See

discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/281064853

Characterization of Bacterial Symbionts in

Deep-Sea Fauna: Protocols for Sample
Conditioning, Fluorescence In Situ...

Chapter May 2015

DOI: 10.1007/8623_2015_73

CITATIONS READS

2 147

1 author:

Sbastien Duperron
Pierre and Marie Curie University - Paris 6
95 PUBLICATIONS 1,676 CITATIONS

SEE PROFILE

Some of the authors of this publication are also working on these related projects:

PhD: Patterns in adaptive developmental biology and symbioses of small-sized deep-sea

chemosymbiotic mussels (Bathymodiolinae) View project

All content following this page was uploaded by Sbastien Duperron on 18 August 2015.

The user has requested enhancement of the downloaded file. All in-text references underlined in blue are added to the original document
and are linked to publications on ResearchGate, letting you access and read them immediately.
Characterization of Bacterial Symbionts in Deep-Sea Fauna:
Protocols for Sample Conditioning, Fluorescence In Situ
Hybridization, and Image Analysis
Sebastien Duperron

Abstract
Symbioses with bacteria are key adaptations allowing various groups of metazoans to reach high biomasses
at deep sea reducing habitats including hydrothermal vents and cold seeps. Characterizing these associa-
tions is challenging due to the constraints associated with work on deep-sea organisms. These include
limited sample availability, impact of recovery procedures and shipment on sample quality, and general lack
of environmental data. In this chapter, a standard procedure for sample processing at sea which can
maximize sample use back in the laboratory is presented, with example protocols for sample fixation,
fluorescence in situ hybridization (FISH)-based localization of symbionts in animal tissues, and estimation
of their relative abundances in the case of multiple symbioses.

Keywords: Deep sea, Fluorescence in situ hybridization, Sample conditioning, Symbiosis

1 Introduction

The study of bacterial symbioses in animal hosts has enjoyed renewed

interest in recent years, thanks to advances in culture-independent
approaches with which information can be acquired without the
need to isolate symbionts in pure cultures [1]. In the marine realm,
symbioses are of prime importance to their hosts in various habitats
and fundamental in maintaining the high biomass often recorded at
deep-sea cold seeps and hydrothermal vents [2]. There, diverse
metazoan groups including arthropods, annelids, and mollusks asso-
ciate with different types of bacteria [3]. The most common associa-
tions involve sulfur-oxidizing Gamma- or Epsilonproteobacteria and
methane-oxidizing Gammaproteobacteria, the latter being mainly
reported in mytilid bivalves [4]. However, several recent studies
employing molecular and microscopic approaches have revealed a
broader diversity of bacterial taxa involved in symbiosis including
methylotroph- and Cycloclasticus-related symbionts, member of the

T.J. McGenity et al. (eds.), Hydrocarbon and Lipid Microbiology Protocols, Springer Protocols Handbooks,
DOI 10.1007/8623_2015_73, Springer-Verlag Berlin Heidelberg 2015
 Sebastien Duperron

Bacteroidetes, as well as various unknown Gammaproteobacteria,

some of which even occur within host cell nuclei [58]. Depending
on the host taxa, symbionts can occur on the tegument surface
(annelids, arthropods), in gills (mollusks), in the gut or digestive
gland (arthropods, mollusks, annelids), or in dedicated organs, such
as the trophosome in some annelids. Vertically transmitted sym-
bionts also occur in the gonads, while horizontally acquired bacteria
may occur free-living in the environment [912].
Gaining information regarding the identity, localization, and
metabolism of bacterial symbionts is mandatory for understanding
the symbiotic system. However, deep-sea biology is by nature
sample limited due to constraints associated with sample collection,
be they performed using submersibles or surface-operated devices
such as box corers. Limited sample availability (not to mention
rarity of certain species), pressure-related issues during recovery,
sample processing onboard, and shipment must all be properly
managed so that all necessary material is available back in the
laboratory. Sampling and conditioning strategy must thus be
planned carefully, particularly when no further visits to the deep-
sea site are anticipated. The aim of this chapter is to describe a
standard procedure for sample processing at sea which can maxi-
mize sample use by permitting a wide array of techniques to be
carried out in the laboratory with example protocols for the locali-
zation and relative abundance measurement of microbial symbionts
provided. The first section is dedicated to study design, which
summarizes important points to be considered prior to and during
sampling at sea. Materials are summarized in the second section.
Several protocols follow, detailing proper sample processing
onboard with a variety of subsequent analyses in mind, appropriate
means to facilitate sample shipment depending on constraints, and
specific protocols for symbiont visualization and relative symbiont
quantification in animal tissue, based on fluorescence in situ
hybridization.

2 Study Design and Strategy

Studying symbiosis can be summarized into a few objectives. The

first is to identify the partners involved in symbiosis. This usually
relies on gene- or (meta-) genome-sequencing approaches. The
second is to localize symbionts in host tissues, which involves
histological techniques and symbiont identification based on hybri-
dization of specific molecular probes. The third is to understand the
role of each partner in the relationship, the degree of interdepen-
dence, and their interplay in the context of their environment. This
can involve various DNA- and RNA-based approaches, enzyme
assays, proteomics, lipid characterization, and various more or less
 Characterization of Bacterial Symbionts in Deep-Sea Fauna: Protocols. . .

quantitative methods. The fourth is to evaluate the degree of host-

symbiont coupling, by documenting the life cycle stages of each
partner and in particular the mechanisms of symbiont transmission.
The fifth integrates this knowledge in order to address the evolu-
tion of symbiotic systems. Designing a study on deep-sea
symbiont-associated metazoans is not straightforward, and the
whole procedure requires a thorough consideration in advance.
Most sampling events are one shot, with little chance to return
to the same sampling site. The sampling plan, including work on
the seafloor, must therefore accommodate all the work envi-
sioned.

2.1 The Importance Deep-sea sciences are integrative. The symbiotic system must be
of Background considered in terms of interactions with its environment. Ideally,
Environmental Data three main environmental aspects need to be investigated alongside
the symbiotic system itself. First, the physicochemical environment
must be characterized at a scale relevant to the target organisms,
including but not exclusive to temperature, salinity, pH, oxygen
content, reduced sulfur species, methane, and heavy metals. For
certain compounds, direct in situ measurements are possible using
sampler- or submersible-attached probes or analyzers [13, 14].
However, in other cases, samples of the habitat under examination,
such as seawater or sediment, must be collected and characterized
later. The second aspect is the characterization of potential free-
living forms of symbionts or closely related bacteria in the environ-
ment. This requires sampling habitats (e.g., seawater, reduced
fluids, authigenic carbonates, biofilms, sediment, decaying sub-
strates) and processing them for the same analyses intended for
the partner organisms. The final aspect of environmental character-
ization deals with potential sources of locally available food, both
for the metazoan hosts and their symbionts. This involves evaluat-
ing the composition and stable isotope ratios of potential sources,
including dissolved and particulate organic matter, which require
samples to be frozen as soon as possible upon recovery [15]. In
concert, these data yield an informative contextual overview for the
development of symbiotic systems and provide the necessary base-
line and background data for the interpretation of ensuing results.
Due to various constraints, many studies lack some or all of these
environmental data.

2.2 The Issue of Several recent symbiosis studies have pointed toward significant
Replication and intraspecific variability in the composition, abundances, and roles
Optimal Sample Use of symbionts at various scales [8, 16, 17]. Such variability, intrinsic
to highly dynamic environments and subject to natural selection,
reflects the adaptability and resilience of symbiotic organisms to
their environment [18, 19]. As a critical ecological feature, it not
only requires investigation but also emphasizes the need for repli-
cate specimens. Replicates are also mandatory to gain minimal
 Sebastien Duperron

statistical support for the patterns observed. These may be relatively

easy to collect from large host aggregations (e.g., dense mussel
beds), but may prove more challenging to obtain from low-density
or infaunal species associated with certain seeps or with wood and
whale falls, for example. When several complimentary approaches
are to be applied on a limited number of samples, the best approach
is to perform the whole suite of methods upon each specimen,
having split individual tissues appropriately (see protocols below).
In this way, interindividual replication is retained, and specific
aspects of the host-symbiont association can be collated and com-
pared directly using various methods.

2.3 The Impact of Deep-sea organisms suffer tremendous pressure loss during recov-
Recovery Methods ery, corresponding to 1 bar per 10 m during their ascent. This has
considerable impact on their physiology, illustrated by various
groups from which specimens collected deeper than ~1,500 m
commonly arrive at the surface dying or dead. Pressure vessels
which can restore, or ideally maintain, at-depth pressures have
been developed, allowing ongoing experiments on live specimens
once aboard [2022]; recently, pressure-maintaining devices have
been designed which permit both isobaric sampling and transfer
into larger aquaria which permit manipulation [23]. When not
available, as a minimum, the installation of specimens in insulated
hermetic boxes at the seafloor will minimize temperature variations
during recovery and maintain sample integrity by preventing flush-
ing. Early developmental stages such as larvae and postlarvae are
much more difficult to sample because of their small size, often
lower densities of occurrence, and a general lack of knowledge
regarding their environmental distribution. However, the recovery
of pre-deployed colonization devices and sediment traps or actively
deployed water pumps can be effective means for their collection
[2426].

3 Materials

3.1 Sample Fixation 1. Oven is set at 60
C for sample drying; a hybridization oven can
be used (see FISH protocol).
2. Caliper.
3. Petri dishes or dissection bowls.
4. Sterile tweezers and scalpels.
5. Cryotubes for storage in liquid nitrogen.
6. Parafilm.
7. Ethanol.
8. Formaldehyde 37%, histology grade, for example, Sigma-
Aldrich cat: F1635.
 Characterization of Bacterial Symbionts in Deep-Sea Fauna: Protocols. . .

9. Glutaraldehyde, electron microscopy grade, available at Sigma-

Aldrich cat: G7526.
10. Seawater (SFS) filtered on a 0.22 m filter. Syringe filtering is
possible for low amounts; otherwise, use filtering units or
disposable filters.
11. Sodium azide (NaN3) available at Sigma-Aldrich cat: S2002.
Due to acute toxicity, this needs to be pre-weighted before a
cruise: 0.13 g can be stored in an Eppendorf tube and will be
added to 50 mL SFS.
12. Osmium tetroxide (OsO4) available at Sigma-Aldrich cat:
201030.
13. Uranyl acetate available at Electron Microscopy Sciences cat:
22400. This compound is radioactive and toxic and requires
the use of appropriate procedures.
14. RNA-preserving buffer such as RNAlater Stabilization solu-
tion, Ambion, cat: AM7021 (500 mL).

3.2 Fluorescence In 1. Confocal or epifluorescence microscope equipped with motor-

Situ Hybridization ized stage for 3D acquisitions.
2. Histology molds, for example Peel-a-Way disposable embed-
ding molds available in different sizes.
3. Microtome.
4. Heating bench for warming slides.
5. Sealed slide-staining racks.
6. Hydrophobic PAP pen, available at Sigma-Aldrich cat:
Z377821.
7. Hybridization oven.
8. SuperFrost Plus adhesive glass slides, available from Eurome-
dex cat:71869.
9. Paraffin wax, available with different melting temperatures, an
example being Sigma-Aldrich cat: 327212 with a Tmelting
between 58 and 62
C. Wax can be removed using Histo-
Clear available from Agar Scientific cat:AGR1345. For safety
reasons, the use of xylene is not recommended.
10. Steedmans wax, composed of polyethylene glycol distearate
(Sigma-Aldrich cat: 305413) and 1-hexadecanol (Sigma-Aldrich
cat: 258741) in a 9:1 weight ratio. Melting temperature is 37
C,
but higher temperatures can be used when preparing the wax.
Wax is soluble in pure ethanol.
11. Acryl resin, available at Sigma-Aldrich LR white resin cat:
62661. It requires the use of benzoyl peroxide as an initiator
for polymerization cat: B5907. Wax is hydrophilic and does not
need to be removed prior to hybridization.
 Sebastien Duperron

Table 1
Composition of hybridization buffer depending on the formamide concentration employed.
Concentrations of stock solutions are displayed, and volumes are given in mL for a final volume of
~6 mL, to be used for wetting tissue in hybridization chambers and for mixing with probes (see
Sect. 4.3.2 steps 2 and 5)

Formamide used 10% 20% 30% 40% 50% 60%

NaCl (5 M) 1.08 1.08 1.08 1.08 1.08 1.08
Tris-HCl (1 M) 0.12 0.12 0.12 0.12 0.12 0.12
Milli-Q 4.2 3.6 3 2.4 1.8 1.2
SDS (20%) 0.003 0.003 0.003 0.003 0.003 0.003
Formamide 0.6 1.2 1.8 2.4 3 3.6

Table 2
Composition of washing buffer depending on the formamide concentration employed during
hybridization. Concentrations of stock solutions are displayed, and volumes are given in mL for a
final volume of 100 mL, to be split between washing buffer 1 and 2 (see Sect. 4.3.2 step 7)

Formamide used 10% 20% 30% 40% 50% 60%

NaCl (5 M) 9 4.3 2.04 0.92 0.36 0.08
Tris-HCl (1 M) 2 2 2 2 2 2
EDTA (0.5 M) 0 1 1 1 1 1
SDS (20%) 0.05 0.05 0.05 0.05 0.05 0.05
Milli-Q 89 93 95 96 96.5 97

12. Hybridization buffer containing 900 mM NaCl, 20 mM Tris-

HCl, 0.01% SDS, and 1060% vol. formamide depending on
the probe(s) used (Table 1). Prepare 6 mL for each hybridiza-
tion chamber to be used (a chamber may contain more than a
single slide). Unused buffer can be frozen.
13. Hybridization chambers can be 50 mL Falcon tubes or sealed
slide-staining racks containing stuffed tissues wetted with 4 mL
of hybridization buffer. They can be used for several hybridiza-
tions if still wet.
14. The washing buffer composition depends on formamide con-
centration used for hybridization. Table 2 indicates how to
prepare 100 mL, to be split between the two consecutive
washing steps 1 and 2 (see Sect. 4.3.2 step 7). Washing buffer
can be stored at room temperature (RT) and be used for several
slides.
15. Anti-fade mounting medium, for example, SlowFade with
DAPI, available at Life Technologies cat: S36938. It can be
 Characterization of Bacterial Symbionts in Deep-Sea Fauna: Protocols. . .

ordered with or without DAPI for counterstaining and is best

stored frozen.
16. Custom DNA probes labeled with various fluorochromes in
their 50 end can be ordered from various companies such as
Eurogentec. Most commonly used fluorochromes are fluores-
cein isothiocyanate (FITC, green fluorescence) and cyanine
dyes including Cy3 (orange fluorescence) and Cy5 (far-red
fluorescence to be detected by cameras), but many more are
available. Probes can be resuspended and diluted in sterile
water. Prepare aliquots with final concentration of 50 ng/L.
Stocks and aliquots are stored frozen, and probes are light
sensitive.
17. Install the SymbiontJ plugin into ImageJ by copying the source
file to the Plugins folder of ImageJ (http://www.snv.jussieu.
fr/~wboudier/softs/symbiontj.html).

4 Methods

4.1 Sample To optimize sample use, the best option is to split each individual
Processing: How to specimen in tissue subsamples for the various approaches that are
Make the Most of the planned. Dissection needs to be performed quickly after recovery,
Few Specimens in a cold room and using sterile tweezers and scalpels, in large Petri
Available? dishes or ethanol-cleaned dissection bowls. Whenever size allows,
specimens can be split along planes of symmetry. Figure 1 illustrates
an example of how a bivalve mussel specimen can be dissected and
split for different types of analyses. This allows the direct correlation
of results from different analyses within each specimen so that
genuine within-host processes can be elucidated (rather than
inferred from multiple specimens) and ensures that data originates
from a single species allowing intraspecific, interindividual variabil-
ity to be described (Note 1). Photo-documentation of specimens
under the dissecting microscope is important, and any morpho-
metric measurements that are needed can be obtained at this stage
(e.g., size parameters).

4.2 Sample Fixation Sample fixation has to be performed as quickly as possible. For
Procedures this, tubes should be clearly labeled and filled with appropriate
fixatives before samples arrive onboard. Proper fixation requires
the use of fragments small and thin enough to ensure good
penetration of the fixatives, typically a 1:10 sample-to-fixative
volume ratio.

4.2.1 Liquid Nitrogen This fixation is suitable for samples to be used in nucleic acid (DNA,
Fixation and Alternatives RNA)-, protein-, enzymatic activity-, and stable isotope-based
analyses:
Sebastien Duperron

Fig. 1 An example of how a specimen of Bathymodiolus aff. boomerang can be

split for various analyses. Adductor muscle (M) is classically used for host DNA-
based identification. Gills (G) containing the symbionts are split to be used for
symbiont and host DNA and RNA studies, for fluorescence in situ hybridization
(FISH) in the anterior, median, and posterior regions (Gant, Gmed, Gpost), for electron
microscopy, and for stable isotope analyses. The gonad (Go) is located in the dorsal
region, but can extend laterally in the mantle and ventrally on the visceral mass. It
can be split and used for histology including EM and FISH identification of potential
symbionts and to investigate gamete formation. The digestive gland (Dg) and
associated stomach and intestines are used for molecular and FISH identification
of potential bacteria and are located dorsal to the anterior pedal retractor muscles.
The foot (F) tissue is devoid of symbionts and can be used as a host-only reference
for gene expression or stable isotope studies. The mantle tissue (Ma) is also used
for reference. The image also features the commensal annelid Branchipolynoe
seepensis (Bs), common in deep-sea mussels

1. In a cold room, dissect tissue of interest using sterile tweezers/

scalpels immediately upon recovery.
2. Place tissue in a cryotube and transfer immediately to liquid
nitrogen.
3-. Store in liquid nitrogen or at 80
C.
 Characterization of Bacterial Symbionts in Deep-Sea Fauna: Protocols. . .

Below are alternatives that are less efficient but still relevant
when liquid nitrogen is not available or in places where shipment of
frozen material back to the lab is problematic:
1. An alternative for DNA is to transfer tissue to pure ethanol, one
volume of tissue in 10 volumes of ethanol. Samples can then be
shipped at 4
C or even at room temperature for a short period
of time. The cap can be sealed with Parafilm to prevent leakage.
2. An alternative for RNA is to transfer tissue to RNAlater, one
volume of tissue for 10 volumes of RNAlater. Samples can then
be shipped at 4
C or even at room temperature for a short
period of time.
3. An alternative for stable isotope analyses is to dry tissue samples
directly in a chamber at 60
C for 3 days. The most common
stable isotope analyses to be performed are those of carbon,
nitrogen, and sulfur. Beware that a significant amount of mate-
rial can be necessary for proper analyses, in particular for nitro-
gen and sulfur when these compounds are not abundant, and
that it is not possible to provide general guidelines. This may
require pooling samples prior to analysis. Once desiccated in
appropriate tubes for transport and sealed prior to removing
from the oven, these can be transported at room temperature.

4.2.2 Glutaraldehyde 1. Tissue can be fixed in 2% paraformaldehyde and 2.5% EM-

Fixation for Electron grade glutaraldehyde (or 2.54% EM-grade glutaraldehyde
Microscopy only) in 0.1 M phosphate-buffered saline (PBS), corrected to
pH 7.4 (minimum 1 h, typically 416 h, 1 mm3 or less of tissue
for optimal penetration at RT). Fixative-to-specimen volume
ratio ought to be at least 20:1.
2. Rinse and store in sodium azide solution (0.13 g pre-weighted
NaN3 in 50 mL SFS). Samples can be transported to the lab at
4
C or even at RT.
3. Transfer to 1% osmium tetroxide solution in 0.1 M phosphate
buffer (pH 7.4, 45 min). Osmium is highly toxic and requires
the use of an appropriate fume hood. This and the following
steps are thus usually performed back to the lab.
4. Wash by aspiration, 4 times for 5 min in 0.1 M PBS.
5. Eventually stain using 2% aqueous uranyl acetate (2 h, RT, in
the dark to avoid precipitation).
6. Transfer 3 times for 5 min each in increasing ethanol (30%,
50%, 75%, and 95%) in distilled water.
7. Store at 4
C or embed right away.
 Sebastien Duperron

4.2.3 Tissue Fixation This procedure is employed to fix tissue samples for fluorescence in
Using Formaldehyde situ hybridization but can also be used for other histology staining
techniques such as hematoxylin-eosin staining:
1. Dissect tissue of interest using sterile tweezers and scalpels
immediately upon recovery, in a cold room. Volume of dis-
sected tissue should not exceed 10% of the volume of fixative to
be used.
2. Add 24% formaldehyde in sterile-filtered seawater (SFS can be
syringe-filtered using a 0.22 m filter). If working with hard-
shelled specimens, fixative penetration is markedly improved by
preventing their closure (sever contracting musculature, or
at least crack the shell, if dissection is impractical). Leave in
the fridge (4
C) for 24 h, depending on volume of tissue
(Note 2).
3. Remove fixative, rinse twice in SFS, and mix by inversion.
4. Dehydrate tissue in increasing ethanol series (50%, 70%, 80%,
20 min each). It is best to use SFS for diluting ethanol, at least
on the first two steps.
5. Tissue samples can be stored in 80% ethanol at 4
C (Note 2)
and can tolerate exposure to room temperature during trans-
port if needed. Do not store at 80
C or below.

4.2.4 Conditioning Sample shipment to the lab is often a major (and risky) issue when
and Shipment working at sea. Nitrogen-fixed samples need to be transported on
dry ice or in liquid nitrogen containers, shipment modes that are
simply not available in some regions of the world. Transporters
such as World Courier offer continuous monitoring of temperature
and refill of nitrogen or dry ice but this comes at a cost. Liquid
nitrogen is considered a hazardous substance and air shipment
must fulfill stringent IATA guidelines, including the use of dry
shippers. For this reason, many people prefer leaving frozen sam-
ples onboard until the ship stops at a readily accessible port from
which samples can be transported easily. Given the risks associated
with shipment of frozen material, it is good to duplicate samples
and ship half under the best conditions, in dry ice for example,
while the other half travels in an alternative fixative (see Sect. 4.2.1)
at room temperature by courier. Note that various kits are also
available for DNA or RNA extractions that require minimal mate-
rial, usually a microcentrifuge. When possible, extraction onboard
is a good approach, as it prevents the action of degrading enzymes
during transport.
Many countries, not only the final destination but also any
country through which the samples transit, apply strict rules reg-
ulating the transport of animal samples. This often requires com-
pleting appropriate forms before shipment. Whatever the option
chosen, sample shipment needs to be planned well in advance and
discussed with local authorities and port agents.
 Characterization of Bacterial Symbionts in Deep-Sea Fauna: Protocols. . .

4.3 Fluorescence Several types of wax can be used for tissue embedding. The choice
In Situ Hybridization depends on the size of tissue samples and the thickness of sections
(FISH) on Sections to be cut. Three classic examples are Steedmans polyester wax,
of Animal Tissue laboratory-grade paraffin wax, and, if semi-thin sectioning is
needed, a hydrophilic methacrylate resin, such as LR white. Steed-
4.3.1 Tissue Embedding mans wax melts around 37
C and dissolves in ethanol. It is appro-
priate for thicker sections (712 m) and yields bright FISH
signals, but usually the structures are less well preserved than with
paraffin or methacrylate resin. Paraffin usually melts at <60
C
(depends on manufacturer). It is a good compromise between
FISH signal intensity and tissue preservation at intermediate thick-
nesses (~310 m). We herein present the procedure used for
inclusion in Steedmans wax and paraffin:
1. Melt the wax overnight at 40
C (Steedman) or appropriate
melting temperature Tmelting (paraffin).
2. Prepare glass vials containing ethanol-wax mixtures in the fol-
lowing ratios 2:1, 1:1, 1:2, and 0:1 to be kept at 3740
C;
ethanol must be replaced by Histo-Clear or xylene for paraffin
wax infiltration, and temperature set to Tmelting.
3. Transfer tissue from the first to the last vial at 37
C (or Tmelting),
each bath between 45 min and 1 h.
4. Transfer tissue to a mold containing pure wax. Orient using
hair, nylon fishing line, or warm needle.
5. Let the block harden at RT overnight.
6. Store at 20
C.
7. Let the block warm up before sectioning. Section using the
microtome, and transfer ribbons containing 3 to 10 sections to
SuperFrost Plus-coated slides on a drop of sterile water.
8. Let the sections unfold on slides using a slide warmer (25
C),
remove water, and leave to air-dry.
9. Store cold.
Alternatives for embedding include methacrylate resins (LR
white type) for which several polymerization approaches are possi-
ble (see the resins supplied protocols). These typically either
employ extended heating (e.g., 5060
C oven for minimum
24 h, absence of oxygen), UV light (at 20
C 0
C, 48 h), or
more rapid polymerization in a microwave or with a chemical
accelerator at room temperature (e.g., aromatic tertiary amine
requires cooling during the exothermic reaction). The choice of
polymerization will depend on the tissues sensitivity to heat.
These resins can then be sectioned using an ultramicrotome and
transferred to droplets of distilled water arranged on SuperFrost
Plus slides. Hybridizations can be performed without resin
removal, following a rehydration step using 0.1 M PBS (10 min).
 Sebastien Duperron

This hard resin is particularly appropriate for thinner sections down

to 0.5 m, below which FISH signals may be severely attenuated,
either to enhance structural detail in host tissues or when limited by
tissue availability in smaller specimens such as larvae or juveniles
[27]. Methacrylate resins are severely compromised by exposure to
ethanol.

4.3.2 Fluorescence Symbiont- or group-specific oligonucleotide probes targeting ribo-

In Situ Hybridization somal RNA (usually 16S or 23S) will be applied. Examples of
published probes targeting symbionts of deep-sea metazoans are
provided in Table 3. Probe specificity is usually achieved by identi-
fying the optimum formamide concentration for the hybridization
buffer, i.e., when the probe still binds readily to its target but can no
longer hybridize to a control bacterium which displays a single
base-pair mismatch in its rRNA sequence. Bear in mind that pub-
lished group- or phylotype-specific probes were specific at the time
of design. Given the growth of 16S rRNA gene databases over the
last years, many of these probes now appear not specific anymore.
Many group-specific probes indeed now have numerous extra-hits.
Probe specificity can be checked anytime against current databases
on the ARB-SILVA (http://www.arb-silva.de/search/testprobe/)
or Ribosomal Database Project websites (https://rdp.cme.msu.
edu/probematch/):
1. Before hybridization, dissolve Steedmans wax by dipping sec-
tions in decreasing ethanol series from 96 to 70%. 5 min per
bath should remove most of the wax. For paraffin, use Histo-
Clear or xylene prior to rehydration (the latter requires an
extraction hood).
2. Preheat hybridization chambers containing a piece of tissue
wetted with hybridization buffer at 46
C.
3. Preheat the washing buffer to 48
C.
4. Circle sections to be hybridized with distinct probe sets using a
PAP pen. Use at least one of the circled sections for control on
each slide (Note 3).
5. Hybridize by applying the mix containing hybridization buffer
(with appropriate formamide concentrations, see Table 1) and
probes (1:15 dilution of the 50 ng/L probe stock solution in
the buffer) to each individual circled section so the drops do
not mix. 30 L is enough for a 0.7 cm diameter circled section,
i.e., 2 L probe plus 28 L appropriate buffer. Several probes
with distinct fluorochromes can be mixed. Probes are light
sensitive, so work under low and indirect light.
6. Place glass slide into the hybridization chamber carefully, close
the chamber, and leave to hybridize for 3 h at 46
C. Hybridiza-
tion time can be modified.
Table 3
Examples of published FISH probes which target bacterial symbionts of deep-sea metazoans and concentrations of formamide (%) or hybridization temperatures
(
C) necessary to achieve probe specificity in classic FISH experiments. These may need reevaluation when using CARD- or DOPE-FISH. Indicated hosts species
are those for which the probe was originally designed, but probes usually also target symbionts in related species. Tax. is the bacterial taxon (G,
Gammaproteobacteria; E, Epsilonproteobacteria; M, Mollicutes). Targeted symbiont describes the type: sulfur (SOX) or methane oxidizer (MOX) and/or phylotype
name as in original publication. A whole set of probes is also available for Osedax symbionts in [28], not presented here
Formamide
Phylum Host genus and species Probe name Probe sequence (50 -30 ) Tax. Targeted symbiont (%) Reference Remark

Porifera Unidentified sponge BMARt193modSponge CGAAGATCCTCCACTTTA G SOX related 30 [11]

Unidentified sponge CspongeMeth208 CGCAAGGCTCTATCCGAA G MOX related 30 [11]
Annelida Lamellibrachia LaSp60 CCATCGTTACCGTTCGAC G SOX 30 [29] Combined with
anaximandri LaSp640
Lamellibrachia LaSp640 CACACTCTAGTCAGGCA G SOX 30 [29] Combined with
anaximandri LaSp60
Lamellibrachia L.mars_symb1 CTCTGCTGGATTCTGTCAAT G SOX type A 40 [30] Helper probes
anaximandri available
Lamellibrachia L.mars_symb2 CTCTAACAAGTTCTGAGGAT G SOX type B 40 [30] Helper probes
anaximandri available
Escarpia sp. TbwT-643 TCTACCACACTCTAGTCAGGCAG G SOX 60 [7] Good for
CARD-FISH
Siboglinum contortum Scon-467 ACGTCAAGACCCGAGAAT G SOX 40 [31] HRP labeled
Siboglinum contortum Scon-444 TCCCAAGCCTTTCTTCAC G SOX 40 [31] HRP labeled
Oligobrachia Ohaa2-77 CCTGCTAGCAAGCTAGCA G SOX type 2 30 [31]
haakonmosbiensis
Oligobrachia Ohaa2-60 GCATCGTTACCGTTCGAC G SOX type 2 35 [31]
haakonmosbiensis
Oligobrachia Ohaa-653 CTCACCTCTACCAAACTC G SOX 55 [31]
haakonmosbiensis
Riftia/Tevnia/Oasisia RifTO830 CCCTTATAATGAGCCCAACGG G SOX 20 [32]
Riftia/Tevnia/Oasisia RifTO147 GATTTCTCCGAGTTGTCC G SOX 20 [32]
Riftia/Tevnia/Oasisia RifTO445 TCCTCAGGCTTTTCTTCC G SOX 35 [32]
Osedax frankpressi sym435_I CTTTCCTCACAGCTGAA G Oceanospirillales 35 [33]
Arthropoda Rimicaris exoculata Probe-653 ATCTTCCCCTCCCAGACTCT E SOX 42
C [34]
Rimicaris exoculata Rexogam1268RT CTTTCTGGGATTRGCTTGCTCT G SOX 30 [35] Specific for a
vent site

(continued)
Table 3
(continued)

Formamide
Phylum Host genus and species Probe name Probe sequence (50 -30 ) Tax. Targeted symbiont (%) Reference Remark

Rimicaris exoculata Rexogam1268LS CTTTCTGGGATTGGCTTACTCT G SOX 30 [35] Specific for a

vent site
Rimicaris exoculata Epsilon 1 CGACACCCAATCCGAAGA E SOX 30 [35] Specific for a
vent site
Rimicaris exoculata Epsilon 2 CTGTCGGATTCTCTCAAT E SOX 30 [35] Specific for a
vent site
Rimicaris exoculata Epsilon 3 GTATATTAGCTCCCGAA E SOX 30 [35] Specific for a
vent site
Rimicaris exoculata Epsilon 5 CGACAGCTAGGTACAACTAC E SOX 30 [35] Specific for a
vent site
Mollusca Leptochiton boucheti MolliA-350 AAAATTCCTTACTGCTG M Mollicutes 30 [36]
Thyasira sp. Regab ThyGui138 TTCCACAGGTTGTCC G SOX 30 [37]
Thyasira vulcolutre TGOC193 TAGAGGCCTCCTTTA G SOX 30 [37]
Thyasira sp. Regab ThyGui642 TCTAGTTGAACAGTT G SOX 30 [37]
Lyrodus pedicellatus lp1 (637) GCAATACTCTAGCAACCCAGTTCTG G LP1 65 [38]
Lyrodus pedicellatus lp2 (637) GCTGTACTCTAGCTATACAGTTCTA G LP2 61
C [38]
Lyrodus pedicellatus lp3 (637) GCAATACTCTAGTAATCCAGTTCTG G LP3 61
C [38]
Lyrodus pedicellatus lp4 (637) GCTGTACTCAAGTTACCCAGTTCTA G LP4 63
C [38]
Calyptogena/Vesicomya Cpon_1014 CGAAGGCACTTTTCCATC G SOX 30 [39] Helper probes
available
Calyptogena/Vesicomya Cpon_826 AACCCCCCTCAACGACTA G SOX 30 [39]
Calyptogena/Vesicomya Cpon_831 AGGGTAACCCCCCTCAAC G SOX 30 [39]
Calyptogena valdiviae Creg821 GTACCCCCCCCAACGACT G SOX 30 [40]
Laubiericoncha chuni Lchu821 GTAAATCCCCCCAACGGCT G SOX 30 [19]
Bathymodiolus spp. Bnix-64 GCTAGACCTGTTACCGCT G Ca. Endonucleobacter 35 [5]
bathymodioli
Bathymodiolus spp. Bnix-643 CCGTACTCTAGCCACCCA G Ca. Endonucleobacter 35 [5]
bathymodioli
Bathymodiolus spp. Bnix-1249 GCAGCTTCGCGACCGTCT G Ca. Endonucleobacter 35 [5]
bathymodioli
Bathymodiolus aff. BangT-642 CCTATACTCTAGCTTGCCAG G SOX 30 [41]
boomerang
Bathymodiolus aff. BangM-138 ACCAGGTTGTCCCCCACTAA G MOX 30 [41]
boomerang
Bathymodiolus heckerae Cypu-829 GGAAACCCGCCCAACAGT G Cycloclasticus related 10 [7]
Bathymodiolus heckerae Bthio-193 CGAAGATCCTCCACTTTA G SOX 20 [42]
Bathymodiolus heckerae BhecT1-193 AAGAGGGCTCCTTTT G SOX-T1 20 [42]
Bathymodiolus heckerae BhecM2-822 CTCCCACACACTTAGTTG G Methylophaga related 20 [42]
Bathymodiolus brooksi NOR2-1453mod GGTCATCGCCATCCCCGA G Psychromonas related 10 [7]
Bathymodiolus brooksi BbroM1-574 AAACCACCTACGAACGC G MOX 20 [42]
Bathymodiolus childressi LA-1 CCGCCACTAAACCTGTATATAGG G MOX 42
C [43]
Bathymodiolus childressi LA-2 GTAGGGCATATGCGGTATTAGCATGGG G MOX 42
C [43]
Bathymodiolus MAR-P1 TCGCCACTAAGAGGTAAATCCT G SOX 37
C [44]
puteoserpentis
Bathymodiolus MAR-P2 CCGCCACTAAGCCTATAAATAGA G MOX 37
C [44]
puteoserpentis
Bathymodiolus azoricus/ BmarT-193 CGAAGGTCCTCCACTTTA G SOX 30 [45]
puteoserpentis
Bathymodiolus azoricus/ BmarM-845 GCTCCGCCACTAAGCCTA G MOX 30 [45]
puteoserpentis
Idas modiolaeformis ImedT2-193 TAGAGGCCTCCTTTA G SOX-T2 40 [46]
Idas modiolaeformis ImedM-138 ACCATGTTGTCCCCCACTAA G MOX-M1 40 [46]
Idas modiolaeformis ImedG-193 AACAGATCCCCTCCTTTC G Symbiont G 40 [46]
Alviniconcha sp. Alvp130 CAGTCCAAGGGGCACATT E SOX 15 [47]
Ifremeria nautilei Inaug577 GACTAAACCGCCTACG G SOX 35 [47]
Lepetodrilus fucensis gammaLf1-128 CCCCACTATTCGGCAATTTC G SOX 45 [48]
Lepetodrilus fucensis gammaf1-643 ACCATACTCTAGTGAGCCAG G SOX 45 [48]
 Sebastien Duperron

7. Wash slides by dipping into washing buffer 1 to remove

hybridization mix, and then transfer to washing buffer 2 for
15 min at 48
C.
8. Quick dip slides into Milli-Q water, and remove water.
9. Cover each hybridized section with a small drop of anti-fading
agent and add coverslip.
10. Store at 20
C until observation. Overnight storage often
improves the signal-to-noise ratio by decreasing tissue auto-
fluorescence (Note 4).
Sections can then be observed under an epifluorescence or
confocal microscope and images acquired using excitation wave-
lengths corresponding to the different fluorochromes.

4.3.3 Analyzing Bacterial FISH is not only used to test for the presence of prokaryote rRNA
Areas (2D) or Volumes (3D) phylotypes, but more and more often to estimate their abundances
Using ImageJ in various environments such as water bodies. Within tissues or
larger animals, quantification is harder to achieve. This is because
symbiont-bearing tissues are tridimensional, often with compli-
cated shapes (molluskan gills, annelid trophosome) and irregular
distribution. Microscopy-based approaches are most efficient in
establishing relative abundances of distinct types of symbionts in
tissue by direct counts on electron microscopy sections when
symbionts have distinct morphological features such as between
methane- and sulfur-oxidizing symbionts of bathymodiolin mussels
[49, 50]. When bacteria cannot be distinguished based on their
shape, 2D and 3D FISH is one appropriate method with which
relative abundances can be estimated based on measured areas in
thin sections or volumes in thicker hybridized sections respectively
(Note 5). The general methodology to perform such measure-
ments using the free software ImageJ is presented:
1. Open the image or stack. If the image is red green blue (RGB),
you need to generate a black and white image from each
channel, which is achieved by Image - > Color - > Split
channels. Otherwise, you may work with images
corresponding to each channel.
2. Select the area of interest using the freehand selection tool.
3. Select Tool- > ROI Manager in the menu Analyze and
add object.
4. Crop the area of interest using the Crop function of the
Image menu and then Clear outside in the Edit menu.
This procedure may be applied to all images within a stack. If
needed, set the background to black using Edit - > Options
- > color.
5. Binarize images using Image - > Adjust - > Threshold
either manually or automatically. This can be applied to a single
or all images within a stack.
 Characterization of Bacterial Symbionts in Deep-Sea Fauna: Protocols. . .

6. Numbers of black (value 0) and white (value 255)

pixels/voxels can be obtained using the tool Analyze - > His-
togram - > List. The output file can be saved.
7. When using several probes, results from individual channels can
be compared to measure relative abundances.
An automated procedure for counting dual symbionts, initially
designed for methane- and sulfur-oxidizing symbionts of hydro-
thermal vent mussels, is also available as the ImageJ plugin Sym-
biontJ [16]. It automatically identifies bacterial signals, identifies
thresholds for the channels, and computes the percentage of bacte-
rial areas or volumes occupied by each of the two distinct
symbionts:
1. You can directly use the RGB image without splitting channels.
In this case, the red color will be used as a mask (anything
outside is not considered true signal), so make sure to set the
general bacterial probe signal to the red channel.
2. After cropping the area of interest, save it into a folder as a
.TIFF file.
3. Start SymbiontJ (Plugins- > SymbiontJ) and select the folder
in which you have saved the image. Several images can be
stored within a single folder and will each be analyzed.
4. The resulting file summarizes the red, green, and blue areas in
pixels/voxels and calculates the percentage of green and blue
within the red area or volume.
5. Save the results as an Excel file.

5 Notes

1. Deep-sea metazoan hosts of bacterial symbionts often belong

to poorly documented groups for which taxonomic data is
scarce. Names are often inappropriate or messy, and many
cryptic species are reported. Good examples are the deep-sea
symbiont-bearing bathymodiolins for which most genera
names actually correspond to polyphyletic groups [51]. It is
thus important to back any morphology-based identification
with molecular barcoding data for future comparison.
2. Over-fixation in formaldehyde or long-term storage in 96%
ethanol is known to result in loss of FISH signal intensity.
3. Controls are of prime importance to confirm FISH signals. A
given probe should always be tested associated to several fluor-
ochromes. Positive (a general bacterial probe such as Eub338)
and negative (a probe targeting no organism, such as the probe
 Sebastien Duperron

Non338, antisense of Eub338) controls are mandatory. False

positives that display signals even in the absence of a targeting
probe are also problematic, but such signals can be identified as
false by running RNAse-treated slides in parallel as further
negative controls [12].
4. A very common problem when working with bacterial sym-
bionts within animal tissue is the low intensity of FISH signals
compared to background tissue fluorescence. FISH signal
intensities can be greatly improved by changing the approach
to an improved version of FISH, such as CARD-FISH or
DOPE-FISH [52, 53]. However, some simple steps can help
optimize results of standard FISH. Regarding signal-to-noise
ratios, as a rule of thumb, autofluorescence in animal tissues
tends to decrease with increasing wavelength. For a given
probe, signal-to-noise ratios are often improved when using
Cy5 (infrared emission) compared to Cy3 (orange) and FITC
(fluorescein, green). Long tissue exposure up to a few minutes
to laser light may also decrease autofluorescence and result in
higher signal-to-noise ratios. The use of confocal microscopes
usually greatly improves the ratios.
5. Various alternative non-microscopy-based methods for the
quantification of symbionts or their activity have been pro-
posed including rRNA slot blot, qPCR using symbiont
lineage-specific primer sets, and measurement of chemical
compounds such as lipids produced by a partner, all with
their own biases [42, 54, 55].

References

1. McFall-Ngai M, Hadfield MG, Bosch TCG
et al (2013) Animals in a bacterial world, a
new imperative for the life sciences. Proc Natl
Acad Sci U S A 110:32293236
2. Tunnicliffe V, Juniper SK, Sibuet M (2003)
Reducing environments of the deep-sea floor.
In: Tyler PA (ed) Ecosyst. Elsevier, World
Deep-Sea, pp 81110
3. Dubilier N, Bergin C, Lott C (2008) Symbiotic
diversity in marine animals: the art of harnes-
sing chemosynthesis. Nat Rev Microbiol
6:725740
4. Petersen JM, Dubilier N (2009) Methano-
trophic symbioses in marine invertebrates.
Env Microbiol Rep 1:319335
5. Zielinski FU, Pernthaler A, Duperron S et al
(2009) Widespread occurrence of an intranuc-
lear bacterial parasite in vent and seep bath-
ymodiolin mussels. Environ Microbiol
11:11501167
6. Duperron S (2010) The diversity of deep-sea
mussels and their bacterial symbioses. In: Kiel S
(ed) The vent and seep biota. Springer, Nether-
lands, pp 137167
7. Raggi L, Schubotz F, Hinrichs K-U et al
(2012) Bacterial symbionts of Bathymodiolus
mussels and Escarpia tubeworms from
Chapopote, an asphalt seep in the southern
Gulf of Mexico. Environ Microbiol
15:19691987
8. Rodrigues CF, Cunha MR, Genio L, Duperron
S (2013) A complex picture of associations
between two host mussels and symbiotic bac-
teria in the Northeast Atlantic. Naturwis-
senschaften 100:2131
9. Gros O, Liberge M, Heddi A et al (2003)
Detection of the free-living forms of sulfide-
oxidizing gill endosymbionts in the lucinid
habitat (Thalassia testudinum environment).
Appl Environ Microbiol 69:62546257
 Characterization of Bacterial Symbionts in Deep-Sea Fauna: Protocols. . .
10. Harmer TL, Rotjan RD, Nussbaumer AD et al
(2008) Free-living tube worm endosymbionts
found at deep-sea vents. Appl Environ Micro-
biol 74:38953898
11. Petersen JM, Wentrup C, Verna C et al (2012)
Origins and evolutionary flexibility of chemo-
synthetic symbionts from Deep-Sea animals.
Biol Bull 223:123137
12. Szafranski KM, Gaudron SM, Duperron S
(2014) Direct evidence for maternal inheri-
tance of bacterial symbionts in small deep-sea
clams (Bivalvia: Vesicomyidae). Naturwis-
senschaften 101:373383
13. Vuillemin R, Le Roux D, Dorval P et al (2009)
CHEMINI: A new in situ CHEmical MINIa-
turized analyzer. Deep Sea Res Part Oceanogr
Res Pap 56:13911399
14. Wankel SD, Huang Y, Gupta M et al (2013)
Characterizing the distribution of methane
sources and cycling in the deep sea via in situ
stable isotope analysis. Environ Sci Technol
47:14781486
15. Carlier A, Ritt B, Rodrigues CF et al (2010)
Heterogeneous energetic pathways and carbon
sources on deep eastern Mediterranean cold
seep communities. Mar Biol 157:25452565
16. Halary S, Riou V, Gaill F et al (2008) 3D FISH
for the quantification of methane- and sulphur-
oxidising endosymbionts in bacteriocytes of
the hydrothermal vent mussel Bathymodiolus
azoricus. ISME J 2:284292
17. Lorion J, Halary S, do Nascimento J et al
(2012) Evolutionary history of Idas sp. Med,
(Bivalvia: Mytilidae), a cold seep mussel bear-
ing multiple symbionts. Cah Biol Mar
53:7787
18. Stewart FJ, Young CR, Cavanaugh CM (2008)
Lateral symbiont acquisition in a maternally
transmitted chemosynthetic clam endosymbio-
sis. Mol Biol Evol 25:673683
19. Decker C, Olu K, Arnaud-Haond S, Duperron
S (2013) Physical proximity may promote lat-
eral acquisition of bacterial symbionts in vesi-
comyid clams. PLoS One 8(7):e64830
20. Shillito B, Jollivet D, Sarradin PM et al (2001)
Temperature resistance of Hesiolyra bergi, a
polychaetous annelid living on vent smoker
walls. Mar Ecol Prog Ser 216:141149
21. Shillito B, Gaill F, Ravaux J (2014) The ipo-
camp pressure incubator for deep-sea fauna.
J Mar Sci Technol Taiwan 22:97102
22. Pradillon F, Shillito B, Chervin JC et al (2004)
Pressure vessels for in vivo studies of deep-sea
fauna. High Press Res 24:237246
23. Shillito B, Hamel G, Duchi C et al (2008) Live
capture of megafauna from 2300 m depth,
using a newly designed Pressurized Recovery
Device. Deep-Sea Res Part -Oceanogr Res Pap
55:881889
24. Mullineaux LS, Mills SW, Sweetman AK et al
(2005) Vertical, lateral and temporal structure
in larval distributions at hydrothermal vents.
Mar Ecol Prog Ser 293:116
25. Beaulieu SE, Mullineaux LS, Adams DK, Mills
SW (2009) Comparison of a sediment trap and
plankton pump for time-series sampling of lar-
vae near deep-sea hydrothermal vents. Limnol
Oceanogr Methods 7:235248
26. Gaudron SM, Pradillon F, Pailleret M et al
(2010) Colonization of organic substrates
deployed in deep-sea reducing habitats by sym-
biotic species and associated fauna. Mar Env
Res 70:112
27. Gros O, Maurin LC (2008) Easy flat
embedding of oriented samples in hydro-
philic resin (LR White) under controlled
atmosphere: application allowing both
nucleic acid hybridizations (CARD-FISH)
and ultrastructural observations. Acta Histo-
chem 110:427431
28. Verna C, Ramette A, Wiklund H et al (2010)
High symbiont diversity in the bone-eating
worm Osedax mucofloris from shallow whale-
falls in the North Atlantic. Environ Microbiol
12:23552370
29. Duperron S, De Beer D, Zbinden M et al
(2009) Molecular characterization of bacteria
associated with the trophosome and the tube of
Lamellibrachia sp., a siboglinid annelid from
cold seeps in the eastern Mediterranean.
FEMS Microbiol Ecol 69:395409
30. Zimmermann J, Lott C, Weber M et al (2014)
Dual symbiosis with co-occurring sulfur-
oxidizing symbionts in vestimentiferan tube-
worms from a Mediterranean hydrothermal
vent. Environ Microbiol 16:36383656
31. Losekann T, Robador A, Niemann H et al
(2008) Endosymbioses between bacteria and
deep-sea siboglinid tubeworms from an Arctic
Cold Seep (Haakon Mosby Mud Volcano,
Barents Sea). Environ Microbiol
10:32373254
32. Nussbaumer AD, Fisher CR, Bright M (2006)
Horizontal endosymbiont transmission in
hydrothermal vent tubeworms. Nature
441:345348
33. Goffredi SK, Orphan VJ, Rouse GW et al
(2005) Evolutionary innovation: a bone-eating
marine symbiosis. Environ Microbiol
7:13691378
34. Polz MF, Cavanaugh CM (1995) Unique
dominance of one bacterial phylotype at a
 Sebastien Duperron
Mid-Atlantic Ridge hydrothermal vent site.
Proc Nat Acad Sci USA 92:72327236
35. Petersen JM, Ramette A, Lott C et al (2010)
Dual symbiosis of the vent shrimp Rimicaris
exoculata with filamentous gamma- and epsi-
lonproteobacteria at four Mid-Atlantic Ridge
hydrothermal vent fields. Environ Microbiol
12:22042218
36. Duperron S, Pottier M-A, Leger N et al (2013)
A tale of two chitons: is habitat specialisation
linked to distinct associated bacterial commu-
nities? FEMS Microbiol Ecol 83:552567
37. Rodrigues CF, Duperron S (2011) Distinct
symbiont lineages in three thyasirid species
(Bivalvia: Thyasiridae) form the eastern Atlan-
tic and Mediterranean Sea. Naturwissenschaf-
ten 98:281287
38. Distel DL, Beaudoin DJ, Morrill W (2002)
Coexistence of multiple proteobacterial endo-
symbionts in the gills of the wood-boring
bivalve Lyrodus pedicellatus (Bivalvia: Teredini-
dae). Appl Environ Microbiol
2002:62926299
39. Wentrup C, Wendeberg A, Schimak M et al
(2014) Forever competent: deep-sea bivalves
are colonized by their chemosynthetic sym-
bionts throughout their lifetime. Environ
Microbiol 16:36993713
40. Duperron S, Rodrigues CF, Leger N et al
(2012) Diversity of symbioses between chemo-
synthetic bacteria and metazoans at the Gui-
ness cold seep site (Gulf of Guinea, West
Africa). MicrobiologyOpen 1:467480
41. Duperron S, Nadalig T, Caprais JC et al
(2005) Dual symbiosis in a Bathymodiolus
mussel from a methane seep on the Gabon
continental margin (South East Atlantic):
16S rRNA phylogeny and distribution of
the symbionts in the gills. Appl Environ
Microbiol 71:16941700
42. Duperron S, Sibuet M, MacGregor BJ et al
(2007) Diversity, relative abundance, and met-
abolic potential of bacterial endosymbionts in
three Bathymodiolus mussels (Bivalvia: Mytili-
dae) from cold seeps in the Gulf of Mexico. Env
Microbiol 9:14231438
43. Distel DL, Cavanaugh CM (1994) Indepen-
dent phylogenetic origins of methanotrophic
and chemoautotrophic bacterial endosym-
bioses in marine bivalves. J Bacteriol
176:19321938
44. Distel DL, Lee HKW, Cavanaugh CM (1995)
Intracellular coexistence of methano- and
thioautotrophic bacteria in a hydrothermal
vent mussel. Proc Natl Acad Sci USA
92:95989602
View publication stats
45. Duperron S, Bergin C, Zielinski F et al (2006)
A dual symbiosis shared by two mussel species,
Bathymodiolus azoricus and B. puteoserpentis
(Bivalvia: Mytilidae), from hydrothermal vents
along the northern Mid-Atlantic Ridge. Envi-
ron Microbiol 8:14411447
46. Duperron S, Halary S, Lorion J et al (2008)
Unexpected co-occurrence of 6 bacterial sym-
bionts in the gill of the cold seep mussel Idas
sp. (Bivalvia: Mytilidae). Environ Microbiol
10:433445
47. Urakawa H, Dubilier N, Fujiwara Y et al
(2005) Hydrothermal vent gastropods from
the same family (Provannidae) harbour - and
-proteobacterial endosymbionts. Environ
Microbiol 7:750754
48. Bates AE, Harmer TL, Roeselers G, Cavanaugh
CM (2011) Phylogenetic characterization of
episymbiotic bacteria hosted by a hydrothermal
vent limpet (Lepetodrilidae, Vetigastropoda).
Biol Bull 220:118127
49. Cavanaugh CM, Levering PR, Maki JS et al
(1987) Symbiosis of methylotrophic bacteria
and deep-sea mussels. Nature 325:346347
50. Fiala-Medioni A, McKiness ZP, Dando P et al
(2002) Ultrastructural, biochemical and
immunological characterisation of two popula-
tions of the Mytilid mussel Bathymodiolus azor-
icus from the Mid Atlantic Ridge: evidence for
a dual symbiosis. Mar Biol 141:10351043
51. Lorion J, Buge B, Cruaud C, Samadi S (2010)
New insights into diversity and evolution of
deep-sea Mytilidae (Mollusca: Bivalvia). Mol
Phyl Evol 57:7183
52. Pernthaler A, Pernthaler J, Amann R (2002)
Fluorescence in situ hybridization and cata-
lysed reporter deposition for the identification
of marine Bacteria. Appl Environ Microbiol
68:30943101
53. Stoecker K, Dorninger C, Daims H, Wagner M
(2010) Double labeling of oligonucleotide
probes for fluorescence in situ hybridization
(DOPE-FISH) improves signal intensity and
increases rRNA accessibility. Appl Environ
Microbiol 76:922926
54. Pond DW, Bell MV, Dixon DR et al (1998)
Stable-carbon-isotope composition of fatty
acids in hydrothermal vent mussels containing
methanotrophic and thiotrophic bacterial
endosymbionts. Appl Environ Microbiol
64:370375
55. Guezi H, Boutet I, Andersen AC et al (2014)
Comparative analysis of symbiont ratios and
gene expression in natural populations of two
Bathymodiolus mussel species. Symbiosis
63:1929