Anda di halaman 1dari 26

10/20/2017

TRANSKRIPTOMIK, PROTEOMIK
DAN METABOLOMIK
DR. REFLI, MSc
Jurusan Biologi FST
Universitas Nusa Cendan

1
10/20/2017

GENOM

Mengadung informasi
genetika
Infromasi genetika pada
organisme eukariotik DNA
Sebagian virus mengandung
informasi genetik RNA

GENOM ; khusus pada manusia

Genom pada manusia


terdiri atas ;
Genom Nukleus
Genom Mitokondria

2
10/20/2017

GENOM ; khusus pada manusia

Genom Nukleus;
pada manusia:
tersusun sekitar 3,2 x 109 nukleotida yang
terkandung dalam 24 untaian DNA
setiap untaian terkandung dalam kromosom
yang berbeda
46 kromosom : 44 autosom dan 2 genosom (X dan Y)
Sekitar 35.000 gen terdapat di genom nukleus

GENOM ; khusus pada manusia

Genom Mitokondria;
Merupakan untaian DNA berbentuk
cincin
tersusun sekitar 16.569 nukleotida
Mengandung sekitar 37 gen

3
10/20/2017

EKSPRESI GENOM

Genom; kumpulan informasi genetik yang


terkandung di dalam tubuh suatu organisme
Informasi genetik (genom) tersebut dapat
diekspresi melalui tahapan reaksi secara
berurutan;
Transkripsi produk transkripsi
(Transkriptome); RNA
Translasi produk translasi (proteome); protein

TAHAPAN EKSPRESI GENOM

4
10/20/2017

Mengukur Ekspresi genom RNA

Microarrays
Monitors the level of each gene:
Is it turned on or off in a
particular biological condition?
Is this on/off state different
between two biological
conditions?

Microarray is a rectangular grid of


spots printed on a glass microscope
slide, where each spot contains DNA
for a different gene

5
10/20/2017

Two-color DNA microarray


design Reverse
Transcription

cDNA-chip of brain glioblastoma

6
10/20/2017

Types of microarrays
Spotted (cDNA)
Robotic transfer of cDNA clones or PCR products
Spotting on nylon membranes or glass slides coated with poly-lysine

Synthetic (oligo)
Direct oligo synthesis on solid microarray substrate
Uses photolithography (Affymetrix) or ink-jet printing (Agilent)

All configurations assume the DNA on the array is in excess of the hybridized
samplethus the kinetics are linear and the spot intensity reflects that
amount of hybridized sample.

Labeling can be radioactive, fluorescent (one-color), or two-color

Microarray Spotter

7
10/20/2017

Affymetrix High Density Arrays

Microarrays (continued)

Imaging
Radioactive 32P labeling: Autoradiography or
phosphorimager
Fluorescent labeling: Confocal microscope (invented by
Marvin Minsky!!)

Feature density
Nylon membrane macroarrays 100-1000 features
Glass slide spotted array 5,000 features / cm2
Synthesized arrays 50,000 features / cm2

8
10/20/2017

Microarray
Collects sharply defined optical confocal scanner
sections from which 3D
renderings can be created
The key is spatial filtering to
eliminate out-of-focus light or
glare in specimens whose
thickness exceeds the
immediate plane of focus.
Two lasers for excitation
Two color scan in less than 10
minutes
High resolution, 10 micron pixel
size

cDNA / EST sequencing projects


cDNA = complementary or copy DNA
EST = Expressed Sequence Tag

The microarray could be described as a closed system because


information about RNAs is limited by the targets available for
hybridization. RNAs not represented on the array are not
interrogated.
Direct sequencing of cDNAs (yielding ESTs) overcomes this
problem by large-scale random sampling of sequences from a
whole-cell RNA extract
Statistical counting of distinct sequences provides an estimate of
expression level
Conversely, cDNA library can be normalized to capture rare
messages
Requires large scale sequencing to get statistical significance

9
10/20/2017

cDNA / EST Sequencing:


Preparation of a cDNA library
in phage l vector

SAGE Technology

Serial Analysis of Gene Expression


>50X more efficient than cDNA
sequencing because many
RNAs are represented in a
single sequencing run

10
10/20/2017

Steps to SAGE
Copy mRNA ds cDNA using biotinylated (dT)
Cleave with anchoring enzyme (AE) which cleaves
within ~250bp of poly-A tail at 3 end.
Capture this segment on streptavidin beads
Ligate to linkers containing a type IIs restriction
site, which cleave DNA 14 bp away from this site.
Ligate sequences to each other and PCR amplify
Cleave with AE to remove linkers
Concatenate, clone, and sequence

Velculescu et al.
Science (1995)

WHY DI-TAGS?
Ditags are used to
detect bias in the PCR
A B amplification step.
A B
A B
The probability of any
two tags being
PrimerA PrimerB coupled in the same
ditag is small.

Biased amplification
PrimerA PrimerB
can be detected as
many ditags always
having the same 2
tags present.

11
10/20/2017

SAGE (continued)
Example of a concatemer:

CATGACCCACGAGCAGGGTACGATGATACATGGAAACCTATGCACCTTGGGTAGCACATG

TAG1 TAG2 TAG3 TAG4

Tag Sequence Count


Tag Sequence Count GCGATATTGT 66
ATCTGAGTTC 1075 TACGTTTCCA 66
GCGCAGACTT 125 TCCCGTACAT 66
Counting the tags: TCCCCGTACA 112 TCCCTATTAA 66
TAGGACGAGG 92 GGATCACAAT 55
GCGATGGCGG 91 AAGGTTCTGG 54
TAGCCCAGAT 83 CAGAACCGCG 50
GCCTTGTTTA 80 GGACCGCCCC 48

PROTEOMIC

12
10/20/2017

Pengertian
Proteomic; Ilmu yang mengkaji
protein secara keseluruhan dalam sel
atau organisme; plasma, sel dan
jaringan
Proteome; kumpulan protein yang
terkandung di dalam organisme; contoh
hemeglobin dan insulin

Fungsi Proteomik
Mengkaji modifikasi pada akhir translasi
protein
Indentifikasi target protein baru untuk obat
Analisis tumor atau kanker
Membandingkan antara jaringan normal dan
jaringan sakit
Membandingkan antara jaringan sakit dan
jaringan yang mendapatkan pengobatan

13
10/20/2017

Bidang Kijang Proteomik


Area proteomik dibagi ke dalam dua
kajian utama;
Proteomik fungsional
Mengidentifikasi protein yang belum dikeltahui fungsi
biologinya di dalam tubuh
Proteomik ekspresi
Mengkaji secara kuantitatif dan kualitatif tingkat
ekpresi protein yang dipengaruhi oleh faktor internal
atau eksternal tubuh; penyakit seluler, fase
pertumbuhan, stres

GENOM & PROTEOME

Genom antara larva dan kupu dewasa indek namun


proteiom berbeda pada ke duanya

14
10/20/2017

GENOM & PROTEOME

Genom antara Berudu dan katak dewasa indek


namun proteiom berbeda pada ke duanya

Pemahaman yang baik tentang


Proteome akan memudahkan untuk
Karakterisasi jenis protein
Mengetahui pola interaksi antar
protein atau protein dengan non
protein
Mengindentifikasi biomarka suatu
penyakit

15
10/20/2017

Biomarka
Indikator suatu penyakit
Berfungsi untuk diagnosis, prognosis
dan mengetahui respons tubuh
terhadap terapi
Mengindentifikasi biomarka suatu
penyakit

Biomarka

16
10/20/2017

Biomarka

Alir Kerja Proteomik

17
10/20/2017

Tehnik Proteomik; 2D electrophoreses

Tehnik Proteomik; 2D electrophoreses

18
10/20/2017

Tehnik Proteomik; 2D electrophoreses

Tehnik Proteomik; Mass Spectrometry

19
10/20/2017

Tehnik Proteomik; Micro Array

METABOLOMIC

20
10/20/2017

Pengertian
Metabolomic ; kajian secara simultan dan
komprehensif tentang senyawa metabolit yang
dihasilkan akibat pengaruh stimulus
Metabolome; kumpulan senyawa metabolit yang
berukuran kecil yang bersifat dinamis
Metabolit; produk metabolisme
Metabolit primer; asam amino, monosakarrida, asam
lemak, mononukleotida, polipeptida, polisakarida, lipida
da polinuklotida
Metabolit sekunder; plavonoid, terpenoid, alkaloid dan
steroid

Empat hal utama dalam Analisis


metabolome
Efesiensi
Pemisahan metabolit
Deteksi
Identifikasi dan quantifikasi

21
10/20/2017

Tehnik Pemisahan & Deteksi


Metabolome

Tehnik pemisahan
Gas Kromatografi
Elektroforesis kapiler
HPLC
UPLC

Tehnik Pemisahan & Deteksi


Metabolome
Tehnik deteksi
NMR (Nuclear Magnetic Resonance
Spectroscopy)
Spektrometetri massa
Tehnik pemisahan-deteksi
GC-MS
HPLC-MS

22
10/20/2017

23
10/20/2017

24
10/20/2017

Aplikasi metabolomic

Evaluasi obat
Toksikologi klinik
Nutrigenomic
Genom fungsional

25
10/20/2017

Resea metabolomic

26