica de cada uno de los
cromosomas homlogos que son 46 cromosomas o 23
pares dobles a 23 cromosomas simples que ya no tiene
homlogos. Al unirse con el espermatozoide se comple-
tan nuevamente 46 cromosomas o 23 pares de cromo-
somas, cada uno con su homlogo correspondiente.
En la primera divisin meitica la clula reduce de 46
cromosomas dobles a 23 pares de cromosomas dobles
(forma una clula n cromosomas) y en la segunda divi-
Cuadro sinptico de la meiosis producir una clula que es viable y otra clula no viable
denominada segundo corpsculo polar.
Esquema de la meiosis en las mujeres
Leptotene
(bouquet)
Zigotene
(Zipper)-? C i e -
Paquitene
(crossing over)
rPROFASE I
Diplotene
(tetradas)
Diakinesis
(qulasmatas)

MEIOSIS I METAFASE I
MEIOSIS
, kNAFASE I

LOFASE I

P R O F A S E II
METAFASE II
4EI0SS 11
ANAFASE II
T E L O F A S E II Esquema de la meiosis en los varones
MEIOSIS I

La meiosis es un proceso de divisin celular que ocurre


en las clulas germinativas tanto espermatogonios como
ovogonias con el fin de producir las clulas haploides,
espermatozoides y vulos que son gametos que al
unirse dan lugar a la formacin del huevo o cigoto,
clula que formar un nuevo organismo.

La meiosis es un evento de divisin celular asexual


indirecto en el que a partir de una clula diploide termi-
nan formando cuatro clulas hijas haploides que contie-
nen un material gentico diferente entre ellas, debido
bsicamente a un evento denominado crosing over o
intercambio de material gentico.

Mientras la mitosis es un proceso de divisin celular,


que ocurre desde la formacin del huevo o cigoto hasta
el perodo embrionario, perodo fetal, nacimiento del
nuevo ser, desarrollo hasta la adolescencia, madures PROFASE I
del individuo y la muerte del individuo. La meiosis es un
evento que ocurre en los individuos durante el perodo Ocun-en eventos parecidos a la profase de la mitosis, en
frtil, por lo que en las mujeres este perodo va desde el esencia, los cromosomas aparecen, la cubierta nuclear
momento de la menarqua hasta la menopausia, mo- se desorganiza, al igual que el nuclolo se desintegra y
mento de la vida en que se deja de producir vulos. En cada material gentico constituir los satlites de cro-
el hombre igualmente va desde la adolescencia hasta la mosomas Submetacntricos mencionados. Tambin los
andropausia, momento no bien definido pues hay posibi- centriolos se separan y forman el aparato meitico,
lidad de formacin de espermatozoides hasta avanza- similar al mittico.
das edades.
La profase I de la meiosis es el evento ms largo e
La mitosis forma dos clulas diploides que genticamen- interesante de la meiosis, puesto que en este perodo
te son iguales y la meiosis forma cuatro clulas hijas hay una serie de cambios en el material gentico que le
haploides que genticamente son diferentes. hace diferente al de la mitosis. Por ejemplo en la mitosis
no hay los perodos a describirse en la meiosis como
En las mujeres la meiosis se produce en la vida embrio- son: el Leptotene, Cigotene, Paquitene, Diplotene y
naria, pero esta queda detenida en una fase denomina- Diacinesis. En la mitosis no existe intercambio de mate-
da de dictioteno, y solo reinicia el proceso a partir de la rial gentico y en la meiosis es el evento ms importan-
menarqua, gracias a una estimulacin de hormonas te.
FSH y LH producidas en la hipfisis, al momento de la
ovulacin las ovogonias han terminado la primera divi- Se describir a continuacin los pasos que notaremos
sin meitica y solo completan la segunda divisin si en la meiosis como son: el Leptonema o Leptotene, el
existe embarazo. Cigonema o Cigotene, el Paquinema o Paquitene, el
Diplonena o Diplotene y la Diacinesis
En las mujeres la meiosis tiene la capacidad de producir
apenas una clula (un solo vulo) si hay fecundacin, Leptotene: Los cromosomas son visibles como hebras
pues en la primera divisin meitica se produce una alargadas, independientes entre s. Tienen la tendencia
clula viable y otra denominada primer corpsculo polar, a buscarse entre cromosomas homlogos y a formar el
que es una clula no viable puesto que la otra recogi "bouquet" o ramillete, orientando el inicio del ramillete
casi todo el materia! citoplasmtico. Como queda indica- hacia los centriolos que se encuentran en el citoplasma
do, solo si hay fecundacin el oocito termina con la de la clula.
segunda divisin meitica y en este caso se vuelve a

I
2S
42

METAFASE!

Los cromosomas se disponen en el ecuador de la clula,


la formacin del huso acromtico meitico y del uso
cromosmico son eventos parecidos a la mitosis. Los
cromosomas son dobles y al inicio de la siguiente fase
van a conservar su centrmero uniendo las cromtides
de los cromosomas dobles

ANAFASEI

Los cromosomas homlogos que son dobles, termina de


separarse y romper los quiasmatas, de tal manera que a
l;e,Aji<liel;.Telol!. cada polo celular, migran la mitad de los cromosomas.
Al inicio de la meiosis haban 23 pares de cromosomas
dobles o cromosomas d, en el momento que los cromo-
somas homlogos se separan y migran a los polos, en
cada polo se contarn 23 cromosomas d (ya no son
pares). Por este motivo, la clula en su primera divisin
meitica se ha reducido de una clula diploide 2n a una
clula haploide n.
Zigotene: Los cromosomas homlogos se unen y for-
man el "zipper" o cremallera. Cada cromosoma con su TELOFASEI
homlogo ha formado una sinapsis iniciando esta unin,
en el extremo cercano a la cubierta nuclear, de tal ma- Los cromosomas llegan a los polos celulares, la clula
nera que aparenta como que los cromosomas han madre forma dos clulas hijas haploides. Recuerde que
disminuido en nmero pero cada uno de ellos es ms los cromosomas son dobles, pero ya no hay homlogos.
grueso. En realidad no hay disminucin del nmero de La clula termina formando dos clulas hijas, reestructu-
cromosomas, estos estn unidos simplemente con su rando el ncleo, con su cubierta nuclear y quedando
homlogo. La unin de los cromosomas homlogos lista para iniciar la segunda divisin celular o Meiosis II.
forma el complejo sinaptonmico que en realidad es En la espermatognesis aparecen realmente dos clulas
una proteina de aspecto similar a un cierre relmpago, listas, para entrar en la segunda divisin. En el caso de
dado que existe dos estructuras paralelas densas, a lo la ovognesis, el oocito de II orden solo es uno, ya que
largo de cada cromosoma denominado elemento lateral, se fomna el primer corpsculo polar, esto se debe a que
en la parte media se distingue el elemento central y la reparticin del citoplasma es inequitativo, absorbiendo
entre ellos la presencia de nodulos de recombinacin, la una clula viable casi todo el citoplasma, mientras que
por eso el aspecto que presenta es el comparable a una el primer corpsculo polar se queda con poco citoplas-
cremallera o cien-e. ma, quedando como una clula Inviable que desapare-
ce.
Paquitene: Es el evento ms importante de la Profase
I, o quizs de la meiosis entera, ya que en este momen- MEIOSIS II
to se produce el intercambio de material gentico, even-
to llamado "crosing over". Segmentos de un cromoso- P R O F A S E II
ma homlogo se intercambian (es como si al unirse dos Es similar al de la mitosis, los cromosomas se engme-
dedos homlogos podran intercambiar entre ellos una san, la cubierta nuclear y el nuclolo se desorganizan,
parte de la falanges, y en otros una parte de las falangi- los centriolos forman el aparato meitico formando el
nas o falangetas.) Este intercambio, produce que el huso acromtico. Los cromosomas quedan nadando en
material gentico que llevan los nuevos cromosomas el citoplasma.
sean distintos al original y tenninarn formando clulas
distintas a la clula madre. Es tambin responsable de METAFASE II
seleccionar ciertas caractersticas de los padres y an
de los abuelos. Un nuevo individuo podra de esta ma- Los 23 cromosomas d, se disponen en el ecuador de la
nera recibir informacin gentica de cada uno de los 4 clula
abuelos patemos y maternos. (Al unirse el espermato-
zoide con caractersticas de los 2 abuelos, y el vulo ANAFASE 11
infonnacin gentica de los otros dos abuelos). Cada
segmento intercambiado, lleva genes que bien podran Los cromosomas d, rompen el centrmero y cada cro-
ser diferentes al original y producir obviamente caracte- mosoma s, migran hacia los polos de la clula
res genotpicos y fenotpicos diferentes a la clula ma-
dre. Recuerde que cada gameto es haploide y solo lleva T E L O F A S E II
la mitad de la informacin gentica.
Es la llegada de los 23 cromosomas s, a los polos celu-
DIplotene: Los cromosomas homlogos que estaban lares, la clula fonna dos clulas hijas haploides (en
unidos mediante el zipper, y que han realizado inter- total 4 en el caso de la espermatognesis, y solo uno en
cambio de material gentico, se separan. Excepto en los el caso de la ovognesis, ya que aqu se forma el se-
puntos de intercambio, o quiasmatas. Es en este mo- gundo corpsculo polar, con igual caracterstica de
mento que al intentar separarse los cromosomas hom- inequidad en la reparticin de citoplasma)
logos aparecen las "tetradas". Por ser en realidad 4
hemicromtides.

Dlakinesis: Es el evento final de la profase I de la meio-


sis I, los cromosomas aparecen ms espirilizados y la
cubierta nuclear se desorganiza.
43

CITOPLASMA DE LA CLULA
A las clulas clsicamente se las ha dividido: como que MEMBRANA C E L U L A R O PLASMALEMA
presentan ncleo, citoplasma y membrana celular.
Sin embargo en los actuales momentos se considera Es considerado como un organito citoplasmtico, rodea
formada, solo por ncleo y citoplasma. a la clula y la separa del medio circundante, conser-
vando la Integridad estructural, le permite realizar inter-
La membrana celular de acuerdo a lo que hoy se cambio de sustancias desde el exterior al interior de la
conoce es un organito citoplasmtico importante, y no se clula, o desde el interior al exterior y regula las interac-
ha disminuido su importancia en la nueva clasificacin, ciones celulares entre una y otras clulas
por el contrario la membrana celular ha tenido un reco-
nocimiento mayor segn iremos desarrollando los cono- La integridad de la membrana mantiene la vida de la
cimientos. clula y el momento en que se destruye, la clula mue-
re.
Muchos de los organitos citoplasmticos estn forma-
dos por un sistema de membrana celular (sistema La membrana celular tiene protenas especficas que le
unitario de membrana) y permite formar varios compar- dan una identidad y que hace por ejemplo que en un
timentos, que separan principalmente sustancias enzi- medio de cultivo celular las que son del mismo tipo se
mticas, que de otra manera podran producir una auto- agrupen. As, si tenemos un cultivo de clulas epitelia-
lisis, de hecho, cuando una clula muere las enzimas les y conectivas, las epiteliales no solo que se agrupan
encerradas dentro de estos organitos se desintegra y las sino que Inclusive forman uniones celulares entre ellas.
enzimas producen necrosis de la clula
Aunque la composicin bioqumica no es exactamente
El citoplasma de las clulas es el responsable de la igual entre las diferentes clulas y de las membranas
funcin celular durante el perodo de interfase, claro que que rodean a los organitos membranosos, se habla de
quien comanda esas acciones es el ncleo, pero la un sistema unitario de membranas porque el patrn
manifestacin se da en el citosol y se manifiesta con la general del plasmalema es una blcapa fosfolipdica con
presencia de mayor o menor cantidad de organitos e protenas y carbohidratos.
Inclusiones. As una clula que necesite producir gran
cantidad de energa se carga de mitocondrias; si el
papel de la clula es la defensa, presenta mayor canti-
dad de lisosomas; si necesita producir mayor cantidad
de protenas, habr gran cantidad de ribosomas.

El citosol o citoplasma est formado por 1. Una serie de


organitos citoplasmticos, 2, Inclusiones citoplas-
mticas y 3. La matriz citoplasmtica en donde se
incluye el jugo citoplasmtico.

ORG.ANITOS INCLUSIONES CITOES-


CITOPLAS- QUELETO
MTICOS Se consideraba en principio que la membrana celular
era semipermeable, pero aclaremos este trmino y
Organitos mem- Organitos Sustan- Matriz entendamos que la membrana celular tiene una per-
branosos no mem- cias meabilidad selectiva, es decir, es capaz de permitir el
branosos nutriti- paso o no y la captacin de unas sustancias, si la mem-
vas
Membrana Riboso- Pig- Jugo citoplas- brana pierde esta selectividad y no logra mantener esta

Celular o Plasma- mas libres, mantos mtico propiedad, la homeostasis se altera y las funciones
celulares se pierden e inclusive provoca su destmccin.
lema Polisomas End-
genos Mucho antes de la utilizacin del microscopio electrni-
co, se consideraba que la membrana celular, estaba
Retculo Endo- Microt- Pig- fomiada por dos capas de protenas y una intennedia de
plasmtico bulos nientos lipidos, a manera de un snduche o emparedado. Al
Rugoso exge- hacer estudios mediante criofractura y observacin de la
nos membrana con fijacin de Tetraxido de Osmio al mi-
Aparato de Golgi Centn'olos croscopio electrnico, se pudo confirmar que la verdade-
Lisosomas Cilios y ra estructura de la membrana celular es el del fluido en
flagelos mosaico.

GREL Filamen- Estructura Qumica de la Membrana Celular


los
Vesculas Secre- El Plasmalema est formado por una bicapa fosfolip-
torias dica (revise las caractersticas de los fosfolpidos y su
Vesculas Recu- clasificacin en la estructura qumica de los lipidos) que
biertas tiene propiedades antipticas, es decir un extremo no
Endosomas polar hidrfobo y otro extremo polar hidrfilo. Lo que le
Peroxisomas permite ser ideal para la fomnacln de membranas.
Retculo Endo- Los fosfolpidos (fosfatidil colina -lecitina-, fosfalidil
plasmtico Liso etanolamina -cefalinas-, fosfatidiiserina y esfingomieli-
na) forman una especie de mar de lipidos, cuya viscosi-
Cuadro sinptico de la estructura del Citoplasma dad esta dada por la presencia de colesterol que es un
estabilizador de la membrana, (como en la elaboracin
44

de una sopa o caldo, al usar harina y hacerla mas con- El espesor de la membrana celular es de 8 a 10 nan-
centrada, la sopa se espesa, permitiendo que la cuchara metros, 2.5 nanmetros la capa extema o E y 2.5 nm la
se pare, lo mismo hace el colesterol en la membrana, capa citoplasmtica o cara P, entre las dos capas de
aumentando la viscosidad). El colesterol impide que al fosfolpidos hay una separacin de 3 nm. Si el tamao
bajar la temperatura al punto de fusin de los lpidos, los de la membrana celular es tan pequeo, no se puede
fosfolpidos se cristalicen. ver en forma real con microscopio de luz, ya que el
poder de resolucin del microscopio compuesto es de
Si la membrana celular est formada de lpidos, la 200 nanmetros; solo se observa en f o m a real con la
temperatura del organismo no puede ser alta ni baja, ayuda del microscopio electrnico.
debe estar en niveles homeostticos (36.2 C y 37.5 C)
niveles extremos de temperatura en el organismo como Si en una observacin al microscopio "notamos" la
menos de 34 C o mas de 44 C, producen una deses- presencia indirecta de la membrana, es debido a la
tabilizacin de las membranas y producen una citolisis. diferente concentracin de material en el interior y exte-
rior de la clula, mucho ms cuando se la colorea con
Comprendiendo esta propiedad sabemos la necesidad H.E. y a veces queda en el espacio intercelular prote-
de mantener dentro de niveles homeostticos a la tem- nas que se pintan de un color rosado mas intenso.
peratura, claro que al aumentar la temperatura el orga-
nismo, lo hace para contribuir en el proceso inflamatorio.
Pero el aumento excesivo de la temperatura es perjudi- LIPIDOS PROTEINAS CARBOHIDRA-
cial, de ah que, soto se deba controlar la temperatura TOS
en un proceso inflamatorio. Fosfolpi- Protenas trans- Glucolpidos
dos membranosas
Otro componente importante de la membrana celular es
Protenas extrn- Glucoprotenas
el Proteico o Protenas de la membrana celular que
secas o perifricas
estn nadando en el mar de lpidos, y que atraviesan la
bicapa fosfolipdica, dejando sobre la superficie interna y Colesterol Proteoglicanos
externa la huella de su presencia. Como lo hacen los
tmpanos de hielo. De la misma manera como se des-
plazan los tmpanos en el mar, las protenas se despla- Cuadro de la composicin de la membrana celular
zan de un lado a otro. La presencia de estas protenas
determina las propiedades especficas de una clula, y
como su composicin no es exactamente igual, como si Transporte a travs de la Membrana Celular
es la de los lpidos, la especificidad de una c\u\a est
determinada por el tipo de protenas que tiene la mem- Recuerde que la membrana celular es una bicapa fosfo-
brana, por ejemplo para constituirse en clula blanco de lipdica, y que los fosfolpidos son anfipticos con un
una hormona detenninada. extremo polar hidrfilo y el otro extremo hidrfobo, por lo
que la capa media de la membrana es altamente hidr-
Hay tres tipos de protenas que son: transmembranosas, foba (huye al agua) al tener esta propiedad la doble
protenas perifricas y unidas a los lpidos o lipoprote- capa no permite el paso de sustancias lquidas con
facilidad, la facilitacin del paso de molculas se las
hace por las protenas transmembranosas, pero tiene
El otro componente de la membrana celular y presente mucha importancia el tamao y la liposolubilidad de las
solo en la capa extema (capa E), es el glucocliz o molculas que atraviesan la membrana.
cubierta celular o glicocliz. Formado de carbohidratos
unidos a las molculas de lpidos y protenas. Estos son Difusin simple a favor de la gradiente de concentra-
glucolpidos, glucoprotenas o proteoglicanos. Intervie- cin (de mayor a menor), pasan las molculas polares
nen en el reconocimiento celular, en la adhesin, etc. muy pequeas y sin carga elctrica como las de agua y
La cara interna de la membrana celular se denomina etanol, las molculas que presentan carga como la
cara P o protoplasmtica y como se ver no es simtrica glucosa o electrolitos (Na*, K*) la penneabilidad es 10^
con la cara E. veces menor y deben buscar la ayuda de las protenas
para su transporte.
Constituyen receptores especficos de membrana en el
que interviene una protena, una glucoprotena o un Protenas de transporte se ubican en la membrana
polisacrido y son sitios de reconocimiento especifico en como protenas integrales o transmembranosas del tipo
un lugar de la clula permitiendo captar una hormona, de pasaje mltiple y permiten el paso de sustancias
una molcula mensajera, un virus o una bacteria especi- hidrfilas, sin que interfiera la porcin hidrfoba de la
fica. La sustancia a integrarse se denomina ligando y membrana, son como verdaderas puertas a travs del
tiene una estructura tridimensional que hace que se cual molculas ms grandes o con carga contraria
unan como una llave a su candado. logran pasar. Pueden ser con canales o simplemente
transportadoras, ya que arrastran consigo al ligando.

Las protenas de canal fonnan poros o canales hidrfilos


que facilitan el paso de sustancias pero a favor de la
gradiente -transporte pasivo- pueden actuar tambin
como difusin facilitada cuando pasan sustancias con
carga elctrica, ya que las protenas forman la gradiente
electroqumica. Tambin pueden formar canales inicos
que permiten el paso facilitado de Na*, K*, Ca**, CI" en
este caso la velocidad de difusin es mayor, pero re-
quieren de un transmisor que abran estos canales.

tmvnu /' Los transportadores necesitan fijar una sustancia espe-


cfica y atravesar la membrana, lo hacen a una veloci-
dad menor que la del transporte facilitado. Muchas
veces la transportacin de sustancias se hace a favor de
la gradiente, pero tambin lo pueden hacer en contra de
45

la g r a d i e n t e m e d i a n t e u n a accin d e b o m b e o , n e c e s i t a n Las m i t o c o n d r l a s p o s e e n D N A e inclusive r i b o n u c l e o p r o -


utilizar A T P , as p o r e j e m p l o el t r a n s p o r t e d e la g l u c o s a . tenas RNA, p o r lo q u e podran f o r m a r a l g u n a s protenas
A u n q u e el a g u a p u e d e t r a n s p o r t a r s e a travs d e la y t e n e r hasta c i e r t o m o d o , u n a v i d a i n d e p e n d i e n t e .
b i c a p a fosfolipdica. E n a l g u n a s clulas h a y c a n a l e s
para el t r a n s p o r t e d e a g u a y s e d e n o m i n a n a c u a p o r i n a s . Las m i t o c o n d r i a s al p a r e c e r t i e n e n u n o r i g e n e n la " s i m -
O t r a f o r m a especfica d e p a s a r s u s t a n c i a s a travs d e la biosis" d e clulas p r o c a r i o t a s ( b a c t e r i a s ) c o n l a s clulas
m e m b r a n a e s mediante endocitosis y exocitosis. e u c a r i o t a s , e s t a relacin debi ocurrir e n el p r o c e s o
e v o l u t i v o d e la vida s o b r e la f a z d e la tierra, n o q u i e r e
MITOCONDRIAS d e c i r q u e al e n t r a r b a c t e r i a s al interior d e la clula, stas
se transformen e n mitocondrias, pero es interesante
E s u n o r g a n i t o m e m b r a n o s o q u e s e e n c u e n t r a e n el c o n o c e r q u e al p o s e e r D N A , R N A y p r o d u c i r a l g u n a s
protenas s e c o m p o r t a n c o m o si f u e s e n i n d e p e n d i e n t e s
e i n c l u s o e n la mitosis, la reparticin d e l a s m i t o c o n d r i a s
s e h a c e previa divisin binaria d e stas, c o m o si s e
t r a t a r a n d e b a c t e r i a s . El D N A n u c l e a r sin e m b a r g o t i e n e
la funcin p r i n c i p a l d e p r o d u c i r ms d e 7 0 0 e n z i m a s q u e
t i e n e la m i t o c o n d r i a .

c i t o p l a s m a , d e f o n n a a l a r g a d a c u a n d o s e o b s e r v a c o n el
m i c r o s c o p i o d e l u z {mtos= hilo o hebra, chondros=
grano). A l m i c r o s c o p i o electrnico s e o b s e r v a c o m o u n a
e s t r u c t u r a c o n d o b l e m e m b r a n a celular, u n a i n t e r n a q u e
f o r m a c r e s t a s y p o r lo t a n t o es irregular y u n a e x t e r n a
q u e e s a p a r e n t e m e n t e lisa, c o n u n e s p a c i o e n t r e las d o s
m e m b r a n a s d e 10 a 2 0 n m c o n u n m a t e r i a l electrnica-
m e n t e d e n s o , d i f e r e n t e al m a t e r i a l electrnico, q u e s e
p r e s e n t a e n la m a t r i z interna d e la m i t o c o n d r i a y el
m a t e r i a l e x t e r n o q u e c o r r e s p o n d e al citosol. L a l o n g i t u d
d e la m i t o c o n d r i a d e d e 0,5 a I p m h a s t a 10 p m

La c a n t i d a d , el tamao y la f o r m a d e las m i t o c o n d r i a s , Electromicrografla que muestra lisosomas secundarios (colora-


d e p e n d e d e la funcin y la energa q u e d e b e p r o d u c i r la cin oscura) rodeadas por numerosas mitocondrias Junquera,
clula, s o n n u m e r o s a s y c o n g r a n c a n t i d a d d e c r e s t a s
m i t o c o n d r i a i e s e n las clulas n e r v i o s a s , hepticas y L a f u n c i n m s i m p o r t a n t e d e la m i t o c o n d r i a c o m o
m u s c u l a r e s ; estn e n m e n o r nmero e n clulas q u e n o q u e d e s t a b l e c i d o e s la p r o d u c c i n d e e n e r g a .
n e c e s i t a n g r a n c o n s u m o d e energa c o m o las clulas d e Transformacin q u e la realiza m e d i a n t e el ciclo d e K r e b s
los e p i t e l i o s d e proteccin s i m p l e , linfocitos y macrfa- d e g r a d a n d o g l u c o s a y cidos g r a s o s , p r o d u c i e n d o A T P .
g o s , f a l t a n p o r c o m p l e t o e n los glbulos rojos, p o r q u e la C u a n d o el A T P d o n a s u energa para el t r a b a j o d e la
produccin d e energa s e realiza e n f o r m a a n a e r o b i a p o r clula, s e t r a n s f o r m a e n A D P y el ciclo s e repite c o n
gluclisis. n u e v o ciclo d e K r e b s para f o r m a r n u e v a m e n t e A T P y
e s t o e s lo q u e s e c o n o c e c o m o fosforilacin o x i d a t i v a .
L a f u n c i n d e l a s m i t o c o n d r i a s e s la d e p r o d u c i r e n e r -
ga, m e d i a n t e fosforilacin o x i d a t i v a , e n l a z a n d o el P, a En 1988 se descubri que el DNA m (mitocondrial)
las molculas d e A D P y p r o d u c i e n d o A T P ( a d e n o s i n t r i puede sufrir mutaciones y causar graves trastornos al
f o s f a t o ) , q u e e s c o n s i d e r a d o c o m o f u e n t e d e energa, encfalo y al msculo, llevando a una atrofia muscular y
p r e s e n t a n c i t o c r o m o o x i d a s a s . Si n o p r o d u c e A T P la dao cerebral con manifestaciones de demencia cuadro
clula, n o h a y t r a b a j o . O t r a funcin d e las m i t o c o n d r i a s que se conoce como encefalomiopatia mitocondrial.
est r e l a c i o n a d a c o n la produccin d e e n z i m a s q u e Se cree que el trastorno est dado por va materna, ya
c a t a l i z a n la sntesis d e cidos g r a s o s y aminocidos, que al formarse el huevo o cigoto, el espermatozoide no
sntesis d e h o m n o n a s e s f e r o i d e s , a u n q u e t e r m i n a n s u lleva mitocondrias. Las mitocondrias son de origen
sntesis e n el Retculo Endoplasmtlco liso. ( R E I) materno.

La m e m b r a n a e x t e r n a q u e t i e n e protenas t r a n s p o r t a d o - En la actualidad se han descrito ms de 150 enferme-


r a s ( p u r i n a s ) , m a n t i e n e e s t a b l e el c o n t e n i d o i n t e r n o d e la dades, relacionados con desrdenes en la mitocondria,
m i t o c o n d r i a . El e s p a c i o nter m e m b r a n o s o m i t o c o n d r i a ! principalmente explicadas por alteraciones en los 13
t i e n e c o m p o n e n t e s q u e m a n t i e n e n el equilibrio. . tipos de proteina que produce la mitocondria.

Las crestas mitocondriaies forman varios compartimen-


t o s y e n s u s u p e r f i c i e p r e s e n t a partculas F partcu-
las elementales c o n u n dimetro d e 10 n m e s d o n d e s e
sintetiza el A T P . E n la m a t r i z h a y g r a n u l o s d e 3 0 a 5 0
n m y s u e l e n s e r g r a n d e s d e p e n d i e n d o d e la c a n t i d a d d e
C a " e n el interior d e la m i t o c o n d r i a .
46

RIBOSOMAS s o n v e r d a d e r a s m q u i n a s q u e s i n t e t i z a n las p r o t e n a s ,
al r e c e p t a r el R N A m q u e v i e n e d e l D N A nuclear, c o n
Los ribosomas son organitos citoplasmticos no m e m - una secuencia de bases nitrogenadas, ordenadas en
b r a n o s o s , p r e s e n t e s e n el c i t o p l a s m a y q u e t i e n e n la tripletos, y q u e s o n c a p a c e s d e c o d i f i c a r o unirse a un
f u n c i n d e s i n t e t i z a r p r o t e n a s a l g u n a s d e ellas s o n a m i n o c i d o e s p e c f i c o el m o m e n t o q u e el R N A m p a s a
protenas estructurales o d e utilizacin e n d o c e l u l a r y por el ribosoma.
s o n p r o d u c i d a s p o r r i b o s o m a s l i b r e s c o m o el c a s o d e
los e r i t r o b l a s t o s q u e p r o d u c e n h e m o g l o b i n a . O t r a s El R N A t p e r m i t e t r a e r al sitio e s p e c f i c o el a m i n o c i d o
p r o t e n a s q u e s i n t e t i z a n los r i b o s o m a s , s o n enzimas por q u e t i e n e el tripleto o c o d n y as fomna largas c a d e n a s
lo q u e n o p u e d e n s e r s i n t e t i z a d a s d i r e c t a m e n t e al c i t o - d e a m i n o c i d o s d e a c u e r d o al c d i g o g e n t i c o ( g e n : e s
sol, sino que deben ser encerradas en un sistema de una p o r c i n d e D N A o R N A t r a n s c r i t o q u e e s c a p a z d e
m e m b r a n a , p a r a s e r utilizadas e n f o r m a r e g u l a d a , o para sintetizar una p r o t e n a . C o d n o t r i p l e t o = c o n j u n t o d e
q u e s e c o n s t i t u y a n e n s u s t a n c i a q u e la c l u l a s e c r e t a al tres a m i n o c i d o s q u e c o d i f i c a n una a m i n o c i d o ) .
exterior, por lo q u e los ribosomas s e a s o c i a n al r e t c u l o
e n d o p l a s m t i c o r u g o s o , a p a r a t o d e G o l g i , G r e l , y el
L o s r i b o s o m a s p u e d e n s e r libres o e s t a r a s o c i a d o s u n o s
m e c a n i s m o de exocitosis.
a otros formando polisemas o polirribosomas, cuando se
a s o c i a n al retculo e n d o p l a s m t i c o f o m i a n e n retculo
L o s ribosomas s o n p r o d u c i d o s e n e l n u c l o l o d e la endoplasmtico rugoso.
c l u l a , lugar d o n d e est la i n f o r m a c i n g e n t i c a para la
p r o d u c c i n d e e s t o s o r g a n i t o s c o m o s e v i o e n el t e m a
sobre nuclolo.

El R N A r ( r i b o s o m a l ) q u e e s s i n t e t i z a d o e n el n c l e o ,
s u f r e u n p r o c e s o d e m a d u r a c i n , y a q u e el t r a n s c r i t o
p r i m a r i o del n u c l o l o t i e n e 4 5 S ( c o n 1 3 0 0 0 p a r e s d e ^ ' ' - - ' 4
bases) y forma una molcula de 28 S (5000 pares de
b a s e s ) q u e s e i n c o r p o r a n a una g r a n s u b u n i d a d d e 6 0 S.
O t r a d e 18 8 ( 2 0 0 0 p a r e s d e b a s e s ) s e i n c o r p o r a a la
s u b u n i d a d del ribosoma d e 4 0 S. T a m b i n s e p r o d u c e
e n el t r a n s c r i t o p r i m a r i o o t r a s d o s m o l c u l a s m s p e -
q u e a s d e 5 S y 3 S q u e s e i n c o r p o r a n a las u n i d a d e s
del ribosoma d e 6 0 S y 4 0 S.
Imagen de un polirhbosoma, sintetizando liemoglobina

RETCULO ENDOPLASIWTICO RUGOSO (Ergasto-


plasma)

Los R i b o s o m a s miden a p r o x i m a d a m e n t e 20 a 30 n m de
d i m e t r o , por lo q u e c o n m i c r o s c o p i o d e luz, n o s e l e s
p u e d e v e r e n f o r m a real, p e r o si u t i l i z a m o s c o l o r a c i o n e s
H E , por el c o n t e n i d o d e R N A s e m a n i f i e s t a n c o m o u n
citoplasma basfilo (azulado).

C u a n d o los ribosomas s o n libres la basofilia e s t d i s t r i -


b u i d a e n t o d o el c i t o p l a s m a , p e r o si los ribosomas s e
e n c u e n t r a n a s o c i a d o s al R E , e n t o n c e s s e v e u n a b a s o f i -
lia e n u n s e c t o r d e t e m i i n a d o d e la c l u l a , c o m o la b a s o -
filia b a s a l q u e p r e s e n t a la c l u l a p a n c r e t i c a .

C u a n d o s e c o l o r e a el c i t o p l a s m a d e la c l u l a c o n b a s o f i -
lia d e s c r i t a , t a m b i n s a b e m o s q u e e s u n a c l u l a j o v e n , Es u n o r g a n i t o c i t o p l a s m t i c o m e m b r a n o s o , f o r m a d o p o r
y a q u e las c l u l a s viejas d e j a n d e p r o d u c i r p r o t e n a s y u n sistema unitario de membrana (sistema unitario de
t i e n e n un c i t o p l a s m a acidfilo (rosado). membrana quiere decir que estructuraimenfe es igual al
del plasmalema).

U b i c a d o c e r c a del n c l e o y a s o c i a d o a la m e m b r a n a
e x t e r n a d e la c u b i e r t a nuclear, s e c o l o r e a c o n h e m a t o x i -
lina y el c i t o p l a s m a s e p r e s e n t a b a s f i l o , e n las c l u l a s
p a n c r e t i c a s p r e s e n t a una basofilia b a s a l . Est f o r m a d o
por c i s t e r n a s a p l a n a d a s , a l a r g a d a s y d i s p u e s t a s e n
p a r a l e l o o d e d i s p o s i c i n reticular, c o n a n a s t o m o s i s . L a
luz f o r m a un c o m p a r t i m e n t o a i s l a d o del citosol. E s t
asociado a ribosomas y su funcin es s i n t e t i z a r prote-
V PROTENA
ribosomas nas de exportacin o protenas que luego se trans-
Subunidad 40 S
47

forman en lisosomas van a la luz del REr como si mente, pero cualquier clula secretoria que presente
estuvieran por fuera de la clula. {Igual ocurre con el aparato de Golgi o complejo de Golgi porque son varios,
Intestino en relacin al organismo, la luz est fuera). Las hay esta zona blanquecina. Es diferente a la coloracin
protenas producidas pasan luego ai aparato de Golgi en que presenta el REr, ya que la coloracin basfila est
donde contina la maduracin. Si las protenas progra- dada porque los ribosomas asociados son en verdad los
madas para ser secretadas a la luz del REr, se secreta- que presentan la coloracin, el Golgi al carecer de ribo-
ran al citosol podran producir citolisis. La secrecin de somas presenta un contraste perfectamente distinguible,
la protena hacia la luz, est determinada, porque en la ya que el REr, rodea al Golgi.
fase de iniciacin de la formacin de la protena hay una
secuencia de codones en el RNA m que codifican la El Golgi est fomiado de varias cisternas o unidades
formacin de 20 aminocidos, que deben buscar una estructurales denominados sculos, apiladas, como un
proteina transportadora en la membrana del REr, si no conjunto de platos tendidos, la cara inferior o formadora
hay la seal, la protena va directamente al citosol y se denomina c i s y la ltima capa superior o secretora se
quiere decir que ser una protena para consumo in- denomina trans. La cara cis recibe las vesculas de
terno, por el contrario la secuencia seal obliga a la transferencia del REr, las que contienen protenas a ser
protena, que para continuar su sntesis, busque la transformadas en los sculos del aparato de Golgi,
partcula de reconocimiento de seal o receptor conforme pasan a sculos superiores por ejemplo sufren
especifico y hacia pasa hacia la luz del retculo. Al una glucosilacin debido a que posee enzimas como la
terminar la formacin de la protena la secuencia seal glucosiltransferasa, que permiten agregar a las prote-
se desintegra por una sealpeptidasa, sin embargo se nas glucosa o galactosa, hecho comprobado mediante
piensa que la persistencia podra provocar que la se- autorradiografa al incorporar glucosa o galactosa mar-
cuencia seal se enhebre repetidamente en la membra- cada con Tritio. Tambin puede incorporar maosa
na y dando origen a protenas transmembranosas. En la marcada con tritio, aunque se pueden incorporar en el
luz del retculo se agregan varios oligosacridos como REr, en el Golgi especficamente se incorporan la gluco-
N-acetilglucosamina, maosa, y glucosa a los grupos sa, mucosa y el cido silico, Esto permite la formacin
amino libres del aminocido asparagina. El proceso se de glucoprotenas que formaran vesculas secretorias o
llama glucosilacin ligada a W y es catalizada por la particularmente lisosomas.
glucosiltransferasa relacionada con la porcin luminar de
la membrana del REr. Las vesculas secretorias, salen de la clula mediante
mecanismos de exocitosis y permiten aumentar la canti-
La presencia de REr significa que la clula realiza snte- dad de membrana celular, es as pues, un mecanismo
sis activa de protenas y se encuentra en clulas jve- de recambio de la clula, ya que posteriormente, la
nes, inmaduras o en clulas cancerosas. membrana envejecida se restringe por un mecanismo de
endocitosis o mediante crinofagia que explicaremos mas
tarde.
El aparato de Golgi es tambin responsable de la pro-
duccin y secrecin de lipoprotenas y del procesamien-
to de prohomionas ppticas como la paratohormona y la
APARATO DE GOLGI insulina.

Es un organito citoplasmtico, formado por cisternas


aplanadas, de estructura membranosa. Localizado GREL
generalmente cerca del ncleo, con una orientacin
apical en las clulas secretoras epiteliales, no as, en las El GREL es considerado por algunos autores como un
clulas conectivas, ya que la secrecin podra estar organito citoplasmtico especial, o por otros, simplemen-
orientada a cualquier polo celular. La funcin del com- te como luna estructura particular de la ltima capa de
plejo de Golgi que es como a veces est presente es la Golgi, denomina GREL por ser un anacrnico formado
de secretar protenas, algunas de las cuales formarn por el Complejo de Golgi. El Retculo Endoplasmtlco
lisosomas y otras formaran protenas de exportacin rugoso y la formacin de Lisosomas. Se lo ha conside-
celular. rado como un organito diferente al Golgi, porque espec-
ficamente presenta un compartimento que contiene
fosfatasa. Novikoffes el creador de este anacrnico (un
anacrnico es parecido al acrstico que se hace poemas
con el nombre de una persona amada, el anacrnico
considera los organitos que intervienen en su composi-
cin). La funcin del GREL es la formacin de Lisoso-
mas y al parecer es una ruta mas corta en la formacin
de protenas que se constituyen en enzimas que contie-
ne el lisosoma.

VESCULAS S E C R E T O R I A S

Al salir las glucoprotenas fomriadas por el Golgi, se


rodean de membrana celular y van al citosol, claro que

Al observar el aparato de Golgi en clulas de gran


secrecin, como las clulas plasmticas, presenta una
zona blanquecina cerca del ncleo, lo que es muy carac-
terstico en la identificacin de estas clulas particular- las protenas en mencin sern de exportacin y debe-
48

rn salir al exterior de la clula por mecanismos de acumularse forman la pus (lquido amarillento verdosos
exocitosis, como ocurre en la secrecin de procolgena de mal olor, presente en los procesos inflamatorios).
en los fibroblastos, o las enzimas producidas por las Los macrfagos son clulas que cumplen un papel de
clulas pancreticas, en el caso de las clulas calicifor- fagocitosis, sin llegar a autodestruirse. Al tomar una
mes las vesculas secretorias que contienen glucopro- partcula u antgeno como fagosoma, los lisosomas
tenas o moco y que se almacenan en la parte apical de primarios se unen y forman el lisosoma secundario, pero
la clula, en los tejidos pigmentados con H:E. no toman est funcin es regulada y la clula no sufre destruccin.
ni la Hematoxilina, ni la Eosina por lo que dan un aspec- 3. Crinofagia
to blanquecino espumoso al citoplasma de estas clulas. Es un mecanismo de autorregulacin y autofagia para
sustraer organitos citoplasmticos que estn en exceso
u organitos envejecidos o materiales acumulados en
LISOSOMAS demasa, dentro del citosol, por ejemplo el exceso de
mitocondrias, ribosomas etc.
Se fomnan estos organitos citoplasmticos en el Retculo
endoplasmtico rugoso, pasan al aparato de Golgi y 4. Pinocitosis
salen por la cara trans del aparato de Golgi o del GREL Es un mecanismo de endocitosis, parecido a la fagocito-
Contienen enzimas o hidrolasas acidas capaces de sis, se diferencia fundamentalmente porque la clula
demoler cualquier compuesto macromolecular como Incluye dentro de su citoplasma sustancias de naturale-
protenas, carbohidratos, lpidos o cidos nucleicos, (se za lquida aunque lleve disuelta en su interior partculas
han demostrado ms de 50 enzimas hidroliticas agrupa- incluyendo protenas u otros compuestos macromolecu-
das en el genrico de hidrolasas acidas), estn en el lares. La accin es igual al de la fagocitosis, ya que la
citosol de la clula rodeados de un sistema unitario de vescula pinocitaria se une a lisosomas primarias y
membrana. Su dimetro vara entre 0.2 a 0.4 micrme- produce una demolicin macromolecular, el residuo se
tros por lo que la observacin con microscopio com- denomina cuerpos residuales que pueden ser expulsa-
puesto es de difcil reconocimiento, pero son claramente dos por exocitosis, en ocasiones la vescula pinocitaria
demostrados en observaciones al microscopio electrni- atraviesa el espesor del citoplasma de un lado a otro sin
co, sobre todo cuando se comprueba la presencia de la sufrir modificaciones, como ocurre con la extravasacin
enzima, fosfatasa acida que es la ms fcil de demos-
de protenas en los endotelios, desde el interior de un
trar, pero contiene otras enzimas como proteasas, nu-
vaso sanguneo hasta el tejido conectivo laxo.
cleasas, lipasas, fosfolipasas, glucosidasas, sulfatases,
etc.
Una variacin especfica de este fenmeno est dado en
la endocitosis mediada por receptores y que explica
Lisosoma viene de las raices (Griegas: Lysis= destruc- como los anticuerpos producidos en la leche materna se
cin, ruptura y Soma= cuerpo; de ah que los lisosomas transmiten de madre a hijo, durante la lactancia. Las
son cuerpos que producen destruccin) Pueden encon- protenas al ser compuestos macromoleculares no
trarse en todas las clulas, pero son frecuentes en pueden atravesar las membranas celulares, para poder
clulas de defensa del organismo atravesar las protenas deben degradarse a aminoci-
dos y estos al llegar al torrente sanguneo se distribuyen
en clulas que, nuevamente y de acuerdo al cdigo
La accin de los lisosomas pueden ser mencionados en: gentico se resintetizan.
1. Citolisis Si las inmunoglobulinas maternas que estn en la leche
Al producirse hipoxia celular, las membranas celulares se degradaran a aminocidos, ya no podran cumplir
se desestabilizan y las enzimas lisosmicas salen al con el papel de proteccin, por lo que es la protena
citosol. Provocando autolisis o destruccin celular, se ntegra, la que debe atravesar las clulas de absorcin
observa en el caso de una degeneracin post morten, del intestino del nio lactante, llegar al torrente sangu-
tambin en casos de traumatismos fsicos o infecciosos neo y cumplir con su papel de proteccin.

2. Intervienen en la fagocitosis
Fagocitosis viene de Fago= comer cito= clula osis=
proceso, de ati que la fagocitosis es un proceso celular
mediante la cual la clula come, aunque el trmino no es
preciso en todos los casos, ya que es un mecanismo de
defensa de las clulas para destruir sustancias antigni-
cas como virus, bacterias u otros microorganismos
cuando han ingresado al interior de las clulas.
Al ingresar una sustancia extraa al Interior de la clula,
que puede ser un compuesto macromolecular o ciertas
partculas: stas, entran rodeadas de membrana celular
y se denomina fagosoma (fago=comer, soma=cuerpo;
cuerpo que come la clula). El fagosoma en el citosol se
une a los lisosomas primarios, los mismos que sueltan
las hidrolasas, produciendo una demolicin de las ma-
cromolculas y transformndose en una vescula fagoci-
taria, al trmino del proceso se denomina vacuola excre-
toria o pulstil. Los residuos son eliminados al exterior
de la clula. Esta funcin cumple principalmente los
neutrfilos y los macrfagos.

Los neutrfilos son clulas que poseen gran cantidad de


lisosomas, e intervienen directamente en los procesos
inflamatorios del organismo. Un neutrfiio fagocita 6 a 8
bacterias, las introduce como fagosomas, forma lisoso-
mas secundarios, suelta lisosomas y lisozimas que
provocan la destruccin de los antgenos y tambin una
autodestruccin de la clula, formando piocitos que al
49

Las clulas intestinales del nio, captan las inmunoglo- PEROXISOMAS


bulinas, por receptores especficos (un receptor est
formado por protenas especificas en la membrana Organitos citoplasmticos membranosos, muy pequeos
celular) Las inmunoglobuiinas ingresan rodeados de de 1 micrmetro de dimetro, contienen en su interior
membrana celular por lo que se pareceran a fagoso- perxido y catalasa que metabolizan el perxido de
mas, en el interior de la clula se forman vesculas Hidrgeno intracelular, necesario para la degradacin de
formadas con clatrina y los trisqueliones, la vescula bacterias fagocitadas, se las encuentra ms grandes y
atraviesa la clula sin ser degradada, lo que si puede numerosas en hgado y rion. Los peroxisomas contie-
ocurrir es que los receptores especficos sean sustra- nen en su interior un material cristalino llamado mucoi-
dos de las vesculas y llevados nuevamente a la mem- de. El mucoide puede contener urato oxidasa (o uricasa)
brana celular de la clula intestinal para captar ms enzima no presente en los humanos, si hay en reptiles,
inmunoglobuiinas. su funcin es la de metabolizar el cido rico. Experi-
Tambin son captadas por este mecanismo ms de 50 mentos han demostrado que pueden intervenir en el
protenas como hormonas, factores de crecimiento metabolismo de lpidos para convertidos en glucosa, ya
celular. La sustancia captada se denomina ligando que que al tomar medicamentos hipolipemiantes con el fin de
se une al receptor especfico, primero forma alrededor reducir los triglicridos y el colesterol, los peroxisomas
de la membrana celular una estructura planar que con- aumentan su tamao y nmero, aumentando una enzi-
tiene una base denominada la clatrina, con la presencia ma la beta oxidasa.
de los trisqueliones estructuras proteicas a manera de
una semicruz de tres patas dobladas, va transformado la
estructura planar, en una de esfera en forma parecida a RETCULO ENDOPLASMTICO LISO
como est constituido un baln
de ftbol, con estructuras hexagonales (que dan la Se diferencia del Retculo endoplasmtico rugoso, por-
forma planar) y estructuras pentagonales (que forman la que carece de ribosomas y por lo tanto no sintetiza
esfera).

Otro mecanismo importante en los mecanismos de


endocitosis, es la captacin de LDL (lipoprotenas de
baja densidad) que representan una fuente importante
de colesterol, sustancia utilizada en la elaboracin de
membranas celulares y de algunas hormonas esteroida-
les. La endocitosis de LDL est en relacin directa a los
receptores LDL en las clulas, como en los fibroblastos
en donde se han realizado investigaciones, que interna-
lizan esta sustancia. En individuos con defectos genti-
cos, la cantidad de receptores est disminuido y el
resultado es un aumento de estas fracciones en el
plasma sanguneo, que determinan una acumulacin de
las fracciones lipdicas en el interior de los vasos san-
guneos, desencadenando una ateroesclerosis.

ENFERiVlEDADES RELACIONADAS CON ACUMULA-


CIN DE SUSTANCIAS POR DEFECTOS ENZIMTl-
COS

Si la clula carece de ciertas enzimas que pueden me-


tabolizar sustancias en el interior de las clulas. Como
lpidos, glucgeno Se produce acumulacin de estas
sustancias en el interior de la clula y sta, no podr
cumplir con su funcin en forma adecuada, incluso pone protenas. Presenta tbulos y cisternas aplanadas anas-
en peligro la vida de los individuos que tienen estos tomosantes irregulares. La funcin es la de elaborar
defectos, denominadas 'enfermedades de almacena- ciertas sustancias lipdicas como en las clulas endocri-
miento lisosmico" nas que elaboran hormonas esteroidales, as como
intervenir en los procesos de detoxicacin sobre todo se
ENFERDAD DE TAY-SACHS Es una enfermedad de ha visto en las clulas hepticas, cuando existe presen-
tipo gentico, por acumulacin de un ganglisido en las cia de medicamentos como el fenobarbital o el alcohol.
neuronas por defecto de la enzima acetilhexosaminidasa La produccin de retculo endoplasmtico liso podra
ausente en los lisosomas neuronales, empaquetando el relacionarse con el intercambio de membrana celular y
ganglisido e interfiriendo en la funcin inclusive del para producir membranas para la formacin de organitos
cerebro y provocando la muerte tempranamente.^incluso citoplasmticos membranosos.
en la etapa de lactancia.
Intervienen en el metabolismo del glucgeno por la
ENFERMEDAD DE NIEMAN-PICK Es una enfermedad presencia de fosfatasas de glucgeno sintetasa y de
primaria de la infancia, gentica, recesiva, que se carac- fosforilasas como la 6-G-Fosfato. Otro papel cumplen en
teriza por la acumulacin de esfingomielina en clulas las clulas musculares ya que el calcio se acumula en el
de bazo, hgado, ganglios inclusive otros rganos como interior del retculo y es distribuido para la contraccin
rion, cerebro; provoca la muerte en tempranas etapas muscular tanto del msculo estriado como del miocardio
de la vida generalmente a la segunda infancia.

Aunque la lista es de casi un millar de trastornos, men-


cionaremos la enfermedad de McARDLE hay un defecto
de la fosforilasa del msculo, que impide la transforma-
cin de glucgeno en glucosa. Hay una miopata con
debilidad muscular.
50

MICROTBULOS hemicromtides, cada hemi cromtide luego es separa-


da a un polo diferente. Ver la descripcin de la mitosis.

Como su nombre lo dice, los microtbulos son pequeos


tubos de un dimetro externo de 25 nm, presentan una
luz electrnicamente densa pero menor que la de las
paredes de los microtbulos. Compuestas de tubulina
que es una proteina que puede demostrarse mediante
inmunofluorescencia Indirecta, ya que por el tamao
difcilmente se observara con microscopio de luz. En la
clula estos microtbulos constituyen parte del citoes-
queleto y tambin forman estructuras que se ensamblan CILIOS Y F L A G E L O S
durante la mitosis. (Durante la profase, metafase y
anafase) Los Cilios son prolongaciones citoplasmticas, rodeadas
de membrana celular, de aspecto filiformes y mviles,
Existe tubulina en los microtbulos y en forma soluble en de 10 pm de largo por 0.2 pm de dimetro. Se fornian a
el citosol, en donde se presenta como dmeros con dos partir de los centriolos, desde el COMT. Forman un
unidades polipeptdicas alfa y beta tubulina. Los dmeros cuerpo basal y un axonema, el cuerpo basal es estructu-
estn sometidos a una delacin molecular (o banda ralmente igual al centriolo, es decir formado por nueve
sin fin) que consiste en un ensamblado y disociando en tripletos. El axonema est formado por nueve dupletos,
el otro extremo de tal manera que queda sometido a un el tercer microtbulo da origen a los brazos de dineina
equilibrio constante. presente en las clulas superficiales de las vas del
aparato respiratorio.(trquea, bronquios, bronquiolos) El
Al microscopio electrnico los microtbulos presenta una movimiento de los cilios permite transportar el moco
estructura ensamblada en los centriolos compuestos de producido por las clulas mucosas o caliciformes. Los
nueve tripletos, que a su vez cada tripletos formado por centriolos son capaces de captar seales que permiten
13 protofilamentos. La formacin de microtbulos en la el movimiento dirigido de una clula, as como la polari-
clula se inicia en un Centro formador de microtbulos dad de la clula.
COMT que estn en todo el citoplasma pero preferen-
temente cerca de los centriolos. Es as como forma el LOS FLAGELOS son estructuras generalmente solita-
aparato mitsico responsable de la divisin celular, as rias en una clula, son largas y se encuentran en clulas
como tambin la formacin de lnea media que termina que tienen gran movimiento, como es el caso de los
formando dos clulas hijas, en otro momento sirve como espermatozoides.
estructura que forma parte del citoesqueleto y da forma
preestablecida a la forma celular, as como tambin FILAMENTOS
interviene en el transporte de organelos y sustancias
como los neurotransmisores en las neuronas. Son organitos citoplasmticos no membranosos, filifor-
mes, no huecos como los microtbulos, se observan con
El ensamblado de microtbulos puede estar interferido el microscopio electrnico y tiene un dimetro variable
por sustancias como la colchicina, vincristina y vinblasti- medido en nanmetros. Estn presentes en el citoplas-
na; estas dos ltimas utilizadas como anti cancergenos. ma de la clula sobre todo de clulas que tienen movi-
miento como el caso de las clulas musculares, o inclu-
so en clulas que realizan algn tipo de constriccin
LOS CENTRIOLOS citoplasmtica para degranular como es el caso de las
plaquetas. Pueden se parte del citoesqueleto celular y
Los centriolos son pequeas estructuras de forma cilin- an considerarse como filamentos de stress celular, ya
drica de aproximadamente 0,5 jjm de dimetro, son que se disponen cerca de la membrana celular (como el
estructuras pares dispuestas en forma perpendicular y caso de las microvellosidades, de clulas del intestino
estn localizadas en el centro de la clula. Ham refiere delgado, e intervienen en el movimiento de estos en la
que el centriolo se ubica exactamente en el centro de la accin de absorcin). Intervienen tambin en la forma-
clula, cosa que no siempre se cumple, puesto que el cin de la lnea media en clulas que estn en procesos
ncleo ocupa este espacio, de no ser as se ubicara en de divisin celular. Se ha demostrado la accin de la
el centro celular, se observa por ejemplo en las clulas citocalacina y la faloidina como inhibidores del ensam-
plasmticas en el espacio que deja el Golgi negativo. blado y funcin de los microfilamentos.

Cumple un papel fundamental en el momento de la Se clasifican en filamentos; gruesos, medios y delgados


divisin celular, tanto en mitosis como en la meiosis.
Durante la fase de Sntesis del ciclo celular, los centrio-
los se duplican (llegan a ser cuatro), al inicio de la profa-
se migran tiacia los polos celulares, y sern responsa-
bles de la presencia del Aparato mitsico, que permite la
separacin del centrmero que mantiene unidas las
51

L O S FILAMENTOS G R U E S O S A las inclusiones se ha denominado tambin como


paraplasma o metaplasma.
O filamentos de mioslna, estn en clulas musculares y
tienen un dimetro de 12 a 16 nanmetros. Estn for- Pueden encontrarse aislados en el citoplasma sin limita-
mados por las protenas: meromiosina liviana y mero- cin por sistemas unitarios de membrana o pueden estar
miosina pesada. Forman en las clulas musculares incluidos en una membrana celular como fagosomas,
estriadas esquelticas y en las clulas musculares son estructuras esfricas regulares o irregulares, mu-
cardacas, unidades estructurales, que son las sarcme- chas veces como cristales.
ras. En las clulas animales y en las del organismo humano
pueden ser considerados los siguientes:

L O S FILAMENTOS DELGADOS
1. ALIMENTOS ALMACENADOS como carbohidratos
O filamentos de actina, estn presentes en clulas y lpidos.
musculares y en clulas que realizan movimiento. Estn
formadas de tres protenas que son: actina G, troponina Los carbohidratos como el glucgeno (en clulas vege-
y tropomiosina. Tiene un dimetro de 4 a 6 nm. Las tales el almidn) que se acumula en hepatocitos, clulas
fibras de actina se intercalan con las de miosina para musculares y otras clulas que necesitan producir ener-
formar las Sarcmeras, que son unidades estructurales ga. Las neuronas no tienen la capacidad de acumular
y funcionales de clulas musculares estriadas. glucgeno, por lo que la glucosa debe llegar en forma
constante. Si los niveles en sangre de glucosa disminu-
L O S FILAMENTOS INTERMEDIOS yen a menos de 60 mg/100 mi o 40 o 20, el individuo
presenta una disminucin en sus funciones como son:
Son estructuras filiformes de dimetro entre 7 y 11 nm, somnolencia, convulsiones, coma y an la muerte.
promedio de 10 nm, presentes en algunas clulas,
constituyen parte del citoesqueleto celular y seguramen- La presencia de carbohidratos en las clulas pigmenta-
te intervienen en algunas funciones celulares. das con H.E. se ven como espacios blanquecinos irregu-
Se ha demostrado diferentes filamentos intermedios en lares.
clulas como las citadas en el siguiente cuadro.
Algunos individuos sufren trastornos en el almacena-
miento del glucgeno, a causa de la incapacidad para
Filamentos Intermedios en clulas degradar esta sustancia, por falta de enzimas o mal
funcionamiento de las mismas, producen enfermedades
a nivel heptico, muscular y otros sectores del orga-
1. Prequeratina . Clulas epiteliales
nismo.
2. Desmina Clulas musculares
3. Neurofilamento Neuronas
Los lpidos se acumulan principalmente en los adipocitos
4. Filamento glial Clulas guales (astrocitos,
en forma de triglicridos, pero pueden estar presentes
ependimarias, Schwano
en cualquier otra clula del organismo como en clulas
5. N^mentina Clulas embrionarias hepticas, en condrocitos al envejecer.

Se determina la presencia de lpidos en clulas cuando


con H.E. observamos espacios blanquecinos de aspecto
regular. Esto debido a que en el procesamiento de las
muestras histolgicas con el mtodo de la parafina se
usan muchos solventes de grasas, como el formaldehi-
do, el mismo alcohol, el xilol y por ltimo consideremos
el uso de parafina. Al realizar el corte y devolver el agua,
ya no es posible devolver las grasas y estos espacios
antes ocupados por lpidos se llenan de agua, que es de
pH neutro, por lo que no toman ni la Hematoxilina ni la
Eosina y se presentan como espacios blanquecinos
generalmente redondeados y de bordes regulares.

2. PIGMENTOS

Pigmentos exgenos Como los carotenos presentes en


los vegetales en general y particularmente en los vege-
tales de color como las zanahorias, tomate, cascara de
las manzanas, etc. Los carotenos son pigmentos liposo-
lubles, que dan color amarillento a las grasas, a la yema
del huevo. La coloracin de las grasas depende de la
cantidad de carotenos incluidos, por ello la grasa de
cerdo es generalmente blanquecina cremosa, y la de las
INCLUSIONES CITOPLASMTICAS reses de color amarillo intenso (la vaca come hierba
toda su vida). Las aves de corral criadas en galpones y
Las inclusiones citoplasmticas se diferencian de los con alimento "balanceado" si no reciben suficiente canti-
organitos, porque estos aunque actan en la estructura dad de carotenos tendrn huevos con yemas plidas,
celular y funcin, no estn encargados de cumplir fun- que de acuerdo a las costumbres alimenticias de la
ciones especficas, son materiales de composicin poblacin resultan poco apetitosas.
qumica heterognea, a veces presentes como producto Los individuos que ingieren abundantes vegetales de
de acumulacin celular de materiales excretados o color, pueden llegar a tener una pigmentacin en la piel
incluidos como producto de fagocitosis, pueden ser de color amarillento, que puede confundir con la "icteri-
pigmentos endgenos y exgenos, sustancias de reser- cia" (ictericia es color amarillento de la piel por acumula-
va celular como carbohidratos y lpidos. cin excesiva de bilirrubina). Estos individuos se dice
52

tienen hipercarotinemia, que aunque no se ha determi-


nado que sea una patologa especfica, por lo menos
presentan una coloracin anormal, sobre todo a nivel de
las palmas de las manos.
Los carotenos son precursores de la vitamina A (mol- Otro pigmento endgeno es la melanina, da color a la
culas de 40 tomos de carbono, que al partirse forman 2 piel, pelo, ojos. La eumelanina pigmento de color paro
molculas de 20 tomos de carbono) da cotoracin oscura a la piel y al pelo y la feomelanina
que es un pigmento amarillo rojizo da cx\or al cabello
El carbn de los fumadores puede pigmentar los macr- (pelirrojos). Otro pigmento considerado como de "des-
fagos pulmonares y dar un aspecto negruzco a los gaste o envejecimiento" es la Hpofucsina es un pigmento
pulmones, se observa en casos de autopsias de estos Wpocmmo presente en clulas cardacas, cuando sobre-
individuos. Intoxicaciones de minerales pueden pigmen- viven a un infarto
tar las clulas como el caso de intoxicaciones con pio-
rno, mercurio, plata. Cristales Se encuentran en determinadas clulas como
en las clulas de Sertoli, en forma de cristales de Char-
Los tatuajes son otro tipo de inclusiones pigmentarias cot-Bocher; en las clulas intersticiales de Leydig se
exgenas. encuentran cristales de Reinke, se relaciona la presen-
cia de cristales por la presencia de protenas.
Pigmentos endgenos En los glbulos rojos se acumula
hemoglobina en condiciones normales, al destruirse los
hemates la hemoglobina se transforma en bilirrubina
que pinta la orina, las heces, cuando hay exceso de
produccin de bilirrubina el sujeto, adquiere una colora-
cin amarillenta en la piel e incluso en mucosas y con-
juntiva (a esto se denomina ictericia). La hemosiderina
pigmento derivado de la hemoglobina da una coloracin
pardo dorado.
53

CAPTULO I V

PRCTICAS DE L A B O R A T O R I O

P R A C T I C A D E L A B O R A T O R I O No UNO

TEMA: EL MICROSCOPIO.

Objetivo de la prctica y competencias c) Transformador de la fuente luminosa, incorporado


en el pie del microscopio.
a) Presentar al microscopio de trabajo y hacer que los d) Lmpara de halgeno con filamento de Tungsteno.
alumnos conozcan las partes que lo confomnan y e) Regulador de la tensin para trabajo de la lmpara
que luego de conocer su funcionamiento, lo utilicen en 3 6 voltios, el mismo que debe estar en la ten-
adecuadamente en las prcticas de laboratorio. sin ms baja o en la mitad de la regulacin. La
b) Conocer los fundamentos tericos de microscopa mxima regulacin debe ser usada en caso de con-
y aplicarlos en la observacin de clulas, tejidos y traste de fase, microscopio de campo oscuro o en
rganos. microfotog rafia.
c) Determinar las unidades de medida utilizadas en f) Colector esfrico,
microscopa. g) Diafragma de campo luminoso con anillo moletea-
d) La competencia est relacionada al buen uso que do.
se le d al microscopio y el reconocimiento paula- h) Espejo desviador con un par de placas cua con
tino de las clulas, tejidos y rganos del cuerpo dos anillos moleteados regulables entre si, de la
humano que la superior se comporta como cojinete filtrante.
i) Fuente luminosa o fuente de energa elctrica.
(Generalmente 110 voltios).
EL MICROSCOPIO

prerrequisitos C. Condensador compuesto de:

1- Cul es el concepto de microscopio a) Porta condensador con el tornillo para desplazar


2. Cul es la diferencia entre microscopio simple y com- este trompo hacia arriba o hacia abajo, lo que per-
puesto mite que el cono de luz incida en diferente ngulo
3. Qu tipos de microscopio existen sobre la lente objetivo.
4. Cul es la diferencia entre microscopio fotnico y b) Lente de campo grande, intercalable.
microscopio electrnico c) Diafragma de apertura
5. Quien fue ei inventor del microscopio compuesto d) Porta filtros.
6. Cul fue el papel de Van Leeuwenhoek
7. Reconozca las partes constitutivas del microscopio lll.Parte ptica.
fotnico
Compuesto del tubo ptico con la presencia de dos
I. Parte mecnica: Formada por: lentes o dos sistemas de lentes que forman el Ocular y
el objetivo.
a) El estativo formado por el pie y el porta tubos
b) Brazo del microscopio a) El ocular: denominado as por estar cerca del ojo
c) Platina con carro para desplazamiento del portaob- del observador. Tiene varios tipos de amplificacin:
jetos, descrito en el punto f. 5X, 10X, 15X. Generalmente la lente ms usada es
d) Tornillo macromtrico y micromtrico o un solo el de 10 X. {Amplificacin: operacin que consiste
tornillo de enfoque de precisin, que tiene un mar- en aumentar la magnitud o energa de una seal
gen de desplazamiento de 0.1 mm (100 micrme- elctrica, mediante su aplicacin a un amplificador
tros), de aproximadamente media vuelta del botn ptica: aumento positivo de un sistema ptico. La
de pin y cremallera. El valor de la divisin de la accin de amplificar no aumenta el poder de reso-
graduacin es de 2 micrmetros. lucin, solamente se ven las imgenes ms gran-
e) Tornillo de desplazamiento del condensador o des)
accionador del condensador, moviliza el porta con- b) E l Objetivo: denominado as porque la lente se
densadores. encuentra cerca o en contacto con el objeto de ob-
f) Tornillo de desplazamiento del portaobjetos sujeto servacin del microscopio. Se encuentra dispuesto
a la platina, compuesto de un carro que transporta en un sistema de revolver, que permite hacer el in-
el portaobjetos en movimientos horizontales o de tercambio de lente para diferentes usos y amplifi-
derecha a izquierda o viceversa y de adelante ha- caciones.
cia atrs o de atrs hacia delante, con lmites de a. Generalmente son de dos tipos:
movimiento de 26 mm x 76 mm.
I. Lentes de Observacin normal o ms fre-
cuente.
II.Fuente luminosa.
f) Lentes panormicos o con aumentos
La fuente luminosa fijamente incorporada al pie del que van entre 3.2 X, 4 X, o 5X
microscopio, est fonnado por: g) Lentes de Observacin media o lentes
con 10 X, o 20X
a) Enchufe a la fuente elctrica, regulable a 110 V, h) Lentes de Observacin amplificada
127 V, 220 V 240 Voltios, Generalmente el fun- como el de 40 X.
cionamiento se realiza en 110 Voltios.
b) Fusible (No es de operacin, ni de control del II. Lentes de inmersin
alumno, pero debe conocer su existencia) a) lente de 100 X
54

SamWoialmKiiir

Oiafagma

CUESTIONARIO PARA L A SIGUIENTE CLASE DE


LABORATORIO.

1. Qu tipo de microscopio utilizar durante el pre-


sente ao, en las prcticas de Laboratorio?
2. Qu otros aparatos audiovisuales utilizaremos en
nuestra prctica de Laboratorio?
3. Cul es el poder de resolucin o de amplificacin
de cada uno de los aparatos que usaremos?
4. A qu se llama poder de resolucin?
5. Qu otras unidades de medida, a ms de las
enunciadas aqu, pueden utilizarse en microscopa,
Biologa celular o Biologa molecular?
6. Anote las numeraciones que tienen cada una de
las lentes en el microscopio y averige que signifi-
can!
7. Cul es la tcnica para limpiar las lentes cuando
estas estn sucias?
8. Cul es la diferencia entre poder de resolucin y
de amplificacin?
9. Compare mediante un grfico el funcionamiento
del microscopio fotnico y el microscopio electrni-
co.
10. Haga un dibujo de microscopio y seale las partes
que lo conforman.
55

PRCTICA D E No DOS

TEMA: MANEJO DEL MICROSCOPIO


8. Mueva el potencimetro a una medida media de 5
Objetivo de la prctica y competencias: V (recuerde las indicaciones de la clase anterior)

a) El alumno iniciar el manejo del microscopio com- 9. Siga el trayecto de los rayos luminosos hasta
prendiendo su estructura y funcionamiento. encontrarse con el ojo humano, compare con el
b) Adquirir tiabilidades para su mejor utilizacin. esquema que se le pidi realice en el informe para
c) Comprender y aplicar el concepto de medida en esta clase.
las observaciones al microscopio.
d) Proceder a realizar clculos matemticos de las 10. Mueva el tornillo moleteado para ajusfar el ngulo
observaciones al microscopio. de incidencia luminosa.
e) Aprender a cuidar su microscopio.
11. Remueva el filtro de luz y anote lo que ocurre en
Materiales: esta operacin!

1. Microscopio fotnico o denominado tambin com- 12. Observe el condensador y mueva con el tornillo de
puesto o comn. desplazamiento del porta condensador, anotando
2. Laminillas de vidrio: portaobjetos y cubreobjetos. lo que pasa con el ngulo del rayo luminoso.
3. Gotero con agua El condensador debe estar lo ms cerca de la pla-
4. Papel milimetrado. tina cuando usa lente de inmersin, y lo ms aleja-
5. Tiras de papel peridico. do cuando esta observando con lentes panormi-
6. Pelo humano. cos, en la mitad con lentes de observacin media.
7. algodn
8. Tijeras 13. Mueva la palanca del diafragma incluido en el
porta condensador y anote lo que pasa.
Procedimiento:
Observacin del papel milimetrado:
1. Reconozca las partes del microscopio, valindose
del esquema que ya tiene dibujado. a) Corte el papel milimetrado, en un cuadrado de
1 cm de lado y coloque sobre un portaobjetos.
2. Utilice el tornillo micromtrico - macromtrico y b) Coloque el papel milimetrado de manera que
observe el desplazamiento de la platina o del tubo sus ejes: vertical y horizontal queden paralelos
ptico, (anote lo que sucede) a los ejes del portaobjetos.

3. Examine las lentes oculares y objetivos y recuerde


el poder de aumento y la abertura numrica de ca-
da uno de ellos, (anote en su hoja de trabajo las ci-
fras y valores)

4. Reconozca la lente de 100 X o de inmersin y


anote los valores que tiene esta lente.

Colocacin correcta del papel milimetrado

5. Calcule el valor de aumento del microscopio con


cada una de las lentes a utilizarse, para lo cual de- Disposicin anmala del papel
be proceder a multiplicar el valor de aumento de la
lente objetivo por el ocular y luego multiplicar por
1.5 X que es el valor del aumento que provoca el
prisma en los microscopios binoculares.

Ejemplo:

Lente Lente Prisma Total del au-


Objetivo Ocular ment
3.2 X X 10 X X 1.5 X = 48X

c)Agregue una gota de agua sobre el papel milimetrado,


de manera que lo cubra completamente. Cuide que al
poner la gota de agua, no se dae la disposicin de los
ejes pedidos en fonna paralela al portaobjetos.
X= veces de aumento.

6. Conecte el microscopio a la fuente de energa.


Recuerde que debe ser en 110 V.

7. Prenda y apague el interruptor de la fuente de


energa.
56

Observacin incorrecta del papel milimetrado

d)Cubra con un vidrio cubreobjetos (Recuerde mantener


los ejes). Al colocar el cubreobjetos debe primero besar
el agua con uno de sus bordes y dejar caer como si se
tratara de una tapa de bal, de acuerdo al siguiente
esquema.

Observacin incorrecta de la observacin del papel


milimetrado

Cambie a la lente objetivo de 10 X y mida el nmero de


milmetros observados
13.2 Proceda de igual manera con el objetivo de
40 X.
13.3 Compruebe con clculos matemticos lo
observado en la prctica.
e) Con el objetivo de menor aumento, enfoque la
placa preparada. Para realizar los clculos matemticos nos valemos de
una regla de tres simple indirecta, pues recuerde que a
La platina separada lo ms posible del objeti- mayor aumento del microscopio, menor ser la superfi-
vo, se le acerca hasta que se vea la imagen cie observada.
clara en el microscopio, (esto se llama enfo- Tomamos como valor conocido, el primer dato de nues-
que) tra observacin. Para los siguientes clculos procede-
mos de la siguiente manera:
g) Mueva la platina, con el tornillo de desplaza-
miento del carril del portaobjetos de manera Ejemplo de clculo matemtico con observacin de
que una linea horizontal del papel milimetrado, objetivo de 10 X
se coloque en el dimetro horizontal del cam-
po del microscopio. 48 X 5.5 mm
150 X ?
h) llueva la platina de manera que una linea
vertical del papel milimetrado bese el borde 48 X 5.5 mm
del campo de observacin del microscopio. 150X

Dibuje la observacin y cuente el nmero de


milmetros observados. 14. Calcule la superficie observada en cada uno de los
campos del microscopio.
Observacin correcta Superficie de la circunferencia es igual a:

S= TT.r =

15. Proceda a la observacin de papel peridico, colo-


cando sobre el portaobjetos un pedazo de papel
del mismo tamao que el que realiz con el papel
milimetrado.

15.1. Observe las letras y nmeros del papel peridico,


notar que las letras se presentan al revs de lo
que usted program, como si estuviera viendo a travs
de un espejo.

15.2. Observe que cuando usted desplaza la platina de


derecha a izquierda, el objeto o las letras o nmeros se
desplazan de izquierda a derecha. Cuando desplaza la
platina de adelante hacia atrs, las imgenes van de
atrs hacia delante.
57

CUESTIONARIO PARA LA PRXIMA CLASE DE


LABORATORIO

1. Explique, porqu al observar con 40 X, se dice que


hay 600 aumentos.
2. Qu es la aberracin cromtica y que pasa en los
actuales microscopios?
3. Por qu el papel milimetrado debe ser un cuadra-
do de 1 cm?
4. Qu es dimetro y que es radio en la circunferen-
cia?
5. Cmo se calcula la superficie de la circunferen-
cia?
6. Por qu razn debe iniciar la observacin con
lentes de menor aumento y paulatinamente con las
otras lentes de mayor aumento?
7. A qu se llama ngulo de incidencia?
8. Haga los dibujos correspondientes a las observa-
ciones de papel milimetrado, con los aumentos de
3.2 X, 10X, 40 X.
9. Haga los clculos matemticos de las observacio-
nes de longitud con 10 X, 40 X, 100 X.
10. Haga los clculos matemticos de las observacio-
16. Observe un pelo (coloque el pelo sobre el portaob- nes de superficie con 5 X, 10 X, 40 X, y 100 X.
jetos, coloque una gota de agua y cbralo con el (los dibujos deben reflejar la realidad de lo obser-
cubreobjetos. vado y calculado.
17. Anote los clculos y dibujos de lo observado.
58

PRACTICA DE LABORATORIO No TRES

TEMA: OBSERVACIN DE CORCHO, C E B O L L A Y CLULAS DE M ATAGALLO.

Objetivo de la prctica:

a) Mirar clulas de corcho, vistas por Robert Hooke


en 1665.
b) Observar clulas de la cutcula y parnquima de
cebolla blanca y cebolla paltana.
c) Descubrir la presencia de estomas en las clulas
de la epidermis del "matacallo".
d) Introducir al estudiante en el estudio de las clulas
vegetales.
e) Reconocer la estructura de las clulas vegetales y
, luego compararlas con las clulas animales.

Materiales:

1. - Microscopio fotnico
2. Un corcho
3. Una rama de cebolla blanca con todos sus elemen-
tos o catfilas
4. Una hoja de matacallo u hoja similar a sta. El corcho:
5. Hoja de Gillette o bistur
6. Estiletes o alfileres montados en la punta de una El corcho fue observado por Robert Hooke en
esferogrfica. 1665 y constituy una revolucin en la descripcin de la
7. Portaobjetos (varios de ellos) composicin de los seres vivos. Inicia una nueva era de
8. Cubreobjetos (varios de ellos) conocimientos cientficos biolgicos hasta nuestros das.

Procedimiento: El corcho est formado de clulas muertas y general-


mente se la obtiene industrialmente de la corteza del
OBSERVACIN DE L A S CLULAS DE CORCHO. "alcornoque". Es producido por el "cambio subergeno",
el mismo que se divide repetidamente para formar unas
1. Tome un pedazo de corcho. Y con una navaja, filas de clulas radiales, las mismas que se llenan de un
bistur o gillette, realice varios cortes finos, hasta material graso o creo, que impide el paso del agua y
obtener una rebanada muy transparente de pocos gases, haciendo que las clulas de la corteza se mueran
micrmetros de espesor. y se descamen.

La mayora de las plantas leosas y algunas herbceas


tienen una capa de corcho en la parte exterior del tallo
durante la primera temporada de crecimiento, las clulas
de corcho se encuentran ordenadas en filas radiales. El
corcho separa la epidermis del suministro de alimento y
agua y por ello la epidermis muere y se descara gra-
dualmente. Las clulas de corcho mueren y se llenan de
aire, tanino, material creo, etc. El corcho retrasa la
prdida de agua de los tejidos del tallo y se forma tam-
bin durante la curacin de heridas impidiendo la
desecacin de los tejidos expuestos y la entrada de
hongos que podra pudrir la planta.

Las patatas son un buen ejemplo de la formacin del


corcho. Al principio de la cosecha, al frotar la papa, se
pela fcilmente. Al almacenada, solo se puede retirar la
Monte una fina rebanada de corcho, sobre un cascara con la pelada. Esta cascara desprendlble o
portaobjetos, coloque una gota de agua sobre la llamada en nuestro medio como papacara es el corcho.
preparacin, protjalo con el cubreobjetos. Recuer-
de que el espesor del corte debe ser mas fino que
una hoja de papel.

Inicie la observacin del corcho con el lente de


menor aumento. (3.2 X) corcho

Realice un dibujo de lo observado y compare con


lminas de libros.

Realice observacin con otros objetivos (10X, 40 X)


y dibuje parnquima
e Blmace-
Utilizando los conocimientos de la clase pasada, amiento
usted puede intentar decir cul es el tamao de las
clulas de corcho que est observando.

Robert Hooke
59

(1635-1703) La cebolla es un tallo subterrneo, llamado bulbo y con


presencia de hojas denominadas catfilas. La capa de
Fue un fsico, astrnomo y naturista ingls. Perfeccion clulas que cubre las hojas por ambos lados se denomi-
muchos instrumentos de medida y observacin como na epidermis.
microscopio, telescopio y relojes. Construy una bomba
al vaco e ide muchos aparatos meteorolgicos. Su
mayor azaa es el haber podido descubrir la presencia
de celdas en la observacin del corcho.

OBSERVACIN DE LAS CLULAS DE MATACALLO.


OBSERVACIN DE LA EPIDERMIS Y PARNQUIMA
DE CEBOLLA. 1. Tome una hoja fresca de matacallo y separe la
cutcula con el estilete.
1. Tome una rama de cebolla blanca en buenas 2. Coloque sobre una placa portaobjetos, cbrale con
condiciones, no con las catfilas secas. agua y con el cubreobjetos.
2. Separe la cutcula, para lo cul es necesario la 3. Otra placa con matacallo, preprele con azul de
ayuda de un estilete o un alfiler. El estilete debe metileno.
mantenerlo paralelo a la superficie de la cebolla, 4. Observe con el lente de menor aumento y luego
como pretendiendo despellejarlo o sacar una tela con lentes de mayor aumento.
muy fina. 5. Observe la presencia de estomas y dibuje.
3. Tome un pedazo de la cutcula desprendida (debe
ser de aspecto bastante transparente) y coloque
sobre el portaobjetos. Cbrale con agua y tpele
con el cubreobjetos.
4. Realice otra preparacin igual, pero tale con azul
de metileno.
5. Observe con lentes primero de menor aumento y
luego siga hasta observar con 10 X y 40 X.
6. Cuente el nmero de clulas en una observacin y
determine el tamao de las clulas que est obser-
vando.
7. Haga los dibujos y los clculos de lo aprendido en
este laboratorio.
6. Mire las clulas estomticas o arrionadas, dibje-
las y descrbalas.
7. Cuente el nmero de clulas ubicadas en el ecua-
LA CEBOLLA.
dor y detenmine el tamao de las mismas.
La cebolla es una planta bienal de la familia de
las liliceas, de bulbo foliceo y esfrico, cuyo nombre
cientfico es Allium cepa. Est compuesto de varias
tnicas superpuestas gruesas y carnosas, excepto las

finas y secas exteriores que varan de peso, color, y


forma, segn la especia. Se las utiliza como condimento
en la alimentacin debido a su olor y sabor.
60

EL MATACALLO. Tejidos Secundarios

El matacallo es una planta herbcea originaria En contraste con los tejidos primarios, los tejidos secun-
de Ecuador y Chile, parecida a las siemprevivas y las darios se forman de la actividad de un meristema lateral,
utilizaremos para hacer observaciones de estomas en ya sea el cambium vascular o el cambium subergeno.
las hojas, De ella resulta el crecimiento llamado secundario que
La estructura de la hoja tiene: acrecienta el grueso del tallo y de la raz.
1. La epidermis La actividad del cambium comienza por lo regular antes
2. El mesfilo que los tejidos vasculares primarios se hayan diferen-
3. Haces vasculares. ciado plenamente. Las clulas del cambium se dividen y
producen el xilema secundario en el lado interno y floe-
ma secundario en el lado externo. Los radios vasculares
se forman tambin por el cambium, el xilema secundario
La observacin de los estomas se realiza en la epider- en el lado interno y el floema secundario en el lado
mis de las hojas de matacallo, la epidermis se compone externo. El cambium contina formando xilema y floema
de un solo estrato de clulas entrelazadas, que gene- ao tras ao durante toda la vida de la planta.
ralmente no contiene cloroplastos. Se extiende a ambos
lados de las hojas. Tejido Funcin Caractersti- Tipo celular
Los estomas son estructuras que permiten la salida de ca
agua del interior de la hoja, estn formadas de dos Meristema Crecimiento Paredes I r a Clulas meser'
clulas arrionadas con presencia de cloroplastos, por divisin ncleo grande qu^mticas
forman una especie de poro. Alrededor de las clulas cettiiar
arrionadas hay las clulas de sostn. Parnquima Procesos Paredes Clulas paren-
Las clulas vegetales presentan una pared celular que del metabo- primaria o quimatosas
debe ser observada. lismo secundaria, Colnquima
fotosntesis, clulas vivas a angular tangen-
respiracin, la madurez cial y angular
TEJIDOS VEGETALES
almacn y
conduccin
Se los puede dividir en:
acorta
distancia
Tejidos primarlos etc.
Colnquima $Q$tn e n Pared I r a Coln^uma
Cuando se encuentran perfectamente diferenciados y rganos e n desigualmente angular tangen-
maduros, nacen del meristema apical del tallo y de la crecimiento engrosada cial y angular
raz o de sus derivados. Hay floema primario y xilema Esclernqu- Sostn Pared I r a y Fibras y tra-
primario. ma 2da general- queidas
mente lignifi-
La corteza, la mdula y la epidermis son tambin tejidos cada
primarios, los precursores de estos tejidos se distinguen Epi4erms Proteccin Pared I r a la Clulas epidr-
inmediatamente debajo del meristema apical y denomi- de partes externa con micas pro^wa-
nados segn el sistema de tejidos a que dan origen. verdes cutina mente dichas
clulas especia-

Los meristemas son: 1) La protoepidermis que forma la lizadas tricomas


estomas, etc.
epidermis; 2) El procambium que da origen a los tejidos
vasculares primarios; 3) El meristema fundamental que
produce los tejidos fundamentales como la mdula y la CUESTIONARIO PARA LA PRXIMA CLASE DE
corteza. LABORATORIO
1. Realice los dibujos correspondientes a las obser-
El procambium consta de clulas alargadas verticalmen- vaciones realizadas de corcho, cebolla, matacallo.
te y que en los tallos de dicotiledneas y coniferas Determine el tamao correspondiente a cada uno
forman un cilindro. Prolongaciones laterales de este de los tipos de clulas observadas.
cilindro se extienden en las hojas y se diferencian en Cules son las caractersticas de las clulas
rastros florales. Las clulas procambiales de pequeo vegetales?
dimetro pero ricas en protoplasma, se ven dispuestas Cul es la diferencia entre clulas vegetales y
en crculos compuestos de grupos de clulas separados clulas animales?.
por tejido que por algn tiempo permanecen como Qu funcin cumplen los estomas y cul es el
meristemtico. Los cordones procambiales se diferen- papel en las diferentes clulas que la conforman?.
cian y maduran para convertirse en haces vasculares Cul es la estructura de los estomas y realice un
separados por parnquima interfascicular. dibujo de su estructura?.
Las clulas exteriores de estos cordones se diferencian Qu tipo de clulas observ (procariticas o
en floema primario y las interiores en xilema primario. eucariticas) y como reconoce?
Entre ellas queda una capa de clulas denominada Cul es la diferencia entre clulas eucariticas y
cambium vascular que permanece indiferenciado como procariticas?
meristema, estas clulas mantienen indefinidamente la Por qu los virus no son considerados como
capacidad de dividirse y con ello aumentar el dimetro clulas?
del tallo. El cambium situado dentro de los haces vascu- 10. Realice un esquema de la estructura de un virus
lares se llama cambium fascicular
61

P R A C T I C A D E L A B O R A T O R I O No CUATRO.

TEMA: OBSERVACIN DE CLULAS DE LA MUCOSA BUCAL. COLORACIN DE CLULAS CON AZUL DE METI-
LENO Y ORCENA OBSERVACIN DE CLULAS COLOREADAS CON (H.E.) HEMATOXILINA Y EOSINA.
4. Coloque una placa cubreobjetos y observe con
Objetivo de la prctica: lente de menor aumento.

a) Reconocer clulas eucariticas y observar los


diferentes componentes del ncleo y citoplasma,
sus organitos citoplasmticos y las inclusiones ci-
toplasmticas.
b) Observar clulas eucariticas y distinguir perfecta-
mente el ncleo de otras estructuras celulares.
c) Estudiar las caractersticas del ncleo en clulas
normales, y compararlas con observaciones de c-
lulas con ncleos picnticos, con cariolisis, o con
cariorrexis. 5. Haga los dibujos de lo observado.
d) Reconocer las clulas coloreadas con tiematoxili- 6. Luego de flamear una segunda placa que contenga
na-eosina e interpretar por la presencia o no del co- un frotamiento, puede colocar sobre ella azul de
lorante, el tipo de sustancia o composicin qurnica metileno, u orcena, por el lapso de 1 a 3 minutos.
de la clula. 7. Lave la placa con agua corriente o con un gotero,
e) Iniciar la observacin con lente de inmersin de la condicin importante es que el chorro de agua
100 X. debe caer sobre la placa en forma oblicua y no de
manera perpendicular, ya que esta ltima manera
Materiales: puede arrastrar consigo la muestra objeto de nues-
tro estudio.
1. Palillos de dientes o mondadientes.
2. Placas portaobjetos y cubreobjetos.
3. Lmpara de alcohol o mechero de gas (fosforera a
gas)
4. Clulas escamosas del epitelio bucal
5. Aceite de cedro.
Azul de metileno.
Orcena (colorante)
Placas de hgado y clulas preparadas de extendi-
dos vaginales.

OBSERVACIN DE CLULAS DE LA MUCOSA BU-


CAL.

Procedimiento:

1. Obtenga una muestra de clulas de la mucosa


bucal, mediante el raspado o frotamiento del mon-
dadientes sobre la pared interna del carrillo bucal. Cuentagotas
Se puede obtener una muestra con hisopo con al-
godn al aplicarlo fuertemente sobre el sitio indica-
do. 8. Coloque una placa cubreobjetos y observe al mi-
2. Realice un frotamiento en una placa portaobjetos. croscopio con lentes de 3.2 X, 10 X, y 40 X.
El material obtenido debe ser aplastado con el cu-
breobjetos. 9. Observacin con lente de inmersin:

9.1. Coloque sobre una placa preparada con azul de


metileno u orcena, una gota de aceite de cedro.
(No coloque el cubreobjetos, en algunos casos de
placas previamente preparadas con cubreobjetos,
el aceite de inmersin va sobre el cubreobjetos.)
9.2. Baje con el macromtrico el tubo ocular, o depen-
diendo del tipo de microscopio, suba la platina,
con el accionamiento del mismo tomillo.
9.3. Enfoque con el tomillo micromtrico o mediante
movimientos sumamente finos, cuando solo tiene
3. Realice el flameo de la placa, sobre una lmpara un tornillo de enfoque. El enfoque finaliza cuando
de alcohol encendida, o sobre el mechero de gas. usted vea la imagen clara.
Tenga cuidado de no pasar la temperatura de la 9.4. Dibuje lo observado.
placa, por encima de 37 C, para lo cual luego de 9.5. Repita la observacin, utilizando placas prepara-
cruzar la placa sobre la llama, aplique sta sobre el das en el laboratorio.
dorso de la mano. Si usted soporta el calor, est
por debajo de 37 C, si no soporta el calor esta re- Tenga cuidado de no manchar las lentes de 40 X, con
basando los 37 C. (al pasar de 37 C, las clulas el aceite de inmersin. Ya que pueden daarse o quedar
pueden degenerarse y daarse su trabajo de inves- pemianentemente sucias. Cuando se utiliza aceite de
tigacin) cedro u observacin con lente de inmersin, ya no debe
regresar a observar con 40 X.
62

contiene cidos nucleicos (DNA, RNA), se presentan un


color azul violeta.
Con la Eosina que tien las protenas de color rosado y
permite distinguir especialmente el citoplasma.
Los espacios blanquecinos en la clula coloreada con
hematoxilina eosina, sern grasas si presentan un
contorno regular, generalmente circular. Si los bordes de
los espacios blanquecinos son irregulares se puede
pensar en carbohidratos como el Glucgeno o en
Glucoprotenas o Glucosaminoglicanos etc. (moco,
antiguamente denominado como mucopolisacrido).
La detenninacin especfica de grasas y carbohidratos
CLULAS DE LA MUCOSA BUCAL. se realiza con las coloraciones de PAS o Pa-Schiff y
Sudn o Rojo Scarlach. Tambin se puede recurrir a
coloraciones especiales como por ejemplo para demos-
Las clulas de la mucosa bucal, son clulas
descamativas, que ocupan la ltima capa del epitelio. trar la presencia de Hierro u otros elementos.
Estn destinadas a morir y por eso generalmente pre-
sentan un ncleo picntico.
La coloracin de las clulas es esencial, pues siendo
estas incoloras, al incluir el colorante pueden ser obser- Com- Acidos Prote- Carbohi- Lpidos
vadas con claridad. Es mejor la utilizacin de dos o ms puesto nuclei- nas dratos
colorantes que tian selectivamente el ncleo y el cito- celular cos
plasma. Cuando se utiliza un solo colorante como el azul Hemato- Color
de metileno, el colorante tie de manera diferencial el xilina violeta
ncleo y el citoplasma, pero en realidad el azul de meti- Eosina
rosado -
leno es ms afn al ncleo que al citoplasma.
Pa-Schiff Color
OBSERVACIN DE CLULAS COLOREADAS CON OPAS magenta -
HEMATOXILINA Y EOSINA. Rojo Color
Congo o rojizo
1. Coloque una placa preparada, por ejemplo de Scarlach
hgado, sobre la platina del microscopio.
2. Observe con lente de menor aumento o 3.2 X,
luego con 10 X, y por ltimo con 40 X (Este es el
orden de observacin, en todas las placas y duran-
te todo este ao lectivo.)
3. Haga los dibujos de lo observado y compare sus
dibujos con los grficos o fotografas de la Histolo-
ga de Ham o del atlas de Mariano Diffiore.
4. Coloque una gota de aceite de cedro y observe con
lente de 100 X.
5. Calcule el tamao de las clulas en las diferentes
observaciones y saque conclusiones.
6. Observe el color de cada uno de los componentes
celulares y aplique los conceptos recibidos durante
las clases tericas.

COLORACIN DE LAS CLULAS

Como se explic al inicio, la mayor parte de clulas del


organismo son incoloras. Por lo tanto, para la observa-
cin se necesitan colorantes que tian selectivamente
los diferentes componentes qumicos celulares, por ello, H y E
estos mtodos se denominan mtodos histoqumicos,
citoqumica o histoqumica simplemente. Figura N 1 Coloracin H E en una clula heptica
El ncleo de color azul violeta, se observa la cubierta nu-
clear y el nuclolo. En el citoplasma observe la gran canti-
Mediante la histoqumica se puede demostrar la presen-
dad de espacio blanquecino de bordes irregulares, se debe
cia de un compuesto qumico orgnico especfico, as, a la acumulacin de glucgeno, en el citoplasma se observa
cidos nucleicos, protenas, carbohidratos y grasas o granulos basfilos (azules) debido a la presencia de R E r y
lpidos. ribosomas
Como las protenas son especficas para cada individuo,
se podr determinar selectivamente la presencia de un Figura N 2 Coloracin de PAS en una clula hepti-
tipo especial de protena, como las del tejido epitelial, ca
conectivo, muscular o nervioso. O si se quiere la pre- Observe las estructuras de color magenta irregulares que
sencia de un anticuerpo (anticuerpo es una protena) representan el glucgeno acumulado en las clulas hepti-
presente en el organismo en forma natural o mediante la cas
reaccin antgeno anticuerpo. (Entender mejor cuando
Figura N 3 Coloracin H E en clulas adiposas
recuerde lo que es la inmunofluorescencia) Observe las clulas con una bandeleta pequea de cito-
plasma, el gran lbulo de grasa de color blanquecino,
El mtodo de coloracin comn es la de la hematoxi- aunque en realidad lo que se ve es el espacio que ocupaba
lina eosina. Se basa en la demostracin de sustancias la grasa, y que ahora esta lleno de agua de pH neutro
acidas como los cidos nucleicos y de sustancias bsi-
cas como las protenas en general.
As, con la Hematoxilina, es fcil determinar la presencia
del ncleo y de ciertos organitos citoplasmticos que
63

Coloracin H E de mdula espinal. Sustancia blanca


observe el axn rodeado de mielina

Coloracin H E de una placa de ojo, se observa la


conjuntiva, la esclertica, la coroides y la retina

Coloracin H E de Cerebelo
Observe las meninges como espacios blanquecinos
CUESTIONARIO PARA LA PRXIIMA CLASE DE
LABORATORIO.
1. A qu se denomina citoquimica y qu es la histo-
qumica?
2. Para que utiliza ia tcnica de coloracin Pa-Sctiiff o
coloracin de FAS?
3. Cul es la diferencia entre coloracin simple y
coloracin compuesta?
4. De donde se obtiene especficamente la eosina y
cul es su parentesco con la fluorescena?
5. Que es la coloracin de Feulgen y para que sirve?
6. Qu pasos se deben seguir para la preparacin de
una placa por ia tcnica de ia Parafina?
7. Qu diferencias hay entre la tcnica de la parafina
y ia tcnica de la congelacin?
8. Cmo se debe proceder para la preparacin de una
muestra para ME?
9. Qu son los artefactos en las observaciones de
microscopa?
10. Realice los dibujos de las observaciones vistas,
Coloracin H E en una placa de Tiroides explicando con nombres las particularidades que
fue encontrando.
64

PRCTICA D E L A B O R A T O R I O No CINCO.

TEMA: LA MITOSIS. OBSERVACIN DE CROMATINA DE BARR (HETEROCROMATINA).

Objetivo de la prctica:

a) Observar y reconocer imgenes en mitosis, en las


clulas de cebolla colorada.
b) Reconocer la cromatina de Barr, en frotamiento de
la mucosa bucal.
c) Iniciar el estudio de la fisiologa celular con obser-
vaciones de clulas en mitosis.
d) Aplicar los conocimientos y destrezas sobre el Coloque sobre las races una gota de fijador de HCI
manejo del microscopio. al 5% y djelo por 3 a 5 minutos.
e) Iniciar la curiosidad cientfica y hacer una prctica Lave los pices con agua, cuidando de no perder
de investigacin cientfica. las races en este proceso. El fin de lavar, es arras-
trar el HCI
Materiales: Cbrale momentneamente con un cubreobjetos, y
ayudado de un pedazo de papel higinico, proceda
1. IVlicroscopio fotnico. a aplastar la raz, de manera que las clulas se di-
2. Varios portaobjetos y cubreobjetos seminen por el portaobjetos.
3. Vidrios de reloj o cajas de Petri Coloque una gota de orcena actica sobre la
4. Hojas de bistur o de Gillette. muestra y deje de 5 a 8 minutos.
5. Mondadientes o palillos de dientes. Lave la muestra con agua, tratando de eliminar el
6. Hojas de papel higinico. exceso de colorante y manteniendo la preparacin.
7. Cebolla colorada o paitea, lista para realizar la 9. Coloque una placa cubreobjetos.
prctica. 10. Ponga la placa sobre la platina y empiece a obser-
Clulas de la mucosa bucal obtenidas mediante var, no olvide que tiene que empezar por el lente
tcnica aprendida. de menor aumento y continuar en forma ascenden-
9. Fijador de cido clorhdrico al 5% (MCI). te hasta ver con 40 X,
10. Orcena (colorante preparado, listo para usarse)
11. Violeta de cresilo brillante.
12. Aceite de cedro.

Procedimiento:

MITOSIS:

1. Obtenga un bulbo de cebolla paitea o colorada


que est en buenas condiciones.
1.1. Retire las hojas secas o destruidas de la cebolla
colorada.
1.2. Corte superficialmente la zona de crecimiento de
las races de la cebolla, o simplemente proceda a
raspar la zona indicada.

11. Coloque una gofa de aceite de cedro y observe con


100 X.
12. Busque clulas en mitosis en las diferentes ases:
profase, metafase, anafase, telofase y clulas en
interfase.

cebolla paitea
LA MITOSIS.
1.3. Coloque la cebolla en un vaso de agua, de
manera que el bulbo quede nadando y el La mitosis es un proceso de divisin celular asexual, que
agua bese el borde inferior. se presenta en una clula diploide (2n), y que ha dupli-
1.4. Cambie el agua del recipiente cada 24 horas, cado su material gentico, es decir est en fase de G2.
cuidando de no daar las races que como usted Produciendo dos clulas tambin diploides, pero en fase
observar, empezarn a crecer. de G 1 , o clula que tiene un nmero diploide de cromo-
1.5. Lleve la cebolla preparada al laboratorio, debe somas simples. Las clulas hijas sern idnticas a la
transportarla en el vaso que germin, y con agua. clula progenitura, y tendrn el mismo tipo de informa-
cin gentica.
2. Con una Gillette corte el pice de las races, (parte La mitosis se presenta como un evento que permite
terminal de una raz entera) de una longitud de 2 a aumentar el nmero de clulas a partir del huevo o
3 mm. cigoto y permite el desarrollo y crecimiento de un nuevo
3. Coloque los pices en un portaobjetos y corte organismo, tambin mediante este proceso se renuevan
longitudinalmente con un bistur, de acuerdo con el las clulas viejas o degeneradas.
siguiente esquema:
65

Con fines didcticos la mitosis, se divide en varias fases a fomnar el huso cromosmico que nace de los ci-
que son: netocoros (estructura presente en los centrme-
a) Profase ros). Los cromosomas se encuentran entre las fi-
b) Metafase bras del huso acromtico o fibras del ster del apa-
c) Anafase rato mittico, como si se tratara de corredores, pa-
d) telofase sillos o galeras. Al formar el uso cromosmico, los
cromosomas que estn como los bomberos en un
pasillo tratando de abrir una escalera, la nica ma-
nera de abrir la escalera en fonna completa es dis-
ponindose en el centro del corredor.

Clula madre

Anafase: Los eventos ms importantes durante la ana-


fase son:
1. Los cromosomas que hasta este momento son
dobles (tienen el doble de material gentico, es de-
cir, estn en G 2, y son cromosomas "d"), se rom-
pen longitudinalmente. Liberando el material gen-
tico en dos partes, que luego migrarn hacia polos
diferentes.
Profase: Los eventos ms importantes la profase 2. Los cromosomas que luego de la divisin ya no son
son: dobles sino cromosomas "s" migran hacia los po-
La cromatina se condensa paulatinamente, y termi- los. Evento que se puede mirar para calificar a una
na formando los cromosomas. clula en anafase.
El nuclolo desaparece aparentemente, pues el
material gentico que lo forma, va a constituir parte
de los satlites de algunos cromosomas. En la es-
pecie humana, los cromosomas que tienen satlite Telofase: Los eventos ms importantes de la telofase
y por lo tanto presentan material gentico denomi- son:
nado "organizadores nucleolares", son los cromo- 1. Los cromosomas "s", llegan a los polos de la clula.
somas de los pares 13, 14, 15, 2 1 , y 22. 2. Reorganizacin del ncleo con la despirilizacin o
descondensacin de los cromosomas, para formar
nuevamente la cromatina.
3. Reestructuracin de la membrana nuclear.
4. Reaparicin del nuclolo ya que los organizadores
nucleolares, se renen en una o dos masas, para
formar uno, dos o ms nuclolos.
5. Los centrolos que en cada polo son un solo par, se
dividen en dos.

Para terminar la mitosis, la clula debe dividir-


se en dos clulas hijas. La clula progenitora o madre,
0 sufre una constriccin en la parte media, y mediante una
9 estrangulacin cada vez ms profunda, forma dos clu-
las hijas.
Mientras la reparticin del material gentico (ncleo) a
las clulas hijas fue exactamente igual. En la reparticin
3. La membrana nuclear se desorganiza, consecuen- del citoplasma no ocurre de la misma manera, y las
temente los cromosomas ya formados quedan so- clulas hijas reciben diferente cantidad de organitos
brenadando en el citoplasma. citoplasmticos y de todo el material del citosol. La
4. Los centrolos que al momento del inicio de la reparticin se hace al azar e implica que por este proce-
mitosis son 4 (o dos pares), se separan y cada par so las clulas hijas pueden dar origen a un proceso de
migra hacia los polos de la clula, entre los centro- diferenciacin celular.
los se forma el huso acrosmioo y esto fonna el La diferenciacin celular tiene una base en lo expuesto,
aparato mittico. pero tambin tiene importancia la persistencia de la
cromatina como eucromatina o heterocromatina, expli-
Metafase: Los eventos ms importantes en esta fase caciones que lo recibirn en las clases magistrales.
son:
1. La cromatina que estaba en fase de condensacin
en la profase, contina hasta formar los cromoso-
mas, los mismos que son pequesimos y regorde- CROMATINA DE BARR O HETEROCROMATINA
tes debido a la mayor condensacin de la red de SEXUAL.
cromatina.
2. Los centrolos llegan hacia los polos y terminan 1. Prepare una placa con un extendido de mucosa
fonnando el aparato mittico. bucal, de acuerdo a las indicaciones de la prctica
3. Al desaparecer la membrana nuclear, los cromo- anterior.
somas se disponen en el ecuador de la clula. Este 2. Fije la placa con el calor, utilice el mechero de
es el evento que caracteriza a una clula en meta- alcohol o una fosforera de gas, recuerde no pasar
fase. la temperatura de 37 C.
Una explicacin del porqu los cromosomas se 3. Coloque sobre la placa unas gotas de violeta de
disponen en el ecuador de la clula es la siguiente: cresilo brillante.
A! inicio de la metafase, los cromosomas empiezan 4. Deje el colorante por lo menos 5 minutos.
66

5. Lave la placa con agua corriente, de acuerdo con de sexo masculino y tiene 1 cuerpo de Barr como en la
las indicaciones antes dadas para este procedi- mujer normal.
miento.
Cuntos cuerpos de Barr tendr una variacin del
sndrome de Klinefelter 47, XXX (Llamado tambin
super hembra)?
Respuesta:

Cuntos cuerpos de Barr tendr la variacin del sn-


drome de Klinefelter sper macho 47, XYY?
Respuesta:

6. Deje secar la placa al medio ambiente, o aydese


con el calor de sus manos ya que de esta manera
se propicia una evaporacin ms rpida.
7. Coloque una gota de aceite de cedro y observe con
lente de inmersin o 100 X.
8. Realice dibujos de lo observado, tomando en con-
sideracin la presencia o no del cuerpo de Barr o
heterocromatina sexual.

CROMATINA DE BARR O HETEROCROMATINA


SEXUAL.

La cromatina sexual, fue descubierta por Barr


y Bertrn, en clulas nerviosas de gatas, cuando se
estudiaban reacciones fisiolgicas en estas clulas. Por
extensin se descubri la presencia de esta heterocro-
matina en clulas femeninas de casi todas las especies. CUESTIONARIO PARA L A PRXIMA C L A S E DE
El estudio de la cromatina de Barr (como se denomina LABORATORIO.
en honor de su descubridor), es til; ya que permite 1. Cul es la diferencia entre mitosis y meiosis?
determinar el sexo de un individuo o descubrir alteracio- 2. Relate como se descubri la cromatina de Barr o
nes cromosmicas sexuales como en el caso del sn- llamada heterocromatina sexual.
drome de Turner o el sndrome de Klinefelter. 3. Qu es el sndrome de Turner y cul es la utilidad
de la investigacin de cuerpos de Barr en esta
El nmero de cuerpos de Barr es igual al nmero de anomala?
cromosomas sexuales X, menos uno. Esto segn la 4. Qu es el sndrome de Klinefelter y cul es la
explicacin dada por Mary Lyon sobre la heterocromati- utilidad de la investigacin de cuerpos de Barr en
na sexual en las mujeres que poseen dos cromosomas esta anomala?
X. A diferencia de los hombres que presentan un solo 5. En qu consiste la hiptesis de IVIary Lyon.
cromosoma X. Enumere los pasos de la mitosis
7. Enumere los eventos demostrables en el proceso
de meiosis
Cuerpos de Barr = nmero de cromosomas X - 1 Cmo se realiza la preparacin de una muestra
para ver mitosis en el laboratorio
9. Qu es un cariotipo humano?
Cuerpo de Barr 10. Haga los dibujos de las observaciones realizadas
en laboratorio.

El cuerpo de Barr es til para la determinacin rpida


del sexo de un individuo, y representa una condensa- Frmula Nmero ' ^

cin del cromosoma X "extra" que tiene la mujer. En cromosmi- de cuer-


la actualidad no es una prueba determinante, ya que se ca pos de
disponen de mejores mtodos de laboratorio, como Ban-
hacer un cariotipo y con bandeo de cromosomas. La Hombre nor- 46, XY ; 0
investigacin del corpsculo de Barr, se usa en determi- rrial
nacin de sexo de los individuos en competencias atlti- Mujer normal 46,XX 1
cas.
Sndrome de 45,X0 0
Recuerde que en el caso del sndrome de Turner
(45,X0), fenotpicamente el individuo es de sexo feme- Turner
nino y no presenta cuerpos de Barr, En el caso del Sndrome de 47,XXY 1
sndrome de Klinefelter (47, XXY), fenotpicamente es Klinefelter 47,XXX 2
47,XYY 0
67

P R A C T I C A D E L A B O R A T O R I O No SEIS.

TEI^^A: OBSERVACIN DE PROTOZOOS Y A L G A S .


mallculos se desplazan a gran velocidad. Ejm: Eu-
Objetivo de la prctica: glena.

a) Observar clulas vegetales y protozoarios, con un


grado de complejidad primitiva.
b) Reconocer algunos medios de locomocin en
protozoos
c) Medir la reaccin de los protozoarios a la luz, calor
etc.
d) Observar y reconocer clulas vegetales procariti-
cas como el caso de algas azul verdosas.
e) Comparar semejanzas y diferencias entre proto-
zoos y algas.

Materiales:

Microscopio fotnico.
Portaobjetos y cubreobjetos
Papel absorbente (servilletas, papel higinico)
Motas de algodn.
Colorantes como azul de metileno, orcena actica,
azul de cresilo brillante.
Muestras de cultivos de agua estancada, agua de
florero, agua de perejil. Aguas estancadas verdo- 3. Ciliados con presencia de cilios o pequeos apn-
sas con presencia evidente de algas. dices a manera de finos pelos que arrancan desde
7. Esquemas o lminas de diferentes tipos de algas y la membrana celular. Ejm: Paramecio
protozoos.
4. Esporozoos son todos parsitos y no tienen me-
Procedimiento: dios de locomocin, son arrastrados por la corrien-
te sangunea y se dividen por esporas. Ejm: plas-
1. Coloque sobre un portaobjetos una gota de agua modios causantes del paludismo.
de la muestra a estudiar
2. Protjalo con el cubreobjetos.
3. Retire el exceso de agua con el papel secante o
con una servilleta.
4. Ponga la preparacin en el microscopio e inicie la
observacin con lente de menor aumento, contine
con los otros objetivos hasta llegar a 40 X.
5. Haga los dibujos y anotaciones de las obsen/acio-
nes de algas y de protozoarios.
6. Si la movilidad de los protozoarios es muy rpida
puede ser til colocar unas fibras de algodn que
hagan las veces de galeras y pueda atrapar proto-
zoarios.
7. Repita estas indicaciones con cada una de las
muestras llevadas al laboratorio.
8. Observe el comportamiento de las algas y de los
protozoarios ante la Incidencia de la luz.
9. En su observacin al microscopio puede encontrar-
se con algunas larvas de insectos u otros animales
en distintas fases de crecimiento, favor ignore sus
detalles.

LOS PROTOZOARIOS O PROTOZOOS.


LAS A L G A S .
Los protozoos son animales unicelulares y a
primera vista parecen estar constituidos de una clula
que tiene ncleo y citoplasma. Con mayor detenimiento
observar algunos organitos citoplasmaticos que le
permiten el funcionamiento a estos organismos.

Dependiendo de su estructura celular y sobre todo de


los medios de locomocin, los protozoarios se clasifican
en cuatro grandes grupos:

1. Sarcodinos con locomocin dado por emisin de


seudpodos o falsos pies como es el caso de las
amebas.

2. Flagelados presentan un largo flagelo o filamento Stentor (cJtiado)

que se desprende del citoplasma, algunos tienen


un solo flagelo, otros presentan varios. Estos ani-
68

Son organismos unicelulares o multicelulares presentes


en estanques (o agua estancadas) y en lugares hme-
dos, de amplia distribucin, se encuentran en agua
salada o de mar y en agua dulce. Estn en todo clima Diatomeas
desde la nieve hasta en manantiales del desierto y
algunos lagos temporales, estn en la corteza terrestre y
en el subsuelo y tambin sobre o dentro de otros orga-
nismos animales y vegetales.
Son autotrficas, es decir, presentan organitos citoplas-
mticos que le permiten hacer fotosntesis (cloroplas-
tos). Hay ms de 30.000 especies pero la mayora son
marinas.
Exhiben gran cantidad de colores, desde el verde hasta
el verde amarillento y verde azulado y an rojo, anaran-
jado, verde oliva y pardo.
Se presentan en forma de pelotas, filamentos, hojas,
cintas y gran cantidad de figuras ramificadas. De tamao
muy variable desde 30 metros en el mar pacfico hasta
estructuras microscpicas.

Clasificacin:

Verde azuladas, verdes, pardas y rojas. Modernamente


se clasifican en siete grupos:

1. Algas verdes (ciorofitas) de agua dulce y salada,


tienen alimento almacenado en forma de almidn.
Reproduccin sexual y asexual, plantas unicelula-
res o multicelulares y en colonias.
2. Euglenoides (euglenofitas) flageladas, verdes o
incoloras, con uno o ms flagelos, clulas desnu-
das sin pared celular. La mayora en agua dulce
estancada o corrompida o suelos pantanosos.
3. Verde azuladas (cianofitas) sin plastidios organi-
zados, estructura nuclear primitiva, es decir, son
clulas procariticas. Presentes en rocas, panta-
nos, agua dulce y agua salada.
4. Algas verde amarillentas, dorado pardo y dra-
tomeas (crisofitas). La mayora corresponden a
diatomeas. Presentes den el suelo, agua dulce y
salada.
5. Pirrofitas, son dinoflageladas y organismos flage-
lados, con pared celular gruesa, ms comunes en
agua salada que en la dulce.
6. Algas Pardas (feofitas) son principalmente mari-
nas.
7. Algas rojas (rodofitas) presentes en ambientes
marinos (da el color rojo al mar de su nombre "mar Spirogyras, algas azul verdosas presentes en aguas estancadas
rojo").

Grfico representativo de algunas diatomeas y al-


gas
PRCTICA D E L A B O R A T O R I O No S I E T E .

TEMA: OBSERVACIN DE TEJIDOS E P I T E L I A L E S .


8. Note la coloracin de la placa, generalmente las
Objetivo de la prctica: preparaciones de los "cortes histolgicos" estn
realizados con coloracin de hematoxilina y eosi-
a) Observar tejidos epiteliales en diferentes rganos, na.
en placas preparadas y con tincin de hematoxili- 9. Ponga la placa en la platina y comience la obser-
na eosina. (H.E.). vacin con lente de menor aumento o vista pano-
b) Reconocer tejidos epiteliales, guiados por el n- rmica
mero de capas, forma y tipos de clulas que la 10. Distinga el epitelio en forma efectiva, de acuerdo a
constituyen. la orientacin que tuvo anteriormente.
c) Verificar y clasificar los tejidos epiteliales, de 11. Encuentre la membrana basa!, que es una lnea
acuerdo a los conocimientos adquiridos en clase. que no necesariamente es visible, pero que marca
d) Reconocer todo tipo de epitelio incluidos los teji- la diferencia entre lo que es el epitelio y el tejido
dos epiteliales glandulares. conectivo subyacente.
12. Coloque la placa de tal manera que el epitelio este
Materiales: en la parte superior del campo del microscopio,
esta regla sirve para odas las observaciones, es
1. Microscopio fotnico. como cuando a usted le ensean geografa, los
2. Placas preparadas con H.E. de: vasos sangu- mapas siempre tienen el norte hacia aniba.
neos, ovario, estmago, intestino delgado (duo- 13. Cuente el nmero de capas de clulas que tiene el
deno), pulmn; para observacin de epitelios sim- epitelio y diga si es un epitelio simple, pseudoes-
ples. tratificado o un epitelio estratificado. No olvide en
3. Placas de trquea, pulmn, para observacin de pensar en un epitelio glandular.
epitelio pseudoestratificado. 14. Observe los ncleos de las clulas y de acuerdo
4. Placas preparadas de esfago, vagina, vejiga, con ello, determine la forma de la clula que est
piel; para observar epitelios estratificados. mirando. Ncleo alargado, paralelo a la membrana
5. Placas de vejiga, urter parra la observacin de basal es una clula plana. Ncleo alargado locali-
epitelios estratificados polimorfos o mixtos zado a la base, y perpendicular a la membrana
6. Placas de lengua, partida, pncreas, piel; para basal, es una clula cilindrica. Ncleo redondeado
ver epitelios glandulares exocrinos. y generalmente central, es una clula cbica o po-
7. Placas de tiroides, pncreas, (islotes de Langer- lidrica.
hans) para ver epitelios glandulares endocrinos. 15. Reconozca el tipo de clulas que presenta el
epitelio y de acuerdo con ello, descifre el tipo de
Procedimiento: epitelio. Epitelio simple plano, cbico, cilindrico
etc. Epitelio estratificado plano con o sin querati-
1. Antes de iniciar las observaciones de epitelios, na, cilindrico, de transicin. Etc.
usted debe conocer claramente la parte terica de 16. Si esta observando un epitelio glandular, vea si
la clasificacin y tipos de epitelios que se presenta tiene o no conductos. Si tiene conductos ser un
a continuacin. epitelio glandular exocrino, si carece de ellos y
2. Mire la placa macroscpicamente y de ser posible presenta vasos sanguneos entre los cordones ce-
inicie un esquema de cmo se ve la placa a sim- lulares o entre los folculos ser un epitelio glandu-
ple vista. lar endocrino.
3. Observe la placa a investigar, y determine si es un 17. Relacione el tipo de epitelio que observa, con la
rgano compacto o se trata de un rgano hueco. clase de rgano que est usted observando.
4. Si es un rgano compacto, se nota que el epitelio Diagnosticar adecuadamente el epitelio le dar,
se encuentra alrededor del rgano o en un extre- seguridad para hacer diagnstico del rgano, co-
mo y ser un epitelio de cubierta, si la placa a ob- mo se ocurrir cuando est viendo organografa.
servarse presenta una luz.
El epitelio se distingue de otros tejidos por ser
ms basfilo. Tome en cuenta que si el epitelio Si usted sigue este proceso, de seguro podr diag-
encontrado se encuentra entre las estructuras del nosticar adecuadamente y satisfar los objetivos de
rgano, es posible que lo que encontrar ser un esta prctica.
epitelio glandular.
5. Si es un rgano hueco, el epitelio se encuentra EL TEJIDO EPITELIAL
alrededor de la luz y necesariamente ser un epi-
telio de revestimiento. Viene de dos voces epi = sobre Thele = pezn o papila
6. Si se trata de un rgano compacto seguramente el
epitelio a observar ser un epitelio de cubierta. No Los Tejidos epiteliales estn formados de membranas
olvide considerar que a veces podra estar obser- celulares que mantienen sus clulas ntimamente
vando un rgano hueco que parecera ser com- unidas, sin dejar espacios intercelulares entre ellas, se
pacto, como es el caso de la observacin de es- encuentran cubriendo rganos del organismo humano
tmago, en donde lo que ve es un segmento de la como el caso de la piel que cubre a todo el organismo,
pared y podra pensar que es un rgano compacto o revistiendo la luz de rganos huecos como el epitelio
7. Luego de sealar el epitelio en forma macroscpi- de la mucosa del estmago, otra fomna de presentarse
ca, escudrie el espesor del mismo, esto mismo el tejido epitelial es formando el parnquima de rga-
ir aclarando cuando ya est observando con len- nos glandulares, las clulas fonnan cordones, folculos,
te de menor aumento y con las otras lentes paula- acinos etc.
tinamente. Esto le permite orientarse para saber si
el epitelio a mirar, es un epitelio simple, pseudoes- CARACTERSTICAS DE LOS EPITELIOS
tratificado o estratificado. Los epitelios simples
presentan una lnea basfila delgada, los epitelios Los tejidos epiteliales se caracterizan porque las
estratificados presentan una banda relativamente clulas estn estrechamente unidas unas con otras,
ancha mediante varios tipos de unin. Algunos epitelios pre-
sentan clulas con complejos de unin. (Un complejo
70

de unin est formado por 1. Znula ocluyente 2. Unio- FUNCION DE LOS EPITELIOS
nes desmosmicas y 3. Uniones de nexo). Al estar
ntimamente unidas no dejan espacios intercelulares. Proteccin Se refiere a la separacin que brinda el
tejido epitelial del tejido conectivo, para que este, no se
Las clulas epiteliales estn polarizadas, es decir ponga en contacto directo con el exterior del organis-
presentan una base y un pice, de manera que cuando mo, tambin en algunos sitios, hace lo mismo en regio-
se unen por su tendencia a formar membranas, siem- nes internas del organismo, ya sea que estn cubrien-
pre lo liarn considerando su polarizacin. De ati se do superficies o revistiendo rganos huecos.
desprende que los organitos citoplasmticos se ubi-
quen en lugares detenninados de la polaridad celular, La epidermis de la piel es un buen ejemplo de mem-
el ncleo se localiza generalmente hacia la base, por brana de proteccin, ya que la capa de queratina evita
encima est el aparato de Golgi. Las vesculas secreto- la evaporacin del agua y mantiene las clulas hme-
rias se localizan hacia la luz de la clula. El retculo das: as como evita el ingreso de microorganismos al
citoplasmtico rugoso se localiza hacia la base de la interior del organismo. El epitelio del esfago, protege
clula. de las laceraciones que podran producir el paso de los
alimentos. En algunos sectores el epitelio evita el in-
Otra caracterstica importante es que los epitelios son greso de sustancias, en cambio en otros sectores
avasculares, es decir no tienen vasos sanguneos. favorece la absorcin de esas sustancias. En las mu-
No quiere decir que las clulas no necesitan O2 y nu- cosas la produccin de moco evita las ulceraciones.
trientes, de hecho las clulas reciben estos y otros Recuerde que la luz del tubo digestivo y respiratorio no
elementos necesarios para mantenerse con vida, me- estn dentro del organismo, literalmente estn por
diante mecanismos de difusin a partir del lquido "fuera del organismo"; para que una sustancia ingrese
tisular que se forma en los vasos sanguneos del tejido al interior del organismo debe atravesar el tejido epite-
conectivo subyacente. lial, pero no todas las sustancias que estn en la luz del
aparato digestivo o respiratorio pueden ingresar, por lo
Los epitelios estn separados del tejido conectivo por que este es considerado conio un mecanismo de pro-
una membrana basa!. La membrana basal no siempre teccin.
es recta, presenta ciertas depresiones, evaginaciones y
protrusiones que le dan un aspecto irregular, Evita la evaporacin de lquidos
LAS PROYECCIONES del tejido conectivo sobre el Impide el ingfeso de microorganismos
epitelio se denominan papilas, Las proyecciones del FuncionesPro eccin de dao mecnico
epitelio sobre el conectivo por ejemplo en la epidermis De la piel J Presenta temiinaciones nerviosas
se denominan clavos papilares Es el'^rgano del tacto
Acta como barrera
Las membranas epiteliales se encuentran cubriendo o
revistiendo, o formando glndulas de secrecin inter-
nas o externas del organismo, cuando las clulas se 2. Secrecin porque producen sustancias como las
invaginan en el tejido conectivo y producen secreciones glucoprotenas o moco que secretan las mucosas
se denominan epitelios glandulares (mucosa es un epitelio interno hmedo que reviste la
luz de los aparatos digestivo, respiratorio, urinario,
genital, etc.). Cuando las clulas epiteliales producen
Clulas estrechamenti unidasPresencia de medios de secreciones fornian glndulas que pueden ser unicelu-
unin (ocluyentes, ad lerentes, nexo)No dejan espacios lares o reunidas fonnan verdaderamente el sistema
intercelulareso interst cales glandular externo o interno.
Caractersticas Son avasculares (se nutren por
mecanismos de difusin) 3. Absorcin ya que permiten la entrada de sustancias
< Los epitelios Presentan una que pasan del exterior al interior. Se observa esta
membrana basal que la separa funcin en el caso del intestino delgado que absorbe
del tejido conectivoCumplen las sustancias alimenticias, agua, electrolitos y muchas
funciones de secrecin, absor- otras sustancias, necesarias para la supervivencia del
cin y proteccin organismo principalmente a nivel del duodeno. Otro
ejemplo es el epitelio de los tbulos renales como el
tubo contorneado proximal que absorben el 70% de
agua, del filtrado glomerular y de otras sustancias tiles
para el organismo, concentrando aquellas que constitu-
yen desecho o excrecin y sern eliminadas en la
orina.

El tipo de epitelio que posee una regin del cuerpo est


relacionado ntimamente con el papel o funcin que
cumple, as, si es un epitelio de absorcin ser simple,
pero si debe cumplir con la funcin de proteccin el
epitelio es compuesto o estratificado. En la epidermis el
epitelio est cubierto de queratina, para impedir la
deshidratacin de las clulas. En el aparato respiratorio
las clulas presentan cilios ya que debe movilizar el
moco que a su vez constituye un filtro de las impurezas
del aire. El epitelio de la vejiga es polimorfo con clulas
en raqueta que le permite al rgano estirarse sin que
1. Proteccin deje soluciones de continuidad.
Funciones de la piel 2 .Secrecin
3 Absorcin Las mucosas presentan clulas caliciformes intercala-
das para secretar moco y brindar proteccin, o pueden
estar asociadas a glndulas en el tejido conectivo
subyacente que producen grandes cantidades de
moco, como es el caso del epitelio estratificado de la
71

mucosa del esfago, o el epitelio pseudoestratificado La observacin real se lo hace con microscopio
de la trquea, que en el corin presenta glndulas Electrnico y mediante coloraciones de PAS o con
traqueales. mtodos argnticos. Se ve con PAS por la presencia de
Carbohidratos y se ve con coloraciones Argnticas por
Las clulas epiteliales en medios de cultivo celular la presencia de fibras reticulares
mixtas, debido a la presencia de molculas de adhe-
sin celular se reconocen y se relacionan formando
membranas que constituyen tejido epitelial

NUTRICIN DE LOS EPITELIOS


1. lmina lcida
Los epitelios son avasculares, es decir carecen de 2. lmina densa
vasos sanguneos. Pero ninguna clula o tejido del ^ lmina reticu-
organismo puede sobrevivir sin el concurso de Oxigeno
y nutrientes, que los obtiene de capilares sanguneos,
por lo que los epitelios deben obtener estas sustancias 1+2 Lmina basal
de los vasos sanguneos presentes en el tejido conecti-
vo subyacente, mediante mecanismos de difusin. Las
sustancias que pueden difundirse son los cristaloides
o micromolculas y no sustancias macromoleculares La composicin bioqumica de la lmina densa est
como las protenas, carbohidratos compuestos o trigli- dado por: colgena tipo IV, laminina (que es una
cridos o grasas complejas. glucoproteina adhesiva), una glucoprotena entactina y
un proteoglicano denominado perlacano.
Los cristaloides o soluciones verdaderas, son part-
culas pequeas, con un dimetro menor a 1 nanme- Las funciones de la membrana basal son: a) sostn
tro, para permitirles difundirse: Ejemplo; el Oxgeno, los del epitelio, b) filtro molecular pasivo al permitir el paso
aminocidos, los monoglicridos, diglicridos, glicerol, de micromolculas e impedir el paso de compuestos
cidos grasos, la glucosa, los electrolitos., etc. macromoleculares o sustancias con carga negativa, c)
permite el paso selectivo de clulas como los leucocitos
El producto del metabolismo celular debe ser depurado e impide el paso o migracin de clulas conectivas, por
o eliminado, igualmente mediante mecanismos de ejemplo en la cicatrizacin de epitelios, d) cumple papel
difusin desde las clulas epiteliales a los vasos san- importante en los procesos de diferenciacin celular.
guneos del tejido subyacente y atravesando la mem- No debe confundir el trmino membrana basal con
brana basal que separa el epitelio del tejido conectivo. capa basal que corresponde a la primera capa de
Ejm el C O 2 productos nitrogenados etc. clulas epiteliales sobre la membrana basal.

LA MEMBRANA BASAL
RENOVACIN DE LOS EPITELIOS
La membrana basal es una capa de aproximadamente
200 nanmetros de espesor, que divide o limita el La renovacin de los epitelios se realiza por clulas
tejido epitelial del tejido conectivo, da asiento a las tipo 2 segn la clasificacin de Leblond porque estos
membranas epiteliales. Pero la membrana basal no es mantienen clulas madres y son capaces de dividirse
exclusiva del tejido epitelial, tambin existe entre el por mitosis y reemplazar las clulas que han envejeci-
tejido muscular y el tejido conectivo y entre el tejido do, clulas muertas o daadas. En condiciones norma-
nervioso y el tejido conectivo. les las clulas sufren un proceso de envejecimiento y/o
dao por lo que deben ser sustituidas por nuevas
La IVIB es producto de la secrecin tanto del tejido clulas.
epitelial como del tejido conectivo, es una membrana
ace/u/ar compuesta de: 1. La lmina lcida externa. 2 Las clulas madres o germinativas de los epitelios se
La lmina densa 3. Lmina reticular o fibroreticular. (la localizan inmediatamente por encima de la membrana
lmina lcida y la lmina densa se conoce como lmina basal y son:
basal) 1. Las mismas clulas, en los epitelios simples

Al ser una membrana relativamente delgada, de 100 a 2. Las clulas bsales en los epitelios pseudoestratifi-
200 nm difcilmente se observa con el microscopio de cados,
Luz, aunque se nota claramente como una lnea entre
el tejido epitelial y conectivo por las distintas coloracio- 3. En los epitelios estratificados las clulas madres
nes de estos tejidos. ocupan la primera capa de clulas cilindricas o a veces
en las primeras capas dos o tres lo que se conoce con
el nombre de estrato de IWaIphigio.

4. En caso de prdida del epitelio estratificado con


queratina en la piel (epidermis), el reemplazo de clulas
se hace porque los folculos pilosos literalmente vomi-
tan clulas madres que reemplazan l epitelio perdido.
Por ello la regeneracin de la epidermis se hace por un
granulado evidente en los procesos de curacin. (En
pacientes con quemaduras se puede observar que la
re-epitelizacin se realiza no solo desde los bordes de
la lesin, sino que hay un granulado en forma de islas
que son capaces de formar tejido epitelial estratificado
queratinizado)

La velocidad de recambio celular normal, es diferente


en los distintos epitelios, as el epitelio del tubo digest-
72

vo tiene un alto ndice mittico y se considera que en el bien adoptan un sistema de cremallera o borde serra-
plazo de 3 das todo el epitelio es renovado, en la piel do, existen protenas complementarias que forman una
una clula basal alcanza las ltimas capas y por consi- banda selladora como se observa entre las clulas
guiente su prdida en 4 semanas. La velocidad de intestinales evitando el paso de sustancias micro y
recambio de clulas en el estmago se realiza en macromoleculares por los espacios intercelulares.
pocos minutos u horas, considere que las clulas del
estmago estn dispuestas a dao permanente, debido La znula ocludens es una unin en cinturn alrede-
a substancias que ingerimos en nuestra dieta, asi el aj dor del borde luminal, y con clulas vecinas, ocupando
puede matar clulas, lo mismo tiace el cido acetil todo el perimetro celular. Se ve sobre todo en las clu-
salicllico o Aspirina, pero gracias a su capacidad de las cilindricas del intestino.
renovacin el epitelio es reparado; de no tiacerlo se
presenta una lcera. El cido ciortidrico es otra sus- La fascia ocludens es un tipo de unin pero no alre-
tancia que puede lastimar o matar clulas epiteliales, dedor de todo el permetro, sino ms bien es una ban-
pero el moco producido protege al epitelio del dao, sin da de unin en uno de los lados de la clula, como la
embargo en casos de tiipersecrecin de HCI, la pre- que existe en las clulas endoteliales. Este tipo de
sencia de lceras gstricas es mayor. Algo similar unin permite la diapdesis de leucocitos a travs de
ocurre en caso de la presencia del Helicobacter Pylori los endotelios.
(una bacteria identificada como causante de lceras
gstricas, inclusive su presencia se le ha relacionado
con la presencia de cncer gstrico)

UNIONES CELULARES

Las clulas epiteliales tienen tendencia a presentar


polaridad, de tal manera que la superficie libre es dife-
rente a la basal, de igual manera en la membrana
celular lateral, presenta ciertos dominios que le permi-
ten unirse a otras clulas. Esta polaridad determina la Unin del tipo ocluyente o estrecho
localizacin de los organitos citoplasmticos, como la
del aparato de Golgi que est ubicado por encima del
ncleo y la secrecin de sustancias se lo hace al polo
superior celular.
La unin lateral de las clulas hace poco posible sepa-
rarias, ya que se han encontrado diversas tipos de
unin, para lo cual se han demostrado la presencia de
molculas de adhesin sobre todo en las clulas
nerviosas, otras molculas son las cadhaerinas que
son mediadas por iones de calcio, existen cadhaerinas
especficas como las cadhaerinas E del epitelio,
cadhaerinas N del tejido nervioso y cadhaerinas P de la
placenta. La ausencia de calcio permite la ruptura de la
adhesin. Otras sustancias son las lectinas que son Observacin al microscopio electrnico de Z-
protenas con propiedades de unin a molculas de nula Ocludens
hidrato de carbono, otras son las cateninas. Ahora es
momento para que describamos algunos tipos de unin 2. UNIONES DESlWOSMICAS
entre las clulas epiteliales, que pasaremos a describir-
las. Son un tipo de unin adherente, presentan puntos de
unin fuerte entre dos clulas contiguas. Bsicamente
Las clulas de los epitelios se encuentran unidas la unin desmosmica se caracteriza porque entre los
por: sitios de unin hay un espado de unos 20 a 30 nan-
1. Uniones ocluyentes o estrechas metros, lleno de un material electrnico poco denso,
2. Uniones adherentes semejante a una cola o pega entre las membranas, de
3. Uniones de nexo aspecto filamentoso complejo, por los bordes externos
de unin existe la presencia de una placa y tonofila-
Cada uno de estos tipos de unin presenta uniones de mentos compuestos de microfibrillas intermedias de
la siguiente manera: prequeratina. El aspecto general de este tipo de unin
a) Znula da la apariencia al estrato espinoso de los epitelios
b) Fascia estratificados queratinizados, de tener espinas. Tam-
3) IVlcula bin se encuentran entre las clulas musculares car-
Aunque tericamente podra observar todas las combi- dacas.
naciones, las ms frecuentes son:

1 ZNULA OCLUDENS

O tipo de unin en el tejido epitelial. Las membranas


celulares estn fundidas literalmente como lo haran
dos lminas de plstico en los bordes de una cdula de
identidad. Si cada membrana celular presenta 3 capas,
al unir o adherir dos membranas debern presentarse 7
capas o espacios, que solo son mirados al microscopio
electrnico, en las uniones estrechas las dos caras
externas de las membranas se unen y solo se observa-
rn 5 capas. DtamosonM
Para que sea znula, la unin se efecta alrededor de Estructuralmente se observa la presencia de dos mem-
todo el permetro de la clula y cerca del borde apical, branas celulares, separadas por un espacio de 20 nm,
las super'icies de unin no son rectas sino que ms junto a las membranas se encuentran unas placas de
73

placoglobina y desmoplaquina, sobre las que se adhie- 1. Epitelio simple plano,


ren unos filamentos intermedios, el espacio intercelular 2. Epitelio simple cbico
se conecta por medio de desmoglena y desmocolina. 3. Epitelio simple cilindrico.
Los hemidesmosomas presentes en la unin de las
clulas epiteliales a la membrana basa! presentan
exactamente la mitad de su estructura, lo que se ve en
el esquema de la derecha.

UNIONES DE ABERTURA (Nexos)

Es un tipo de unin estrecha pero con la presencia de


canales de comunicacin, que permiten el paso de
sustancias micromoleculares de una clula a otra,
estn formados por protenas que forman una canal
cilindrico por donde sustancias menores a 2 nm las
atravesaran tranquilamente, aunque el paso de sus-
tancias no es indiscriminado, evita el paso de sustan-
cias con carga negativa, lo que hace suponer la pre-
sencia de protenas que en su composicin tambin
Glomrulo renal. Se muestra la cpsula parietal y visceral de Bo-
wman de un glomrulo renal. Presenta un epitelio de revestimiento
simple plano.

EPITELIOSIMPLE PLANOS (Tejido epitelial, simple


plano)

1) Epitelios simples, presentan una sola capa de


clulas planas. Las clulas son alargadas y el ncleo
es ovalado o aplanado, localizado en el centro de la
son de carga negativa. clula. Dependiendo del corte realizado, el ncleo se ve
Este tipo de unin celular favorecera el paso de sea- alargado o puede verse redondeado como si se tratara
les intercelulares, seales elctricas como ondas de de un huevo frito. Ejemplo de tejido de revestimiento
despolarizacin, seales embrionarias que permiten la simple plano, como los epitelios presentes en alvolos,
diferenciacin de las blastmeras, seales de recono- asa de Henle del rion, endotelio en todos los vasos
cimiento celular sanguneos Etc.

a) Mesotelios, tejido epitelial de cubierta simple plano.


CLASIFICACIN DEL TEJIDO EPITELIAL: Son epitelios formados de una sola capa de clulas
planas y se encuentran cubriendo rganos internos.
El tejido epitelial se clasifica en tres categoras: Ejemplo epitelio de cubierta simple plano del cordn
umbilical, epitelio de cubierta simple plano del estma-
I Epitelios de cubierta o revestimiento go. Etc.
II Epitelios glandulares y
III epitelios sensitivos

1. EPITELIOS DE CUBIERTA O REVESTIMIENTO.

Los epitelios de cubierta son aquellos que se encuen-


tran alrededor de un rgano como por ejemplo el meso-
telio que es un epitelio que cubre a rganos ubicados
en la cavidad abdominal, o la epidermis de la piel que
cubre todo el organismo.
Los epitelios de revestimiento son aquellos que estn
tapizando la luz de rganos huecos por ejemplo el
epitelio que forma la mucosa gstrica, o la de todo el
tubo digestivo, el endotelio de los vasos sanguneos

Qu tipo de epitelio tiene la len-


gua?

Los epitelios de cubierta o revestimiento se clasifi-


can en epitelios: Vaso sanguneo. Vnula con un endotelio a epitelio de revestimiento
simple plano

1. Epitelios simples
2. Epitelios pseudoestratificados
c) Endotelios, son epitelios de origen mesodrmico.
3. Epitelios Estratificados
Formados de una sola capa de clulas planas y se
presentan en el epitelio de revestimiento de todo
vaso sanguneo. Ejemplo epitelio de revestimiento
1. EPITELIOS SIMPLES.
simple piano -endotelio-. Todo el sistema vascular
como son las arterias, las arteriolas, los capilares,
Los epitelios simples son membranas celulares com-
las vnulas y las venas presentan endotelio, inclu-
puestas de una sola capa de clulas y toman el nom-
ye el endotelio que reviste las cavidades carda-
bre dependiendo de la forma de sus clulas y pueden
ser:
74

cas (msculos papilares, cuerdas tendinosas, en- cilindrica, se explica este fenmeno porque: Las clulas
docardio, vlvulas cardiacas). caliciformes estn intercaladas con otras clulas cili'n-
Pero adems debemos considerar como endote- dricas, al producir su secrecin en la parte apical,
lios, al epitelio que reviste los vasos linfticos acumula los granulos secretores que dan un aumento
A) TEJIDO EPITELIAL DE REVESTIMIENTOSIM- de la tensin y desplazan a las clulas vecinas y adop-
PLE CBICO (Tejido epitelial simple cbico) tan la forma de un cliz. En el epitelio simple cilindrico
secretor del estmago, al ser todas las clulas secreto-
ras de moco, las fuerzas de tensin de las clulas
vecinas son iguales y continan manteniendo la fornia
cilindrica.
Este epitelio cumple con la funcin de proteccin, al
perder una parte de su epitelio se produce una lcera
(lcera gstrica)

Estmago se observa el epitelio de revestimiento de la mucosa gstrica

Ovario, se demuestra el epitelio germinativo que es un epitelio de


cubierta simple cbico

a) Epitelio formado de una sola capa de clulas cbicas


o cuboides, se encuentra en el epitelio de cubierta del
ovario, tubos de secrecin de algunas glndulas, parte
terminal de bronquiolos. Etc. b) Tejido epitelial de revestimiento simple cilindrico
Ciliado, (Tejido epitelial simple cilindrico ciliado) la
capa de clulas cilindricas presentan en su superficie.
Cilios o pequeas pestaas, este tipo de epitelio tiene
clulas caliciformes intercaladas. Por la presencia de
cilios, es til para desplazar moco que a su vez ha
atrapado impurezas del aire respirado, se encuentra en
el epitelio de bronquiolos.

1. Con chapa estriada u orla estriada, (Tejido epite-


lial simple cilindrico con chapa estriada y clulas
caliciformes intercaladas) denominado tambin
epitelio de absorcin. Est formado de una sola capa
de clulas cili'ndricas, las mismas que en su parte
apical presentan microvellosidades y con clulas calici-
formes intercaladas Se encuentra presente en el epite-
lio de revestimiento del intestino delgado y grueso; en
la vescula biliar, en el tubo contorneado proximal y

Esquema de un epitelio s i m p l e c b i c o , presente en un f o l c u l o


t i r o i d e o , en un acno g l a n d u l a r o en un c o n d u c t o

EPITELIOS SIMPLES CILINDRICOS.

a) Tejido epitelial de revestimiento o cubierta Sim-


ple cilindrico simple, (Tejido epitelial de revesti-
miento o cubierta simple cilindrico simple) general-
mente de revestimiento, formados de una sola capa de
clulas de forma cilindrica, se encuentran en conductos
glandulares. En algunos epitelios "simples cilindricos
simples" hay clulas caliciformes intercaladas. distal del rion.

b) Tejido epitelial de revestimiento simple cilindrico EPITELIOS PSEUDOESTRATIFICADOS. (Tejido


Modificado epitelial pseudoestratificado, cilindrico, ciliado con
clulas caliciformes intercaladas)
1. Tejido Epitelial de revestimiento simple cilindrico
Secretor (Tejido epitelial simple cilindrico secretor)
Como es el epitelio de revestimiento del estmago,
donde todas las clulas cilindricas son clulas secreto- Epitelios formados de las siguientes capas o estratos:
ras de moco. En realidad son exactas a las clulas
caliciformes, pero su forma no es caliciforme sino
75

1 2
Los epitelios estratificados se dividen en:

A) Epitelio estratificado cilindrico o cbico


B) Epitelio estratificado plano o pavimentse
a) sin queratina
b) con queratina
c) Epitelios estratificados polimorfos

A) EPITELIO ESTRATIFICADO CILINDRICO. Se


1. Capa de clulas cilindricas, ubicadas a diferente altura, encuentra formado de dos capas de clulas cilindricas.
pero todas ellas partiendo de la membrana basal. Se presenta en conductos de gran calibre como el
Presencia de clulas cilindricas altas. conducto galactforo mamario. El nombre completo de
2. Capa de clulas bsales. este tejido sera: Tejido Epitelial de Revestimiento
3. Capa de clulas caliciformes intercaladas, con ncleo Estratificado Cilindrico
basal, presencia de granulos apicales que no se colo-
rean con H.E. y por lo tanto permanecen blanquecinos
o incoloros. En la parte terminal de estas clulas tiay
microvellosidades difciles de ver con microscopio
fotnico. Adems mire la forma de las clulas, como
una copa.
4. Observe la presencia de cilios en las clulas cilindricas
superficiales altas, no hay cilios encima de las clulas
caliciformes.
5. Es particular en estos epitelios la presencia de una
membrana basal gruesa, ms fcil de distinguirla que
en otros epitelios.
Se clasifican de la siguiente manera:
EPITELIOS ESTRATIFICADOS PAVIMENTOSOS O
PLANOS.
A) DE TIPO RESPIRATORIO. Todos los epitelios
pseudoestratificados que se encuentran en las vas a) Sin queratina. (Tejido Epitelial estratificado plano
respiratorias estn compuestos de clulas cilindricas, sin queratina) Son epitelios estructurados por varias
dispuestas a diferente altura, con ncleos a diferente capas de clulas: clulas bsales cilindricas, varias
nivel y con la presencia de clulas caliciformes interca- capas de clulas cbicas o polidricas y terminan con
ladas y presencia de cilios. Por esta razn a los epite- un estrato superior formado de clulas planas. Por esta
lios respiratorios se los denomina "epitelio pseudoes- ltima razn a este tipo de epitelios se los denomina
tratificado cilindrico ciliado con clulas calicifor- "epitelios estratificados planos, sin queratina". Se en-
mes intercaladas". cuentra en epitelio de lengua, vagina. Esfago. Etc.

B) NO RESPIRATORIOS. Son epitelios pseudoestratifica-


dos cilindricos, no siempre presentan cilios, pero pue-
den estar formados de estereocilios, pero generalmente b) Con queratina o capa crnea. (Tejido epitelial
presentan clulas secretoras caliciformes intercaladas. estratificado plano con queratina) Denominado
No se encuentran en el aparato respiratorio. tambin epitelio estratificado pavimentse con querati-
na, o epitelio poliestratificado plano con queratina. Se
encuentra en la epidermis de la piel. Presenta varias
EPITELIOS ESTRATIFICADOS. capas de clulas o estratos de clulas y son:

Se denominan epitelios estratificados a los epitelios


que presenta ms de una capa o estrato de clulas, por
ejemplo si tiene dos capas es estratificado, si fiay
muctias capas se denomina como poliestratificado.
Una caracterstica importante de los epitelios estratifi-
cados es que nunca presentan cilios o estereocilios o
chapa estriada en sus clulas apicales.
Cuando observa un epitelio con ncleos a diferente
altura y en las clulas apicales la presencia de cilios,
piense que lo que est observando es un epitelio pseu-
doestratificado.
76

3. Capa de clulas superficiales grandes, poliploi-


1. Capa de clulas cilindricas, llamada capa basal o des
germinativa.
2. Capa espinosa, formada de clulas polidricas con Esta caracterstica de tener clulas superficiales poli-
uniones celulares de tipo desmosmico. ploides que son grandes es lo que le caracteriza a este
Las dos primeras capas se denominan tambin estrato epitelio. Recuerde que para algunos autores este tipo
de Malphigro, debido a que se encuentran o es de epitelio es un epitelio pseudoestratificado modifica-
posible ver clulas en mitosis, y es el sitio donde do.
se muertas o descamadas. Las clulas superficiales son poliploides (4n 8n) para
ser grandes y revestir adecuadamente la luz del urter,
3. Capa granulosa, formada de clulas polidricas y la vejiga y la uretra. Y que al ser estirado este epitelio,
con la presencia de granulos de queratohialina. las clulas superficiales continen sellando la luz e
4. Capa lcida, no siempre visible, formada de una impidiendo que la orina escape a los intersticios y se
capa de clulas planas sin ncleo o con ncleo picnti- mantenga en la luz como debe ser.
co.
5 Capa crnea o capa de queratina. Es la ltima capa,
fomnada de clulas muertas.

s aa forma
una glndula EXOCRINA; . una gtinduia ENDOCRINA:

pwMtan lis
culw da
.oonaxianqua
EPITELIO POLIMORFO, DE TRANSICION, O MIXTO. -forman un
'conducto;
(Tejido epitelial estratificado polimorfo o de transi- I culaa m<s
cin) protundaa
aacratoria]

Se denomina tambin uroepitelio ya que reviste el


urter, la vejiga y parte de la uretra, es decir est en el
aparato urinario. Formado por clulas dispuestas en
varias capas o estratos, con las siguientes caractersti- II. EPITELIOS GLANDULARES.
cas:
Son epitelios que por su origen, por estar formados
de clulas ntimamente unidas y productores de sus-
tancias como moco, enzimas u hormonas se les deno-
mina glndulas. Generalmente estn rodeadas de
tejido conectivo, por lo que serian islotes de clulas
epiteliales en el tejido conectivo, se excepta a glndu-
las unicelulares que estaran entre otras clulas epite-
liales.

Su caracterstica principal es que son productoras de


sustancias de alto peso molecular, que provienen de
sustancias de bajo peso molecular y que se secretan a
una regin del cuerpo por medio de conductos (glndu-
las de secrecin externa). Las secreciones que se
vierten directamente a un capilar sanguneo se deno-
minan hormonas (glndula de secrecin interna)

LAS GLNDULAS DE SECRECIN EXTERNA pro-


ducen glucoprotenas (moco), o sustancias enzim-
tlcas u otras que se vierten por medio de conductos a
cavidades del organismo o hacia el exterior del mismo.
Ejm: glndulas salivales, pncreas, glndulas sudorpa-
ras, glndulas lagrimales, etc.
1., Capa de clulas cilindricas o capa basal, o capa
germinativa. LAS GLNDULAS DE SECRECIN INTERNA produ-
2. Capa de clulas polidricas. cen sustancias denominadas hormonas, y lo hacen a
travs de capilares sanguneos que se encuentran
77

alrededor de las clulas glandulares. Ejm: Hipfisis, 2. Tbulo-alveolares, con acinos unos alveolares y otros
Tiroides, suprarrenales, etc. tubulares, o por la forma mixta que presenta el acino
una parte tubular y otra alveolar.
Las glndulas paracrinas son aquellas que producen
sustancias que salen al intersticio y afectan a clulas
vecinas, pueden considerarse como sustancias "seal"
El epitelio glandular se origina en los epitelios de cu-
bierta o revestimiento, al proliferar clulas que lejos de
acumularse hacia la luz, invaden el tejido conectivo
subyacente, cordones de clulas que proliferan muchas
veces a espacios alejados como el caso de la forma-
cin del hgado y del pncreas.
Si estos cordones de clulas fomian un conducto per-
manente que mantiene la relacin con el sitio de fonna-
cin, se denominar glndula de secrecin externa. Si
el cordn de clulas que mantiene contacto con su sitio
de origen desaparece la glndula ser glndula de
secrecin interna
b) POR EL TIPO DE CONDUCTOS:
Eprttiio.
1. Simple: si tiene un solo conducto secretorio,
La$ c l u l M <M p i t e l i o ejemplo las glndulas sudorparas
conectivo

2. Compuesta: cuando tiene varios conductos,


generalmente se unen para terminar en uno solo,
como lo hacen los afluentes de un rio. Ejm; el h-
gado, el pncreas
crecen bi&oducindose
n t xto * u b Y c n t

c) POR EL TIPO DE SECRECIN: Se refiere a la


caracterstica de la secrecin, generalmente se
CLASIFICACIN DE LAS GLNDULAS EXOCRINAS utiliza este clasificacin al referirse a las glndu-
las salivales y pueden ser;
Las glndulas exocrinas, eliminan su produccin a
travs de un conducto, hacia una cavidad o al exterior
del organismo. Como el pncreas que elimina el jugo 1. Mucosas. Si el producto de la secrecin es una
pancretico hacia el duodeno a travs del conducto de sustancia viscosa como moco, est fomiado de
WIrson, Las glndulas sudorparas eliminan su produc- glucoprotenas Ejm: las glndulas salivales su-
cin hacia la parte externa del organismo. blinguales. Las unidades secretoras son de tipo
acinar, como el moco es viscoso el conducto cen-
Se clasifican atendiendo a ciertas caractersticas como tral es grande, las clulas secretoras en nmero
el tipo de secrecin, la integridad de cmo quedan las de 4 a 6 son como pirmides truncadas, y el n-
clulas secretorias, del nmero de conductos, o del tipo cleo es aplanado y pegado hacia la base. El cito-
de sustancia que producen. plasma celular presenta granulos secretorios con
glucoprotenas que no se pigmentan con H.E. por
A) EXOCRINOS O DE SECRECIN EXTERNA. Se lo que se ven espumosos o blanquecinos
caracterizan por tener conducto de excrecin.

a) POR S U FORMA: Se refiere a la forma que


adopta el acino o la porcin secretoria y se clasifican
en;

1. Alveolares o en forma de uvas, se denominan


acinos, este tnnino de acino era utilizado casi exclusi-
vamente para denominar a las unidades secretoras del
pncreas, pero cada vez se utiliza para cualquier uni-
dad secretora que tenga una fomia redondeada.

L a s glndulas alveolares se encuentra en gran canti-


dad de glndulas, como en el pncreas, la partida,

2. Tubulares o en forma de tubo. Se refiere a cuando


las unidades secretoras se presentan en forma de un
tubo, o alargadas.

AnnBcldn **** iWffWCMn


78

Mucosa Serosa Mixta

Acino o Pirmides Clulas Acinos mucosos


porcin truncadas : pira- con medias lunas
secretora : mdales serosas
Conduc- Grande Peque- Grande
to o
Forma Aplanado y Re- Aplanado en los
del n- pegado a la dondo mucosos y re-
cleo base y casi dondo por las
pegado medias lunas
a la serosas
base
Tipo de Viscosa Lquida De los dos tipos
secre- como moco como de secrecin
cin suero
Colora- Menos Basfl- ^ Se observa la
cin de Basfila que la coloracin co-
la gln- la serosa rrespondiente a
duH (acidfilas) los dos tipos.
Sublingual Parti- Sublingual (ms
Ejemplo da, mucoso), sub-
Glndula serosa Pn- maxilar (ms
creas seroso)
2. Serosas. Son glndulas serosas si el producto
de la secrecin es lquida como suero, los acinos
d) Por el tipo de secrecin relacionado con la
serosos se caracterizan porque presenta un con-
INTEGRIDAD DE LAS CLULAS. Las glndulas
ducto central pequeo y poco visible, las clulas
pueden ser:
tienen la forma de una pirmide. El ncleo es re-
dondo, basal, pero no pegado a la base, el cito-
1. Holcrinas. Las glndulas holcrinas correspon-
plasma se presenta basfilo con coloracin H.E.
den solamente a las glndulas sebceas, son
Se encuentra en la partida que es la glndula
glndulas en las que el producto de la secre-
salival de mayor tamao.
cin celular es la muerte misma de la clula
En este caso la clula hace un verdadero holo-
causto

3. Mixtas El producto de la secrecin esta dado por


moco y suero, las unidades secretoras estn for-
madas de unidades secretoras mucosas con me-
dias lunas serosas como en el caso de glndulas
submaxilares y sublinguales. Observe que las
imgenes presentan un acino mucoso (blanque-
cino) con ncleos aplanados, pegados a la base
y ncleos redondos a la parte externa del acino
que son de las medias lunas serosas

Caractersticas a observar al microscopio

2. Mercrinas. Son mercrinas la mayora de las


unidades secretoras, es cuando al producir la
secrecin, la clula queda ntegra y no hay ni
79

muerte de la clula, y tampoco parte de su ci- B) ENDOCRINOS O DE SECRECIN INTERNA.


toplasma se pierde. Por ejemplo las glndulas Sern estudiados y vistos en el captulo relacio-
sudorparas o los acinos serosos del pncreas nado con el sistema endocrino, solo menciona-
remos determinadas caractersticas relacionadas
3. Apcrnas. Son glndulas que al producir la con la morfologa histolgica general y la m3nera
secrecin, parte de la clula se pierde, como de almacenar las hormonas.
ocurre con las glndulas mamarias. Si la leche
es una secrecin apcrifa, considere que entre Cordones Folculos Mixto
los mamferos, la madre alimenta a su hijo con celulares
parte de su propia estructura. jem- Islotes de Tiroides Hipfisis
Apcrifa, la clula pierde poco de su estructura. pl Langerhans
0
Ausencia de Ausencia Ausencia de
conductos de con- conductos.
ductos
Tipo de Almacena- Almace- En la par
alma- miento namiento media hay
cena- hormonal en hormonal folculos, el
miento. el interior de extracelu- resto con
la clula lar cordones
celulares

C) MIXTOS O DE SECRECIN EXTERNA E IN-


TERNA. Ejemplos: Hgado, Pncreas.

Esquema de la secrecin lctea de una glndula ma-


maria.

Holcrinas Apcrinas Mercrinas


Glndula Glndulas sudorparas Glndulas
sebcea ecrinas y glndulas sudorparas
mamarias
La clula Parte de la clula se La clula
muere al elimina con la secre- queda nte-
secretar la cin gra
sustancia

III EPITELIOS SENSITIVOS Se los ver cuando obser-


vemos rganos de los sentidos

CLASIFICACIN DE LAS GLNDULAS DE SECRE-


CIN INTERNA
80

INFORME PARA LA PRXIMA C L A S E DE LABORA-


TORIO. 5. Cmo se diferencia una glndula serosa, de una
1. Cmo reconoce un epitelio simple de un epitelio mucosa y de una mixta?
estratificado y de un pseudoestratificado? 6. Qu diferencias hay entre una glndula de se-
2. Por qu a los epitelios mixtos se los denomina, crecin exocrina y endocrina?
segn algunos autores, como epitelios pseudoes- 7. Qu es una membrana basal, en donde se en-
tratificados? cuentra y cual es su composicin?
3. A ms de la capa de queratina, que otra caracte- 8. Qu es un complejo de unin, describa la com-
rstica le permite definir entre un epitelio plano con posicin?
o sin queratina? 9. Qu diferencias hay entre las glndulas holcri-
4. Por qu a los epitelios se los observa con una nas, mercrinas y apcrinas?
mayor basofilia que el tejido conectivo o muscu- 10. Realice los dibujos correspondientes a la
lar? observacin de la prctica!

DETERMINE EN L A S SIGUIENTES IMGENES A


QUE TIPO DE EPITELIO P E R T E N E C E !
81

P R A C T I C A D E L A B O R A T O R I O No OCHO.

TEMA: OBSERVACIN DE TEJIDOS CONECTIVOS O CONJUNTIVOS:


TEJIDO CONECTIVO MUCOSO EMBRIONARIO, TEJIDO CONECTIVO LAXO ORDINARIO, TEJIDO CONECTIVO
DENSO ORDINARIO, TEJIDO CONECTIVO ADIPOSO.

EL TEJIDO CONECTIVO
Objetivo de la prctica:
El tejido conectivo es el segundo tipo de tejido animal y
a) Reconocer la estructura y composicin de los por ende del organismo humano. Se origina en el me-
tejidos conectivos. snquima, aunque alguna parte de la cabeza sea de
b) Diferenciar el tejido conectivo dei epitelial y de origen ectodrmico. Se lo considera como un tejido que
otros tejidos por su estructura y composicin. est por debajo del tejido epitelial, o entre el tejido mus-
c) Relacionar la estructura a la funcin que cumple el cular o alrededor del tejido nervioso perifrico
tejido conectivo. Consta de tres partes fundamentales que son:
d) Conocer porque el tejido conectivo cumple con las a) clulas
funciones de soporte, nutricin y defensa del orga- b) fibras y
nismo. c) sustancia fundamental
e) Estudiar la morfologa y funcin del tejido conectivo
mucoso embrionario. Los tejidos conectivos son los de mayor extensin en el
f) Reconocer las diferentes clula que componen los organismo, cumplen muchas funciones dependiendo de
diferentes tejidos conectivos y relacionarlos con la su estructura y localizacin. Son parte de la estructura
funcin. misma y esqueleto del organismo, se los considera
g) Capacitarse para la descripcin, anlisis e investi- como tejidos de unin, sostn, relleno, etc.
gacin de estructura y funcin de los tejidos conec-
tivos.

Materiales:

1. Microscopio de luz o fotnico.


2. Placas preparadas de cada uno de los tejidos
enunciados: Cordn umbilical para la observacin
de tejido conectivo mucoso embrionario o tejido
mesenquimatoso embrionario.
3. Placas de piel para el estudio y reconocimiento de
tejido conectivo laxo ordinario, tejido conectivo
denso ordinario, tejido conectivo adiposo o graso.
Reconocimiento de clulas es estos tejidos.
4. Placas de epiddimo para observacin del tejido
adiposo circundante.

Procedimiento:

1. Observe macroscpicamente cada una de las


placas a estudiar, dibuje su estructura. CLASIFICACIN DEL TEJIDO CONECTIVO
2. Seale si se trata de rganos huecos o compactos.
3. Determine el tipo de coloracin del rgano en TEJIDOS CONECTIVOS NO MODELADOS
estudio.
4. Seale la disposicin del tejido conectivo y distinga a) Tejido Conectivo Mucoso Embrionario
del tejido epitelial. b) Tejido Conectivo laxo ordinario o areolar
5. Coloque la placa en la platina, tenga cuidado de c) Tejido Conectivo adiposo
poner el cubreobjetos hacia arriba, si no lo hace d) Tejido Conectivo Denso ordinario de disposicin
de esta manera no podr ver con lentes de 40 X. irregular
6. Observe con lente de menor aumento y luego con e) Tejido Conectivo Denso de disposicin regular
lentes de aumentos crecientes, limitando el sector Tejido conectivo tendinoso
de tejido epitelial y del tejido conectivo. Recuerde Tejido conectivo ligamentoso
que el tejido epitelial debe estar en la parte superior
del campo del microscopio y el tejido conectivo por TEJIDOS CONECTIVOS DE SUSTANCIA FUNDA-
debajo de este. MENTAL LQUIDA
7. Observe las clulas y trate de distinguir los diferen- a) Tejido Conectivo Sanguneo
tes tipos, de acuerdo con los esludios realizados en b) Tejido Conectivo Hematopoytico (se considera
clase. tambin como un rgano)
8. Observe las fibras colgenas, y anote sus caracte- c) Tejido Conectivo Linfoldeo (igual que en el caso
rsticas. anterior debe considerarse como rganos)
9. Observe la sustancia fundamental y anote como
esta coloreado. TEJIDOS CONECTIVOS MODELADOS O DE SUS-
10. Observe los vasos sanguneos propios del tejido TANCIA FUNDAMENTAL DURA
que est observando. a) Tejido Conectivo Cartilaginoso
11. Haga los dibujos de sus observaciones y compare b) Tejido Conectivo seo
con las del atlas de Diffiore. c) Tejido Conectivo Dentario
82

TEJIDO CONECTIVO LAXO ORDINARIO. Origen del tejido conectivo laxo

Iniciaremos el estudio del tejido conectivo, con la des- El tejido conectivo laxo se origina directamente del
cripcin del tejido conectivo laxo ordinario, ya que mesnquima, las clulas del tejido laxo provienen direc-
representa un tejido conectivo de amplia distribucin y tamente del mesnquima o a partir de clulas madre de
su estructura es la base para comprender la estructura la sangre, como las clulas plasmticas que se originan
de otros tejidos conectivos. de los linfocitos, o los macrfagos que se originan de los
monocitos de la sangre.
El tejido conectivo laxo ordinario se forma en el mesn-
quima (mesodermo) y est formado por:

1. Clulas que se encuentran separadas, (no estn


unidas como las clulas que forman los epitelios), las
clulas separadas dejan un espacio llamado intersticial
o intercelular. Generalmente las clulas nacen de clu-
las mesenquimatosas o de clulas que se originaron en
el mesnquima, como es el caso de los fibroblastos,
clulas plasmticas, o el caso de los leucocitos (clulas
sanguneas que se originan a partir de una clula madre
el hemocitoblasto que se origina en el mesnquima

2. Fibras (colgenas, elsticas y reticulares) y

3. Sustancia fundamental (formada por agua, prote-


nas, glucoprotenas, proteoglicanos y principalmente El mesnquima es una parte del disco embrionario
glucosaminoglicanos sulfatados y no sulfatados). denominado mesodenno

Iniciaremos el estudio de los tejidos conectivos con el ESTRUCTURA D E L TEJIDO CONECTIVO LAXO
tejido conectivo laxo denominado tambin tejido areo-
lar por su capacidad de dejar espacios que se llenan de Estructuralmente el tejido conectivo est formado de
agua o lquido tisular. clulas, fibras y sustancia fundamental.

Es de amplia distribucin en el organismo, se encuentra


por debajo de los epitelios, entre el tejido muscular
(endomisio, perimisio, epimisio), alrededor de los vasos
sanguneos y alrededor del tejido nervioso (no en el
interior del tejido nervioso central).En el tejido nervioso
perifrico forma el endoneurio, perineurio y epineurio,
alrededor del tejido nervioso central forma parte de las
meninges piamadre, aracnoides y duramadre.

Funcin del tejido conectivo laxo ordinario:

Sirve de sostn y, es responsable de la nutricin del


organismo y es capaz de cumplir con los mecanismos
de defensa del organismo

1. Sirve de sostn, unin o relleno de otros tejidos:


como el epitelial, de otros tejidos conectivos, del
tejido muscular, alrededor del tejido nervioso y al-
rededor de los vasos sanguneos, tambin consti-
tuye un tejido de relleno.
r..
2. Es el tejido nutricio por excelencia, ya que los
capilares sanguneos le son propios y distribuyen
los nutrientes necesarios para la supervivencia de
las clulas, los capilares recogen los productos del
metabolismo celular para destinarlos a los rganos
emuntorios del organismo (pulmones, rion)

Al ser un tejido nutricio, encargado de llevar nu-


trientes a "todas las clulas del organismo", es de
entender que este tejido estar donde haya clulas.
Si una clula no recibe Oxgeno y/o nutrientes est
condenada a morir.
1. CLULAS:
3. Tiene funciones de defensa, ya que el tejido co-
nectivo laxo es el campo de batalla a bacterias, A) Endoteiiales Se encuentran en la capa ntima de
tiongos, virus y presenta clulas que fagocitan sus- los vasos sanguneos y corresponde a las clulas
tancias o clulas extraas o producen inmunoglo- que se encuentran hacia la luz de los mismos,
bulinas que reconocen a antgenos invasores del tambin hay clulas endoteiiales en la luz de los
tejido conectivo. Las clulas especializadas reco- linfticos.
nocen clulas daadas o cancergenas, las mismas Estas clulas se desarrollan del mesnquima embriona-
que en condiciones nomnales desaparecern gra- rio y rodean a clulas sanguneas en desarrollo o a
cias a las acciones de defensa. diminutas gotas de lquido tisular, para formar luego el
sistema vascular. Las clulas endoteiiales tienen una
83

gran capacidad de proliferacin y forman tubos Inter- que envuelve a los dos tipos de clulas. Los pericitos
conectados que son parte del sistema circulatorio del son clulas madres permanentes del tejido conectivo
organismo. C) Fibroblastos Son clulas de origen mesenquimato-
so, estn presentes en el tejido conectivo laxo, en el
En la observacin al microscopio de luz estas clulas se tejido conectivo denso y otros tejidos conectivos como el
las reconoce por su ncleo aplanado. Al microscopio pericondrio del cartlago, el periostio de los huesos, los
electrnico se reconoce las clulas con mayor facilidad y tendones, etc. Se considera a los fibroblastos como las
demuestran las uniones entre ellas y suelen ser "Unio- clulas ms abundantes en el tejido conectivo
nes estrechas" fascia ocludens y uniones adherentes.
Las clulas son alargadas, con varias prolongaciones
Las clulas endoteliales tiene gran capacidad de proli- citoplasmticas que le dan un aspecto estrellado, tienen
feracin y gracias a que mantienen la capacidad de un ncleo con cromatina iaxa, dentro de l, el nuclo-
realizar mitosis, reparan las clulas envejecidas o daa- lo.
das; tambin son capaces de proliferar activamente
cuando el organismo necesita recanalizar la circulacin El citoplasma es basfiio por la presencia de retculo
sangunea o cuando debe conectar un tejido trasplanta- endoplasmtico rugoso, que explica la capacidad de
do como el caso de injerto de piel, en este caso las producir protenas como la colgena. Posee un aparato
clulas endoteliales proliferan y forman nuevos vasos de Golgi, para poder secretar sustancias como la tropo-
sanguneos que conectan el tejido trasplantado. colgena. Y algunas mitocondrias relacionadas con la
necesidad de producir energa para el trabajo celular.
Las clulas endoteliales en los capilares forman dos
tipos de capilares:

TIPOS DE CAPILARES

CAPILARES CONTINUOS

Formados de clulas endoteliales sin la presencia de


ventanas o fenestras. Revisten la luz del vaso sangu-
neo y las micromolculas no pasan con facilidad su
estructura, lo deben hacer a travs de vesculas pinoci-
tarias, que es la forma como se explica la extravasacin
de pequeas gotas de plasma sanguneo y la salida de
algunas protenas u otros compuestos macromolecula-
res. Estn presentes en las barreras hemticas del Su funcin es la de producir fibras colgenas, reticula-
organismo como es el caso de la barrera hemato-fmica, res, y la sustancia f u n d a m e n t a l d e l o a tcjdoo c o n c c t i v o o .
hemato-placentaria, hemato-encefllca, etc.
Cuando envejecen se transforman en fibrocitos, clula
CAPILARES FENESTRADOS en forma de huso, con citoplasma acidfilo porque ha
perdido la capacidad de formar protenas y consecuen-
Son estructuras formadas por clulas endoteliales que temente ya no tiene retculo endoplasmtico rugoso
presentan unas fenestras, orificios o ventanas de apro- abundante, o por lo menos disminuye considerablemen-
ximadamente 60 a 80 nm de dimetro, con un pequeo te la formacin de sustancia fundamental y fibras.
diafragma que facilita en cierto modo la extravasacin
de partculas de pequeo peso molecular, aunque la Los fibroblastos son estimulados por el Factor de creci-
capacidad de las sustancias de atravesar estos orificios miento de fibroblastos FGF producido por macrfagos y
est dado por el tamao de las partculas a atravesar y otras clulas, en caso de reparacin de heridas.
por la carga elctrica que presentan. Pasan las sustan-
cias de carga positiva y no pasan las sustancias de Se considera que las clulas que producen las fibras
carga negativa. Este tipo de capilares se encuentra en reticulares, se deben denominar clulas reticulares, muy
sectores que necesitan facilitar el paso de sustancias, a pesar que son un tipo de fibroblasto
como en los glomrulos renales

B) Pericitos que son clulas mesenquimatosas persis-


tentes o embrionarias del T. C. Laxo, mantienen la
capacidad de proliferacin y competencia para dar
origen a otras clulas del tejido conectivo como fibro-
blastos y clulas musculares lisas. Se encuentran alre-
dedor de los capilares sanguneos.

Los pericitos son capaces de diferenciarse a fibroblas-


tos. En el caso de que el tejido conectivo se someta a
radiaciones previamente a una intervencin quirrgica
de la cavidad abdominal en una persona con cncer, por
ejemplo. Al irradiar la zona, los fibroblastos mueren y no
permitiran la cicatrizacin de la zona a no ser por perici-
tos que migran de sitios no irradiados y se transforman
en fibroblastos nuevos y permitir la cicatrizacin de las
heridas. Esquema de un fibroblasto Fibroblastos del Te-
Los pericitos se encuentran por fuera de las clulas jido conectivo
endoteliales, pero comparten la misma membrana basal,
84

tambin de origen mesenquimatoso pero de origen


directo de monocitos seran los verdaderos macrofagos
y aparecen despus del nacimiento.

Esquema de la estructura de un fibroblasto:


Observe la forma de la clula con prolongaciones citoplasma-
ticas, retculo endoplasmtico, aparato de Golgi, mitocondrias, Los monocitos son clulas que se desarrollan en la
presencia de vesculas secretorias y la exocitosis celular de las mdula sea, de la mdula pasan al torrente sanguneo
fibras de procolgena. y luego al tejido conectivo donde se desarrollan a ma-
crofagos o clulas adultas diferenciadas con capacidad
de fagocitar antgenos o cuerpos extraos. Los macro-
D) Macrofagos o histiocitos clulas de aproximada- fagos tienen receptores FC y C3 de superficie, lo que le
mente 12 micrmetros de dimetro, al M.L. se los ve con confiere en algunos casos una accin predeterminada,
ncleo arrionado y desplazado hacia la membrana encaminada a fagocitar y destruir un antgeno especfi-
celular, citoplasma con presencia de vacuolas excreto- co. Pero tambin actan en forma inespecfica limpiando
ras. Su funcin es la fagocitosis. de cualquier cuerpo extrao del organismo.

Los macrofagos constituyen una lnea muy extendida de Para las funciones de fagocitosis, el macrfago posee
clulas en todo el organismo, se originan de clulas abundantes lisosomas que contienen sustancias demo-
mesenquimatosas (histiocitos) pero la mayor parte de ledoras para cualquier compuesto macromolecular
ellas se originan en los monocitos de la sangre para orgnico, aunque en algunas ocasiones su intento de
constituir el "sistema mononuclear macrofgico" que desaparecer sustancias sea infructuosa, como es el
comprende a macrofagos del hgado o llamadas clulas caso de la presencia de cido rico ya que el organismo
de Kupffer del higado. Clulas de la microgla en el humano carece de uricasas que pueden destruir al
tejido nervioso (son las nicas clulas de origen mesen- cido rico.
quimatoso en el tejido nervioso central). Macrofagos del
bazo, cuya funcin es la fagocitosis de los eritrocitos Los monocitos y por ende los macrofagos son partici-
envejecidos, o daados, o alterados. Macrofagos del pantes directos de los problemas inflamatorios, por lo
tejido conectivo laxo cuya funcin es la fagocitosis de que se activan en un momento determinado. Tienen
sustancias extraas en el "campo de batalla". Clulas capacidad de quimiotaxis es decir migran hacia sitios
gigantes a cuerpo extrao, clulas presentes en algunas donde se les necesita como ante la presencia de una
enfermedades granulomatosas como la tuberculosis. bacteria. O son clulas fijas localizadas en la piel, por
Osteoclastos o clulas fagocticas del hueso, las clulas debajo de ella, o en las mucosas, donde vigilan la entra-
de Langerhans de la piel, etc. da de micro organismos

Las clulas retculo epiteliales en el interior de los vasos


sanguneos, eran consideradas como otro tipo de clu- E) Clulas Plasmticas Son clulas del tejido conectivo
las del T: C. Laxo, pero a la luz del microscopio electr- laxo, de origen mesenquimatoso indirecto, ya que pro-
nico, se ha visto que constituyen prolongaciones de vienen de los linfocitos B de la sangre y tienen como
macrofagos hacia la luz de los vasos sanguneos funcin la produccin de inmunoglobulinas especficas
(o anticuerpos) para el bloqueo y desaparicin de sus-
tancias antignicas.
Macrofagos
Estructuralmente se presentan como clulas redondas
con ncleo perifrico y cromatina dentada, Golgi nega-
tivo (en el centro se hallan los centriolos), el citoplasma
es abundante y basfilo, por la presencia de retculo
endoplasmtico rugoso, para la produccin de protenas
(inmunoglobulinas) y presencia de cuerpos de Roussetl,
que constituyen cmulos de ribosomas

Las clulas plasmticas se presentan tambin en los


tejidos linfopoyticos secundarios como ganglios, nodu-
los linfoides, bazo, y por debajo de las mucosas de los
aparatos digestivo, respiratorio, urinario. Estas clulas
de defensa nos permiten entender los procesos inmuno-
lgicos que ocurren dentro del organismo.

Algunos autores distinguen claramente entre HISTIOCI-


TOS y CLULAS MACROFAGICAS O MACRFAGOS
y determinan que las clulas de origen directo mesen-
quimatoso se las debe llamar Histiocitos. Las clulas
85

tcnica de coloracin especfica que permite etiquetar


una protena ESPECFICA, utiliza un colorante inmuno-
fluerescente como la fluorescena que da una coloracin
verdosa, (se puede usar la lisamina rodamina que emite
una luz roja o inclusive realizar una inmunofluorescencia
con oro) La inmunofluorescencia puede ser directa si
pretende descubrir el antgeno (protena) o inmunofluo-
rescencia indirecta si se pretende reconocer el anticuer-
po o inmunoglobulina.

Las inmunoglobulinas producidas por los linfocitos B son


los siguientes: IgM en enfermedades agudas, constituye
un pentmero, por lo que aparece como una molcula
grande que no puede atravesar la barrera placentaria.
La IgG que es un monmero y tiene la estructura tpica
de un anticuerpo, es de peso ligero por lo que atraviesa
la barrera placentaria, se presenta en enfermedades
crnicas. La IgA es un dmero y se presenta en secre-
ciones del organismo, se produce al reconocer un ant-
Qu e s inmunidad? Mecanismo por el cual un orga- geno que podra ingresar al organismo, es una inmuno-
nismo vivo es capaz de tolerar o soportar la presencia globulina de proteccin y por eso aparece en la saliva,
de una sustancia extraa o antgeno, sin que cause en las lgrimas, en el moco de las mucosas, en la leche
infeccin o malestar. Es un mecanismo de seguridad etc. La IgD es tambin un monmero y se le considera
que evita la reaccin del organismo a actuar, o por lo como una inmunoglobulina de superficie que se une a
contrario se refiere a acciones que tiene el organismo los receptores Fe de los monocitos y macrfagos. Por
para evitar una infeccin ocasionada por un antgeno. El ltimo tenemos a la IgE que es por decir una inmuno-
organismo humano adquiere inmunidad al sarampin globulina de mala calidad, se presenta en individuos
luego de contraer la enfermedad o por medio de la hipersensibles en los que se desarrolla una alergia o son
vacuna antisarampionosa, solo se presenta una vez y responsables de la anafilaxia.
nunca ms durante la vida presentar sarampin. AL
VACUNARSE el nio presenta una infeccin moderada
o un malestar pasajero, que no es comparado con la Tipo de Inmu' Presentes en: Caracteristl-
enfermedad misma. noglobulina cas
IgM Enfermedades, Es un pentme-
No todas las infecciones causan inmunidad permanente, agudas ro
algunas veces el organismo necesita realizar un recuer-
IgG Enfemnedades Es un monme-
do nmunolgico peridico, como en el caso de vacuna
crnicas ro
contra el ttanos, que debe recibir nuevas dosis del
toxoide tetnico para mantener niveles de inmunoglobu- IgA Presente en Es un dmero
linas que impidan la enfemnedad. En otros casos los secreciones del
antgenos se modifican genticamente y burlan las organisnrvo
defensas. como; la saliva,
el sudor, la
Qu e s un antgeno? Son sustancias extraas al leche, el semen
organismo y de origen protenico no reconocido por el etc-
individuo. Antes del nacimiento el organismo "inscribe" a IgD Inmunoglobuti- Es un monme-
todas sus estructuras proteicas en una especie de "re- na presente en ro
gistro civil". En verdad ocurre un mecanismo compiejo ; superficies
en donde los linfocitos pre programados para actuar celulares como
contra una estructura proteica extraa o propia, desapa- en macrfagos
recen ante la presencia de una protena detenninada. Mediador de las Presentes en
reacciones de clulas ceba-
La presencia permanente de esta impedir ia aparicin alergia y anafi- das
de estos linfocitos. Si una sustancia extraa (protena) laxia
ingresa al organismo antes del nacimiento y no es letal,
el organismo lo aceptar como propia, pero a conse-
cuencia que est presente siempre, si la protena o
antigeno en mencin desaparece, los linfocitos que
F) Clulas Cebadas Son clulas del tejido conectivo
fueron reprimidos se recuperan y pueden actuar. Los
laxo, pero pueden encontrarse tambin en el tejido
conocimientos actuales nos penniten entender lo que
conectivo adiposo, alrededor de los capilares sangu-
ocurre con el virus de la coriomeningitis linfoctica del
neos del tejido graso.
ratn VCIWL. El virus es letal si se inocula a un ratn
Son de origen mesenquimatoso, y se supone estn
adulto, pero si hay contacto del virus en un ratn antes
emparentadas con los basfilos de la sangre, se piensa
del nacimiento, el virus es tomado como estructura
que podran originarse de los basfilos igual a como se
propia y el ratn no presenta la enfermedad al ponerse
forman los macrfagos de monocitos y las clulas plas-
en contacto con el virus de la coriomeningitis del ratn.
mticas de los linfocitos B.
Se concluye que el virus per. s no ha sido letal y lo que
provoca la muerte en el ratn es la reaccin inmunolgi-
Poseen granulos abundantes en su citoplasma conte-
ca.
niendo a) heparina, b) histamina, y c) serotonina (me-
nos en clulas cebadas humanas).
Qu son las Inmunoglobulinas? Son sustancias de
naturaleza proteica, producidas especficamente por
protenas extraas, que anulan la accin antignica.
(Protena vs protena)
Las inmunoglobulinas son reconocidas por tcnicas de
inmunofluorescencia. La inmunofluorescencia es una
86

la cascada de condiciones es decir;

1. individuo hipersensible con un cdigo gentico


predisponerte y muy relacionado con la herencia.
No todos los individuos son alrgicos a un determi-
nado "antgeno"

2. Que reciba una dosis sensibilizante o un primer


contacto con el alrgeno, si un individuo es alrgico
al Heno y nunca se pone en contacto con el polen
que causa la alergia, nunca manifestar el proble-
ma
La heparina acta como un aclarante del plasma san-
guneo, o en grandes concentraciones como anticoagu- 3. Que tenga un contacto posterior al de su sensibili-
lante. De atii que una de las funciones de las clulas zacin por segunda ocasin
cebadas sea contribuir en el metabolismo de las grasas,
al pennitir el paso de los lpidos al interior de clulas de La anafilaxia en muchas ocasiones no se puede deter-
almacenaje, ya que la heparina constituye un precursor minar con precisin y vamos a poner como ejemplo la
o por si mismo es una enzima la "lipasa de la lipoprote- anafilaxia a la penicilina
na" que al actuar sobre las fracciones lipdicas las sepa-
ra de la protena y hace posible que las lipoprotenas Un paciente puede desencadenar anafilaxia al recibir
(quilomicrones) se transformen en sustancias micromo- una dosis desencadenante de penicilina, no importa si
leculares que pueden atravesar las membranas celula- han pasado varios meses o varios aos, despus de
res recibir la dosis sensibilizante, el paciente presenta un
shocl< agudo que le provoca la muerte. No todos los
La heparina en grandes cantidades es usada in Vitro, individuos son hipersensibles, pero cuando va a poner
como un excelente anticoagulane, pero al parecer no una segunda dosis de penicilina a un individuo, recuerde
tiene un papel relevante in Vivo (excepto si se adminis- que puede ser hipersensible.
tra heparina IV en forma de medicamento para controlar
la coagulacin sangunea) ya que la coagulacin san- La anafilaxia se provoca experimentalmente al inyectar a
gunea est controlada por un mecanismo complejo que un conejo, suero de caballo. El conejo recibe el primer
se denomina "cascada de coagulacin", regulada por da suero de caballo y hasta generalmente el octavo da
muchos factores que van de I al XIII el conejo no presenta reaccin, es al dcimo da en que
el conejo puede presentar una reaccin anafilctica, el
La histamina Es una amina vasoconstrictora derivada conejo tiene gran dificultad respiratoria, convulsione y
del aminocido histidina, acta contrayendo el msculo muere. Se produce anafilaxia en los casos de inyectar
liso y es un mediador de las reacciones de alergia y "suero" de una especie a otra, por ello recomiendo tener
anafilaxia en el organismo en cuenta, los casos en que se usa suero antiofdico, o
suero antitetnico etc. Al tratar por segunda ocasin la
La anafilaxia se produce cuando al interior del organis- mordedura de serpiente y ya anteriormente se us suero
mo entra una sustancia extraa o antgeno, sobre la cual de antiofdico de caballo, la segunda vez tome en cuenta
se tiene una hipersensibilidad que est dado por el que se puede presentar una anafilaxia.
cdigo gentico. Es decir el organismo lo reconoce
como extrao, si no lo reconoce como sustancia extra- G) Clulas Adiposas cuando estn aisladas son parte
a, no hay reaccin. del tejido conectivo laxo, en conjunto forma un tejido
conectivo propio, o sea, el tejido graso. Se describirn
La presencia de la sustancia anafilctica es reconocida en el desarrollo del tejido conectivo adiposo
por los linfocitos, que provocan una proliferacin de
clulas plasmticas que a su vez producen una Inmuno-
globulina DEL TIPO IgE.

La IgE es por decir un tipo de Inmunoglobulina de mala


calidad, que es absorbida por las clulas cebadas. Este
fenmeno requiere de aproximadamente 8 a 10 das,
tiempo que se considera como de sensibilizacin. Luego
de ocurrida la sensibilizacin y al ingresar por segunda
ocasin el antgeno, este llega a la superficie de las
clulas cebadas provocando una unin antgeno anti-
cuerpo y desencadenando la salida de los granulos de iodo de sensibi-
histamina de las clulas cebadas. Primer ingreso del lizacin
alrgeno Produccin de IgE
La histamina liberada provoca contraccin de la muscu- por las clulas
latura lisa en los vasos sanguneos que a su vez provo-
ca un edema que al ser generalizado y multi-sistmico
Las clulas cebadas
provoca la muerte.
absorben la IgE
En la anafilaxia es necesario tomar en cuenta los si- Dosis desen-
z:
T
guientes eventos y requisitos para que ocurra este 'cadenante
fenmeno:
Nuevo ingreso
LA ALERGIA es producida por un fenmeno parecido a del alrgeno
la anafilaxia, pero la alergia no es multisistmica sino
que ataca a tejido u rganos localizados, Ejm la rinitis Individuo hipersensible
ataca a la mucosa de las fosas nasales.

Pero en los dos casos alergia y anafilaxia es necesaria


87

Clulas inmigrantes del tejido conectivo laxo, o sea, Las fibras colgenas (de 1 a 10 p m ) , estn fonnadas
los leucocitos que son clulas de la sangre y que migran de fibrillas (de 0,2 a 0,5 pm), las fibrillas de mlcrofibrillas
(diapdesis) al tejido conectivo laxo. Son clulas como (50 nm), las mlcrofibrillas de tropocolgena que son las
los linfocitos que al migrar al tejido conectivo laxo se que forman las cadenas alfa. Las fibras, fibrillas y micro-
diferencian a clulas plasmticas. O como los monocitos fibrillas discurren en forma ondulada y paralela, tienen
de la sangre que al migrar al tejido conectivo laxo se capacidad de distenderse, al ponerse rectas, pero esta
transfonnan en macrfagos. Los basfllos estn relacio- distensibilidad es pequea, ya que la funcin importante
nados con las clulas cebadas, aunque no se ha deter- es el de sostener y unir. Son capaces de soportar una
minado con exactitud que se transformen en ellas. Los traccin de cerca de 6 kg por mm^ Una traccin mayor
neutrfilos aparentemente no se transforman en otro tipo conduce a una distensin irreversible y produce desga-
de clulas, pero si, constituyen los micrfagos que al rros que gracias a que son producidas por los fibroblas-
final de su lucha se transforman en piocitos y forman la tos, pueden ser reparadas. Las mlcrofibrillas estn
pus. Los eosinfilos son otras clulas migrantes y al fonnadas de unidades denominadas tropocolgeno que
estar en el tejido conectivo pueden cumplir su funcin son las cadenas alfa. La Tropocolgena de 300 nm de
como es la de fagocitar, aunque no con el papel prepon- largo enrollada a manera de un cordn presenta unas
derante que lo hace el macrfago o el micrfago, su bandas oscuras y claras que simulan la estructura del
funcin es mas bien de ser un mediador de las reaccio- msculo estriado, pero la distancia entre una banda y
nes alrgicas. otra en el msculo es en micrmetros y en las fibras
colgenas es en nanmetros (1000 veces ms peque-
a).
4. FIBRAS:
Son las fibras: colgenas, reticulares y elsticas. La hidroxiprolina es un aminocido importante al ser
detectado en la orina, ya que cuando hay destruccin de
FIBRAS COLGENAS Son las ms abundantes de colgena, en el interior del organismo, aparece cantida-
organismo y estn constituidas por una protena que es des importantes en la orina, as en el caso de destruc-
la colgena. Est formada por cadenas polipeptdicas cin de hueso como en los casos de mieloma, se en-
alfa con solamente tres aminocidos que son: La Usina, cuentra hidroxiprolina elevada en la orina.
a glicina y la prolina, pero tambin en la composicin
se encuentra la hidroxilisina y la hidroxiprolina. Son
fibras onduladas y largas en los tendones, en el tejido
conectivo laxo ordinario son de longitud pequea pero
conservan la forma ondulada.

Las fibras colgenas se colorean de Hematoxilina Eosi-


na de color rosado por efecto de la eosina, ya que la
colgena es protena. Con coloracin de Mallory se tien
de color azul y con van Gieson de color rojo. El conoci-
miento de este tipo de tinciones, se hace necesario para
distinguir adecuadamente la observacin de msculo y
diferenciarlo de la colgena.

La colgena es la materia prima para la elaboracin de


cuero, cuando se realiza la curtiembre con el cido
tnico. Durante la II guerra mundial se utilizaba el cido
tnico para evitar el sangrado, gracias a esa propiedad
de transformarse en cuero y permitir una cicatrizacin
inmediata. Al trmino de la guerra, los individuos en
quienes se uso el cido tnico presentaron cirrosis
heptica, por lo que se estableci la hepatoxicidad de
este producto, prohibindose el uso de esta sustancia
como cicatrizante.. La colgena es tambin materia
prima para la elaboracin de cola de carpintero.

La colgena fomna gelatina, cuando se la cocciona por


largo tiempo como es la preparacin del caldo de pata.
La resistencia de la colgena sucumbe a una buena
hidratacin, fenmeno que ocurre cuando cocinamos
por tiempo prolongado. Mientras el mencionado caldo
est caliente se encuentra en estado de sol, pero al
enfriarse se transforma en estado de gel. En los libros
de medicina interna se refiere a la gelatina, sustancia
importante para el tratamiento de la desnutricin, pero
recuerde que la famosa gelatina no es de carbohidratos,
si no de este producto protenico.
Existen varios tipos de colgena de acuerdo con el nooido en el extremo amino, de la colgena interfiere
siguiente cuadro con la fibrillognesis.

DISTRIBUCIN CINCO TIPOS EN EL ORGA-


Y ORIGEN DE DE COLGENA NISMO HU-
LOS IVIANO
TIPO DE CO- Distribucin Clulas de
LGENA origen

Tejido conectivo Fibroblastos y


laxo y denso, clulas reticu-
cartlago fibroso lares, Con-
hueso droblastos
dentina osteoblastos
Odontoblastos
Cartlago hialino Condrocitos
y elstico clulas de la
cuerpo vitreo del retina
ojo
Las fibras colgenas son metabolizadas y destruidas por
III Tejido Colectivo Fibroblastos, una enzima la colagenasa, producida por fibroblastos,
laxo, fibras clulas reticu- macrfagos y neutrfilos. Tambin es sensible a la
reticulares lares, clulas accin de la elastasa lisosmica de neutrfilos y macr-
capa papilar de de msculo fagos. como tambin las catepsinas lisosmicas N y B
la dermis liso degradan la colgena.
vasos sangu- clulas endo-
neos teliales
IV Membranas Clulas epite-
bsales liales y endo-
cpsula del teliales
cristalino del ojo Fibras crista-
linas

FIBRAS ELSTICAS

Las fibras elsticas son fibras alargadas de 0,2 a 1 pm


de dimetro, realizan anastomosis y se encuentran entre
las colgenas a las cuales dan sostn y permiten que
las fibras colgenas recuperen la ondulacin cuando son
Membranas Fibroblastos sometidas a estiramiento.
fetales, placen- Osteoblastos
ta Clulas del Estn formadas de una protena la elastina, compuesta
Hueso msculo liso por prolina y glicina, poca cantidad de hidroxiprolina y
Msculo liso carece de hidrolisina. Contiene adems dos aminoci-
La colgena tipo Vil se encuentra en individuos con dos denominados desmosina e isodesmosina. Adems
Sndrome de Helers Danlos, que es una alteracin se ha comprobado la presencia de fibrillina.
gentica. Caracterizada por una extensibilidad inusitada
de la piel, hiperextensibilidad de las articulaciones, se
acompaa de luxacin congnita de caderas y puede
estar asociado a otras alteraciones genticas como el
sndrome de Down.

La tropocolgena que son subunidades para la forma-


cin de la colgena, sufre una hidroxilacin (necesaria
para la formacin de la colgena) al ser secretada por
los fibroblastos, la enzima capaz de producir esta hidro-
xilacin en una enzima denominada prolilhidroxilasa,
la misma que est dado por la presencia de la vitamina
C. Los individuos con deficiencia de vitamina C tienen
alteraciones en la formacin de colgena,
Al afectar la colgena de los vasos sanguneos, pueden
sangrar fcilmente (es una manifestacin del escorbuto
o deficiencia de vitamina 0 ) . La sustitucin de un ami-
(TIO Id

>- -I O O n/ri'i

SUSTANCIA FUNDAMENTAL O sustancia intersticial


amorfa, Dentro de la sustancia fundamental existe la
presencia de glucosaminoglicanos no sulfatados (cido
hialurnico) y una pequea cantidad de glucosaminogli-
canos sulfatados (cido cendro itin sulfrico). En el
espacio intersticial se encuentra agua que proviene de la
formacin del lquido tisular, protenas. Fonna un gel
amorfo que puede encontrarse en estado de sol y gel
dependiendo de la presencia de la hialuronidasa, enzi-
ma que despolimeriza el cido hialurnico. La hialuroni-
dasa se denomina tambin factor de difusin de Me-
yer, ya que al ser producido por bacterias permite intro-
ducirse al interior del organismo.

La hialuronidasa es producida por los espermatozoides


para romper la corona radiante del vulo, y como puede
sintetizarse, se la usa en ciertos medicamentos como
cremas con el fin de permitir la difusin de sustancias.

En el espacio intersticial del tejido conectivo laxo, exis-


ten gran cantidad de capilares sanguneos, los mismos
que producen el lquido tisular que lleva los nutrientes
necesarios a todas las clulas del organismo. Por esta
razn el tejido conectivo se encuentra distribuido am-
pliamente en el organismo, est por debajo de la mem-
brana basal que le separa de los epitelios, alrededor de
otros tejidos conectivos, constituye parte del endomisio
de los msculos, del endoneurio de los nervios perifri-
cos. nicamente no hay tejido conectivo en el Sistema
Nervioso Central

Las fibras elsticas suelen ser muy resistentes y no


contienen enzimas que las metabolicen como las col- COMPONENTES DE LA EN EL ESPACIO IN-
genas, de tal manera que en momias egipcias se encon- SUSTANCIA FUNDA- TERSTICIAL DEL TEJI-
tr fibras elsticas pero no fibras colgenas. Las fibras MENTAL CONECTIVO DO
son muy resistentes, pero cuando se pierden es muy LAXO
difcil SU recuperacin. Puede ser metabolizada por Gel Amorfo de composi- (-120 (agua)
elastasas que son enzimas pancreticas. cin qumica compleja Protenas (colgena)
Glucoprotenas y gluco-
Las fibras elsticas resisten una tensin de 20 Kg por saminoglicanos no sulfa-
mm^y pueden distenderse hasta en un 150%. Pueden tados y sulfatados
estar en forma de redes, en cpsulas de rganos, en los Proteoglicanos
pulmones, en las paredes de los vasos sanguneos en la
emergencia del corazn. Tambin estn presentes en el
ligamento amarillo (entre los arcos de vrtebras vecinas) La matriz amorfa constituye una sustancia impor-
tante del tejido conectivo es un gel complejo, viscoso de
Con la coloracin de H.E no se pigmenta, pero se lo aspecto gelatinoso, de hecho va transformndose del
puede ver con Orcena, H.E ms Azn y mtodo de van estado de sol a gel y viceversa. Se considera que man-
Gieson. tener esta propiedad es "el principio y fin de la vida" est
formado por:
La funcin de las fibras como su nombre lo dice es dar
elasticidad a ciertos rganos como el caso de la piel que Proteoglucanos Sustancia de composicin com-
al ser estirada y al retirarse la fuerza regresa a su esta- pleja formada por una protena central que es el ncleo,
do inicial, lo mismo ocurre en el caso de los vasos arte- donde se enlaza distintas cadenas de polisacridos, los
riales, que son distendidos por la llegada de sangre y hidratos de carbono constituyen hasta el 95% de la
son causantes del pulso. Otro ejemplo son la distencin composicin. Las glucoprotenas alcanzan un 60% de
de los pulmones. carbohidratos. La cadena de carbohidratos se denomina
Las fibras elsticas se producen en los fibroblastos, pero glucosaminoglicanos.
principalmente en fibras musculares lisas.

FIBRAS RETICULARES

Son fibras parecidas a las colgenas, debido a la misma


composicin qumica; excepto que adems de las cade- OurM
nas alfa, se encuentran recubiertas de carbohidratos, Pfoen
por lo que no se pintan con H.E. pero si aparecen con
coloracin de PAS, o con coloraciones argnticas, se
CoiKfrc
encuentra en el tejido conectivo reticular, en el hgado, 8. Proteoglucano
en el rion, en el endomisio del msculo, en el endoneu-
rio de nervios. Son parte de las membranas bsales ya
que forman la capa fibroreticular.

Las fibras reticulares tienen colgena tipo III, Las fibras Hialuronano Esta sustancia se demostr por pri-
reticulares son formadas por los fibroblastos mera vez en el cuerpo vitreo del ojo, por lo que se con-
sidera como una sustancia birrefringente es decir permi-
90

te el paso de la luz, anteriormente se le denominaba mo para llenar los requerimientos, remplazar materiales
cido hialurnico, Esta sustancia es primordial en el gastados, consumidos, metabolizados etc.
tejido conectivo y su molcula gigante de hasta 2,5
micrmetros de largo. La sangre llega por el extremo arterial y contina por el
El Hialuronano agrega muchas molculas de Pro- extremo venoso. En el trayecto pasa el agua mediante
teoglucanos. mecanismo de osmosis, atraviesa los capilares que son
fenestrados. El agua que pas el endotelio y la mem-
brana basal de las mismas, arrastra consigo a los crista-
loides o sustancias verdaderas como son: la glucosa,
cidos grasos, glicerol, monoglicrido, diglicridos,
aminocidos, electrolitos, aminocidos, O2, etc.

Despus de baar las clulas y recoger los productos


del metabolismo celular, como rea, creatinina, creatina,
cido rico, etc. El lquido debe retornar por el extremo
venoso a la circulacin general, y aqu nuevamente se
pone en juego la osmosis, gracias a que en el espacio
intravascular, las protenas plasmticas, al haber perdi-
do agua se han concentrado; y en el espacio intersticial
las protenas del lugar han sufrido una dilucin.

No todo el lquido tisular producido en el extremo arte-


rial, retorna por el extremo venoso, por ello el remanente
de lquido, debe salir por capilares linfticos que nacen
en las asas capilares. De esta manera la cantidad de
lquido formado, retorna a la circulacin general, sin
dejar residuos que al acumularse en el espacio intersti-
cial provocaran edema.

EDEMA

El edema es la acumulacin anormal del lquido tisular,


en el espacio intersticial. Se considera como un tumor
Estas molculas suelen contener grandes cantida- de agua.
des de agua y estn en estado de sol y gel, permitiendo Las causas generales de! edema son:
el movimiento de lquidos en el intersticio del tejido
conectivo. A estas molculas tambin se las ha conside- 1. Aumento de la presin hidrosttica, que se
rado o comparado con un cepillo para lavar biberones. produce cuando hay una disminucin del calibre o una
verdadera obstruccin del capilar en su extremo venoso.
En la composicin de la sustancia fundamental se en- El corazn es el principal responsable de mantener la
cuentra una gran cantidad de sustancias como son: presin hidrosttica; si hay un aumento del volumen
Condroitinsulfatos en cartlago sanguneo el corazn deber realizar un esfuerzo mayor
Dermatn sulfato relacionada con la anterior para bombear la sangre. Al producirse un aumento de la
Queratn sulfato crnea, cartlago, hueso presin sangunea por aumento del volumen sanguneo
Heparn sulfato aorta, hgado, pulmones y por aumento consecuente de la presin hidrosttica,
se produce lquido tisular en mayor volumen. Al estar
disminuido el calibre del extremo venoso, no retorna
Recuerde que estas SUSTANCIAS SE AFECTAN todo el lquido tisular que normalmente lo hara. El lqui-
POR ENZIMAS denominadas hialuronidasa. do tisular se acumula en el espacio intersticial. De todas
maneras los linfticos cumplen un papel importante en
Pero ADEIVIS CONSIDEREMOS COMO PARTE estas circunstancias, pues se abren en mayor propor-
DE la sustancia fundamental a glucoprotenas adhesivas cin, es decir aumenta la permeabilidad al agua y pre-
como fibronectina que forman parte de la membrana tenden compensar la disminucin del lquido que no
basal de los medios de unin celular. Igualmente re- regresa por el extremo venoso. Los capilares linfticos
cuerde otras protenas como la laminina, la entactina, de todas maneras no son capaces de equilibrar el 100 %
tenascina etc. de este problema y se acumula lquido provocndose
este tumor de agua. El espacio intersticial est hincha-
do.

Es causa de aumento de la presin hidrosttica, los


problemas cardacos. La obstruccin a la libre circula-
FORMACIN D E L LIQUIDO TISULAR Y LINFA cin venosa como en las mujeres embarazadas que por
presencia del feto literalmente aplastaran la vena cava
La formacin del lquido tisular se realiza a nivel del inferior. Al haber una obstruccin del retorno venoso por
tejido conectivo laxo, donde estn presentes los capila- una tumoracin daran lugar a un edema localizado.
res sanguneos. Los capilares sanguneos son tubos de
hasta 10 micrmetros de dimetro, revestidos de clulas 2. Disminucin de la Presin Onctica. La pre-
endoteliales, a travs de estas clulas y por mecanis- sin Onctica est dada por la presencia de protenas
mos de osmosis y por presin hidrosttica, (Presin en el espacio intravascular, por lo tanto para que se
Onctica), se forma el lquido intersticial que es un produzca una buena presin Onctica, sobre todo en el
dializado del plasma sanguneo. retorno del lquido en el extremo venoso es necesario
una buena cantidad de protenas plasmticas que son;
Este dializado est cargado de nutrientes, electrolitos y las albminas y las globulinas principalmente. La Osmo-
Oxgeno, que son utilizados por las clulas del organis- sis en extremo venoso retorna gracias a la concentra-
91

cin de protenas en este sitio, si el individuo no presen-


ta protenas suficientes no arrastra el agua y consecuen- TEJIDO CONECTIVO DENSO ORDINARIO.
temente se produce el edema.
Similar al tejido conectivo laxo excepto porque:
1. Tiene mayor cantidad de fibras colgenas. Aqu
predominan las fibras a las clulas y a la sustancia
intersticial.
2. Las clulas, son principalmente fibroblastos y
aunque pueden haber el mismo tipo de clulas del
tejido laxo, en realidad son muy escasas.
3. No es un tejido nutricio por excelencia ya que
posee una pobre cantidad de capilares sanguneos.

El tejido conectivo denso suele estar unido al tejido


conectivo laxo, por ejemplo en la demiis de la piel; se
puede observar estos dos tipos de tejidos, pero sin una
lnea demarcadora que los separe, solo se puede distin-
guir la diferencia por la cantidad de clulas, capilares
sanguneos, fibras y sustancia intersticial.

tumMn avud
nwur Hqukto 9jr}

Es causa de edema por disminucin de la presin


Onctica los individuos que carecen de suficiente canti-
dad de protenas (albminas y globulinas) en los si-
guientes casos: a) desnutricin tipo Washiorkor o ede-
matosa, frecuente en nios en edad escolar, no ingieren
protenas y su dieta se hace principalmente por carbohi-
dratos; estos nios aparentan tener buen peso y estar
"gorditos", en realidad estn edematosos, acumulan
agua en los cachetes y en el abdomen, tienen domen
prominente incluso con protrusin del ombligo.
La desnutricin tipo marasmtica es diferente, los
individuos no ingieren la cantidad normal de caloras, es
frecuente en nios o ancianos en pases tercer mundis-
tas o demasiado pobres como los pases del frica.
b) Prdida de protenas como en insuficientes rena- TEJIDO CONECTIVO MUCOSO EMBRIONARIO.
les o en quemados que exudan importantemente al no
tener piel que evite esta prdida de protenas, por eso Este tejido conectivo como todos los tejidos conectivos,
los individuos con quemaduras importantes se encuen- es de origen mesenquimatoso, se encuentra originando
tran edematosos otros tejidos conectivos en el perodo embrionario y
luego en la edad fetal.

3. Aumento de la permeabilidad capilar, ocurre Al momento del nacimiento se encuentra en pequeas


cuando hay una solucin de continuidad (heridas) con cantidades por debajo de la piel, y en la gelatina de
destruccin de capilares, como ocurre en caso de trau- Wharton del cordn umbilical. En los adultos solo se
matismos o contusiones, se incluyen los aplastamientos. encuentra en algunos dientes en la pulpa dentaria. (Ver
El capilar al estar destruido permite la salida de todos diente).
los componentes intravasculares. Si hay prdida de toda Como todo tejido conectivo, el mucoso embrionario
la sangre incluso puede provocar equimosis o moreto- tiene: clulas, fibras y sustancia fundamental o sustancia
nes con hinchazn del tejido intersticial. intersticial.

4. Obstruccin de los capilares linfticos, el pa-


pel de los linfticos es drenar el remanente de lquidos,
pero a su vez como tiene un permeabilidad aumentada
es capaz de retornar la pequea extravasacin de pro-
tenas de bajo peso molecular que abandonan el espa-
cio intravascular en el extremo arterial. Al obstruirse los
linfticos no hay retorno de ese remanente y se produce
edema.
Una causa de edema por obstruccin de linfticos
es producido por tumores en ese sector o en el caso de
una parasitosis llamada "elefantiasis", producida por un
parsito (filarla) que generalmente entra por la planta de
los pies y se toma los linfticos de una extremidad infe-
rior, la pierna se vuelve gigante tanto que semeja a la de
un paquidermo
92

TEJIDO CONECTIVO MUCOSO EMBRIONARIO

Las Clulas: son los fibroblastos de forma estrellada,


TEJIDO ADIPOSO. Clulas adiposas se muestra el estroma con gran
con largas prolongaciones citoplasmticas, las que cantidad de vasos sanguneos
estn entrecruzndose con otras, dejando un espacio
areolar que se llena de sustancia intersticial con gran
cantidad de lquido, por su capacidad de absorber lqui-
dos. Las clulas se ven como fibroblastos peludos por la
produccin de colgena. Al envejecer los fibroblastos
podran transformarse en fibrocitos
Las fibras: son las fibras colgenas que son producidas
por los fibroblastos. Son fibras de caractersticas iguales
a otros sitios de tejido conectivo donde se encuentra la
colgena, pero debe anotarse que son poco visibles.
Estas se pigmentan con H.E. de color rosado.

La sustancia fundamental formada por cido hialurni-


co, denominado actualmente como glucosaminoglicano
no sulfatado.

El tejido conectivo mucoso embrionario o tejido


mesenquimatoso puede confundir al estudiante princi-
piante con el tejido adiposo, por ciertas caractersticas,
sobre todo el tener un aspecto areolar. Si toma en con-
sideracin las siguientes diferencias no se desconcerta-
r.
X
a) En el tejido conectivo mucoso, los espacios areola-
res no s o n regulares. El tejido adiposo tiene es-
pacios ms o menos regulares con clulas poligo-
nales tendiendo a clulas redondas aplastadas por
sus vecinas que le dan un aspecto de panal o de
alambrada.
b) En el tejido conectivo mucoso los espacios estn
llenos de sustancia intersticial con glucosaminogli-
canos y presencia de fibras colgenas, por lo que
se ven de aspecto rosado con HE. El adiposo pre-
senta espacios incoloros, blanquecino (coloracin
de H.E.), llenos de H 2 0 con un pH neutro; que no
se pigmenta ni con la Hematoxilina ni con la Eosi-
na.
c) El ncleo de las clulas en tejido mucoso se en-
cuentra en los fibroblastos, ocupando la parte cen-
tral del citoplasma. En el tejido adiposo el ncleo
de los adipocitos est desplazado hacia la mem-
brana celular que le da la caracterstica de una c-
lula en anillo.
d) Se observa tejido conectivo mucoso embrionario
solo en la gelatina de Wharton del cordn umbilical
y en la pulpa dentaria.
93

TEJIDO CONECTIVO ADIPOSO O GRASO. las clulas suelen ser desplazadas por clulas adiposas
vecinas por lo que suelen deformarse mutuamente y
El tejido conectivo adiposo, como todo tejido co- adoptar la textura de una malla de alambre, es decir se
nectivo es de origen mesenquimatoso y se encuentra presentan polidricas.
formado de clulas, fibras y sustancia fundamental
El ncleo se presenta atachado y desplazado hacia la
membrana celular, con una cromatina nuclear discreta-
El tejido conectivo adiposo se clasifica en tres tipos de mente laxa. Su citoplasma rodea un gran lbulo de
tejidos: 1. Tejido adiposo comn con clulas adiposas grasa y es una fina bandeleta con algunos organitos
blanquecinas o clulas amarillentas llenas de carotenos citoplasmticos, como retculo citoplasmtico rugoso,
2. Tejido conectivo adiposo pardo con clulas pequeas aparato de Golgi, ribosomas y mitocondrias, retculo
multiloculares, gran cantidad de mitocondrias y gran citoplasmtico liso.
vascularizacin. 3. Clulas almacenadoras de grasa de
la mdula sea (tejido hematopoytico o formador de
sangre)

TEJIDO ADIPOSO COMN

El tejido adiposo comn se presenta macroscpicamen-


te como un tejido de color amarillo si est cargado de
carotenos, o de color blanco si no tiene caroteno, si la
cantidad de caroteno es media, la grasa se presenta de
color rosado.

La grasa del ganado vacuno, puesto que los animales


son herbvoros, comen hierba con gran cantidad de
caroteno, se presenta de color amarillo. La del cerdo,
que tiene alimentacin pobre en carotenos es de color
crema. Al hacer una diseccin de un cuerpo humano se
encontrar grasa amarilla si el individuo ha consumido
alimentos con carotenos, de lo contrario la grasa ser
blanca.

Constituye el 20% del peso corporal y est ricamente


vascularizado, por lo que individuos obesos suelen tener Se pensaba que los adipocitos se originan en los fibro-
poliglobulia (aumento de glbulos rojos). blastos, en la actualidad esta teora est descartada,
dernosrdda curiiu tudtd, ya qut tariu l u s nJpuufu
Histolgicamente la grasa o el tejido adiposo comn como los fbroblastos son clulas terminales o diferen-
estar fonnado de: estroma y parnquima. El estroma ciadas y no podran transformarse la una en la otra.
es el tejido de sostn compuesto por tejido conectivo
laxo, con fibras colgenas, reticulares, por lo que el En el tejido mieloide (mdula sea), pueden aparecer
estroma tiene fibroblastos, clulas reticulares, clulas unas "clulas almacenadoras de grasa" de origen y
cebadas o Mastocitos. comportamiento distinto a las clulas adiposas del tejido
graso.

1. CLULAS:

Son principalmente los adipocitos, clulas de origen


mesenquimatoso. Se encuentran en el tejido conectivo y
en un nmero determinado al momento del nacimiento
Su funcin es la de almacenar grasa, la que utiliza como
reserva energtica, aislante trmico, o simplemente
tejido de relleno.

En otros rganos como el hgado, las clulas hepticas


normales son sustituidas por clulas que almacenan
lpidos y dan un sndrome de hgado graso que puede
ser premonitorio de la cirrosis heptica.
Tienen la forma de anillo, con una fina bandeleta de
citoplasma que rodea a un gran lbulo de grasa, por lo Otros tipos de clulas presentes en el tejido adiposo
que a este tejido se le conoce como grasa unilocular. son: Las clulas cebadas, a las que debe considerarse
como asociadas al tejido graso, pero no, propias de este
Las clulas son redondeadas de tamao variable desde tejido.
pocos micrmetros hasta 200 micrmetros de dimetro,
94

2. FIBRAS DEL TEJIDO ADIPOSO En los seres humanos la grasa parda es til en el mo-
mento del nacimiento, ya que la combustin de esta
Son las fibras colgenas que a su vez, constituyen parte grasa produce calor, necesario para compensar la dife-
del tejido conectivo que rodea al tejido adiposo, consti- rencia de temperatura entre el claustro materno a 37 C
tuyen el estroma o tejido de sostn del tejido conectivo y la del medio ambiente al momento del alumbramiento,
adiposo. Cuando se cocciona la grasa (para hacer por eso el momento de nuestro nacimiento, es un mo-
fritada), el calor destruye las grasas y esta sale, queda mento dramtico, el primer choque es ese cambio de
conno residuo el famoso chicharrn que no es otra cosa temperatura, mucho ms si el parto se realiza en un sitio
que el tejido estromtico con algn residuo de lpidos. fri como Quito, y dependiendo de la hora a la que se
produce el nacimiento del nio. Una recomendacin
La membrana celular de los adipocitos de la grasa importante es no olvidar que una sala de partos, debe
blanca o amarilla (grasa unilocular), presenta receptores estar a una temperatura cercana a 37 C
para hormonas como la insulina, hormona del creci-
miento, noradrenalina y glucocorticoides, por lo que
es posible la captacin de grasas al interior de la clula,
agrandamiento o hipertrofia de las clulas, adems del
proceso de neoglucognesis (formacin de glucosa a
partir de otras sustancias, que no sea el glucgeno).

El aumento de grasa en el organismo se conoce como


obesidad, la misma que se considera como un estado
de peligro por las complicaciones que repercuten en el
organismo. En la antigedad se consideraba la obesidad
como sinnimo de "salud", hoy por el contrario se consi-
dera como un factor de riesgo ya que incrementa los
problemas cardacos con infartos, hipertensin arterial,
predispone a la diabetes y es un factor de envejecimien-
to prematuro.
CUESTIONARIO PARA LA PRXIMA CLASE DE
LABORATORIO.
LA GRASA PARDA 1. Por qu razn al poner la placa l microscopio,
debe ver que el cubreobjetos quede hacia arriba?
Es llamada tejido adiposo pardo o grasa multilocular, ya Cul es la diferencia de coloracin entre el epitelio
que almacena no solo un lbulo de grasa, sino muchos y el tejido conectivo y por qu razn o razones?
de ellos. El tejido adiposo multilocular, tiene una rica Cul es la diferencia histolgica entre tejido co-
vascularizacin, sus clulas estn cargadas de ms nectivo laxo y denso?
mitocondrias, presenta fibras nerviosas amielinicas. En Qu caractersticas tiene el tejido conectivo?
general el tejido adiposo pardo, tiene una estructura Qu funciones cumple el tejido conectivo?
parecida a una glndula, con lobulillos, rica vasculariza- Cules son las diferencias ms importantes en el
cin. reconocimiento de fibroblastos, fibrocitos, macrfa-
gos, clulas cebadas, y clulas plasmticas?
La grasa parda es til al organismo por la gran produc- 7. Cul es la importancia de determinar, el tipo de
cin de calor, necesario en animales que hacen hiber- clulas presentes en el tejido conectivo?
nacin, al momento que el animal despierta de su largo Qu diferencias hay entre las distintas fibras del
letargo es este tipo de grasa, la que le suministra el tejido conectivo?
calor necesario para despertario. 9. Cul es la composicin de la sustancia'fundamen-
tal?
10. Haga los dibujos correspondientes a los tejidos y
Adipocitos Tejido adiposo tipos de clulas presentes en cada una de las pla-
muliiloculares marrn
cas que observ en el laboratorio.
95

P R A C T I C A DE L A B O R A T O R I O No NUEVE.

TEMA: OBSERVACIN DE S A N G R E : " L O S ERITROCITOS, HEMATIES O GLBULOS R O J O S " .


I) Seque la placa antes de colocarlo al micros-
Objetivo de la prctica: copio.
J) Coloque un cubreobjetos (no siempre se ne-
a) Conocer la morfologa, tamao y color de los eritro- cesita colocar el cubreobjetos en observacio-
citos al microscopio de luz. nes de sangre, a veces es mejor observar sin
b) Diferenciar eritrocitos humanos de eritrocitos en cubreobjetos).
mamferos, aves y reptiles. K) Observe al microscopio, empezando por el
c) Observar el comportamiento de los eritrocitos, lente de menor aumento, hasta llegar al lente
sometidos a diferentes soluciones: (isotnicas, fii- de 40 X. Anote en su cuaderno las observa-
potnicas, hipertnicas). ciones realizadas, vaya haciendo dibujos y
d) Distinguir los eritrocitos, de las plaquetas y de los explicaciones de lo visto.
leucocitos L) Coloque una gota de aceite de cedro y obser-
e) Diagnosticar la morfologa normal de los eritrocitos. ve con 100 X.
f) Aprender a recolectar sangre y hacer las prepara-
ciones de placas para observar al microscopio fo-
tnico.

Materiales:

1. Microscopio de luz
2. Placas portaobjetos y placas cubreobjetos.
3. Lancetas sanguneas o agujas hipodrmicas.
4. Capilares para microhematocrito.
5. Tubos para recoleccin de sangre, con anticoagu-
lante
6. Tubos para recoleccin de sangre, sin anticoagu-
lante. Frotamiento Sanguneo Extendido sangu-
7. Alcohol yodado neo
8. Torundas o motas de algodn o gasa estril.
9. Esmalte para uas (transparente)
10. Sangre de diferentes animales, perros, gatos,
palomas o pollos, (obtener sangre con anticoagu-
lante en un tubo de ensayo). O debe llevar al labo-
ratorio: lagartijas, sapos, peces, palomas. Etc.
11. Sangre humana obtenida con la lanceta sangunea
o mediante venopuncin.
12. Colorantes para sangre.

Procedimiento:
2. Observacin de los eritrocitos al microscopio
1. Extendido de sangre en una placa portaobjetos. con lente de 100 X.

Proceda de la siguiente manera: A) Las observaciones se realizan en una placa


coloreada por el mtodo de Giemsa o por el
A) Previamente la zona a pincharse debe estar mtodo de White. Observe entre el cuerpo y
limpia, para lo cual la persona a ser pinchada la cola del extendido. En la cabeza estn muy
debe lavarse y mantener la zona limpia apelotonados y en la cola los eritrocitos estn
B) Esterilice el pulpejo del dedo, con alcohol yo- muy dispersos.
dado empapado en una torunda o con gasa.
C) Deje que el alcohol yodo acte sobre la piel un B) Mire la forma de los eritrocitos en el extendido
tiempo aproximado de 5 minutos. de sangre. Lo normal es verse como discos
D) Pinche la yema del dedo, que debe estar lim- bicncavos anucleados, si hay alteracin de la
pia y estril, con una lanceta sangunea o con forma como cuando se presentan como esfe-
una aguja hipodrmica. Hgalo una sola vez, ras, bien pigmentadas y muy pequeas, se
en forma enrgica pero apropiada. denomina microesferocitos. Eritrocitos en
E) Deseche las dos primeras gotas, la tercera go- forma de valo se denominan ovalocitos. Los
ta de sangre aplique sobre la placa portaobje- eritrocitos con bordes y membrana celular
tos en uno de los extremos, como se seala irregular con proyecciones se denominan
en el esquema del extendido. acantocitos. Toda alteracin de la forma de
F) Extienda la sangre, ayudado por otra placa los eritrocitos se denomina "poiquilocito".
portaobjetos o llamada placa diseminadora,
desplazando la una sobre la otra y mante- C) Observe el color: de acuerdo con esta obser-
niendo un ngulo entre 30 a 45. El extendido vacin califique a los hemates como normo-
debe tener al final una cabeza, un cuerpo y crmicos (color normal o cantidad de hemo-
una cola, (vea el esquema del frotamiento globina normal), hipocrmicos (color dismi-
sanguneo) nuido, traduce una disminucin de la concen-
G) Coloque unas gotas de azul de metileno o co- tracin de hemoglobina), hipercrmicos (con
lorante de Giemsa por 3 a 5 minutos. Si la co- concentraciones de hemoglobina mayor o
loracin es con Giemsa o en un "coloreador" aumentado). Se considera color normal,
automtico el procedimiento es casi similar. cuando los 2/3 externos presentan color, dado
H) Lave la placa con agua corriente, tratando de por la presencia de hemoglobina y el 1/3 cen-
eliminar el exceso de colorante. tral es claro casi blanco debido a que en los
96

discos bicncavos en este sitio hay menor infla como una bomba de carnaval, hasta que
cantidad de liemoglobina. explota o se destruye.

D) Observe el tamao de los eritrocitos y calif- F) En una nueva preparacin coloque una solu-
quelos como normocitos si mide 7.2 micr- cin hipertnica (agua con sal sobresaturada).
metros +/- 0.5 micrmetros (tamao normal), Haga sus anotaciones y dibujos. Observe la
microcitos si el tamao de los eritrocitos es formacin de crenocitos o clulas deshidrata-
menor de 6 micrmetros (tamao pequeo o das por el fenmeno de osmosis
disminuidos), macrocitos si el tamao es ma-
yor de 9 micrmetros (tamao aumentado). Si Osmosis: Es el paso del solvente (agua), desde un sitio
en un extendido sanguneo mira eritrocitos de de menor concentracin a otro de mayor concentracin,
todos los tamaos, a esto se denomina aniso- a travs de la membrana celular. Con el fin de nivelar las
citosis. diferentes concentraciones entre dos compartimentos
E) Recuerde que lo primero que tiene que anali- separados por una membrana celular o una estructura
zar en la observacin de una placa de sangre, que haga sus veces.
son los eritrocitos y ve a) la forma, b) el color y
c) el tamao

F) De acuerdo con las observaciones anteriores EL TEJIDO CONECTIVO SANGUNEO


haga un diagnstico de los eritrocitos y anote
en su cuaderno. Ejemplo: eritrocitos; normoci- LA S A N G R E
to, normocrmico con caracteres normales.
La sangre es un lquido de color rojo que se moviliza
por las arterias y las venas del sistema circulatorio, de
los animales vertebrados y por lo tanto en el hombre.
Por analoga se considera como sangre al lquido blan-
quecino que circula por los vasos de animales inverte-
brados.

La sangre HISTOLOGICAMENTE: es un tejido conecti-


vo no modelado y debe describirse como un tejido
conectivo: formado por Clulas, Sustancia Fundamental
lquida y fibras.
No encontramos propiamente fibras, como las tpicas
del tejido conectivo (colgenas, elsticas, reticulares).
Estas pueden compararse por la presencia de fibrina
3. Preparacin de sangre en gota gruesa: que se transforma a partir del fibringono.

A) Despus de haber pinchado el pulpejo del de- Esta consideracin puede ser abordada ms tarde
do previamente esterilizado. La cuarta gota de cuando hablemos de aspectos fisiolgicos relacionados
sangre coloque sobre una placa portaobjetos con la coagulacin sangunea o la formacin del fibrin-
en su parte central, de acuerdo con el esque- gono en fibrina.
ma.
Como Sustancia Fundamental en el tejido sanguneo
se considera, a la presencia del plasma sanguneo, que
tampoco coincide tpicamente con la del tejido conectivo
(glucosaminoglicanos sulfatados y no sulfatados, ade-
ms de otras sustancias constitutivas como glucoprote-
nas, protenas, etc.). ^
B)
La Sustancia Fundamental del tejido sanguneo es el
C) Selle la placa cubreobjetos con esmalte de agua con una cantidad mensurable de varias otras
uas transparente; de acuerdo con el esque- sustancias que se encuentran en solucin.
ma, dejando una ventana, sobre la cual va a El Plasma sanguneo contiene soluciones: a) verdaderas
trabajar con soluciones de diferente concen- o cristaloides, b) soluciones coloidales y c) suspensio-
tracin. nes.

D) Por la ventana que usted dej, coloque una As se considera:


gota de suero fisiolgico y obsen/e lo que su-
cede con los glbulos rojos. Observe por largo a) Una solucin verdadera o cristaloide a la presencia
tiempo los eritrocitos, mrelos de frente y de de agua en solucin con azcares simples (glucosa), o
peri'il, mire el movimiento de los hemates y aminocidos, o glicerol o cidos grasos. O con otras
algunos de ellos estticos formando pilas de sustancias como electrolitos, Oxgeno, etc.
monedas, dibuje sus observaciones y haga
anotaciones. Las soluciones verdaderas presentan un solvente que
es el agua (en la materia viva) y el soluto, que son part-
E) En otra preparacin de gota gruesa, coloque culas de menos de 0,001 pm o sea ms pequeas que 1
una gota de agua destilada y con la misma nm. Las soluciones verdaderas tienen varias propieda-
tcnica que en (D), proceda a realizar anota- des como: a) son capaces de atravesar las membranas
ciones y dibujos. Observe el proceso de he- celulares, b) No enturbian el solvente, c) aumentan el
molisis que se produce punto de ebullicin, d) disminuye el punto de congela-
cin, e) no pueden ser separados por medios fsicos
La hemolisis es la destruccin de los glbulos comunes ya que por ejemplo los filtros no permiten la
rojos por efecto del proceso de osmosis, el agua separacin del soluto del solvente, f) Cuando se los deja
que es hipotnica en relacin al interior de los en reposo no se separan el solvente y el soluto. Y la
hemates ingresa al interior de las clulas y los ms importante es que los cristaloides o soluciones
97

verdaderas pueden atravesar las membranas celulares. Estos constituyentes y otros forman con el agua el
Las soluciones verdaderas no enturbian el solvente, plasma sanguneo.
conocimiento importante para analizar una solucin que El plasma sanguneo contiene otras sustancias no men-
va a ser puesta como venoclisis. Cuando mira una cionadas hasta ahora como: fibringeno, hemoglobina,
solucin glucosada o salina o cualquier otra, esta no sales orgnicas, hormonas, nmunoglobullnas y las
puede presentarse turbia, si est turbia debe descartar- clulas sanguneas en suspensin.

Entre las Sustancias Inorgnicas: se encuentra princi-


b) Soluciones coloidales se forman por la presencia palmente al agua que constituye el 90%. En el interior
del agua en solucin con: carbohidratos compuestos de los eritrocitos hay agua en el 65%. En concentracio-
como el glucgeno, con polipptidos o protenas, con nes variables estn el Na, K, Ca, Mg, Cl, P, Fe, Cu, etc.
grasas neutras, etc. Muchos elementos qumicos en forma de iones y otros
en compuestos qumicos inorgnicos como sales, etc.
Las soluciones coloidales tambin presentan un solven-
te que es el agua y un soluto o micelas de un tamao La SANGRE est constituida por una parte lquida: el
que va entre 10 nm y 100 nm o entre 0,^,01 pm y 0,1 pm. plasma sanguneo, y otra parte slida: las clulas san-
guneas.
Tambin presentan propiedades como: a) no pueden
atravesar las membranas celulares, b) enturbian ligera- Se mide la cantidad de plasma versus elementos figura-
mente al solvente, c) aumentan el punto de ebullicin dos por el hematocrito. El hematocrito es un procedi-
aunque lo hacen ligeramente, d) disminuyen el punto de miento de laboratorio, utiliza la centrifugacin de la
congelacin levemente, cuando se las deja en reposo, el sangre total, obtenida con un anticoagulante. Hay varios
soluto no se separa del solvente debido a que las mice- mtodos para la determinacin del hematocrito, una
las presentan la misma carga inica, por ejemplo si las forma es con la utilizacin de un tubo de Wintrobe, tubo
cargas inicas son negativas, al unirse con otra negativa que contiene una regleta para medir el porcentaje. En
se repelen y dan lugar a un movimiento llamado Brow- los actuales momentos la determinacin del hematocrito
niano. se realiza con el empleo de tubos capilares que se
consideran ms precisos y se llama microhematocrito.
Pero la caracterstica ms importante es que las solu-
ciones coloidales presentan como propiedad importante
el de estar en estado de sol y gel. El estado de sol es
lquida (sol-ucin) y el estado de gel es un estado semi-
lquido (gelatina)

Las emulsiones son un tipo de soluciones coloidales en


donde el disperso y dispersante son lquidos ejemplo la
mezcla de agua y grasas. La leche ce un buen ejemplo
de emulsin.

c) L a s suspensiones son soluciones en las que el


soluto est formado de partculas igual o mayor a un
micrmetro, se forman por la presencia del plasma
sanguneo y las clulas hemticas (eritrocitos, leucoci-
tos, plaquetas).

Las propiedades de las suspensiones son: a) no alteran


el punto de ebullicin, b) no disminuyen el punto de
congelacin, c) cuando se las deja en reposo sedimen-
tan y se separan el soluto del solvente, d) no pueden
atravesar las membranas celulares, (el paso de los
eritrocitos, a travs de los sinusoides se denomina
diapdesis y es una propiedad de las clulas por ser
estructuras vivas).
El microhematocrito mide en forma indirecta la cantidad
La presencia de clulas en el tejido sanguneo es im- de elementos figurados de la sangre. Aunque este valor
prescindible puesto que de otra manera no lo considera- no es confiable para determinar el nmero de eritrocitos
ramos como tejido. Las clulas son los llamados ele- si estos no son normocitos o de un tamao normal. En
mentos figurados de la sangre y estn constituidos por: pacientes con hemates grandes aparecer el Hemato-
crito aumentado (tendr menor nmero de eritrocitos) y
a) glbulos rojos (hemates o eritrocitos), b) glbulos en pacientes con microcitos o hemates pequeos esta-
blancos que deberan llamarse siempre como leucocitos r el hematocrito disminuido (tendr mayor nmero de
y c) las plaquetas, estas ltimas no consideradas como eritrocitos).
clulas propiamente, ya que son segmentos celulares y
no presentan ncleo.

COMPOSICIN DE L A SANGRE Una frmula emprica de obtener el nmero de eritroci-


tos en base al Hcto es sumar al Hcto una constante de
La sangre qumicamente est constituida por sustancias 3.3 y se obtiene el nmero en millones por milmetro
orgnicas e inorgnicas. cbico.
Ejm: Hcto= 50 Nmero de eritrocitos 50 + 3.3 = 53.3 y
Entre las Sustancias Orgnicas: encontramos: Prote- en millones 5'300.000
nas (albminas, globulinas, nmunoglobullnas). Carbohi-
dratos o azcares simples como la glucosa y azcares El Hematocrito (Hcto) se obtiene, tomando sangre en un
compuestos como el glucgeno. Lipidos o grasas en tubo capilar o microcapilar con anticoagulante. Se le
forma de triglicridos, cidos grasos y glicerol. centrifuga a 10.000 rpm por 5 a 10 minutos y se lee en
98

p o r c e n t a j e , e n t r e el p l a s m a s a n g u n e o y la m a s a de c o r p u s c u l a r m e d i o ( V C M ) , r e c u e n t o d e eritrocitos, l e u c o -
eritrocitos p r e s e n t e . citos y p l a q u e t a s . A d e m s , e n t r e g a i n f o m i a c i n s o b r e la
d i s p e r s i n d e l t a m a o d e los eritrocitos ( R D W ) (Red
Procedimiento; blood cell distribution width), el q u e s e e x p r e s a e n % y
1. O b t e n c i n d e la m u e s t r a r e p r e s e n t a el c o e f i c i e n t e d e v a r i a c i n d e t a m a o s d e los
eritrocitos.
a. O b t e n g a s a n g r e d i r e c t a m e n t e del p u l p e j o del d e d o ,
o d e l l b u l o d e la o r e j a . IVIediante u n a p u n c i n c o n
E n el h e m o g r a m a s e a n a l i z a t a m b i n el frotis s a n g u n e o
l a n c e t a s a n g u n e a . P r e v i a m e n t e e s t e r i l i c e el sitio
q u e c o n s i s t e e n la e v a l u a c i n m o r f o l g i c a d e los e l e -
d e la p u n c i n c o n a l c o h o l y o d a d o
m e n t o s s a n g u n e o s , lo c u a l p u e d e s e r e s p e c i a l m e n t e til
b. Puede obtener de un tubo de recoleccin de s a n -
e n los p a c i e n t e s c o n a n e m i a , pero t a m b i n a n o r m a l i d a -
g r e c o n a n t i c o a g u l a n t e , el v a l o r p u e d e v a r i a r por la
d e s e n los l e u c o c i t o s o p l a q u e t a s p u e d e n s e r d e o r i e n t a -
cantidad de anticoagulante usado
c i n d i a g n s t i c a . La v e l o c i d a d d e S e d i m e n t a c i n g l o b u -
lar e s otro valor, q u e v a p e r d i e n d o i m p o r t a n c i a d i a g n s -
2. Llenado del microcapilar heparinizado o tubo de
tica, p e r o q u e e n a l g u n o s c a s o s e s u n v a l o r d e t e r m i n a n -
Wintrobe
te.

a. R e c o j a la s a n g r e e n el m i c r o c a p i l a r , h a s t a las %
p a r t e s del t u b o . O e n un t u b o d e W i n t r o b e , l l e n a n d o Valores de hematocrito y liemoglobina
el t u b o h a s t a d o n d e m a r c a 1 0 0 / 1 0 0
b. Cierre el m i c r o c a p i l a r e n u n o d e s u s e x t r e m o s , c o n
L o s v a l o r e s H c t o y H b s e r e l a c i o n a n al n m e r o y c a n t i -
plastilina. L o p u e d e realizar m e d i a n t e f l a m e a d o a la
d a d d e Hb d e los eritrocitos. C u a n d o e s t o s v a l o r e s e s t n
l l a m a , p e r o n e c e s i t a d e m a y o r c u i d a d o para n o c a -
disminuidos en m s de 2 DS respecto al promedio,
lentar o h e m o l l z a r la s a n g r e .
s e g n la e d a d , s e h a b l a d e a n e m i a (tabla 1). Si el H c t o y
la H b e s t n a u m e n t a d o s s e h a b l a d e la p o l i c i t e m i a , q u e
3. C e n t r i f u g a c i n
p u e d e s e r primaria (policitemia v e r a ) o s e c u n d a r i a ( e n -
fermedad cardiaca, ciantica, tumores cerebrales, rena-
a. Centrifugue en una micro centrifuga a 10.000 rpm
les, etc.).
por 3 a 5 minutos. T e n g a cuidado de no pasar este
t i e m p o o d e d i s m i n u i r el t i e m p o d e e s t e p r o c e d i -
miento. Tabla 1
b. Si s e t r a t a d e un t u b o d e W i n t r o b e u otro t i p o d e V a l o r e s d e h e m o g l o b i n a y h e m a t o c r i t o e n la i n f a n c i a
t u b o , lleve a c e n t r i f u g a r a 1 0 . 0 0 0 r p m y por el m i s - Edad Hcto Criterio H b g/dl Criterio
mo lapso de tiempo. diagns- Prome- diagns-
tico de dio 2 tico d e
4 . L e c t u r a del p r o c e d i m i e n t o a n e m i a (> DE a n e m i a (>
a. D e b e O b t e n e r la l e c t u r a e n f o r m a p o r c e n t u a l , y a 2DE) 2DE)
s e a m e d i a n t e una regleta p r e e s t a b l e c i d a o u n a RN 45 a ^45 17 2 ^ 15
e l a b o r a d a por u s t e d 2 m - 3 m 65 <30 11 1,5 <9,5
b. E n los t u b o s d e W i n t r o b e , lea la c a n t i d a d d e g l b u - Prematu- 30 a <35 92 <7,0
los rojos e n f o r m a d i r e c t a , d e p e n d i e n d o h a s t a q u e ro 40 <40 12,5 < 11,0
m a r c a lleg los eritrocitos 5m-2 35 a 1,5 < 11,0
aos 45 12,5 < 11,5
Interpretacin de los resultados Preesco- 40 a 1,5 < 12,0
lar 45 13 1 , 5 < 12,5
L o s v a l o r e s o b t e n i d o s s o n d i f e r e n t e s , d e p e n d i e n d o si el Escolar 5 Cifras 13,5
e s t u d i o s e realiza e n i n d i v i d u o s q u e v i v e n e n la c o s t a a - 9 aos de 1,5
nivel del m a r , o e n i n d i v i d u o s q u e v i v e n e n la sierra e n Escolar 9 adul- 14,0
las alturas. T a m b i n e s d i f e r e n t e si el e s t u d i o e s e n un -12 a o s tos 1,5
hombre o una mujer Id. 1 2 -
14 a o s Cifras
E n un e s t u d i o r e a l i z a d o por C a i z a r e s y B e z e n el a o de
d e 1980 e n c o n t r a m o s v a l o r e s d e m i c r o h e m a t o c r i t o en la adultos
c i u d a d d e Q u i t o a 2 8 3 0 m s o b r e el nivel d e l m a r , en las
siguientes cifras: R o l d e l VCIVI, R D W y r e c u e n t o d e r e t i c u l o c i t o s e n la
evaluacin de las a n e m i a s
Hombres: Hcto. 46.3 a 52.6 con
una media de 49.4
L o s s i g n o s y s n t o m a s o b t e n i d o s e n la historia clnica,
m e d i a n t e la a n a m n e s i s y el e x a m e n f s i c o e n un p o s i b l e
Mujeres: Hcto. 40.7 a 47.0 con
paciente con anemia no sern tratados en esta revisin.
una media de 43.8
A c n o s r e f e r i r e m o s a c m o los d i f e r e n t e s v a l o r e s del
h e m o g r a m a nos pueden orientar a un posible diagnsti-
c o . El V C M ( v o l u m e n c o r p u s c u l a r m e d i o ) y R D W ( c o n t a -
el nivel d e h e m a t o c r i t o a nivel del m a r e s : je d e g l b u l o s r o j o s ) , n o s e n t r e g a n i n f o n n a c i n s o b r e el
t a m a o y d i s p e r s i n del t a m a o d e los g l b u l o s rojos
Hombres: Hcto. 47 ( G R ) . E n el n i o el V C M , es m e n o r q u e e n el a d u l t o
Mujeres: Hcto. 42 (tabla 2) y e n un nio c o n a n e m i a , el t a m a o d e los G R
p u e d e s e r n o r m a l , p e q u e o o a u m e n t a d o y la d i s p e r s i n
del t a m a o ( R D W ) , p u e d e e s t a r n o r m a l o a u m e n t a d a
El h e m o g r a m a o b i o m e t r a h e m t i c a e s un e x a m e n ( r a n g o n o r m a l en nio R D W = 11,5 - 1 4 , 5 % ) .
r e l a t i v a m e n t e s i m p l e , a y u d a e n la e v a l u a c i n d i a g n s t i -
c a d e los p a c i e n t e s , y d e t e r m i n a v a l o r e s n o r m a l e s e n
personas que consideramos sanas. Este e x a m e n (he- Tabla 2
m o g r a m a ) entrega datos sobre hematocrito (Hcto), A p r o x i m a c i n d i a g n s t i c a d e las a n e m i a s b a s a d a s e n
c o n c e n t r a c i n d e la h e m o g l o b i n a ( H b ) , c o n c e n t r a c i n d e V C M del g l b u l o rojo y frotis s a n g u n e o
hemoglobina corpuscular media (CHCM), volumen
99

Microcti- Macrocitico Mormocf- Alteracio- Recin Naci-


co Mco nes do a trmino
1 a 7 dias 102 34 +/- 5 330 +/- 25
hlpocro- normo- morfolgi-
< 3 mesei
Nios > 1 ao
""978
51 +/-
T r8e " 30 +/- 4
'" 3 3 0 + / -
330 +/-
30
25
mo cromo cas
Nios entre 1 85+/-8 27 +/- 3 330 +/- 25
Anemia por Anemia Prdida Esferoettos
y 12aiios
dficit de megalobls- Ag. sangre
Mujeres no 88 +/- 8 30 +/- 3 340 +/- 25
Hierro tica
Ovalocitos embarazadas
Infecciones Varones 90+/-8 30 +/- 3 340+/- 25
Talasemla Arjemia
Esfomato-
aplstica
fniamacio- citos
Anemia nes Crni- Cmo Obtener valores de HCM
stderobfs- Leucemia cas
Cl.fald- La HCM se obtiene relacionando la cantidad de hemo-
tica
formes globina g/l, sobre el nmero de eritrocitos (x10'^/l)
Drogas Enf. rena-
Intoxica- les crni- Cmo obtener la CCMH
Esquistoci-
cin por Pb cas
tos
La CCMH Se obtiene comparando la cantidad d4lb con
Enf. malig- la cantidad de Hcto
nas
Obtener el VCM, HCM y CCMH en un paciente con 14
g de Hb y 4'500.000 de eritrocitos y Hcto de 42

V A L O R E S HEMATIMTRICOS O ERITROCITARIOS Tabla 4


Se basan en clculos matemticos manuales depen- Aproximacin diagnstica basada en el recuento reticu-
diendo del Hcto, determinacin de la cantidad de Hb y locitario
recuento eritrocitario. Y son: VCM (Volumen Corpuscular
medio) que se mide en micrmetros cbicos. HCM
(Hemoglobina corpuscular media) medido en pg y la Reticutocitos aumentados Reticiiocttos nomiiaies o
CCMH (concentracin corpuscular media de hemoglobi- disminuidos
na) medida en gramos por micrmetros cbicos. I. . Anemias hemolticas Dficit nutrientes
a. Corpuscular infecciones inflamacio-
nes crnicas
Cmo Obtener el VCM (VOLUMEN C O R P U S C U L A R
Enfennedades crnicas
MEDIO) Defectos de membrana
Invasin medular
Alteraciones enztmticas
Para obtener este valor es necesario conocer el valor
del volumen de glbulos rojos aglomerados en mi por
1000 mi de sangre y la cantidad de glbulos rojos en Hemogtobinopatas
mililitros por milmetro cbico.
Ejemplo obtener el VCM siendo el Hcto 45 y el contaje b. Extracorpusoular:
de glbulos rojos 4'800.000

Test Coombs (+) (-)


45 X 1000
VCM = = 93.75 I. Hemorragias agudas

4'8*10
El recuento de reticulocitos mide la produccin de eritro-
citos, lo que es importante en la evaluacin de una
anemia (tabla 4). El recuento de reticulocitos se afecta
por la vida media de los reticulocitos y la intensidad de la
anemia por lo que se usa el ndice reticulocitario, que
La determinacin del nmero de eritrocitos en forma corrige los valores segn la intensidad de la anemia. La
manual tiene un ndice de error de hasta el 20%, por ello vida media de los reticulocitos vara de 1 da con Hoto
la mejor manera de contar los eritrocitos es mediante normal, a 2,5 das con Hcto 15%. Para calcular el ndice
contadores automticos. reticulocitario se utiliza la siguiente frmula:
En 1956 Wallace Coulter descubri el principio de la
electroconductividad para el recuento rpido y fiable de % reticulocitos x (Hcto paciente/Hcto normal)
clulas sanguneas en suspensin. Gracias a ello los IR = . .
ndices eritrocitarios son hoy da suministrados por la Factor de correccin
gran mayora de autoanalizadores hematolgicos y los
valores normales varan ligeramente con la edad pero
no con el sexo. Ver la siguiente tabla.
Hcto normal IR: Indice reticulocitario Factor de correc-
cin segn Hcto: 45% = 1 ; 25% = 2; 35% =1,5; 15% =
Tabla No 3 2,5 Se considera un ndice regenerativo mayor o igual a
VALORES NORMALES DE LOS NDICES ERITROCI- 3
TARIOS AUTOMATIZADOS

COMPOSICIN QUIMICA DE LA SANGRE Y GLBU-


VCy<m HtM(pg) CCUH LOS ROJOS
SANGRE PLASMA GLBULOS
100

ROJOS componente normal en pequeas cantidades o tener


CJncefttracin en gram por 100 mi cifras altas anormales por destruccin de eritrocitos,
Agua 78.0 90.7 64.0 fenmeno que se conoce con el nombre de tiemlisis. El
Slidos 22.0 9.3 36.0 color puede variar a blanquecino lechoso por la presen-
Sales Org- 21.2 8.5 35.0 cia de quilomicrones o por grasas, fenmeno que se
nicas observa en individuos despus de la digestin de ali-
Protena 18.5 7.2 30.0 mentos en la etapa postprandial temprana o en caso de
hiperlipidemias.
total
Albmina 2.5 4.7

suero OPACIDAD
Globulina 1.38 2.5
suero Depende de la integridad de los eritrocitos, ya que estos


Fibringeno 0.25 0.30 cuando estn completos suelen reflejar la luz, y se
Hemoglobina 15.0 (13- 34.0 denomina sangre opaca. Cuando los eritrocitos estn
17) destruidos, la sangre se vuelve transparente y se habla
Nitrgeno de sangre lacada.
Total
Concentracin en gramos por 100 mi DENSIDAD
Nitrgeno no
proteico La densidad de los eritrocitos suele ser mayor a 1.093
(1.090 - 1.100) y la del plasma sanguneo en 1.024
Agua 78.0 90.7 64.0 (1.023 - 1.032). Cuando se deja la sangre en reposo
esta suele sedimentar. La densidad de la sangre total
depende de la concentracin eritrocitaria y por ello es
mayor en el hombre. 1.059 mientras que en la mujer es
CONCENTRACIN EN mg POR 100 mt
de 1.052. La densidad tambin depende de la concen-
Nitrgeno no 33.00 25.00 44.00 tracin de protenas y por este motivo, es una prueba
proteteo sencilla para medir variaciones de concentraciones
Nitrgeno de 12.00 12a 15 11.00
protenicas disminuidas, como en individuos con hipo-
Urea
proteinemias en caso de quemaduras o presencia de
H de amino- 5.6 4.5 7.4 shock.
cidos
o determina- 13.00 3.00 25.00
do
VISCOSIDAD
Urea 20.00 a 26.00 20.00
35.00
Se puede medir con el viscmetro de Hess y se lo com-
cido rico 2.00 3.00 2.00
para con la densidad del agua. En el hombre es igual a
Creatinina 1.1 1.3 0.7
4.7 (4.3 a 5.3). En la mujer es Igual a 4.4 ( 3.8 a 4.8). L a
Fenoles 1.6 1.7 1.5
viscosidad depende del frotamiento interno de sus part-
Bilirrubinas 0.6
culas, en la sangre la viscosidad depende directamente
Glucosa 70.00 80.00 65.00
de la concentracin de eritrocitos.
cido lctico 6.00 8.00 5.00
cidos grasos 360.00 370.00 340.00
PRESIN OSMTICA
Lecitina 300.00 200.00 400.00
Golesterol 200.00 180.00 200.00
Hablar de presin osmtica de la sangre es importante,
Cuerpos 2.00 nos permite comprender el paso de sustancias desde un
cetnicos compartimento a otro, por ejemplo el paso del agua y
espacio intravascular al intersticial y
COMPONENTES INORGANICOS DEL PLASMA, EN mg MMsmbtB al intr icelular.
Na K Ca Mg 01 Fe Cu Na CO2 Cl
'Para descriWP k que es presin osmtica, hablemos
Plasma 330 17 10 365 3.5 0.12 0.10 ^imeSQ de \i^e es la Osmosis.
Clulas 46 410 1 185 100 En la osmosis ce nsideremos tres elementos importan-
Samgre 190 200 5.6 3 280 50 0.14 tes: 480
a) soluto,
b) solvente, y
La composicin qumica de la sangre difiere, depen- c) membrana celular
diendo si se toma sangre arterial o sangre venosa. Es
mejor tomar las muestras para estudio qumico la sangre Osmosis es el paso del solvente (agua), desde un sitio
arterial, ya que la sangre venosa suele salir modificada y de menor concentracin a otro de mayor concentracin,
depende del metabolismo del rgano y por las funciones y a travs de la membrana celular.
que le son propias
La presin osmtica: es la fuerza (o cantidad de agua
PROPIEDADES FISICAS DE LA SANGRE que pasa de un sitio a otro), de arrastre del solvente
conjuntamente con cristaloides, desde un sitio de menor
COLOR: concentracin a otro de mayor concentracin, pero
El color de la sangre depende directamente de la hemo- siempre a travs de la membrana celular. Ejemplo: Si
globina. En la sangre arterial oxigenada es rojo escarla- existen dos soluciones en concentraciones diferentes,
ta, mientras que la venosa menos oxigenada, es dicroica en un medio A y otro B pero separadas por una mem-
o rojo negruzca. En algunos casos el color puede cam- brana celular u otra que haga sus veces con concentra-
biar por la presencia de algn melabolito en la sangre ciones distintas de cloruro de sodio, al 5% y 10%, las
como la metahemoglobina, etc. soluciones no se quedan estticas sino que tienden a
igualarse.
El plasma sanguneo es de color ligeramente amarillen- Para ello es fcil suponer que el cloruro de sodio atrave-
to, pero depende de la cantidad de bilirmbina o en oca- sar la membrana celular para igualar las concentracio-
siones, de la cantidad de hemoglobina, la que puede ser nes, pero el cloruro no tiene la misma facilidad que el
101

agua para atravesar la membrana celular y es ms fcil igual que los eritrocitos; la disminucin de hemoglobi-
que sea el agua la que al pasar desde el sitio A de na y/o eritrocitos, se denomina anemia.
menor concentracin al compartimento B de mayor
concentracin, as diluye la solucin y equipara las
distintas fuerza que ejercen las soluciones distintas. ERITROCITOS HEMATES O GLOBULOS ROJOS
CARACTERSTICAS
clula
Los eritrocitos (eritros, rojo) se denominan tambin
glbulos rojos o hemates, son clulas anucleadas
presentes en la sangre de los mamferos, tienen la
Cl Na 0.1 % forma de discos bicncavos y su funcin es la de conte-
ner hemoglobina para transportar oxgeno desde los
pulmones hasta las clulas de todo el organismo, tam-
paso del agua, desde fuera de la clula al interior de la bin transportan el anhdrido carbnico, producto del
misma. metabolismo celular, desde.las clulas hasta los pulmo-
nes, para ser eliminados al exterior. Los hemates con-
tienen varias enzimas, imprescindibles para mantener
LAS CLULAS DE LA S A N G R E un metabolismo celular mnimo.

Los eritrocitos son clulas que carecen de ncleo, pero


Las clulas de la sangre son: A. Eritrocitos o hemates o
esta situacin presenta en la etapa adulta, pues las
glbulos rojos B. Leucocitos o glbulos blancos C.
clulas jvenes o eritroblastos son clulas que si poseen
Plaquetas o trombocitos
ncleo, mientras permanecen en la mdula sea.

La prdida del ncleo se debe a que es una clula que


alcanza un alto grado de diferenciacin celular, que
necesita probablemente el espacio para ocupario con
hemoglobina, tambin porque si mantuviera el ncleo no
podra adoptar la forma de disco bicncavo, forma im-
portante que le permite deformarse y recuperar su forma
original al pasar por la microcirculacin.

Tamao de los eritrocitos

Los eritrocitos tienen un dimetro de 7.2 micrmetros.


Las clulas que tiene un dimetro menor a 6 micrme-
tros se denominan microcitos. Las clulas que tienen
entro O y 12 miormciroo o c denominan maorootoo.
Entre 6,5 micrmetros y 7,7 micrmetros la clula se
denomina nomnocito.
L O S ERITROCITOS
Forma de los eritrocitos
L o s eritrocitos llamados tambin hemates o glbulos
rojos son clulas de la sangre y tienen como funcin
La forma nomnal de un eritrocito es como un disco bi-
importante el transporte del Oxgeno desde los pulmo-
cncavo, cualquier alteracin de la forma interrumpe la
nes hacia todas las clulas del organismo. Todas las
propiedad de atravesar la microcirculacin. El glbulo
clulas del cuerpo y sin exclusin, necesitan de nutrien-
rojo puede deformarse gracias a que la hemoglobina
tes y Oxgeno para cumplir con su metabolismo, mante-
que tiene, acta como una masa gelatinosa que le
nerse con vida y poder reproducirse, si no hay Oxgeno
permite recuperar la forma luego que ha pasado la
la clula muere.
microcirculacin.
Los eritrocitos son clulas que tienen la forma de un
Cualquier defecto de la hemoglobina, de las enzimas o
disco bicncavo, con un tamao de 7.2 micrmetros +/-
de la membrana celular produce alteraciones de la
0.5 micrmetros. En su estado adulto y cuando estn
forma y de la funcin y termina presentando una imagen
circulando en el torrente sanguneo no presentan n-
anormal como en la drepanocitosls, talasemias, esferoci-
cleo, pero si tienen ncleo cuando estn en formacin
tosis, deficiencia de 6-fosfato deshidrogenasa, etc.
en la mdula sea.
Al entrar a la circulacin sangunea, por diapdesis
Membrana del eritrocito:
atravesando los sinusoides, el eritrocito pierde el ncleo.
Es la responsable de la forma discoide del glbulo rojo,
Se encuentran entre 4.5 millones y 5.5 millones de
y adems en condiciones normales, mantiene la elasti-
glbulos rojos por cada mililitro de sangre. La cantidad
cidad y deformabilidad. La membrana celular eritrocitaria
vara dependiendo el sexo (gnero), la edad y la altura
es igual a otras membranas celulares ya descritas,
sobre el nivel del mar en la que viven los individuos
constituidas por lpidos (fosfolpidos, colesterol, glucol-
(A mayor altura, hay disminucin de la presin atmosf-
pidos), protenas (intrnsecas, extrnsecas, glucoprote-
rica y consecuentemente, de la presin parcial de Ox-
nas) y carbohidratos (cadenas de oligosacridos).
geno, lo que se compensa con un aumento de los eritro-
Los lpidos constituyen el 40 % del peso en seco de la
citos) en las alturas, para que las clulas reciba la mis-
membrana y las protenas el 52 %, el resto lo formaran
ma cantidad de Oxgeno sin importar el sexo, la edad o
los carbohidratos. .Los fosfolpidos forman una doble
la altura a que se habita.
capa, en donde se hallan inmersas unas cuantas prote-
nas llamadas extrnsecas o transmembranosas, al lado
Los hemates estn llenos de hemoglobina que es una interno de la membrana celular se presentan protenas
protena compleja con un ncleo de Hierro, que es la fibrilares que constituyen el esqueleto de la membrana
que verdaderamente transporta el Oxgeno, la cantidad como son: la espectrina, actina (protena 5), ankirina y
de hemoglobina en un individuo es de 14 a 16 g por otras.
cada 100 mi de sangre, estas cifras pueden variar al
102
Hemoglobina: Aproximacin diagnstica de las anemias basadas en VCM del
glbulo rojo y frotis sanguneo
La hemoglobina (Hb) es la protena ms abundante del
eritrocito e interviene en la captacin y transporte del
Oxgeno. Microctlco Macrodtico Norinoctico Alteraciones
hipocromo normocromo morfolgicas
Estructuralmente la hemoglobina est formada por 4
subunidades proteicas llamadas globinas, con un grupo Anemia por Anemia Prdida Ag. Esferocitos
hem en cada una de ellas, en la regin central delimitan dficit de megaloblstica sangre
Hierro
un espacio para el 2,3, difosfoglicerato, metabolito im-
Ovalocitos
portante para su funcin. Anemia Infecciones
Talasemia aplstica
La hemoglobina est formada de 4 cadenas polipeptdi- Estomatocitos
cas formando un tetrmero, 2 cadenas alfa y 2 cadenas Inflamaciones
beta, cada una de las cuales tiene un grupo hem unido. Anemia Leucemia Crnicas Cl. falcifor-
La cadena alfa posee 141 aminocidos y la beta 146 y sideroblstica mes
como en la actualidad se conoce el orden de cada uno Drogas Enf. renales
de los aminocidos, ha sido posible descubrir cualquier Intoxicacin crnicas Esquistocitos
sustitucin o cambio en el orden de las molculas, porPb
permitiendo distinguir a las hemoglobinas alteradas
como en el caso de las drepanocitosis, las talasemias, Enf. malignas
etc. VCMx7^^
R N = 119 4 m-2 aos = 77; 2 a - 6 aos = 80; 6 a - 12 aos =
La hemoglobina al igual que el hematocrito difiere en 856 a - 12 aos = 85; Adulto =^90
los hombres y las mujeres, y tambin es diferente la
cantidad si el individuo vive a nivel del mar o en las
alturas. Los valores de hemoglobina encontrados en un
estudio de hemoglobina en la ciudad de Quito a 2830
metros sobre el nivel del mar fueron:
CUESTIONARIO PARA L A PROXIMA C L A S E DE
LABORATORIO.
hemoglobina a 2830 metros sobre el nivel del mar en la
ciudad de Quito
Por qu los eritrocitos humanos y de mamferos
Hombres: 16.1 g por 100 mi de sangre (14.9 -
17.2) carece de ncleo?
Qu significado tiene encontrar eritrocitos nuclea-
Mujeres : 14.2 g por 100 mi de sangre (13.0 -
15.1)... dos en sangre perifrica?
3. Qu significado tiene encontrar eritrocitos hipo-
crmicos?
Cul es el significado de encontrar microcitos
Hemoglobina a nivel del mar
hipocrmicos en sangre perifrica?
Hombres: 15.4 g en 100 mi de sangre
Qu significa la presencia de macrocitos?
Qu tipo de alteraciones en la forma se observa
Mujeres: 13.8 g en 100 mi de sangre
en los eritrocitos?
A qu se denomina Poiquilocitosis?
Funcin de los eritrocitos: A qu se denomina anisocitosis?
Cul es el valor de hematocrito y hemoglobina en
Los eritrocitos tienen una funcin importante, el trans- Quito
porte de oxigeno desde los alvolos pulmonares hasta 10. Haga los dibujos y las explicaciones de sus obser-
las clulas de todos los tejidos, y el transporte del bixi- vaciones al microscopio.
do de carbono desde las clulas de los tejidos hasta los
alvolos pulmonares. El transporte de oxgeno se realiza
gracias a la presencia de la hemoglobina que est ence-
rrada dentro de los eritrocitos.

Perodo de vida de los eritrocitos:

Los eritrocitos viven aproximadamente 3 a 4 meses


(entre 80 y 120 das). Nacen en los rganos hemafopo-
yticos localizados en la mdula roja sea. Inicialmente
se denominan eritroblastos y son clulas con ncleo,
pero al madurar las clulas paulatinamente van perdien-
do la capacidad de realizar mitosis, y tambin pierden el
ncleo. Cuando el organismo las requiere, atraviesan las
sinusoides de la mdula y van a la circulacin general
en el ton-ente sanguneo. Las clulas jvenes que recin
empiezan a circular se conocen con el nombre de reticu-
locitos. Se reconoce a los reticulocitos con coloracin de
azul de cresilo brillante. Estos se presentan con residuos
de RNA que le dan la apariencia de una red
103

PRACTICA DE LABORATORIO No DIEZ.

TEMA: DETERMINACIN DE G R U P O S SANGUNEOS: SISTEMAS ABO Y RH.

Objetivo de la prctica:

a) Tipificar y encontrar los diferentes tipos de grupos san-


guneos en los alumnos.
b) Iniciar el estudio inmunolgico y comprender a travs de
la prctica, la afinidad o diferencia entre los grupos san-
guneos.
c) Comprender la importancia de saber el grupo sanguneo
Anti A AntiB
y el factor Rh.
d) Hacer investigacin y estadstica de los resultados obte-
nidos en el laboratorio.

Materiales:

1. Placas portaobjetos y cubreobjetos.


2. Lancetas sanguneas.
3. Mondadientes o palillos de dientes.
4. Torundas de alcohol yodado. Anti D
5. Reactivo para determinacin de grupos sanguneos: anti
A, anti B, anti D. E) Mezcle las dos gotas (sangre y reactivo) ayudado de un
mondadientes. No use mondadientes sucios o ya utiliza-
dos.
F) Espere unos segundos para leer la reaccin. Haga lige-
ros movimientos de rotacin o de vaivn con las placas
sobre todo en la placa con el reactivo anti D.
G) Lea el resultado de la reaccin: Si hay aglutinacin es
positivo, si no hay aglutinacin el resultado es negativo.
H) Escriba el resultado obtenido.

INTERPRETACIN DE LA PRCTICA.

G R U P O S SANGUNEOS

La determinacin de los grupos sanguneos es muy importan-


te en medicina, sobre todo cuando se quiere realizar transfu-
siones sanguneas.

Las transfusiones se iniciaron en la mitad del siglo XVII. Lower


transfundi sangre de cordero a individuos e increblemente
Procedimiento: tuvo xito, al punto que Denis lo utiliz en un paciente para
tratar la locura, el paciente en su primera transfusin no pre-
A) Esterilice el pulpejo del dedo con una torunda de algodn sent reaccin, pero luego produjo una hemolisis mortal y
empapado en alcohol yodo. Denis fue acusado de homicidio pero se le declar inocente
B) Pinche el dedo con la lanceta sangunea o con una aguja luego de un largo juicio. Obviamente a la luz de los conoci-
hipodrmica. mientos actuales es "una locura" realizar tal procedimiento. El
C) Descarte las dos primeras gotas de sangre y las prxi- parlamento ingls y una bula papal prohibieron las transfusio-
mas coloque en 2 placas portaobjetos de acuerdo con el nes.
siguiente esquema:
150 aos ms tarde James Blundell haba utilizado transfusio-
nes sanguneas en 10 pacientes con sangrado importante
posparto y tuvo xito en 5 ocasiones. Al ao de 1875 se ha-
ban realizado 347 transfusiones. **""

En 1900 se inician las transfusiones sanguneas con xito y


con sustento cientfico cuando Landsteiner descubre la pre-
sencia de sustancias isoaglutinantes e isoaglutinables.

En 1936 se funda en Estados Unidos el primer Banco de


Sangre ante la necesidad de transfusiones sanguneas. En la
actualidad constituye un procedimiento mdico utilizable,
aunque siempre habr de hacerte, cuando la vida del pa-
ciente est en riesgo y con todos los cuidados necesarios, se
podr utilizar las transfusiones sanguneas para reemplazar
una hemorragia severa en la que el individuo no la puede
Sobre las golas de sangre, coloque los reactivos para la reemplazar. Considere a una transfusin sangunea como un
D)
determinacin de grupos y factor Rh. Reactivo azul es riesgo que podra poner en peligro la vida o adquirir ciertas
anti A, reactivo amarillo es anti B, reactivo blanco es anti enfermedades como hepatitis. Sida, sfilis y muchas otras
D. enfermedades.

En la actualidad se obtiene de la sangre muchos subproductos


que con conocimientos cientficos es posible su utilizacin y
104

obtener el beneficio para el paciente, as por ejemplo se pue- pero al momento del nacimiento los receptores no estn ma-
den aislar y transfundir factores de coagulacin. duros, y van en aumento hasta los 12 a 24 meses.

Las inmunoglobulinas A y B se encuentra en los eritrocitos, en


las membranas de muchas clulas del organismo, adems en
el 80% de personas denominadas "segregantes" se localizan
en el plasma sanguneo, en la secrecin de glndulas exocri-
nas, en la saliva, jugo gstrico, lgrimas, tambin se puede
determinar en orina, bilis, leche y esperma.

Anticuerpos de los antgenos A y B

En el plasma sanguneo de un individuo de grupo sanguneo A


hay una aglutinina Beta que se une a los glbulos rojos B, en
el plasma sanguneo de individuos de glbulos rojos B hay
una aglutinina alfa que al unirse con los eritrocitos A produce
hemolisis. En los individuos AB no hay aglutininas ni alfa ni
beta en el plasma sanguneo, pero los individuos O tienen en
el plasma sanguneo las aglutininas Alfa y Beta, por lo que se
debe tomar en cuenta este conocimiento para transfundir
sangre completa o simplemente suero.

El sistema ABO.

El sistema ABO, y el sistema Rh, son los ms importante en la


investigacin de los grupos sanguneos humanos.
Beta Alfa ,alfa y beta
En la membrana de los glbulos rojos, hay alfa-2 globulinas /
que son lipoprotenas que actan como sitios antlgnicos,
cuando se los inyecta a una persona de otro tipo sanguneo.

Se calcula que hay por lo menos 800.000 a 7 millones de


receptores en el sistema ABO. Los individuos que tienen un
tipo de lipoprotenas (alfa-2-gobulinas) se califican como del Plasma
tipo A, otros tienen lipoprotenas diferentes y se califican como
B, algunos individuos tienen los dos tipos de lipoprotenas y se
califican como B, aquellos individuos que sus eritrocitos no
presentan ningn tipo de lipoprotenas son de grupo sangu-
neo O.
GlbulosI
La determinacin del grupo sanguneo est definida por dos Rojos
genes aleles, el uno proviene del padre y el otro de la madre,
es decir la madre puede transmitir el gen A, y el padre tambin
el gen A; el hijo ser AA. Si la madre transfiere el gen A y el
padre el gen B el hijo ser AB. Si la madre y el padre no trans-
fieren ni A ni B, el hijo ser de grupo sanguneo 0 0 AB

De acuerdo con la presencia y herencia de estos genes los


grupos sanguneos pueden ser: EL SISTEMA RHESUS O Rh
Son eritrocitos que tienen un antgeno de membrana, que
aglutina con un anticuerpo preparado en suero de conejo,
Gentica de grupos sanguneos: cuando a ste animal se le inyecta eritrocitos de mono Rhe-
sus. El 80 % de la poblacin humana, reacciona con este
Gen del B 0 anticuerpo, y se denomina Rh positivo, el 20 % restante no
padre presenta aglutinacin y se denomina Rh negativo.
Gen de la
madre En la actualidad se ha descubierto que el sistema Rh est
A AA AB AO dado por 5 antgenos principales, serolgicamente comproba-
bles. Que son denominados como: D, C, c, E, e.
AB BB BO Igual que en la determinacin de grupos sanguneos ABO, se
B
usan reactivos que son el anti D, anti G, anti c, anti E, antl e.
No se ha encontrado el antgeno anti d y se lo considera ms
O AO BO OO
bien como ausencia del antgeno en la membrana del eritroci-
to.
En la prctica de laboratorio, solo usados el reactivo antl D. La
reaccin con este reactivo determina si el individuo es Rh
Fenotipos de acuerdo al cdigo gentico:
positivo. SI no hay reaccin el individuo es Rh negativo y
deber completar su investigacin en un centro especializado.
Genotipos Fenotipos
Las caractersticas del sistema Rh, se transmiten como "com-
AA, AO A
binantes" de acuerdo con las leyes de Mendel. Los genes que
BB, BO B determinan el carcter de los antgenos se encuentran estre-
AB AB chamente agrupados y localizados en un cromosoma. Se
OO O supone que existen 3 sitios o locus diferentes para el sistema
Rh, segn otra teora habran un locus con 2 o 3 sitios antlg-
Los antgenos se encuentran en la membrana del eritrocito y nicos comprobables as: DCE, DCe, DcE, Dce, dce, dCe, dcE,
se los puede reconocer a partir del tercer mes de embarazo,
105

dCE (recuerde que el d no es comprobable y solo indica au- trocitos, en 1947 se descubri el antgeno S y en 1951 el
sencia.) antgeno s. Estos antgenos son lbiles al tratamiento de
Gentica del sistema Rh eritrocitos con fennentos proteolticos, no se secretan en
secreciones como el caso de los antgenos del sistema
ABO. La transmisin gentica es independiente de los
otros grupos sanguneos y estn sujetas a las leyes de
Mendel, transmitindose los genes M o N y S o s e n for-
ma combinante. Su determinacin se realiza con antisue-
ros anti M, anti N, anti S y anti s.

C t 1 t

Completar el cdigo gentico posible. Pinte cada uno de los - -i.


- rr IS-IMO
1 Kf
casilleros, con rojo si es Rh positivo y con azul si es Rh nega- eD*/eD* M . o,ou

tivo. - -f - + cdE;ed H't M n s

-_ - - rn"

Los antgenos D, C, E, son dominantes, y los antgenos c, e, + + cDE/cOC n,m.

son recesivos; el antgeno d no existe solo significa ausencia. -


+
1
+ - M3S3
K.R.
Ser Rh positivo cuando presenta cualquiera de los antigenos
--
+ + + +
+ + + + D*/cl - t.0<1t
dominantes D, C, o E.
- - .T144
+
Recuerde que en la prctica de laboratorio solo utilizamos -f f

el reactivo anti D.
+
- cD*/Cd M 1,0509
cdC/Cd* R-H- I.M34
+ - -
CdE/ft* .f .ooee

Genotpicamente un individuo presenta un alelo del padre y


otro alelo de la madre. As: DCE/DCE DCe/dce. Etc. El Rh
+
+
- ++ +-
+ COfl.'c&E
\n" t.woa

+ + + eDt/COE "A .0129


negativo, solo es aquel que presenta la siguiente estructura + + + CD;e4C .MU
genotpica: dce/dce.
+ + + + ^7i
+ ( 1 + n,t
Cuando un individuo Rh negativo, recibe sangre Rh positivo, + + + C4&e0 "A .OM
1 + _ Mmr
forma anticuerpos contra los antgenos presentes D, C, o E.
los mismos que desencadenan + +
+
t -- Cd/sDE
n-n.
M 0

- - -
lisis o destruccin de los glbulos rojos del receptor. Pueden + tjmr

taponarse los rones y desencadenar la muerte.


+ + _
- CD/tO

De igual manera si una mujer Rh negativa, se embaraza y el


+
+
-
_
+
+
-
+
+
<3>*/CDC
hijo en gestacin es Rh positivo; los glbulos rojos del nio m i . tJtM

sensibilizan a la madre y provocan la formacin de anticuer-


+
-_ 4- 9jwn
+ _ _ COf/CD A
pos anti Rh positivo. Los glbulos rojos del nio son afectados + - + CtKDK .0000

ya que los anticuerpos atraviesan la barrera placentaria y - 1 CdE/Cd* .Noa

uD*e
provocan lisis de los hemates del nio. Con ello se provoca la
TbllS: U>itifraid.lttTuimTignf>attnlurfer).
muerte del nio gestante. La madre despus del primer emba-
razo o despus de la sensibilizacin (mujer Rh negativa que
recibi sangre Rh positiva, en cualquier momento de su vida y 2. Sistema P. Descubierto en 1927, es un sistema muy
se sensibiliz) tendr tal carga de anticuerpos que ser impo- complejo, se han encontrado antgenos similares en el
sible un nuevo embarazo con un nio Rh positivo, no habr caso de Hidatidosis de ovejas y en algunos gusanos. Al
ningn problema si su prximo hijo es Rh negativo. momento del nacimiento este antgeno no es demostra-
La siguiente tabla, permite calificar el genotipo de los indivi- ble. Los antgenos del sistema P no se eliminan en se-
duos, dependiendo la reaccin con cada uno de los antisuero creciones y constituyen aglutininas "del fro". No son muy
importantes desde el punto de vista clnico, pero en
transfusiones incompatibles toma importancia por las
hemolisis que ocasiona.
DETERMINACIN DE GRUPOS SANGUNEOS:
3. Sistema Lewls. Se bas en el descubrimiento de un
Existen muchas otras determinaciones de antgenos en el anticuerpo en el suero de dos mujeres, de reaccin idn-
eritrocito, los mismos que solo los mencionaremos. tica en apariencia y que aglutinaban del 20% al 24% de
todas las pruebas sanguneas del grupo O. Dicho anti-
1. Sistema MNSs. El antgeno MN fue descubierto en 1927, cuerpo se denomin anti-Lewis (Le). Se encuentran tanto
ai realizar ensayos de inmunizacin en animales con eri- en los eritrocitos como en el plasma sanguneo y estn
relacionados con la capacidad de secrecin del antge-
Ge DCE DCe DcE Dce dce dCe dcE dCE nos del sistema ABO en exudados.
nes
DC DCE/ DCE/ DCE/ DCE DCE DCE DCE DCE/ 4. Sistema Kell. Este sistema tiene tres parejas de antge-
E DCE DCe DcE /Dce /dce /dCe /dcE dCE nos: anti Kell (K) y anti-Cellano (k), Anti-Penney (Kp"),
DC DCe/ DCe/ DCe/ DCe/ DCe DCe/ DCe/ DCe/ Anti-Rautenberg (Kp'') y Anti-Sutter (Ls* y Ls"). Los ant-
e DCE genos Sutter han sido encontrados exclusivamente en la
Do DcE/ DcE/ DcE/ DcE/ DcE DcE/ DcE/ DcE/ raza
E DCE 5. OTROS SISTEMAS DE negra. El sistema Kell est
De Dce/ Dce/ Dce/ Dce/ Dce Dce/ Dce/ Dce/ completamente determinado al momento del nacimiento
e DCE y se encuentran solo en los eritrocitos por lo que no se
dce dce/ dce/ dce/ dce/ dce/ dce/ dce/ dce/ encuentran en secreciones del organismo.
DCE dce 6. Sistema Duffy. Pueden ser causa de anemias hemolti-
DC dCe/ dCe/ dCe/ dCe/ dCe/ dCe/ dCe/ dCe/ cas en recin nacidos. Se encuentran antgenos en la
e DCE membrana de los eritrocitos Fy^ y Fy'' Estn completa-
dcE/ dcE/ dcE/ dcE/ mente formados al momento del nacimiento.
De dcE/ DcE/ dcE/ dcE/
E DCE 7. Sistema Lutheran. Son anfgenos muy raros Lu" y Lu""
DC dCE/ dCE/ dCE/ dCE/ dCE/ dCE/ dCE/ dCE/
E DCE
106

8. Sistema Kidd. Ei antgeno I K " y IK"" fue descubierto en


1953 al estudiarse la sangre de una madre que tuvo un
hijo con anemia hemoltica del recin nacido
9. Y otros factores sanguneos de presencia muy escasa o
muy frecuente. As muy frecuente como vel, Ge (Ger-
bich), Lan, co (Colton), Gy (Gregory). Etc.

CUESTIONARIO PARA LA PRXIlWA CLASE DE LABORA-


TORIO.

Cules fueron los resultados de grupos sanguneos


ABO y Rh entre sus compaeros de curso?
2. cul es la semejanza y/o diferencia con estadsticas de
grupos sanguneos en el Ecuador?.
3. Por qu en la determinacin del factor Rti solo se utiliza
i
el anti D?
4. Por qu solo es importante y peligroso que una mujer


Rh negativa se case con un hombre Rh positivo?
Hay la posibilidad de eritroblastosis fetal en caso de un
hombre Rh negativo casado con una mujer Rh positiva?
6. Cul es la utilidad en el conocimiento previo del grupo y
factor sanguneo?
7. Cul es la utilidad de la determinacin de grupo sangu-
neo para definir una paternidad?
Determine los antgenos en el grupo sanguneo ABO
9. Determine los antgenos en el factor Rh
10. Haga los dibujos y las explicaciones de lo realizado en el
laboratorioi

E T A B L. B C I

1 CMUUUa Ct>B

EXAMEN >uMVl.TADO

TromtwptMtliMi, timi>o pr. <TTP)


FtiiquBUui. rvuaa m.F1.> ...,^4K
HvniMKvUA (JHlctoi Grupo HrauIno fA.B.O.} . ....
Oi. . - ......_...-
HcmaUeii. rw:uato * - H. TwlerancJa m la fxnpwrtfM .
Hmaff. cwp. medi <HCM> Coomlx* directo ,.-,~..._
H 0 i n t i . cwc. corp. f n * d . <CHCaM> . OtwralM k K r t c t e .....
VfdHrnan cm^. n>*<IIi (VCM .
HHJctjloctUw , .
. tmpo A T. r-

C * I A C T C.WI,AJt*

1 8 MAY 19S.5
107

P R A C T I C A D E L A B O R A T O R I O No ONCE.

TEMA: OBSERVACIN D E LEUCOCITOS Y PLAQUETAS EN U N EXTENDIDO DE SANGRE PERIFRICA.


(3 e s u n a c o n s t a n t e ) .
O b j e t i v o d e la p r c t i c a :
8. Inicie la o b s e r v a c i n d e l e u c o c i t o s c o n u n N e u t r f i -
a) Reconocer los diferentes tipos d e leucocitos e n u n lo.
extendido d e sangre. a) O b s e r v e la f o r m a d e la c l u l a y d i b u j e , deter-
b) R e c o n o c e r la s p l a q u e t a s e n u n e x t e n d i d o d e s a n - m i n e e l t a m a o d e la c l u l a ( c o m p a r e c o n l o s
g r e y d i f e r e n c i a r l o s d e los eritrocitos y l e u c o c i t o s . eritrocitos q u e t i e n e n 7.2 m i c r m e t r o s )
c) H a c e r u n a f r m u l a diferencial y p o r c e n t u a l d e b) O b s e r v e la f o r m a d e l n c l e o , c u e n t e e l n m e -
leucocitos y relacionarlos c o n estados d e normali- ro d e s e g m e n t a c i o n e s q u e p r e s e n t a .
d a d y pato. c) E n el c i t o p l a s m a d e t e r m i n e la p r e s e n c i a d e
d) Interpretar y e x p l i c a r el p o r q u d e la c o l o r a c i n d e g r a n u l o s , m i r e d e c u a n t o s t i p o s h a y y v e a la
c a d a u n a d e las c l u l a s o b s e r v a d a s . coloracin que tienen.
e) R e c o n o c e r la p r e s e n c i a d e p l a q u e t a s y r e l a c i o n a r - d) P o r la f o r m a d e l n c l e o y e l n m e r o d e s e g -
los c o n el n m e r o d e eritrocitos c o n e l f i n d e s a c a r m e n t a c i o n e s q u e t i e n e , e s t a b l e z c a si e s u n a
u n v a l o r e s t i m a t i v o del n m e r o d e p l a q u e t a s . forma juvenil (ncleo en forma de
e) cayado o herradura), o e s un segmentado o
Materiales: clula diferenciada terminal (ncleo con 3 a 5
segmentaciones o lobulaciones).
1. Placas c o n extendidos sanguneos coloreados por
el m t o d o d e G i e m s a o d e W r i g h t . 9. IVlire u n Linfocito y d e t e r m i n e :
2. Placas coloreadas con azul d e metileno. a) O b s e r v e la f o r m a d e la c l u l a y e l t a m a o q u e
tiene.
Procedimiento: b) O b s e r v e e l n c l e o y la d i s t i n g a la p r e s e n c i a y
d i s p o s i c i n d e la c r o m a t i n a
1. C o l o q u e la p l a c a d e s a n g r e p r e p a r a d a , y a c o l o r e a - c) Observe el citoplasma, anote el tipo d e colo-
d a c o n e l m t o d o d e G i e m s a e n la platina d e l m i - racin que presenta.
croscopio. d) B u s q u e la p r e s e n c i a d e g r a n u l a c i o n e s e n e l c i -
2. S e p a r e e l l e n t e o b j e t i v o d e 100 X , d e la p l a c a y p o r toplasma.
lo t a n t o d e la platina del m i c r o s c o p i o . e) E s t a b l e z c a si e s u n linfocito p e q u e o o u n l i n -
3. C o l o q u e u n a g o t a d e a c e i t e d e c e d r o e n t r e la c o l a y focito g r a n d e .
el c u e r p o del f r o t e s a n g u n e o . f) Dibuje sus observaciones.
4. S u b a l e n t a m e n t e la platina h a s t a q u e e l l e n t e d e
100 X , t o p e c o n la g o t a d e a c e i t e d e c e d r o . E s t e 10. B u s q u e u n Eosinfilo y d i s t i n g a ;
movimiento s e lo hace s i n mirar a travs d e los a) L a f o r m a y e l t a m a o d e la c l u l a .
oculares. b) L a p r e s e n c i a d e grnuloe ctoplaemtiooc, d o
5. E n f o q u e c o n el tornillo m i c r o m t r i c o , m i r a n d o a c o l o r rojo c o m o e n r a c i m o d e u v a s .
t r a v s d e los o c u l a r e s . c) D i s t i n g a el n c l e o y c u e n t e el n m e r o d e l o b u -
6. Inicie la o b s e r v a c i n m i r a n d o la m o r f o l o g a , color, laciones que presenta
t a m a o . Etc. d e los eritrocitos. d) Dibuje el Eosinfilo observado.
7. O b s e r v e la p r e s e n c i a d e p l a q u e t a s y d e t e r m i n e e l
n m e r o aproximado d e estas clulas (no s n pro- 11. Identifique u n M o n o c i t o y o b s e r v e :
p i a m e n t e c l u l a s ) . Mientras los eritrocitos se en- a) La f o r m a y el t a m a o d e la c l u l a .
cuentran en aproximadamente 5' 000.000 por mil- El c i t o p l a s m a , v e a la c o l o r a c i n e i d e n t i f i q u e la
metro cbico (o mi), las plaquetas se encuentran presencia o no d e granulaciones.
en 200.000 por milmetro cbico (o mi). Es decir C o m p a r e la d i s p o s i c i n d e la c r o m a t i n a c o n
una relacin de 2511, si conocemos esta relacin los neutrfilos y los linfocitos.
podemos calcular la cantidad de plaquetas. Obser- O b s e r v e la f o r m a y e l t a m a o d e l n c l e o ,
vando el nmero de plaquetas existentes en 10 c o m p a r e c o n la d e u n linfocito.
campos de aproximadamente 100 eritrocitos y e) Dibuje sus observaciones.
adems relacionando con el hematocrito.
12. E n c u e n t r e u n basfilo e i n v e s t i g u e :
Clculo: si en 10 campos de 100 eritrocitos a) L a fomna y el t a m a o d e la c l u l a
encontramos 46 plaquetas, el promedio por b) L a f o r m a e l t a m a o y la p r e s e n c i a o n o , d e l
campo es de 4.6 por 100 eritrocitos ncleo.
Si establecemos una relacin: c) La presencia de granulaciones azurfilas e n el
citoplasma.
d) B u s q u e las s e m e j a n z a s y las d i f e r e n c i a s c o n
En 100 eritrocitos 4.6 plaquetas los E o s i n f i l o s .
En 5' 000.000 eritrocitos X.

13. C u a n d o y a h a y a a p r e n d i d o a d i s t i n g u i r los d i f e r e n -
S'OOO.OOO eritrocitosx 4.6 plaquetas t e s l e u c o c i t o s , c u e n t e 100 l e u c o c i t o s , d e t e r m i n a n d o
y anotando a q u e clase d e leucocito pertenece, al
100 eritrocitos final habr realizado una frmula porcentual.

= 230.000 plaquetas

S e s a b e q u e e l H c t o , m i d e i n d i r e c t a m e n t e la
cantidad d e hemates por milmetro cbico.
As Hcto d e 46 = 4 6 + 3 = 4 9 ; 49 =
4 ' 9 0 0 . 0 0 0 eritrocitos por m i .
..11
05-
108

LOS LEUCOCITOS: SOOO h


10
Los leucocitos o glbulos blancos son clulas de la
sangre, cuya funcin es la defensa del organismo, no
dentro del torrente circulatorio, sino cuando por un
fenmeno de diapdesis atraviesan los endotelios y se
ubican en el tejido conectivo que es el campo de batalla.

a-a-a
La observacin de los leucocitos al microscopio, se hace
con una pelcula o extendido de sangre, la misma que
debe estar coloreada con colorantes para sangre que
bsicamente son la eosina y el azul de metileno.

Es ms fcil demostrar los leucocitos en un frotis, en la


zona gruesa, pero la morfologa no es la ms adecuada.
Por ello buscaremos leucocitos en la zona ms extendi-
da, considere que los leucocitos en un extendido suelen Los antgenos se identifican por un enorme nmero de
ubicarse con mayor facilidad en los extremos de la variaciones, as se conocen como 300 para el lugar A,
placa. alrededor de 500 para el B, ms de 150 para el C, 400
para el DR, ms de 500 para el DQ y todos estos van en
Los leucocitos se dividen en granulocitos y no granuloci- crescendo.
tos.
Los granulocitos son; Los neutrfilos, los eosinfilos y El DNA se trasmite de padres a hijos y en el caso del
los basfilos; se denominan as porque el citoplasma HLA, se trasmite haplotipos o conjunto de genes, en
est lleno de granulos. este caso del HLA, lo que le vuelve muy complejo y
difcilmente se encontrara dos individuos con un mismo
Los no granulocitos son los linfocitos y los monocitos,
puesto que en principio no se haban determinado gra- H
nulos en el citoplasma. Pero tanto los linfocitos como los
monocitos, si tienen granulos en su citoplasma, por lo Hay cinco tipos de leucocitos y son:
que la clasificacin entre granulosos y no granulosos es
equivocada.
NEUTROFILOS:
ANTGENOS HLA ' 'Z' ^ '
Son clulas sanguneas, las ms numerosas de los
Son antgenos de histocompatibilidad asociados a los leucocitos, estn entre 60 a 70 % en la frmula porcen-
leucocitos humanos. As como los glbulos rojos presen- tual y en nmeros absolutos de 3000 a 6000. El aumen-
tan alfa-2-globulnas en la membrana celular, el resto de to en el nmero de neutrfilos se llama neutrofilia, la
clulas del organismo y referido generalmente a las disminucin se denomina neutropenia.
clulas nucleadas, presenta sustancias antignicas en la
membrana celular. La neutrofilia significa que el organismo necesita gran
cantidad de estas clulas, posiblemente para poder
Esta identificacin es til, sobre todo cuando se quiere responder adecuadamente a un proceso infeccioso o
realizar trasplantes de rganos o tejidos. Los individuos inflamatorio. La disminucin de neutrfilos o neutropenia
deben ser etiquetados con el sistema HLA, que determi- est relacionado con una disminucin de los mecanis-
na la posibilidad de que el receptor de un rgano acepte mos de defensa, menos de 500 neutrfilos en cifras
el trasplante y no lo rechace. absolutas, puede poner en riesgo la vida del individuo ya
que no tendr clulas que respondan adecuadamente a
El HLA es igual a HCM o complejo mayor de histocom- un ataque de microorganismos como bacterias.
patibilidad, al reconocer estos antgenos de superficie se
pudo comprender por qu el rechazo de rganos tras- Tambin podra estar relacionada con una aplasia o
plantados, igualmente se han asociado a muchos tipos hipoplasia de mdula sea generalmente por lesin
de enfermedades autoinmunes como el Lupus Eritema- medular provocada por radiaciones, medicamentos u
toso Sistmico (LES), Miastenia Gravis, Sndrome de otras causas.
Sjngren, Espondilitis anquilosante y enfermedad cela-
ca, etc. Asociados a un tipo especfico de HLA. Se caracterizan por ser clulas redondeadas, de apro-
ximadamente 10 a 12 micrmetros de dimetro, con un
ncleo que presenta varios segmentos o lobulaciones
por lo que a esta clula se la conoce como polimorfo
HLA-B nuclear (poli = muchos, morfo = forma, nuclear = ncleo)
HLA-A
o segmentado.

El promedio de lobulaciones en una clula normal va de


3 a 5 lobulaciones, cuando se encuentra gran porcentaje
de neutrfilos con ms de cinco lobulaciones o segmen-
tos de ncleo, se debe descartar, la presencia de
anemia megaloblstlca, que se debe a la disminucin o
HLA-B ausencia de vitamina B 12, y cido folleo. En general
mirar la cantidad de lobulaciones permite relacionar la
edad de los neutrfilos, ya que al determinar aumento
de formas con dos o tres lobulaciones, pensaramos en
Infografia ilustra los haplotipos del HLA una produccin aumentada de neutrfilos y que estos
mueren rpidamente, sin permitir a la mdula sea,
formar clulas maduras.
En el citoplasma se encuentra gran cantidad de granu-
Infografa que ilustra la trasmisin de los haplotipos de padres a Inijos
los; unos muy pequeos de color lila o acidfilos llama-
109

dos granulos especficos que contienen colagenasa El aumento en el nmero de Linfocitos se denomina
(enzima que destruye la colgena), lactoferrina (enzima linfocitosis y la disminucin linfopenia. La alteracin de
que atrae al hierro y de esta manera podra privar a las los linfocitos est relacionada con problemas virales
bacterias de un elemento esencial para su reproduccin generalmente.
y de esta manera tener una accin bacteriosttica) Se
ha visto que la lactoferrina inhibe la produccin de factor Su ncleo ms o menos redondeado, presenta una
estimulador de colonias de granulocitos. muesca en uno de sus extremos, pero lo ms importante
es mirar la cromatina, que en el linfocito est muy con-
densada, tanto as que se hace difcil observar nuclo-
los.

El citoplasma de la clula de un color celeste claro,


puede presentar granulaciones azurfilas. Su funcin es
la de actuar en los procesos inmunolgicos. Existen dos
tipos de linfocitos: Los linfocitos T y los linfocitos B.
Los linfocitos T se encargan de la defensa del organis-
mo a travs de la defensa celular y los linfocitos B,
clulas de defensa humoral encargada de producir
inmunoglobulinas especficas, o el de madurar hacia
clulas ms diferenciadas como son las clulas plasnn-
ticas.

EOSINFILOS:
Estn entre 1 a 3 % y en nmeros totales de 120 a 300
por mi. Son ligeramente mayores que los neutrfilos ya
que miden entre 12 a 14 micrometros. El ncleo poco
destacado presenta 2 lobulaciones y ocasionalmente 3.
Hay otros granulos ms grandes y menos numerosos de Lo ms destacado es la presencia de granulaciones
color azulado o basfilos, denominados/granulos especficas de color rojo a rosado en el citoplasma,
azurfilos/ Que corresponden a lisosomas qtt contie- granulos de aproximadamente 0.5 micrometros, ocultan
nen enzimas que pueden demoler compuestos macro- el ncleo parcialmente. La funcin del Eosinfilo es la de
moleculares como protenas, carbohidratos y lpidos. ser un mediador en las reacciones de alergia y anafila-
Adems poseen mieloperoxidasa, que activa el perxi- xia, pero tambin son clulas fagocticas y mediadores
do de hidrgeno. La presencia de granulos acidfilos y en las reacciones inflamatorias.
basfilos le confiere el nombre de Neutrfilo.
El aumento de eosinfilos se denomina eosinofilia y est
La funcin de esta clula es la fagocitosis por (o que relacionado con procesos alrgicos, dentro de ellos las
tambin se le conoce con el nombre de micrfago (micro parasitosis por una reaccin del mismo tipo. La disminu-
= pequeo, fago = comedor). Hay clulas jvenes en la cin de eosinfilos no debe tomarse en cuenta, ya que
circulacin, que an no han completado su proceso de al realizar una frmula porcentual podran llenarse el
maduracin y se manifiestan porque el ncleo np_pre-- 100% entre los neutrfilos y los linfocitos, en verdad no
sentarkibulaeionBs^eLncleo se ve como una herradura es que haya 0% de eosinfilos si no que el hallazgo de
o cayado, razn por la que se les denomina juveniles o este tipo de clulas es ms rara, lo que en realidad debe
cayados. Estos estn en un porcentaje normal de 1 a hacerse es que cuando se hace una frmula porcentual
2% El aumento de cayados determina como quedo deben contarse por lo menos 500 leucocitos, cifra que
dicho la necesidad de una mayor produccin de clulas estadsticamente nos permitir tener un valor mayor-
por la mdula sea. mente aproximado de la realidad.

LINFOCITOS: De ah .que los valores de mquinas automatizadas


podran dar una idea ms clara de la cantidad de eosi-
En nmero son las segundas clulas ms frecuentes de nfilos.
los leucocitos sanguneos. Se encuentran entre un 20 a
40 % en trminos porcentuales, y en nmeros absolutos
estn entre 1000 a 3000 por mi. Tienen un dimetro de
8 a 12 micrometros lo que hace que se observen algu-
nos linfocitos pequeos y otros grandes, con un ncleo
de 7 a 8 micrometros los pequeos y los linfocitos gran-
des con ncleo de aproximadamente 10 micrometros o
ms.


110

MONOCITOS:
Pertenecen a los leucocitos de la sangre y son los ms K
grandes. Estn entre 3 a 8 % en cifras porcentuales y en
nmeros absolutos de 200 a 600 por mi, Miden entre 16
a 20 micrmetros de dimetro, a veces se los confunde
con los nfocitos, por tener un ncleo de forma arrio-
nada, pero la cromatina es menos condensada, sin
embargo el nuclolo no es visible. El ncleo con muesca
grande da el aspecto de doblado, el citoplasma con 4
presencia de granulos azurfllos, aunque celeste parece
ser ligeramente sucio a diferencia del linfocito que tiene
un citoplasma celeste claro. La funcin del monocito es
ser precursor de las clulas del sistema mononuclear
macrofgico (macrfagos) y por lo tanto relacionado con
los procesos de fagocitosis.

CARACTERISTICAS DE L O S LEUCOCITOS
Neu- Linfo- Eosi- Bas- Mo-
trfilo cito nfilo filo nocito
Por- 60 a 20 a 1 a 3 0 a 1 3 a 8
centa- 70% 40% % % %
je
J*=
3000 a 1000 a 120 a 60 a 200 a
abso- 6000 : 3000 300 100 600
lutos
Ta- 10 a 8 a 16 12 a 10 a 16 a
mao 12 nm j.im 14 .im 12 nm 20 |.im
N- Seg- Redon : Bilo- Bilo- Redon
-aik'i cleo men- don- bulado bulado don-
tado deado deado
mues- mues-
cado
El aumento del nmero de monocitos se denomina como
Monocitosis, la disminucin de monocitos sera una dobla-
monocitopenia y lo que ms se encuentra es alteracin do
en el funcionamiento nonnal de estas clulas, que como Cro- Poco Con- Poco Poco Poco
aprender ms tarde est relacionado con muchos matina con- den- visible visible con-
sndromes patolgicos. den- sada den-
sada sada
Cito- Acid- Celes- Rojo Azul Celes-
BASOFILOS: plas- filo 0 te por por te
ma rojizo claro granu- granu- sucio
Tienen un porcentaje de O a 1 %, en nmeros absolutos los los
de 60 a 100 por mi, Su ncleo puede ser bilobulado,
Gra- Lilas 0 Oca- Acid- Bas- Oca-
pero generalmente queda oculto entre los granulos
basfilos metacromticos que se tien de un color rojo nulos acid- sional- filos 0 filos 0 sional-
violceo casi negros, densamente agrupados, la croma- filos y nal- rojos azules nal-
tina es poco condensada. Lo ms caracterstico es la azules mente espe- espe- mente
presencia de granulos de color azul intenso en el cito- 0 azur- cficos cficos azur-
plasma o granulos azurfllos especficos. basfi- fllos fllos
los
El aumento de basfilos (basofilia) en nmeros absolu- Fun- Fago- Inmu- Aler- Aler- Fago-
tos est relacionado con problemas alrgicos y an cin citosis nol- gia, gia citosis
neoplsicos, se ha sealado el parentesco entre los gica anafi-
basfilos y las clulas cebadas del tejido conectivo, laxia
debido al contenido de sus granulos y la presencia de
Histamina y serotonina, se cree que podran ser precur-
sores de los mastocitos. Modelo de reporte de una biometra hemtica, consiga
una biometra hemtica y vaya analizndola paulatina-
La disminucin de los basfilos, aparentemente no tiene mente.
importancia, puesto que al igual que la explicacin
anterior respecto a los eosinfilos, porcentualmente los
basfilos estn entre O y 1 % , porcentaje tan bajo que
como qued explicado el 100% se llena con los neutrfi-
los y nfocitos.
111

LAS PLAQUETAS Estructura de la plaqueta

Las plaquetas provienen de la serie megacarioctica- Las plaquetas presentan una forma redondeada ligera-
plaquetas, formada por un conjunto de clulas que se mente alargada de 2 a 3 pm y puede presentarse espi-
fonnan en la mdula sea a partir de una clula madre culado cuando ha degranulado, al ML se demuestra una
mieloide CFU-GEMM y que forman cuatro estados estructura central denominado granulmero (con nume-
evolutivos que son: rosos granulos, granulos densos, otros muy densos que
contienen serotonina, mitocondrias y ribosomas, un
1. Megacarioblaslo sistema tubular conectado con la superilcie) y otra peri-
2. Promegacariocito frica llamada hialmero (presenta microtbulos, alma-
3. Megacariocito granular cenamiento de glucgeno, citoplasma celular), carecen
4. Megacariocito formador de plaquetas de ncleo ya que no son propiamente clulas, sino
fragmentos de la clula gigante denominada megacario-
cito.

Se encuentran normalmente entre 200.000 a 400.000


plaquetas por mi de sangre. La disminucin se llama
plaquetopenia y el aumento trombocitosis.

La plaquetopenia menor a 5000 por mi pone en peligro


la vida y en general menos de 80.000 plaquetas ya es
inquietante. La alteracin en la funcin plaquetaria
puede dar trastornos en el proceso de coagulacin,
como en el caso del Sndrome de Bernard Soulier que
tiene plaquetas gigantes, pero sin un normal funciona-
miento.
El aumento de plaquetas se denomina trombocitosis y
ms de 1' 000.000 de plaquetas podra inducir a la
presencia de trombosis.
Los megacariocitos son clulas poliploides, resultado de
la no separacin del material gentico o cromosomas de
clulas un proceso de mitosis, lo que permite que las
clulas sean grandes y con una masa nuclear cada vez
ms voluminosa. El 50% de los megacariocitos son 8n,
pero hay clulas de hasta 64n.

Las plaquetas se forman por un proceso de disgregacin


del citoplasma del megacariocito, de ah pasan al torren-
te sanguneo y cumplen funciones de hemostasia y
contribuyen a la coagulacin de la sangre.

La vida de las plaquetas en la sangre perifrica es de


aproximadamente 10 das, pero fuera del torrente san-
guneo, en una bolsa de flebotoma apenas si duran
unas pocas horas, por lo que al querer transfundir pla-
quetas, se lo debe hace con sangre lo ms fresca posi-
ble o mediante una mquina de cell fresis en forma ESTRUCTURA DE LAS PLAQUETAS
inmediata Granulmero
Granulos Factor plaque- Fi- Trombos-
La hemostasia alfa tario 4 y PDGF bringe pondina
no Fibronecti-
Al producirse una lesin en el vaso sanguneo, las pla- Factor V na
quetas se adhieren al sitio y forman una placa trombti- Factor Albmina
ca o cogulo plaquetario. Inmediatamente liberan facto- VIII/ von Alfa 1
res como el DPGF que es una sustancia mitgena Wil- antitripsina
(estimula la mitosis), y pemilte el crecimiento de clulas lebrand Alfa 2
de reparacin de la tienda. Por ejemplo estimula la macroglo-
divisin de fibroblastos, clulas endoteliales etc. bullna
Cuerpos Serotonina
Las plaquetas tienen receptores para unirse a la colge- densos ADP
na desfifrilada en el sitio de la lesin y estimulada, as ATP
las plaquetas empiezan un proceso de degranulacin, Enzimas Fosfafasa
expresan as receptores de fibringeno y forman fibrina lisosmi- acida
que van atrapando glbulos rojos, formando as un cas Betaglucoroni-
cogulo sanguneo. Los granulos liberados eliminan dasa
sustancias vasopresoras, prostaglandinas, que colabo- Ariisulfatasa
ran con el proceso hemosttico. N-acetil-
betagluco-
Las plaquetas no solo se adhieren al vaso lesionado, saminidasa
tambin lo hace en caso de irregularidad del endotelio, Hialmero
lo que podra provocar la formacin de una placa trom-
Glucgeno
btica que al desprenderse ocasionara trombosis.
Microtbu-
Jos
Microfila-
mentos
112

LA COAGULACIN SANGUNEA

La coagulacin sangunea es un proceso complejo que Trombo plaquetario


permite mantener un equilibrio entre la formacin y
destruccin de fibrina en los vasos sanguneos y se
manifiesta en la incoagulabilidad de la sangre circulante
y en la adecuada reparacin de las lesiones de los Coagulacin
vasos. Plaqueta
La lesin de un vaso desencadena un mecanismo en el
que participan factores vasculares, plaquetarios y plas-
mticos al unsono, y que tienen como fin ltimo la
formacin de un cogulo de fibrina y su autodestruccion
ulterior Induccin e Inhibicin de la fibrinollsis
En la forma inicial participa el factor vascular y el plaque-
tario, formando la hemostasia primaria y que tiene por
objeto formar el cogulo plaquetario y luego intervienen
las protenas plasmticas que son los factores de coagu-
lacin que permite el depsito de fibrina sobre el tapn
inicial plaquetario, conformando el tapn inicial plaqueta-
rio, conformando el cogulo definitivo; accin que junto a
la destruccin posterior a este, recibe el nombre de
hemostasia secundaria.

La participacin de la plaqueta en la hemostasia secun-


daria puede resumirse en lo siguiente:
1. Segn estudios de Waish, la plaqueta activa los
factores XII, XI y lo protege de inhibidores CUESTIONARIO PARA L A PRXIMA C L A S E DE
2. Libera fibringeno y factor V, el que recibe el nombre LABORATORIO:
de factor I y contribuye a la formacin de fibrina peripla- 1. Cul es la frmula porcentual de los diferentes
quetaria. leucocitos, que encontr en la observacin de su
3. El factor III plaquetario, acta como catalizador de placa?
superficie, en sus reacciones enzimticas de la fase 2. Determine los nmeros absolutos de leucocitos si
plasmtica de la coagulacin: complejo de factor IX el nmero total de estos se supone fue de 8500 por
activado, factor VIII y palcio inico y complejo formado mi
por factor X activado, factor V y calcio inico 3. Cul es la cifra de plaquetas que encontr en las
4. El factor Xa se une a receptores de superficie y forma observaciones de su placa si se supone un hema-
trombina, a su vez evita los factores inhibidores de la tocrito de 52.
Goagulacin como la antrambina III 4. La p/Qca q u e uaed m i r , c o n o r m a l o pafogioa,
5. El factor plasmtico activado desencadena la agrega- defina el por qu?
cin plaquetario y a su vez mayor formacin de factor 5. A qu se llama leucocitosis y qu significado
plasmtico activado tiene?
6. El factor II plaquetario har al fibringeno ms activo 6. Qu es una plaquetopenia y qu significado
a la accin proteoltica de la trombina y el factor IV tiene?
plaquetario ejercer su accin antiheparnica 7. Qu es hemostasia?
7. La plaqueta no solo contribuye a la formacin del 8. Qu es Leucopenia y qu significado tiene?
cogulo de fibrina sino tambin a regular el mecanismo 9. Qu es aplasia y porqu puede producirse?
de su destruccin. Por un lado activa la fibrinollsis acti- 10. Haga los dibujos y ponga nombres de lo observado
vando o liberando plasmingeno en la membrana pla- en el laboratorio.
quetaria y por otro lado inhibe la fibrinlisis por medio de
inhibidores de la activacin de la activacin del plasmi-
ngeno y antiplasminas plaquetarias
113

P R A C T I C A D E L A B O R A T O R I O No DOCE.

TEMA: OBSERVACIN DE MDULA SEA O TEJIDO MIELOIDE


plasma no desprende plaquetas. Los megacarioci-
Objetivo de la prctica: tos clulas gigantes con ncleo enorme mamelo-
a ) Reconocer: en un extendido o en una biopsia de nado y citoplasma ligeramente basfilo que si des-
mdula sea, al tejido mieloide. prenden plaquetas.
b) Diferenciar un extendido de mdula sea, de un
7. Con 100X, observe panormicamente a las clulas
extendido de sangre perifrica.
y reconozca las clulas maduras de la mdula
c) Conocer y diferenciar clulas estromticas y clu- sea, que son exactamente iguales a las clulas de
las del parnquima del tejido mieloide. un extendido sanguneo de sangre perifrica. Eri-
d) Observar las diferentes lneas de diferenciacin trocitos maduros, leucocitos maduros, presencia de
celular hematopoyticas (eritroide, mieloide, mega- plaquetas. "Se denomina pool de clulas maduras."
carioctioa, linfoctica, monocitica).
e) Estudiar a la mayor parte de las clulas tiematopo- 8. La observacin con lente panormico y con 100 X
yticas posibles por su tamao, coloracin y morfo- tambin le permitir reconocer a las clulas de la
loga. serie eritroide, porque son clulas que con coloran-
tes para sangre se encuentran ms pigmentadas y
Materiales: le confieren a la mdula sea una tonalidad azul in-
1. Microscopio fotnico, comn o corriente. tensa, tanto as que cuando hay una reaccin eri-
2. Preparaciones de extendido de Mdula sea. troblstica se llega a decir que la mdula es azul.
3. Preparaciones de tejido seo esponjoso con mdu- Se observa mdula azul en casos de hemolisis in-
la sea activa. tensas ya que el ndice mittico de la mdula est
4. Circuito de vdeo para reconocer las diferentes aumentado.
clulas. 9. Reconozca a las diferentes clulas, de diferentes
series en proceso de maduracin, de todas y cada
TCNICA DE OBSERVACIN DE UN EXTENDIDO DE una de las serles antes mencionadas.
MDULA SEA:
Las clulas de la serle blanca o leucocitos en dife-
1. Obtenga una muestra de mdula sea del esternn rentes fases de maduracin, se diferencian de la
o de la espina ilaca pstero superior. serie roja porque se presentan ms plidas, menos
pigmentadas que la serie roja.
a) Ubique el sitio de puncin. Si se trata del es-
ternn debe realizarlo 2 cm por debajo del n- 10. Haga el reconocimiento en una placa de biopsia de
gulo de Louis. Si es en la espina ilaca pstero mcdufa GCO. LQ mdulo O O O p u e d o obtononoo

superior debe estar seguro del sitio de pun- tambin por puncin biopsia, de la cresta ilaca
cin. pstero superior.
b) Esterilice la piel con una gasa empapada en
yodo o alcohol yodado.
c) Pinche la zona escogida con una aguja ade-
cuada, la misma que debe tener un mandril,
para evitar el taponamiento.
d) Coloque una jeringuilla en la aguja y absorba
lentamente la mdula sea.

2. Realice un extendido de mdula sea, en forma


parecida a como se lo realiza con sangre.
3. Proceda a colorear con el mtodo de Giemsa o de
Wright.
Es probable que todos estos pasos anteriores, se
deban obviar. Es mejor trabajar con placas prepa-
radas con anterioridad. Estas tcnicas requieren de
manos expertas y no estn exentas de problemas
graves
4. Enfoque la placa con la lente de menor aumento:
3.2 X, luego 10 X, haga una observacin panor-
mica observando las clulas estromticas (como 11. Reconozca las clulas del estroma: Clulas alma-
clulas almacenadoras de grasa) y las clulas del cenadoras de grasa, macrfagos, clulas endotelia-
parnquima mieloide. les, en caso de biopsias. Fibroblastos y fibrocitos,
Mientras ms ncleos observe, mayor cantidad de clulas reticulares, osteoblastos, osteoclastos, etc.
clulas habrn. Pero no olvide que estos ncleos
pertenecen en su mayor parte a las clulas del pa- 12. Reconozca el tejido noble de la mdula sea. Aqu
rnquima. es difcil distinguir las clulas en diferentes etapas
de maduracin, excepto cuando hay una mdula
5. Con 10X y en observacin panormica reconozca a con un solo tipo de clulas (por ejemplo leucemia
los megacariocitos, que son las clulas muy gran- linfoblstica), en estos casos se habla de una m-
des que se presentan en los campos del microsco- dula montona.
pio.
13. Cuente 100 clulas y establezca una relacin entre
6. Lleve a 100 X y confirme que son megacariocitos. la serie roja y la serle blanca. (Solo debe conside-
Son megacarioblastos cuando estas clulas son rarse las clulas en proceso de maduracin, en lo
muy basfllas, tienen un ncleo grande y su cito- referente a la serie roja).
w

114

LA MDULA SEA. LA MDULA SEA S E DIVIDE EN MDULA ROJA Y


AMARILLA
La mdula sea constituye el principal rgano hemato-
poytico del organismo tiumano, y se localiza en el La mdula sea se denomina roja cuando es activa y
tejido seo esponjoso, como en el diploe o capa media se denomina amarilla cuando deja de producir clulas
de los tiuesos planos, en el hueso esponjoso de huesos sanguneas.
cortos, y epfisis de huesos largos.
La mdula roja es un rgano hematopoytico que est
El hgado y el bazo tambin son rganos hematopoyti- produciendo sangre en forma activa e liistolgica-
cos antes del nacimiento, En el grfico inferior se puede mente es un rgano que presenta:
notar como el organismo forma sangre, durante la vida
embrionaria y fetal. Inicia la formacin de sangre en los 1. Abundantes eritrocitos, que contribuyen a presen-
islotes sanguneos, luego al mes y medio inicia la hema- tarse de un color rojo.
topoyesis en el hgado, tanto que al tercer mes de vida 2. Gran cantidad de vasos sanguneos que dan una
gestacional es el hgado el principal rgano hematopo- rica irrigacin en comparacin con la mdula amari-
ytico, luego va decreciendo su papel hasta el momento lla. Visibles nicamente en preparados de biopsia.
del nacimiento. El bazo inicia la hematopoyesis en el 3. Pequea cantidad de clulas almacenadoras de
tercer mes y produce clulas sanguneas hasta el spti- grasa.
mo mes. A partir del nacimiento es la mdula sea la
responsable de la formacin de clulas sanguneas. La mdula amarilla se encuentra localizada en la
difisis de huesos largos y en otros sectores de
El bazo y el hgado pueden retomar la funcin hemato- hueso esponjoso que va cediendo paso a la mdula
poytica cuando la mdula sea no puede formar san- amarilla conforme envejece el individuo. Esta mdu-
gre, o en momentos especiales como ciertas condicio- la se caracteriza:
nes; como en anemias hemolticas importantes o cuan-
do se hacen trasplantes de mdula sea en ratones el 1. Presenta pocas o ninguna clula en proceso de
rgano hematopoytico es el bazo. maduracin. Pocos eritrocitos en proceso de madu-
racin.
Al examen fsico, de un paciente, la presencia de hepa- 2. Poca cantidad de vasos sanguneos.
tomegalia (crecimiento del hgado) o esplenomegalia 3. Abundantes clulas almacenadoras de grasa, que
(crecimiento del bazo) indicara entre otras cosas que tambin se tien de color amarillo por los carote-
podra tratarse de un trastorno de la hematopoyesis, as nos, que son pigmentos liposolubles presentes en
como en enfermedades neoplsicas como leucemias. vegetales de color como la zanahoria, tomates y
otros de color verde.

1/ jf' J 4. S.
La mdula amarilla se transfomia en mdula roja
cuando hay aumento de la temperatura. En general la
mdula se vuefve mas nemaiopoyeiica cuanao nay
elevacin de la temperatura. Si un individuo con un
proceso inflamatorio tiene fiebre, la cantidad de clulas
sanguneas aumenta y particularmente la cantidad de
leucocitos.

ESTRUCTURA HISTOLGICA DE LA MDULA


Fig. SI, Eriiropoyesis en el embrin humno. (Segn Knoii.) SEA.

Estructuralmente la mdula sea presenta un estroma y


un parnquima. El estroma o tejido de sostn formado
En la observacin de la mdula sea se encuentra por clulas y fibras, la que le da un sustento a las clu-
tres grupos o pool de clulas las que constituyen el parnquima o tejido noble de la
1. Pool de clulas madres indiferenciadas auto- mdula sea.
proliferativas es decir que se dividen por mito-
sis para mantener clulas madre primitivas y ESTROMA DE LA MDULA SEA
otras que avanzan en el proceso de diferen-
ciacin, clulas indiferenciadas porque no SINUSOIDES La mdula sea presenta gran cantidad
pueden demostrarse su presencia, pues mu- de sinusoides que se miran cuando sometemos a la
chas de las clulas madres pareceran linfoci- mdula a radiaciones, disminuyendo la produccin del
tos tejido parenquimatoso.
2. Clulas en proceso de diferenciacin o clu-
las en formacin y que corresponden a las se- Los sinusoides son capilares sanguneos de luz amplia,
ries eritroide, mieloide, linfoblstica, monocti- tienen clulas endoteliales y carecen de msculo liso. A
ca y megacarioctica. Estas clulas ya no son travs de los sinusoides se produce la diapdesis, o
autorregenerativas, proliferativas es decir ya paso de clulas ya maduras a la circulacin sangunea.
no se dividen por mitosis, pero sus caracters-
ticas fsicas las delata como clulas en forma- Los sinusoides son intermediarios entre la circulacin
cin. arterial y venosa, exactamente igual que los capilares en
3. Clulas madres diferenciadas no se dividen otros sectores del organismo. Los sinusoides estn
por mitosis, son clulas adultas por lo que en asociados a macrfagos (clulas reticuloepiteliales) y
principio por la presencia de eritrocitos, pla- son capaces de fagocitar clulas mal formadas, ncleos
quetas, leucocitos diferenciados parecera tra- de eritrocitos o cualquier otra sustancia extraa, este
tarse en un extendido de mdula, que se trata mismo papel cumplen aunque con ms efectividad los
de un extendido de sangre. macrfagos del bazo.
115

CLULAS ALMACENADORAS DE GRASA Son clu- c) Serie megacarloctica se observan clulas fonnado-
las del tejido mieloide y son diferentes a los adipocitos ras de plaquetas y son megacarioblastos clulas muy
sobre todo porque no reaccionan a la insulina, pero si lo basfilas y megacariocltos clulas menos basfilas. Los
hace en presencia de glucocorticoides, acumulando megacariocitos son los responsables de la produccin
mayor cantidad de clulas y lpidos. de plaquetas. Recuerde que las plaquetas no son pro-
piamente clulas sino nicamente fragmentos de clulas
FIBROBLASTOS, CLULAS RETICULARES Son
clulas formadoras de fibras reticulares, colgenas que d) Serie monoctica con la presencia de clulas primiti-
sirven de sustento para la fonnacin de clulas nobles vas o monoblastos y otras ms diferenciadas hasta
de la mdula sea. Cuando hay alteracin de este sec- llegar a los monocitos.
tor del estroma se produce por ejemplo fibrosis medular
y el resultado es falta de produccin de clulas sangu- e) Serie Linfoctica con linfoblastos y otras clulas en
neas. proceso de maduracin hasta llegar a ser linfocitos
adultos e incluso se puede demostrar en porcentajes
muy bajos la presencia de clulas plasmticas.
1. Clulas estromticas como:
a) Clulas endoteliales, que corresponden a los SERIES DE CLULAS DE LA IVIDULA SEA
vasos sanguneos.
b) fibroblastos y fibrocilos,
c) Macrfagos,
d) Clulas reticulares,
e) Clulas fibroblsticas,
f) Clulas almacenadoras de grasa que son las
ms frecuentes,
g) Osteoblastos y osteoclastos que son compo-
nentes del tejido seo.

PARNQUIMA DEL TEJIDO MIELOIDE

El parnquima de la mdula sea o de cualquier otro


rgano, es el tejido noble funcionante o principal, en
este caso son las clulas sanguneas que se forman

2. Clulas del parnquima mieloide o tejido noble de


la mdula sea, en la que se observan 5 series de
clulas en diferentes procesos de maduracin;

La primera diferencia al observar al microscopio, es


reconocer las clulas de la serie blanca y las clulas de
la serie r o j a . t i ncleo de los eritroblastos sufre un
proceso de picnocitosis, por lo que la cromatina ms
condensaba se pinta de color azul, en relacin al mate
rial gentico de las clulas de la serie mieloide que
permanecen con una cromatina laxa.i

a) Serie eritroide o presencia de glbulos rojos en


diferentes estados de maduracin como: >I- Determine las clulas observables al microscopio
StiBlsla9t?''*l9stos-:toasfios, eritroblastos poli-
cromatfilos, eritroblastos'aotdfilos o Uamados-tambin ERI- IVIEGACA- IVIIE- IMONO- LINFO-
nomnoblastos, reticulocitos; o eritrocitos jveneis yeritro- TROI- RIOCITICA LOIDE CITICA CITICA
c|tos adultos o ya completamente formados. Las clulas DE
mencionadas y que estn en proceso de proliferacin y
maduracin, son clulas que tienen ncleo. En condicio-
nes normales no hay clulas nucleadas en la circulacin
general, sin embargo ocasionalmente puede existir una
clula, si en un extendido de sangre se observan eritro-
citos nucleados que los llamaremos eritroblastos, debe
suponer que hay algn trastorno o enfemnedad.

La serie eritroide en coloraciones con azul de metileno y


eosina (Colorantes para sangre) estn ms pigmentadas
con el azul de metileno y por ello al haber una reaccin
erltroblstica la mdula sea toma la apariencia de
mdula azul. La serie mieloide en relacin a la serie
eritroide est en una relacin de 3 a 1

b) Serie mieloide o granuloctica. Se observa clulas


formadoras de neutrfilos, eosinfilos, y basfilos. Bsi-
camente presentan: IVIieloblastos (neutrfilos, eosinfi-
los, basfilos). Promielocitos (neutrfilos, eosinfilos,
basfilos). IVIielocitos (de las tres series o neutrfilos,
eosinfilos o basfilos). Metamielocitos (tambin de las
tres series). Cavados. Y por ltimo segmentados.
116

CUESTIONARIO PARA LA PRXIMA CLASE DE


LABORATORIO.

1. Qu relacin obtuvo entre la serie mieloide y


eritroide, en sus observaciones de mdula sea?
Cul es la diferencia en coloracin entre la serle
roja y la serie blanca?
Cmo reconoce a una clula de la serie megaca-
rioctica?
Cul es el significado del hallazgo de gran canti-
dad de clulas plasmticas en mdula sea?
Qu pozas o tipos de clulas tiene la mdula
sea
Qu es una clula madre?
Por qu los linfocitos T no se forman en la mdula
sea?
Enumere las clulas reconocibles en el proceso de
maduracin de un eritrocito
Enumere las clulas reconocibles en el proceso de
maduracin de un neutrfilo
10. Haga los dibujos de sus observaciones en el labo-
ratorio, debe comprender todas las series y en to-
dos los estados o procesos de diferenciacin celu-
lar.
j 5 T,ft :>o..,...os ^^^^^

117

PRCTICA DE LABORATORIO No T R E C E .

TEMA: OBSERVACIN DE TEJIDOS LINFOPOYTICOS Y RGANOS LINFOIDEOS.


especficamente inmunoglobulinas (Igs) que pueden ser
Objetivo de la prctica: precipitinas, opsoninas, usinas u otras que al ponerse en
contacto con el antgeno, anulan el efecto patgeno o
a) Reconocer al timo como un rgano linfopoytico reconoce al antgeno para iniciar el proceso inmunolgi-
primario, y a los nodulos o foliculos linfoides, gan- co. Las inmunoglobulinas son especficas para el ant-
glios linfticos y el bazo como rganos linfoides se- geno que le activa. Realmente los linfocitos son clulas
cundarios. pre programadas que se activan y se clonan al encontrar
b) Observar y comprender la Importancia de la pre- el antgeno para el cual fueron programadas. Si nunca
sencia de nodulos linfoides ocasionales presentes se encuentra con el antgeno los linfocitos, nunca se
en el corion de los aparatos digestivo, respiratorio, activan y no f o m a n clones celulares.
urinario y otros.
c) Reconocer linfocitos y detenninar su funcin y la Los LINFOCITOS T son clulas que se forman en el
importancia que tienen. Timo, migran a los rganos linfoideos secundarios y son
d) Iniciar el estudio de los mecanismos inmunolgicos capaces de reconocer un antgeno y, coordinar la
como sistema de defensa del organismo iiumano. respuesta inmune celular desapareciendo los antgenos
que bien pueden ser sustancias proteicas extraas o
Materiales: inclusive clulas anormales con potencial neoplsico.
Los linfocitos T tienen un clasificacin y clones enormes
1. Microscopio de luz. distribuidos en todo el organismo.
2. Placas preparadas con coloracin de iiematoxilina
eosina de: Los linfocitos T constituyen el 70% de los linfocitos del
a) Timo. ton-ente sanguneo, y tienen una defensa celular a dife-
b) Bazo. rencia de los linfocitos B que tienen un defensa humoral
c) Ganglio linftico. (formacin de Igs). Tienen una restriccin CMH recuerde
d) Apndice cecal que es la histocompatibilidad celular mayor, es decir los
e) Intestino delgado para ver placas de Peyer linfocitos T reconocen toda estructura proteica que no
f) Amgdala palatina. est registrada en e organismo, que tenga un HLA
g) Nodulos linfoides ocasionales en otros rga- DIFERENTE por lo que esta funcin es til conocerla al
nos del cuerpo humano. momento de realizar trasplantes de tejidos u rganos.

TEJIDO LINFTICO Y S U RELACIN CON E L SIS- Se han descrito varios tipos de linfocitos, as:
TEMA INMUNOLGICO /
Linfocitos TCR 1 que representan el 15% de los linfoci-
L O S LINFOCITO^ son clulas que se reconocieron tos circulantes, en realidad no son circulantes, si no que
inicialmente en la linfa, y por ello se denominan linfoci- estn en ciertos epitelios, ejemplo los linfocitos intra
tos, se pens que estas clulas se producan en los epiteliales del intestino y reconocen antigenos que
vasos linfticos, mucho ms cuando se realiz el si- potencialmente pueden entrar por las mucosas.
guiente experimento. Se canaliz el conducto torcico, y
se filtraba los linfocitos y el lquido retornaba a la circula- Los linfocitos TCR 2 clasificados como:
cin general, se vio que los linfocitos disminuan con-
forme se filtraba la linfa, Linfocitos T citotxicos o CTL o linfocitos GD 8+ encar-
gados de funciones efectoras de inmunidad celular,
lo que no saban en principio, es que los linfocitos eran mediante la interaccin de un complejo "pptido CMH-1
clulas recirculantes, que se formaban en la mdula o CTL reconoce clulas infectadas por patgenos para
sea, en rganos linfopoyticos primarios como el Timo clulas tumorales, las destruye segregando perforina,
y en rganos secundarios como los nodulos linfoideos, granzimas, FasL que activan la apoptosis de las clulas
los ganglios linfticos y en el bazo, y desde los sinusoi- diana.
des pasaban a la circulacin general, luego de la luz de
los vasos sanguneos iban al tejido conectivo, encon- Linfocitos T ayudadores o Helper cells, son clulas CD
trndose en el corion de las mucosas de los aparatos 4+ Asi se encargan de iniciar la cascada de la respues-
digestivo, respiratorio, urinario, genital etc. ta inmune, produce una serie de citoquinas. Lo Helper
Cells pueden ser Th 1 migran a los tejidos y activan a
Abandonaban luego el tejido conectivo y por los linfti- los macrfagos producen inferieron, son necesarios en
cos regresaban a la circulacin general dentro de los los procesos inflamatorios.
vasos sanguneos, por este motivo se dice que los
linfocitos son clulas recirculantes- Los Th2 se localizan en los rganos linfoideos secunda-
rios y activan a los linfocitos B, segregan IL 4 (interieuci-
Al conocerse el origen y la funcin de los linfocitos,
na 4), que estimula la produccin de IgE y activa a los
modernamente se los llama inmunocitos, pues los linfo-
mastocitos. La IL 5 activa los eosinfilos los Th 2 son
citos, cumplen la funcin de reconocimiento de antge- importantes en procesos alrgicos y en parasitosis
nos y desaparicin de los mismos, mecanismo que se
conoce como inmunidad (defensa) Los Th 17 segregan IL 17 e IL 22 son mediadores en
enfermedades como esclerosis mltiple, artritis reuma-
CLASIFICACIN DE LINFOCITOS toidea, y la enfermedad inflamatoria intestinal

L O S LINFOCITOS B se llaman as por ser de vida Los linfocitos T de memoria pueden estar presentes por
breve, pues apenas si viven tres das en la circulacin varios aos, se activan cuando el individuo se vacuna.
general, luego pasan por diapdesis al tejido conectivo.
Se fornian en la mdula sea y pasan a fomnar parte de Linfocitos T reguladores o Ts (T supresores), su funcin
principal es eliminar la inmunidad mediada por clulas,
los linfocitos del tejido conectivo, o forman nodulos u al final de la reaccin inmune y eliminar las clulas T
otras estructuras linfoideas. Su funcin es la de formar
118
auto reactivas que escaparon al proceso de seleccin contacto del virus con un ratn antes del nacimiento, lo
negativa en el Timo. considera como propio y no hay reaccin. En este caso,
no ha sido el virus propiamente el letal, sino la reaccin
Clulas T gamma/delta son clulas en % mnimo, que inmunolgica del organismo lo que provoca la muerte.
presentan TCR especfico en su superficie, son abun-
dantes en la mucosa del intestino formando los leucoci- Mdula
tos intraepiteliales.
Presenta linfocitos en menor concentracin que la corte-
Dentro de la clasificacin de linfocitos los mas conocidos za y con la presencia de clulas retculo epitelial que da
son los CD4 y CD8 o denominados tambin como 0KT4 lugar a la formacin de corpsculos o nodulos de Has-
y 0KT8. sall. La mdula del timo compuesta por clulas retculo
epiteliales, en forma no explicada adquiere una morfolo-
E L TIMO: RGANO LINFOIDEO PRIMARIO ga plana, se enrolla como hojas de cebolla y llegan a
constituir los nodulos de >Hassall, los mismos que al
Es El principal rgano linfopoytico primario, situado por estar formados por clulas epiteliales planas tienden a
detrs de la parte superior del esternn, de forma ms o formar queratina en el centro del enrollado. En colora-
menos triangular, compuesto de dos lbulos, unidos por ciones HE toma un color rojizo, a diferencia de las po-
tejido conectivo y que le dan la apariencia de una H. blaciones de linfocitos que tienen una tonalidad azulada
Histolgicamente el timo presenta: cpsula, corteza y por la hematoxilina. Los linfocitos ocultan a las clulas
mdula retculo epitelial sobre todo a nivel de la corteza. La
presencia de los corpsculos de Hassall es determinan-
Cpsula te para el diagnstico de una placa histolgica de Timo-

Es de tejido conectivo denso fibroso, con o sin infiltra- HISTOLOGA D E L TIMO


cin de tejido adiposo, sobre todo a nivel del hilio del
rgano. Presenta tabicaciones incompletas a su interior El timo tiene dos componentes importantes: el estroma
y divide a los lbulos en lobulillos, no siempre rodeados formado por las clulas retculo epitelial y el parnquima
de cpsula. En general las tabicaciones suelen ser que estara confonnado por los linfocitos.
incompletas en los diferentes rganos del cuerpo hu-
mano.

Corteza

Corresponde a la parte perifrica del Timo, inmediata-


mente por debajo de la cpsula, es el sitio donde se
encuentran gran poblacin de linfocitos T, linfocitos que
se disponen en fonna difusa y no presenta nodulos
linfoides como otros rganos que describiremos luego.
Los linfocitos T dispuestos de la siguiente manera: los
linfocitos ms jvenes estn hacia la periferia y los
linfocitos maduros cerca de la unin crtico-medular,
sector donde se encuentran venas poscapilares, desde
donde salen hacia la circulacin general y hacia el orga-
nismo en general. Posteriormente se encuentran pobla- Componente estromtico y/o glandular
ciones de linfocitos T, en ganglios, bazo, nodulos linfoi-
des o como linfocitos solitarios en el tejido conectivo El componente estromtico tiene un origen endodmnico
laxo o propiamente en el corlen de varias mucosas. y se inicia en la tercera y cuarta bolsas branquiales.
Remeda y constituye la formacin de una glndula de
La corteza fonnada por poblaciones celulares de linfoci- secrecin interna que produce hormonas como la timo-
tos en proceso de diferenciacin, se ubican inmediata- poyetina y la timosina alfa uno. Inicialmente el estroma
mente por debajo de la cpsula y forman una masa est constituido por cordones celulares que van ramifi-
compacta de linfocitos sin dar la apariencia de nodulos cndose como las ramas de un rbol, para formar el
como en amgdalas, el bazo o en los ganglios. Al centro tejido de soporte del timo. Se rodea de tejido mesen-
de los lobulillos timicos se destaca una masa clara, quimatoso (por lo que parte del tejido estromtico es de
compuesta de linfocitos en poca cantidad, y es la mdu- origen mesodrmico) y cuando est listo recibe al com-
la del rgano. ponente linfoide o linftico. Las clulas endodnnicas
proliferativas y estromticas, van ramificndose y adqui-
Funcin del Timo y de los linfocitos T riendo una forma estrellada o fusiforme, se mantienen
unidas por desmosomas y conforman una especie de
Consideremos al timo como una incubadora, en la que los red, el epitelio reticular. El retculo - epitelial terminan
linfocitos son los huevos y el aparecimiento de un linfocito T formando los corpsculos de Hassall
comprometido, sera como el nacimiento del pollito. La condi-
cin esencial y necesaria es que el timo debe estar protegido
de la invasin de antgenos, ya que la presencia temprana de
un antgcno desencadena la muerte de las clulas en proceso
de maduracin, el resultado sera que los linfocitos T, no se
programan y no pueden postcrionncntc reconocer el antgeno.
Si el supuesto antgeno es patgeno y mortal, el individuo
padece una enfermedad que le puede conducir a la muerte.
Pero si el antgeno que logr desaparecer el linfocito pre
programado no es patgeno, el individuo toma a ste
como propio y no pasa nada. Componente linfoide o linftico
La explicacin anterior nos permite entender el caso de
la corlo meningitis linfoctica del ratn que es una enfer- Est fonnado casi exclusivamente por linfocitos T o
medad viral y mortal, cuando un ratn se encuentra con timocitos que se forman a partir de clulas linfoides
la presencia del virus en la edad adulta. Pero si hay madres (Stem Cells) provenientes del saco vitelino, de la
119

mdula sea, del hgado o bazo, cuando estos ltimos sa. Todas las barreras hemticas como la placentaria,
son todava rganos hematopoyticos. Infiltran el epitelio retiniana, testicular, nerviosa etc tienen la misma estruc-
reticular. Puede haber linfocitos B en el Timo, pero casi tura bsica.
nunca se observarn clulas plasmticas ya que el timo
posee una barrera HEMATICA que no d la oportunidad Funcin del timo
de recibir antgenos y por lo tanto los linfocitos B no se Se pudo determinar la funcin del timo gracias a la
estimularan para formar clulas plasmticas. timectoma (extirpar el timo). Pronto se vio que los me-
canismos de defensa se anulaban y los individuos mo-
ran. Si a un animal timectomizado le injertamos otro
timo, el animal puede restablecer las funciones de de-
fensa y sobrevivir.

La ausencia del timo es incompatible con la vida, as


mismo se demostr que al timectomizar a un animal,
otros rganos linfoides como ganglios, nodulos linfoides
sufran alteracin en la concentracin de linfocitos, sobre
todo los sitios destinados a tener poblaciones de linfoci-
tos T, lo que confirm adems la funcin endocrina del
timo, ya que producen dos hormonas necesarias para el
mantenimiento normal de la estructura tmica.

El timo V la mdula sea son considerados rganos


lnfopoyticos primarios, pues en estos sitios proliferan y
Tamao del Timo se programan los linfocitos T y B. El Timo es considera-
do como una escuela de formacin de linfocitos T. Mien-
Al nacimiento el timo es sumamente grande en compa- tras la mdula sea es el sitio de programacin y prolife-
racin con el tamao del cuerpo. Crece el Timo hasta racin de linfocitos B.
ios dos aos y luego tiene un crecimiento lento hasta los
12 aos, y en comparacin al resto del cuerpo es pe- Los linfocitos son clulas de defensa del organismo, ya
queo. El timo a partir de su involucin va acumulando que son capaces de reconocer especficamente un
tejido fibroso y adiposo. Al nacimiento pesa 12 a 15 antgeno determinado y una vez que lo reconocen, los
gramos, en la pubertad 30 a 40 gramos. linfocitos se programan y proliferan. La programacin no
es sino la diferenciacin celular para producir determi-
nados anticuerpos (inmunoglobulinas) especficos que
Circulacin sangunea del timo anulan o desaparecen a los antgenos.

La sangre ingresa por el hilio del rgano. Son ramas de "Los linfocitos no son clulas vrgenes, estn programa-
las arterias mamarias internas y tiroidea inferior. Se dos de antemano para actuar contra detenninado ant-
ramifican paulatinamente, desde el hilio, por la cpsula, geno" si un linfocito no ha sido programado para actuar
hasta las trabculas y entre los lobulillos llega AL ES- contra un antgeno, simplemente es como si no existiera
PACIO CORTICO-MEDULAR donde forman asas capi- y al paso de un antgeno no le hace caso. En cambio si
lares, sigue enviando sangre tanto a la corteza como a ha sido previamente programado el linfocito no solo que
la mdula. Retorna la sangre por vasos venosos colate- es capaz de reconocer el antgeno, sino que se estimula
rales de las arterias y fomna las venas tmicas que dre- y prolifera, produciendo un clono de clulas que confor-
nan en el tronco venoso braquioceflico y tiroideas. me acta, aumenta en nmero, y anula la accin del
Mientras los capilares medulares no son permeables a antgeno.
macromolculas ni linfocitos, la regin de las venas Los linfocitos B se conocen como de defensa humoral
post-capilares son pemrieables a macromolculas y porque producen anticuerpos especficos de diferente
linfocitos y es el sitio en que un linfocito ya maduro y tipo como anticuerpo IgM, IgG, IgA, IgD o IgE.
programado puede tomar el torrente sanguneo y locali-
zarse en cualquier parte del organismo.

Barrera hemato-timica

Elemento importante del timo, mediante el cual impide


que los antgenos circulantes en el torrente sanguneo,
puedan ponerse en contacto con los linfocitos T en
proceso de comprometimiento o diferenciacin celular.
La barrera hemato-tmica est formada por:
Clulas endoteliales de los vasos sanguneos que
llegan al timo, como por ejemplo a la regin crtico-
medular
Membrana basal de las clulas endoteliales de los
vasos de capilares del timo
Espacio perivascular en donde hay tambin macr-
fagos, que estn a la caza de antgenos que logren
burlar las dos primeras barreras
Membrana basal de las clulas retculo epiteliales
Clulas reticuloepiteliales Observacin al microscopio:

Al lograr un antgeno burlar todos los anteriores obstcu-


los, podra ponerse en contacto con el linfocito T e
impedir su programacin, lo que dara como resultado
una tolerancia inmunolgica adquirida. Podra ser la
causa de una deficiencia en los mecanismos de defen-
120

NODULOS LINFOIDES:
En la descripcin histolgica del nodulo es necesario
Los nodulos linfoides son estructuras ovoides o redon- atender a la siguiente descripcin: Las estructuras nodu-
deadas, no encapsuladas, dispuestas en forma solitaria lares tienen un estroma formado por clulas dendrticas,
en el corion de algunos rganos como el digestivo, fibroblastos, fibras colgenas y fibras reticulares. El
respiratorio etc. con gran concentracin de linfocitos T y parnquima formado por linfocitos fonnados por una
B, primera masa de clulas sin lmites externos definidos
debido a que carecen de cpsula, este conjunto repre-
sentan el nodulo o folculo primario.

NODULO PRIMARIO
En el centro del nodulo o folculo linfoideo, cuando existe
estimulacin (es decir cuando hay llegada de antge-
MANTO nos), aparece una zona clara que se denomina el centro
germinativo de Fleming o nodulo secundario formado
CENTRO DE FLEMING
por linfocitos en fase de proliferacin por lo que no es
raro observar mitosis, tiene una coloracin clara debido
ZONA CLARA a la poca concentracin de linfocitos y al tipo de clulas
grandes que aqu se encuentran. El centro germinativo
ZONA OSCURA de Fleming presenta una semicircunferencia superior
' denominada zona clara y una semicircunferencia Inferior
denominada zona oscura. Limitando el semicrculo de la
zona clara hay un rodete de linfocitos ms concentrados
formando una especie de "cpsula" denominado manto.

GANGLIOS LINFTICOS:

Los ganglios linfticos son estructuras linfoi-


des, que tienen la forma de un rion pequeo y que
tienen como funcin la filtracin de la linfa gracias a los
linfocitos y a los macrfagos que poseen. Ubicados en el
trayecto de los vasos linfticos, sobre todo en el mbito
de la ingle, cavidad peritoneal, torcica, axilas y cuello.
Desde el punto de vista histolgico se consideran los
siguientes elementos:

Los nodulos pueden ser permanentes u ocasionales.


Los nodulos ocasionales, se forman a la llegada de una
muestra antignica (antgeno) que ha rebasado el epite-
lio. Al encontrarse con un linfocito empieza a proliferar
con un clono de clulas que rpidamente fomian una
estructura ovoide. Como su nombre lo dice son ocasio-
nales y se encuentran en la mucosa de algunos indivi-
duos, en otros no se presentan.

Cpsula fonnada de tejido conectivo fibroso, rodea


completamente al rgano, se engruesa en el hilio y
manda tabicaciones al interior, para simular lobuli-
llos. Puede estar rodeada de tejido adiposo, desde
la cpsula se desprenden fibras reticulares que son
parte del tejido de sostn del rgano.

Corteza fonnada de nodulos linfoides, localizados


a la periferia. Los linfocitos fuertemente apelotona-
dos en la cortical, envan cordones de clulas hacia
la mdula para formar los cordones medulares (Se
observa a los nodulos como piezas dentaras y a
los cordones como sus raices).

Mdula con la presencia de cordones medulares


que como qued dicho, son cadenas de linfocitos
que se desprenden desde los nodulos en la corte-
za.
Los nodulos permanentes sern estudiados en los
respectivos aparatos donde se encuentran. Por el mo- 4. Circulacin de la linfa, se considera los siguientes
mento solo los mencionamos y son: 1. Amgdala palati- elementos: a) vasos linfticos aferentes, o entrada
na, farngeas y linguales. 2. Placas de Peyer y GALT. 3. de la linfa. Ingresan al ganglio linftico por su cara
Apndice cecal o vermicular. 4. Tejido linfoide propio de convexa. Tienen unas vlvulas que permiten el pa-
los bronquios o BALT. Etc so de la linfa en una sola direccin, b) seno sub-
121

capsular o espacio que queda por debajo de la fibras musculares lisas que le confieren al rgano
cpsula del ganglio linftico llena de linfa, rodeando capacidad de contraccin, lo que da como resulta-
a este rgano como una fosa en un castillo medie- do que en un momento determinado enve ms
val, c) seno cortical une el seno subcapsular con el sangre a la circulacin general, til en el caso de
siguiente que es el seno medular, d) seno medular sangramientos o hemorragias. Una caracterstica
son como canales, por donde circula la linfa, locali- importante es que la cpsula del bazo no tiene teji-
zados al nivel de la mdula del ganglio linftico, en- do adiposo.
tre los cordones medulares, e) vasos linfticos efe-
rentes o vasos linfticos de salida del ganglio, sa- 2. Pulpa esplnica dividida en a) pulpa gris o blanca,
can la linfa filtrada. por la presencia de nodulos linfoides ampliamente
distribuidos en toda la economa del bazo, sin ubi-
5. Circulacin Sangunea: Las arterias ingresan por carse en la corteza como en el ganglio. Se deno-
el hilio, ubicado en la cara cncava del ganglio lin- mina pulpa blanca por estar formada de linfocitos
ftico y avanzan por la mdula hacia la corteza, (clulas blancas, en bazo sin coloracin), y se lla-
ramificndose paulatinamente hasta fomiar capila- ma tambin pulpa gris, porque cuando se utiliza
res ubicados en la corteza y que se desprenden de hematoxilina eosina, los linfocitos se tornan grises
las arterias arcuatas a nivel crtico-medular. La cir- por la hematoxilina. b) pulpa roja constituida por la
culacin de retorno se realiza por las venas satli- presencia de los sinusoides esplnicos y la sangre
tes de las arterias. que es filtrada a este nivel.

6. Variaciones histolgicas de los ganglios linfti- 3. Circulacin sangunea: Las arterias esplnicas
cos: a) con corteza desarrollada b) con mdula entran al bazo por el hilio, juntamente con las tabi-
desarrollada c) ganglios que en vez de linfa tienen caciones o proyecciones de la cpsula de este ni-
sangre y se denominan ganglios hemales. vel se continan en las denominadas trabculas
Los ganglios pueden presentar en algunos casos, esplnicas (trabculas son proyecciones de tejido
desarrollo de la corteza y en otros casos presentan conectivo desde la cpsula hacia la pulpa esplni-
la mdula desarrollada, en el curso de vasos san- ca). Las trabculas tambin dividen al bazo en es-
guneos, puede haber la presencia de ganglios que bozos de lobulillos, se ramifican y llega a los nodu-
en vez de circular linfa, circula sangre, a estos se los linfoides, siempre al centro de estas estructuras
los llama ganglios hemales y es normal. est una arteria que va transformndose en vasos
cada vez ms delgados, llamada arteria trabecular,
luego arteria folicular. Al llegar al folculo la arteria
centro folicular se contina con las arterias penicila-
res que tenninan capilarizndose y drenando la
sangre en los sinusoides del bazo.

BAZO:

El bazo es un rgano linfoide ubicado en el hipocondrio


izquierdo, dentro de otras funciones, filtra la sangre y
atrapa glbulos rojos envejecidos, destruidos, daados o
simplemente alterados.
LA AlVIIGDALA PALATINA
Desde el punto de vista histolgico observaremos:
LA AMIGDALA PALATINA constituye una estructura
formada por nodulos permanentes en el organismo. Los
nodulos se distribuyen en forma general en el estroma y
corion de este rgano. No forman ni^corteza ni mdula.
La caracterstica histolgica a ms delds-hdulos linfoi-
des es la presencia de un'epitelio estratificado sin quera-
tina que se profundiza para formar las criptas amigdali-
jjas.

1. Cpsula lisa, brillante, rodeando completamente al


rgano. Est formado de tejido conectivo fibroso y
122

INFORME PARA L A PRXIMA C L A S E DE LABORA-


TORIO.
1. Por qu la mdula sea debe ser considerado
como el nico rgano linfoide primario?
2. Cul es la diferencia entre linfocitos de la sangre y
linfocitos de los rganos linfoides?
3. De qu manera el bazo filtra la sangre y porqu
es un rgano linfoide?
4. Cul es el significado de los nodulos de Hassall?
5. Cmo es la circulacin de la linfa en el ganglio
linftico?
Cmo es la circulacin sangunea en el bazo?
7. Cul es el papel de las amgdalas?
8. Por qu es posible realizar una esplenectoma y
el individuo vive?
9. Qu es un nodulo solitario ocasional y cuando se
produce?
10. Haga los dibujos de los rganos observados en el
laboratorio.
CARACTERSTICAS DE RGANOS LINFOIDES
Cpsu- Corte- Mdula Linfti-
la za cos
TIMO Pre- No tiay Clulas Eferen-
sente nodu- retculo tes
con/sin los epitelial
grasa Y fcor-
psculos
de Has-
sall 1
NODU- Sin Ausen- ' Ausente fererv-
LOS cpsula te tes
GAN- Pre- Nodu- Cordones Aferen-
GLIO sente los medula- tes
LINFTI- con/ sin linfoi- res eferen-
CO grasa des tes
BAZO Lisa, Ausen- Ausente Eferen-
brillan- te tes
te, sin
grasa y
: con
fibras
lisas
123

P R A C T I C A D E L A B O R A T O R I O No C A T O R C E .

TEMA: OBSERVACIN DE TEJIDOS CONECTIVOS: TENDN Y CARTLAGO.


une a las fibras musculares. Compuesto casi ex-
Objetivo de la prctica: clusivamente de fibras colgenas, cuando el tejido
es viejo o con-esponde a un individuo de edad.
a) Reconocer la estructura del tendn y relacionarlo
con su funcin. Algunos tendones estn recubiertos de una vaina
b) Observar la estnjctura del cartlago y comprender tendinosa que favorece la reparacin en caso de
la funcin que desempea. ruptura, y como qued manifestada la funcin ms
c) Estudiar los tipos de clulas que forman estos Importante es evitar el desgaste del tendn.
tejidos.
d) Comparar la estructura, funcin, disposicin de las
clulas, las fibras y la sustancia fundamental en
cada uno de los diferentes tipos de cartlago.

Materiales:

1. Microscopio de luz.
2. Placas preparadas de tendn y cartlago humanos.

EL TENDN:

El tendn es un tejido conectivo de disposicin re-


gular. Est formado de clulas, fibras y sustancia inters-
ticial o fundamental. Se destaca la presencia de fibras.

a) Clulas: son fibroblastos-y" al envejecer se trans-


forman h'fibrocitos. Se dlspofieft'en hileras, como
lo observable son los ncleos aparentan un rosarlo
de ncleos. ^Algunos autores denominan a estas
clulas corrib tendlnocitos Aunque las clulas vie-
jas fibrocitos ya no son activos, de alguna manera
V- mantienen la estructura del tendn, al ir pasando
los aos los tendones pueden estar formados con REPARACIN DEL TENDN
pocas clulas.
En caso de ruptura del tendn, la reparacin remeda la
b) Fibras: son fibras colgenas, que discurren en un formacin del tendn. Primero existe una proliferacin
mismo plano y en una misma direccin, es decir, es de fibroblastos, ricamente vascularizados, la riqueza de
un tejido conectivo denso de disposicin regular. vasos sanguneos provee de nutrientes y Oxgeno a los
Las fibras colgenas se enlazan en la terminacin fibroblastos para la formacin de fibras colgenas.
del msculo, sobre el cual producen una traccin, Conforme se producen fibras colgenas, los vasos
importante para el movimiento. En sitios irregulares sanguneos van disminuyendo paulatinamente, al final
o donde el tendn discurre como una tijera, los de la reparacin se habrn formado suficientes fibras
tendones se cubren de una vaina tendinosa, con colgenas que se entrelazan con las fibras viejas y el
dos hojas, de tal manera que dejan un espacio, en tendn nuevo quedar pobremente vascularizado.
el que se produce lquido sinovial, para permitir un
deslizamiento sin desgaste del tejido. La reparacin es ms fcil si hay una vaina tendinosa, la
misma que impide que haya adherencias a planos veci-
c) Sustancia intersticial o sustancia fundamental, nos. La..reparacin del tendn en los nios es ms
formada de glucosaminoglicanos no sulfatados y rpid'en las personas adultas o de edad avanzada, la
otros componentes como protenas, proteoglica- reparacin es ms lenta, conforme pasan los aos la
nos, agua. Etc. reparacin es ms larga. Como vemos el proceso de
reparacin requiere de una rica vascularizacin, por ello
El tendn es un tejido que tiene insercin, en el te- frente a un desgarro de tendn o a una ruptura de ten-
jido seo a travs dn es necesaria una buena Inmovilizacin. Si hay
ruptura del tendn este se retrae y es necesario en
de las fibras de Sharpey y por el otro extremo se muchas ocasiones proceder a realizar un autoinjerto de
tendn, ventajosamente en el organismo hay tendones
que sirven para el efecto, por ejemplo se puede tomar el
tendn de la fascia lata para este acto quirrgico. Es
probable que el tendn injertado quede largo, pero el
organismo, posterionnente acortar el tendn a sus
necesidades fisiolgicas.

La reparacin del tendn debe hacerse con Inmoviliza-


cin, si se manipula la lesin con movimientos como
suelen realizar los "empricos o imprudentes" la forma-
cin de vasos sanguneos, necesarios en el inicio de la
reparacin no se har y la lesin podra agravarse o
nunca llegar a una reparacin.

/
124

Tcnica de observacin:
El cartlago est formado de clulas, fibras, y sustancia
1. Busque una placa de tejido muscular en la que fundamental o intersticial, como cualquier otro tejido
haya tendn. conectivo.
2. Localice el tendn en forma macroscpica, lo que
le orientar cuando est viendo a travs del mi- El cartlago se encuentra dentro del organismo, asocia-
croscopio. do al tejido seo, en el perodo fetal, muchos de los
3. Inicie sus observaciones con lente panormico y huesos largos sobre todo, tienen una estructura cartila-
contine con otras lentes de mayor aumento. ginosa.
4. Observe las fibras colgenas y distinga la direccin
que toman. Constituyen un molde de donde dar paso a la forma-
5. Compare la disposicin de las fibras en el tendn y cin de hueso. Tambin hay cartlago formando parte
la disposicin de las fibras colgenas en la derniis del aparato respiratorio como la laringe, la trquea, los
de la piel. bronquios. (Si encuentra cartlago en una placa histol-
6. Reconozca las clulas del tejido conectivo tendino- gica, debe pensar que ese cartlago es parte del esque-
so y observe la disposicin de los ncleos, anote leto o que forma parte del aparato respiratorio, tambin
como estn dispuestos. hay cartlago en la trompa de Eustaquio que es parte del
7. Diferencie la estructura del tendn, con las fibras aparato auditivo, el pabelln auricular En el cartlago la
musculares vecinas. sustancia^ intersticial se destaca de las otras, por la
8. Abra el libro y lea todo lo relacionado con el ten- presencile'cido cendro itin sulfrico, esta matriz le un
dn, trate de encontrar en su placa de observacin, aspecto gelatinoso y no permite la difusin de partculas
la mayor parte de la explicacin posible. grandes o macromolculas.

LIGAIVIENTOS
El cartlago y la inmunidad
Los ligamentos estn formados de haces de fibras
elsticas y colgenas, ya que los ligamentos se rodean Como las macromolculas no atraviesan la matriz carti-
de fibroblastos comunes. laginosa, el cartlago puede burlar el sistema inmunol-
gico del organismo, puesto que las inmunoglobulinas
Hay ligamentos en muchas partes del organismo como son protenas o macromolculas. Al realizar un injerto de
el ligamento cervical posterior denominado ligamento cartlago, lo ms comn es que se realice un haloinjerto
muchae, el ligamento amarillo de la columna o ligamen- o un heteroinjerto. No se realiza autoinjertos, puesto que
to flavo, ligamentos de la laringe en las cuerdas vocales, no existe cartlago de sobra, o a nadie se le ocurrira,
o los ligamentos cruzados de la articulacin fmoro sacar cartlago de la nariz para trasplantado a la rodilla o
tibial. Otros ligamentos a mencionar son el ligamento viceversa, o cortar una oreja etc. Este es el motivo para
periodontal que sujeta las piezas dentales a los alveolos, que en caso de necesidad de hacer un injerto de cartla-
el ligamento ancho, redondo en el ovario, etc. go se procede a realizar un haloinjertos (injerto de una
2.0 i-S
persona o de un animal un receptor)
6 V;.j La ruptura del ligamento, debido a su composicin
principal de fibras elsticas, es de difcil reparacin, Como el cartlago trasplantado debe tener un HLA dife-
ocurre ruptura de los ligamentos en los atletas princi- rente, el organismo husped, debera rechazarlo, pero
palmente futbolistas. Las fibras elstica son ms resis- las protenas cartilaginosas difcilmente pueden ser
tentes que las fibras colgenas, no tienen enzimas que reconocidas, pero si as lo hiciera el organismo, recono-
las metabolice, pero igualmente al daarse no hay ciendo la sustancia extraa, al formar inmunoglobulinas
clulas que las repare, en las arterias son las fibras y/o actuar los linfocitos T para la defensa celular, las
musculares lisas, quienes producen fibras elsticas. inmunoglobulinas estaran impedidas de ponerse en
Pero en caso de ruptura de ligamentos, es muy difcil su contacto con las clulas esculpidas en la matriz cartila-
reparacin, podra reparase con tejido tendinoso, ginosa, o en la matriz cartilaginosa nunca encontrare-
mos linfocitos.

TEJIDO CONECTIVO CARTILAGINOSO CRECIMIENTO D E L CARTILAGO

El cartlago es un tejido conectivo modelado, cuya fun- El crecimiento del cartlago se hace en forma intersticial
cin es: y en forma aposicional.

a) estructural, se encuentra asociado al esqueleto del El crecimiento intersticial del cartlago esta dado
organismo, o a nivel de las vas areas del aparato porque ios condroblastos, mantienen la capacidad de
respiratorio, permite mantener abierta la luz de trquea, dividirse por mitosis y como cada una de las clulas
bronquios forma una nueva laguna y a su alrededor secreta fibras
y sustancia fundamental, el tamao del cartlago aumen-
b) El cartlago sirve tambin como parte del esqueleto ta..
del organismo y puede soportar peso, o estar sometido
a soportarlo, pero no lo hace tan bien como lo hace el El crecimiento aposicional en cambio est dado por la
hueso, capacidad que tienen las clulas de la capa interna del
pericondrio (capa condrgena), para dividirse y caer
c) El cartlago puede constituirse en un molde para la como hojas de un rbol y as aumentar mayor cantidad
formacin posterior del hueso del organismo, cuando los de capas celulares, esta es otra forma de crecimiento
huesos tienen una osificacin endocondral. del cartlago.

d) El cartlago es responsable del crecimiento del indivi-


duo, cuando forma parte de los discos epifisarios en los
huesos largos.
125

Al completar la adolescencia y entrar en la edad adulta


(entre los 20 a 25 aos), el cartlago asociado al hueso
se calcifica, da paso a hueso y el individuo ya no crece-
r.

El cartlago hialino es importante para formar las super-


ficies articulares, ya que constituye el cartlago articular,
que tiene una superficie completamente lisa, lo que
permite que la articulacin se movilice adecuadamente,
mucho ms cuando estas superficies, tienen menor
roce, gracias al lquido sinovial.

Si hay desgaste de la superficie articular, el cartlago no


se repara. Si las superficies articulares se daan, el
individuo tendr una artrosis o una artritis, al moverse la
articulacin provocar dolor o impedimento para su
funcionamiento.

COMPOSICIN D E L CARTLAGO HIALINO:

CARACTERSTICAS D E L CARTLAGO El cartlago hialino al ser un tejido conectivo, est


formado por clulas, fibras y sustancia fundamental
A ms del tipo de crecimiento, otra caracterstica impor-
tante del cartlago es, que, es un tejido avascular es 1. Clulas que son:
decir carece de vasos sanguneos y la nutricin del
cartlago se realiza por mecanismos de difusin de los
nutrientes. Oxgeno, electrolitos y todos los elementos
necesarios para la sobrevida del tejido, desde los vasos
sanguneos localizados en el pericondrio o tejidos adya-
centes al cartlago que presentan capilares sanguneos
y permiten el aporte de nutrientes.

Al ser el cartlago avascular, es un tejido poco antignico


y presenta facilidades para utilizarlo en haloinjerto o
heteroinjertos sin que exista rechazo. El sistema inmu-
nolglco del organismo queda burlado porque el cartla-
go es avascular, y solo las micromolculas pueden
difundirse por su matriz, las macromoleculas como son
las inmunoglobulinas, en caso de formarse y de alguna
manera, reconocer al cartlago injertado como una
sustancia extraa, no pueden atravesar la matriz y no se
contactan con las clulas del cartlago, aunque genti-
camente sean diferentes.

Los linfocitos T, tampoco alcanzaran a ponerse en


contacto con las clulas extraas del cartlago. Los
tejidos avasculares como el cartlago, la crnea y otros a) clulas condrgenas, o clulas madres ubicadas en
pueden ser utilizados en Injertos, aunque su HLA o el la capa interna del pericondrio, son clulas indiferencia-
DNA sean diferentes. das hasta cierto punto, con una bipotencialidad ya que
forman condroblastos (responsables de la presencia de
cartlago) o forman osteoblastos (responsables de la
Clasificacin: encontramos tres tipos de cartlago: formacin de hueso). Son capaces de formar condro-
blastos y consecuentemente dan origen al aparecimien-
1. Cartlago iialino. to del cartlago; pero tambin pueden producir osteo-
2. Cartlago fibroso o fibrocartlago. blastos originando hueso
3. Cartlago elstico.
Las clulas condrognicas son estrechas y fusifonnes,
derivan de las clulas mesenquimatosas. Poseen un
CARTLAGO HIALINO ncleo ovoide, con uno o dos nuclolos. El citoplasma
es escaso con un aparato de Golgi pequeo, retculo
El cartlago hialino joven se presenta macroscpicamen- endoplasmtico rugoso discreto, pocas mitocondrias.
te como un tejido blanquecino, vidrioso perlado, transpa-
rente, o semilcido, flexible, y es el ms extenso de los
tipos de cartlago. Cuando envejece el cartlago tiene un b) condroblastos o clulas jvenes, principales consti-
aspecto amarillento, poco traslcido, ya no es tan flexi- tuyentes de la estructura del cartlago. Producen fibras
ble. Se encuentra en la nariz, laringe, extremos de las colgenas y la sustancia fundamental, son clulas em-
costillas, sitios que conectan al esternn, en los anillos parentadas con los fibroblastos, osteoblastos, odonto-
traqueales y bronquiales. blastos, en todas ellas se ve un denominador comn
que es el de producir fibras colgenas
En el perodo prenatal el cartlago constituye un molde
para los huesos que tienen ua osificacin endocondral, Por ello las clulas presentan una basofilia citoplasmti-
al calcificarse el cartlago es sustituido por hueso. Los ca por la presencia de REr importante ribosomas, mito-
huesos al no tener crecimiento intersticial, no pueden condrias y aparato de Golgi.
crecer en longitud, por ello es necesario que exista
cartlago en la metfisis de los huesos (disco epifisario).
126

Los condroblastos producen la sustancia fundamental bre los otros componentes en el cartlago. Est
que consiste en glucosaminoglicanos sulfatados del tipo formada por: a) protenas de 40 a 70 % constituida
4 condroitinsulfato, 6 condroitinsulfato, heparn sulfato y principalmente por colgena, b) por proteoglicanos,
dermatn sulfato. La secrecin de estas sustancias c) de glucosaminoglicanos sulfatados (cido cendro
sobre todo el 4 y 6 condroitinsulfato dan con coloracin itin sulfrico). Condrocalcina y Condronectina, etc.
H.E un halo basfilo intenso alrededor de las lagunas
zona denominada territorial, la zona menos basfila La matriz del cartlago es rica en agrecanes, que son
entre las diversas lagunas se conoce como zona interte- grandes molculas de proteoglicanos, recuerde la es-
rritorial. tructura de los proteoglicanos en el tejido conectivo,
igualmente en el cartlago aparecen estas macromolcu-
d) condrocitos (cito = viejo), el condrocito es una las que atrapan por ejemplo agua y le dan la flexibilidad
Clula vieja terminal del cartlago, esta clula se origina al cartlago. En la matriz del cartlago encontramos hasta
en los condroblastos, cuando sta ha terminado la un 80 % de su peso, de agua.
formacin de fibras colgenas y de sustancia fundamen-
tal. Los condrocitos estn rodeados de la matriz cartila- En la matriz hay tambin Condronectina una protena
ginosa, en el interior de las lagunas, son las clulas similar a la fibronectina y el papel es permitir el enlace
responsables de mantener la estructura cartilaginosa, entre los condrocitos y las fibras, mecanismo que con-
mientras estas clulas persistan habr cartlago. Al serva la estructura cartilaginosa
envejecer estas clulas se hipertrofian, acumulan en el
citoplasma lpidos y carbohidratos, empieza a producir
fosfatasa alcalina, permiten la enucleacin de sales de
calcio y se calcifica. Al calcificarse el cartlago da paso a
la formacin de hueso.

Los condroplastos o lagunas (nombre tomado por ex-


tensin, de los osteoplastos en el tejido seo). Son
estructuras del cartlago donde se alojan las clulas:
condroblastos o condrocitos, constituyen verdaderas
lagunas o "casitas".

Alrededor de los condroblastos y condrocitos se deposi-


ta mayor cantidad de matriz, cargada de cido con-
droitinsulfrico, lo que le da cierta basofilia perifrica,
conocida como zona territorial o para algunos autores
una falsa cpsula. La presencia de la zona territorial
sirve para distinguir un cartlago joven de uno envejeci-
do, pues con el paso del tiempo, la zona territorial va
disminuyendo.

2. Fibras: Son las fibras colgenas de tipo II, produ-


cidas por los condroblastos, estas fibras no se ob-
servan al microscopio de luz porque presentan un
tamao de 10 a 100 nm, es decir estn por debajo
del poder de resolucin del microscopio de luz. Se
las observa con microscopio electrnico.

En el cartlago hialino se encuentran estas fibras col-


genas. En el cartlago elstico hay adems de fibras
colgenas fibras elsticas, pero para observarlas es Pericondrio: Es un tejido comparable a la cpsula
necesario pigmentarias con coloraciones especiales. En de rganos, est formado de dos capas: a) capa fi-
el cartlago fibroso hay predominio de fibras colgenas y brosa formada de tejido conectivo denso fibroso.
si se observan al microscopio de luz.

3. Sustancia Fundamental o sustancia intersticiaL


La sustancia fundamental es la que se destaca so- dispuesto en la parte externa, aqu hay fibroblastos,
127

fibrocitos y fibras colgenas, b) capa condrgena o 3. Observe el pericondrio y la disposicin de las fibras
capa interna de clulas madres, productoras de elsticas con relacin a ste y al espesor del cart-
condroblastos. lago.
4. Investigue en qu sitios del organismo se encuen-
Son estas clulas responsables del crecimiento aposi- tra este tejido.
cional del cartlago. El cartlago crece tambin en forma
intersticial dado por la divisin y crecimiento de los CARTLAGO FIBROSO:
condroblastos.
Denominado tambin como fibrocartlago, se encuentra
en lugares del hueso, donde hay insercin de tendones,
en los discos intervertebrales, en la snfisis del pubis.
Tcnica de Observacin: del cartlago hialino
El cartlago fibroso pierde en la edad adulta o no tiene el
1. Busque una placa de trquea y observe macrosc- pericondrio. Tiene una escasa matriz cartilaginosa ya
picamente, distinga el cartlago, se distingue por- que lo que predomina en este tipo de cartlago son las
que tiene la forma de una C, con una basofilia im- fibras colgenas.
portante. La C de la trquea mantiene la luz de es-
te rgano.
2. Inicie la observacin con lente de menor aumento,
encuentre el cartlago hialino.
3. Ubique el pericondrio y distinga las dos capas: a)
capa fibrosa externa, formada de tejido conectivo
fibroso, con fibras colgenas y fibroblastos y b) ca-
pa condrgena interna compuesta de clulas con-
drgenas o clulas que al dividirse aumentan el
espesor del cartlago.
4. Observe los condroblastos y condrocitos, distinga
la morfologa y otras caractersticas celulares, co-
mo la forma y la localizacin del ncleo, vea la
agrupacin y califique esta asociacin: nidos celu-
lares o grupos isgenos coronarios, o si se encuen-
tran en hileras como grupos isgenos lineales.
5. Mire las lagunas o condroplastos, son los sitios
donde se ubican las clulas del cartlago.
6. Descubra la presencia de la zona territorial o mal
llamada cpsula y la zona interterritorial o zona in-
tercapsular, califique al tejido de acuerdo con esta
observacin.
7. Abra el libro y lea todo lo relacionado con el cartla-
go, trate de encontrar explicacin de lo estudiado y
su aplicacin al observar al microscopio.
Las clulas suelen ser redondas y grandes y producen
las fibras colgenas que son de tipo I, por lo tanto si son
visibles al microscopio de luz. Los condroblastos y
CARTLAGO ELSTICO: condrocitos se encuentran fomnando grupos isgenos
lineales y las clulas madres localizadas en el centro de
El cartlago elstico es muy resistente y sirve para ser estos grupos lineales suelen ser ms grandes
flexionado repetidamente. Se encuentra en la trompa de
Eustaquio que es parte del odo medio, tambin hay El cartlago fibroso se puede observar en placas histol-
cartlago elstico en la epiglotis que cierra la glotis u gicas de los discos intervertebrales, en el centro de
orificio superior de la laringe, Tambin es parte del estos discos se encuentra el ncleo pulposo formado de
pabelln auricular, forma el cartlago cuneiforme de la clulas derivadas del notocordio, se encuentran rodea-
laringe. das de cido hialurnico, estas clulas desaparecen a
los 20 aos de edad. El ncleo pulposo se rodea del
El cartlago elstico es discretamente amarillento, anillo fibroso que est fonnado de capas de cartlago
histolgicamente es parecido al cartlago hialino, con la fibroso, cuyas fibras colgenas tipo I, corren en sentido
diferencia de que a ms de fibras colgenas, hay la vertical, entre los cartlagos hialinos ente las dos vrte-
presencia de libras elsticas sobre todo a nivel del bras. El anillo fibroso brinda proteccin al ncleo pulpo-
pericondrio, para la observacin de la fibras elsticas es so gelatinoso.
necesario coloraciones especiales como orcena, por lo
tanto la observacin de este tipo de cartlago necesita
coloracin con hematoxilina orcena.
Tcnica de Observacin del cartlago fibroso
Este tipo de cartlago conserva la presencia del pericon-
drio hasta la edad adulta, al igual que el hialino. El cart- 1. Observe los condrocitos, y describa la disposicin y
lago fibroso en la edad adulta pierde el pericondrio. tamao de los mismos.
2. Examine las fibras colgenas y describa su dispo-
Tcnica de la observacin del cartlago elstico sicin.
3. Note la zona territorial y describa su disposicin.
1. Mire la sustancia intersticial y encontrar la presen- 4. Mire la disposicin y la forma del ncleo, compare
cia de fibras elsticas de distinto espesor. con los otros tipos de cartlago.
2. Observe el tamao de los condroblastos y condro-
citos, su ubicacin y describa como se encuentran.
se

128 w

5. Abra el libro y lea lo relacionado a cartlago fibroso, CUESTIONARIO PARA L A SIGUIENTE C L A S E DE


y trate de plasmar los conocimientos tericos con la LABORATORIO.
observacin al microscopio. 1. Haga un cuadro sinptico de los diferentes tipos de
6. Investigue en donde se encuentra este tejido. cartlago, indicando las semejanzas y diferencias.
2. Cul es la importancia del pericondrio en el cre-
cimiento del cartlago?
3. Cul es el significado de la cpsula o zona territo-
rial en el tejido cartilaginoso?
4. Cul es la composicin de la sustancia fundamen-
tal 0 intersticial del cartlago? \
5. Por qu el cartlago es poco o nada inmunogni-
co? \
6. Por qu la reparacin del cartlago se iiace con
trasplante fieterlogo?
7. Por qu el cartlago articular no tiene crecimiento
aposicional?
8. Cmo se puede realizar la reparacin del cartla-
go fracturado? \
9. Qu tiempo dura la reparacin del tendn de
Aquiles en nios y en adultos? \
10. Haga los dibujos de las observaciones al microsco-
pio y ponga nombres.

^ Tom , ^
Observacin de trquea, busque el cartlago y sea-
129

PRCTICA D E L A B O R A T O R I O No QUINCE.

TEMA: OBSERVACIN DEL TEJIDO SEO COMPACTO Y ESPONJOSO.

Objetivo de la prctica:

a) Reconocer ei tejido seo y estudiar cada uno de


sus componentes y estructuras.
b) Comparar el tejido seo con el cartilaginoso y
diferenciar la estructura, composicin y funcin de
cada uno de ellos.
c) Comparar y diferenciar el tejido seo compacto del
tejido seo esponjoso.
d) Observar la mdula sea en el tejido seo espon-
joso.
e) Aprender a elaborar una placa histolgica de tejido
seo de pollo, mediante la tcnica del esmerilado o
pulido.

Materiales:

Microscopio de luz
Placas de tejido seo compacto y esponjoso de
pollo, preparadas con la tcnica de esmerilado o
pulido, realizado en forma personal e individual por
cada uno de los alumnos.
3. Placas preparadas de tejido seo compacto y
esponjoso humanos, con cortes por la tcnica de la
parafina y coloreadas con H.E. El tejido seo es-
ponjoso deben contener mdula sea.

PREPARACIN DE UNA PLACA DE TEJIDO SEO


ESPONJOSO O COMPACTO DE POLLO, POR LA
TCNICA DEL ESMERILADO O PULIDO. Tcnica de Observacin de una placa de hueso
compacto en corte transversal y longitudinal, de
1. Obtenga una muestra de hueso de pollo por ejem- tibia de pollo.
plo tibia de pollo.
2. Corte dos lminas delgadas de hueso con una 1. Coloque en la platina del microscopio la placa de
sierra, la una en corte transversal de la difisis de hueso a estudiar y enfoque con lente panormico.
la tibia y otro corte longitudinal tambin de la difi- 2. Determine el tipo de corte que va a observar, si es
sis de la tibia de pollo. Otras muestras para estudio corte transversal o longitudinal.
pueden incluir segmentos de epfisis del hueso. 3. Aumente el lente de observacin a 10 X y 40 X.
3. Comience a pulir con una lija gruesa, conforme Recuerde que toda observacin al microscopio, se
vaya adelgazndose el hueso, siga puliendo pero debe iniciar con la lente de menor aumento, en
con lijas ms finas. nuestro microscopio es el objetivo de 3,2 X
4. Deje de pulir cuando las laminillas obtenidas estn 4. Observe las osteonas o sistemas de Havers, deli-
tan delgadas como una hoja de gillette o una hoja mite las estructuras.
de papel. 5. Mire los conductos de Havers, ubicados en el
5. Complete el pulido con una piedra de afilar o con centro de las osteonas.
lija de agua. 6. Observe las clulas seas (osteoblastos y osteoci-
6. Monte la preparacin, sobre una placa portaobje- tos) en sus lagunas o osteoplastos.
tos. 7. Busque la presencia de los conductillos seos o
7. Coloree, el montaje con azul de metileno por apro- canalculos seos.
ximadamente 5 minutos. 8. Rastree la ubicacin y presencia del periostio
8. Lave la placa en agua corriente, tratando de elimi- alrededor del tejido.
nar el exceso de colorante. 9. Rastree la ubicacin y presencia del endostio
9. Protjalo con un cubreobjetos. revistiendo los conductos de Havers.
10. Mire al microscopio. 10. Examine las estructuras del periostio y endostio y
establezca las semejanzas y diferencias.
La elaboracin de una placa de tejido seo por esta
tcnica, demanda mucho tiempo, de manera que reali-
zar el trabajo con varios das de anticipacin. Debe
traer sus placas coloreadas, montadas y protegidas con
el cubreobjetos.
Podra intentar preparar otras placas de tejido seo de
otros animales.
Otra tcnica en la preparacin de tejido seo, es me-
diante la tcnica de la parafina, con corte en micrtomo.
Esta tcnica requiere que antes de proceder a los pasos
para el endurecimiento del tejido por parafina, el hueso
debe ser sometido a un proceso de descalcificacin que
se lo hace sometiendo al hueso a una solucin de EDTA
(cido etilen diamino tetra actico).
130

11. R e p a r e e n la p r e s e n c i a d e las laminillas s e a s y n c l e o s p i n t a d o s d e a z u l ) , o si s e t r a t a d e u n a t e j i -


distinga e n t r e laminias c o n c n t r i c a s y e x c n t r i c a s ; do de mdula sea amarilla.
c i r c u n f e r e n c i a l e s internas y c i r c u n f e r e n c i a l e s exter- 9. O b s e r v e las e s t r u c t u r a s q u e c o n f o r m a n el e s t r o m a
nas. (clulas a l m a c e n a d o r a s d e g r a s a , f i b r a s c o l g e n a s ,
12. O b s e r v e la placa c o n h u e s o p r e p a r a d o y e n corte reticulares o d e reticulina, o t r a s c l u l a s c o m o o s -
longitudinal t e o c l a s t o s o la p r e s e n c i a d e o s t e o b l a s t o s .
13. B u s q u e la d i s p o s i c i n d e las laminillas s e a s 10. O b s e r v e las c l u l a s d e la m d u l a o p a r n q u i m a ,
14. O b s e r v e los c o n d u c t o s d e H a v e r s d e s c u b r i e n d o p r i m e r o la c a n t i d a d y c a l i d a d d e m e -
15. O b s e r v e los c o n d u c t o s d e V o l k m a n gacariocitos o megacarioblastos, contine investi-
16. H a g a los d i b u j o s c o r r e s p o n d i e n t e s d e las o b s e r v a - g a n d o la p r e s e n c i a d e c l u l a s d e la s e r i e roja y
ciones l u e g o las c l u l a s d e la s e r i e b l a n c a .
17. Con una cmara fotogrfica tome fotos (microfoto- 11. O b s e r v e d e s e r p o s i b l e s las d i f e r e n t e s c l u l a s e n
grafas) p r o c e s o d e m a d u r a c i n , h a s t a llegar a c o n s t i t u i r s e
e n los e l e m e n t o s f i g u r a d o s d e la s a n g r e , ( e r i t r o c i -
tos, plaquetas, leucocitos)

T c n i c a d e o b s e r v a c i n d e u n a p l a c a d e tejido s e o
e s p o n j o s o y de mdula sea. Observacin de un d i s c o epifisario.

1. E n f o q u e u n a placa d e tejido s e o e s p o n j o s o y a P a r a la o b s e r v a c i n del d i s c o epifisario, d e b e tener


p r e p a r a d a y c o l o r e a d a c o n la t c n i c a d e H e m a t o x i - placas que tengan estas estructuras
lina y e o s i n a . ( G e n e r a l m e n t e e s t a s p l a c a s s o n o b -
t e n i d a s m e d i a n t e una p u n c i n b i o p s i a d e la c r e s t a 1. O b t e n g a una m u e s t r a d e tejido s e o q u e . c o n t e n g a
ilaca p s t e r o s u p e r i o r ) un d i s c o epifisario.
2. D i f e r e n c i e los d o s tejidos f u n d a m e n t a l e s q u e s e 2. O b s e r v e c o n lente p a n o r m i c o y d i s t i n g a los d i f e -
v i s u a l i z a n , el uno c o r r e s p o n d e a las e s p c u l a s r e n t e s estratos q u e c o m p o n e n e s t a e s t r u c t u r a .
s e a s y el o t r o a la m d u l a s e a h e m a t o p o y t i c a o 3. O b s e r v e las c l u l a s c o n d r g e n a s y e s t u d i e s u
mdula sea amarilla. e s t r u c t u r a ( f o r m a del n c l e o , p r e s e n c i a d e c i t o -
3. O b s e r v e la d i s p o s i c i n d e los o s t e o c i t o s en las p l a s m a , c o l o r a c i n , z o n a territorial, d i s p o s i c i n d e
e s p c u l a s y diga si o b s e r v a o n o laminillas s e a s . las clulas).
C o m p a r e c o n las o b s e r v a c i o n e s d e tejido s e o 4. O b s e r v e la z o n a c o r r e s p o n d i e n t e a la p r o l i f e r a c i n
compacto. de condroblastos.
4. O b s e r v e si las e s p c u l a s t i e n e n v a s o s s a n g u n e o s y
de no tenerlos explique c m o se produce su nutri- 5. O b s e r v e la z o n a d e los c o n d r o c i t o s y d e f i n a las
cin. d i f e r e n c i a s c o n la a n t e r i o r c a p a .
5. Mire la e s p e c i e d e r e d q u e f o r m a n las e s p c u l a s 6. O b s e r v e la z o n a d e c a l c i f i c a c i n del c a r t l a g o .
s e a s en el e s p e s o r d e e s t a m u e s t r a . 7. O b s e r v e el tejido s e o recin f o r m a d o .
6. D e s c u b r a la p r e s e n c i a o n o d e periostio o d e 8. O b s e r v e la z o n a d e c e m e n t a c i n o a g u a .
endostio y describa su estructura. 9. Mire la z o n a c o r r e s p o n d i e n t e a h u e s o viejo.
7. lyiire la m d u l a s e a e n c e r r a d a e n t r e las e s p c u l a s
seas
8. C o n u n a o b s e r v a c i n p a n o r m i c a , d e s c r i b a la
m d u l a p r e s e n t e ; si e s m d u l a a c t i v a c o n p o c a s o
m u c h a s c l u l a s (se d i s t i n g u e por la p r e s e n c i a d e
131

El cartlago crece en fonna aposicional e intersticial, el


hueso solo puede crecer en forma aposicional por lo que
el hueso solo podra aumentar su espesor, pero no su
longitud. Como se entender es el disco epifisario el
responsable del crecimiento en longitud del hueso.

El cartlago y el hueso presentan una capa de cubierta


que es el periostio en el hueso y el pericondrio en el
cartlago. La misma capa que cubre al cartlago al dar
paso este a hueso, el pericondrio se transforma en
periostio. De ah que cuando hay una fractura, la repa-
racin de la misma se har con hueso si la tensin de
Oxgeno es alta, es decir si hay una rica vascularizacin.
Si hay baja tensin de Oxgeno la capa interna del
periostio-pericondrio formar condroblastos y por lo
tanto intenta reparar la fractura con cartlago.

COMPOSICIN DEL TEJIDO SEO

Las Clulas:
vjtft |jt dm 2aivtt |4lterjidone tienen lugof en a n i l l o
y k fomiadR de ic^idct o . Uncin de fA;antftnJi!nA j- azul de
tiddina. ^ucfio aumcno. 1, CLULAS OSTEGENAS U OSTEOPROGENITO-
RAS, se encuentran en el periostio y en el endostio. Se
diferencian a partir del mesnquima, igual que la mayo-
ra de clulas que forman los tejidos conectivos, as
E L TEJIDO CONECTIVO SEO. forman las clulas del hueso. Estas clulas ostegenas
son las mismas clulas que en una etapa de la vida
El tejido seo es un tejido conectivo de sustancia fun- forman parte del pericondrio y consecuentemente for-
damental dura, que le sin/e al organismo, para soportar man condroblastos y cartlago.
peso, y en consecuencia es la principal estructura del
esqueleto, el mismo que le sirve para proteger muchos Estas clulas mantienen una bipotencialidad es decir
rganos como el del Sistema Nervioso Central, formar la son capaces de formar hueso o cartlago, dependiendo
jaula torcica que protege a los pulmones y corazn. de la tencin de O2, por ello cuando reparan una fractu-
Otras funciones importantes del tejido seo son: a) ra, si el sitio es reparado con una buena tensin de O2
Reservorio de calcio, b) sostn de mdula sea. forma osteoblastos y se repara con hueso, si el sector
tiene una baja tensin de O2 fonna condroblastos y el
FUNCIONES DEL TEJIDO SEO resultado es que la fractura se repara con cartlago. Es
1. Soporta peso y constituye el esqueleto y e s parte por esta razn que cuando hay una fractura se debe
del sistema locomotor inmovilizar las articulaciones comprometidas con el
2. Reservorio de Calcio hueso roto para evitar la ruptura de capilares sangu-
3. Sostn de ia mdula sea neos neoformados que llevan el Oxgeno necesario, de
otra manera al iniciarse la reparacin de la fractura si
El hueso como todo tejido conectivo est formado de hay movimiento aunque aparentemente imperceptible,
clulas, fibras y sustancia fundamental. los vasos sanguneos se destruyen y la tensin de
Oxgeno cae por lo que se forman condroblastos y la
El hueso es diferente al cartlago en varios aspectos, es fractura se repara con cartlago.
similar en otros:
E L PERIOSTIO
El hueso es ms duro que el cartlago, por lo que sopor-
ta peso de mejor manera, sin embargo el hueso puede Est formado igual que el pericondrio, por una capa
degenerar cuando soporta un peso excesivo y por mu- fibrosa y una capa celular, las clulas tienen la capaci-
cho tiempo. Como veremos el metabolismo del hueso es dad de dividirse por mitosis. Esta capa ostegena u
muy alto por lo que tiene que estar en renovacin cons- osteoprogenitora al dividirse por mitosis puede formar
tante, al soportar un peso excesivo, exagerado y por unas clulas madres y otras que se diferencian a osteo-
mucho tiempo el hueso se deforma, ejemplo en obesos blastos.
con sobrepeso mrbido.
Las clulas osteoprogenitoras y por lo tanto el periostio
Mientras el cartlago es avascular, el hueso es ricamente son responsables del crecimiento aposicional del hueso
vascularizado, esto debido al alto metabolismo que tiene que es la nica manera en que el hueso crece, es decir
que sufrir el hueso, cuando est en constante remodela- el hueso solo puede crecer en espesor.
cin, resorcin sea versus formacin de hueso. El El crecimiento en longitud lo realiza el disco epifisario o
hueso presenta gran cantidad de vasos sanguneos, la cartlago de crecimiento.
nutricin de los osteoblastos y osteocitos se realiza por
el aporte de Oxgeno y nutrientes a partir de capilares El periostio cubre al hueso en toda sus superficie, ex-
sanguneos y conductillos o canalculos seos, que son cepto en las superficies articulares, que a su vez termina
comunicaciones entre las clulas del hueso en cartlago, llamado cartlago articular.

La sustancia o matriz sea est calcificada, por lo que la E L ENDOSTIO


nutricin en el hueso es diferente, y la dureza del hueso
es mayor que el cartlago. El cartlago tiene un 40% de El endostio est formado solo por la capa ostegena,
colgena, en relacin a la matriz orgnica, el hueso carece de la capa fibrosa que tiene el periostio. Se ubica
tiene el 70% de colgena. en el interior del canal medular en los huesos largos, y
132

revistiendo las cavidades o las espiculas que deja el miento de los osteoclastos y por lo tanto la desminerali-
hueso esponjoso. zacin del hueso.

Es responsable del crecimiento al interior de laminillas Los osteoblastos al envejecer se denominan osteocitos
seas que permiten la transformacin de hueso espon- y ya no producen sustancia fundamental y fibras colge-
joso en hueso compacto. Las clulas del endostio estn nas, pero de alguna manera son capaces de mantener
rodeadas del conducto de Havers y por lo tanto al divi- la estructura del hueso.
dirse en las lagunas de Howship cierran las lagunas
progresivamente y forman nuevas osteonas o sistemas La calcificacin del hueso es el depsito de sales de
haversianos. Ca**, formando cristales denominados de apatita e
hidroxiapatita, esto le da la consistencia al hueso para
ser duro y comparable al de una piedra, pero debemos
L O S O S T E O B L A S T O S o clulas jvenes del tejido definir claramente ciertos trminos relacionados con el
seo, producen las fibras colgenas y la matriz orgnica hueso como:
del hueso que implica formar colgena, proteoglicanos,
glucosaminoglicanos sulfatados, partculas de Osteocal-
cina, Osteonectina y osteopondina. Osificacin: Es la formacin de hueso ya sea de un
molde cartilaginoso, llamado osificacin endocondral o
de una membrana y se denomina osificacin intramem-
branosa. Existe un tercer tipo de Osificacin denomina-
da heterotpica que consiste en el aparecimiento de
hueso en un sector que normalmente no hay hueso. Los
osteoblastos se disponen en hileras a manera de un
tejido epitelial cbico sobre el hueso joven o recin

0
formado, su citoplasma es muy basfilo puesto que
activamente produce las fibras colgenas y la sustancia
fundamental, presentan largas prolongaciones citoplas-
mticas que se unen a otras vecinas, para formar los
conductillos o canalculos seos, que permiten la nutri-
cin de clulas vecinas y sobre todo de las que se alejan
del conducto de Havers. El citoplasma de los osteoblas-
tos contiene fosfatasa alcalina para que el hueso se
mineralice, adems de citoquinas, factores de crecimien-
to de accin local que regulan los procesos de osifica-
cin y resorcin sea, como la interleucina I, 6 y 11 que
es un factor de crecimiento de osteoclastos, adems se
estimula el crecimiento de los osteoclastos la hormona
paratiroidea (1,25-dihidroxicolecalciferol, que es la vita-
mina D activa). La BMP (proteina modeladora sea)
favorece la formacin de hueso.

La osificacin de un modelo cartilaginoso de un hueso


largo, inicia la formacin y aparecimiento de hueso en la
difisis del hueso, a esto se denomina osificacin prima-
Los Osteoblastos son clulas con largas prolongaciones ria. En las epfisis de los huesos largos aparece un
citoplasmticas que hacen anastomosis con otras clu- segundo sitio de osificacin denominado osificacin
las vecinas, lo que permite que al depositar calcio en el secundaria. La osificacin primaria y secundaria avanza
espacio intersticial, constituyan tutores para la formacin paulatinamente a unirse, pero no ser sino al trmino del
de canalculos seos, necesarios para la nutricin de los crecimiento del individuo cuando el cartlago desaparez-
osteocltos o clulas adultas del hueso. ca. El cartlago que permanece entre los puntos de