BMC Genetics BioMed Central

BMC
22001,Genetics
Research article :13
Major genomic mitochondrial lineages delineate early human
expansions
Nicole Maca-Meyer, Ana M Gonzlez, Jos M Larruga, Carlos Flores and
Vicente M Cabrera*

Address: Department of Genetics, Faculty of Biology, University of La Laguna, Tenerife, 38271, Spain
E-mail: Nicole Maca-Meyer - nmacame@ull.es; Ana M Gonzlez - amglez@ull.es; Jos M Larruga - jlarruga@ull.es;
Carlos Flores - cflores@ull.es; Vicente M Cabrera* - vcabrera@ull.es
*Corresponding author

Published: 13 August 2001 Received: 9 July 2001

Accepted: 13 August 2001
BMC Genetics 2001, 2:13
This article is available from: http://www.biomedcentral.com/1471-2156/2/13
2001 Maca-Meyer et al; licensee BioMed Central Ltd. Verbatim copying and redistribution of this article are permitted in any medium for any non-
commercial purpose, provided this notice is preserved along with the article's original URL. For commercial use, contact info@biomedcentral.com

Abstract
Background: The phylogeographic distribution of human mitochondrial DNA variations allows a
genetic approach to the study of modern Homo sapiens dispersals throughout the world from a
female perspective. As a new contribution to this study we have phylogenetically analysed complete
mitochondrial DNA(mtDNA) sequences from 42 human lineages, representing major clades with
known geographic assignation.
Results: We show the relative relationships among the 42 lineages and present more accurate
temporal calibrations than have been previously possible to give new perspectives as how modern
humans spread in the Old World.
Conclusions: The first detectable expansion occurred around 59,00069,000 years ago from
Africa, independently colonizing western Asia and India and, following this southern route, swiftly
reaching east Asia. Within Africa, this expansion did not replace but mixed with older lineages
detectable today only in Africa. Around 39,00052,000 years ago, the western Asian branch spread
radially, bringing Caucasians to North Africa and Europe, also reaching India, and expanding to
north and east Asia. More recent migrations have entangled but not completely erased these
primitive footprints of modern human expansions.

Background eages, defined as haplogroups, whereas those at the tips

Human mtDNA is a non-recombining molecule with ma-
ternal inheritance and practically haploid genetics. Dif-
ferences between mtDNA sequences are only due to
mutation. As time passes, mutations accumulate sequen-
tially along less and less related molecules that constitute
independent lineages known as haplotypes. Relation-
ships among lineages can be estimated by phylogenetic
networks [1] where mutations are classified in hierarchi-
cal levels. Basal mutations are shared for clusters of lin-
characterize individuals. Major haplogroups [2] are con-
tinental or ethnically specific. Three of them (L1, L2, and
L3) group sub-Saharan African lineages, nine (H, I, J, K,
T, U, V, W and X) encompass almost all mtDNAs from
European, North African and Western Asian Caucasians.
Finally, haplogroups A, B, C, D, E, F, G and M embrace
the majority of the lineages described for Asia, Oceania
and native Americans. The geographic distribution of de-
rived branches of these haplogroups has shed light on
 1048
2245 3666
825A
3516A 7389
2758
4312 13293
2885
95 13789
4586 7146
5442 14178
8468
5460 14560
8655
5603 10688
6185 709
100 10810
2394d
8428 1406 13105
5951
8566 1738 13506
6071
9042 2352 15301
6917
9347 2768 16187
7498
9755 3308 16189
7789
9818 5036 16311
8027
10589 5046 247
BMC Genetics 2001, 2:13

9072
10664 5393 9370
10915 5655 769
9377
100 11176 6827 680 1018
9966
11641 7055 709 3594
10586
11914 7867 1442 4104
11302
12007 8248 2332 7256
11396 93
12720 12519 2416 7521
11719
13276 14203 3200A 13650
12019
15136 14769 5201 16278
12501
15431 14812 5988 152
12616
16148 15115 6437 182
12810
16172 16126 7624A
14000A 13105 10400 8701
16230 16264 8206
14911 16124 14783
9221 9540
16320 16270 84
15622 15043
10115 78 10398
73 16293 15905 1719 3450 489
93 11944 10873
16519 15978 4688 3492 514dd 15301
95C 185T 12026 11946
16129 5147 4164 3552A
182 195 12236 146 16189 153 514dd
16187 7389 5773 4715
189 13590 1047
357 16294 7424 8870 1106 6446 8251 12705
6221 7013 4071 2626 663 1719 62
236 13958C 3254 709
16360 8618 12007 6680 1719 16223
8393 7196A 4850 2772 1736 4722 709
14061A 4200T 3243
151 13752 9305 12234 5442 12403 68 10238 4216 14766 11467
8584 4386 4248 6221 5046
L1b 15110 4216 4833 827
1539A 186A 13886 9449 15431 6455 96 14110 12501 11251 12308
2857 9545 4958 4824 6371 5460 9137 11719
15217 152 4317 5108 961 80 68 65
5096 189C 14284 10086 9557 8059 16249 15452A 12372
3565 15236 195A 6455 5601 5480 7400A 7864 4529T 9667 73
5231 15061 4883 16311 1598 3816
3808 316 10373 11914 9824 16126 152
15849 204 7337 7600 8027 8393 8994 10034 16278 3010
5628 16256 5178A 195 1703 4117 2387
4596 10424T 12454 11152g 9824 8794 11908 11947 16311 7028 16519 1811
16390 5301 9377 10398 6023 3010 709 4580
5911 16519 2639
5147 11002 12574 11719 10730 12007 13708 12414 16519 61
150 5442 9575 8868 813 6413 10398 1888 4928 5189 2706 3197 16051 14798
7258 L1c 152 13914A
M2 12091 3921A 100 13780 1692T 81 4703 52
5581 13263 11143 13448 14470 12574 15043 150 303i
195 5554 11553g 14645 14127 6455 12612 4917 8277 12245 9477 16189
8191 458 4960 1438 4452 7669 2706 78 6518
5711 15311 14318 15236 12771 15205 15927 16292 15924
198 7129 13563 15247g 15172 8206 13708 8697 13617
14007 5471 8279 12358 3010 7309 14233 5471 3720 7256 980
6257 15314 16298 16295 15422 16111 16129 189 HV 1700 1189
303i 7669 14173 15670 15884 16129 8272d9 16069 10463 16270
14308 8836 9656 73 9066 7805 5390 9266 3741
6607 L3d 15824 16325 16362 16189 195 4769 4025 5913
325 15915 14200 16185 16129 16209 16391 295
16129 7673 9335 13590 13368 12237d 303i H1 14034 10506
7561 16278 16327 199 8860 16093 5656 5147 5426 5360 9055
513 16140 14569 303ii 16290 16278 204 709
16168 8580 16182C 11362 6515 15236 462 14905 14629 14179 13934
8251 16362 248d 303ii 8272d9 15326 16183d 7385 5460 6045 8137
16209 16194 466 16319 195 1700 100 9698
16188g 10397 16183C 12372 15758 15535 489 15607 15904 H2 15043 14139
8272d9 263 12961 16519 16189 7768 6962 6152 10084 10154
16262 16195g 152 16362 225 W 1780
16293 11902C 12822 16184A 16136 15928 16298 15530 15454
8460 286dd 13602 1733 263 10927 9545T 100 10876 10142 10398
L2 L3b M1 16274 16197g 311ii 235 227 16183C 7789 3316
16519 12810 M12 16145 16189 16519 15632 16343 10382
10984g 493 14233 14180 311i HF 12618 10398 13020 10550
16320 16256 513 303i 16189 7963 5495
152 13984 16176g IF 16294 72 16172 16390 13500
11172 15452A 16145 14182 11893 15907 11299
16399 16278 437 16217 8633 14793
185 14927 X 16180 303i 303i RCRS 16219 150 15601
12967C 16148 16222 16189 13789 16129C 12738g
146 16362 9380 14861
C 15562 M11 16390 16284 152
15317 250 16261 16192 14926 16362 16248 14167
303i 152 15924 9899 736 15218
15622 A 152 199 V U6
16184 L1a 16519 150 16234 508 16318T 15301
215 16193 12633A 2308 15924 867 3010
15737 514dd I 202
16188A 303i 16294 514dd 16145
16300 16163 14180 16093 10352 10724
16184i 207 709 3849
16278 M3 152 J1b 16153 471 16224
303i 16186 14233 6917 514dd 15734
16190i G 7151
64 N1b 248d 152 16153 16256 U5b U7 16311
16311 499 7759 13734 16356
89 195 150 16311 U2 U32 146
16316 11176 16092
171 J2 16399 U31 152
16362 12346 16368
514dd B T1 T5 152 195
16519 16319 150
195 514iCA
150 217
L1aA 151 340
U21
152 U5a K
303ii U22

Figure 1
Phylogenetic network based on complete mtDNA genome sequences. Nomenclature of individuals is as in Table 1. Numbers along the links refer to nucleotide posi-
tions; suffixes are transversions; underlining indicates recurrent mutations; the order of the mutations on a path not interrupted by any branching or distinguished
nodes is arbitrary. The same topology was supported by bootstraps, using NJ and 1000 replicates; the bootstrap values higher than 50% are shown over the branches.
The star shows the position where the chimpanzee sequence roots in the network.
http://www.biomedcentral.com/1471-2156/2/13
BMC Genetics 2001, 2:13
crucial aspects of human history, such as the probable
origin and approximate dating of migrations into the
New World [3] and Polynesia [4,5], and quantitative es-
timations of the relative Paleolithic and Neolithic contri-
butions to the extant European mtDNA diversity [2]. At
the other end of the phylogenetic tree, the ultimate coa-
lescence of all worldwide mtDNA lineages into Africa has
favored, since the beginning, the recent African origin
hypothesis for all modern humans [6]. The analyses of
the complete mtDNA sequence of 53 humans of diverse
origins [7] have added statistical support to this hypoth-
esis. However, as the current definition of the major hap-
logroups is not based on total genomic sequences, there
is not yet a clear resolution of their basal relationships.
This genomic phylogenetic reconstruction is necessary to
infer the early human dispersal routes after the African
exodus. We present the phylogenetic network of 42 com-
plete mtDNA sequences including representatives of the
major haplogroups. Based on their relative clustering
and coalescence ages we propose a tentative model of the
way the Old World could have been colonized by modern
humans.
Results and Discussion
The phylogenetic network of the 42 mtDNA sequences
(Fig. 1) was free of reticulations when mutations [8] 150,
152, 303i and 16519 were omitted in its construction. The
tree topology was the same as the bootstrap supporting
neighbor joining tree. We detected 35 parallel substitu-
tions from 124 variable positions (28%) in the non-cod-
ing region (1,122 bp in length), and 45 from 409 (11%) in
the coding region (15,447 bp in length). Shared muta-
tions in basal branches of the tree relate haplogroups,
U5 A tation. The next branching (Fig. 2), dated between
39.000-53.000
B 59,00069,000 yr BP, also occurred in Africa but com-
U6 U2
C
D
L3 M
G (L3), and others with a first expansion out of Africa. To-
59.000-69.000
L2
L1b/c
L1a
Figure 2
Geographic dispersal routes and minimal estimated ages of
major human expansions in the Old World, deduced from
the age and geographic localisation of main mtDNA haplo-
groups.
http://www.biomedcentral.com/1471-2156/2/13
however, parallel mutations should be avoided in their
global affiliations. As can be expected from haplotypes of
well-differentiated haplogroups the majority of muta-
tions are in the external branches of the tree, including
those that specifically define them [2]. Nevertheless, it is
well known that in population studies these main lineag-
es sprout into several sub-clusters sometimes with inter-
esting geographic localization. In the cases where
representatives of these sub-clusters have also been ana-
lyzed, it is evident that the African ones are at the same
level of divergence as non-African clusters. More infor-
mation of cluster structure in Africa is necessary. In non
African groups, two haplotypes belonging to sub-haplo-
group U2 have a divergence similar to that found be-
tween other sub-clusters of the Caucasian U haplogroup.
One of them, lacking mutations 16129C and 15907, that
are present in all western Eurasian representatives, re-
sembles haplotypes found in India [9]. The proposed in-
clusion of haplogroup K into the U cluster [10] is
confirmed, being U7 its most probable related sub-clade.
Main Asian haplogroups belong to two different major
clusters, whereas A and B rooted with Caucasoid haplo-
groups, C, D, G and M constitute a monophyletic cluster.
Likewise, African haplogroup L3 is more related to Eur-
asian haplogroups than to the most divergent African
clusters L1 and L2. Chimpanzee rooting shows that the
oldest lineage of extant modern humans is the African
L1a cluster. In addition, the significant bootstrap values
on the deep African branches reinforce the statistical
support that the out of Africa hypothesis has obtained
through a parallel genomic mtDNA study [7]. We have
estimated a minimum total coalescence for modern hu-
man lineages from 156,000 to 169,000 years before
present (yr BP). The two subsequent ancient splits also
happened inside Africa, originating the L1b/c and L2
haplogroups with ages of 122,000132,000 yr BP and
85,00095,000 yr BP respectively. These three clades
still have an overwhelming sub-Saharan African implan-
prising clades currently found only in this continent
day, L3 derivatives are present in nearly all the African
populations. This ancient spread inside Africa has been
directly detected by the ages of several sub-clade expan-
sions [11] and indirectly confirmed by genetic admixture,
involving archaic and modern autosomal gene alleles,
detected only in Africa [12]. The coexistence in African
populations of very divergent non-recombining lineages
may erroneously bias demographic estimations based on
pair-wise nucleotide differences [11]. Two hypothetical
routes for the Asian colonization have been proposed
[13], one through Central Asia and one through South
Asia. Coincidentally, we detect at least two independent
lineages spreading out of Africa. One comprises all M de-
BMC Genetics 2001, 2:13 http://www.biomedcentral.com/1471-2156/2/13

Table 1: HVS I motifs

Sample HVS I motif Haplogroup Origin Ref.a

K 145 224 311 K Iberian 1

U7 248 318T U7 Iberian 1
U31 343 356 390 U3 Canarian 1
U32 343 390 U3 Moroccan 1
U21 051 092 129C 189 362 368 U2 Jordanian 1
U22 051 129C 189 319 362 U2 Iberian 1
U2 051 189 234 294 U2 Jordanian 1
U5b 189 192 270 U5b Berber 1
U5a 093 153 256 270 311 399 U5a1a Swede 2
U6 172 219 U6 Moroccan 1
H1 H Mauritanian 1
HF 093 183d 189 H 3
RCRS H European 4
H2 H Iberian 1
V 298 V Berber 1
HV 278 311 HV Jordanian 1
T5 126 153 189 294 T5 Moroccan 1
T1 126 163 186 189 294 T1 Iberian 1
J1b 069 126 145 222 261 J1b Moroccan 1
J2 069 126 193 300 J2 Iberian 1
B 136 183C 189 217 284 B Japanese 5
I 129 148 223 391 I Iberian 1
IF 129 184A 223 391 I 3
N1b 145 176G 180 223 390 N1b Jordanian 1
W 223 292 W Iberian 1
X 129 189 223 278 X Moroccan 1
A 111 209 223 290 319 362 A Canarian 1
M11 129 182C 183C 189 223 249 311 M1 Moroccan 1
M12 185 189 223 249 311 M1 Jordanian 1
G 189 194 195G 197G 223 256 278 362 G Japanese 6
M3 140 209 223 262 274 320 399 M Japanese 7
D 184iC 190iC 223 311 316 362 D Japanese 6
M1 223 295 362 M Filipino 1
M2 223 M Indian 1
C 223 298 325 327 C Canarian 1
L3b 124 223 278 362 L3b Mauritanian 1
L3d 124 223 256 L3d Jordanian 1
L2 223 278 390 L2 Mauritanian 1
L1c 129 189 223 278 294 311 360 L1c Mauritanian 1
L1b 126 187 189 223 264 270 278 293 311 L1b Mauritanian 1
L1a 129 148 168 172 187 188G 189
223 230 278 293 311 320 L1a Moroccan 1
L1aA 148 172 184 187 188A 189 223
230 311 320 L1a African 8

a 1, This work; 2, GenBank accession number X93334; 3, H and I references [34], we have added for the comparisons the 263, 311i and 16519
mutations in both sequences and 00073 in the I sequence; 4, revised Cambridge reference, GenBank accession number NC 001807; 5, Positive con-
trol [35], for comparisons we added 1438; 6, MELAS, P-1 (G) and FICM (D) [36]; 7, (ref [37]); 8, GenBank accession number D38112, for compar-
isons we added 311i.

rivatives that radiated 30,00057,600 yr BP. Subse- like radiation of these clades suggests that this wide geo-
quent expansions of this clade have been found in India graphic colonization could have happened in a relatively
[9] and Eastern Asia where it possibly originated and ex- short time. Genetic support for this southern spread of M
panded as haplogroups C, D, G and others [14]. The star- through Ethiopia and the Arabian Peninsula along South
BMC Genetics 2001, 2:13
Asia has been recently proposed due to the presence of
subclade M1 in Eastern Africa [15]. However, a posterior
return from Asia to Africa of these lineages is a more
plausible explanation because the genetic diversity of M
is much greater in India [9] than in Ethiopia [15]. In fact,
M1 could be a branch of the Indian cluster M as ancestral
motifs of the African M1 are found in M*, M3 and M4 In-
dian subclusters [16]. Furthermore, one of the most de-
rived M3 haplotypes in India (10398, 10400, 16086,
16129, 16223, 16249, 16259, 16311) has all the basic sub-
stitutions that defined the Ethiopian clade, excepting the
highly variable 16189 [9]. This supposed Indian expan-
sion to the west also reached northern areas since
evolved representatives of M4 have been also detected in
Central Asia [17]. We may consider the upper bound for
this return to Africa 25,00047,000 yr BP, the age calcu-
lated for M1 in Eastern Africa based on HVSI sequences
or 33,00063,000 obtained using RFLPs [15].
The other major branch that left Africa gave rise mainly
to Caucasoid lineages which is congruent with a northern
route through the Levant. With a lower bound of
43,00053,000 yr BP this branch spread into at least
three main clusters. One comprises haplogroups X and A
with only a shared mutation between them and different
geographic distributions. Whereas A is widespread in
Asia, X is mainly restricted to Europe. Curiously, repre-
sentatives of both clusters have been detected in native
Americans raising the possibility that some American In-
dian could have European ancestry [18]. Nevertheless, X
haplotypes have recently been detected in Central Asia.
These Asian X haplotypes lack the 225A mutation, as the
majority of the American X, pointing to this area as the
most probable source for the dispersal of the New World
founders [19]. The second cluster groups minor haplo-
groups W, I and N1b, the three are present although in
low frequencies in Europe, Near East and Caucasus but
only I and N1b have been also detected in Egypt and Ara-
bia [2]. The last group radiated around 39,00052,000
yr BP, giving at least four ancestral clusters. One of them
originated haplogroup B that expanded to Eastern Asia,
reaching Japan and southeastern Pacific Archipelagos
[20,21]. In early studies, this clade was defined by the 9-
bp COII-tRNALys deletion but after that it has been
found with independent origins on other haplogroup
backgrounds [2224]. In this study we have detected
this deletion on an Iberian haplotype belonging to haplo-
group I. Curiously, it was also found in an Italian haplo-
type I [25]. However, the 9-bp deletion was absent in a
wide screen that we carried out on Iberian and North-
west African I haplotypes. The detection in two Mediter-
ranean populations of I haplotypes harboring the 9-bp
deletion points to the existence in this area of a subset of
I haplotypes that share a recent common ancestor. As
happens with A, haplogroup B has not been found in
http://www.biomedcentral.com/1471-2156/2/13
northern India [9] but is present in Mongolia [26], fa-
voring a Central Asian route for the expansion of these
prominent Asian haplogroups. Two additional clades
join haplogroups J and T and haplogroups H, V and HV
respectively. Derivatives of at least some of them are
found in Europe, North Africa, Central Asia and even In-
dia, but the most probable origin for all these expansions
is the Near East-Caucasus area [2,17,27]. Finally, cluster
U seems to have suffered a radial spread (Fig. 2), giving
subsequent diversification in different geographic areas.
Three sub-haplogroups, U2, U5 and U6 had their major
expansions in India, Europe and North Africa respective-
ly. U2 split in two branches, one, characterized by muta-
tions 16129C and 15907, is geographically scattered from
Western Europe to Mongolia [2,26] but has not been de-
tected in North Africa. The other reached India where it
gave origin to several sub-clusters with global frequen-
cies around 10% being, after its predecessor haplogroup
M (53%), the second most abundant haplogroup in India
[9]. U7 with a minor implantation in Europe but third in
frequency in India [9] and also not detected in North Af-
rica might have had a similar expansion as U2. The main
radiation of haplogroup U5 occurred in Europe. It has
been stated that this lineage entered Europe during the
Upper Paleolithic [2], most probably from the Middle
East-Caucasus area. The great divergence found here for
the two U5 representatives is in agreement with the old
age proposed for this haplogroup. Finally, U6 traces the
first detectable Paleolithic return to Africa of ancient
Caucasoid lineages. It has been mostly found in North-
west Africa, with a global estimated age of 47,000 years
[28] reflecting an old human continuity in that rather
isolated area. The fact that in Europe it has only been de-
tected in the Iberian Peninsula [29] rules out a possible
European route, unless a total lineage extinction in all
the path is invoked. On the other hand, its presence in
Northeast Africa [30], albeit in low frequencies, reinforc-
es its way through North Africa. A third possibility could
be that this lineage never went out of Africa but its coa-
lescence with clades which all had prominent expansions
in Eurasia weakens this option. U3 has also been found
with a comparatively higher frequency in Northwest Af-
rica [29] and might have followed the same route as U6,
however, as its star-like expansion in the Caucasus has
been dated around 30,000 yr BP [30], it most probably
reached Africa in a posterior expansion. This out of Afri-
ca and back again hypothesis has also been suggested for
Y-chromosome lineages [31]. Subsequent Neolithic and
historic expansions have doubtlessly reshaped the hu-
man genetic pool in wide geographic areas but mainly as
limited gene flow, not admixture, between populations.
Consequently, the continental origin of the major haplo-
groups can still be detected and the earliest human
routes inferred through them.
BMC Genetics 2001, 2:13 http://www.biomedcentral.com/1471-2156/2/13

Table 2: Oligonucleotide pairs used in the amplification and sequencing

Fragment Annealing
Name CRS reference Sequence (5'3') size (pb) temp.(C)

L16340 (1631816340) AGCCATTTACCGTACATAGCACA 681 52

H408 (429408) TGTTAAAAGTGCATACCGCCA
L382 (362382) CAAAGAACCCTAACACCAGCC 603 56
H945 (964945) GGGAGGGGGTGATCTAAAAC
L923 (902923) GTCACACGATTAACCCAAGTCA 607 56
H1487 (15081487) GTATACTTGAGGAGGGTGACGG
L1466 (14451466) GAGTGCTTAGTTGAACAGGGCC 629 58
H2053 (20732053) TTAGAGGGTTCTGTGGGCAAA
L2025 (20042025) GCCTGGTGATAGCTGGTTGTCC 609 52
H2591 (26122591) GGAACAAGTGATTATGCTACCT
L2559 (25382559) CACCGCCTGCCCAGTGACACAT 591 56
H3108 (31283108) TCGTACAGGGAGGAATTTGAA
L3073 (30513073) AAAGTCCTACGTGATCTGAGTTC 640 52
H3670 (36903670) GGCGTAGTTTGAGTTTGATGC
L3644 (36253644) GCCACCTCTAGCCTAGCCGT 623 58
H4227 (42474227) ATGCTGGAGATTGTAATGGGT
L4210 (41894210) CCACTCACCCTAGCATTACTTA 625 55
H4792 (48134792) ACTCAGAAGTGAAAGGGGGCTA
L4750 (47294750) CCAATACTACCAATCAATACTC 599 52
H5306 (53275306) GGTGATGGTGGCTATGATGGTG
L5278 (52595278) TGGGCCATTATCGAAGAATT 593 58
H5832 (58515832) GACAGGGGTTAGGCCTCTTT
L5781 (57625781) AGCCCCGGCAGGTTTGAAGC 626 58
H6367 (63876367) TGGCCCCTAAGATAGAGGAGA
L6337 (63186337) CCTGGAGCCTCCGTAGACCT 601 58
H6899 (69186899) GCACTGCAGCAGATCATTTC
L6869 (68506869) CCGGCGTCAAAGTATTTAGC 578 58
H7406 (74277406) GGGTTCTTCGAATGTGTGGTAG
L7379 (73587379) AGAAGAACCCTCCATAAACCTG 580 56
H7918 (79377918) AGATTAGTCCGCCGTAGTCG
L7882 (78617882) TCCCTCCCTTACCATCAAATCA 506 56
H8345 (83668345) TTTCACTGTAAAGAGGTGTTGG
L8299 (82808299) ACCCCCTCTAGAGCCCACTG 603 56
H8861 (88828861) GAGCGAAAGCCTATAATCACTG
L8799 (87798799) CTCGGACTCCTGCCTCACTCA 638 58
H9397 (94169397) GTGGCCTTGGTATGTGCTTT
L9362 (93429362) GGCCTACTAACCAACACACTA 609 56
H9928 (99509928) AACCACATCTACAAAATGCCAGT
L9886 (98659886) TCCGCCAACTAATATTTCACTT 617 56
H10462 (1048110462) AATGAGGGGCATTTGGTAAA
L10403 (1038310403) AAAGGATTAGACTGAACCGAA 612 56
H10975 (1099410975) CCATGATTGTGAGGGGTAGG
L10949 (1093010949) CTCCGACCCCCTAACAACCC 617 58
H11527 (1154611527 CAAGGAAGGGGTAGGCTATG
L11486 (1146711486 AAAACTAGGCGGCTATGGTA 629 56
H12076 (1209512076 GGAGAATGGGGGATAGGTGT
L12028 (1200812028 GGCTCACTCACCCACCACATT 615 58
H12603 (1262312603 ACGAACAATGCTACAGGGATG
L12572 (1255312572 ACAACCCAGCTCTCCCTAAG 591 56
H13124 (1314313124 ATTTTCTGCTAGGGGGTGGA
L13088 (1306813088 AGCCCTACTCCACTCAAGCAC 618 58
H13666 (1368513666 AGGGTGGGGTTATTTTCGTT
L13612 (1359313612 AAGCGCCTATAGCACTCGAA 614 56
H14186 (1420614186 TGGTTGAACATTGTTTGTTGG
L13612 (1359313612 AAGCGCCTATAGCACTCGAA 614 56
H14186 (1420614186 TGGTTGAACATTGTTTGTTGG
L14125 (1410414125 TCTTTCTTCTTCCCACTCATCC 602 58
BMC Genetics 2001, 2:13 http://www.biomedcentral.com/1471-2156/2/13

Table 2: Oligonucleotide pairs used in the amplification and sequencing (Continued)

H14685 (1470514685 CATTGGTCGTGGTTGTAGTCC
L14650 (1462914650 CCCCATTACTAAACCCACACTC 604 58
H15211 (1523215211 TTGAACTAGGTCTGTCCCAATG
L15162 (1514315162 CTCCCGTGAGGCCAAATATC 597 58
H15720 (1573915720 GTCTGCGGCTAGGAGTCAAT
L15676 (1565715676 TCCCCATCCTCCATATATCC 524 56
H16157 (1618016157 TGATGTGGATTGGGTTTTTATGTA
L15996 (1597515996 CTCCACCATTAGCACCCAAAGC 446 58
H16401 (1642016401 TGATTTCACGGAGGATGGTG

Conclusions strap resampling with 1000 replications (PHYLIP

After coming out of Africa, modern humans first spread
to Asia following two main routes. The southern one is
represented by haplogroup M and related clades that are
overwhelmingly present in India and eastern Asia. The
northern one gave a posterior radiation that, through
Central Asia, again reached North and East Asia carry-
ing, among others, the prominent lineages A and B. Later
expansions, can be detected by the presence of subclades
of haplogroup U in India and Europe. There were also re-
turns to Africa, most probably from the same two routes.
The return from India could be detected by the presence
of derivatives of M in Northeast Africa, and the arrival of
Caucasoids by the existence of a subclade of haplogroup
U that, today, is mainly confined to Northwest Africa.
Materials and Methods
Lineages
We have manually sequenced 33 complete mtDNA ge-
nomes from available samples previously assigned to
major haplogroups. To include lacking haplogroups we
added 9 published sequences to the analyses (Table 1).
Complete mtDNA sequences
Complete mtDNA were amplified in 32 overlapping frag-
ments with primers and PCR conditions described in Ta-
ble 2. The same primers were utilized to directly
sequence both strands of the fragments using the Prome-
ga fmol DNA Cycle Sequencing System and the Usb
Thermo Sequenase Radiolabelled Terminator Cycle Se-
quencing Kits.
Statistic analyses
Sequences were aligned manually. Phylogenetic rela-
tionships were estimated using median-joining networks
[32] as implemented in Network 2.0d [http://www.flux-
us-engineering.com] and refined by hand. The same to-
pology was obtained using the neighbor-joining method
[33]. A chimpanzee sequence (GenBank accession n
D38113) was added to root the networks. Statistical sig-
nificance of the branches were accomplished by boot-
Package 3.5c, [http://evolution.genetics.washing-
ton.edu/phylip.html] ). Minimum estimates of coales-
cence ages, and 95% confidence intervals, were based on
mean divergence among lineages for the coding region
and a constant evolutionary rate of 1.7 10-8 per site per
year that has been inferred for this region on the basis of
53 complete mtDNA sequences [7].
Accesion numbers
Sequences are available in GenBank (accession nos.
AF381981-AF382013)
References
1. Bandelt H-J, Forster P, Sykes BC, Richards MB: Mitochondrial por-
traits of human populations using median networks. Genetics
1995, 141:743-753
2. Richards M, Macaulay V, Hickey E, Vega E, Sykes B, Guida V, Rengo
Ch, Sellito D, Cruciani F, Kivisild T, et al: Tracing European found-
er lineages in the Near Eastern mtDNA pool. Am. J. Hum.
Genet. 2000, 67:1251-1276
3. Torroni A, Neel JV, Barrantes R, Schurr TG, Wallace DC: Mitochon-
drial DNA "clock" for the Amerinds and its implications for
timing their entry into North America. Proc Natl Acad Sci U.S.A.
1994, 91:1158-1162
4. Sykes B, Leiboff A, Low-Beer J, Tetzner S, Richards M: The origins
of the Polynesians: An interpretation from mitochondrial
lineage analysis. Am. J. Hum. Genet. 1995, 57:1463-1475
5. Lum JK, Cann RL, Martinson JJ, Jorde LB: Mitochondrial and nucle-
ar genetic relationships among Pacific Island and Asian pop-
ulations Am. J. Hum. Genet. 1998, 63:613-624
6. Cann RL, Stoneking M, Wilson AC: Mitochondrial DNA and hu-
man evolution. Nature 1987, 325:31-36
7. Ingman M, Kaessmann H, Pbo S, Gyllensten U: Mitochondrial ge-
nome variation and the origin of modern humans Nature 2000,
408:708-713
8. Anderson S, Bankier AT, Barrell BG, de Bruijn MHL, Coulson AR,
Drouin J, Eperon IC, Nierlich DP, Roe BA, Sanger F, et al: Sequence
and organization of the human mitochondrial genome Nature
1981, 290:457-465
9. Kivisild T, Bamshad MJ, Kaldma K, Metspalu M, Metspalu E, Reidla M,
Laos S, Parik J, Watkins WS, Dixon ME, et al: Deep common an-
cestry of Indian and western-Eurasian mitochondrial DNA
lineages. Curr. Biol. 1999, 9:1331-1334
10. Macaulay V, Richards M, Hickey E, Vega E, Cruciani F, Guida V, Scoz-
zari R, Bonn-Tamir B, Sykes B, Torroni A: The emerging tree of
West Eurasian mtDNAs: A synthesis of control-region se-
quences and RFLPs Am. J. Hum. Genet. 1999, 64:232-249
11. Watson E, Forster P, Richards M, Bandelt H-J: Mitochondrial foot-
prints of human expansions in Africa. Am. J. Hum. Genet. 1997,
61:691-704
BMC Genetics 2001, 2:13 http://www.biomedcentral.com/1471-2156/2/13

12. Labuda D, Zietkiewicz E, Yotova V: Archaic lineages in the histo- 31. Hammer MF, Karafet T, Rasanayagam A, Wood ET, Altheide TK,
ry of modern humans. Genetics 2000, 156:799-808 Jenkins T, Griffiths RC, Templeton AR, Zegura SL: Out of Africa
13. Cavalli-Sforza LL, Menozzi P, Piazza A: The History and Geogra- and back again: Nested cladistic analysis of human Y chro-
phy of Human Genes. Princeton University Press, New Jersey 1996 mosome variation. Mol. Biol. Evol. 1998, 15:427-441
14. Ballinger SW, Schurr TG, Torroni A, Gan YY, Hodge JA, Hassan K, 32. Bandelt H-J, Forster P, Rhl A: Median-joining networks for in-
Chen K-H, Wallace DC: Southeast Asian mitochondrial DNA ferring intraspecific phylogenies. Mol. Biol. Evol. 1999, 16:37-48
analysis reveals genetic continuity of ancient Mongoloid mi- 33. Saitou N, Nei M: The neighbor-joining method: A new method
grations Genetics 1992, 130:139-152 for reconstructing phylogenetic trees. Mol. Biol. Evol. 1987,
15. Quintana-Murci L, Semino O, Bandelt H-J, Passarino G, McElreavey K, 4:406-425
Santachiara-Benerecetti AS: Genetic evidence of an early exit of 34. Finnil S, Hassinen IE, Ala-Kokko L, Majamaa K: Phylogenetic net-
Homo sapiens sapiens from Africa through Eastern Africa. work of the mtDNA haplogroup U in Northern Finland
Nature Genetics 1999, 23:437-441 based on sequence analysis of the complete coding region by
16. Kivisild T, Kaldma K, Metspalu M, Parik J, Papiha S, Villems R: The conformation-sensitive gel electrophoresis. Am. J. Hum. Genet.
place of the Indian mitochondrial DNA variants in the global 2000, 66:1017-1026
network of the maternal lineages and the peopling of the old 35. Ozawa T, Katsumata K, Hayakawa M, Tanaka M, Sugiyama S, Tanaka
world. In: Genomic Diversity: Applications in Human Population Genetics T, Itoyama S, Nunoda S, Sekiguchi M: Genotype and phenotype of
(Edited by Papiha S, Deka R, Chakraborty R) New York, Kluwer Academic severe mitochondrial cardiomyopathy: A recipient of heart
/ Plenum Publishers 1999135-152 transplantation and the genetic control. Biochem. Biophys. Res.
17. Comas D, Calafell F, Mateu E, Prez-Lezaun A, Bosch E, Martnez-Ari- Commun. 1995, 207:613-620
as R, Clarimon J, Facchini F, Fiori G, Luiselli D, et al: Trading genes 36. Ozawa T, Tanaka M, Sugiyama S, Hidekazu I, Ohno K, Hattori K, Oh-
along the silk road: mtDNA sequences and the origin of Cen- bayashi T, Ito T, Deguchi H, Kawamura K, et al: Patients with idio-
tral Asian populations Am. J. Hum. Genet. 1998, 63:1824-1838 pathic cardiomyopathy belong to the same mitochondrial
18. Brown MD, Hosseini SH, Torroni A, Bandelt H-J, Allen JC, Schurr TG, DNA genes family of Parkinson's disease and mitochondrial
Scozzari R, Cruciani F, Wallace DC: mtDNA haplogroup X: An encephalomyopathy. Biochem. Biophys. Res. Commun. 1991,
ancient link between Europe/Western Asia and North 177:518-525
America? Am. J. Hum. Genet. 1998, 63:1852-1861 37. Nishino I, Seki A, Maegaki Y, Takeshita K, Horai S, Nonaka I, Goto Y:
19. Derenko MV, Grzybowski T, Malyarchuk BA, Czarny J, Miscicka-Sliw- A novel mutation in the mitochondrial tRNAThr gene asso-
ka D, Zakharov IA: The presence of mitochondrial haplogroup ciated with a mitochondrial encephalomyopathy. Biochem. Bi-
X in Altaians from South Siberia. Am. J. Hum. Genet. 2001, ophys. Res. Commun. 1996, 225:180-185
69:237-241
20. Horai S, Hayasaka K: Intraspecific nucleotide sequence differ-
ences in the major noncoding region of human mitochondri-
al DNA. Am. J. Hum. Genet. 1990, 46:828-842
21. Melton T, Peterson R, Redd A, Saha N, Sofro ASM, Martison J,
Stoneking M: Polynesian genetic affinities with Southeast
Asian populations as identified by mtDNA analysis. Am. J.
Hum. Genet. 1995, 57:403-414
22. Soodyall H, Vigilant L, Hill AV, Stoneking M, Jenkins T: MtDNA con-
trol-region sequence variation suggests multiple independ-
ent origins of an "Asian-specific" 9-bp deletion in Sub-
Saharan Africans Am. J. Hum. Genet. 1996, 58:595-608
23. Watkins WS, Bamshad M, Dixon ME, Bhaskara Rao B, Naidu JM, Red-
dy PG, Prasad BVR, Das PK, Reddy PC, Gai PB, et al: Multiple ori-
gins of the mtDNA 9-bp deletion in populations of South
India. Am. J. Phys. Anthropol. 1999, 109:147-158
24. Yao Y-G, Watkins WS, Zhang Y-P: Evolutionary history of the
mtDNA 9-bp deletion in Chinese populations and its rele-
vance to the peopling of East and Southeast Asia. Hum. Genet.
2000, 107:504-512
25. Torroni A, Petrozzi M, Santolamazza P, Stellitto D, Cruciani F, Scoz-
zari R: About the "Asian"-specific 9-bp deletion of mtDNA...
Am. J. Hum. Genet. 1995, 57:507-508
26. Kolman CJ, Sambuughin N, Bermingham E: Mitochondrial DNA
analysis of Mongolian populations and implications for the
origin of New World founders Genetics 1996, 142:1321-1334
27. Metspalu E, Kivisild T, Kaldma K, Parik J, Reidla M, Tambets K, Villems
R: The trans-Caucasus and the expansion of the Caucasoid-
specific human mitochondrial DNA. In: Genomic Diversity: Appli-
cations in Human Population Genetics (Edited by Papiha S, Deka R,
Chakraborty R) New York, Kluwer Academic / Plenum Publishers 1999121-
133
Publish with BioMed Central and every
28. Rando JC, Pinto F, Gonzlez AM, Hernndez M, Larruga JM, Cabrera scientist can read your work free of charge
VM, Bandelt H-J: Mitochondrial DNA analysis of Northwest Af- "BioMedcentral will be the most significant development for
rican populations reveals genetic exchanges with European, disseminating the results of biomedical research in our lifetime."
Near-Eastern, and sub-Saharan populations Ann. Hum. Genet.
Paul Nurse, Director-General, Imperial Cancer Research Fund
1998, 62:531-550
29. Flores C, Hernndez M, Gonzlez AM, Cabrera VM: Genetic affini- Publish with BMC and your research papers will be:
ties among human populations inhabiting the Subsaharan ar-
ea, Northwest Africa, and the Iberian Peninsula. In Prehistoric available free of charge to the entire biomedical community
Iberia: Genetics, Anthropology, and Linguistics (Edited by Arnaiz-Villena A) peer reviewed and published immediately upon acceptance
New York, Kluwer Academic/Plenum Publishers 200033-50
30. Krings M, Salem AH, Bauer K, Geisert H, Malek A, Chaix L, Simon C, cited in PubMed and archived on PubMed Central
Welsby D, Di Rienzo A, Utermann G, et al: mtDNA analysis of yours - you keep the copyright
Nile River valley populations: A genetic corridor or a barrier BioMedcentral.com
to migration? Am. J. Hum. Genet. 1999, 64:1166-1176 Submit your manuscript here:
http://www.biomedcentral.com/manuscript/ editorial@biomedcentral.com