Anda di halaman 1dari 37

LAPORAN PRAKTIKUM BIOTEKNOLOGI

PERANCANGAN PRIMER

Disusun oleh :
Meranti Bekti Pertiwi
152210101117

BAGIAN BIOLOGI FARMASI


FAKULTAS FARMASI
UNIVERSITAS JEMBER
2017

i
KATA PENGANTAR

Puji syukur kami panjatkan kehadirat Allah Subhanahuwataala yang telah


melimpahkan segala rahmat-Nya sehingga saya bisa menyusun laporan Bioteknologi ini
hingga selesai. . Tidak lupa saya juga mengucapkan banyak terima kasih atas bantuan dari
semua pihak yang telah berkontribusi dengan memberikan sumbangan baik materi maupun
pikirannya.
Laporan ini disusun untuk memenuhi tugas pembuatan laporan praktikum
Bioteknologi Farmasi dengan materi Perancangan Primer. Dan harapan saya semoga
laporan ini dapat menambah pengetahuan dan pengalaman bagi para pembaca, untuk ke
depannya dapat memperbaiki bentuk maupun menambah isi laporan agar menjadi lebih baik
lagi.
Karena keterbatasan pengetahuan maupun pengalaman saya, saya yakin masih
banyak kekurangan dalam laporan ini. Oleh karena itu, saya sangat mengharapkan saran dan
kritik yang membangun dari pembaca demi kesempurnaan laporan ini. Mudah-mudahan
dengan dukungan kerja sama yang nyata dari semua pihak benar-benar mampu memberikan
sekaligus meningkatkan informasi-informasi ang berkaitan dengan isi laporan. Akhirnya
kepada semua pihak yang telah berpartisipasi dalam penyusunan program kerja ini
disampaikan terimakasih.

Jember, 18 Mei 2017

Penyusun

2
BAB I
PENDAHULUAN

1.1 Latar Belakang


Penemuan yang berpengaruh terhadap perkembangan biologi molekuler salah
saunya adalah PCR (Polymerase Chain Reaction). Teknik ini mempunyai fungsi
utama untuk memperbanyak DNA target. Proses yang terjadi melibatkan suatu primer
yan berfungsi sebagai cetakan untuk membuat DNA baru.
Perancangan primer dilakukan untuk memperoleh primer yang dapat
digunakan dalam amplifikasi DNA dengan metode Polymerase Chain Reaction (PCR).
Keberhasilan amplifikasi DNA tergantung dari ketepatan primer yang digunakan.
Primer yang digunakan dalam proses PCR harus dapat membatasi daerah yang akan
diamplifikasi. Primer berfungsi sebagai pembatas fragmen DNA target yang akan
diamplifikasi.
Amplifikasi DNA dengan metode PCR terdiri dari tiga tahap. Tahap awal dari
proses amplifikasi yaitu denaturasi untai DNA, selanjutnya dilakukan penempelan
primer pada fragmen DNA target (annealing) dan tahap akhir merupakan proses
extension yaitu proses pemanjangan sekuen DNA. Perancangan untuk memperoleh
suatu primer yang memenuhi kriteria primer yang baik untuk amplifikasi dilakukan
secara in silico, yaitu mErancang/mendesain primer dengan bantuan suatu program
dalam komputer.
Suatu keberhasilan reaksi PCR dipengaruhi oleh desain primer yang
digunakan, desain primer dapat dibuat dengan menggunakan beberapa aplikasi, dalam
pembuatan desain primer cukup sulit dilakukan sehingga dibutuhkan keterampilan
dalam membuatnya.
1.2 Rumusan Masalah
1.2.1 Bagaimana cara melakukan perancangan primer secara online ?
1.2.2 Bagaimana cara menentukan spesifitas primer ?
1.3 Tujuan
1.3.1 Mengetahui dan mampu melakukan penelusuran bioinformatika secara online.
1.3.2 Mampu menentukan spesifitas primer yan dibuat.

3
BAB II
TINJAUAN PUSTAKA

2.1 Pengertian PCR (Polimerase Chain Reaction)


PCR (polymerase chain reaction) merupakan suatu teknik atau metode perbanyakan
(replikasi) DNA secara enzimatik tanpa menggunakan organisme. Dengan teknik ini, DNA
dapat dihasilkan dalam jumlah besar dengan waktu relatif singkat sehingga memudahkan
berbagai teknik lain yang menggunakan DNA. Teknik ini dirintis oleh Kary Mullis pada
tahun 1983 dan ia memperoleh hadiah Nobel pada tahun 1994 berkat temuannya tersebut.
Penerapan PCR banyak dilakukan di bidang biokimia dan biologi molekular karena relatif
murah dan hanya memerlukan jumlah sampel yang kecil. PCR (Polimerase Chain Reaction)
atau reaksi berantai polimerase adalah suatu metode in vitro yang digunakan untuk
mensintesis sekuens tertentu DNA dengan menggunakan dua primer oligonukleotida yang
menghibridisasi pita yang berlawanan dan mengapit dua target DNA. Kesederhanaan dan
tingginya tingkat kesuksesan amplifikasi sekuens DNA yang diperoleh menyebabkan teknik
ini semakin luas penggunaannya.
2.2. Komponen
Selain DNA template yang akan digandakan dan enzim DNA polymerase, komponen
lain yang dibutuhkan adalah :

a. Primer
Primer adalah sepasang DNA utas tunggal atau oligonukleotida pendek yang
menginisiasi sekaligus membatasi reaksi pemanjangan rantai atau polimerisasi DNA.
PCR hanya mampu menggandakan DNA pada daerah tertentu sepanjang maksimum
10000 bp saja, dan dengan teknik tertentu bisa sampai 40000 bp. Primer dirancang
untuk memiliki sekuen yang komplemen dengan DNA template, jadi dirancang agar
menempel mengapit daerah tertentu yang kita inginkan.
b. dNTP (deoxynucleoside triphosphate)
dNTP alias building blocks sebagai batu bata penyusun DNA yang baru. dNTP
terdiri atas 4 macam sesuai dengan basa penyusun DNA, yaitu dATP, dCTP, dGTP
dan dTTP.
c. Buffer
Buffer yang biasanya terdiri atas bahan-bahan kimia untuk mengkondisikan reaksi
agar berjalan optimum dan menstabilkan enzim DNA polymerase.
4
d. Ion Logam
- Ion logam bivalen, umumnya Mg++, fungsinya sebagai kofaktor bagi enzim DNA
polymerase. Tanpa ion ini enzim DNA polymerase tidak dapat bekerja.
- Ion logam monovalen, kalsium (K+).
2.3 Prinsip Kerja

Secara prinsip, PCR merupakan proses yang diulang-ulang antara 2030 kali siklus.
Setiap siklus terdiri atas tiga tahap. Berikut adalah tiga tahap bekerjanya PCR dalam satu
siklus:

1. Tahap peleburan (melting) atau denaturasi. Pada tahap ini (berlangsung pada suhu
tinggi, 9496 C) ikatan hidrogen DNA terputus (denaturasi) dan DNA menjadi
berberkas tunggal. Biasanya pada tahap awal PCR tahap ini dilakukan agak lama
(sampai 5 menit) untuk memastikan semua berkas DNA terpisah. Pemisahan ini
menyebabkan DNA tidak stabil dan siap menjadi templat (patokan) bagi primer.
Durasi tahap ini 12 menit.
2. Tahap penempelan atau annealing. Primer menempel pada bagian DNA templat yang
komplementer urutan basanya. Ini dilakukan pada suhu antara 4560 C. Penempelan
ini bersifat spesifik. Suhu yang tidak tepat menyebabkan tidak terjadinya penempelan
atau primer menempel di sembarang tempat. Durasi tahap ini 12 menit.
3. Tahap pemanjangan atau elongasi. Suhu untuk proses ini tergantung dari jenis DNA
polimerase yang dipakai. Dengan Taq-polimerase, proses ini biasanya dilakukan pada
suhu 76 C. Durasi tahap ini biasanya 1 menit.
Setelah melewati tahap 3, siklus diulang kembali mulai tahap 1. Akibat denaturasi dan
renaturasi, beberapa berkas baru (berwarna hijau) menjadi templat bagi primer lain. Akhirnya
terdapat berkas DNA yang panjangnya dibatasi oleh primer yang dipakai. Jumlah DNA yang
dihasilkan berlimpah karena penambahan terjadi secara eksponensial. Pada tahap denaturasi,
pasangan untai DNA templat dipisahkan satu sama lain sehingga menjadi untai tunggal. Pada
tahap selanjutnya, masing-masing untai tunggal akan ditempeli oleh primer. Jadi, ada dua
buah primer yang masing-masing menempel pada untai tunggal DNA templat. Biasanya,
kedua primer tersebut dinamakan primer maju (forward primer) dan primer mundur(reverse
primer). Setelah menempel pada untai DNA templat, primer mengalami polimerisasi mulai
dari tempat penempelannya hingga ujung 5 DNA template. Dengan demikian, pada akhir

5
putaran reaksi pertama akan diperoleh dua pasang untai DNA jika DNA templat awalnya
berupa sepasang untai DNA.

Pasangan-pasangan untai DNA yang diperoleh pada suatu akhir putaran reaksi akan
menjadi templat pada putaran reaksi berikutnya. Begitu seterusnya hingga pada putaran yang
ke n diharapkan akan diperoleh fragmen DNA pendek sebanyak 2n 2n. Fragmen DNA
pendek yang dimaksudkan adalah fragmen yang ukurannya sama dengan jarak antara kedua
tempat penempelan primer. Fragmen pendek inilah yang merupakan urutan target yang
memang dikehendaki untuk digandakan (diamplifikasi).

Bisa kita bayangkan seandainya PCR dilakukan dalam 20 putaran saja, maka pada
akhir reaksi akan diperoleh fragmen urutan target sebanyak 220 2.20 = 1.048576 40 =
1.048536. Jumlah ini masih dengan asumsi bahwa DNA templat awalnya hanya satu untai
ganda. Padahal kenyataannya, hampir tidak mungkin DNA templat awal hanya berupa satu
untai ganda. Jika DNA templat awal terdiri atas 20 untai ganda saja, maka jumlah tadi tinggal
dikalikan 20 menjadi 20.970.720, suatu jumlah yang sangat cukup bila akan digunakan
sebagai fragmen pelacak.
2.4 Perancangan Primer
Tahapan PCR yang paling menentukan adalah penempelan primer. Sepasang primer
oligonukleotida (primer maju dan primer mundur) yang akan dipolimerisasi masing-masing
harus menempel pada sekuens target, tepatnya pada kedua ujung fragmen yang akan
diamplifikasi. Untuk itu urutan basanya harus komplementer atau setidak-tidaknya memiliki
homologi cukup tinggi dengan urutan basa kedua daerah ujung fragmen yang akan
diamplifikasi itu. Padahal, kita belum mengetahui dengan pasti urutan basa sekuens target.
Oleh karena itu, diperlukan cara tertentu untuk merancang urutan basa kedua primer yang
akan digunakan.

Dasar yang digunakan adalah urutan basa yang diduga mempunyai kemiripan dengan
urutan basa sekuens target. Urutan ini adalah urutan serupa dari sejumlah spesies/strain
organisme lainnya yang telah diketahui/dipublikasikan.

Daerah lestari juga dapat ditentukan melalui penjajaran urutan asam amino pada
tingkat protein. Urutan asam amino ini kemudian diturunkan ke urutan basa DNA. Dari satu
urutan asam amino sangat mungkin akan diperoleh lebih dari satu urutan basa DNA karena
setiap asam amino dapat disandi oleh lebih dari satu triplet kodon. Dengan demikian, urutan
6
basa primer yang disusun dapat merupakan kombinasi beberapa kemungkinan. Primer dengan
urutan basa semacam ini dinamakan primer degenerate. Selain itu, primer yang disusun
melalui penjajaran urutan basa DNA pun dapat merupakan primer degenerate karena urutan
basa pada daerah lestari di tingkat DNA pun tidak selamanya memperlihatkan homologi
sempurna (100%).
Urutan basa pasangan primer yang telah disusun kemudian dianalisis menggunakan
program komputer untuk mengetahui kemungkinan terjadinya primer-dimer akibat homologi
sendiri(self-homology) atau homologi silang (cross-homology). Selain itu, juga perlu dilihat
kemungkinan terjadinya salah tempel(mispriming), yaitu penempelan primer di luar sekuens
target. Analisis juga dilakukan untuk mengetahui titik leleh (Tm) masing-masing primer dan
kandungan GC-nya. Sepasang primer yang baik harus mempunyai Tm yang relatif sama
dengan kandungan GC yang cukup tinggi. Pemilihan primer yang akan digunakan pada PCR
harus memenuhi kriteria atau parameter tertentu agar primer berfungsi maksimal, parameter
tersebut diantaranya adalah :
1. Panjang primer 18-24 nukleotida, jika kurang dari 15 akan menurunkan spesifitas
hibridisasi dengan DNA target, jika lebih dari 40 akan menurunkan aktifitas DNA
polymerase
2. Suhu leleh (Tm) primer 50-60C dengan selisih Tm antara primer kurang dari 5C
3. Urutan nukleotida yang sama tidak boleh lebih dari 4 karena akan menurunkan
spesifitas
4. Kandungan GC sebaiknya 40-60%
5. Ujung 3 kedua primer tidak saling berkomplemen
Berikut adalah rumus untuk menghitung Tm dari primer :

Tm = 4 (G+C) + 2 (A+T)

2.5 Aplikasi teknik PCR


Saat ini PCR sudah digunakan secara luas untuk berbagai macam kebutuhan,
diantaranya:

a. Isolasi Gen
Kita tahu bahwa DNA makhluk hidup memiliki ukuran yang sangat besar, DNA
manusia saja panjangnya sekitar 3 miliar basa, dan di dalamnya mengandung ribuan
gen. Sebagaimana kita tahu bahwa fungsi utama DNA adalah sebagai sandi genetik,
yaitu sebagai panduan sel dalam memproduksi protein, DNA ditranskrip menghasilkan
7
RNA, RNA kemudian diterjemahkan untuk menghasilkan rantai asam amino alias
protein. Dari sekian panjang DNA genome, bagian yang menyandikan protein inilah
yang disebut gen, sisanya tidak menyandikan protein atau disebut junk DNA, DNA
sampah yang fungsinya belum diketahui dengan baik. Kembali ke pembahasan
isolasi gen, para ahli seringkali membutuhkan gen tertentu untuk diisolasi. Sebagai
contoh, dulu kita harus mengekstrak insulin langsung dari pankreas sapi atau babi,
kemudian menjadikannya obat diabetes, proses yang rumit dan tentu saja mahal serta
memiliki efek samping karena insulin dari sapi atau babi tidak benar-benar sama
dengan insulin manusia. Berkat teknologi rekayasa genetik, kini mereka dapat
mengisolasi gen penghasil insulin dari DNA genome manusia, lalu menyisipkannya ke
sel bakteri (dalam hal ini E. coli) agar bakteri dapat memproduksi insulin juga.
Hasilnya insulin yang sama persis dengan yang dihasilkan dalam tubuh manusia, dan
sekarang insulin tinggal diekstrak dari bakteri, lebih cepat, mudah, dan tentunya lebih
murah ketimbang cara konvensional yang harus mengorbankan sapi atau babi. Untuk
mengisolasi gen, diperlukan DNA pencari atau dikenal dengan nama probe yang
memiliki urutan basa nukleotida sama dengan gen yang kita inginkan. Probe ini bisa
dibuat dengan teknik PCR menggunakan primer yang sesuai dengan gen tersebut.
b. DNA Sequencing

Urutan basa suatu DNA dapat ditentukan dengan teknik DNA Sequencing, metode
yang umum digunakan saat ini adalah metode Sanger (chain termination method) yang
sudah dimodifikasi menggunakan dye-dideoxy terminator, dimana proses awalnya
adalah reaksi PCR dengan pereaksi yang agak berbeda, yaitu hanya menggunakan satu
primer (PCR biasa menggunakan 2 primer) dan adanya tambahan dideoxynucleotide
yang dilabel fluorescent. Karena warna fluorescent untuk setiap basa berbeda, maka
urutan basa suatu DNA yang tidak diketahui bisa ditentukan

c. Forensik

Identifikasi seseorang yang terlibat kejahatan (baik pelaku maupun korban), atau
korban kecelakaan/bencana kadang sulit dilakukan. Jika identifikasi secara fisik sulit
atau tidak mungkin lagi dilakukan, maka pengujian DNA adalah pilihan yang tepat.
DNA dapat diambil dari bagian tubuh manapun, kemudian dilakukan analisa PCR
untuk mengamplifikasi bagian-bagian tertentu DNA yang disebut fingerprints alias
DNA sidik jari, yaitu bagian yang unik bagi setiap orang. Hasilnya dibandingkan
8
dengan DNA sidik jari keluarganya yang memiliki pertalian darah, misalnya ibu atau
bapak kandung. Jika memiliki kecocokan yang sangat tinggi maka bisa dipastikan
identitas orang yang dimaksud. Konon banyak kalangan tertentu yang memanfaatkan
pengujian ini untuk menelusuri orang tua sesungguhnya dari seorang anak jika sang
orang tua merasa ragu.

d. Diagnosa Penyakit
Penyakit berbahaya seperti infeksi virus memerlukan diagnosa yang cepat dan akurat.
PCR merupakan teknik yang sering digunakan. Teknologi saat ini memungkinkan
diagnosa dalam hitungan jam dengan hasil akurat. Disebut akurat karena PCR dapat
mengamplifikasi daerah tertentu DNA yang merupakan ciri khas virus penginfeksi
yang tidak dimiliki oleh virus atau makhluk lainnya.

9
BAB III
METODOLOGI
3.1 Waktu dan Tempat
Praktikum dilakukan pada hari Jumat tanggal 12 Mei 2017 pukul 07.00 09.40 WIB,
bertempat di Ruang Kuliah 5 Fakultas Farmasi Universitas Jember.
3.2 Alat dan Bahan
Alat :
Seperangkat lengkap komputer dan assesorinya yang terkoneksi dengan internet.
Bahan :
CDS gen dari organisme tertentu sebagai molekul DNA target.
3.3 Prosedur Kerja
1. Mencari CDS gen target dari situs http://www.ncbi.nlm.nih.gov.

Dibuka situs http://www.ncbi.nlm.nih.gov

ketikkan gen yang akan dicari sekuensnya pada kolom search. pilih
nucleotide pada pilihan all databases. tekan tombol search

pilih complete genom

klik Fasta, maka akan muncul tampilan yang menunjukkan CDS genome

2. Mencari Primer

Buka kembali situs http://www.ncbi.nlm.nih.gov di tab yang berbeda

Klik DNA & RNA

Klik Primer-BLAST

Salin semua CDS gen yang dimaksud pada kolom enter accession gi or
FASTA sequence. pilih genome (all organisms) sebagai pilihan database.

Lalu klik Get Primer, tunggu hingga hasilnya keluar

10
3. Menentukan spesifitas primer

Buka kembali situs http://www.ncbi.nlm.nih.gov di tab yang berbeda

Pilih BLAST

Pilih nucleotide BLAST

Masukkan primer yang ingin dicek pada kolom enter accession number (s),
gi (s), or FASTA sequence.

Pilih nucleotide pada pilihan database, lalu klik BLAST

Tunggu beberapa sat, akan diperoleh presentasi kesamannya

3.4 Pengamatan
1. Mencari CDS gen target dari situs http://www.ncbi.nlm.nih.gov.
a. Buka laman tersebut

b. Ketikkan gen yang akan dicari sekuensnya pada kolom search. pilih nucleotide
pada pilihan all databases. tekan tombol search

11
c. tampilannya akan seperti berikut ini :

12
d. Pilih homo sapiens. Tampilan sebagai berikut :

e. Klik FASTA, akan muncul tampilan seperti berikut :

CDS
genome

2. Mencari primer
a. Buka kembali situs http://www.ncbi.nlm.nih.gov di tab yang berbeda

13
b. Klik DNA & RNA

14
c. Klik Primer BLAST. Hasil tampilan Primer-BLAST :

d. salin semua CDS gen yang dimaksud pada kolom enter acession gi or FASTA
sequence. Pilih genome (all organisms) sebagai pilihan database. Lalu klik Get
Primer.

15
e. Tunggu hingga hasilnya keluar. Tampilan hasil Primer-BLAST :

16
17
18
19
3. Menentukan spesifitas primer
a. Buka kembali laman http://www.ncbi.nlm.nih.gov di tab yang berbeda

b. Pilih BLAST

20
c. Pilih nucleotide blast

21
d. Masukkan primer yang ingin dicek pada kolom enter accession number(s), gi(s),
or FASTA sequence. Pilih nucleotide pada pilihan database. Lalu klik BLAST.

e. Tunggu beberapa saat, akan diperoleh presentase kesamaannya.


1. Forward primer 1

22
Hasil pencarian BLAST
menunjukkan primer yang
kita miliki mempunyai
persamaan 100% dengan
nukleotida target

23
24
2. Reverse primer 1

25
26
3. Forward primer 2

27
28
4. Reverse primer 2

29
5. Forward primer 3

30
6. Reverse primer 3

31
32
BAB IV
HASIL DAN PEMBAHASAN

4.1 Hasil Pengamatan


Dari sekian primer yang muncul pada program perl primer, dipilih 3 primer terbaik yaitu
tertera pada tabel di bawah ini :
No Primer Panjang Panjang GC Tm Dim Hasil
Primer Produk er Blast
1 F GTACAGCCAGTGTGTCCGAA 20 243 55% 59,97 - 100%
R TTGGTGAGCTGGTAGAAGCG 20 60% 59,97 - 100%
2 F GCCATTGAGCCAGGTGTAGT 20 75 55% 60,04 - 100%
R ACTTGTGCATGCGGTACTCA 20 50% 59,97 - 100%
3 F GTACAGCCAGTGTGTCCGAA 20 240 55% 59,97 - 100%
R TTGGTGAGCTGGTAGAAGCG 20 55% 60,04 - 100%

4.2 Pembahasan
Pada praktikum kali ini, dilakukan perancangan primer menggunakan software
online. Primer sendiri berfungsi untuk pembatas fragmen DNA target yang akan
diamplifikasi dan sekaligus menyediakan gugus hidroksi (OH) pada ujung-ujung yang
diperlukan untuk proses eksistensi DNA. Primer ini sangat menetukan keberhasilan dari
proses PCR yaitu teknik amplifikasi atau perbanyakan DNA secara invitro pada daerah
spesifik yang dibatasi oleh dua buah primer oligonukleotida. Untuk itu diperlukan primer
yang baik.
Nukleotida(sekuens DNA) yang digunakan berasal dari gen NF-kb, c-Fos, dan c-
Mycyang didapat dari http://www.ncbi.nlm.nih.gov, yang kemudian sequens nukleotida dari
NF-kb, c-Fos, dan c-Mycdi copy ke kolom sequence yang. Sebelum memulai pencarian
primer, kami mengatur Tm, dan panjang primer. Tm primer yang kami gunakan yaitu 50-
60C dengan selisih Tm antara primer sebesar 5C, dan panjang primer 18-24 nukleotida. Lalu
tekan Get primer. Selanjutnya akan muncul beberapa primer. Pada saat praktikum dipilih 3
primer terbaik yang akan diidentifikasi. Berikut identifikasi tiga buah primer yang saya
lakukan :
Dari data yang dihasilkan dapat dilihat kualitas primer yang baik untuk PCR. Beikut
analisis primer yang telah dirancang dibandingkan dengan syarat-syarat primer yang baik:

33
a. Panjang primer

Syarat primer yang baik adalah 18 24 nukleotida. Jika panjang primer kurang dari 15
menyebabkan terjadinya mispriming (penempelan primer di tempat lain yang tidak
dikehendaki) tinggi sehingga menyebabkan spesifitas dari primer tersebut berkurang dan
berakibat pada efektifitas dan efisiensi proses PCR. Sedangkan jika panjang primer lebih dari
40, dapat menurunkan aktifitas DNA polymerase.
Pada ketiga primer yang saya gunakan (AR) panjang primernya 20 nukleotida, hal
tersebut menunjukkan primer tersebut baik karena rentang panjang primer yang baik itu
antara 18-24 nukleotida.
b. Kandungan G+C

Kandungan G+C dalam urutan primer yang baik sebesar 40-60%. Pada untai DNA
pasangan basa G-C melibatkan tiga ikatan hidrogen, sedangkan untuk pasangan basa A-T
terlibat dalam dua ikatan hidrogen, sehingga keseimbangan prosentase GC memungkinkan
ikatan yang terbentuk lebih spesifik dan stabil.
Kandungan % GC yang rendah dapat menurunkan efisiensi proses PCR disebabkan
karena primer tidak mampu berkompetisi untuk menempel secara efektif pada template.
Untuk kandungan GC dari ketiga primer tersebut dalam rentang 40-60%, dimana
kandungan tersebut masuk kedalam rentang kandungan primer yang baik yaitu berkisar
antara 40-60%.

c. Tm primer

Tm adalah suhu dimana 50% untai ganda DNA terpisah. Tm dapat mempengaruhi
proses annealing. Tm diatas 60 oC akan mengurangi efektifitas annealing sehingga proses
amplifikasi DNA kurang berjalan baik.Tm ini sangat ditentukan oleh jumlah basa GC,
sebagaimana dapat dijelaskan pada persamaan berikut : {Tm = {4 (G + C) + 2 ( A + T )}
Ketiga primer yang telah dirancang pada praktikum memiliki Tmyang masuk kedalam
rentang Tm primer yang baik yaitu berkisar antara 50-60C.
d. Selisih Tm antar primer

Pasangan primer yang baik memiliki selisih Tm kurang dari 5C. Jika selisih Tm
primer lebih dari 5C menyebabkan penurunan proses amplifikasi, atau bahkan
memungkinkan tidak terjadi proses amplifikasi.

34
Pada praktikum ini dihasilkan selisih Tm primer pada masing-masing primer telah
didapatkan kurang dari 5C
e. G/C pada ujung 3 ( GC Clamp)

Basa A atau T lebih toleran terhadap mismatch, sehingga menurunkan spesifisitas


primer. Mismatch adalah penempelan primer di tempat yang tidak diinginkan pada DNA
template. Keberadaan G/C di ujung 3 primer sangat membantu terjadinya stabilitas ikatan
antara primer dengan DNA template yang diperlukan untuk inisiasi polymerase DNA (proses
PCR).
Tetapi perlu dihindari adanya lebih dari 3 basa G atau C pada 5 basa terakhir ujung 3
karena ujung 3-nya bisa melipat membentuk struktur dimer yang mengakibatkan ujung 3
primer tidak terikat pada template.
Pada praktikum ini, digunakan protein AR. Dari berbagai macam primer yang telah
didapatkan diatas, diambil primer pair 1 dikarenakan pada primer pair 1 Tm-nya memiliki
selisih yang paling kecil yaitu 0 dan memenuhi syarat rentang 50-60C serta GC-nya
memenuhi syarat rentang 40-60%. Panjang primernya 20 nukleotida dan panjang produknya
246 nukleotida. Panjang primernya juga memenuhi syarat rentang 18-24 nukleotida.
Pada hasil dari BLAST, menunjukkan hasil primer yang diketahui memiliki
persamaan 100% dengan nukleotida target. Untuk Reversed Primer menunjukkan primer yang
diketahui memiliki persamaan 100% dengan nukleotida target. Sehingga dapat disimpulkan
BLAST menunjukkan bahwa hasil pencarian menunjukkan primer yang diketahui memiliki
persamaan 100% dengan nukleotida target.

35
BAB V

PENUTUP

5.1 Kesimpulan

Protein AR pada forward primer memiliki urutan nukleotida


GTACAGCCAGTGTGTCCGAA, panjang primernya 20 nukleotida sedangkan panjang
produknya 246 nukleotida. Selain itu memiliki GC sebesar 55% dan Tm sebesar 59,97 oC, dan
hasil blast sebesar 100% dari Homo sapiens cell-line 104S androgen receptor (AR) mRNA,
partial cds, sedangkan pada reverse primer memiliki urutan nukleotida
TTGGTGAGCTGGTAGAAGCG, dimana panjang primernya 20 nukleotida sedangkan
panjang produknya 75 nukleotida. Selain itu memiliki GC sebesar 60%, Tm sebesar 59,97 oC,
dan hasil blast sebesar 100% dari Homo sapiens cell-line 104S androgen receptor (AR)
mRNA, partial cds.

5.2 Saran
Mahasiswa seharusnya mempelajari dahulu materi yang akan dipraktikumkan supaya
paham pada waktu praktikum dan tidak mengalami kesulitan

36
DAFTAR PUSTAKA

David, J. C, Jannet L.,Comparison of Vitek 32 and Microlog ML3 System for


Identification of Select Biological Warfare Agents, Armed Force Institute of Pathology,
American Registry of Pathology, Washington, DC, 2001de Nogueira L., Bittrich, V.P.C.,
Shepherd, G. J., Lopes A. V., and Marsaioli, A. J. 2001.

Marlina, Radu, S., Kqueen, C. Y., Napis, S., Zakaria, Z., Mutalib, S. A. and Nishibuchi, M.
Occurrence of tdh and trh genes in Vibrio parahaemolyticus isolated from Corbicula
moltkiana Prime in West Sumatera, Indonesia. Southeast Asian Journal of Tropical Medical
Public Health Vol.38 No. 2 March 2007.

Marlina, Zulqifli, Anamerta, L., Revadiana, I., Radu, S., Kqueen, C. Y. and Nishibuchi, M.
Identification of Vibrio parahaemolyticus from clinical samples in West Sumatera Using
Polymerase Chain Reaction Methods. Acta Pharmaceutica Indonesia 31 (2): 2007, 96-99.

Retnoningrum, D.S. 1997. Penerapan Polymerase Chain Reaction (PCR) untuk diagnosis
penyakit infeksi. Jurusan Farmasi FMIPA. Bandung: ITB.

37