Anda di halaman 1dari 267

Biologa de 2 de bachillerato

Robert Hooke

Jos Luis Snchez Guilln


IES PANDO

Oviedo 2007
2007 I.E.S. PANDO
Departamento de Biologa-Geologa
OVIEDO-Asturias (ESPAA).
NDICE

BLOQUE I: BIOMOLCULAS
1. Bioelementos y biomolculas: Generalidades............. 10 pags
2. El agua y las sales minerales........................... 7 pags
3. Los glcidos.......................................... 12 pags
4. Los lpidos........................................... 10 pags
5. Las protenas......................................... 14 pags

BLOQUE II: LA CLULA (ESTRUCTURA Y METABOLISMO)


1. Teora celular......................................... 4 pags
2. Membranas y transporte.................................11 pags
3. El medio interno celular................................3 pags
4. Sistemas de membranas...................................7 pags
5. Metabolismo: Enzimas....................................8 pags
5a. Fotosntesis y quimiosntesis....................... 15 pags
5b. Respiracin celular y fermentaciones................ 17 pags

BLOQUE III: INFORMACIN CELULAR


1. El ncleo celular...................................... 5 pags
2. Los cidos nuclicos...................................10 pags
3. El ADN como portador de la informacin gentica......... 3 pags
4. Trascripcin y traduccin de la informacin gentica... 11 pags
5. La replicacin del ADN..................................3 pags
6. El ciclo celular: Mitosis...............................8 pags
7. Los cromosomas metafsicos..............................4 pags
8. La meiosis............................................. 7 pags
9. La reproduccin....................................... 11 pags
10. Las mutaciones....................................... 10 pags
11. La herencia gentica: Mendelismo...................... 17 pags
12. Gentica aplicada......................................5 pags

BLOQUE IV: MICROBIOLOGA Y BIOTECNOLOGA


1. Microbiologa y biotecnologa.......................... 29 pags

BLOQUE V: INMUNOLOGA
1. Inmunologa........................................... 22 pags
I) Biomolculas 1) Biomolculas

I-1

BIOELEMENTOS Y BIOMOLCULAS

LOS BIOELEMENTOS: CONCEPTO Y CLASES

Los bioelementos son los elementos qumicos que constituyen los seres vivos.

De los aproximadamente 100 elementos qumicos que existen en la naturaleza, unos


70 se encuentran en los seres vivos. De estos slo unos 22 se encuentran en todos
en cierta abundancia y cumplen una cierta funcin.

Clasificaremos los bioelementos en:

>Bioelementos primarios: O, C, H, N, P y S. Representan en su conjunto el


96,2% del total.

>Bioelementos secundarios: Na+ , K+ , Ca2 + , Mg 2 + , Cl-. Aunque se encuentran


en menor proporcin que los primarios, son tambin imprescindibles para los
seres vivos. En medio acuoso se encuentran siempre ionizados.

Oligoelementos o elementos vestigiales: Son aquellos bioelementos que se


encuentran en los seres vivos en un porcentaje menor del 0.1%. Algunos, los
indispensables, se encuentran en todos los seres vivos, mientras que otros,
variables, solamente los necesitan algunos organismos.

TABLA

BIOELEMENTOS OLIGOELEMENTOS
Primarios Secundarios Indispensables Variables
O Na+ Mn B
C K+ Fe Al
H Mg 2 + Co V
N Ca2 + Cu Mo
P Cl- Zn I
S Si

J. L. Snchez Guilln Pgina I-1-1


I) Biomolculas 1) Biomolculas

PRINCIPALES CARACTERSTICAS DE LOS BIOELEMENTOS PRIMARIOS

El hecho de que los bioelementos primarios sean tan abundantes en los seres vivos
se debe a que presentan ciertas caractersticas que los hacen idneos para formar
las molculas de los seres vivos. As:

* Aunque no son de los ms abundantes, todos ellos se encuentran con


cierta facilidad en las capas ms externas de la Tierra (corteza, atmsfera
e hidrosfera).

TABLA
Los elementos qumicos ms abundantes en la corteza terrestre y en
los seres vivos (en % en peso).
Elementos Corteza (%) Elementos Seres vivos (%)
Oxgeno 47 Oxgeno 63
Silicio 28 Carbono 20
Aluminio 8 Hidrgeno 9,5
Hierro 5 Nitrgeno 3

* Sus compuestos presentan polaridad por lo que fcilmente se disuelven en


el agua, lo que facilita su incorporacin y eliminacin.

Tabla de los Bioelementos

H He

Li Be B C N O F Ne

Na Mg Al Si P S Cl Ar

K Ca Sc Ti V Cr Mn Fe Co Ni Cu Zn Ga Ge As Se Br Kr

Rb Sr Y Zr Nb Mo Tc Ru Rh Pd Ag Cd In Sn Sb Te I Xe

Cs Ba La Hf Ta W Re Os Ir Pt Au Hg Tl Pb Bi Po At Rn

Fr Ra Ac

Cs Pr Nd Pm Sm Eu Gd Tb Dy Ho Er Tm Yb Lu

Th Pa U Np Pu Am Cm Bk Cf Es Fm Md No Lw

Primarios Indispensables
Bioelementos Oligoelementos
Secundarios Variables 15

* El C y el N presentan la misma afinidad para unirse al oxgeno o al


hidrgeno, por lo que pasan con la misma facilidad del estado oxidado al
reducido. Esto es de gran importancia, pues los procesos de oxidacin-
reduccin son la base de muchos procesos qumicos muy importantes y en
particular de los relacionados con la obtencin de energa como la
fotosntesis y la respiracin celular.

J. L. Snchez Guilln Pgina I-1-2


I) Biomolculas 1) Biomolculas

* El C, el H, el O y el N son elementos de pequea masa atmica y tienen


variabilidad de valencias, por lo que pueden formar entre s enlaces
covalentes fuertes y estables. Debido a esto dan lugar a una gran variedad
de molculas y de gran tamao. De todos ellos el carbono es el ms
importante. Este tomo es la base de la qumica orgnica y de la qumica
de los seres vivos.

LAS BIOMOLCULAS: CLASIFICACIN

Los bioelementos se unen entre s para formar molculas que llamaremos


biomolculas: Las molculas que constituyen los seres vivos. Estas molculas se han
clasificado tradicionalmente en los diferentes principios inmediatos, llamados as
porque podan extraerse de la materia viva con cierta facilidad, inmediatamente, por
mtodos fsicos sencillos, como : evaporacin, filtracin, destilacin, disolucin, etc.

Los diferentes grupos de principios inmediatos son:

Inorgnicos Orgnicos
-Agua -Glcidos
-CO2 -Lpidos
-Sales minerales -Prtidos o protenas
-cidos nucleicos

LOS COMPUESTOS ORGNICOS DE LOS SERES VIVOS.

Son compuestos orgnicos los compuestos de carbono. Esto es, aquellos en los
que el tomo de carbono es un elemento esencial en la molcula y forma en ella la
cadena bsica a la que estn unidos los dems elementos qumicos.

Los seres vivos contienen compuestos orgnicos. Son stos los que caracterizan a
la materia viva y la causa de las peculiares funciones que realiza. La gran variedad
de compuestos orgnicos que contienen los seres vivos no se clasifican desde un
punto de vista qumico, sino a partir de criterios muy simples, tales como su
solubilidad o no en agua, u otros. Siguiendo estos criterios se clasifican en :

-Glcidos o hidratos de carbono


-Lpidos
-Prtidos (protenas)
-cidos nucleicos

Las funciones que cumplen estos compuestos en los seres vivos son muy variadas,

J. L. Snchez Guilln Pgina I-1-3


I) Biomolculas 1) Biomolculas

as:

-Glcidos y lpidos tienen esencialmente funciones energticas y estructurales.


-Las protenas: enzimticas y estructurales.
-Los cidos nucleicos son los responsables de la informacin gentica.

Algunas sustancias son de gran importancia para los seres vivos pero estos las
necesitan en muy pequea cantidad y nunca tienen funciones energticas ni
estructurales. Por esta causa reciben el nombre de biocatalizadores. Son
biocatalizadores las vitaminas, las enzimas y las hormonas.

REPARTICIN DE LOS COMPONENTES MOLECULARES


DE LA CLULA
(en % sobre masa total)
Principios inmediatos PROCARIOTAS EUCARIOTAS
Glcidos 3 3
Lpidos 2 4,5
Prtidos 15 18
cidos Nucleicos
ARN 6 1,25
ADN 2 0,25
Precursores 1 2
Agua 70 70
Sales minerales 1 1

EL ENLACE COVALENTE

Los tomos que forman las molculas


orgnicas estn unidos mediante enlaces
H O H
covalentes. Se trata de un enlace muy
resistente cuando la molcula est en H C C C S H
disolucin acuosa, lo que es el caso de los
seres vivos. H H
Fig. 1 Unin mediante enlaces covalentes de
Este tipo de enlace se forma cuando dos los diferentes tomos que constituyen una
tomos comparten uno o ms pares de biomolcula.
electrones. Si comparten 2 electrones, uno
cada tomo, diremos que ambos estn unidos mediante un enlace simple; si
comparten 4, aportando dos cada uno, el enlace ser doble, y si son seis
tendremos un enlace triple. Los enlaces se representan mediante trazo entre los

J. L. Snchez Guilln Pgina I-1-4


I) Biomolculas 1) Biomolculas

tomos a los que une. As, por ejemplo: -C-C-, para el enlace simple carbono-
carbono o -C=C- , para el doble. Es de destacar que el enlace simple permite el
giro, lo que no sucede con los enlaces doble y el triple.

El enlace covalente se da entre elementos


no metlicos de electronegatividad similar: +

C-C, C-O, C-N, C-H. Si existe una mayor


- - +
diferencia de electronegatividad, como
ocurre entre el oxgeno y el nitrgeno con
Polaridad del enlace N-H
el hidrgeno, el elemento ms Polaridad del enlace O-H

electronegativo (el oxgeno y el nitrgeno,


respectivamente) atrae hacia s los Fig. 2 Polaridad del enlace-O-H y del enlace
electrones crendose una polaridad. Esto es, >N- H.
la molcula tendr zonas cor carga elctrica
positiva y otras con carga negativa.

CARACTERSTICAS DEL TOMO DE CARBONO

El carbono es el elemento nmero 6 de la tabla peridica (Z=6 y A =12). Su


estructura electrnica es 1s 2 2s 2 2p 2 .

Como ya se ha dicho, es el elemento ms


importante de los seres vivos, aunque no
C C C C
sea el que se encuentra en ms
abundancia. En la corteza terrestre es un Cuatro simples Uno doble y dos
simples
Dos dobles. Uno triple y uno
simple.

elemento relativamente raro. Lo


encontramos en la atmsfera en forma de Fig. 3 Enlaces covalentes que puede tener el
CO2 , disuelto en las aguas formando tomo de carbono al unirse a otros
bioelementos.
carbonatos y en la corteza constituyendo
las rocas calizas (CO3 Ca) el carbn y el
petrleo.

LOS ENLACES COVALENTES DEL CARBONO Y DE OTROS BIOELEMENTOS

El tomo de carbono tiene 4 electrones en


la ltima capa. Esto hace que pueda unirse H O S N
a otros tomos mediante cuatro enlaces N
O S
covalentes pudindose formar tres N
estructuras distintas. Estas son:
El hidrgeno tiene El oxgeno tiene dos El azufre tiene dos El nitrgeno tiene
un electrn de electrones de electrones de tres electrones de
valencia. valencia. valencia. valencia.

-La hibridacin tetradrica. En la que el


tomo de carbono est unido mediante Fig. 4 Enlaces covalentes que pueden tener
cuatro enlaces covalentes simples a otros el resto de los bioelementos primarios.

cuatro tomos. En este tipo de hibridacin

J. L. Snchez Guilln Pgina I-1-5


I) Biomolculas 1) Biomolculas

el tomo de carbono ocupa el centro de un tetraedro y los cuatro enlaces simples


se dirigen hacia sus vrtices.

-La hibridacin trigonal. En la que el tomo


de carbono se une a otros tres tomos
C C C
mediante dos enlaces simples y uno doble. C

En este caso los cuatro tomos forman un


H. tetradrica H. trigonal H. digonal H. digonal
tringulo con el tomo de carbono situado
en el centro. Debe tenerse en cuenta que el Fig. 5 Hibridaciones del tomo de carbono.
enlace doble es algo ms corto que los
enlaces simples, por lo que el tringulo no
ser equiltero sino issceles.

-La hibridacin digonal. Cuando el tomo de carbono est unido a otros dos tomos
mediante un enlace simple y uno triple o mediante dos dobles.

Los dems bioelementos van a poder formar, bien con el carbono o entre s, los
enlaces covalentes que pueden verse en el recuadro.

LOS ESQUELETOS DE LAS MOLCULAS Tipos de esqueletos de las molculas orgnicas

ORGNICAS
-C- C- C- C- C- C- C- C-
1) Cadena lineal saturada

Las diferentes biomolculas van a estar


constitudas bsicamente por tomos de -C- C- C=C- C- C=C- C-

carbono unidos entre s mediante enlaces


2) Cadena lineal insaturada 4) Doble ciclo mixto.

covalentes. La resistencia y versatilidad de -C- C- C-


-C- C- C- C- C-
los enlaces carbono-carbono y del carbono -C- C- C-
con otros elementos: oxgeno, nitrgeno o 3) Cadena ramificada.
5) Ciclo mixto.

azufre, va a posibilitar el que se puedan


formar estructuras que sern el esqueleto Fig. 6 Ejemplos de esqueletos carbonados de
las biomolculas.
de las principales molculas orgnicas.

FUNCIONES ORGNICAS
FUNCIONES ORGNICAS
Las molculas orgnicas van a tener
Concepto: Agrupaciones caractersticas de tomos
determinadas agrupaciones caracters ticas
Alcohol: -O-H
de tomos que reciben el nombre de Cetona: >C=O
Aldehdo: -CHO
funciones o grupos funcionales. Las cido: -COOH
Amino: -NH2
principales funciones son: Amida: -CONH2
Tiol: -S-H

-Alcohol o hidroxilo
-Aldehdo Fig. 7 Los principales frupos funcionales.
-Cetona
-cido orgnico o carboxilo

J. L. Snchez Guilln Pgina I-1-6


I) Biomolculas 1) Biomolculas

-Amina
H O
-Amida C O H
-Tiol o sulfidrilo C O C C C
Funcin alcohol Funcin aldehdo Funcin cetona

O Funcin cido

Las cuatro primeras estn formadas por C, C S H


H, y O (funciones oxigenadas); las dos Funcin tiol
C O H
siguientes, por tener nitrgeno, se
H O Funcin amida

denominan funciones nitrogenadas. C N H


H C N
Funcin amina H
Los aldehdos se diferencian de las * En los enlaces libres slo puede haber o carbonos o hidrgenos.

cetonas por estar siempre en un carbono si-


Fig. 8 Los principales grupos funcionales.
tuado en el extremo de la molcula; esto
es, el carbono que lleva una funcin
aldehdo se encuentra unido a otro carbono
o a un hidrgeno.

Entre las funciones con azufre la ms


importante en los compuestos de los seres
vivos es la funcin tiol (-SH).
Encontraremos esta funcin en algunos
aminocidos. El fsforo se encuentra sobre
todo en los cidos nucleicos y sus Fig. 9 Representacin en un modelo de
esferas de una biomolcula: un aminocido.
derivados en forma de cido fosfrico
(H3 PO4 ) o sus iones (iones fosfato).

Las diferentes funciones pueden representarse de una manera simplificada tal y


como se indica en la figura.

ALGUNAS PROPIEDADES QU MICAS DE LAS FUNCIONES ORGNICAS

Los alcoholes por deshidrogenacin (oxidacin) se transforman en aldehdos o


cetonas y estos por una nueva oxidacin dan cidos. Por el contrario, los cidos
por reduccin dan aldehdos y estos a su vez dan alcoholes. Estos procesos son de
gran importancia en el metabolismo de los seres vivos, en particular en los procesos
de obtencin de energa.

CH3-CH3
H H Frmula semidesarrollada

FORMULACIN DE LAS BIOMOLCULAS


H C C H
Las sustancias orgnicas pueden H H C2H6
Frmula desarrollada
representarse mediante diferentes tipos de Frmula emprica

frmulas. Estas pueden ser:


Fig. 10 Frmulas desarrollada,
a) Frmulas desarrolladas o estructurales: En semidesarrollada y emprica del etano.
ellas se indican todos los tomos que

J. L. Snchez Guilln Pgina I-1-7


I) Biomolculas 1) Biomolculas

forman la molcula y todos los enlaces


covalentes los unen. Este tipo de frmulas CH2OH

da la mxima informacin pero las molculas C O


complejas es laborioso representarlas. H
H
OH

C C
b) Frmulas semidesarrolladas: en las que OH OH H H
se indican nicamente los enlaces de la C C

cadena carbonada. El resto de los tomos H OH


que estn unidos a un determinado carbono
se agrupan segn ciertas normas (ejemplo: Fig. 11 Ejemplo de representacin entre
CH3 -, -CH2 - , CH2 OH-, -CHOH-, CHO-, -CO-, desarrollada y semidesarrollada de la
glucosa, en la que algunas funciones se han
-COOH, -CHNH2 -). agrupado.

c) Frmulas empricas: En ellas se indican


nicamente el nmero de tomos de cada CH2OH CHO C CO C
Funcin aldehdo Funcin cetona
elemento que hay en la molcula; as, Funcin alcohol

frmula emprica de la glucosa: C6 H12 O6 . Funcin cido

CHSH COOH
Es de destacar que las frmulas empricas Funcin tiol

no dan una idea de la estructura de la Funcin amida

molcula y que puede haber muchos CH2NH2 CONH2


compuestos que, siendo diferentes, tengan
la misma frmula emprica y diferente Fig. 12 Representacin semidesarrollada de
frmula estructural. los principales grupos funcionales.

En ciertos casos, por ejemplo, si la O

molcula es muy compleja, se recurre a COOH

determinadas simplificaciones. As, las


largas cadenas carbonadas de los cidos
OH
grasos pueden representarse mediante una OH

lnea quebrada en la que no se indican ni


Fig. 13 Representacin simplificada de una
los carbonos ni los hidrgenos pero s se
biomolcula.
indican las funciones, los dobles enlaces u
otras variaciones que posea la molcula.
Tambin se simplifican las cadenas cclicas, en las que a veces tampoco se indican
ni los carbonos ni los hidrgenos.

CONCEPTOS DE POLMERO Y MONMERO

Frecuentemente los compuestos que constituyen los seres vivos estn formados
por la unin ms o menos repetitiva de molculas menores. Por ejemplo, el almidn
y la celulosa estn formados por la unin de miles de molculas de glucosa. Las
protenas por decenas, centenares o miles de aminocidos, y la unin de miles o
millones de nucletidos forma los cidos nucleicos. Cada una de las unidades
menores que forman estas grandes molculas es un monmero y el compuesto que
resulta de la unin se llama polmero. Los polmeros son, a su vez,
macromolculas, molculas de elevado peso molecular.

Pequeas molculas.....................................................................de 100 u a 1000 u


Grandes molculas (macromolculas)............................. de 10 4 u a ms de 10 6 u

J. L. Snchez Guilln Pgina I-1-8


I) Biomolculas 1) Biomolculas

Unidad de masa molecular: unidad de masa atmica (u) o dalton


(da).
1u = 1da = 1,660*10 -24 g

monmero

Fig. 14 Fragmento de la molcula de almidn. El almidn es un polmero formado por el


monmero glucosa.

ENLACES INTRA E INTERMOLECULARES

Los medios biolgicos son una mezcla compleja de compuestos qumicos, tanto
orgnicos como inorgnicos. Unos son de pequeo tamao: como el in H+ (1da).
Otros, como los cidos nucleicos, pueden tener 10 8 da o incluso ms. Todas estas
molculas van a interaccionar entre s. La principal de estas interacciones es la
reaccin qumica en la que se produce una trasformacin qumica de las sustancias
que intervienen en ella. Otros tipos de interaccin son los diferentes enlaces que
pueden darse entre molculas o entre partes de una misma molcula. Estos enlaces
van a dar una mayor estabilidad a las macromolculas por la formacin de agregados
o de molculas de mayor tamao. Estas uniones pueden ser, entre otras:

1-Enlaces inicos. Se suelen dar preferentemente en molculas que contienen grupos


-COOH y -NH2 . Estos grupos en agua se encuentran ionizados:

-COOH -COO- + H+
-NH2 + H+ -NH3 +

El enlace se debe a las fuerzas de carcter elctrico que se establecen entre las

J. L. Snchez Guilln Pgina I-1-9


I) Biomolculas 1) Biomolculas

cargas negativas de los grupos -COO- y las


positivas de los grupos -NH+ 3 , bien dentro
de una misma molcula o entre molculas
prximas. Estos enlaces en medio acuoso
son muy dbiles.
- +
2- Los puentes disul fu ro. Se llama as a los
enlaces covalentes que se forman al
Grupo -COOH Grupo H2N-C-
reaccionar entre s dos grupos -S-H para
dar -S-S- . Este tipo de enlaces son ex-
Fig. 15 Enlaces inicos entre grupos
traordinariamente resistentes. Los encontra- -COOH y H2N-
remos en las protenas uniendo las
subunidades que componen algunas mo-
lculas proteicas.

3-Enlaces o puentes de hidrgeno. Se trata


de enlaces dbiles pero que si se dan en
gran nmero pueden llegar a dar una gran
estabilidad a las molculas.

Los enlaces de hidrgeno se deben a la


mayor o menor electronegatividad de los
elementos que participan en un enlace
covalente. As, por ejemplo, en los grupos
-C-O-H, el oxge no es ms electronegativo
que el hidrgeno y atrae hacia s el par de
electrones que forma el enlace covalente. Fig. 16 Puentes disulfuro (4) entre las
En las proximidades del oxge no habr un subunidades de una protena.
exceso de carga negativa y, por el
contrario, el hidrgeno estar cargado positi-
vamente. Lo mismo sucede con los grupos
-C-N-H, u otros, en los que tambin se
produce una diferencia de
electronegatividad. Como consecuencia se
generarn fuerzas elctricas entre tomos
que presentan un exceso de carga positiva
(H) y otros con exceso de carga negativa
(O, por ejemplo). Estos enlaces son de gran
importancia en determinados compuestos y,
en particular, en las protenas y en los Fig. 17 Puentes o enlaces de hidrgeno
cidos nucleicos. entre las bases nitrogenadas del ADN.

4-Fuerzas de Van der Waals. Se trata de fuerzas de carcter elctrico debidas a


pequeas fluctuaciones en la carga de los tomos. Actan cuando las molculas se
encuentran muy prximas unas a otras.

5- Uniones hidrofbicas. Ciertas sustancias insolubles en agua cuando estn en un


medio acuoso van a mantenerse unidas entre s por su repulsin al medio en el
que se encuentran. Estas uniones, aunque son muy dbiles, van a ser de gran
importancia en el mantenimiento de los componentes lipdicos de la membranas
celulares y en la configuracin de muchas protenas.

Es de destacar que los enlaces ms dbiles, inicos y de hidrgeno,


particularmente, pueden contribuir en gran manera a la estabilidad de la
configuracin de una molcula cuando se dan en gran nmero.

J. L. Snchez Guilln Pgina I-1-10


I) Biomolculas 2) El agua

I-2

EL AGUA

IMPORTANCIA DEL AGUA PARA LOS SERES VIVOS

El agua es el lquido ms abundante de la corteza y uno de los pocos lquidos


naturales. No es de extraar entonces que el agua sea una sustancia esencial en los
seres vivos. El agua es el componente ms abundante en los medios orgnicos, los
seres vivos contienen por trmino medio un 70% de agua. No todos tienen la misma
cantidad, los vegetales tienen ms agua que los animales y ciertos tejidos (por
ejemplo: el tejido graso) contienen menos agua -tiene entre un 10% a un 20% de
agua- que otros como, por ejemplo: el nervioso, con un 90% de agua. Tambin vara
con la edad, as, los individuos jvenes tienen ms agua que los adultos (la carne de
ternera es ms tierna que la de vaca).

El agua en los seres vivos se encuentra tanto intra como extracelularmente. El agua
intracelular, la que est en el interior de las clulas, representa 2/3, aproximadamente,
del agua que contiene un ser vivo y el agua extracelular representa el tercio restante.
Esta ltima se encuentra baando las clulas o circulando en forma de sangre, linfa,
savia, etc.

En los seres unicelulares y en los organismos acuticos el agua es adems su medio


ambiente.

El agua no es un simple medio ni una mera fase inerte, es un lquido muy


reaccionable. Interviene en muchas reacciones qumicas, bien como reactivo o como
producto de la reaccin, y resulta imprescindible para la estabilidad de muchas
sustancias biolgicas, por ejemplo, las protenas.

Por ltimo diremos que la vida se origin hace ms de 3500 millones de aos en
el medio acutico y las condiciones de aquel ambiente primitivo imprimieron un sello
permanente en la qumica de los seres vivos. Todos los seres vivos han sido
diseados alrededor de las propiedades caractersticas del agua, tales como su
carcter polar, sus enlaces de hidrgeno y sus elevados puntos de fusin, ebullicin,
calor especfico y tensin superficial.

J. L. Snchez Guilln Pgina I-2-1


I) Biomolculas 2) El agua

ALGUNAS PROPIEDADES DEL AGUA

Masa molecular.......... 18 da
Punto de fusin......... 0 oC (a 1 atm)
Punto de ebullicin .... 100 oC (a 1 atm)
Densidad (a 4 0 C)........ 1g/cm 3
Densidad (00 C).......... 0'97g/cm 3 Fig. 1 Modelo de la molcula de agua

ESTRUCTURA QU MICA DEL AGUA

La molcula de agua est formada por dos


tomos de hidrgeno y uno de oxgeno. En
el agua existen tambin los productos oxgeno =
resultantes de la disociacin de algunas de
sus molculas: el in H3 O+ y el OH-.

H
En la molcula de H2 O los enlaces H
+
+
covalentes entre el oxgeno y los dos
tomos de hidrgeno forman un ngulo de
104'5 0 . Adems, el tomo de oxgeno atrae Fig. 2 Representacin de la molcula de
agua.
hacia s los electrones del enlace covalente.
Esto hace que la molcula presente un exceso de carga negativa en las proximidades
del tomo de oxgeno y un exceso de carga positiva en los tomos de hidrgeno.
Por lo tanto, cada molcula de agua es un dipolo elctrico.

ESTRUCTURA QU MICA DEL AGUA COMO SUBSTANCIA

Al ser las molculas de agua dipolos elctricos


se establecen enlaces de hidrgeno entre el + =
tomo de oxgeno de una molcula y los
tomos de hidrgeno de las molculas vecinas.
Estos enlaces de hidrgeno se forman y se
+
escinden a gran velocidad, aunque su
estabilidad disminuye al elevarse la temperatura.

Debido a estos enlaces las molculas de agua


se mantienen unidas - cohesividad - y el agua
=
es lquida a temperaturas a las que otras
sustancias de masas moleculares similares +
como el CH4 y el H2 S son gaseosas. De la +
cohesividad dependen tambin una serie de
Fig. 3 Formacin de enlaces de
propiedades del agua de gran importancia para
hidrgeno entre molculas de agua.
los seres vivos.

J. L. Snchez Guilln Pgina I-2-2


I) Biomolculas 2) El agua

COHESIVIDAD DEL AGUA

La cohesividad, debida a los puentes de


=
hidrgeno entre las molculas de agua, es
responsable de importantes caractersticas O =
+

H
+ +
del agua y de muchas de las funciones que
el agua cumple en los seres vivos. As, son H H O +
debidas a la cohesividad:
Enlace de hidrgeno
H
- Fenmenos como el de la capilaridad, que Fig. 4 Los enlaces de hidrgeno entre
permite la ascensin de la savia a molculas de agua son los responsables de la
cohesividad de sus molculas.
travs de los finsimos conductos que
forman los vasos leosos en las plantas.

- Es tambin responsable de que el agua sea


un lquido prcticamente
incompresible capaz de dar volumen y
turgencia a muchos seres vivos
(p.e.:gusanos) y por ejemplo, es la
responsable del esqueleto hidrosttico
de las plantas.

- Tambin es responsable de la elevada


Fig. 5 Los enlaces de hidrgeno entre
tensin superficial del agua; propiedad molculas de agua son los responsables de la
cohesividad de sus molculas.
que permite las deformaciones del
citoplasma celular y los movimientos
internos en la clula.

- Como ya se ha dicho es la responsable de los elevados puntos de fusin y ebulli-


cin del agua. Otras sustancias de masas moleculares parecidas son gaseosas
a temperaturas en las que el agua es lquida. El hecho de que el agua sea
lquida en su mayor parte a las temperaturas que se dan en la Tierra ha
posibilitado el desarrollo de la vida en nuestro planeta.

- De su elevado calor especfico: cantidad de calor necesaria para elevar la


temperatura de una cierta masa de agua. Esto hace que el agua almacene o
libere una gran cantidad de calor al calentarse o al enfriarse; lo que permite
que el agua acte como amortiguador trmico, evitando bruscas alteraciones de
la temperatura y evitando de esta forma que, por ejemplo, algunas molculas
como las protenas, muy sensibles a los cambios trmicos, se alteren.

- Su elevado calor de vaporizacin: cantidad de calor necesario para evaporar un

J. L. Snchez Guilln Pgina I-2-3


I) Biomolculas 2) El agua

gramo de agua es tambin debido a la


CO- O-CH2
cohesividad, pues para pasar del
estado lquido al gaseoso es CO- O-CH

necesario romper los enlaces de CO- O-CH2


hidrgeno entre las molculas de agua.
Fig. 6 Los triacilglicridos (grasas neutras)
son sustancias muy insolubles en agua.
Estas dos ltimas propiedades son de gran
importancia a la hora de regular la
temperatura en muchos seres vivos,
por ejemplo: la sudoracin.

SOLUBILIDAD

El agua es un buen disolvente de los


compuestos inicos. Esto es debido a que el
agua es una sustancia polar. Las molculas
de agua se disponen alrededor de los iones
positivos con la parte negativa de su Fig. 7 Modelo de triacilglicrido (grasa
molcula hacia ellos y en el caso de los neutra). Estas sustancias tienen pocos grupos
polares y una gran proporcin de -CH- y poco
iones negativos les enfrentan la parte
oxgeno.
positiva. Tambin son solubles en agua las
sustancias polares, por ejemplo: los glcidos;
normalmente, estas sustancias tienen una O

elevada proporcin de oxgeno. Por el C O- CH 2

O
contrario, aquellas sustancias orgnicas que C O- CH

presentan una elevada proporcin de hidrge- O CH3


H2COPOCHCHNCH3
no y pocos tomos de oxgeno son poco OH CH3
solubles en agua; por ejemplo: los lpidos.
Fig. 8 Los fosfoglicridos son sustancias
Algunas sustancias tienen una parte de su anfipticas.

molcula que es soluble en agua (hidrfila) y


otra parte insoluble (hidrfoba). Estas
sustancias se dice que son anfipticas. Las
sustancias anfipticas, cuando estn en un
medio acuoso, orientan su molcula y dan
lugar a la formacin de micelas, monocapas
o bicapas.

Las grandes molculas, como las protenas, Estado de sol Estado de gel

si son solubles en agua, forman un tipo


macromolcula agua u otro disolvente
especial de disoluciones denominadas
disoluciones coloidales. Las disoluciones
Fig. 9 Estados de sol y de gel de una
coloidales van a poder estar en dos estados: disolucin coloidal.
sol y gel. En el estado de sol predomina la

J. L. Snchez Guilln Pgina I-2-4


I) Biomolculas 2) El agua

fase dispersante, el agua, por ejemplo, sobre


la fase dispersa y la solucin es ms fluida.
En estado de gel predomina la fase dispersa,
por ejemplo: la protena, sobre la fase
dispersante, y la solucin es ms viscosa. El
paso de un estado a otro es reversible y
diversos factores fsicos y qumicos pueden
hacer que una solucin pase de un estado a
otro sin necesidad de variar la concentracin
de soluto. Estos factores pueden ser: el pH,
Fig. 10 Hemodilisis.
la temperatura o una alteracin en la
concentracin de determinados iones
presentes en el medio. Los soluciones
coloidales pueden separarse por dilisis por
medio de membranas cuyos poros slo Parte polar Parte apolar

permiten pasar las molculas de pequeo


tamao y no las partculas coloidales.

IONIZACIN Y pH

Parte de las molculas (10 -7 moles por litro


de agua, 1 mol =6 '023x10 23 molculas) estn Fig. 11 Los lpidos anfipticos forman
disociadas (ver en la figura 13 la ecuacin monocapas sobre una superficie acuosa.
de ionizacin del agua).

Las sustancias cidas al disolverse en agua


se disocian y producen iones H+ que
aumentan la concentracin de iones H3 O+
del medio. Las sustancias bsicas se
disocian tambin produciendo iones OH- que
se unen a los iones H3 O+ formndose dos
molculas de agua, por lo que la
concentracin de iones H3 O +
del agua
Fig. 12 Bicapa formada por un lpido
disminuye. anfiptico.

La concentracin de iones H3 O+ del agua


H2O + H2O H3O+ + OH-
se puede tomar, por lo tanto, como una
medida de su acidez, si es alta, o de su
+ -
basicidad, si es baja. El pH se define como + +

el logaritmo decimal negativo de la


concentracin de iones H3 O+ de una
Fig. 13 Ionizacin del agua.
disolucin. En el agua pura (neutra) la
concentracin de protones es de 10 -7 moles
por litro (pH=7). Por lo tanto:

si el pH < 7, la disolucin ser cida;


si el pH = 7, ser neutra;

J. L. Snchez Guilln Pgina I-2-5


I) Biomolculas 2) El agua

si el pH > 7, ser bsica.

Puede decirse, a modo de ejemplo, que el


pH de la sangre es ligeramente bsico H2O + HA H3O+ + A-
(pH=7'37) mientras que el del estmago es
fuertemente cido (pH=1).

Las variaciones del pH son de gran


importancia en muchos procesos biolgicos
de la clula. As, por ejemplo, en los
procesos de acumulacin de energa en el
Fig. 14 Ionizacin de un cido en agua.
ATP o en la activacin de las enzimas de
los lisosomas.

EL AGUA COMO SUSTANCIA REACCIONABLE

El agua participa activamente en los procesos qumicos que se dan en la clula,


pues es en s misma una sustancia muy reaccionable. As:

- En las reacciones de hidrlisis. Se trata de la rotura de un enlace covalente


por la adicin de H y OH a los tomos que estn unidos entre s. De esta
manera se separan, por ejemplo, los aminocidos que forman las protenas
cuando estas se hidrolizan; el H y el OH se unen al nitrgeno y al carbono
que forman el enlace peptdico en un proceso similar, pero inverso, al de la
formacin del enlace. Algo parecido ocurre con otros enlaces como con el
glicosdico o con el enlace ster.

- El agua puede ser adicionada a un doble enlace formndose una funcin


alcohol.

- El agua tiene tambin una gran importancia en la fotosnte sis por ser la
sustancia que repone los electrones que se utilizan en los procesos de sntesis
de sustancias orgnicas.

SOLUCIONES AMORTIGUADORAS1

Los procesos qumicos que se dan en la clula producen sustancias que alteran el pH del
medio celular. Ciertas sustancias actan como amortiguadores del pH o tampones evitando
que ste sufra grandes variaciones. As, por ejemplo, el in bicarbonato (HCO3 -) acta como
tampn en los medios orgnicos. Si el pH es cido habr un exceso de iones H3 O+ . Estos
sern captados por el in HCO-3 que se transformar en H2 CO3 y H2 O, con lo que el pH
aumentar. El H2 CO3 , a su vez, se descompondr en CO2 y H2 O. El proceso se desarrolla a
la inversa si hay pocos iones H3 O+ . El in bicarbonato acta como un tampn eficaz para
valores de pH en las proximidades de 7, que es el pH de la sangre. En los medios
intracelulares el tampn ms frecuente es el in fosfato(H 2 PO4 -).

1
Los textos en letra itlica suelen ser textos de ampliacin o de aclaracin y no entran
en los exmenes.

J. L. Snchez Guilln Pgina I-2-6


I) Biomolculas 2) El agua

LAS SALES MINERALES

gramos/litro
Podemos encontrarlas disueltas en los medios
Cloruro de sodio 8,0
celulares internos o externos, o precipitadas en
huesos y caparazones. Cuando estn disueltas se Cloruro de potasio 0,2

encuentran disociadas en cationes y aniones. Los Cloruro de calcio 0,2

principales cationes y aniones presentes en los Cloruro magnsico 0,1


medios orgnicos son:
Bicarbonato de sodio 1,0

Fosfato monosdico 0,05


Cationes: Na+ , K+ , Ca+ 2 y Mg + 2 .
Aniones:Cl-, SO4 -2 , PO4 -3 , CO3 -2 , HCO3 - y NO3 - Glucosa 1,0

Agua destilada Hasta 1000 cm3

La proporcin de iones, y sobre todo de


Fig. 15 Solucin de Tyrode, utilizada para
cationes, debe mantenerse constante en los cultivos de tejidos, preservado de rganos e
medios orgnicos pues ciertos cationes tienen irrigaciones de la cavidad peritoneal.
efectos antagnicos. Por ejemplo, el Ca+ + y el
K+ tienen funciones antagnicas en el
funcionamiento del msculo cardaco .

PRINCIPALES FUNCIONES DE LAS SALES


MINERALES

- Esqueletos y caparazones.
- Mantener la salinidad.
- Estabilizar las disoluciones. Por ejemplo, los
amortiguadores del pH.
Fig. 16 Las conchas de los moluscos estn
- Especficas: Movimiento muscular, impulso formadas por una matriz orgnica de
nervioso etc. naturaleza fundamentalmente protenica
(conquiolina) y un depsito inorgnico de
carbonato clcico.

J. L. Snchez Guilln Pgina I-2-7


I) Biomolculas 2) El agua

J. L. Snchez Guilln Pgina I-2-8


I) Biomolculas 3) Glcidos

I-3

GLCIDOS

CONCEPTO, CARACTERSTICAS Y FUNCIONES GENERALES DE LOS GLCIDOS

Los glcidos son compuestos orgnicos consti- H


tuidos por carbono, hidrgeno y oxgeno; en
C=O
algunos casos pueden tener adems otros
H-C-O-H
elementos qumicos como nitrgeno o azufre.
H-O-C-H

Se les ha llamado hidratos de carbono porque H-C-O-H


algunos responden a la frmula general Cn(H2 O)m H-C-O-H
y azcares por su sabor dulce, aunque slo los H-C-O-H
de baja masa molecular lo tienen. H

Concepto: Qumicamente son polihidroxialdehdos, Fig. 1 Frmula lineal de la D-


glucosa.
polihidroxicetonas, sus derivados o sus polmeros
(ms adelante se explicarn estos conceptos).
CH2OH
Algunos son molculas de relativamente baja
O
masa molecular; la glucosa tiene una Mm =180 H OH
da. Otros, como el almidn, tienen masas H

moleculares de ms de 100 000 da y son grandes


molculas, macromolculas. OH OH H H

Sus propiedades fsicas y qumicas son muy


H OH
variadas. Y en cuanto a sus funciones biolgicas:
Fig. 2 Frmula cclica de la D-
-La glucosa, sacarosa, glucgeno y almidn glucosa.
son sustancias energticas. Los seres
vivos obtienen energa de ellas o las usan para almacenar energa. Esta
energa est contenida en determinados enlaces que unen los tomos de estas
molculas.

-Celulosa y quitina son estructurales. Forman parte de las paredes de las


clulas vegetales (celulosa) o de las cubiertas de ciertos animales (quitina).

-Ribosa y desoxirribosa forman parte de los cidos nucleicos.

J. L. Snchez Guilln Pgina I-3-1


I) Biomolculas 3) Glcidos

Estos son slo algunos ejemplos que nos pueden ilustrar sobre las funciones que
cumplen los glcidos.

CLASIFICACIN DE LOS GLCIDOS

Atendiendo a su complejidad se clasifican en:

A) Monosacridos u osas: Son los ms sencillos. No son hidrolizables; esto es,


no se pueden descomponer por hidrlisis en otros glcidos ms simples.
Constituyen los monmeros a partir de los cuales se forman los dems
glcidos.

B) sidos: Formados por la unin de varios monosacridos mediante enlaces


"O-glicosdicos", pudiendo poseer en su molcula otros compuestos
diferentes de los glcidos. Son hidrolizables, descomponindose en los
monosacridos y dems compuestos que los constituyen. Se dividen en:

* Holsidos. Son aquellos que estn constituidos por carbono, hidrgeno


y oxgeno, exclusivamente. A su vez se subclasifican en:

-Oligosacridos, formados por entre 2 y 10 monosacridos


unidos.
-Polisacridos, formados por un gran nmero de monosacridos.

* Hetersidos. Formados por osas y otros compuestos que no son


glcidos. Por lo tanto, adems de carbono, hidrgeno y
oxgeno, contienen otros elementos qumicos.

LOS MONOSACRIDOS

CONCEPTO Y NATURALEZA QUMICA

Concepto: Qumicamente son polihidroxialdehdos, polihidroxicetonas o sus derivados.


Se caracterizan por no ser hidrolizables.

Un polihidroxialdehdo es un compuesto orgnico que tiene una funcin aldehdo en


el primer carbono y en los restantes carbonos una funcin alcohol. Las polihidro-
xicetonas en lugar de una funcin aldehdo tienen una funcin cetona, normalmente
en el carbono 2. Los monosacridos que tienen funcin aldehdo se llaman aldosas y
cetosas los que tienen una funcin cetona.

Los monosacridos responden a la frmula emprica Cn(H2 O)n, de aqu proviene el


nombre de hidratos de carbono. El valor de n normalmente est comprendido entre 3
y 7.

J. L. Snchez Guilln Pgina I-3-2


I) Biomolculas 3) Glcidos

Segn el nmero de tomos de carbono se H


clasifican en : H
C=O
H-C-O-H
H-C-O-H
Triosas........n = 3 C=O
H-O-C-H
Tetrosas.......n = 4 H-C-O-H
H-C-O-H
Pentosas.......n =5 H-C-O-H
H-C-O-H
Hexosas........n = 6 H-C-O-H
H-C-O-H
Heptosas.......n = 7 H
H
A B
As, un monosacrido con 6 tomos de
carbono y con la funcin aldehdo ser una
Fig. 3 A) La glucosa, una aldohexosa; B)
aldohexosa; si tiene cuatro tomos de la ribulosa. , una cetopentosa.
carbono y una funcin cetona, ser una
cetotetrosa, y as sucesivamente.

PROPIEDADES FSICAS Y QUMICAS DE LOS MONOSACRIDOS

- Propiedades fsicas: Los monosacridos son slidos, cristalinos, incoloros o blancos,


de sabor dulce. Como los grupos hidroxilo son polares, los monosacridos son muy
solubles en agua, pues se establecen enlaces polares con las molculas de agua.

- Propiedades qumicas: El grupo carbonilo reduce fcilmente los compuestos de


cobre (licor Fehling) y de plata oxidndose y pasando a grupo cido. Esta propiedad
es caracterstica de estas sustancias y permite reconocer su presencia, pues la
reduccin de las sales cpricas del licor de Fehling a cuprosas hace virar el reactivo
del azul al rojo ladrillo.

Cu+ + ------- Cu+


azul rojo

H
1 H
C=O
FRMULA LINEAL DE LOS MONOSA- 2
1
H-C-O-H
H-C-O-H 2
CRIDOS 3 C=O
H-O-C-H 3
4 H-C-O-H
H-C-O-H 4
5 H-C-O-H
DIASTEREOISOMERA H-C-O-H 5
6 H-C-O-H
H-C-O-H
H
Las frmulas lineales de los monosacridos H
se escriben con el carbono 1, el carbono A B

que lleva la funcin aldehdo o el carbono


Fig. 4 Numeracin de los tomos de
ms prximo a la funcin cetona, en la carbono en A) una aldosa y en B) una cetosa.
parte superior y el resto de los carbonos en

J. L. Snchez Guilln Pgina I-3-3


I) Biomolculas 3) Glcidos

orden descendente.
-C- -C-
Los monosacridos tienen tomos de carbo- H-C-O-H H-O-C-H
no asimtricos (carbonos que tienen 4 sus-
-C- -C-
tituyentes diferentes) por lo que presentan
diastereoisomera (ismeros pticos). Los
diastereoismeros se diferencian en su Fig. 5 Diferenciacin en la posicin de
los -OH en los carbonos asimtricos de los
formulacin en la colocacin de los H y OH monosacridos.
de cada carbono asimtrico a un lado u otro
del esqueleto carbonado de la molcula.

El nmero de ismeros pticos, para un


monosacrido dado, es de 2 n, siendo n el
nmero de tomos de carbono asimtricos
que tenga. La glucosa con cuatro tomos de
carbono asimtricos tendr 2 4 = 16 ismeros
Fig. 6 Disposicin de los sustituyentes
pticos. De los 2 n ismeros posibles de un alrededor de un carbono asimtrico.
monosacrido, la mitad pertenecen a la serie
D, y la otra mitad son sus imgenes
especulares y pertenecen a la serie L. Los monosacridos que tienen el OH del ltimo
tomo de carbono asimtrico a la derecha pertenecen a la serie D, los de la serie L lo
tienen a la izquierda. En los seres vivos normalmente slo aparece una de las formas.
Por convenio, se ha decidido que esta forma es la D.

H H H H
C O C O C O C O
H C OH HO C H H C OH HO C H
H C OH H C OH HO C H HO C H
H C OH H C OH H C OH H C OH
H H H H

1 2 3 4

Fig. 7 Diastereoismeros de una aldotetrosa. Las formas 1 y 2 son D; las formas 3 y 4 son L. 1 y 4
son enantimeras al se una la imagen especular de la otra. Lo mismo ocurre con 2 y 3.

EL HEMIACETAL INTRAMOLECULAR.
CICLACIN DE LA MOLCULA

Si las aldopentosas y las hexosas se disuelven en agua, o si forman parte de los di-
sacridos o polisacridos, el grupo carbonilo (-C=O) reacciona con el grupo hidroxilo (
-C-O-H) del carbono 4, en las aldopentosas, o del carbono 5, en las hexosas,
formndose un hemiacetal (reaccin entre un alcohol y un aldehdo) o un hemicetal
(reaccin entre un alcohol y una cetona) y la molcula forma un ciclo.

J. L. Snchez Guilln Pgina I-3-4


I) Biomolculas 3) Glcidos

Las frmulas c clicas de la hexosas se re-


presentan, segn la proyeccin de Haworth,
con el plano del anillo perpendicular al plano
de escritura, los carbonos 2 y 3 dirigidos
hacia delante, el carbono 5 y el oxge no del
anillo hacia detrs.

Los OH que en la frmula lineal estaban a


Fig. 8 Pirano y furano.
la derecha se ponen por debajo del plano y
los que estaban a la izquierda se ponen
hacia arriba. En la formas D el -CH2 OH se H H
pone por encima y en las L por debajo. C O H-O C

H C O H H C O H

Si las frmulas c clicas forman un anillo H O C H H O C H


O
pentagonal reciben el nombre de furanosas, H C O H H C O H

mientras que si ste es hexagonal se H C O H H C

denominan piranosas. En stas ltimas, a su H C O H H C O H

H H
vez, el anillo puede adoptar dos disposicio-
nes diferentes: de silla, si el carbono 1 y el Fig. 9 Formacin de un hemiacetal en
4 estn a ambos lados del plano formado una aldohexosa. Dentro del crculo el OH
por los carbonos 2, 3 y 5, y de bote o hemiacetlico.

nave si estn a un mismo lado.

H
HO H OH
FORMAS y CH2OH
CH2OH H
O HO
H
H O
HO H
Cuando se produce la ciclacin de la mo- H HO OH
HO H

lcula aparece un nuevo tomo de carbono H


H OH

asimtrico, el carbono 1 en las aldosas o el Fig. 10 Formas de bote o silla de la


glucosa.
2 en las cetosas. Este carbono recibe el
nombre de carbono anomrico. El OH de este
carbono, -OH hemiacetlico, puede estar a
CH2OH
uno u otro lado del plano de la molcula
C O
originndose dos nuevos ismeros pticos. H OH
H
Cada uno de estos ismeros se distingue
C C
mediante los smbo los y (formas y
OH OH H H
).
C C

H OH
La forma se representa situando el OH
hemiacetlico por debajo del plano de la Fig. 11 Forma cclica de la D
molcula; en la forma se sita por encima. glucosa.
Las formas y de un monosacrido
reciben el nombre de formas anmeras1 .

1
Curiosidad: Al aparecer un nuevo tomo de carbono asimtrico cambia el ngulo con el que el monosacrido
desva el plano de la luz polarizada. Por ejemplo:

J. L. Snchez Guilln Pgina I-3-5


I) Biomolculas 3) Glcidos

NOMENCLATURA DE LAS FORMAS


CCLICAS CH2OH
O CH2OH

C C
Para nombrar la forma cclica de un
monosacrido, se indica en primer lugar si
H OH
H OH
es o , a continuacin, si es D o L y, C C
por ltimo, el nombre del monosacrido y el OH H
tipo de anillo. Por ejemplo: -D-
glucopiranosa, -D-fructofuranosa
Fig. 12 Frmula de la D
fructofuranosa.

ORIENTACIN DE LAS FRMULAS CCLICAS DE LOS MONOSACRIDOS

Normalmente, las frmulas cclicas de los monosacridos se representan con el


carbono anomrico hacia la derecha, el resto de los carbonos del ciclo por orden en el
sentido de las agujas del reloj. No obstante, la molcula puede representarse bien
girada (giro de 180 o segn el eje Y) o volteada (giro de 180 o segn el eje Z). En los
esquemas se ha representado la -D-fructofuranosa en posicin normal (a), girada (b)
y volteada (c).

OH H
O 1 CH OH
O H
6
CH2OH 2
4 OH
3
C C
5
C C HOH2C CH2OH
2
C C
5
2
H OH H H
CH2OH
H OH
HOH2C
H OH 2 C C5
C C
C C OH H 3 4
4 3 O OH HO
HO H

a) b) c)

D-glucosa a 201C desva el plano +112.21


D-glucosa a 201C " " +18.7 1
La mezcla de y " " +52.7 1

J. L. Snchez Guilln Pgina I-3-6


I) Biomolculas 3) Glcidos

EJEMPLOS DE MONOSACRIDOS DE INTERS BIOLGICO

CH2OH
CH2OH
O CH2OH
C O
H OH
H C C
C C H OH
H OH
OH OH H H
C
C C
C
OH H
H OH

Glucosa: Sustancia muy difundida tanto entre los Fructosa: Cetohexosa. Sustancia muy difundida
vegetales (uvas) como entre los animales. Forma entre las plantas, sobre todo en sus frutos, y en
parte de muchos disacridos y polisacridos. la miel. En el hgado se transforma en glucosa.
Importante fuente de energa de las clulas. En Junto con la glucosa forma el disacrido
la sangre hay un uno por mil de glucosa sacarosa.
procedente de la digestin.

CH2OH
O CH2OH
O
OH OH

C C C C
H H H H
H H
H H
C C C C
OH OH OH H

Ribosa: Aldopentosa. Forma parte de muchas Desoxirribosa: Derivada de la ribosa. Le falta el


sustancias orgnicas de gran inters biolgico, grupo alcohol en el carbono 2. Forma parte del
como el ATP o el ARN. ADN.
CH2OH
CH2OH

C O C O
HO H H H
H H
C C C C
H OH H OH
OH OH H OH
C C
C C
H OH
H NH

CO

CH3

Galactosa: Junto con la glucosa forma la lactosa, N-acetilglucosamina: Derivado de la glucosa. Se


disacrido de la leche. encuentra en las paredes de las bacterias y es
tambin el monmero que forma el polisacrido
quitina presente en el exoesqueleto de los
insectos y las paredes celulares de muchos
hongos.

J. L. Snchez Guilln Pgina I-3-7


I) Biomolculas 3) Glcidos

LOS OLIGOSACRIDOS. EL ENLACE O-GLICOSDICO.

Los oligosacridos estn formados por la unin de 10 o menos de 10


monosacridos mediante un enlace O-glicosdico.

As, si reaccionan el -OH del carbono anomrico de un monosacrido con otro -OH
de otro monosacrido, ambas sustancias quedarn unidas mediante un enlace O-
glicosdico. Como consecuencia de la unin se forman un disacrido y una molcula
de agua.

C6 H12 O6 + C6 H12 O6 C12 H22 O11 + H2 O

El -OH o los -OHs que intervienen en la unin pueden encontrarse bien en forma
o , lo que dar lugar a sustancias diferentes.

CH2OH CH2OH
O O
H H H
H H
H

OH OH H OH OH H
OH OH

H OH H OH
H2O

CH2OH CH2OH
O O
H H H
H H
H

OH H H
OH O OH OH

H OH H OH

Fig. 13 Formacin de maltosa, disacrido reductor, mediante la unin 1 4 de dos molculas de glucosa.

Los disacridos son sustancias de


propiedades similares a las de los
monosacridos. Ahora bien, si los -OH de
los carbonos anomricos de ambos
monosacridos intervienen en el enlace O-
glicosdico, enlace dicarbonlico, el
disacrido no ser reductor, pues no tiene
ningn OH hemiacetlico/hemicetlico libre y
es este OH el que les da las propiedades
reductoras.
Fig. 14 Modelo de esferas de la
Los oligosacridos se encuentran, junto a sacarosa, un disacrido.
lpidos y protenas, en la membrana
plasmtica donde actan como receptores de muchas sustancias y como molculas
que sirven para que las clulas se reconozcan entre s.

La hidrlisis de los oligosacridos proporciona los correspondientes monosacridos:

C12 H22 O11 + H2 O C6 H12 O6 + C6 H12 O6

J. L. Snchez Guilln Pgina I-3-8


I) Biomolculas 3) Glcidos

EJEMPLOS DE DISACRIDOS DE INTERS BIOLGICO

OH H
CH2OH
O H
H
H HO CH2OH
H
O
OH H
OH
H
HOCH2 O

H OH

Sacarosa: Formada por -D-glucosa y -D-fructosa (enlace 12), unidas por los OH de los carbonos
anomricos y por lo tanto no reductor. Es el azcar de mesa. Se encuentra en la caa de azcar y en la
remolacha.

CH2OH CH2OH
O O
HO H
H
H H
O

OH H H
H OH OH
H

H OH H OH

Lactosa: Formada por -D-galactosa y D-glucosa, unidas 1 4 . Reductor. Se encuentra en la leche de los
mamferos.

CH2OH CH2OH
O O
H H H H
H H

OH H H
OH O OH OH

H OH H OH

Maltosa: Formada por dos D-glucosas unidas por un enlace 1 4. Reductor. Se obtiene por hidrlisis del
almidn y del glucgeno. Aparece en la germinacin de la cebada empleada en la fabricacin de la cerveza.
Tostada se emplea como sucedneo del caf (malta).
CH2OH CH2OH
O O
H H OH
H H
O

OH H H
OH OH
H H

H OH H OH

Celobiosa: Formada por dos D-glucosas unidas por un enlace 1 4. Reductor. Se obtiene por hidrlisis de la
celulosa.

J. L. Snchez Guilln Pgina I-3-9


I) Biomolculas 3) Glcidos

POLISACRIDOS

Uno de los monosacridos de la maltosa presenta libre su OH hemiacetlico y podr


unirse mediante un nuevo enlace O-glicosdico al OH alcohlico de otro monosacri-
do. Este proceso puede repetirse y formarse un compuesto constituido por la unin
de muchos monosacridos al que llamaremos polisacrido.

O O

HO O O
OH
O O HO
OH
HO O O
O
OH
HO O O
OH
HO
OH

Fig. 15 Fragmento de almidn. El almidn es un polisacrido compuesto por molculas de glucosa.

Los polisacridos son sustancias inspidas, amorfas e insolubles en agua, algunos,


como el almidn, pueden formar dispersiones coloidales.

Aunque los polisacridos podran estar constituidos por diferentes monosacridos, lo


normal es que sea un slo monosacrido el que forma la molcula. Los polisacridos
son macromolculas, molculas de elevada masa molecular, miles o centenares de
miles de daltons. Por ejemplo, cada molcula de celulosa, polisacrido vegetal, con-
tiene de 300 a 3 000 molculas de glucosa y tiene un peso molecular que oscila
entre 54 000 y 540 000 da. Algunos polisacridos presentan ramificaciones.

Es de destacar que los polisacridos, al tener un slo -OH hemiacetlico por molcula
libre, presentan un carcter reductor tan pequeo que se puede considerar como que
no son reductores.

POLISACRIDOS DE INTERS BIOLGICO

Los polisacridos de mayor importancia biolgica estn formados por un slo tipo de
monosacrido. Se trata, por lo tanto de homopolisacridos. Veamos algunos ejemplos:

Fig. 16 Fragmento de amilosa. La amilosa es uno de los componentes del almidn.

El almidn: polisacrido con funcin energtica. Es sintetizado por los vegetales. Est
formado por miles de molculas de glucosa en unin 1 -- 4. La molcula adopta una

J. L. Snchez Guilln Pgina I-3-10


I) Biomolculas 3) Glcidos

disposicin en hlice, dando una vuelta por


cada 6 molculas de glucosa, adems, cada
12 glucosas, presenta ramificaciones por
uniones 1 -- 6. El almidn se reconoce
fcilmente por teirse de violeta con
disoluciones de iodo (solucin de Lugol).

El glucgeno: Polisacrido de reserva


energtica en los animales. Se encuentra en
el hgado y en los msculos donde se
Fig. 17 Estructura helicoidal del almidn
hidroliza transformandose en glucosa. Su
y del glucgeno. 1) Ramificaciones producidas
estructura es similar a la del almidn, por las uniones 1-6.
aunque ms ramificado y su masa molecular
es mucho mayor.

La celulosa: Sintetizada por los vegetales, tiene funcin estructural, formando parte
importante de la pared celular. Est formada por la unin 1 -- 4 de varios millares
de molculas de glucosa. Debido al tipo de enlace cada molcula de glucosa est
girada 180 o respecto a la anterior, lo que le da a la celulosa una estructura lineal
pero "retorcida". Esta disposicin permite que se formen gran cantidad de puentes de
hidrgeno entre cadenas yuxtapuestas, lo que produce muy fibras resistentes.

H OH H OH
CH2OH CH2OH
H O O H H O O H
HO HO
H H
H H

H H
OH H OH H
O
H H O H H O

OH
H
OH
CH2OH H CH2OH

celobiosa

Fig. 18 Fragmento de celulosa.

La quitina. Formada por un derivado nitrogenado de la glucosa: la N-acetil-


glucosamina). Constituye los exoesqueletos de los artrpodos.

CH2OH CH2OH CH2OH CH2OH

O O O O
H H H H
H H H H
O O O
OH H OH H OH H OH H
OH
H H H H

H NH H NH H NH H
C=O C=O C=O
CH3 CH3 CH3

quitobiosa

Fig. 19 Fragmento de quitina.

Tambin podemos encontrar en los seres vivos otros polisacridos ms complejos.

J. L. Snchez Guilln Pgina I-3-11


I) Biomolculas 3) Glcidos

Por ejemplo:

- Las pectinas, de las paredes celulsicas de


los vegetales, formadas por la
polimerizacin del cido galacturnico,
un derivado cido de la galactosa

- Los pptidoglucanos de las paredes


bacterianas, formados por
polisacridos asociados a cadenas
peptdicas.

Fig. 20 Los exoesqueletos de los


artrpodos estn formados por quitina y otras
sustancias.

J. L. Snchez Guilln Pgina I-3-12


I) Biomolculas 4) Lpidos

I-4

LPIDOS

CONCEPTO, PROPIEDADES Y FUNCIONES GENERALES

Concepto: Los lpidos son sustancias qumicamente muy diversas. Slo tienen en
comn el ser insolubles en agua u otros disolventes polares y solubles en disolventes
no polares u orgnicos, como el benceno, el ter, la acetona, el cloroformo, etc

Propiedades fsicas: Son sustancias untosas al tacto, tienen brillo graso, son menos
densas que el agua y malas conductoras del calor.

Funciones en los seres vivos: Los lpidos desempean importantes funciones en los
seres vivos. Estas son, entre otras, las siguientes:

- Estructural: Son componentes estructurales PROTECTORA TRANSPORTE


fundamentales de las membranas
celulares.
FUNCIONES

- Energtica: Al ser molculas poco oxidadas


sirven de reserva energticapues
proporcionan una gran cantidad de REGULADORA
ESTRUCTURAL
energa; la oxidacin de un gramo de ENERGTICA

grasa libera 9,4 Kcal, ms del doble


Fig. 1 Funciones de los lpidos en los
que la que se consigue con 1 gramo
seres vivos.
de glcido o de protena (4,1 Kcal).

- Protectora: Las ceras impermeabilizan las


paredes celulares de los vegetales y
de las bacterias y tienen tambin
funciones protectoras en los insectos
y en los vertebrados.

- Transportadora: Sirven de transportadores


de sustancias en los medios
orgnicos.

- Reguladora del metabolismo: Contribuyen al


normal funcionamiento del organismo.
Desempean esta funcin las
vitaminas (A,D, K y E). Las hormonas
sexuales y las de la corteza Fig. 2 Modelo de esferas de un lpido,
suprarrenal tambin son lpidos. un acilglicrido.

- Reguladora de la temperatura: Tambin sirven para regular la temperatura. Por


ejemplo, las capas de grasa de los mamferos acuticos de los mares de
aguas muy fras.

J. L. Snchez Guilln Pgina I-4-1


I) Biomolculas 4) Lpidos

SAPONIFICACIN DE LOS LPIDOS

Muchos lpidos, como por ejemplo: los cidos grasos, reaccionan con bases fuertes,
NaOH o KOH, dando sales sdicas o potsicas que reciben el nombre de jabones.
Esta reaccin se denomina de saponificacin. Son saponificables los cidos grasos o
los lpidos que poseen cidos grasos en su estructura.

R1-COOH + NaOH R1-COONa + H2O


cido orgnico hidrxido sdico Sal sdica (jabn) agua

Fig. 3 Reaccin de saponificacin entre un cido orgnico y el hidrxido sdico.

CLASIFICACIN

Segn den o no la reaccin de saponificacin, clasificaremos los lpidos en:

Saponificables No saponificables
cidos grasos Esteroides
Acilglicridos
Ceras
Fosfolpidos

Es de destacar que, adems de estas, que son las que estudiaremos, existen otras
clases de lpidos, como: los carotenoides, los terpenos, las prostaglandinas, etc.

LOS CIDOS GRASOS

Concepto. Son cidos orgnicos de


elevado nmero de tomos de
carbono. Este nmero es siempre par
y oscila, normalmente, entre 12 y 22.

Descripcin: La cadena carbonada


puede o no tener dobles enlaces. En
el primer caso, diremos que el cido
graso es insaturado y en el segundo,
saturado. Los cidos grasos se dife-
rencian por el nmero de tomos de
carbono y por el nmero y la posicin Tabla I: Los principales cidos grasos.
de los dobles enlaces. A veces, por
comodidad, representaremos la cadena hidrocarbonada de los cidos grasos como una

J. L. Snchez Guilln Pgina I-4-2


I) Biomolculas 4) Lpidos

simple lnea quebrada.

La cadena de los cidos grasos saturado


puede disponerse totalmente extendida,
mientras que la cadena de los cidos grasos
insaturados al tener dobles enlaces adopta
una disposicin doblada.

Los cidos grasos no suelen encontrarse en


estado libre y se obtienen por hidrlisis
cida o enzimtica de los lpidos
saponificables. Fig. 4 1) Acido graso saturado (ac.
Palmtico) 2) cido graso insaturado (ac.
Olico).

Propiedades qumicas

a) Reaccin de esterificacin: El grupo cido de los cidos grasos va a poder


reaccionar con los alcoholes para formar steres y agua.

R1-COOH + HOCH2-R2 R1-COO-CH2-R2 + H2O


cido orgnico alcohol ster agua

Fig. 5 Reaccin de esterificacin entre un cido graso y un alcohol para dar un ster y agua.

b) Reaccin de saponificacin: Como se ha dicho anteriormente, con bases fuertes


como la sosa (NaOH) o la potasa (KOH), dan las correspondientes sales sdicas o
potsicas del cido graso que reciben el nombre de jabones.

ACILGLICRIDOS O GRASAS
cidos grasos Glicerina

Son steres de la glicerina y de cidos COOH


HO-CH2
grasos. Si un cido graso esterifica uno de COOH + HO-CH

los grupos alcohol de la glicerina tendremos COOH HO-CH2

un monoacilglicrido, si son dos, un


3H2O
diacilglicrido, y si son tres, un triacilglicrido,
triglicrido, tambin llamados: grasas neutras. CO- O-CH2
Estas sustancias por saponificacin dan CO- O-CH
jabones y glicerina. CO- O-CH2
Los acilglicridos sencillos contienen un slo
Triacilglicrido
tipo de cido graso, mientras que los mixtos
tienen cidos grasos diferentes. Fig. 6 Reaccin de formacin de un
triacilglicrido.
Los acilglicridos saponifican dando los
correspondientes jabones y glicerina.

J. L. Snchez Guilln Pgina I-4-3


I) Biomolculas 4) Lpidos

PROPIEDADES FSICAS DE LAS GRASAS Y


FUCIN BIOLGICA

Las propiedades fsicas de estas sustancias


son de gran importancia pues en cierto
modo determinan su funcin biolgica. Estas
propiedades se deben, en gran medida, a la
longitud y al grado de insaturacin de la
Fig. 7 Las grasas animales y los aceites
cadena hidrocarbonada de los cidos grasos vegetales son mezclas complejas de
que las forman. acilglicridos y otros lpidos.

* Solubilidad: Los cidos grasos son


sustancias anfipticas ya que la cadena
hidrocarbonada es apolar mientras que el
grupo carboxilo es polar. Esta propiedad ser
ms ampliamente tratada ms adelante.

Los triglicridos son sustancias apolares,


prcticamente insolubles en agua. Los
monoacilglicridos y los diacilglicridos, al
tener la glicerina radicales OH- libres, tienen
cierta polaridad.
Fig. 8 Monoacilglicrido.
* Punto de fusin: Los cidos grasos
saturados, al poderse disponer la cadena
hidrocarbonada totalmente extendida, pueden C-O-H
O
empaquetarse estrechamente lo que permite
=
=

O
C-O-H

que se unan mediante fuerzas de Van der O


C-O-H
=

C-O-H
O

Waals con tomos de cadenas vecinas (el O


C-O-H
=

nmero de enlaces, adems, est en relacin C-O-H


O
C-O-H
O
directa con la longitud de la cadena). Por el
=
=

O
C-O-H

contrario, los cidos grasos insaturados, al


tener la cadena doblada por los dobles
enlaces no pueden empaquetarse tan Fig. 9 Las grasas que contienen cidos
grasos saturados son slidas; pues sus
fuertemente. Es por esto que los cidos componentes pueden empaquetarse ms
grasos saturados tienen puntos de fusin densamente, lo que aumenta el punto de
fusin.
mas altos que los insaturados y son slidos
(sebos) a temperaturas a las que los insaturados son lquidos (aceites). En los
animales poiquilotermos y en los vegetales hay aceites y en los animales
homeotermos hay sebos. Los sebos y los aceites estn formados por mezclas ms o
menos complejas de acilglicridos.

Las grasas tienen sobre todo funciones energticas. En los vegetales se almacenan
en las vacuolas de las clulas vegetales (las semillas y frutos oleaginosos) y en el
tejido graso o adiposo de los animales. Contienen en proporcin mucha ms energa

J. L. Snchez Guilln Pgina I-4-4


I) Biomolculas 4) Lpidos

que otras sustancias orgnicas, como por ejemplo el glucgeno, pues pueden
almacenarse en grandes cantidades y en forma deshidratada, con lo que ocupan un
menor volumen. En el intestino, las lipasas hidrolizan los acilglicridos liberando
glicerina y cidos grasos.

3NaOH
CO- O-CH2 COONa HO-CH2

CO- O-CH COONa + HO-CH

CO- O-CH2 COONa HO-CH2

Triacilglicrido jabn Glicerina

Fig. 10 Saponificacin de un triacilglicrido.

En algunos animales las grasas acumuladas bajo la piel sirven como aislante trmico
o para regular la flotabilidad, pues son malas conductoras del calor y menos densas
que el agua.

Algunos cidos grasos de cadena muy larga son esenciales en la dieta y se les
conoce bajo el nombre genrico de vitaminas F.

LAS CERAS

Son steres de un monoalcohol lineal y de un cido graso, ambos de cadena larga.

Palmitato de miricilo (cera de abeja)

cido graso (C18)


Enlace
ster

Alcohol de cadena larga (C30)

Fig. 11 Palmitato de miricilo, cera de abejas.

LOS FOSFOLPIDOS

Son lpidos que forman parte de las membranas celulares. Derivan de la glicerina o
de la esfingosina, un alcohol ms complejo. Los derivados de la glicerina se llaman
fosfoglicridos y los que derivan de la esfingosina: esfingolpidos.

I) FOSFOGLICRIDOS

Se trata de una de las clases de fosfolpidos, lpidos con cido fosfrico.

J. L. Snchez Guilln Pgina I-4-5


I) Biomolculas 4) Lpidos

Qumicamente podemos definirlos como steres del cido fosfatdico y un compuesto


polar, generalmente un aminoalcohol. El cido fosfatdico es, a su vez, un ster de un
diacilglicrido y del cido fosfrico. El alcohol es siempre una sustancia polar, soluble
en agua, muy variada qumicamente (aminocido, base nitrogenada, etc). Como
ejemplo de fosfoglicrido podemos ver en la Fig.12 la estructura de la lecitina
(fosfatidilcolina).

O
C O- CH 2

O
C O- CH

O CH3
+
H2COPOCHCHNCH3
X
OH CH3
Y Z W

cido fosfatdico (apolar) alcohol (polar)

Fig. 12 Lecitina. X) cidos grasos. Y) Glicerina. Z) cido fosfrico. W) Colina. X y Y estn unidos por
enlaces ster; Y y Z, y Z y W lo estn por enlaces ster fosfato.

Otros ejemplos de fosfoglicridos segn sea w son:

Alcohol (W) Fosfoglicrido


Colina Fosfatidilcolina
Serina Fosfatidilserina

ESFINGOLPIDOS

Su estructura molecular deriva de la unin


del alcohol esfingosina y una sustancia polar
que puede ser un aminoalcohol o un glcido.
El ms conocido es la esfingomielina. Fig. 13 Esfingonielina.

IMPORTANCIA BIOLGICA DE LOS FOSFOLPIDOS

Los fosfolpidos compuestos anfipticos y debido a esto desempean un papel


estructural de gran importancia en los seres vivos pues constituyen las membranas
celulares. stas estn formadas por una doble capa de fosfolpidos en la que estn
integrados otros lpidos (colesterol, por ejemplo) y protenas. En el caso de la
membrana plasmtica hay tambin oligosacridos.

J. L. Snchez Guilln Pgina I-4-6


I) Biomolculas 4) Lpidos

LOS ESTEROIDES

Son lpidos no saponificables derivados del


ciclo del esterano (ciclopentano-
perhidrofenantreno).

Muchas sustancias importantes en los seres


vivos son esteroides o derivados de Fig. 14 Esterano.
esteroides. Por ejemplo: el colesterol, los
cidos biliares, las hormonas sexuales, las
hormonas de la corteza suprarrenal, muchos
alcaloides, etc. En la tabla de la pgina 9 se
dan algunos ejemplos de esteroides
presentes en los seres vivos.

Fig. 15 Colesterol.
CARCTER ANFIPTICO DE LOS LPIDOS

MICELAS, MONOCAPAS Y BICAPAS

Ciertos lpidos, y en particular los fosfolpi -


dos, tienen una parte de la molcula que es
polar: hidrfila y otra (la correspondiente a
los cidos grasos) que es no polar:
hidrfoba. Las molculas que presentan estas Fig. 16 Representacin de un lpido
anfiptico.
caractersticas reciben el nombre de
anfipticas. A partir de ahora y por
comodidad, representaremos la parte polar
(hidrfila) y la no polar (hidrfoba) de un
fosfolpido como se indica en la Fig. 16.

Cuando los fosfolpidos se dispersan en


agua forman micelas. Los grupos hidrfilos
se disponen hacia la parte acuosa y la parte
hidrfoba de cada molcula hacia el interior.
Las suspensiones que contienen este tipo de
micelas son muy estables.

Los lpidos anfipticos pueden tambin


dispersarse por una superficie acuosa pudin-
dose formar, si la cantidad es la adecuada,
una capa de una molcula de espesor:
monocapa. En este caso las partes hidrfilas Fig. 17 Monocapa y bicapa formada por
se disponen hacia el interior y los grupos un lpido anfiptico.

hidrfobos hacia el exterior de la superficie

J. L. Snchez Guilln Pgina I-4-7


I) Biomolculas 4) Lpidos

acuosa. Pueden tambin formarse bicapas, en


particular entre dos compartimientos
acuosos. Entonces, las partes hidrfobas se
disponen enfrentadas y las partes hidrfilas
se colocan hacia la solucin acuosa. Los
lpidos anfipticos forman este tipo de
estructuras espontneamente. Las bicapas
pueden formar compartimientos cerrados
denominados liposomas. La bicapas lipdicas
Fig. 18 Micelas.
poseen caractersticas similares a las de las
membranas celulares: son permeables al
agua pero impermeables a los cationes y
aniones y son tambin malas conductoras
elctricas. En realidad, las membranas
celulares son, esencialmente, bicapa lipdi -
cas.

Fig. 19 Las membranas celulares estn


constitudas por bicapas lipdicas en la que se
encuentran insertadas protenas.

J. L. Snchez Guilln Pgina I-4-8


I) Biomolculas 4) Lpidos

EJEMPLOS DE ESTEROIDES

Colesterol: El OH confiere un carcter polar a Cortisona: Hormona de la corteza de las


esta parte de la molcula. Precursor de otras mu- glndulas suprarrenales. Acta favoreciendo la
chas sustancias. Presente en las membranas formacin de glucosa y glucgeno.
celulares de las clulas animales a las que
confiere estabilidad.

Progesterona: Una de las hormonas sexuales fe- Testosterona: Hormona sexual masculina.
meninas.

Vitamina D: Regula el metabolismo del calcio y Solanina: Alcaloide presente en la patata. Ob-
del fsforo. srvese que tiene un oligosacrido unido al
anillo del esterano.

J. L. Snchez Guilln Pgina I-4-9


I) Biomolculas 4) Lpidos

J. L. Snchez Guilln Pgina I-4-10


I) Biomolculas 5) Protenas

I-5

PROTENAS

CONCEPTO Y CARACTERSTICAS

Concepto: Se pueden definir como polmeros formados por la unin, mediante


enlaces peptdicos, de unidades de menor masa molecular llamadas aminocidos.

Son molculas muy complejas. Su masa molecular es muy elevada, normalmente est
comprendida entre 6000 da y 10 6 da, son macromolculas. Algunas protenas estn
constituidas por la unin de varios polmeros proteicos que en ocasiones pueden
tambin contener otras molculas orgnicas (lpidos, glcidos, etc). En este ltimo
caso reciben el nombre genrico de prtidos.

Las protenas son las molculas orgnicas ms abundantes en las clulas, ms del
50% del peso seco de la clula son protenas. Estn constituidas,
fundamentalmente, por C, H, O y N y casi todas tienen tambin azufre. Algunas
tienen, adems, otros elementos qumicos y en particular: P, Fe, Zn o Cu. El
elemento ms caracterstico de las protenas es el nitrgeno. Son los compuestos
nitrogenados por excelencia de los seres vivos.

Las protenas son molculas especficas que marcan la individualidad de cada ser
vivo. Son adems de una gran importancia porque a travs de ellas se va a expresar
la informacin gentica, de hecho el dogma central de la gentica molecular nos dice:

DNARNAProtena

FUNCIONES GENERALES

Las protenas estn entre las sustancias que realizan las funciones ms importantes
en los seres vivos. De entre todas pueden destacarse las siguientes:

- De reserva. En general las protenas no tienen funcin de reserva, pero pueden


utilizarse con este fin en algunos casos especiales como por ejemplo en el desarrollo
embrionario: ovoalbmina del huevo, casena de la leche y gliadina del trigo.

- Estructural. Las protenas constituyen muchas estructuras de los seres vivos. Las
membranas celulares contienen protenas. En el organismo, en general, ciertas
estructuras -cartlago, hueso- estn formadas, entre otras sustancias, por protenas.

J. L. Snchez Guilln Pgina I-5-1


I) Biomolculas 5) Protenas

- Enzimtica. Todas las reacciones que se producen en los organismos son


catalizadas por molculas orgnicas. Las enzimas son las molculas que realizan esta
funcin en los seres vivos. Todas las reacciones qumicas que se producen en los
seres vivos necesitan su enzima y todas las enzimas son protenas.

- Homeosttica. Ciertas protenas mantienen el equilibrio osmtico del medio celular y


extracelular.

- Transporte, de gases, como es el caso de la hemoglobina, o de lpidos, como la


seroalbmina. Ambas protenas se encuentran en la sangre. Las permeasas, molculas
que realizan los intercambios entre la clula y el exterior, son tambin protenas.

- Movimiento. Actan como elementos esenciales en el movimiento. As, la actina y


la miosina, protenas de las clulas musculares, son las responsables de la con-
traccin de la fibra muscular.

- Hormonal. Las hormonas son sustancias qumicas que regulan procesos vitales.
Algunas protenas actan como hormonas, por ejemplo: la insulina, que regula la
concentracin de la glucosa en la sangre.

- Inmunolgica. Los anticuerpos, sustancias


que intervienen en los procesos de defensa
frente a de los agentes patgenos, son
protenas.

LOS AMINOCIDOS

Son las unidades estructurales que


constituyen las protenas. Todos los
aminocidos que se encuentran en las
protenas, salvo la prolina, responden a la Fig. 1 Frmula general de un amino-
frmula general que se observa en la figura. cido.

A partir de ahora nos referiremos


exclusivamente a los aminocidos presentes
en las protenas de los seres vivos. Estos, COOH
como indica su nombre, tienen dos grupos
funcionales caractersticos: el grupo HN C H
carboxilo o grupo cido (-COOH), y el
grupo amino (-NH2 ). La cadena carbonada de
los aminocidos se numera comenzando por
el grupo cido, siendo el carbono que tiene Fig. 2 L-prolina; aminocido polar no
ionizable. Es el nico aminocido que no
esta funcin el carbono nmero 1, el grupo responde a la frmula general.
amino se encuentra siempre en el carbono 2

J. L. Snchez Guilln Pgina I-5-2


I) Biomolculas 5) Protenas

o carbono . Por lo tanto, los aminocidos


tienen en comn los carbonos 1 (grupo
COOH
carboxilo) y 2 (el del grupo amino)
CH3
diferencindose en el resto (R) de la H2N C CH2 CH
molcula. En la frmula general de la Fig. 1 , CH3
R representa el resto de la molcula. R H
puede ser desde un simple H- , como en el
aminocido glicocola, a una cadena Fig. 3 L-leucina; aminocido no polar.
carbonada ms o menos compleja en la que
puede haber otros grupos aminos o carboxilo
y tambin otras funciones (alcohol, tiol, etc.).
Las protenas delos seres vivos slo tienen COOH
unos 20 aminocidos diferentes, por lo que
habr nicamente 20 restos distintos. Es de H2N C CH2 OH
destacar el hecho de que en todos los seres
H
vivos slo se encuentren los mismos 20
aminocidos. En ciertos casos muy raros, Fig. 4 L-tirosina; aminocido polar no
por ejemplo en los venenos de algunas ionizable.
serpientes, podemos encontrar otros
aminocidos diferentes de estos 20 e
incluso aminocidos que no siguen la
COOH
frmula general.
H 2N C CH2 CH2 COOH
La mayora de los aminocidos pueden
sintetizarse unos a partir de otros, pero H
existen otros, aminocidos esenciales, que
no pueden ser sintetizados y deben Fig. 5 L-Glutmico; aminocido polar
obtenerse en la dieta habitual. Los ionizable cido.
aminocidos esenciales son diferentes para
cada especie, en la especie humana, por
ejemplo, los aminocidos esenciales son diez: COOH
Thr, Lys, Arg, His, Val, Leu, Ileu, Met, Phe
y Trp. H 2N C CH2 CH2 COOH

H
CLASIFICACIN DE LOS AMINOCIDOS
Fig. 6 L-Arginina; aminocido polar
ionizable bsico.
En funcin de sus caractersticas
qumicas, los aminocidos se clasifican en:

Grupo I: Aminocidos apolares. Aminocidos cuyo resto R no es polar. Esto es, no


posee cargas elctricas en R al tener en l largas cadenas hidrocarbonadas. Estos
aminocidos, si estn en gran abundancia en una protena, la hacen insoluble en
agua.

Grupo II: Aminocidos polares no ionizables. Poseen restos con cortas cadenas

J. L. Snchez Guilln Pgina I-5-3


I) Biomolculas 5) Protenas

hidrocarbonadas en las que hay funciones polares (alcohol, tiol o amida).


Contrariamente al grupo anterior si una protena los tiene en abundancia ser soluble
en agua.
COOH

H2N C CH2 COOH


Grupo III: Aminocidos polares cidos. Pertenecen a
H
este grupo aquellos aminocidos que tienen ms de
un grupo carboxilo. En las protenas, si el pH es H2O
bsico o neutro, estos grupos se encuentran H3O+

cargados negativamente.
COOH
Grupo IV: Aminocidos polares bsicos. Son aquellos H2 N C CH2 COO
aminocidos que tienen otro u otros grupos aminos.
H
En las protenas, estos grupos amino, si el pH es
cido o neutro, estn cargados positivamente. Fig. 8 Ionizacin del grupo
amino suplementario de un
aminocido polar ionizable cido.

ASIMETRA DE LOS AMINOCIDOS


COOH

H2N C CH2 CH2 CH2 CH2 NH2


Excepto en la glicocola, en el resto de los
H
aminocidos el carbono (el carbono que lleva la
funcin amino) es asimtrico. La molcula ser H2 O
OH-
pticamente activa y existirn dos configuraciones:
D y L. Normalmente en los seres vivos slo
COOH
encontramos uno de los ismeros pticos. Por
H2N C CH2 CH2 CH2 CH2 NH3
convenio se considera que los aminocidos presentes
H
en los seres vivos pertenecen todos ellos a la serie
L. No obstante, en los microorganismos (paredes
Fig. 9 Ionizacin del grupo
bacterianas, antibiticos generados por bacterias) amino suplementario de un
existen aminocidos no proteicos pertenecientes a la aminocido polar ionizable bsico.
serie D.

OH OH
C O C O
H C NH2 H2N C H
R R
D aminocido L aminocido

Fig. 10 Asimetra de los aminocidos. Todos los aminocidos, excepto la glicocola, son asimtricos. De
las dos formas, la D y la L, en los seres vivos slo existe, normalmente, la L.

J. L. Snchez Guilln Pgina I-5-4


I) Biomolculas 5) Protenas

Aminocidos del Grupo I (apolares)


COOH COOH COOH
CH3 CH3
H2N-C-CH3 H 2N C CH2 CH H2N C CH
CH3 CH3
H H H
Alanina-Ala Leucina-Leu Valina-Val

COOH
COOH
H 2N C CH2
HN C H
H Fenilalanina-Phe
Prolina-Pro COOH

COOH H 2N C CH2 CH2 S CH3

H 2N C CH2 H Metionina-Met
COOH
H
N
H H 2N C CH CH2 CH3

Triptfano-Trp H CH3 Isoleucina-Ile

Aminocidos del Grupo II (polares no ionizables)

COOH COOH COOH


H2N C H H2N C CH2 OH H2N C CH CH3

H H H OH
Glicocola-Gly Serina-Ser Treonina-Trp

COOH COOH

H2N C CH2 SH H2N C CH2 OH

H Cistena-Cys H Tirosina-Tyr

COOH COOH
O O
H2N C CH2 C H2N C CH2 CH2-C
NH2 NH2
H H
Asparragina-Asn Glutamina-Gln

Aminocidos del Grupo III Aminocidos del Grupo IV


(polares ionizables cidos) (polares ionizables bsicos)

COOH COOH

H 2N C CH2 COOH H2N C CH2 N

H H N
Asprtico-Asp H Histidina-His

COOH COOH

H2N C CH2 CH2 COOH H2N C CH2 CH2 CH2 NH C NH2

H H NH
Glutmico-Glu Arginina-Arg

COOH

H2N C CH2 CH2 CH2 CH2 NH2

H
Lisina-Lys

J. L. Snchez Guilln Pgina I-5-5


I) Biomolculas 5) Protenas

EL ENLACE PEPTDICO

Cuando reacciona el grupo cido de un aminocido con el grupo amino de otro


ambos aminocidos quedan unidos mediante un enlace peptdico. Se trata de una
reaccin de condensacin en la que se produce una amida y una molcula de agua.
La sustancia que resulta de la unin es un dipptido.

H O H O
H N C C O H + H N C C O H
H R1 H R2
Aminocido 1 Aminocido 2

H2 O

H O H O
H N C C N C C O H
H R1 H R2
dipptido

Fig. 12 Reaccin de formacin del enlace peptdico.

CARACTERSTICAS DEL ENLACE PEPTDI CO

1 0) El enlace peptdico es un enlace covalente que se establece entre un tomo de


carbono y un tomo de nitrgeno. Es un enlace muy resistente, lo que hace posible
el gran tamao y estabilidad de las molculas proteicas.

Fig. 13 El enlace C-N se comporta como un doble enlace y no permite el giro.

2 0) Los estudios de Rayos X de las protenas han llevado a la conclusin de que el

J. L. Snchez Guilln Pgina I-5-6


I) Biomolculas 5) Protenas

enlace C-N del enlace pept dico se comporta en cierto modo como un doble enlace y
no es posible, por lo tanto, el giro libre alrededor de l.

3 0) Todos los tomos que estn unidos al carbono y al nitrgeno del enlace
peptdico mantienen unas distancias y ngulos caractersticos y estn todos ellos en
un mismo plano.

Fig. 14 Caractersticas del enlace peptdico.

PPTIDOS, POLIPPTIDOS y PROTENAS

Cuando se unen dos aminocidos mediante


un enlace peptdico se forma un dipptido. A
cada uno de los aminocidos que forman el
dipptido les queda libre o el grupo amino o
el grupo carboxilo. A uno de estos grupos se
le podr unir otro aminocido formndose un
tripptido. Si el proceso se repite
sucesivamente se formar un polipptido.
Cuando el nmero de aminocidos unidos es
muy grande, aproximadamente a partir de
Fig. 15 Modelo de esferas de la insulina,
100, tendremos una protena. un pptido.

2 aa Dipptido
3 aa Tripptido
de 4 a 10 aa Oligopptido
de 10 a 100 aa Polipptido
ms de 100 aa Prote na

Toda cadena polipeptdica tendr en uno de sus extremos un aminocido con el


grupo amino libre. Este ser el aminocido amino terminal (H-). En el otro extremo

J. L. Snchez Guilln Pgina I-5-7


I) Biomolculas 5) Protenas

quedar libre el grupo carboxilo del ltimo


aminocido, aminocido carboxilo terminal
(-OH). Toda cadena proteica tendr por lo
tanto una polaridad indicada mediante una
H- y un -OH. Ejemplo:

H-Gly-Ala-Pro-Leu-Trp-Met-Ser-OH.

Muchas sustancias naturales de gran


importancia son pptidos; por ejemplo: ciertas
hormonas, como la insulina, que regula las
concentraciones de glucosa en la sangre y
que est formada por dos cadenas de 21 y
30 aminocidos unidas por puentes disulfuro;
la encefalina (5 aminocidos) que se produce Fig. 16 Modelo de barras y esferas de la
oxitocina, una hormona peptdica.
en las neuronas cerebrales y elimina la
sensacin de dolor o las hormonas del lbulo
posterior de la hipfisis: vasopresina y
oxitocina (9 aa) que producen las
contracciones del tero durante el parto;
tambin son pptidos algunos antibiticos
como la gramicidina.

ESTRUCTURA O CONFORMACIN DE LAS


PROTENAS

La conformacin de una protena es la


Fig. 17 Modelo de bolas de la ubicuitina,
disposicin espacial que adopta la molcula una protena.
proteica. Las cadenas peptdicas, en
condiciones normales de pH y temperatura,
poseen solamente una conformacin y sta
es la responsable de las importantes
funciones que realizan.

La compleja estructura de las protenas


puede estudiarse a diferentes niveles. A
saber: primario, secundario, terciario y cua-
ternario.
Fig. 18 La insulina, una hormona de
carcter peptdico, est formada por dos
I) NIVEL O ESTRUCTURA PRIMARIA- Viene
cadenas polipeptdicas.
dada por la secuencia: orden que siguen los
aminocidos de una protena. Va a ser de gran importancia, pues la secuencia es la
que determina el resto de los niveles y como consecuencia la funcin de la protena.

La alteracin de la estructura primaria por eliminacin, adicin o intercambio de los

J. L. Snchez Guilln Pgina I-5-8


I) Biomolculas 5) Protenas

aminocidos puede cambiar la configuracin


general de una protena y dar lugar a una
protena diferente. Como, adems, la
funcin de la protena depende de su
estructura, un cambio en la estructura
primaria podr determinar que la protena no
pueda realizar su funcin. Veamos, a
continuacin, un ejemplo de estructura
primaria:

H-Ala-Gly-Ser-Lys-Asp-Asn-Cys-Leu-Met-Ala-
Ile-Trp-Gly-......-Pro-Asn-Glu-OH
Fig. 19 Modelo de cintas de la
ubicuitina.
II) NIVEL O ESTRUCTURA SECUNDARIA-
Las caractersti cas de los enlaces
peptdicos imponen determinadas restriccio-
nes que obligan a que las protenas adopten
una determinada estructura secundaria.

sta puede ser en hlice , hlice de


colgeno o en conformacin . Es de
destacar que las tres son configuraciones en
hlice diferenciandose en el nmero de
aminocidos por vuelta (n) y en el dimetro
de la hlice. En la hlice , n=4; en la hlice
de colgeno, n=3 y en la conformacin , Fig. 20 1) Hlices alfa; 2) conformaciones
beta; 3) enlaces de hidrgeno; 4) puentes
n=2. A continuacin estudiaremos solo la disulfuro; 5) zonas irregulares.
hlice y la conformacin por ser las
configuraciones ms frecuentes.

a) Estructura en hlice . Se trata de la


forma ms simple y comn. En este tipo de
estructura la molcula adopta una disposicin
helicoidal, los restos (R) de los aminocidos
se sitan hacia el exterior de la hlice y
cada 3,6 aminocidos sta da una vuelta
completa.

Este tipo de organizacin es muy estable,


porque permite la formacin de puentes de
hidrgeno entre el grupo C=O de un
aminocido y el grupo N-H del cuarto
aminocido situado por debajo de l en la
Fig. 21 Hlice alfa. Mediante flechas se
hlice. indican algunos enlaces de hidrgeno. R)
restos de los aminocidos.
b) Conformacin . Se origina cuando la

J. L. Snchez Guilln Pgina I-5-9


I) Biomolculas 5) Protenas

molcula proteica, o una parte de la molcula,


adoptan una disposicin en zig-zag. La esta-
bilidad se consigue mediante la disposicin
en paralelo de varias cadenas con esta
conformacin, cadenas que pueden pertene-
cer a protenas diferentes o ser partes de
una misma molcula. De esta manera pueden
establecerse puentes de hidrgeno entre
grupos C=O y -N-H. Los restos van que-
dando alternativamente hacia arriba y hacia Fig. 22 Visin superior de una hlice
abajo. No obstante, si la molcula presenta alfa. Los nmeros indican los aminocidos.

prximos entre s restos muy voluminosos o


con las mismas cargas elctricas se
desestabilizar.

Una molcula no tiene


que estar constituida
exclusivamente por un
tipo de conformacin. Lo
normal es que las
molculas proteicas
presenten porciones con
hlices , otras partes
con conformaciones y
Fig. 23 Conformacin beta o lmina plegada beta. En la figura se partes que no tienen una
observan dos fragmentos de lmina plegada beta asociados por enlaces de conformacin definida y
hidrgeno.
que se llaman zonas
irregulares.

III) NIVEL O ESTRUCTURA TERCIARIA- Las protenas no se disponen linealmente en


el espacio sino que normalmente sufren plegamientos que hacen que la molcula
adopte una estructura espacial tridimensional llamada estructura terciaria. Los pliegues
que originan la estructura terciaria se deben a ciertos aminocidos, como: la prolina,
la serina y la isoleucina, que distorsionan la
hlice generando una curvatura.

La estructura terciaria se va a estabilizar


por la formacin de las siguientes inte-
racciones:

1) Enlaces o puentes de hidrgeno.


2) Interacciones cido base.
3) Puentes disulfuro.

Estos ltimos se forman entre grupos -SH Fig. 24 Estructura de una protena. a)
pertenecientes a dos molculas de cistena hlices alfa; b) conformaciones beta; c) zonas
irregulares.
que reaccionan entre s para dar cistina.

J. L. Snchez Guilln Pgina I-5-10


I) Biomolculas 5) Protenas

-Cis-SH + HS-Cis- ----- -Cis-S-S-Cis-

En la estructura terciaria los restos se van


a disponer en funcin de su afinidad con el
medio. En medio acuoso, los restos
hidrfobos se sitan hacia el interior de la
molcula mientras que los restos hidrfilos lo
hacen hacia el exterior.

Bsicamente se distingen dos tipos de


estructura terciaria: la filamentosa y la
globular, aunque muchos autores consideran
que las protenas filamentosas son
protenas que carecen de estructura
Fig. 25 Estructura terciaria de una
terciaria. protena. a) hlices alfa b) conformaciones
beta; c) zonas irregulares.
Las protenas con conformacin filamentosa
suelen tener funcin estructural, de proteccin o ambas a la vez y son insolubles en
agua y en soluciones salinas. Por ejemplo, tienen esta conformacin: la beta-
queratina, el colgeno y la elastina.

Las protenas con conformacin globular suelen ser solubles en agua y/o en
disoluciones salinas. Son globulares las enzimas, las protenas de membrana y
muchas protenas con funcin transportadora.

Las protenas globulares suelen tener diferentes fragmentos con alfa-hlices y


conformaciones beta, pero las conformaciones beta suelen disponerse en la periferia y
las hlices alfa en el centro de la molcula. Adems, las protenas globulares se
doblan de tal manera que, en solucin acuosa, sus restos hidrfilos quedan hacia el
exterior y los hidrfobos en el interior y, por el contrario, en un ambiente lipdico, los
restos hidrfilos quedan en el interior y los
hidrfobos en el exterior.

IV) ESTRUCTURA CUATERNARIA- Cuando


varias cadenas de aminocidos, iguales o
diferentes, se unen para formar un edificio
proteico de orden superior, se disponen
segn lo que llamamos estructura
cuaternaria. Tambin se considera estructura Glcido Glcido

cuaternaria la unin de una o varias


protenas a otras molculas no proteicas
para formar edificios macromolculares
complejos. Esto es frecuente en protenas
Fig. 26 Los anticuerpos tienen estructura
con masas moleculares superiores a 50.000
cuaternaria pues estn formados por la unin,
mediante puentes disulfuro, de cuatro prot-
Cada polipptido que interviene en la meros o dominios; dos de cadena larga y dos
formacin de este complejo proteico es un de cadena corta
protmero y segn el nmero de protmeros

J. L. Snchez Guilln Pgina I-5-11


I) Biomolculas 5) Protenas

tendremos: dmeros, tetrmeros, pentmeros, etc.

La asociacin o unin de las molculas que


forman una estructura cuaternaria, se
consigue y mantiene mediante enlaces de
hidrgeno, fuerzas de Van der Waals,
interacciones electrostticas y algn que otro
puente disulfuro .

Un ejemplo de estructura cuaternaria es la


hemoglobina, formada por las globinas o
parte proteica (dos cadenas alfa y dos
cadenas beta, con un total de 146
aminocidos) ms la parte no proteica o
Fig. 27 Modelo de anticuerpo.
grupos hemo. O los anticuerpos, formados
tambin por cuatro cadenas, dos cadenas
cortas y dos largas.

PROPIEDADES DE LAS PROTENAS

Las propiedades de una protena, incluso su carga elctrica, dependen de los restos
o radicales de los aminocidos que quedan en su superficie y que podrn
interaccionar mediante enlaces covalentes o no covalentes con otras molculas. A
continuacin veremos las propiedades ms importantes:

Solubilidad. Las protenas solubles en agua, al ser macromolculas, no forman


verdaderas
disoluciones sino dispersiones coloidales. Cada macromolcula proteica queda rodeada
de molculas de agua y no contacta con otras macromolculas gemelas con lo que no
puede producirse la precipitacin.

Especificidad. La especificidad de las protenas puede entenderse de dos maneras.


Por una parte, existe una especificidad de funcin. Esto es, cada protena tiene una
funcin concreta, diferente, normalmente, de la del resto de las molculas proticas.
Esta es la razn de que tenganos tantas protenas distintas, unas 100 000. Ahora
bien, ciertas protenas que realizan funciones similares en los seres vivos, por
ejemplo: la hemoglobina de la sangre, presentan diferencias entre las distintas
especies. Estas diferencias se han producido como consecuencia del proceso evolutivo
y cada especie o incluso cada individuo, puede tener sus propias protenas
especficas. No obstante, estas diferencias se producen en ciertas regiones de la
protena llamadas sectores variables de las que no depende directamente se funcin.
Mientras que otros sectores, de los que si depende la funcin de la protena, tienen
siempre la misma secuencia de aminocidos. La especificidad de las protenas
depender por lo tanto de los sectores variables y a ellos se deben, por ejemplo, los
problemas de rechazos en los transplantes de rganos.

Por ejemplo: La insulina consta de 51 aminocidos en todos los mamferos, que


estn distribuidos en dos cadenas, de 21 y 30 aminocidos respectivamente, unidas
mediante dos enlaces disulfuro; de stos 51 aminocidos, la mayora son los mismos

J. L. Snchez Guilln Pgina I-5-12


I) Biomolculas 5) Protenas

en todas las especies, pero unos pocos (tres


de la cadena corta) varan de unas a otras. Aminocidos
Especies
A8 A9 A10 B30

Los diferentes papeles biolgicos de stas Cerdo Thr Ser Ile Ala

molculas van a depender de la forma que Hombre Thr Ser Ile Thr

Caballo Thr Gly Ile Ala


adopten en su conformacin espacial.
Carnero Ala Gly Val Ala

Pollo His Asn Thr Ala

Vaca Ala Ser Val Ala

DESNATURALIZACIN DE LAS PROTENAS

Fig. 28 Diferencias en la estructura


Las alteraciones de la concentracin, del
primaria de la insulina de diferentes
grado de acidez, de la temperatura (calor); vertebrados.
pueden provocar la desnaturalizacin de las
protenas. La desnaturalizacin es una
prdida total o parcial de los niveles de

Actividad enzimtica
estructura superiores al primario y se debe a
Temperatura ptima
la desaparicin de los enlaces dbiles tipo
puente de hidrgeno, Van der Waals, etc. y
en realidad no afecta a los enlaces
peptdicos y por tanto a la estructura
primaria. Sin embargo al alterarse su
conformacin espacial, la protena perder
su funcionalidad biolgica.
Fig. 29 Variacin de la actividad de una
En las protenas globulares, solubles en enzima con la temperatura. A partir de 451C
agua, la desnaturalizacin est acompaada la enzima se desnaturaliza, por alterarse su
de una prdida de la solubilidad y la conformacin, y al destruirse el centro activo
deja de actuar.
consiguiente precipitacin de la disolucin.

Puede existir una renaturalizacin casi


siempre, excepto cuando el agente causante
de la desnaturalizacin es el calor t
Variacin de la actividad enzimtica

(coagulacin de la leche, huevos fritos,


"permanente" del cabello, etc.).

RELACIN ENTRE LA CONFORMACIN Y


LA ACTIVIDAD DE LAS PROTENAS

tiempo
La funcin de las protenas depende de su
conformacin. Algunas protenas, particular- Fig. 30 Variacin en la actividad de una
mente las enzimas, tienen una o varias enzima medida en funcin de la cantidad de
zonas en su molcula de las que depende su substrato (ligando) transformado a 37oC. En t
se ha aumentado la temperatura hasta 70oC.
funcin llamadas: centro activo o locus. El
centro activo de la protena acta unindose
a la molcula sobre la que se va a realizar la tranformacin, molcula que llamaremos
ligando, que debe encajar en el centro activo.

El ligando y el centro activo interaccionan mediante fuerzas qumicas. Estas


interacciones se deben a que ciertos radicales de los aminocidos de la protena, que

J. L. Snchez Guilln Pgina I-5-13


I) Biomolculas 5) Protenas

estn en el centro activo de la molcula, tienen afinidad qumica por determinados


grupos funcionales presentes en el ligando. Algunas veces la unin protena-ligando
es irreversible como ocurre con las reacciones antgeno-anticuerpo. Otras veces es
perfectamente reversible.

Los aminocidos cuyos restos constituyen el centro activo pueden estar muy
distantes unos de otros en la secuencia primaria de la protena, pero que debido a
los pliegues y repliegues de la estructura terciaria, quedan localizados, espacialmente,
muy prximos unos de otros y, sobre todo, formando una especie de hueco donde
encajar el ligando.

El resto de los aminocidos de la protena Ligando o sustrato

tienen como misin mantener la forma y la


estructura que se precisa para que el centro
sustrato
activo se encuentre en la posicin correcta.
Para que una protena y un ligando se unan coenzima

o se reconozcan deben establecerse entre


enzima centro activo
ambas molculas varios puntos de interaccin
del tipo enlaces dbiles, especialmente
fuerzas de Van der Waals, puentes de
Fig. 31 Ajuste entre el ligando y el
hidrgeno, etc.
centro activo de una enzima.

La conformacin de una protena y por lo


tanto su centro activo y su funcin pueden alterarse si se producen cambios en las
estructura primaria. As, por ejemplo, en la anemia falciforme, el 6 1 aminocido de
una de las cadenas proteicas que forman la hemoglobina, el glutmico, ha sido
sustitudo por valina. Como consecuencia la hemoglobina pierde su funcionalidad y no
puede transportar convenientemente el oxgeno y los heritrocitos (glbulos rojos)
adquieren forma de hoz.

Como ya hemos visto, la conformacin puede tambin alterarse si la protena se


desnaturaliza por la accin de agentes como el calor y los cidos y las bases fuertes.
La desnaturalizacin irreversible destruye el centro activo y la prote na no puede ya
realizar su funcin.

J. L. Snchez Guilln Pgina I-5-14


II) La clula 1) Teora celular

II

FISIOLOGA CELULAR

1) ORGANIZACIN CELULAR DE LOS SERES VIVOS

TEORA CELULAR

En 1665, Robert Hooke, al observar al mi-


croscopio, muy rudimentario en aquella
poca, un fragmento de corcho, descubre
que est compuesto por una serie de estruc-
turas parecidas a las celdas de los panales
de las abejas, por lo que las llam clulas. El
posterior desarrollo de la microscopa permi-
ti que en 1838 Scheleiden y en 1839
Schwan, uno para los vegetales y el otro
para los animales, planteasen la denominada
TEORA CELULAR, que, resumidamente,
indica:

11- Todos los organismos son clulas o estn


Fig. 1 Robert Hooke.
constituidos por clulas.
21- Las unidades reproductoras,los gametos
y esporas, son tambin clulas.
31- Las clulas no se crean de nuevo, toda
clula proviene siempre de otra clula.
41- Existen seres unicelulares y seres pluri-
celulares.

En pocas palabras, segn la TEORA


CELULAR, la clula es la unidad estructural,
fisiolgica y reproductora de los seres vivos;
pues todo ser vivo est constituido por clu-
las:UNIDAD ANATMICA, su actividad es
consecuencia de la actividad de sus Fig. 2 Clulas de la corteza de Quercus
clulas:UNIDAD FISIOLGICA y se reproduce suber (alcornoque) vistas al microscopio
a travs de ellas: UNIDAD REPRODUCTORA. x300.

La TEORA CELULAR ha sido de gran importancia y supuso un gran avance en el


campo de las Biologa pues sent las bases para el estudio estructu rado y lgico de
los seres vivos.

J. L. Snchez Guilln Pgina II-1-1


II) La clula 1) Teora celular

UNICELULARES Y PLURICELULARES

Como consecuencia del cuarto punto de la


teora celular, vamos a dividir los seres
vivos en dos grandes grupos:

-Unicelulares: con una sola clula.


-Pluricelulares: con muchas clulas.

No todos los seres vivos estn constituidos


por clulas. Un claro ejemplo son los virus, a
estos organismos que no son clulas se les
conoce como acelulares.

EUCARIOTAS Y PROCARIOTAS
Fig. 3 Con este primitivo microscopio
Por su estructura se distinguen dos tipos de Antony van Leeuwenhoek (1632-1723) realiz
clulas: procariticas y eucariticas: las primeras observaciones microscpicas.

-PROCARITICAS. Muy simples y primitivas.


Apenas tienen estructuras en su interior. Se
caracterizan por no tener un ncleo propia-
mente dicho; esto es, no tienen el material
gentico envuelto en una membrana y
separado del resto del citoplasma. Adems, 1m

su ADN no est asociado a ciertas


protenas como las histonas y est for- 1m
mando un nico cromosoma. Son proca- A B
riotas, entre otras: las bacterias y las
cianof ceas.
Fig. 4 A) Clula procariota. B) Clula
-EUCARITICAS: Clulas caractersti cas del
eucariota. La primera est representada a un
resto de los organismos unicelulares y aumento mucho mayor que la segunda (ver
pluricelulares, animales y vegetales. Su escala).
estructura es ms evolucionada y compleja
que la de los procariotas. Tienen orgnulos
celulares y un ncleo verdadero separado del
citoplasma por una envoltura nuclear. Su
ADN est asociado a protenas (histonas y
otras) y estructurado en numerosos
cromosomas.

ESTRUCTURA GENERAL DE LA CLULA


EUCARITICA

En toda clula eucaritica vamos a poder


distinguir la siguiente estructura:

- Membrana plasmtica
- Citoplasma
Fig. 5 Dibujo esquemtico de una clula
- Ncleo
eucariota vista al MET (P.A.U. junio de
1999).
El aspecto de la clula es diferente segn

J. L. Snchez Guilln Pgina II-1-2


II) La clula 1) Teora celular

se observe al microscopio ptico (MO) o al electrnico (MET). Al MO observaremos


la estructura celular y al MET la ultraestructura.

DIFERENCIAS ENTRE LAS CLULAS VEGETALES Y ANIMALES

Por lo general las clulas vegetales son de mayor tamao que las animales, tienen
plastos y estn envueltas en una gruesa pared celular, tambin llamada pared
celulsica o membrana de secrecin. Sus vacuolas son de gran tamao y no tienen
centriolos.

ULTRAESTRUCTURA DE LA CLULA

CLULA VEGETAL
1 Membrana plasmtica
2 Retculo endoplasmtico granular
3 Retculo endoplasmtico liso
4 Aparato de Golgi
5 Mitocondria
6 Ncleo
7 Ribosomas
8 Cloroplasto
9 Pared celulsica
10 Vacuola

Fig. 6 Dibujo esquemtico de la ultraes-


tructura de una clula eucariota vegetal.

CLULA ANIMAL
1 Membrana plasmtica
2 Retculo endoplasmtico granular
3 Retculo endoplasmtico liso
4 Aparato de Golgi
5 Mitocondria
6 Ncleo
7 Ribosomas
8 Centrosoma (Centriolos)
9 Lisosomas
10 Microtbulos (citoesqueleto)

Fig. 7 Dibujo esquemtico de la ultraes-


tructura de una clula eucariota animal.

J. L. Snchez Guilln Pgina II-1-3


II) La clula 1) Teora celular

BREVE DESCRIPCIN DE LA ESTRUCTURA Y


FUNCIN DE LOS ORGNULOS CELULARES

MEMBRANA

Membrana plasmtica: Delgada lmina que recubre la clula. Est formada por lpidos,
protenas y oligosacridos. Regula los intercambios entre la clula y el exterior.

Pared celular: Gruesa capa que recubre las clulas vegetales. Est formada por celulosa y otras
sustancias. Su funcin es la de proteger la clula vegetal de las alteraciones de la presin
osmtica.

CITOPLASMA

Hialoplasma: Es el citoplasma desprovisto de los orgnulos. Se trata de un medio de reaccin


en el que se realizan importantes reacciones celulares, por ejemplo: la sntesis de protenas y
la glicolisis. Contiene los microtbulos y microfilamentos que forman el esqueleto celular.

Retculo endoplasmtico: Red de membranas intracitoplasmtica que separan compartimentos en


el citoplasma. Hay dos clases: granular y liso. Sus funciones son: sntesis de oligosacridos y
maduracin y transporte de glicoprotenas y protenas de membrana.

Ribosomas: Pequeos grnulos presentes en el citoplasma, tambin adheridos al retculo


endoplasmtico granular. Intervienen en los procesos de sntesis de protenas en el hialoplas-
ma.

Aparato de Golgi: Sistema de membranas similar, en cierto modo, al retculo pero sin
ribosomas. Sirve para sintetizar, transportar y empaquetar determinadas sustancias elaboradas
por la clula y destinadas a ser almacenadas o a la exportacin.

Lisosomas: Vesculas que contienen enzimas digestivas. Intervienen en los procesos de


degradacin de sustancias.

Vacuolas: Estructuras en forma de grandes vesculas. Almacenamiento de sustancias.

Mitocondrias: En ellas se extrae la energa qumica contenida en las sustancias orgnicas


(ciclo de Krebs y cadena respiratoria).

Centrosoma: Interviene en los procesos de divisin celular y en el movimiento celular por cilios
y flagelos.

Plastos: Orgnulos caractersticos de las clulas vegetales. En los cloroplastos se realiza la


fotosntesis.

NCLEO

Contiene la informacin celular.

Nucleoplasma: En l se realizan las funciones de replicacin y transcripcin de la informacin


celular. Esto es, la sntesis de ADN y ARN.

Nucleolo: Sntesis del ARN de los ribosomas.

Envoltura nuclear: Por sus poros se realizan los intercambios de sustancias entre el ncleo y el
hialoplasma.

J. L. Snchez Guilln Pgina II-1-4


II) La clula 2) Membranas

II-2A) LAS MEMBRANAS BIOLGICAS.

LA MEMBRANA UNITARIA

Muchas estructuras de la clula estn formadas por membranas. Las membranas


biolgicas constituyen fronteras que permiten no slo separar sino tambin poner en
comunicacin diferentes compartimentos en el interior de la clula y a la propia clula
con el exterior.

La estructura de todas las membranas


biolgicas es muy parecida. Las diferencias
se establecen ms bien al nivel de la fun-
cin particular que tienen los distintos
orgnulos formados por membranas; funcin
que va a depender de la composicin que
tengan sus membranas. Este tipo de mem-
branas se denomina, debido a esto, unidad
de membrana o membrana unitaria. La
membrana plasmtica de la clula y la de los
orgnulos celulares est formada por Fig. 1 Membrana celular vista a gran
membranas unitarias. aumento al microscopio electrnico. Se
destacan dos capas oscuras y una intermedia
clara.
ORGNULOS Y OTRAS ESTRUCTURAS
FORMADOS POR MEMBRANAS UNITARIAS

- Membrana plasmtica
- Retculo endoplasmtico granular y liso
- Aparato de Golgi
- Lisosomas
- Peroxisomas
- Mitocondrias
- Plastos
- Vacuolas
- Envoltura nuclear

CARCTER ANFIPTICO DE LOS LPIDOS. Fig. 2 Sistemas de membranas celulares.

Ciertos lpidos, y en particular los fosfolpi -


dos, tienen una parte de la molcula que es Parte hidrfila

polar: hidrfila y otra (la correspondiente a Fosfolpido


Parte hidrfoba
las cadenas hidrocarbonadas de los cidos
grasos) que es no polar: hidrfoba. Las
molculas que presentan estas caractersticas
reciben el nombre de anfipticas. A partir de
Fosfolpidos
ahora representaremos la parte polar (hidr-
fila) y la no polar (hidrfoba) de los lpidos
anfipticos como se indica en la figura 3. agua

Fig. 3 Monocapa de lpidos anfipticos


(fosfolpidos, por ejemplo) en agua.

J. L. Snchez Guilln Pgina II-2-1


II) La clula 2) Membranas

FORMACIN DE BICAPAS LIPDICAS


agua
Si se dispersa por una superficie acuosa
una pequea cantidad de un lpido
anfiptico, se puede formar una capa de una
molcula de espesor: monocapa. Esto es bicapa
debido a que las partes hidrfilas se dispo- lipdica
nen hacia el interior y los grupos hidrfobos
hacia el exterior de la superficie acuosa.
Pueden tambin formarse bicapas, en particu- agua
lar entre dos compartimentos acuosos.
Entonces, las partes hidrfobas se disponen
Fig. 4 Bicapa lipdica.
enfrentadas y las partes hidrfilas se colocan
hacia la solucin acuosa. Los lpidos
anfipticos forman este tipo de estructuras
espontneamente. Las bicapas pueden formar
compartimentos cerrados denominados
liposomas. Las bicapas lipdicas poseen
caractersticas similares a las de las mem-
branas celulares: son permeables al agua
pero impermeables a los cationes y aniones
y a las grandes molculas polares. En reali-
dad, las membranas celulares son,
esencialmente, bicapas lipdi cas. Fig. 5 Estructura de una membrana
biolgica. 1) Protena integral; 2) protenas
perifricas; 3) Doble capa lipdica.
ESTRUCTURA EN MOSAICO DE LAS
MEMBRANAS BIOLGICAS

Las membranas biolgicas estn constituidas por una doble capa de fosfolpidos con
prote nas. Las protenas se pueden encontrar adosadas a la membrana pero sin
penetrar en la doble capa lipdica: protenas perifricas, o empotradas: prote nas
integrales. Las protenas forman as una especie de mosaico (estructura en mosaico).
Las partes hidrfilas de las prote nas integrales quedan hacia el interior o hacia el
exterior de la capa lipdica y las partes lipfilas (hidrfobas) se sitan en su seno.
Las prote nas integrales atraviesan completamente la membrana.

CARACTERSTICAS DE LAS MEMBRANAS BIOLGICAS

Las molculas que constituyen las membra-


nas se encuentran libres entre s pudiendo
desplazarse en el seno de ella, girar o inclu- 4
4

so rotar, aunque esto ltimo ms raramente.


La membrana mantiene su estructura por 3
uniones muy dbiles: Fuerzas de Van der 1
Waals e interacciones hidrofbicas. Esto le 2

da a la membrana su caracters tica fluidez. 3

Todos estos movimientos se realizan sin


consumo de energa. Los lpidos pueden
presentar una mayor o menor movilidad en Fig. 6 Membrana plasmtica. 1) Doble
funcin de factores internos: cantidad de capa lipdica; 2) protena integral
colesterol o de cidos grasos insaturados, o transmembranar; 3) protena perifrica; 4)
externos: temperatura, composicin de oligosacridos del glicoclix
molculas en el exterior, etc. As, una
mayor cantidad de cidos grasos insaturados

J. L. Snchez Guilln Pgina II-2-2


II) La clula 2) Membranas

o de cadena corta hace que la membrana sea ms fluida y sus componentes tengan
una mayor movilidad; una mayor temperatura hace tambin que la membrana sea ms
fluida. Por el contrario, el colesterol endurece la membrana y le da una mayor
estabilidad y por lo tanto una menor fluidez.

Otra caracterstica de las membranas biolgicas es su asimetra , debida a la


presencia de protenas distintas en ambas caras. Por lo tanto, las dos caras de la
membrana realizarn funciones diferentes. Estas diferencias son de gran importancia a
la hora de interpretar correctamente las funciones de las estructuras constituidas por
membrana.

J. L. Snchez Guilln Pgina II-2-3


II) La clula 2) Membranas

II-2B) FLUJO DE SUSTANCIAS ENTRE LA CLULA Y EL EXTERIOR

LA MEMBRANA PLASMTICA. CONCEPTO

Es una fina membrana que limita y relaciona el interior de la clula, el protoplasma,


con el exterior. Como toda membrana biolgica est constituida sobre todo por
lpidos y prote nas. En la membrana plasmtica encontramos muchas protenas
diferentes, hasta 50 clases diferentes. Tambin hay oligosacridos asociados a las
protenas y a los lpi dos.

ESTRUCTURA EN MOSAICO FLUIDO DE LA MEMBRANA PLASMTICA

La membrana plasmtica es extraordinaria-


mente delgada, teniendo un espesor medio 4

de aproximadamente 10 nm (100 ), por lo 2

que slo se ve con el microscopio 3

electrnico.
1
5
La estructura de la membrana plasmtica es 6

la misma que la de cualquier membrana


biolgica. Est formada por una doble capa
lipdica con protenas integrales y perifricas
que se encuentran dispuestas formando una Fig. 7 Esquema tridimensional de la
estructu ra en mosaico fluido. En su cara membrana plasmtica. 1) Doble capa
lipdica. 2) Oligosacricos del glicoclix; 3)
externa presenta una estructura fibrosa, que protena integral; 4) glicoprotena; 5)
no se encuentra en las membranas de los microtbulo; 6) microfilamento.
orgnulos celulares: el glicoclix, constituido
por oligosacridos. Los oligosacridos del glicoclix estn unidos tanto a los lpidos,
glicolpidos, como a las protenas, glicoprotenas. En la cara interna las protenas
estn asociadas a microtbulos, a microfilamentos y a otras protenas con funcin
esqueltica.

MECANISMOS DE FUSIN DE MEMBRANAS

La fluidez de los componentes de la mem-


brana plasmtica permite su crecimiento por
fusin con membranas provenientes de otros
orgnulos celulares, como las llamadas
vesculas de exocitosis. stas van a poder
fusionarse con la membrana. De esta manera
las sustancias que puedan contener las
vesculas pasan al exterior y al mismo
tiempo los componentes de la membrana de Fig. 8 Fusin de membranas.
la vescu la se integran en la membrana
plasmtica hacindola crecer.

J. L. Snchez Guilln Pgina II-2-4


II) La clula 2) Membranas

DIFERENCIACIONES DE LA MEMBRANA PLASMTICA

La membrana plasmtica puede tener las siguientes diferenciaciones morfolgicas:

MICROVELLOSIDADES. Las clulas que por


su funcin requieren una gran superficie,
por ejemplo, las que realizan la absorcin
de los nutrientes en el tubo digestivo,
tienen una membrana con una gran canti-
dad de repliegues que reciben el nombre
de microvellosidades.

DESMOSOMAS. Se dan en clulas que


necesitan estar fuertemente soldadas con
sus vecinas; por ejemplo: las clulas de la
epidermis de las mucosas. En ellas, el Fig. 9 1) Microvellosidades; 2)
espacio intercelular se ampla en la zona Desmosomas.
de los desmosomas y por la parte interna
de ambas membranas se dispone una sustancia densa asociada a finos filamentos
(tonofilamentos), lo que da a estas uniones una gran solidez.

UNIONES IMPERMEABLES. Se dan entre clulas que forman barreras que impiden el
paso de sustancias, incluso del agua. En ellas, el espacio intercelular desaparece y
las membranas de ambas clulas se sueldan.

FUNCIONES DE LA MEMBRANA PLASMTICA

INTERCAMBIOS. La membrana es, bsicamente, una barrera selectiva


(permeabilidad selectiva). Limita a la clula e impide el paso de sustancias, no de
todas, pero s de muchas, tanto del exterior al interior como en sentido inverso.
No obstante, y a pesar de esta funcin limitante, la clula va a necesitar intercam-
bios constantes con el medio que la rodea. Necesita sustancias nutritivas y tiene
que eliminar productos de desecho, que sern transportados a travs de la mem-
brana y por la propia membrana. La membrana es un elemento activo que
"escoge" lo que entrar o saldr de la clula.

RECEPTORA. Algunas protenas de la membrana plasmtica van a tener esta


funcin, por ejemplo: receptoras de sustancias hormonales. Muchas hormonas regu-
lan la actividad de la clula fijndose en determinados puntos de protenas
receptoras espec ficas. La protena receptora va a liberar en el interior de la clula
una molcula orgnica: el mediador hormonal. Esta sustancia va a actuar regulando
ciertos aspectos del metabolismo celular, por ejemplo, activando determinadas enzi-
mas o desencadenando la activacin de determinados genes. Al existir diferentes
prote nas receptoras en la membrana celular y al tener las clulas diferentes
receptores, la actividad de cada clula ser diferente segn sean las hormonas
presentes en el medio celular.

RECONOCIMIENTO. Se debe a las glicoprotenas de la cara externa de la


membrana. As, las clulas del sistema inmunolgico, clulas que nos defienden de
los agentes patgenos, van a reconocer las clulas que son del propio organismo
diferencindolas de las extraas a l por las glicoprotenas de la membrana. Estas
sustancias constitu yen un verdadero cdigo de identidad.

J. L. Snchez Guilln Pgina II-2-5


II) La clula 2) Membranas

DIFUSIN

Es el fenmeno por el cual las part culas


de un soluto se distribuyen uniformemente
en un disolvente de tal forma que en
cualquier punto de la disolucin se alcanza
la misma concentracin. As, si ponemos
un grano de azcar en un recipiente que
contenga 1 litro de agua destilada y
esperamos el tiempo suficiente, el azcar
se disolver y en cualquier parte de la
Fig. 10 Difusin de un soluto (glucosa) en
disolucin un volumen dado de sta
el seno de un disolvente (agua).
contendr la misma cantidad de molculas
que cualquier otro. Esto es debido a que
las molculas del soluto se comportan, en cierto modo, como las de un gas
encerrado en un recipiente desplazndose en todas las direcciones.

CLASES DE MEMBRANAS

En los medios orgnicos la difusin est


dificultada por la existencia de membranas.
Las clulas estn separadas del medio inter-
celular y de las otras clulas por la
membrana plasmtica y determinados
orgnulos celulares estn tambin separados
del hialoplasma por membranas biolgicas.

En general, las membranas pueden ser:


permeables, impermeables y semi- Fig. 11 Clases de membranas.
permeables. Las membranas permeables
permiten el paso del soluto y del disolven-
te, las impermeables impiden el paso de ambos y las semipermeables permiten pasar
el disolvente pero impiden el paso de determinados solutos. Esto ltimo puede ser
debido a diferentes causas. As, por ejemplo, muchas membranas tienen pequeos
poros que permiten el paso de las pequeas molculas y no de las que son
mayores; otras, debido a su composicin, permiten el paso de las sustancias hidrfi-
las y no de las lipfilas, o a la inversa.

LA PERMEABILIDAD SELECTIVA

Las membranas biolgicas se comportan en cierto modo como membranas


semipermeables y van a permitir el paso de pequeas molculas, tanto las no polares
como las polares. Las primeras se disuelven en la membrana y la atraviesan
fcilmente. Las segundas, si son menores de 100 u tambin pueden atravesarla. Por
el contrario, las molculas voluminosas o las fuertemente cargadas, iones, quedarn
retenidas. La membrana plasmtica es permeable al agua y a las sustancias
lipdicas. No obstante, como veremos ms adelante, determinados mecanismos van
a permitir que atraviesen la membrana algunas molculas que por su composicin o
tamao no podran hacerlo. Esto es, las membranas biolgicas tienen permeabilidad
selectiva. De este modo la clula asegura un medio interno diferente del exterior.

J. L. Snchez Guilln Pgina II-2-6


II) La clula 2) Membranas

SMOSIS

Si a ambos lados de una membrana semipermeable se ponen dos disoluciones de


concentracin diferente el agua pasa desde la ms diluida a la ms concentrada. Este
proceso se denomina smosis y la presin necesaria para contrarrestar el paso del
agua se llama presin osmtica.

La smosis se debe a que la membrana semipermeable impide el paso del soluto del
medio ms concentrado al menos concentrado, pero si puede pasar el disolvente, el
agua, en la mayora de los casos, en sentido inverso. Si se trata de un
compartimento cerrado, este aumento de la
cantidad de disolvente a un lado de la
membrana semipermeable es el responsable
de la presin osmtica.

Al medio que tiene una mayor


concentracin en partcu las que no pueden
atravesar la membrana (soluto), se le deno-
Fig. 12 smosis a travs de una
mina hipertnico, mientras que al menos
membrana semipermeable. La sustancia
concentrado en solutos se le llama representada por los crculos mayores no
hipotnico. Si dos disoluciones ejercen la puede pasar a travs de los poros de la
misma presin osmtica, por tener la misma membrana.
concentracin de partculas que no se
pueden difundir a ambos lados de la
membrana semipermeable, diremos que son
isotnicas. Es de destacar que podemos
tener dos disoluciones diferentes a ambos
lados de una membrana semipermeable y, sin
embargo, ambas ser isotnicas entre s.
As, por ejemplo, si a un lado de una
membrana semipermeable tenemos una
disolucin 0,1 molal de glucosa y al otro
lado una disolucin 0,1 molal de fructo sa,
ambas disoluciones son diferentes, pero Fig. 13 a) Turgescencia y b) plasmolisis
como tienen el mismo nmero de partcu las de una clula vegetal normal (c).
de soluto por unidad de volumen, ambas
ejercern la misma presin osmtica.

LAS CLULAS Y LA PRESIN OSMTICA

El interior de la clula es una compleja


disolucin que, normalmente, difiere del
medio extracelular. La membrana de la clula,
membrana plasmtica, se comporta como Fig. 14 a) Plasmolisis y c) turgescencia de
un glbulo rojo normal (b).
una membrana semipermeable.

Cuando una clula se encuentra en un medio hipertnico, el hialoplasma y el interior


de los orgnulos formados por membranas, por ejemplo: las vacuolas de las clulas

J. L. Snchez Guilln Pgina II-2-7


II) La clula 2) Membranas

vegetales, pierden agua, producindose la plasmolisis del contenido celular. Por el con-
trario, si la clula se introduce en una disolucin hipotnica se producir una penetra-
cin del disolvente y la clula se hinchar: turgencia o turgescencia. En las clulas
vegetales la turgencia no suele presentar un grave problema pues estn protegidas
por una gruesa pared celular. En las clulas animales la turgencia puede acarrear la
rotura de la membrana plasmtica. As, los glbulos rojos introducidos en agua
destilada primero se hinchan y despus explotan (hemolisis) liberando el contenido ce-
lular1 .

TRANSPORTE DE SUSTANCIAS A TRAVS DE LA MEMBRANA PLASMTICA

La clula necesita sustancias para su metabolismo. Como consecuencia de ste se


van a producir sustancias de desecho que la clula precisa eliminar. As pues, a
travs de la membrana plasmtica se va a dar un continuo transporte de sustancias
en ambos sentidos. Segn la direccin de este y el tipo de sustancia tendremos:

- Ingestin:Es la entrada en la clula de aquellas sustancias necesarias para su


metabolismo.

- Excrecin: Salida de los productos de desecho.

- Secrecin: Si lo que sale no son productos de desecho sino sustancias


destinadas a la exportacin.

Aunque vamos a referirnos nicamente al transporte a travs de la membrana


plasmtica, deber tenerse en cuenta que los fenmenos de transporte que estudiare-
mos a continuacin se dan tambin a travs de las membranas biolgicas de los
orgnulos formados por membranas: retculo, aparato de Golgi, lisosomas, vacuolas,
mitocondrias y plastos.
Mediante estos fenmenos la clula asegura un medio interno diferente y funciones
distintas en cada uno de los orgnulos formados por membranas.

1
Curiosidades: La presin osmtica de nuestras clulas est entre 7 y 8 atm, que se corresponde
con la que ejercera una disolucin conteniendo 9,596 g/l de NaCl. En nuestro organismo existe un
rgano especializado en regular la presin osmtica, se trata del rin. Su misin, entre otras, es la de
extraer agua y sales del plasma sanguneo para mantener estable la concentracin de solutos y por lo
tanto la presin osmtica. La presin osmtica interviene en muchos otros procesos biolgicos; por ejem-
plo en los que determinan la absorcin y transporte de la savia en los vegetales o en el movimiento en
ciertos animales.

Ciertos organismos unicelulares de las aguas dulces, por ejemplo, el paramecio, al vivir en agua dulce,
su citoplasma es hipertnico con respecto al exterior, por lo que se produce una entrada continua de
agua. No obstante disponen de ciertos orgnulos, las vacuolas pulstiles, que extraen el agua del cito-
plasma y la expulsan al exterior.

J. L. Snchez Guilln Pgina II-2-8


II) La clula 2) Membranas

A) EL TRANSPORTE DE SUSTANCIAS EN
FORMA MOLECULAR A TRAVS DE LAS
MEMBRANAS
Ext.

En el caso de sustancias disueltas, segn 1 2 3

se consuma o no energa, distinguiremos los


Int.
siguientes tipos de transporte: ATP ADP

I) Transporte pasivo. Se trata de un


transporte a favor del gradiente de Fig. 15 1 y 2) Transporte pasivo. 3)
concentracin, por lo que no requiere un Transporte activo.
aporte de energa. Puede ser:
2

a) Transporte pasivo simple o difusin de 2


2
2
molculas a favor del gradiente. Ext. 2 2 2
2
a) Difusin a travs de la bicapa 2 2 2

lipdica. Pasan as sustancias


lipdicas como las hormonas 2
2
esteroideas, los frmacos liposolubles Int. 2
2

2
y los anestsicos, como el ter.
Tambin sustancias apolares como el
oxgeno y el nitrgeno atmosfrico y Fig. 16 Transporte pasivo simple de iones
algunas molculas polares muy a travs de una protena canal. 1) glucosa;
2) in sodio.
pequeas como el agua, el CO2 , el
etanol y la glicerina.
Medio ms
b) Difusin a travs de canales glucosa concentrado

proticos. Se realiza a travs de


protenas canal. Protenas que
forman canales acuosos en la doble
capa lipdica. Pasan as ciertos
iones, como el Na+ , el K+ y el Ca+ + .

b) Transporte pasivo facilitado (difusin naveta

facilitada). Las molculas hidrfilas (glcidos, Medio menos concentrado

aminocidos...) no pueden atravesar la doble


Fig. 17 Transporte pasivo facilitado de
capa lipdica por difusin a favor del molculas de glucosa a travs de permeasas.
gradiente de concentracin. Determinadas
protenas de la membrana, llamadas Medio menos concentrado

permeasas, actan como "barcas" para que


estas sustancias puedan salvar el obstculo
que supone la doble capa lipdi ca. Este tipo
de transporte tampoco requiere un consumo
de energa, pues se realiza a favor del gra- E

diente de concentracin.

II) Transporte activo: Cuando el transporte Medio ms concentrado

se realiza en contra de un gradiente qumi co


(de concentracin) o elctrico (ver nota 1). Fig. 18 Transporte activo. La molcula
Para este tipo de transporte se precisan pasa del medio menos concentrado al ms
concentrado con gasto de energa(E).
transportadores especfi cos instalados en la

J. L. Snchez Guilln Pgina II-2-9


II) La clula 2) Membranas

membrana, siempre prote nas, que, mediante


receptor sustancia
un gasto de energa en forma de ATP, membrana

transportan sustancias a travs de sta. Con


este tipo de transporte pueden transportarse,
adems de pequeas part culas, molculas
orgnicas de mayor tamao, siempre en
clatrinas

contra del gradiente de concentracin o Vescula de endocitosis

elctrico.
Fig. 19 La endocitosis mediada por
receptor implica la presencia en la membrana
Nota 1 : Puede darse el caso de que el interior y el exterior de la
de receptores especficos de la sustancia que
clula sean isotnicos pero que exista una diferencia en el va a ser ingerida.
potencial elctrico que impida el paso de los iones. As, por
ejemplo, entre el interior y el exterior de la neurona hay una
diferencia de potencial de -70 mV, estando el interior cargado
negativamente respecto al exterior. En este caso, los iones
positivos tendrn dificultades para salir de la clula, incluso si
esta salida se realiza a favor de la presin osmtica.

B) TRANSPORTE CITOQU MICO Permite la


entrada o la salida de la clula de partculas
o grandes molculas envueltas en una mem-
brana. Se trata de un mecanismo que slo
Fig. 20 Ameba.
es utilizado por algunos tipos de clulas, por
ejemplo: amebas, macrfagos o las clulas
del epitelio intestinal.
1 4
2 3

I) ENDOCITOSIS. Las sustancias entran en la


clula envueltas en vesculas formadas a A B C

partir de la membrana plasmtica.


Fig. 21 A, B y C) Ameba fagocitando
Cuando lo que entra en la clula son part - bacterias. 1) Seudpodo. 2) Bacteria. 3)
Vacuola digestiva. 4) Ncleo.
culas slidas o pequeas gotitas lquidas el
transporte se realiza por mecanismos espe-
ciales e incluso se hace perceptible. Estos
mecanismos implican una deformacin de la
membrana y la formacin de vacuolas. Este
tipo de transporte puede ser de gran
importancia en ciertas clulas, como por
ejemplo, en los macrfagos y en las
amebas. Distinguiremos dos tipos de endo-
citosis: la fagocitosis y la pinocitosis

a) Fagocitosis: Es la ingestin de grandes


part culas slidas (bacterias, restos celu-
lares) por medio de seudpodos. Los seu-
dpodos son grandes evaginaciones de la Fig. 22 Pinocitosis.
membrana plasmtica que envuelven a la
part cula. sta pasa al citoplasma de la clula

J. L. Snchez Guilln Pgina II-2-10


II) La clula 2) Membranas

en forma de vacuola fagoctica. Este tipo de ingestin la encontramos, por ejemplo,


en las amebas o en los macrfagos.

b) Pinocitosis. Es la ingestin de sustancias disueltas en forma de pequeas gotitas


lqui das que atraviesan la membrana al invaginarse sta. Se forman as pequeas
vacuolas llamadas vacuolas pinocticas que pueden reunirse formando vacuolas de
mayor tamao.

II) EXOCITOSIS: Consiste en la secrecin o


excrecin de sustancias por medio de vacuo-
las, vesculas de exocitosis, que se fusionan
con la membrana plasmtica abrindose al
exterior y expulsando su contenido. Las
vacuolas provienen de los sistemas de
membranas o de la endocitosis. La mem-
brana de la vacuola queda incluida en la
membrana celular, lo que es normal teniendo
en cuenta que ambas membranas poseen la
misma estructura.

En todos los mecanismos de endocitosis


hay una disminucin de la membrana
plasmtica al introducirse sta en el
citoplasma. Esta disminucin es compensada
por la formacin de membranas por exocito-
Fig. 23 Exocitosis: Secrecin de moco en
sis. La membrana plasmtica est en estas
una clula mucosa de la pared intestinal.
clulas en un continuo proceso de
renovacin. En un macrfago, por ejemplo,
toda su membrana es ingerida en 30 min.

J. L. Snchez Guilln Pgina II-2-11


II) La clula 3) Hialoplasma

3) EL MEDIO INTERNO CELULAR

EL HIALOPLASMA

Si retiramos los orgnulos del citoplasma


obtendremos una disolucin constituida por
agua, sales minerales y molculas orgnicas,
protenas, fundamentalmente. Esta disolucin
es el hialoplasma. Entre las protenas, unas Fig. 1 Ameba. Los cambios sol-gel en el
hialoplasma estn relacionados con el
son enzimticas y otras estructurales. Estas movimiento ameboide.
ltimas forman el citoesqueleto.

En el hialoplasma se van a realizar gran


cantidad de procesos qumicos: la sntesis
de prote nas, la glucolisis y las primeras
fases de la degradacin de las grasas y de
algunos aminocidos. El hialoplasma es un
medio de reaccin.
Estado de sol Estado de gel

El hialoplasma, al tener grandes molculas,


va a sufrir transformaciones en el estado
Fig. 2 Estados de sol y gel.
sol-gel. Estas transformaciones darn lugar al
movimiento ameboide y a los fenmenos de
ciclosis.

EL CITOESQUELETO

Es un verdadero armazn interno celular.


Est constituido por unos finos tubos: los
microtbulos. El citoesqueleto es el respon-
sable de la forma de la clula y del
movimiento celular.
Fig. 3 1) Membrana plasmtica. 2)
Microtbulo. 3) Mitocondria. 4) Microtrabcula.
Los microtbulos son pequeos cilindros 5) Retculo endoplasmtico granular. 6)
huecos. Estn unidos a la membrana celular Ribosomas.
a los orgnulos y a la envoltura nuclear,
formando una compleja red bajo la membra-
na plasmtica y alrededor del ncleo celular.
Los microtbulos se forman a partir de unas
protenas globulares denominadas tubulinas.

En el hialoplasma vamos a encontrar


tambin otros tipos de estructuras filamento-
sas.
Fig. 4 Microfotografa en la que se
observan dos microtbulos.

J. L. Snchez Guilln Pgina II-3-1


II) La clula 3) Hialoplasma

FUNCIONES DEL CITOESQUELETO

Los microtbulos juegan un papel de gran Tubulina

importancia en el movimiento celular. La


capacidad de estas estructuras para formarse Tubulina

y destruirse (polimerizarse y despolimerizarse)


con gran rapidez es la responsable de
fenmenos tales como la variacin de la
forma celular o los movimientos celulares
tanto intra como extracitoplasmticos.
Fig. 5 Ultraestructura de un microtbulo.

A) Movimientos intracelulares de los orgnu-


los. Los microtbulos pueden constituir un
soporte sobre el que los orgnulos (mitocon-
drias, plastos, vescu las, cromosomas, etc.)
van a poder desplazarse por el interior del
citoplasma.

B) Movimientos extracelulares. Cilios y flage- Espermatozoide


Ciliado

los son prolongaciones citoplasmticas que


aseguran los movimientos de la clula o de
Fig. 6 1) Ciliado; 2) flagelado.
los fluidos alrededor de sta. Estas
estructuras reciben el nombre de orgnulos
vibrtiles de la clula. Ambos tienen la mis-
ma estructura, pero los cilios son cortos y
numerosos, mientras los flagelos son largos
y poco numerosos. Los vamos a encontrar
en organismos unicelulares y pluricelulares,
tanto animales como vegetales. As, el inte-
rior de nuestros rganos respiratorios se
encuentra recubierto por clulas con cilios
que forman el epitelio vibrtil o ciliado, y lo Fig. 7 Esquema del corte transversal de un
cilio o de un flagelo: a) Pares de
mismo ocurre en las trompas de Falopio del
microtbulos; b) membrana c) Microtbulos
aparato genital femenino. Tienen flagelos centrales.
muchos organismos unicelulares, la mayora
de los gametos masculinos de los animales
y muchos de los vegetales (algas, musgos,
helechos).

Si hacemos un corte transversal a un flage-


lo o a un cilio y lo observamos a gran
aumento al MET, veremos que presenta 9
pares de microtbulos. En el interior se en-
cuentran dos microtbulos centrales y todo
ello est rodeado por la membrana. En la
base de cada cilio o flagelo hay una Fig. 8 El centrosoma en una clula animal.
1) Aparato de Golgi; 2) ribosomas; 3) ncleo;
estructura denominada corpsculo basal. Los
4) nucleolo; 5 envoltura nuclear; 6)
corpsculos basales tienen una estructura centrosoma; 7) R.E.G; 8) mitocondria;
similar, en cierto modo, a la de los centrio- (examen de P.A.U. de sept. 1998).
los.

J. L. Snchez Guilln Pgina II-3-2


II) La clula 3) Hialoplasma

ster

Dato: Los microtbulos de cilios y flagelos


se deslizan unos sobre otros rpidamente,
batiendo a un ritmo de 500 a 1000 veces
por minuto.

centrolo
EL CENTROSOMA
Fig. 9 Esquema del centrosoma de una
Se trata de un centro organizador de micro- clula animal.
tbulos. Se encuentra tanto en las clulas
animales como en las vegetales. En las
clulas animales encontramos adems unas
estructu ras denominadas centriolos que no
se encuentran en las clulas vegetales.

Los centriolos son elementos permanentes


de la clula animal. Vistos al microscopio
electrnico de transmisin (MET) tienen
forma de barril. Son dos estructuras
cilndricas de 0.5 m situadas perpendicu- Fig. 10 Microfotografa de una pareja de
larmente una a la otra. Estn constituidos centrolos.
por 9 tripletas de cortos microtbulos que
se disponen paralelamente unos a otros
formando una hlice.

El centrosoma es muy importante en los


procesos de divisin celular. En la divisin
celular a partir del centrosoma se originar
una estructura llamada huso acromtico
responsable del desplazamiento de los cro-
mosomas a polos opuestos de la clula.
Fig. 11 Ultraestructura del corte
transversal de un centrolo.

centrosoma

Huso acromtico

Cromosomas
(cromtida)

centriolos

Fig. 12 Clula en divisin.

J. L. Snchez Guilln Pgina II-3-3


II) La clula 4) Sis. de membranas

4) SISTEMAS DE MEMBRANAS DEL CITOPLASMA

El citoplasma se encuentra compartimentado


por un complejo sistema de estructuras
formadas por membranas biolgicas relacio-
nadas entre s tanto fsicamente como por
la funcin que realizan, por lo que las
estudiaremos conjuntamente.

Estos orgnulos son:

- Retculo endoplasmtico granular (REG)


- Retculo endoplasmtico liso (REL)
Fig. 1 Esquema de una clula visto al
- Aparato de Golgi (AG) M.E.T. en el que se observan diferentes
- Lisosomas y peroxisomas estructuras constitudas por membranas.
- Vacuolas (P.A.U. de septiembre de 1997).

RETCULO ENDOPLASMTICO (RE)

Es un complejo sistema de tubos, sacos y


cisternas constituidos por membranas biolgi-
cas y que pueden ocupar una gran parte de
la clula.

Existen dos tipos de retculo endoplas-


mtico: el retculo endoplasmtico liso (REL)
y el retculo endoplasmtico rugoso o
granular (REG). En el REG se observan adhe-
ridos a las membranas unos grnulos: los Fig. 2 Elementos del retculo
ribosomas. En el REL no existen stos endoplasmtico.
grnulos y sus estructuras tienen formas
ms tubulares. Tambin se diferencian en la
funcin.

Las estructuras que forman el retculo


endoplasmtico granular se disponen general-
mente en capas concntricas paralelas al
ncleo celular (como las hojas del bulbo de
una cebolla). Es de destacar que la envoltura
nuclear es en realidad una estructura
derivada del retcu lo endoplasmtico.

El retcu lo endoplasmtico granular (REG)


est muy desarrollado en las clulas que por
su funcin deben de realizar una activa labor
Fig. 3 Microfotografa al microscopio
de snte sis, como es el caso de las clulas electrnico de elementos del retculo
del pncreas y las clulas hepticas. Si un endoplasmtico granular.
animal es sometido a un ayuno prolongado,
el REG de sus clulas pancreticas se reduce

J. L. Snchez Guilln Pgina II-4-1


II) La clula 4) Sis. de membranas

considerablemente. Por el contrario, si se le


suministra una rica dieta alimenticia, el REG
se recupera. Esta recuperacin se realiza a
partir de zonas prximas a la envoltura
nuclear.

RIBOSOMAS

Son pequeos orgnulos invisibles al mi-


croscopio ptico y poco visibles al electr- Fig. 4 Ribosomas y polirribosomas.
nico, no pudindose casi ni adivinar su
estructu ra. Invaden en gran nmero el
citoplasma y pueden estar libres o adheridos
a las membranas del retculo endoplasmtico
1
granular. Los que estn adheridos al REG
intervienen en la sntesis de las protenas
de las membranas o de aquellas destinadas
2
al exterior. Los ribosomas estn constituidos 3
bsicamente por prote nas y ARN-r (40% de
protenas y 60% de ARN ribosomal).
Fig. 5 Ultraestructura del ribosoma. 1)
Subunidad menor (40S). 2) Subunidad mayor
Estn formados por dos subunidades: la (60S). 3)Ribosoma completo (80S).
subunidad mayor y la subunidad menor. En
el citoplasma ambas estn separadas pero
pueden volver a unirse en el momento de la
sntesis de prote nas.

EL APARATO DE GOLGI (AG)

Est formado por unos conjuntos de sacos


concntricos muy apretados, mucho ms
concentrados y de menor tamao que los
del retculo endoplasmtico granular y sin Fig. 6 Dictiosoma del aparato de Golgi.
ribosomas. Cada conjunto de sacos es un
dictiosoma. El nmero de dictiosomas por
clula vara entre 5 6 a algunas decenas,
en funcin del tipo de clula y de su estado
funcional. Todos ellos se encuentran
relacionados fsica y funcionalmente.

Los dictiosomas presentan dos caras: una


convexa, la cara de formacin, y otra
cncava, la cara de maduracin. De esta
ltima se van desprendiendo pequeas
vacuolas que se independizan y que reciben Fig. 7 Esquema de un dictiosoma del
el nombre de vesculas de secrecin. aparato de Golgi. 1) Vesculas de secrecin.
2) Sculos. 3) Vesculas de transicin. 4)
Retculo endoplasmtico granular.
El AG se encuentra en permanente trans-

J. L. Snchez Guilln Pgina II-4-2


II) La clula 4) Sis. de membranas

formacin. Sus sculos se forman de manera


continua por su cara de formacin a partir
de vescu las que se desprenden del REG y
se desintegran por la cara de maduracin
para formar las vescu las de secrecin.

El aparato de Golgi se encuentra muy desa-


rrollado en las clulas que realizan funciones
de secrecin, como las clulas secretoras de
mucus del epitelio intestinal.

Los dictiosomas son el sistema de empa-


quetamiento de ciertas sustancias
qumicas, sobre todo de protenas, para su Fig. 8 Clula vegetal. 1) pared celular; 2)
almacenamiento o secrecin. dictiosoma de aparto de Golgi; 3) vacuola; 4)
envoltura nuclear; 5) nucleolo; 6) retculo
endoplasmtico granular; 7 mitocondria; 8)
cloroplasto.
LOS LISOSOMAS

Los lisosomas son pequeas vesculas constituidas por membranas provenientes de


los sistemas de membranas (AG y, ocasionalmente, REG). Se caracterizan por tener
en su interior enzimas hidrolti cas, enzimas que rompen los enlaces de los polmeros
por adicin de H2 O. Estas enzimas estn empaquetadas e inactivas en los lisosomas
y as se evita que puedan destruir las propias estructuras celulares.

Los lisosomas se originan en los dictiosomas del aparato de Golgi y, en algunos


casos, en ciertas regiones del retculo endoplasmtico granular a partir de vescu las
que se destacan de los sculos de los dictiosomas. Slo se encuentran en las clulas
animales.

LOS PEROXISOMAS

Parecidos a los lisosomas, diferencindose


de estos en que contienen enzimas que
degradan los cidos grasos y los
aminocidos. Como estos procesos generan
perxidos, contienen tambin catalasa,
enzima que descompone los perxidos y en
particular el H2 O2 en H2 O y O2 .

LAS VACUOLAS

Son estructuras celulares variables en


Fig. 9 Clula del peciolo de una hoja de
nmero y forma. En general estn consti-
remolacha. 1) Pared celular. 2) Vacuola. 3)
tuidas por una membrana y un contenido Cloroplastos. 4) Ncleo. 5) Citoplasma.
interno. Hay diferencias entre las vacuolas
de las clulas vegetales y las de las clulas
animales. Las clulas vegetales es frecuente

J. L. Snchez Guilln Pgina II-4-3


II) La clula 4) Sis. de membranas

que presenten una nica o unas pocas


vacuolas de gran tamao. Las clulas
animales, en el caso de tener vacuolas, son
de pequeo tamao.

Las vacuolas se originan por la agregacin


de las pequeas vesculas formadas a partir
de los dictiosomas de aparato de Golgi o
por invaginacin de la membrana plasmtica
(endocitosis).

Las vacuolas, en general, tienen funcin de


almacenamiento de sustancias de reserva y,
en ciertos casos, de almacenamiento de
Fig. 10 Vc) gran vacuola en una clula
sustancias txicas.
vegetal.

Existen otras estructuras que se llaman


tambin vacuolas pero cuya funcin es muy
diferente. As:

- Las vacuolas pulstiles, como las que se


observan en muchos organismos unicelulares
de las aguas dulces, por ejemplo, el parame-
cio. Este organismo, al vivir en agua dulce,
su citoplasma es hipertnico con respecto al
exterior, por lo que se produce una entrada
continua de agua. Las vacuolas pulstiles Fig. 11 Paramecios en los que se observan
vacuolas digestivas.
extraen el agua del citoplasma y la expulsan
al exterior por tansporte activo.
cil
- Las vacuolas digestivas. Se dan en las vp Mn
mn vp
clulas que capturan alimentos del medio y
los engloban en una membrana formando
una vacuola llamada vacuola digestiva. En
esta vacuola es donde se va a producir la
digestin de esas sustancias nutritivas. Una vd
vez digeridas pasan al interior de la clula y
los productos de desecho son eliminados Fig. 12 Paramecio, ciliado de las aguas
dulces. vp) Vacuola pulstil. vd) Vacuola
hacia el exterior. digestiva. cil) Cilios. Mn) Macroncleo. mn)
Microncleo.

J. L. Snchez Guilln Pgina II-4-4


II) La clula 4) Sis. de membranas

FUNCIONES DE LOS SISTEMAS DE MEMBRANAS

> Maduracin de protenas: Los sistemas de membranas estn relacionados con la


sntesis, maduracin y transporte de protenas y glicoprotenas. Intervienen, sobre
todo, en los procesos subsiguientes a la sntesis de las protenas de secrecin, las
protenas de las membranas y las enzimas de los lisosomas. Muchas de estas
protenas son glicoprotenas. La parte protica se sintetiza en el hialolplasma y de
aqu pasa al interior del REG y del A. Golgi donde unas enzimas les aaden los
oligosacridos (maduracin de las glicoprotenas). Despus se dirigirn, por medio de
las vesculas de secrecin que se desprenden del Golgi, a formar los lisosomas, a
integrarse en la membrana plasmtica o a la exportacin.

Glicosiltransferasa
( enzima)
Ribosoma
ARNm

Cisterna del REG

Glicoprotenas

Membrana del REG

Fig. 13 Maduracin y transporte de glicoprotenas en el REG.

> Funcin de los lisosomas: Hemos visto


que ciertas clulas tienen la capacidad de
ingerir sustancias por medio de fenmenos de
endocitosis. Las sustancias son englobadas
por la membrana plasmtica que, a
continuacin, se invagina formando una
vescula denominada fagosoma. El fagosoma
se fusiona con los lisosomas formando los
fagolisosomas. Las grandes molculas conte-
nidas en el fagosoma: polisacridos, prote -
nas, cidos nucleicos, etc., son sometidas a
la accin del medio cido de los lisosomas y
a las enzimas, que en este momento ya son
activas. Los polme ros son hidrolizados y
transformados en molculas menores: monosa-
cridos, aminocidos, etc., que se difunden a
travs de la membrana hacia el citoplasma. Fig. 14 1) Endocitosis; 2) lisosomas; 3)
fagolisosoma; 4) lisosoma secundario; 5)
Quedan en el lisosoma los productos no
cuerpos residuales; 6 y 7) exocitosis (excre-
degradados. Un lisosoma que ya ha actuado cin); 8 digestin de una mitocondria por un
recibe el nombre de lisosoma secundario y lisosoma (autofagia).
conserva an la capacidad de unirse a

J. L. Snchez Guilln Pgina II-4-5


II) La clula 4) Sis. de membranas

nuevos fagosomas. Las sustancias no de-


gradadas se van acumulando progresivamen-
te en el interior de los lisosomas secunda-
rios. En ciertos organismos, estos lisosomas
secundarios pueden fusionarse con la
membrana plasmtica y expulsar su
contenido al exterior (exocitosis). En los
organismos pluricelulares lo normal es que
los lisosomas secundarios se transformen en
cuerpos residuales. Esta acumulacin de
cuerpos residuales en una clula a lo largo
de su vida es un signo de degeneracin
celular.

La membrana de los lisosomas puede englo- Fig. 15 Relaciones entre el 1) REG, 2) el


bar tambin orgnulos celulares que de esta aparato de Golgi y las protenas de membrana
manera son digeridos. Por este sistema la o la secrecin de protenas u otras sustancias
clula renueva sus estructuras celulares. (3).

> Sntesis de los polisacridos de la pared celular

En el aparato de Golgi se produce la


sntesis de los polisacridos y en particular
plasmodesmos
Pared celular de la
la sntesis de la celulosa que constituye la clula contigua
sustancia fundamental de las paredes de las
clulas vegetales. Pared primaria

Pared
Las clulas vegetales disponen de una es- secundaria

tructura que las envuelve denominada pared


celular, constituida, fundamentalmente, por
celulosa. La celulosa est formada por mol-
culas de glucosa unidas entre s mediante
enlaces (1-4). Esto hace que las molculas Fig. 16 Fragmento de una clula vegetal
de celulosa adopten una conformacin lineal mostrando la pared celular y los
y que se puedan establecer puentes de hidr- plasmodesmos.
geno entre molculas dispuestas en paralelo
formando microfibrillas entre las que se sitan entrecruzadas molculas de otras
sustancias, como la lignina, que le da a la pared una gran rigidez, o ceras, que la
impermeabilizan. La pared celular no es un orgnulo celular sino un producto de
secrecin de la clula que deposita en su exterior estas sustancias concntricamente.
La pared celular aparece adems atravesada por una gran cantidad, hasta 20 000 en
ciertos casos, de finsi mos conductos denominados plasmodesmos. Los plasmodes-
mos comunican el protoplasma de las clulas contiguas que, en cierto modo, forman
una unidad.

En la pared celular distinguiremos, del interior al exterior de la clula, la pared


secundaria, la pared primaria y la laminilla media.

La pared secundaria. Ms gruesa y resistente, crece bajo la primera y se la

J. L. Snchez Guilln Pgina II-4-6


II) La clula 4) Sis. de membranas

encuentra principalmente en clulas que estn ya diferenciadas.

La pared primaria. Formada por microfibrillas de celulosa ms desordenadas


y es la nica que est presente en clulas jvenes y en clulas que se
dividen activamente.

La laminilla media. Difcil de ver al microscopio. Est formada por


sustancias pcticas y mantiene unidas a las clulas contiguas.

> Funciones del retculo endoplasmtico liso (REL)

El retculo endoplasmtico liso est relacionado con el metabolismo (sntesis,


degradacin y transporte) de los lpi dos. Las hormonas estero dicas son sintetizadas
en el REL. Se ha observado que tambin interviene en los procesos para metabolizar
ciertos medicamentos y determinadas sustancias txicas.

J. L. Snchez Guilln Pgina II-4-7


II) La clula 5) Enzimas

5) EL METABOLISMO CELULAR: GENERALIDADES. ENZIMAS

EL METABOLISMO: CONCEPTO

La nutricin de las clulas supone una serie de complejos procesos qumicos


catalizados por enzimas que tienen como finalidad la obtencin de materiales y/o
energa. Este conjunto de procesos recibe el nombre de metabolismo.

ANABOLISMO Y CATABOLISMO

El metabolismo va a poder descomponerse en dos series de reacciones:

Anabolismo. Son aquellos procesos qumicos que se producen en la clula y


que tienen como finalidad la obtencin de sustancias orgnicas complejas a
partir de sustancias ms simples con un consumo energa. Son anablicos, por
ejemplo, la fotosntesis, la sntesis de protenas o la replicacin del ADN.

Catabolismo. En estos procesos las molculas complejas son degradadas


formndose molculas ms simples. Se trata de procesos destructivos
generadores de energa; como por ejemplo: la glucolisis.

H2O Sales minerales


CO2

Fotosntesis

Compuestos
Glcidos orgnicos Prtidos

Lpidos aminocidos
Glucosa

Gluclisis Compuestos
intermediarios
Nitrgeno inorgnico

Fermentacin Respiracin

cido Lctico
CO2 H2O anabolismo
Etanol
catabolismo

Fig. 1 Principales rutas del metabolismo.

TIPOS DE METABOLISMO

Los organismos no se diferencian en la manera de procurarse compuestos inorgni-


cos del medio, todos los obtienen de una manera directa. En cambio, si se van a

J. L. Snchez Guilln Pgina II-5-1


II) La clula 5) Enzimas

diferenciar en cmo van a obtener las sustancias orgnicas. Ciertos organismos las
obtienen a partir de sustancias inorgnicas, como el CO2 , H2 O, NO3 -, PO4 -3 , etc. A
estos organismos se les llama auttrofos. Otros son incapaces de elaborar los com-
puestos orgnicos a partir de compuestos inorgnicos y deben obtenerlos del medio,
son los organismos hetertrofos.

Los organismos adems de materiales necesitan tambin energa. Cuando la fuente


de energa es la luz, el organismo recibe el nombre de fotosinttico. Cuando la
energa la obtienen a partir de sustancias qumicas, tanto orgnicas como
inorgnicas, los llamaremos quimiosintticos.

LAS ENZIMAS. CONCEPTO DE CATLISIS

energa
Las enzimas son protenas o asociaciones
Sin enzima Energa de activacin
Energa
total sin enzima

305, 14 KJ 292,6KJ

de protenas y otras molculas orgnicas o


inorgnicas que actan catalizando los con enzima

procesos qumicos que se dan en los seres Id. con enzima

vivos. Energa neta


12,54 KJ

A desarrollo de la reaccin B

Esto es, actan facilitando las


transformaciones qumicas; acelerando Fig. 2 Energa de activacin necesaria
para que A se trasforme en B, con y sin
considerablemente las reacciones y
enzima.
disminuyendo la energa de activacin que
muchas reacciones requieren.

As, por ejemplo:

I) La descomposicin del agua oxigenada (perxido de hidrgeno) en agua y oxgeno, segn la reaccin:

2H2O2 ----------> 2H2O + O2


es una reaccin que puede transcurrir espontneamente pero es extraordinariamente lenta. En condi-
ciones normales se descomponen 100 000 molculas cada 300 aos por cada mol de H2O2 (6,023*1023
molculas). Sin embargo, en presencia de una enzima que hay en nuestras clulas, la catalasa, el proceso
se desarrolla con extraordinaria rapidez (el burbujeo que se produce al echar agua oxigenada en una
herida es debido a esto).

II) La reaccin de desfosforilacin de la glucosa:

Glucosa-6-P + H2O ----------> Glucosa + Pi

es exergnica, pero se necesitan 292,6 kJ/mol para romper el enlace fosfoster. Esto significa que
para poder obtener 305,14 kJ/mol de glucosa, deberemos suministrar primero 292,6 kJ/mol
(rendimiento neto 12,54 kJ/mol de glucosa). Esta energa (292,6 kJ) recibe el nombre de energa de
activacin (EA).

J. L. Snchez Guilln Pgina II-5-2


II) La clula 5) Enzimas

Las enzimas, como catalizadores que son, no modifican la constante de equilibrio y


tampoco se transforman, recuperndose intactas al final del proceso. La rapidez de
actuacin de las enzimas y el hecho de que se recuperen intactas para poder actuar
de nuevo es la razn de que se necesiten en pequesimas cantidades.

ESPECIFICIDAD DE LAS ENZIMAS

Es de destacar que las enzimas son


especficas. Esto es, una enzima puede
actuar sobre un substrato o un grupo de
substratos relacionados (especificidad de
substrato) pero no sobre otros; por
ejemplo:la sacarasa, que hidroliza la sacaro-
sa. Otras enzimas, sin embargo, tienen
especificidad de accin al realizar una accin
determinada pero sobre mltiples substratos;
por ejemplo: las lipasas que hidrolizan los
enlaces ster en los lpidos. Debido a esta
especificidad de las enzimas existen en la Fig. 3 Estructura de una enzima.
clula miles de enzimas diferentes.

La especificidad de las enzimas ha llevado


a comparar a stas con llaves y a los
substratos con cerraduras (modelo de la
llave y la cerradura).

Centro activo

CONSTITUCIN QUMICA DE LAS ENZIMA Centro regulador


Y MODO DE ACTUACIN

Fig. 4 Representacin esquemtica de la


En el pasado las enzimas se conocan con estructura de una enzima.
el nombre de fermentos, porque los primeros
enzimas estudiados fueron los fermentos de
las levaduras y de las bacterias. En la
actualidad el trmino fermento se aplica
nicamente a las enzimas que las bacterias, sustrato
productos
hongos y levaduras vierten al exterior para
realizar determinadas trasformaciones: las
fermentaciones. coenzima

Las enzimas son, en general, prtidos. Algu-


nas son protenas en sentido estricto. Otras Centro activo
poseen una parte proteica (apoenzima) y una
Centro regulador
parte no proteica, ambas estn ms o menos
ligadas qumicamente. Fig. 5 Trasformaciones de un sustrato por
la accin de una enzima.
La conformacin espacial de la parte
proteica es la responsable de la funcin que
realiza la enzima. Para ello la sustancia o

J. L. Snchez Guilln Pgina II-5-3


II) La clula 5) Enzimas

sustancias que van a reaccionar y transformarse se unen a la enzima en una zona


que llamaremos centro activo y son las interacciones qumicas entre los restos de
los aminocidos presentes en el centro activo y el substrato o los substratos las
responsables de la transformacin; ya que estas interacciones producen
reordenamientos de los electrones que debilitan ciertos enlaces y favorecen la
formacin de otros desencadenando la transformacin qumica.

MECANISMO DE ACCIN ENZIMTICA

sustrato
coenzima

sustrato

coenzima
enzima
enzima

Centro activo

1) En primer lugar, se forma un complejo: enzima- 2) El sustrato o los sutratos y la coenzima, si es


substrato o substratos. necesaria, se unen al centro activo de la enzima.

Productos
Productos

coenzima

enzima

enzima

3) Los restos de los aminocidos que configuran el 4) Los productos de la reaccin se separan del centro
centro activo catalizan el proceso. Para ello debilitan los activo y la enzima se recupera intacta para nuevas
enlaces necesarios para que la reaccin qumica se lleve a catlisis. Las coenzimas colaboran en el proceso; bien
cabo a baja temperatura y no se necesite una elevada aportando energa (ATP), electrones (NADH/NADPH) o
energa de activacin. en otras funciones relacionadas con la catlisis
enzimtica.

La parte proteica o apoenzima es tambin, y


por las mismas razones, la que determina la
especificidad de la enzima. As, la sacarasa
Actividad enzimtica

Nivel de saturacin de la enzima


acta sobre la sacarosa por ser esta la nica
molcula que se adapta al centro activo.

Muchas enzimas precisan para su actuacin


la presencia de otras sustancias no
proteicas: los cofactores. Qumicamente son
sustancias muy variadas. En algunos casos Concentracin de sustrato

se trata de simples iones, cationes en Fig. 6 Grfica de Michaelis_Menten que


particular, como el Cu+ + o el Zn+ + . En muestra la variacin de la actividad enzimtica
con la concentracin de sustrato. Esta grfica
otros, son sustancias orgnicas mucho ms
demuestra la formacin de un complejo enzima-
complejas, en cuyo caso se llaman coenzi- sustrato.
mas. Muchas vitaminas son coenzimas o

J. L. Snchez Guilln Pgina II-5-4


II) La clula 5) Enzimas

forman parte de coenzimas. Las coenzimas


son imprescindibles para que la enzima
acte. Suelen, adems, ser las responsables
de la actividad qumica de la enzima. As,
muchas reacciones de oxidacin precisan
del NAD , que es el que capta los
+

electrones y sin su presencia la enzima no


puede actuar. Otro ejemplo lo tenemos en
las reacciones que necesitan energa en las
que acta como coenzima el ATP.

Por ltimo, indicar que las enzimas se


nombran aadiendo la terminacin asa, bien
al nombre del substrato sobre el que actan
(sacarasa), al tipo de actuacin que realizan
(hidrolasas), o ambos (ADN polimerasa).
Fig. 7 Esquema del NAD+ -NADP+ . X es
un hidrgeno en el NAD+ y un grupo fosfato
en el NADP+ .
ALGUNAS COENZIMAS IMPORTANTES

i) Coenzimas que intervienen en las


reacciones en las que hay transferencias de
Enlace rico en
energa: energa

*ATP (adenosina-5'-trifosfato): Adenina-Ribo-


sa-P-P-P
*ADP (adenosina-5'-difosfato): Adenina-Ribo-
sa-P-P.
Fig. 8 Esquema del ATP.

ii) Coenzimas que intervienen en las reacciones en las que hay transferencias de
electrones:

* NAD+ (Nicotinamn adenn dinucletido). Se trata de un dinucletido


formado por: Nicotinamida-Ribosa-P-P-Ribosa-Adenina.

* NADP+ (Nicotinamn adenn dinucletido fosfato). Similar NAD + pero con


un grupo fosfato ms esterificando el HO- del carbono 2 de la ribosa unida a
la adenina.

* FAD (Flavn adenn dinucletido). Similar al NAD pero conteniendo


riboflavina (otra de las vitaminas del complejo B2 ) en lugar de nicotinamida.

iii) Coenzimas que intervienen como transportadores de grupos acilo.

Coenzima A. Coenzima de estructura compleja y de la que forma parte el


cido pantotnico (otra de las vitaminas del complejo B2 ).

J. L. Snchez Guilln Pgina II-5-5


II) La clula 5) Enzimas

EL ATP Y EL TRANSPORTE DE ENERGA

En los procesos metablicos que se dan en


E
la clula, algunas reacciones son
endergnicas: necesitan energa para
producirse y en caso contrario no se
producen. Otras son exergnicas: producen
energa y si sta no se emplea en realizar
un trabajo fsico o una reaccin qumica se
E
perder en forma de calor.

Ciertas coenzimas, como el ATP y otras, Fig. 9 El ATP transporta energa (E)
actan transportando energa desde los desde los procesos exergnicos (A>B) a los
endergnicos (C>D).
procesos exergnicos a los endergnicos.
Pues el ATP se puede transformar en ADP y
Pi (fosfato inorgnico) al hidrolizarse el ltimo de sus enlaces ster-fosfato,
desprendindose ms de 7 kcal por mol de ATP. Por el contrario, en aquellas
reacciones en las que se produce energa esta es acumulada al sintetizarse ATP a
partir de ADP y fosfato inorgnico (Pi).

LAS COENZIMAS TRANSPORTADORAS DE


ELECTRONES e-

Muchos procesos qumicos celulares de


gran importancia: fotosntesis, respiracin
celular, etc. Son procesos de oxidacin-
reduccin. As, por ejemplo: la respiracin
celular, en la que la glucosa se oxida al e-
perder electrones, mientras que el oxge no
los capta reducindose. Ciertas coenzimas
Fig. 10 Transporte de electrones (e-) por el
actan transportando estos electrones desde NAD+ /NADH desde una sustancia que se oxida
las sustancias que se oxidan a las que se (O) a otra que se reduce (G).
reducen: son los transportadores de electro-
nes.

As, por ejemplo, el NAD + es capaz de captar dos electrones, y dos protones (H+ ),
reducindose y transformndose en NADH+H + . Mientras que el NADH +H + puede
ceder estos dos electrones all donde se necesiten para reducir a un compuesto
qumico, transformndose de nuevo en NAD + .

FACTORES QUE CONDICIONAN LA ACTIVIDAD ENZIMTICA

Las enzimas, como sustancias proteicas que son, van a ver condicionada su
actuacin por determinados factores fsicos y qumicos. Algunos de estos factores
son:

La temperatura. Como toda reaccin qumica, las reacciones catalizadas enzimtica-

J. L. Snchez Guilln Pgina II-5-6


II) La clula 5) Enzimas

mente siguen la regla de Van t'Hoff. Segn la cual, por cada 101C de aumento de
temperatura, la velocidad de la reaccin se
duplica. No obstante, las enzimas tienen una
temperatura ptima. En el hombre, y en los

Actividad enzimtica
animales homeotermos como el hombre, esta Temperatura ptima

temperatura ptima coincide con la


temperatura normal del organismo. Los
enzimas, como prote nas que son, se desna-
turalizan a elevadas temperaturas.

El pH, que al influir sobre las cargas elctri-


cas, podr alterar la estructura del centro
activo y por lo tanto tambin influir sobre la Fig. 11 Variacin de la actividad
actividad enzimtica. enzimtica en funcin de la temperatura.

Los inhibidores. Determinadas sustancias van


a poder actuar sobre las enzimas
disminuyendo o impidiendo su actuacin.
Estas sustancias son los inhibidores. Se trata Actividad enzimtica
de molculas que se unen a la enzima pH ptimo

impidiendo que sta acte sobre el substrato.


B A

Inhibicin competitiva: Cuando el


inhibidor se une al centro activo
de la enzima impidiendo que el 1 2 3 4 5 6 7 8 9 10 11 12 13 14
pH
sustrato se una a l. Se trata de
una inhibicin que depende de la Fig. 12 Variacin de la actividad
concentracin de sustrato y de enzimtica en funcin del pH de dos enzimas.
inhibidor.
Inhibicin no competitiva: Cuando
el inhibidor se une reversiblemente
a un punto diferente del centro
sustrato
activo pero con su actuacin lo
modifica lo suficiente para que,
inhibidor
aunque se puedan unir la enzima y
el sustrato, la catlisis no se
produzca o la velocidad de sta
disminuya. Este tipo de inhibicin
no depende de la concentracin de
sustrato. Enzima
Inhibicin alostrica: El inhibidor se
une tambin reversiblemente a un
punto diferente al centro activo, Fig. 13 Inhibicin competitiva. El inhibidor
pero con su actuacin lo modifica se une al centro activo, reversiblemente, y con
de tal manera que impide la unin ello impide que el sustrato se una a l.
de la enzima y el substrato.

Es frecuente que el inhibidor sea el propio producto de la reaccin enzimtica o el


producto final de una cadena de reacciones. Cuando se trata del producto final,

J. L. Snchez Guilln Pgina II-5-7


II) La clula 5) Enzimas

recibe el nombre de retrorregulacin o feed-


back.

Envenenadores: Son molculas que se unen


irreversiblemente al centro activo de la
enzima impidiendo pernanentemente que esta
acte. Muchos txicos y venenos tienen
Enzima inactiva
este modo de actuacin.

Los activadores. Son sustancias que se unen


a la enzima, que se encuentra inactiva,
cambiando su estructura espacial inhibidor

activndola.
Fig. 14 Inhibicin no competitiva. El
inhibidor se une reversiblemente a la enzima
en un punto diferente del centro activo y,
modifica este de tal manera, que aunque el
sustrato se una no se realiza la catlisis.

sustrato

Enzima

inhibidor

Fig. 15 Inhibicin alostrica. El inhibidor


se une a la enzima en un punto diferente del
centro activo y modifica este de tal manera
que el sustrato no se puede unir a l.

sustrato
envenenador

Enzima

Fig. 16 Envenenador. Los envenenadores


son sustancias que se unen al centro activo
mediante enlaces fuertes en un proceso
irreversible, con lo que impiden de manera
definitiva la catlisis.

J. L. Snchez Guilln Pgina II-5-8


II) La clula 5a) Fotosntesis

5A) METABOLISMO: OBTENCIN DE ENERGA

5A-1) OBTENCIN DE ENERGA Y SNTESIS DE COMPUESTOS ORG-


NICOS EN LA CLULA VEGETAL (FOTOSNTESIS)

LOS PLASTOS
a
Son orgnulos citoplasmticos exclusivos y
caractersti cos de las clulas vegetales.
d

Existen diversos tipos de plastos: cloroplas-


tos, cromoplastos y leucoplastos. Todos d

tienen un origen comn en unas estructu ras


celulares llamadas proplastos. Algunas e c
caractersticas de las diferentes clases
plastos son: Fig. 1 Corte transversal de una hoja: a)
epidermis del haz; b y d) parnquima
- Cloroplastos. Plastos verdes ya que cloroflico; c) epidermis del envs; e) estoma.
contiene, entre otros pigmentos foto sint-
ticos, clorofila. En ellos se realiza la foto -
snte sis.

- Cromoplastos plastos de color amarillo o


anaranjado por acumulacin de carotenoides,
como los del tomate o la zanahoria.

- Leucoplastos plastos de color blanco. Se


encuentran en las partes no verdes de la
planta. As, por ejemplo, en las clulas de la
Fig. 2 Cromoplastos en clulas vegetales
patata encontramos un tipo de leucoplastos, vistos al microscopio ptico.
los amiloplastos, llamados as por contener
almidn.
O2
Debido a su importancia para todos los
seres vivos, haremos a continuacin un
estudio particular de los cloroplastos.
CO2

Savia elaborada Savia


LOS CLOROPLASTOS bruta

Caractersticas: Son orgnulos muy variables


en cuanto a nmero, forma y tamao. As,
por ejemplo, las clulas de ciertas algas
H2O
filamentosas tienen uno o dos nicos Sales minerales

cloroplastos; otras, como la planta acutica


elodea, tienen numerosos cloroplastos. Su Fig. 3 Intercambios de sustancias entre la
forma es, normalmente, de lente biconvexa, planta y el medio durante el da.
pero pueden ser tambin estrellados o con

J. L. Snchez Guilln Pgina II-5a-1


II) La clula 5a) Fotosntesis

forma de cinta enrollada en hlice.

Ultraestructura: Es difcil observar su


estructura al microscopio ptico. Al MET
(microscopio electrnico de transmisin) se
observa una membrana externa y otra
interna separadas por un espacio
intermembrana. En el interior se ven unas
estructuras alargadas formadas por mem-
branas llamadas lminas o lamelas. Sobre
ellas se ven los grana, que son unos replie-
gues, formados tambin por membranas, que
se disponen unos encima de otros. Todo
este conjunto de membranas internas recibe Fig. 4 Clulas vegetales vistas al
el nombre de tilacoides; pudindose distinguir microscopio electrnico en las que pueden
los tilacoides de los grana y los tilacoides observarse numerosos cloroplastos.
de las lminas. Existe adems un contenido
interno: el estroma, en el que hay ADN
similar al de las clulas procariotas,
ribosomas (plastorribosomas) y
acumulaciones de almidn, protenas y
lpidos.

Funcin: En los cloroplastos se va a realizar


la fotosntesis. En los tilacoides se realiza
una de las fases de la fotosntesis: la fase
luminosa. La otra fase de la fotosntesis: la Fig. 5 Cloroplasto visto al microscopio
fase oscura, se realiza en el estroma del electrnico. me) membrana externa; mi)
membrana interna; gr) grana; la) lminas; es)
cloroplasto. estroma; pg) plastoglbulos; al) almidn.

Origen evolutivo: Es de destacar que los


plastos tienen una estructura similar a los
organismos procariticos. Segn la " Teora
endosimbitica" la clula eucaritica se
habra formado por simbiosis de diferentes
organismos procariotas, uno de ellos el
plasto, que proporcionara al conjunto
compuestos orgnicos que sintetizara
usando como fuente de energa la luz solar.

Fig. 6 Ultraestructura de un cloroplasto.


LA FOTOSNTESIS: CONCEPTO 1) Membrana externa. 2) Membrana interna.
3) Grana. 4) Lminas. 5) Estroma.
La fotosntesis puede definirse como un
proceso anablico que se produce en los cloroplastos y en el que la energa luminosa
es transformada en energa qumica que posteriormente ser empleada para la
fabricacin de sustancias orgnicas a partir de sustancias inorgnicas.

J. L. Snchez Guilln Pgina II-5a-2


II) La clula 5a) Fotosntesis

PROCESOS QUE SE DAN EN LA FOTOSNTESIS

En la fotosntesis se van a producir los siguientes procesos:

11) Captacin por las clorofilas y otros pigmentos fotosintticos de la energa


luminosa y su transformacin en energa qumica contenida en el ATP.

21) Obtencin de electrones a partir del agua. Estos electrones, convenientemente


activados por la energa luminosa, servirn para reducir NADP+ .

31) Incorporacin del carbono del CO2 a las cadenas carbonadas.

41) Reduccin por el NADPH del carbono incorporado y sntesis de compuestos


orgnicos.

51) Reduccin de otras sustancias inorgnicas (nitratos, nitritos, sulfatos, etc.) para su
incorporacin a las cadenas carbonadas.

ECUACIN GLOBAL DE LA FOTOSNTESIS

La fotosntesis en su conjunto es un proceso redox en el que el CO2 y otras


sustancias inorgnicas son reducidas e incorporadas en las cadenas carbonada.
Aunque son muchas las sustancias orgnicas que se forman en el cloroplasto, la que
se forma en mayor cantidad es la glucosa. Por esto la ecuacin global de la sntesis
de glucosa en el cloroplasto se considera como la ecuacin global de la fotosntesis.

6 CO 2 + 6 H 2O C 6 H 12 O 6 + 6 O 2

Fig. 7 Ecuacin global de la fotosntesis.

CONSECUENCIAS DE LA FOTOSNTESIS

Las consecuencias de la fotosntesis son de gran importancia para los seres vivos.
As:

1) Todos o casi todos los seres vivos dependen, directa o indirectamente, de la foto-
sntesis para la obtencin de sustancias orgnicas y energa.

2) A partir de la fotosntesis se obtiene O2 . Este oxgeno, formado por los seres


vivos, transform la primitiva atmsfera de la Tierra e hizo posible la existencia de
los organismos hetertrofos aerbicos1 .

1
Aerbicos son los organismos que necesitan en su metabolismo el oxgeno para los procesos de
oxidacin.

J. L. Snchez Guilln Pgina II-5a-3


II) La clula 5a) Fotosntesis

FASES DE LA FOTOSNTESIS

La fotosntesis es un proceso muy


complejo. Se ha demostrado que slo una
parte requiere energa luminosa, a esta parte
se le llama fase luminosa; mientras que la
sntesis de compuestos orgnicos no
necesita la luz de una manera directa, es la
fase oscura. Es de destacar que la fase
oscura, a pesar de su nombre, se realiza Fig. 8 Fase luminosa y fase oscura de la
tambin durante el da, pues precisa el ATP fotosntesis: visin de conjunto.
y el NADPH que se obtienen en la fase
luminosa.
ATP asa Phs 1 Phs 2 Cit b/f

A) FASE LUMINOSA

Se realiza en la membrana de los tilacoides.


Consiste en un transporte de electrones,
desencadenado por fotones, con sntesis de
ATP y de NADPH+H + . Fig. 9 Disposicin de los fotosistemas
(Phs) de los citocromos (Cit) y de las ATPasas
en los tilacoides de los granas.

ESTRUCTURA DE LA MEMBRANA DE LOS


TILACOIDES

La membrana de los tilacoides tiene una


estructura de doble capa o membrana unita-
ria. Integradas en esta doble capa estn
determinadas sustancias muy importantes en
el proceso de la fotosntesis y en particular
los fotosistemas I y II, ATPasas y citocro-
mos.

Cada fotosistema contiene carotenos,


clorofilas y protenas. Estas molculas
captan la energa luminosa y la ceden a las
Fig. 10 La clorofila a.
molculas vecinas presentes en cada
fotosistema hasta que llega a una molcula
de clorofila-a denominada molcula diana. Los
diferentes carotenos y clorofilas captan
fotones de unas determinadas longitudes de
onda. De esta manera, el conjunto de las
molculas del fotosistema captan gran parte
Fig. 11 El grupo fitol de las clorofilas.
de la energa luminosa incidente, slo
determinadas longitudes de onda son
reflejadas y, por lo tanto, no utilizadas. En particular, son reflejadas las radiaciones
correspondientes a las longitudes de onda del verde y el amarillo.

J. L. Snchez Guilln Pgina II-5a-4


II) La clula 5a) Fotosntesis

En el fotosistema II (Phs II) la molcula diana


es la clorofila aII que tiene su mximo de
absorcin a 680 nm (P 680). Cuando esta
clorofila capta un fotn pasa a un estado Molcula

excitado (P 680 ) y su potencial redox se diana

hace ms negativo hacindose muy reducto- Fotosistema

ra. En el fotosistema I (Phs I), la molcula


diana es la clorofila aI, cuyo mximo de Fig. 12 Captacin de la energa luminosa
absorcin se encuentra a 700 nm (P 700), por un fotosistema.
que tambin se excita (P 700 ) al captar un
fotn. La disminucin de los potenciales
Clorofila a
Clorofila b
150

redox permite que se establezca un Caroteno

transporte de electrones que pueden seguir


dos vas:
100

50

- La fotofosforilacin acclica
- La fotofosforilacin cclica 0
400 500 600 700

Longitud de onda en nm (nanometros)

LA FOTOFOSFORILACIN ACCLICA
Fig. 13 Absorcin de los diferentes
pigmentos del cloroplasto en funcin de la
La luz va a desencadenar un transporte de longitud de onda. La menor absorcin se
electrones a travs de los tilacoides con corresponde con los colores verde (492 a 577
nm) y amarillo (577 a 597 nm).
produccin de NADPH y ATP. Los electrones
ser aportados por el agua. En esta va se
pueden distinguir los siguientes procesos:

I) Reduccin del NADP+ : La clorofila-aII y 700

Rojo (622-770)
otras sustancias del fotosistema II captan
Naranja (597-622)
foto nes (luz) pasando a un estado ms
Amarillo (577-597)
energtico (excitado). Esta energa les va a 600
Verde (492-577)
permitir establecer una cadena de electrones Azul (455-492)
a travs de los tilacoides en la que Ail (430-455)
intervienen diferentes transportadores y en Violeta (390-430)
500

particular el fotosistema I que tambin es


activado por la luz. El aceptor final de estos
electrones es el NADP+ que se reduce a NA- 400

DPH+H + al captar los dos electrones y dos


protones del medio. Fig. 14 Longitudes de onda de los colores
del espectro de la luz visible.

II) Fotolisis del agua y produccin de oxgeno: Los electrones transportados a travs
de los tilacoides y captados por el NADP+ proceden de la clorofila aII (P680). Esta
molcula va recuperarlos sacndolos del agua. De esta manera podr iniciar una nueva
cadena de electrones. En este proceso la molcula de agua se descompone (lisis) en
2H + , 2e- y un tomo de oxgeno. El tomo de oxgeno, unido a un segundo tomo
para formar una molcula de O2 , es eliminado al exterior. El oxgeno producido
durante el da por las plantas se origina en este proceso.

J. L. Snchez Guilln Pgina II-5a-5


II) La clula 5a) Fotosntesis

NADPH

ATP

NADP+
3H+
Luz Luz
estroma H+ ADP

ATPasa
e
PhsII PhsI
e

H2 O 3H+

Interior del tilacoide

O2

Fig. 15 Esquema de la fotofosforilacin accliclica.

III) Obtencin de energa. Sntesis de ATP


(Teora quimiosmtica): El transporte de elec-
trones a travs de los fotosistemas produce
un bombeo de protones desde el estroma
hacia el interior del tilacoide, pues los
fotosistemas actan como transportadores
activos de protones extrayendo la energa
necesaria para ello del propio transporte de
electrones. La lisis del agua tambin genera
protones (H+ ). Todos estos protones se
acumulan en el espacio intratilacoide, pues la Fig. 16 Sntesis de ATP en los tilacoides.
membrana es impermeable a estos iones y
no pueden salir. El exceso de protones genera un aumento de acidez en el interior
del tilacoide y, por lo tanto, un gradiente electroqumico -exceso protones y de
cargas positivas. Los protones slo pueden salir a travs de unas molculas de los
tilacoides: las ATPasa. Las ATPasas actan como canal de protones y de esta
manera cataliza la sntesis de ATP. Es la salida de protones (H+ ) a travs de las
ATPasas la que acta como energa impulsora para la sntesis de ATP.

IV) Balance de la fotofosforilacin acclica: Teniendo en cuenta nicamente los pro-


ductos iniciales y finales, y podemos hacerlo porque el resto de las sustancias se
recuperan en su estado inicial, en la fotofosforilacin acclica se obtienen 1
NADPH+H + y 1 ATP. A su vez, la fotolisis del agua va a generar tambin un tomo
de oxgeno.

LA FOTOFOSFORILACIN CCLICA

En esta va la luz va a desencadenar un transporte de electrones a travs de los


tilacoides con produccin slo de ATP.

Mecanismo: El proceso parte de la excitacin de la molcula diana del fotosistema I


(clorofila-aI, P700) por la luz. Ahora bien, en este caso, los electones no irn al
NADP+ sino que seguirn un proceso cclico pasando por una serie de
transportadores para volver a la clorofila aI. En cada vuelta se sintetiza una molcula

J. L. Snchez Guilln Pgina II-5a-6


II) La clula 5a) Fotosntesis

de ATP de la misma forma que en la fotofosforilacin acclica.

ATP

Luz
ADP 3H+
estroma

e
e
PhsI
e e e
e

3H+

Interior del tilacoide

Fig. 17 Esquema de la fotofosforilacin ccliclica.

Balance de la fotofosforilacin cclica: En esta va se produce una snte sis continua


de ATP y no se requieren otros substratos que el ADP y el Pi y, naturalmente, luz
(fotones). Es de destacar que no es necesaria la fotolisis del agua pues los electrones
no son cedidos al NADP+ y que, por lo tanto, no se produce oxgeno.

REGULACIN DE AMBOS PROCESOS

En el cloroplasto se emplean ambos procesos indistintamente en todo momento. El


que se emplee uno ms que otro va a depender de las necesidades de la clula o lo
que en realidad es lo mismo, de la presencia o ausencia de los substratos y de los
productos que se generan. As, si se consume mucho NADPH+H + en la sntesis de
sustancias orgnicas, habr mucho NADP+ , y ser ste el que capte los electrones
producindose la fotofosforilacin acclica. Si en el tilacoide hay mucho ADP y Pi y
no hay NADP+ , entonces se dar la fotofosforilacin cclica. Ser el consumo por la
planta de ATP y de NADPH+H + , o, lo que es lo mismo, la existencia de los
substratos ADP y NADP+ , la que determinar uno u otro proceso.

J. L. Snchez Guilln Pgina II-5a-7


II) La clula 5a) Fotosntesis

LA FOTOFOSFORILACIN: EXPLICACIN estroma


3H+
DETALLADA Luz Luz
ADP ATP
H+
NADP+ NADPH

NOTA: Se expone aqu una explicacin ms en detalle PhsII Cit b6 PhsI Fd Rd


PQ

ATPasa
de ciertos aspectos de la fotofosforilacin con el P680 Cit f P700
PC
objetivo de que pueda contribuir a una mejor
H2O 2H+ + H+ 3H+
comprensin en aquellos alumnos que estn ms Interior del tilacoide
O2
interesados.

Fig. 18 Fotofosforilacin acclica


A) FOTOFOSFORILACIN AC CLI CA. Al captar un
fotn, la clorofila a II (P680) se excita y aumenta su
poder reductor. Esto le va a permitir reducir, por cesin
3H+
de 2e -, a la plastoquinoma (PQ). Estos dos electrones ATP
Luz ADP
3H+
son cedidos sucesivamente a otros transportadores: estroma
Citocromo b6 (Cit b6 ), citocromo f (Cit f) y
Cit b6 Fd

ATPasa
PQ PhsI
plastocianina (PC), hasta llegar a la clorofila aI (P 700)
Cit f
del fotosistema I. Se establece en consecuencia una P700

cadena de electrones. La clorofila aI (P 700) recibe la PC

3H+ 3H+
energa de otro fotn y se origina una nueva cadena
Interior del tilacoide
redox: P 700, Ferredoxina (Fd), Reductasa (Rd); en la
que el aceptor final es el NADP+ que se reduce a NA-
Fig. 19 Fotofosforilacin cclica.
DPH+H + al captar los dos electrones y dos protones
del medio.
II) LA FOTOFOSFORILACIN C CLICA: El proceso parte de la excitacin de la molcula diana (clorofila P 700) del
fotosistema I. La diferencia con el proceso estudiado anteriormente est en que, en este caso, la ferredoxina (Fd), en
lugar de ceder los 2e- a la reductasa (Rd), los cede a la plastoquinona (PQ). Se establece un proceso cclico en el
que los mismos 2e - estn pasando continuamente por los mismos transportadores: Plastoquinona (PQ), citocromo b6
(Cb6 ), citocromo f (Cf), plastocianina (PC), clorofila aI, etc. En cada vuelta se sintetiza una molcula de ATP de la
misma forma que en la fotofosforilacin acclica .

P700

Fd Fd NADP+

Rd

P680 2e-
NADPH
ADP
PQ
Cb6
Cf
2e- P700 fotones

ATP
H2O

P680 fotones

Fig. 20 Fase luminosa de la fotosntesis.

J. L. Snchez Guilln Pgina II-5a-8


II) La clula 5a) Fotosntesis

B) FASE OSCURA (CICLO DE


CALVIN2 )

En el estroma de los cloroplastos, y


como consecuencia de la fase luminosa, ATP
se van a obtener grandes cantidades de
NADPH+H+
ATP y NADPH+H + , metabolitos 3 que se
van a utilizar en la sntesis de com-
puestos orgnicos. Esta fase recibe el
nombre de Fase Oscura4 porque en ella + 6 H2 O

no se necesita directamente la luz, sino


nicamente las sustancias que se
producen en la fase luminosa. Durante Fig. 21 Ciclo de Calvin.
la fase oscura se dan, fundamentalmen-
te, dos procesos distintos:

-Sntesis de glucosa mediante la incorporacin del CO2 a las cadenas


carbonadas y su reduccin, ciclo de Calvin 5 propiamente dicho.
- Reduccin de los nitratos y de otras sustancias inorgnicas, base de la
sntesis de los aminocidos y de otros compuestos orgnicos.

DESCRIPCIN DEL CICLO DE CALVIN6

1) La ribulosa-5-P (RuP), monosacrido con cinco tomos de carbono (C5 )


fosforilada en posicin cinco, es fosforilada de nuevo por el ATP en el
carbono 1, pasando a Ribulosa-1-5-difosfato (RuBP).

2) La RuBP reacciona con el CO2 obtenindose dos molculas de cido-3-


fosfoglicrico (PGA). Este compuesto contiene una cadena carbonada de tres
tomos de carbono (C3 ). El proceso podra esquematizarse:

1 (C5 ) + CO2 -------> 2 (C3 )

3) El PGA (C3 ) es reducido por el NADPH+H + a gliceraldehdo-3-fosfato


2
En honor a su descubridor, el bioqumico norteamericano Melvin Calvin, premio Nobel de qumica en
el ao 1961 por descubrir los mecanismos de la fotosntesis.

3
Productos que se originan en el metabolismo.

4
Es de destacar, que a pesar de su nombre, la fase oscura se produce tambin por el da; pues, aunque
no precisa luz, s precisa ATP y NADPH y estos slo se originan durante el da en la fase luminosa.

5
Ciertas plantas tropicales, como la caa de azcar, pueden emplear, adems del ciclo de Calvin, otras
vas que son incluso de mayor rendimiento cuando la temperatura es elevada y la planta debe tener cerrados los
estomas. Es la llamada va del C4 o Ciclo de Hatch y Slach. En esta va, el CO2 es incorporado formando un
cido dicarboxlico de cuatro tomos de carbono.

6
Lo que viene a continuacin, se expone a los efectos de que los alumnos puedan interpretar los
esquemas y extraer las consecuencias que se derivan de ellos. No parece conveniente que el alumno deba saberlo de
memoria.

J. L. Snchez Guilln Pgina II-5a-9


II) La clula 5a) Fotosntesis

(PGAL), la reaccin necesita H H


CO2
tambin ATP. H-C-O-H
ATP ADP
H-C-O- P
C=O C=O
H-C-O-H H-C-O-H
Como consecuencia de los H-C-O-H H-C-O-H
H-C-O- P H-C-O- P
procesos 1, 2 y 3, estudiados H H
hasta ahora, vemos que, RuP RuBP

partiendo de una molcula con


cinco tomos de carbono (C5 ) y
H OH
por adicin de una molcula de NADP+ NADPH+H+
C=O
C=O
CO2 , se obtienen dos molculas H-C-O-H H-C-O-H

con tres tomos de carbono cada H-C-O- P


ADP ATP
H-C-O- P 2X
H H
una (C3 ). Esto es: PGAL PGA

C5 + C1 -----> 2 C3
Fig. 22 Primeras etapas del ciclo de Calvin.

El CO2 ha sido integrado en una molcula orgnica, una triosa, el llamado


gliceraldeh do-3-fosfato (PGAL). Si en lugar de una molcula de RuP, partimos
de seis molculas, obtendremos 12 molculas de PGAL.

Fig. 23 Ciclo de Calvin.

4) De cada 12 molculas de PGAL obtenidas, 2 se unen dando una molcula


de glucosa (C6 H12 O6 ) y el resto entra en un complejo proceso que tiene como
objetivo la recuperacin de las 6 molculas de RuP (C5 ). stas, una vez
recuperadas, entran de nuevo en el Ciclo de Calvin.

5) La glucosa as obtenida es polimerizada formndose almidn.

J. L. Snchez Guilln Pgina II-5a-10


II) La clula 5a) Fotosntesis

CICLO DE CALVIN O FASE OSCURA DE LA FOTOSNTESIS


(Estudio detallado)

Se representa aqu el desarrollo del ciclo de Calvin con sus ecuaciones qumicas, con la
finalidad de que aquellos alumnos ms interesados puedan estudiarlo con ms detalle.

CH2O- P
CO2
CO NADPH+H++
NADPH+H ATP
ATP
C=O
2
COOH COOH COOH CHO
H- C-OH H- C-OH + H- C-OH H- C-OH H- C-OH
H- C-OH CH2O- P CH2O- P CH2O- P CH2O- P
CH2O- P NADP++ ADP+Pi
ADP+Pi
NADP
PGA PGA PGA PGAL
RUBP

1) Incorporacin del CO2 a la cadena carbonada de la 2) Reduccin del carbono del CO2 incorporado: Cada
RUBP. El CO2 reacciona con la ribulosa-1-5 difosfato una de las molculas de cido-3- fosfoglicrico (PGA)
(RUBP) para dar dos molculas de cido-3- es reducida por el NADPH a aldehdo-3-fosfoglicrico
fosfoglicrico (PGA). (PGAL). El proceso es endergnico y precisa del ATP.

12NADPH+H++
12NADPH+H
CHO
CH2O- P H- C-OH
6CO2
6CO 12ATP
ATP
C=O 2 12 CHO CHO CHO HO- C-H
6 H- C-OH H- C-OH
12 H- C-OH + H- C-OH H- C-OH
H- C-OH CH2O- P
CH2O- P CH2O- P H- C-OH
CH2O- P 12NADP++ 12ADP+12Pi 2P
12NADP 12ADP+12Pi CH2OH
PGAL PGAL PGAL
RUBP GLU

3) Si los procesos 1 y 2 anteriores se repiten 6 4) Sntesis de glucosa: Dos de estas molculas de


veces obtendremos 12 molculas de aldehdo-3- aldehdo-3-fosfoglicrico (PGAL) se condensan para
fosfoglicrico (PGAL). dar una molcula de glucosa (GLU). Se obtienen,
adems, dos molculas de fosfato inorgnico (P).

CH2OH CH2OH CH2O- P


66ATP
ATP
CHO C=O C=O C=O
10 H- C-OH 6 H- C-OH 6 H- C-OH H- C-OH
6
CH2O- P H- C-OH H- C-OH H- C-OH
CH2O- P CH2O- P 66ADP
ADP CH2O- P
PGAL
RUP RUP RUBP

5) Recuperacin de la ribulosa 1-5 difosfato: Las 6) Recuperacin de la ribulosa 1-5 difosfato: Las 6
otras 10 molculas de aldehdo-3-fosfoglicrico molculas de ribulosa-5-fosfato (RUP) reaccionan con
(PGAL) reaccionan entre s para dar 6 molculas de 6 de ATP para dar 6 de ribulosa-1-5 difosfato (RUBP),
ribulosa-5-fosfato (RUP). cerrndose el ciclo.

J. L. Snchez Guilln Pgina II-5a-11


II) La clula 5a) Fotosntesis

REDUCCIN DE NITRATOS Y SULFATOS

Las plantas pueden obtener el nitrgeno que necesitan a partir de los nitratos (NO3 -),
por ejemplo. Los nitratos son absorbidos por las races y transportados por los vasos
leosos hacia el parnquima cloroflico de la hoja.

En los nitratos el nitrgeno se encuentra en una forma muy oxidada, mientras que
en los compuestos orgnicos se encuentra en forma reducida. La reduccin es
realizada por el NADPH y la energa necesaria para el proceso es aportada por el
ATP. Ambos productos, como ya sabemos, se obtienen en grandes cantidades en la
fase luminosa de la fotosnte sis. Esta es la razn por la que la reduccin del
nitrgeno y su incorporacin en las sustancias orgnicas se realiza en los cloroplas-
tos, y no porque el proceso necesite de una manera directa la luz.

Nota: Para ello, los nitratos son primero reducidos a nitritos y estos a in amonio. El in amonio es
integrado en una cadena carbonada para formar el aminocido glutmico. Es este aminocido el que
servir posteriormente para donar el nitrgeno a aquellas molculas orgnicas que lo precisen.

Por ltimo, indicar que el azufre es absorbido por las races en forma de sulfatos
(SO4 -2 ) u otras sales y, una vez reducido, es incorporado en otras sustancias
orgnicas de una manera similar a la que hemos visto con el nitrgeno.

FACTORES QUE INFLUYEN EN LA FOTOSNTESIS

El rendimiento de la fotosntesis puede ser medido fcilmente por la cantidad de


CO2 absorbido por la planta. En l influyen:

La Intensidad y longitud de onda de la luz.


Ya sabemos que los carotenos y las
clorofilas de los fotosistemas absorben
fotones de una determinada longitud de
Tasa de consumo de CO2

onda. Por lo tanto, si se ilumina una planta


con luz de longitud de onda inadecuada o
con una intensidad insuficiente, la
fotosntesis no podr realizarse y la planta
no se desarrollar.

Temperatura. La fotosntesis, como todo


proceso qumico, est influenciada por la
temperatura, ya que por cada 10 o C de Intensidad de la luz en u.a.

aumento de temperatura, la velocidad se


duplica. Ahora bien, un aumento excesivo de Fig. 24 Variacin en el rendimiento de la
fotosntesis con la intensidad de la luz.
la temperatura desnaturalizar las enzimas
que catalizan el proceso y se producir un
descenso del rendimiento fotosinttico.

Concentracin de CO2 . Si el resto de los factores se mantiene constante, un aumento


en la cantidad de CO2 existente aumentar el rendimiento de la fotosn tesis hasta
llegar a un valor mximo por encima del cual se estabilizar.

J. L. Snchez Guilln Pgina II-5a-12


II) La clula 5a) Fotosntesis

Concentracin de O2 . Un aumento en la con-


centracin de O2 inhibe la fotosntesis, ya

Tasa de consumo de CO2


Temperatura de desnaturalizacin
que el oxgeno inhibe la enzima que
incorpora el CO2 a la Ribulosa-1-5-difosfato
(RuBP).

Temperatura en C

Fig. 25 Variacin en el rendimiento de la


fotosntesis con la temperatura.

J. L. Snchez Guilln Pgina II-5a-13


II) La clula 5a) Fotosntesis

REPRESENTACIN SIMPLIFICADA DE
LOS PROCESOS QUE SE DAN EN EL CLOROPLASTO

Fase luminosa Fase oscura

LA FASE OSCURA

6 6

6 RuBP
12 NADPH PGA
12 ATP 6 ADP

6 ATP

12 NADP+
12 ADP 12 10 6

PGAL
RuP

2
+ 6 H2 O

J. L. Snchez Guilln Pgina II-5a-14


II) La clula 5a) Fotosntesis

5A-2) QUIMIOS NTESIS

LA QUIMIOSNTESIS COMO OTRA FORMA DE NUTRICIN AUTTROFA

La quimiosntesis es tambin una forma de nutricin auttrofa en la que, a diferencia


de la fotosntesis, la energa y los electrones (ATP y NADPH) necesarios para los
procesos de anabolismo van a proceder de la oxidacin de sustancias inorgnicas.

Se trata de una forma de nutricin tpicamente bacteriana. En la que las diferentes


especies se han especializado en la oxidacin de distintos substratos. Segn el
substrato oxidado tendremos:

a) Bacterias nitrosificantes. Como las del


gnero nitrosomonas que obtienen energa en
forma de ATP y coenzimas reducidas por NH4+ H2S FeCO3

medio de la oxidacin de sales amoniacales


(NH4 + ) presentes en los excrementos y en la
materia orgnica en descomposicin.
Bacterias

b) Bacterias nitrificantes. Como las del


gnero nitrobacter que oxidan los nitritos
ATP y NADPH
(NO2 -) a nitratos (NO3 _).

Entre las bacterias nitrosificantes y las Compuestos Compuestos


inorgnicos orgnicos
nitrifi cantes, el nitrgeno incorporado en los
compuestos orgnicos es transformado de
nuevo en nitrgeno contenido en compues- Fig. 26 Esquema simplificado de la
tos inorgnicos que van a parar a los suelos quimiosntesis.
o las aguas. De aqu podr ser absorbido
nuevamente por las plantas, cerrndose as
el ciclo del nitrgeno en la naturaleza.

c) Bacterias del azufre incoloras. Estas bacterias oxidan los sulfuros a azufre y el
azufre a sulfitos o a sulfatos.

d) Bacterias del hierro. Oxidan los compuestos ferrosos a frricos.

Estos dos ltimos tipos de bacterias medran, sobre todo, en los yacimientos de
azufre y hierro de origen volcnico y en particular en los llamados humeros negros.

Es de destacar, que las bacterias quimiosintticas son los nicos seres vivos no
dependientes, ni directa ni indirectamente, de la luz solar.

J. L. Snchez Guilln Pgina II-5a-15


II) La clula 5b) Respiracin celular

5B) OBTENCIN DE ENERGA A PARTIR DE COMPUESTOS


ORGNICOS EN LAS CLULAS VEGETALES Y ANIMALES
(CATABOLISMO DE LA GLUCOSA)

V AS DEL CATABOLISMO
Glucosa

Los organismos auttrofos fijan la energa


solar en forma de energa qumica contenida Glucolisis
en los compuestos orgnicos, glucosa, en
particular. Esta energa, convenientemente O2
liberada, ser utilizada posteriormente por las
Pirvico
partes de la planta que no tienen cloroplas-
tos, como suele ser el caso de las races y
tallos no verdes, o por toda la planta cuando Respiracin Fermentacin
falta la energa solar. Es tambin esta
energa la que permite la vida de los
organismos hetertrofos. La respiracin celular CO2 y H2 O Etanol - Lctico
y las fermentaciones son las vas catablicas
ms corrientes para la obtencin de la ener-
Fig. 1 Principales vas para el
ga contenida en las sustancias orgnicas.
catabolismo de la glucosa.
Ambas vas, no obstante, tienen una primera
fase comn: la glucolisis.

GLUCOLISIS1

La definiremos como el conjunto de reac-


ciones que degradan la glucosa (C6 ) trans-
formndola en dos molculas de cido pir-
vico (PYR) (C3 ). Estas reacciones se realiza
en el hialoplasma de la clula. Es un proceso
anaerobio, que no necesita oxge no, y en el
que por cada molcula de glucosa (GLU) se
obtienen 2 ATP y 2 NADH+ H+ . Fig. 2 Ecuacin global de la glucolisis

Consta de las siguientes reacciones:

10 Fosforilacin de la glucosa (GLU) por el ATP, formndose glucosa-6-fosfato


(G-6-P).

20 La glucosa-6-fosfato (G-6-P) se isomeriza2 a fructosa-6-fosfato (F-6-P).

30 Nueva fosforilacin por el ATP de la fructosa-6-fosfato (F-6-P) que pasa a


fructosa 1,6-difosfato (F-1,6-P).

40 Rotura de la molcula de F-1,6-P en dos molculas: el aldeh do-3-fosfogli-


crico (PGAL) y la dihidroxiacetona fosfato (DHA). Ambas sustancias son
ismeras y se transforman espontneamente una en otra (el equilibrio se
1
Lo que viene a continuacin, se expone a los efectos de que los alumnos puedan interpretar los
esquemas y extraer las consecuencias que se derivan de ellos. No parece conveniente que el alumno deba saberlo de
memoria.

2
Isomerizacin: transformacin de un compuesto qumico-orgnico en otro que sea su ismero.

J. L. Snchez Guilln Pgina II-5b-1


II) La clula 5b) Respiracin celular

alcanza cuando hay un 95% de DHA y un 5% PGAL).

Es de destacar que, hasta ahora, no slo no se ha producido energa, sino


que, incluso, se han consumido dos molculas de ATP.

50 El aldehdo-3-fosfoglicrico (PGAL) se oxida por el NAD+ ; al mismo tiempo


se produce una fosforilacin en la que interviene el fosfato inorgnico3 (H-P),
formndose cido 1,3-difosfoglicrico (1,3-DPGA). Cada molcula de glucosa
(GLU) dar dos molculas de 1,3-DPGA y dos de NADH+H + .

60Fosforilacin del ADP por el 1,3-DPGA, formndose ATP y cido 3-fosfo-


glicrico (3-PGA). Es el primer ATP formado; dos, si tenemos en cuenta la
rotura de la cadena carbonada de la glucosa en dos cadenas de tres tomos
de carbono. Hasta este momento el balance energtico es nulo: dos ATP
consumidos, dos obtenidos.

70 El cido 3-fosfoglicrico (3-PGA) se transforma en cido pirvico (PYR),


sintetizndose una nueva molcula de ATP (dos por cada molcula de glucosa).

CARACTERSTICAS Y SIGNIFICADO BIOLGICO DE LA GLUCOLISIS

- Se realiza tanto en procariotas como en eucariotas.


- En los eucariotas se realiza en el hialoplasma.
- Se trata de una degradacin parcial de la glucosa.
- Es un proceso anaerobio que permite la obtencin de energa a partir de los
compuestos orgnicos en ausencia de oxgeno.
- La cantidad de energa obtenida por mol de glucosa es escasa (2 ATP).
- La glucolisis fue, probablemente, uno de los primeros mecanismos para la
obtencin de energa a partir de sustancias orgnicas en la primitiva atmsfera
sin oxgeno de la Tierra.

CH2OH CH2O - P
O
O O P - O - CH2
H CH2OH
H H H
H H
H OH
OH OH H OH OH H
OH OH H HO

H OH H OH OH H
Glucosa (GLU) Glucosa 6 fosfato (G6P) Fructosa 6 fosfato (F6P)

O
P - O - CH2 CH2 O - P
CHO CH2OH
OH
H H C-OH C=O
H HO
CH2O P CH2O P

OH H
Fructosa 1, 6 difosfato (F1,6P) Aldehido 3 fosfoglicrico (PGAL) Dihidroxiacetona fosfato (DHA)

COO- P COOH COOH


H C-O-H H C-O-H C=O
CH2O P CH2O P CH3

cido 3 fosfoglicrico (3PGA) cido Pirvico (PYR)


cido 1,3 difosfoglicrico (1,3DPGA)

Fig. 3 Compuestos intermediarios de la glucolisis.

3
Es de los pocos casos en los que la fosforilacin se produce por el fosfato inorgnico y no por el
ATP.

J. L. Snchez Guilln Pgina II-5b-2


II) La clula 5b) Respiracin celular

GLUCOLISIS

CH 2OH ADP P O- CH2


ATP
O O
H H H H
H H

OH H OH H
OH OH OH OH

H OH H OH

GLU G-6-P

O
CH2 -O-P CH2 O- P ADP ATP O
CH 2O- P
H CH OH
OH 2

H H OH
OH
H OH
OH H
OH H
F-1,6-P
F-6-P

CHO
O
NAD + NADH
H- C - OH
C -O- P
CH - O - P H - C - OH
2
CH2 - O - P

PGAL H-P

1,3-DPGA

CH2OH
C=O

CH - O - P
2
X2 ADP

DHA

ATP

ATP ADP
O O

C-OH C - OH

C=O H - C - OH

CH2 - O - P
CH 3

PYR 3-PGA

J. L. Snchez Guilln Pgina II-5b-3


II) La clula 5b) Respiracin celular

GLUCOLISIS

CH2O-H ATP CH2O - P CH2O - P


O
O O O P - O - CH2
H H H H H CH2OH
H
H H H
H OH
OH H OH OH H OH OH H
OH OH OH OH H HO

ADP
OH H
H OH H OH H OH

Glucosa-6-P
Glucosa Glucosa-6-P Fructosa-6-P

1) Fosforilacin de la glucosa (GLU) por el ATP, for- 2) La glucosa-6-fosfato (G-6-P) se isomeriza a fruc-
mndose glucosa-6-fosfato (G-6-P). tosa-6-fosfato (F-6-P).
CH2 OH
C=O

ATP CH2O - P
O
O O P - O - CH2
P - O - CH2 P - O - CH2 CH2O -P Dihidroxiacetonafosfato
CH2OH CH2O -P

OH H OH
H H OH

H HO H HO H HO

OH H ADP
OH H OH H CHO
H C-OH
Fructosa-6-P Fructosa-1,6-P Fructosa-1,6-P
CH2O - P

Aldehido 3 fosfoglicrico

3) Nueva fosforilacin por el ATP de la fructosa-6- 4) La fructosa 1,6 difosfato se rompe para dar lugar
fosfato (F-6-P) que pasa a fructosa 1,6-difosfato (F- al aldehdo 3 fosfoglicrico y la dihidroxiacetona-
1,6-P). fosfato.
NAD+ ADP
CHO Pi COO- P COO- P COOH
H C-OH H C-OH H C-OH H C-OH
CH2O - P CH2O - P CH2O - P CH2O - P

Aldehido 3 fosfoglicrico cido 1,3-difosfoglicrico cido 1,3-difosfoglicrico cido -3-fosfoglicrico


NADH+H+ ATP

5) El aldehdo 3 fosfoglicrico se oxida por el NAD+ y 6) El cido1,3 difosfoglicrico reacciona con el ADP
se fosforila por el cido fosfrico para dar el cido1,3 para dar ATP y cido 3-fosfoglicrico.
difosfoglicrico.
ADP
COOH COOH
H C-OH C=O
CH2O - P CH3

cido -3-fosfoglicrico cido pirvico


ATP

7) El cido3 fosfoglicrico reacciona con el ADP para


dar ATP y cido pirvico.

J. L. Snchez Guilln Pgina II-5b-4


II) La clula 5b) Respiracin celular

V AS DEL CATABOLISMO DEL PIRVICO

Para evitar que la glucolisis se detenga por


un exceso de cido pirvico (PYR) y
NADH +H + o por falta de NAD + , se nece-
sitan otras vas que eliminen los productos
obtenidos y recuperen los substratos impres-
cindibles. Esto va a poder realizarse de dos
maneras:

1 0) Respiracin aerobia (catabolismo aerobio).


Cuando hay ox geno, el pirvico es
degradado completamente obtenindose
dixido de carbono (CO2 ). El NADH+H + y
otras coenzimas reductoras obtenidas son Fig. 4 Esquema de una clula vista al
oxidadas y los electrones transportados microscopio ptico. 1) mitocondria; 2) ncleo;
hacia el oxgeno (O2 ), recuperndose el 3) citoplasma; 4 vacuola.
NAD+ y obtenindose H2 O. Este proceso se
realiza en los eucariotas en las mitocondrias.
5

2 0) Fermentacin (Catabolismo anaerbico). 1-2-3 4

Cuando no hay oxgeno el cido pirvico se


transforma de diferentes maneras sin
degradarse por completo a CO2 y H2 O. Este
proceso tiene como objetivo la recuperacin
del NAD+ . En los eucariotas se realiza en el
hialoplasma.

Fig. 5 Mitocondria vista al microscopio


electrnico. 1-2-3) membrana externa, espacio
EL CATABOLISMO AERBICO intermembrana y membrana interna; 4) creta;
(RESPIRACIN AEROBIA) 5) matriz.

MITOCONDRIAS

Aspecto: Son orgnulos muy pequeos,


difci les de observar al microscopio ptico,
al que aparecen como palitos o bastoncitos
alargados. Son orgnulos permanentes de la
clula y se forman a partir de otras mito-
condrias preexistentes.

Forma y nmero: El nmero de mitocondrias


en una clula puede llegar a ser muy elevado Fig. 6 Esquema de la ultraestructura de
(hasta 2000). Normalmente suelen tener una clula animal: 1) nuclolo; 2) mitocondria;
3) retculo endoplasmtico granular; 4)
forma elpti ca, aunque tambin pueden ser aparato de Golgi; 5) ncleo/cromatina; 6) poro
filamentosas u ovoides. Sus dimensiones son de la envoltura nuclear; 7) membrana
muy pequeas (1 a 7m de longitud por 0.5 plasmtica.
m de dimetro). Su forma y tamao depen-
den mucho de las condiciones fisiolgicas de la clula.

J. L. Snchez Guilln Pgina II-5b-5


II) La clula 5b) Respiracin celular

Ultraestructura. Es muy similar en todas las


mitocondrias, independientemente de su for-
ma o tamao. Generalmente se observa la
presencia de una membrana externa y una
membrana interna, ambas similares a las
dems membranas de la clula. La membrana
interna se prolonga hacia el interior en una
especie de lminas llamadas crestas mito-
condriales. Entre ambas membranas hay un
espacio llamado espacio intermembrana (de
Fig. 7 Ultraestructura de la mitocondria.
unos 100 ). Dentro de la mitocondria, entre 1) Membrana externa, 2) Espacio
las crestas, est la matriz mitocondrial. Las intermembrana. 3) Membrana interna. 4)
prote nas de la membrana interna y las de Crestas. 5) Matriz. 6) ADN.
las crestas son muy importantes, ya que
algunas son las responsables de los proce-
sos respiratorios. El interior de la matriz Glcidos
Lpidos O2
mitocondrial es una solucin de prote nas, Otros C.O.

lpi dos, ARN, ADN y ribosomas (mitorri-


bosomas). Es de destacar que el ADN
Respiracin ATP
mitocondrial es similar al ADN de los
procariotas. Esto es, est formado por una
doble cadena de ADN circular asociada a CO2 y H2 O

protenas diferentes de las que se


encuentran en los eucariotas. Fig. 8 Esquema general de la respiracin
celular.

Origen evolutivo: Las mitocondrias, igual que


los plastos, tienen una estructura similar a
los organismos procariticos. Segn la
" Teora endosimbintica" seran organismos
procariotas que han establecido una
simbiosis con las clulas eucariticas a las
que proporcionaran energa a partir de
sustancias orgnicas.

DESCARBOXILACIN OXIDATIVA DEL


CIDO PIRVICO

En condiciones aerbicas el cido pirvico


(PYR) obtenido en la glucolisis y en otros
procesos catablicos atraviesa la membrana
de la mitocondria y en la matriz mitocondrial
va a sufrir un proceso qumico que tiene
dos vertientes:

1 0Descarboxilacin . El cido pirvico


Fig. 10 Descarboxilacin oxidativa del
(PYR) va a perder el grupo CO2
pirvico.
correspondiente al primer carbono, el
carbono que tiene la funcin cido.

J. L. Snchez Guilln Pgina II-5b-6


II) La clula 5b) Respiracin celular

2 0Oxidacin. Al perderse el primer carbono, el segundo pasa de tener un grupo


cetona a tener un grupo aldeh do. Este grupo se oxidar a grupo cido (cido
actico) por accin del NAD+ . En el proceso interviene una sustancia, la
coenzima-A (HS-CoA) que se unir al cido actico para dar acetil-coenzima A
(ACA).

NADH

CO2 NAD+
CoA-SH
COOH H O O
C=O C=O C-OH C S-CoA
CH3 CH3 CH3 CH3

cido cido Acetil


pirvico acetaldehdo actico CoA

Fig. 11 La descarboxilacin oxidativa del cido pirvico (mecanismo).

Como vemos, se van a formar 2 nuevas molculas de NADH+H + por cada molcula
de glucosa (GLU) y, al mismo tiempo, se originan las primeras 2 molculas de CO2 .

EL CICLO DEL CITRATO (CTRICO) O CICLO DE KREBS

Krebs (1938), denomin ciclo del cido


ctrico, y hoy se conoce tambin como ciclo
de Krebs, a la ruta metablica a travs de la
cual el cido actico unido a la coenzima-A
va a completar su oxidacin en la matriz
mitocondrial.

Este ciclo, no slo va a ser la ltima etapa


de la degradacin de los azucares, otros
compuestos orgnicos (los cidos grasos y
determinados aminocidos) van a ser tambin
degradados a acetil-CoA (ACA) e integrados
en el ciclo de Krebs. El ciclo de Krebs es,
por lo tanto, la va fundamental para la
degradacin de la mayora de los Fig. 12 Hans Krebs (Hildesheim
compuestos orgnicos y para la obtencin Alemania -1900-1981).
coenzimas reductoras. Es la va ms impor-
tante para el catabolismo de las sustancias
orgnicas.

J. L. Snchez Guilln Pgina II-5b-7


II) La clula 5b) Respiracin celular

INCORPORACIN DE OTRAS SUSTANCIAS AL CICLO DE KREBS

Al ciclo de Krebs van a incorporarse, adems de las sustancias resultantes del cata-
bolismo de los glcidos, otras que provienen del catabolismo de otras las sustancias
orgnicas. As, por ejemplo, los cidos grasos se degradan en las mitocondrias
transformndose en acetil-CoA. Este proceso se realiza en la matriz mitocondrial y
recibe el nombre de -oxidacin.

Polisacridos Monosacridos

Glucosa

Aminocidos Pirvico Glicerina

Lpidos
Protenas

Aminocidos cidos
Acetil-CoA grasos

Ciclo
De
Krebs

CO2
Fig. 14 Vas metablicas que desembocan en el ciclo de Krebs.

MECANISMO DEL CICLO DE KREBS4

El ciclo de Krebs, como todo proceso ccli co, no tiene ms principio o fin que el
que nosotros queramos ponerle. Es alimentado continuamente en substratos y
continuamente genera productos. Las sustancias intermediarias se recuperan para ser
de nuevo integradas en l. Como una rueda girando sin fin, slo se detendr si faltan
los substratos o si, por exceso de productos, se inhiben las enzimas que participan
en l.

Las diferentes reacciones que se producen en este proceso son:

10 Condensacin de la acetil-CoA (ACA) con el cido oxalactico (OXA) para


formar el cido ctrico (CIT). En este proceso se recupera la CoA-SH.

4
Lo que viene a continuacin, se expone a los efectos de que los alumnos puedan interpretar los esquemas y
extraer las consecuencias que se derivan de ellos. No parece conveniente que el alumno deba saberlo de memoria.

J. L. Snchez Guilln Pgina II-5b-8


II) La clula 5b) Respiracin celular

20 Transformacin del cido ctrico (CIT) en su ismero, el cido isoc trico


(ISO).

30 Descarboxilacin oxidativa del cido isoc trico (ISO) que se transforma en


-cetoglutrico (-KG) con la formacin de CO2 y NADH+H + .

40 Descarboxilacin oxidativa del cido -cetoglutrico (-KG) formndose CO2 ,


NADH+H + y 1 GTP (ATP). El -cetoglutrico (-KG) se transforma en cido
succnico (SUC).

Vemos que en estos momentos ya se ha completado la degradacin del CH3 -CO-


CoA (ACA) con la formacin de 2 molculas de CO2 , cuatro por cada molcula de
glucosa. Tenemos ya las 6 molculas de CO2 que puede originar la glucosa. Las
reacciones que vienen a continuacin van a servir para recuperar el cido oxalactico
(OXA).

50 Oxidacin del cido succnico (SUC) a cido fumrico (FUM). Esta


oxidacin se realiza por la formacin de un doble enlace. Los electrones son
transferidos al FAD que pasa a FADH2 .

60 Adicin de agua al doble enlace formndose el cido mlico (MAL).

70 Oxidacin por el NAD+ del alcohol del cido mlico, que se transforma en
el cido oxalactico (OXA), completndose el ciclo.

Como podemos ver, la cantidad de ATP obtenida en la Glucolisis y en el Ciclo de


Krebs es ms bien escasa. Por el contrario, se van a obtener grandes cantidades de
coenzimas reducidas: NADH+H + y FADH2 que sern oxidadas en la cadena
respiratoria.

O CH2 - COOH HO - CH - COOH


C-S-CoA HO C - COOH H C - COOH
CH3 CH2 - COOH CH2 - COOH

Acetil-Co-A cido ctrico cido isoctrico

O = C - COOH
CH2 - COOH CH - COOH
H C - H
CH2 - COOH CH - COOH
CH2 - COOH

cido cetoglutrico cido succnico cido fumrico

HO - CH - COOH O = CH - COOH
CH2 - COOH CH2 - COOH

cido mlico cido oxalactico

Fig. 15 Compuestos intermediarios del ciclo de Krebs.

J. L. Snchez Guilln Pgina II-5b-9


II) La clula 5b) Respiracin celular

EL CICLO DE KREBS O DEL CTRICO

J. L. Snchez Guilln Pgina II-5b-10


II) La clula 5b) Respiracin celular

DESCRIPCIN DEL CICLO DE KREBS O DEL CTRICO

ACA
O
CH3 -C-S-CoA CH2 - COOH HO- CH - COOH
CH2 - COOH HO C - COOH
O = C - COOH H C - COOH
HO C - COOH CH2 - COOH
CH2 - COOH CH2 - COOH
CH2 - COOH
OXA CoA-SH
CoA-SH CIT ISO
CIT

1) Condensacin de la acetil-CoA (ACA) con el cido 2) Transformacin del cido ctrico (CIT) en su
oxalactico (OXA) para formar el cido ctrico (CIT). ismero, el cido isoctrico (ISO).
En este proceso se recupera la CoA-SH.

NAD++
NAD NAD++
NAD GDP
GDP
HO- CH - COOH O= C - COOH O= C - COOH COOH
H C - COOH HC-H HC-H CH2
CH2 - COOH CH2 - COOH CH2 - COOH CH2 - COOH
NADH
NADH CO2 NADH CO2 GTP
CO2 NADH CO 2 GTP
ISO KG KG SUC

3) Descarboxilacin oxidativa del cido isoctrico 4) Descarboxilacin oxidativa del cido -


(ISO) que se transforma en -cetoglutrico (-KG) cetoglutrico (-KG) formndose CO2, NADH+H + y 1
con la formacin de CO2 y NADH. GTP (ATP). El -cetoglutrico (-KG) se transforma
en cido succnico (SUC).

FAD
FAD HH22OO
COOH COOH COOH
COOH
CH2 CH H-C-OH
CH
CH2 - COOH CH - COOH CH - COOH CH2 - COOH
FADH2
FADH FUM
SUC
2 MAL
FUM

5) Oxidacin del cido succnico (SUC) a cido 6) Adicin de agua al doble enlace formndose el cido
fumrico (FUM). Esta oxidacin se realiza por la mlico (MAL).
formacin de un doble enlace. Los electrones son
transferidos al FAD que pasa a FADH2.

NAD++
NAD
COOH COOH
H-C-OH C=O
CH2 - COOH CH2 - COOH
NADH
NADH
MAL OXA

7) Oxidacin por el NAD+ del alcohol del cido mlico,


que se transforma en el cido oxalactico (OXA),
completndose el ciclo.

J. L. Snchez Guilln Pgina II-5b-11


II) La clula 5b) Respiracin celular

LA FOSFORILACIN OXIDATIVA (CADENA RESPIRATORIA).CONCEPTO Y OBJETIVOS

Concepto: Consiste en un transporte de


electrones desde las coenzimas reducidas,
Acetil-CoA
NADH+H + o FADH2 , hasta el oxgeno. Este
transporte se realiza en la membrana de las
crestas mitocondriales. 3 NAD+

GTP Ciclo de
3 NADH
Objetivos: Es en este proceso donde se Krebs o del
GDP ctrico
obtendr la mayor parte de la energa
2 CO2
contenida en la glucosa y otros compuestos
orgnicos, que ser almacenada en forma de
ATP. Al mismo tiempo se recuperarn las FADH2 FAD

coenzimas transportadoras de electrones en


su forma oxidada, lo que permitir la Fig. 16 Balance del ciclo de Krebs.
oxidacin de nuevas molculas de glucosa y
de otras sustancias orgnicas. Como producto
de desecho se obtendr agua.

ESTRUCTURA DE LA MEMBRANA DE LAS CRESTAS MITOCONDRIALES

Las crestas mitocondriales tienen la estructura de toda membrana biolgica.


Empotradas en la doble capa lipdica se encuentran diferentes sustancias
transportadoras de electrones formando la cadena respiratoria. Estas estn asociadas
formando tres grandes complejos:

- Complejo I (NADH deshidrogenasa).


- Complejo II (Citocromo bc 1 ).
- Complejo III (Citocromo oxidasa).

Existen, adems, otros transportadores: la coenzima Q (Co-Q), el citocromo c (cit c)


y la enzima ATP sintetasa.

Matriz mitocondrial
ATPasa

Espacio intermembrana

Fig. 17 Componentes de la membrana de las crestas mitocondriales.

J. L. Snchez Guilln Pgina II-5b-12


II) La clula 5b) Respiracin celular

LA FOSFORILACIN OXIDATIVA (CADENA RESPIRATORIA): MECANISMO

En la membrana de las crestas mitocondriales se va a realizar un transporte de


electrones desde el NADH o el FADH2 hasta el oxgeno, tal y como se indica en la
figura. Este transporte de electrones va a generar un transporte de protones por parte
de los complejos I, II y III desde la matriz hacia el espacio intermembrana. Cada
complejo ser capaz de bombear dos protones. La salida de estos protones a travs
de las ATPasas servir para sintetizar ATP, 1 ATP por cada dos protones, de forma
similar a como suceda en los cloroplastos. El NADH es capaz de reducir al Complejo
I por lo que se obtendrn 3ATP por cada molcula de NADH. El FADH2 no puede
reducir al complejo I y cede sus dos electrones a la Co-Q (coenzima Q). Esta es la
razn por la que el FADH2 slo genera 2 ATP.

6H+

3ATP
3ADP

ATPasa

Fig. 18 Esquema general de la fosforilacin oxidativa en la cadena respiratoria. Oxidacin del NADH
y sntesis de ATP. Co-Q (coenzima Q) y Cit-c (citocromo C).

Los electrones sern cedidos finalmente al oxgeno que junto con dos protones del
medio darn una molcula de H2 O

2H + + 1/2O 2 + 2e - ---- H2 O

Qu sucede con el NADH de origen


hialoplasmtico en los eucariotas? NAD+
NADH
Hialoplasma
Hemos visto que cada NADH que se origina 2e-

en las mitocondrias rinde 3 ATP. Pero, en los


eucariotas, el NADH que se origina en el 2e-

hialoplasma, en la glucolisis, slo puede Interior mitocondrial

originar 2 ATP. Esto es debido a que este FAD FADH2

NADH no puede atravesar la membrana


Fig. 19 El NADH que se origina en el
mitocondrial y debe ceder sus electrones a hialoplasma cede los electrones a una
una sustancia intermediaria que a su vez los sustancia que los cede a su vez al FAD que
cede al FAD que hay en el interior de la hay en el interior de la mitocondria. Esta es
la razn por la que este NADH slo rinde 2
mitocondria, lo que no sucede en los
ATP.
procariotas.

J. L. Snchez Guilln Pgina II-5b-13


II) La clula 5b) Respiracin celular

LAS FERMENTACIONES ANAERBICAS

La oxidacin del NADH+H + y del FADH2 en la cadena respiratoria tiene como


aceptor final de los electrones al oxgeno. De esta manera, el NAD + se recupera y la
glucolisis y el ciclo de Krebs pueden mantenerse.

Si no hay oxgeno, el NADH+H + y el FADH2 se acumulan y los procesos de


obtencin de energa se interrumpen. En estas condiciones, condiciones anaerobias o
de falta de oxgeno, ciertos microorganismos y, por ejemplo, nuestras clulas
musculares, recuperan las coenzimas oxidadas por diversas vas metablicas
conocidas bajo el nombre de fermentaciones anaerbicas.

Es ms, para algunos microorganismos, los anaerobios estrictos, las fermentaciones


son su nica fuente de energa. Se les llama anaerobios estrictos porque no pueden
vivir en un medio que contenga oxgeno ya que ste les es letal. Otros, los
anaerobios facultativos, utilizan estas vas como mecanismo de emergencia durante
los perodos en los que no disponen de oxgeno.

En las fermentaciones, la glucosa no se degrada totalmente a CO2 y H2 O, sino que


se produce una degradacin incompleta de la cadena carbonada.

Segn el producto obtenido, tendremos las siguientes fermentaciones:

a) Fermentacin lctica.
b) Fermentacin alcohlica.

A) FERMENTACIN LCTICA

La realizan las bacterias del yogur y, por


ejemplo, las clulas musculares, cuando no
reciben un aporte suficiente de oxgeno, lo
que sucede cuando se lleva a cabo un
ejercicio fsico intenso.

Fig. 20 Lactobacillus.
En la fermentacin lctica, el cido pirvico
es reducido a cido lctico por medio del
NADH+H + . De esta manera el NAD + se
recupera y pueden ser degradadas nuevas
molculas de glucosa.

Nuestras clulas musculares emplean la


fermentacin lctica cuando alcanzamos el cido pirvico
cido lctico

90% de la FCM (frecuencia cardiaca


mxima). Si este cido lctico no se elimina
Fig. 21 Fermentacin lctica.
se puede acumular produciendo fatiga
muscular.

J. L. Snchez Guilln Pgina II-5b-14


II) La clula 5b) Respiracin celular

B) FERMENTACIN ALCOHLICA

En la fermentacin alcohlica el cido


pirvico es transformado en alcohol etlico o
etanol.

Esta fermentacin la realizan, por ejemplo,


las levaduras del gnero Saccharomyces . Se
trata de un proceso de gran importancia
industrial que, dependiendo del tipo de
levadura, dar lugar a una gran variedad de
bebidas alcohlicas: cerveza, vino, sidra, etc. Fig. 22 Levaduras.
En la fabricacin del pan se le aade a la
masa una cierta cantidad de levadu-
ra, la fermentacin del almidn de la CO2
harina har que el pan sea ms
esponjoso por las burbujas de CO2 .
En este ltimo caso el alcohol produ-
cido desaparece durante el proceso
cido pirvico etanal Alcohol etlico
de coccin. La fermentacin
alcohlica tiene el mismo objetivo
que la fermentacin lctica: la Fig. 23 Mecanismo de la fermentacin alcohlica.
recuperacin del NAD + en
condiciones anaerbicas.

En la fermentacin alcohlica el ac. pirvico se descarboxila trasformndose en


acetaldeh do y este es reducido por el NADH a alcohol etlico.

ECUACIONES GLOBALES DE LAS DIFERENTES VAS DE


DEGRADACIN DE LA GLUCOSA y RENDIMIENTO ENERGTICO EN
MOLES DE ATP POR MOL DE GLUCOSA

a) Respiracin oxidativa

C6H12O6 + 6O2 6CO2 + 6H2O (36 ATP)

b) Fermentacin lctica

C6H12O6 2 C3H6O3 (2 ATP)

c) Fermentacin alcohlica

C6H12O6 2 C2H5OH + 2CO2 (2 ATP)

J. L. Snchez Guilln Pgina II-5b-15


II) La clula 5b) Respiracin celular

ESQUEMA SIMPLIFICADO DE LA RESPIRACIN CELULAR

O2 Hialoplasma

mitocondria

Acetil-CoA Pirvico
H2O

H+
NADH
Ciclo de
Krebs Glucolisis
e- NAD

ADP+P
Glucosa
ATP

ADP+P
ATP
CO2
Reacciones endergnicas

ESQUEMA GENERAL DE LA GLUCOLISIS Y DE LAS FERMENTACIONES

Glucosa
CH2OH

Glucolisis CH3
2 Etanol

2 cido lctico

2NAD+ 2NAD+

2ATP
F. lctica F. alcohlica

2NADH+H+ 2NADH+H+

2 Etanal
2 CO2
2 cido pirvico

J. L. Snchez Guilln Pgina II-5b-16


II) La clula 5b) Respiracin celular

BALANCE DE LOS PROCESOS DE LA RESPIRACIN CELULAR EN EUCARIOTAS

Coenzimas
Sustancia Sustancia Moles de ATP
Proceso Reducidas y
inicial final (totales)
ATP

2 NADH 4 ATP *
Glucolisis Glucosa 2 cid. pirvico
2 ATP 2 ATP

Descarboxilacin 2 cid. 2 acetil-Co A


2 NADH 6 ATP
del cido pirvico pirvico 2 CO2

6 NADH
18 ATP
2 FADH2
Ciclo de Krebs 2 acetil-Co A 4 CO2 4 ATP
2 GTP
2 ATP

Glucosa 6 CO2
Balance global 36 ATP**
6 O2 6 H2O

* 6 ATP en procariotas
* * 38 ATP en procariotas

J. L. Snchez Guilln Pgina II-5b-17


III) La informacin celular 1) El ncleo celular

III

INFORMACIN CELULAR

POR QU ES NECESARIA LA INFORMACIN CELULAR?

En toda clula, tanto procariota como


eucariota, se dan complejos procesos
metablicos y fisiolgicos con la finalidad
de obtener materiales y energa. Para Regulacin de la
asegurar estos procesos la clula necesita expresin gnica
una gran variedad de protenas, enzimas,
particularmente. Se calcula que nuestras
clulas precisan a lo largo de su ciclo vital Informacin
unas 30.000 protenas diferentes. Cada una celular

de estas protenas consta, por trmino


medio, de unos 500 aminocidos que deben expresin

de estar unidos en su orden correcto. Un


slo cambio puede alterar el centro activo
Sntesis de
de la molcula y hacer que la enzima, si la protenas
protena en cuestin es una enzima, no
pueda realizar su funcin. Si multiplicamos
30.000 protenas por 500 aminocidos cada
una nos da un total de 15x10 6 . sta es la
Fig. 1 La informacin celular.
informacin necesaria, como mnimo, para
poder sintetizar todas las protenas
celulares. Si codificsemos esta informacin con un slo carcter y la escribisemos
en una hoja de papel, a 60 caracteres por lnea y 50 lneas por pgina (3000
caracteres en total por pgina), necesitaramos un total de 5000 pginas para
codificar toda esta informacin.

Adems, la clula no slo requiere protenas sino que tambin necesita regular y
controlar los procesos que se dan en ella.

Toda esta gran cantidad de informacin se encuentra en el ncleo de las clulas


eucariotas y en el genoma o cromosoma de las clulas procariotas.

Dnde est codificada esta informacin, cmo est codificada, cmo se transcribe,
cmo se traduce, cmo pasa de unas clulas a otras en el proceso de divisin
celular y de unos organismos a otros en los procesos de reproduccin y las
consecuencias de las alteraciones que se producen en ella (mutaciones) es lo que
estudiaremos a continuacin.

J. L. Snchez Guilln Pgina III-1-1


III) La informacin celular 1) El ncleo celular

EL NCLEO

EL NCLEO EN INTERFASE

El ncleo es una estructura caracterstica


de las clulas eucariticas. Fue descubierto
por Robert BROWN en 1831 y contiene la
informacin gentica, esto es, la A B

informacin necesaria para que se puedan


realizar las funciones celulares y, ms en Fig. 2 A) ncleo en reposo (interfase) y
concreto, la informacin para la sntesis de ncleo en divisin (mitosis).
las protenas.

FUNCIONES QUE SE DAN EN EL NCLEO


CELULAR EN INTERFASE

1) La trasmisin de la informacin gentica


de los ascendientes a los descendientes y
de una generacin celular a la siguiente se
realiza a travs del ncleo celular. Debido a
esto en el ncleo es necesario que se
realice la duplicacin o replicacin del ADN.

2) Los procesos de sntesis del ARN,


trascripcin de la informacin gentica para
la posterior sntesis de protenas en el
hialoplasma, se dan tambin en el ncleo.

Por ltimo, esta informacin se traducir


Fig. 3 Clula animal vista al M.E.T.
en el citoplasma celular, pues en l se
realizar la sntesis de protenas.

EL NCLEO EN INTERFASE. CARACTERSTICAS

Aspecto. Generalmente se presenta como


una esfera de gran tamao que se destaca
del citoplasma y que est separada de l
por una envoltura nuclear, que es un
elemento del retculo endoplasmtico
granular que rodea el material nuclear. El
contenido del ncleo se revela al
microscopio ptico como ms o menos
homogneo, salvo por la presencia de
pequeas estructuras esfricas llamadas
nuclolos.

Nmero. Normalmente las clulas slo


tienen un ncleo. El paramecio, no
obstante, tiene dos ncleos: uno mayor, el
macroncleo, y otro menor, el microncleo. Fig. 4 Aspecto tpico del ncleo celular.
Las fibras musculares estriadas y los
osteoclastos presentan gran cantidad de
ncleos. Tambin pueden tener muchos

J. L. Snchez Guilln Pgina III-1-2


III) La informacin celular 1) El ncleo celular

ncleos las clulas cancerosas.


M

Forma. Si la clula es isodiamtrica -con


dimensiones similares en todas las
direcciones del espacio (por ejemplo:
esfrica o cbica)- el ncleo, normalmente, m

es esfrico. En las clulas donde dominan


dos dimensiones, clulas aplanadas, el Fig. 5 M) macroncleo y m) microncleo,
ncleo suele ser discoidal. En las clulas del paramecio.
alargadas el ncleo suele ser elptico.
Ciertos tipos celulares tienen ncleos
irregulares; as, por ejemplo, algunos
glbulos blancos tienen un ncleo lobulado
muy irregular y el stentor, organismo
unicelular ciliado, tiene un ncleo de forma
arrosariada.

Tamao. El tamao del ncleo es bastante


constante en una misma especie celular. El
ncleo es muy voluminoso en las clulas Fig. 6 Ncleo en forma de u de la
indiferenciadas o en las muy activas. Si el vorticela.
ncleo sufre un aumento en su volumen es
un indicio de que la clula est prxima a
entrar en divisin.

EL NCLEO EN INTERFASE. ESTRUCTURA

Al MET podemos distinguir en el ncleo


las siguientes estructuras:

La envoltura nuclear. Constituida por dos


membranas unitarias: una exterior y otra
interior con un espacio entre ellas llamado
espacio perinuclear. La envoltura nuclear Fig. 7 Ncleo arrosariado del stentor,
proviene del retculo endoplasmtico organismo unicelular ciliado.
granular y est conectada con l. Adosados
a la membrana exterior hay ribosomas,
como ocurre en el retculo endoplasmtico
granular. La envoltura nuclear no es
continua, pues tiene un gran nmero de
poros de 500 a 700 de dimetro con
una compleja estructura formada por 8
partculas esfricas de naturaleza protenica.
Los poros permiten el paso de grandes
molculas (ARN, protenas) e impiden
diferencias osmticas entre el ncleo y el
citoplasma. En el interior del ncleo y
adosada a la membrana interna
encontramos una estructura protenica
formada por protenas fibrilares: la lmina
nuclear, de un espesor de 150 a 500 . Su
funcin es inducir la aparicin y Fig. 8 Clula vista al M.E.T. 1) aparato
desaparicin de la envoltura nuclear y de Golgi; 2) mitocondria; 3) REG; 4) nuclolo;
resulta fundamental para la constitucin de 5ncleo; 6) membrana plasmtica;
los cromosomas a partir de la cromatina.

J. L. Snchez Guilln Pgina III-1-3


III) La informacin celular 1) El ncleo celular

El nucleoplasma: Es el contenido nuclear


indiferenciado. Se trata de un gel de
estructura y composicin similar al
hialoplasma, pero no tiene ni microt bulos nuclolo
ni microfilamentos. Est formado por agua,
protenas, ARN e iones. En l se encuentra
inmersa la cromatina y se dan los procesos
REG
de sntesis del ARN (transcripcin) y la
replicacin del ADN.
Envoltura
La cromatina. Llamada as por teirse nuclear

fuertemente con ciertos colorantes, est


constituida por ADN (la mayor parte del
ADN celular est en la cromatina), protenas
cromatina
y algo de ARN. Entre las protenas se
encuentran las histonas, que tienen un
elevado porcentaje de aminocidos bsicos Fig. 9 Fragmento de una clula visto al
y, aparte de empaquetar el ADN, MET.
neutralizan el fuerte carcter cido de los
cidos nucleicos. Al parecer, tambin
controlan la actividad de los genes. Envoltura nuclear
REG

Adems de las histonas, podemos nuclolo


encontrar en la cromatina otras protenas,
como la miosina y la actina. Estas protenas
son las responsables en el msculo de la
contraccin muscular y en el ncleo podran
estar relacionadas con la formacin del
cromosoma metaf sico y con la separacin
de las cromtidas en la divisin celular.

La cromatina est estructurada en


elementos individuales llamados nucleoplasma
cromosomas. Hay un nmero constante de cromatina

cromosomas por ncleo celular, por


individuo y por especie. Los cromosomas Fig. 10 Esquema de la ultraestructura del
interf sicos darn lugar, cuando la clula se ncleo celular.
divida, a los metaf sicos.

El ADN nuclear representa el genoma de las clulas eucariotas

El nuclolo. Es una estructura aproximadamente esfrica, visible incluso al


microscopio ptico. Suele destacarse del resto del contenido nuclear por ser ms
brillante. Su tamao es de 1 a 3m.

Caracter sticas del nucl olo: Aparece con frecuencia asociado a zonas de cromatina
densa, los llamados organizadores nucleolares, pues se forma a partir de ellos. Las
clulas jvenes tienen por lo general uno o dos nuclolos. Algunas clulas tienen
ms de dos, segn el nmero de organizadores nucleolares que tengan. Las clulas
viejas tienen uno o ninguno. Su nmero, por lo tanto, depende de la edad y
tambin del estado funcional de la clula. Cuando la clula se va a dividir
desaparece.

J. L. Snchez Guilln Pgina III-1-4


III) La informacin celular 1) El ncleo celular

Estructura del nucl olo: No presenta


membrana de separacin con el ncleo y al
MET tiene un aspecto heterogneo,
grumoso, con zonas ms densa y otras
menos densas. Est constituido bsicamente
por ARN, protenas y ADN asociado.

Funciones del nucl olo: Su funcin principal


es la sntesis de ARNr (el ARN de los
ribosomas) y el ensamblaje de estos
mismos ribosomas. El ARN ribosomal se
sintetiza en el propio nuclolo y las
Fig. 11 Ultraestructura del nuclolo: 1)
protenas de los ribosomas provienen del
Cromatina del organizador nucleolar; 2) parte
citoplasma y pasa al interior del ncleo a granular; 3) parte fibrosa.
travs de los poros de la envoltura nuclear.

J. L. Snchez Guilln Pgina III-1-5


III) La informacin celular 2) cidos nucleicos

2) LOS CIDOS NUCLEICOS

CONCEPTO

Qumicamente, los cidos nucleicos son


polme ros constituidos por la unin mediante
enlaces qumicos de unidades menores
llamadas nucletidos. Los cidos nucleicos
son compuestos de elevado peso molecular,
esto es, son macromolculas.
Fig. 1 Pirimidina.

FUNCIONES GENERALES

Los cidos nucleicos, llamados as porque


en un principio fueron localizados en el
ncleo celular, son las molculas de la
herencia y por lo tanto van a participar en
los mecanismos mediante los cuales la
informacin gentica se almacena, replica y
transcribe. sta no va a ser su nica Fig. 2 Purina.
funcin. Determinados derivados de estas
sustancias: los nucletidos, van a tener
otras funciones biolgicas, entre las que pueden destacarse, como ejemplo, la de
servir de intermediarios en las transferencias de energa en las clulas (ATP, ADP y
otros) o en las transferencias de electrones (NAD+ , NADP+ , FAD, etc.).

LOS NUCLETIDOS: COMPONENTES

Los nucletidos estn formados por: una


base nitrogenada (BN), un azcar (A) y
cido fosfrico (P); unidos en el siguiente
orden: PABN
Adenina

LAS BASES NITROGENADAS

Son sustancias derivadas de dos compues-


tos qumi cos: la purina y la pirimidina. Las
que derivan de la purina son las bases pri-
cas. En los nucletidos vamos a encontrar,
normalmente, dos base pricas: la adenina
(A) y la guanina (G). Las que derivan de la
pirimidina se llaman pirimid nicas. Tres son Guanina
las bases pirimid nicas presentes en los
cidos nucleicos: la citosina (C), la timina Fig. 3 Bases pricas.
(T) y el uracilo (U).

J. L. Snchez Guilln Pgina III-2-1


III) La informacin celular 2) cidos nucleicos

En ciertos casos, aunque esto pasa muy raramente, pueden encontrarse en los
cidos nucleicos otras bases diferentes de estas cinco, por lo general derivados
metilados de ellas.

Fig. 4 Citosina. Fig. 5 Timina. Fig. 6 Uracilo.

EL AZCAR (GLCIDO)

El azcar que interviene en los nucletidos


puede ser o la ribosa (R) o la desoxirribosa
(dR). Ambas son aldopentosas y las
Ribosa
encontraremos en los nucletidos como -
furanosas.

Conviene destacar que la nica diferencia


entre ambas est en que en el carbono 2 de
la desoxirribosa hay un hidrgeno (-H) en
lugar del grupo alcohol (-OH).

Desoxirribosa
LOS NUCLESIDOS
Fig. 7 La ribosa y la desoxirribosa.
El azcar y la base nitrogenada se unen
entre s como se indica en las figuras
formando un nuclesido. El enlace se forma
entre el carbono anomrico del azcar y uno
de los nitrgenos de la base nitrogenada, en
concreto, el indicado en las figuras. En la
unin se forma una molcula de agua. Este
enlace recibe el nombre de enlace N-
glicosdico.

ESTRUCTURA DE LOS NUCLETIDOS

Los nucletidos son los monmeros que


constituyen los cidos nucleicos. Se forman
cuando se unen el cido fosfrico y un
nuclesido. Es una unin fosfoster entre un
OH del cido fosfrico y el OH situado en el
carbono 5 del azcar, con formacin de una Fig. 8 Nuclesido pirimidnico.
molcula de agua. Segn el azcar sea la

J. L. Snchez Guilln Pgina III-2-2


III) La informacin celular 2) cidos nucleicos

ribosa o la desoxirribosa, tendremos ribonucletidos o desoxirribonucletidos. La


timina nunca forma parte de los ribonucletidos y el uracilo no forma parte de los
desoxirribonucletidos.

NUCLETIDOS O DERIVADOS DE
NUCLETIDOS DE INTERS BIOLGICO.

Algunos nucletidos cumplen funciones por


s mismos. As, por ejemplo:

a) Nucletidos que intervienen en las


transferencias de energa : Se trata de
molculas que captan o desprenden energa
al transformarse unas en otras. As, el ATP
desprende energa cuando se hidroliza,
transformndose en ADP y fosfato inorg-
nico (Pi). Por el contrario, el ADP almacena
energa cuando reacciona con el fosfato
inorgnico y se transforma en ATP y agua.
De esta forma se transporta energa (unas 7
kilocaloras por mol de ADP/ATP) de Fig. 9 Nucletido. Las flechas indican los
aquellas reacciones en las que se desprende enlaces fosfoster (roja) y N-glicosdico (verde).

(exergnicas) a aquellas en las que se


necesita (endergnicas).

Ejemplos de nucletidos transportadores de energa:

- AMP (adenosina-5'-monofosfato) A-R-P


- ADP (adenosina-5'-difosfato) A-R-P-P
- ATP (adenosina-5'-trifosfato) A-R-P-P-P
- GDP (guanosidina-5'-difosfato) G-R-P-P
- GTP (guanosidina-5'-trifosfato) G-R-P-P-P

b) Nucletidos que intervienen en los procesos de xido-reduccin. Estas molculas


captan electrones de molculas a las que oxidan y los ceden a otras molculas a las
que a su vez reducen. As, el NAD + puede captar 2e - transformndose en su forma
reducida, el NADH, y ste puede ceder dos electrones a otras sustancias,
reducindolas y volviendo a transformarse en su forma oxidada, el NAD + . As, se
transportan electrones de aquellas reacciones en las que se desprende a aquellas en
las que se necesitan.

Ejemplos de nucletidos transportadores de electrones:

- NAD+ /NADH (Nicotinamida-adenina-dinucletido) oxidado y reducido, respecti-


vamente.
- NADP+ /NADPH (Nicotinamida-adenina-dinucletido-fosfato), oxidado y
reducido.
- FAD/FADH2 (Flavina-adenina-dinucletido), oxidado y reducido.

J. L. Snchez Guilln Pgina III-2-3


III) La informacin celular 2) cidos nucleicos

c) Nucletidos reguladores de procesos metablicos. Algunos nucletidos cumplen


funciones especiales como reguladores de procesos metablicos, por ejemplo el AMPc
(adenosina-3',5'- monofosfato) o AMP ccli co, en el que dos OH del fosfato esterifican
los OH en posiciones 3 y 5 de la ribosa formando un ciclo. Este compuesto qumico
acta en las clulas como intermediario de muchas hormonas.

LOS POLINUCLETIDOS

Dos nucletidos van a poder unirse entre


s mediante un enlace sterfosfato
(fosfoster). Este enlace se forma entre un
OH del cido fosfrico de un nucletido y el
OH (hidroxilo) del carbono nmero 3 del
5
azcar del otro nucletido con formacin de
una molcula de agua. La unin de otros
nucletidos dar lugar a un polinucletido.

Es de destacar que en toda cadena de


polinucletidos el nucletido de uno de los
extremos tendr libre el OH del azcar en
posicin 3, ste ser el extremo 3' de la
cadena. El cido fosfrico del nucletido que
se encuentre en el extremo opuesto tambin
estar libre, ste ser el extremo 5'. Esto 3
marca un sentido en la cadena de polinu-
cletidos. Toda cadena podr considerarse Fig. 10 Dinucletido.
bien en sentido 3' 5' o en sentido 5' 3' y
as habr que indicarlo.
5 P dR A

P dR G
ADN Y ARN: DIFERENCIAS A NIVEL
QUMICO P dR C

P dR T
- El ADN (cido desoxirribonucleico) sus
P dR G
nucletidos tienen desoxirribosa como azcar
y no tiene uracilo. 3
P dR A
- El ARN (cido ribonucleico) tiene ribosa y
no tiene timina.
Fig. 11 Ejemplo de cadena polinucleo-
tdica.

EL ADN (DNA)

Concepto: Qumicamente son polinucletidos


constituidos por d-AMP, d-GMP, d-CMP y d-
TMP. Los nucletidos del ADN no tienen ni
uracilo, ni ribosa, como ya se ha dicho.

Caractersticas: Los ADN celulares tienen


Fig. 12 Modelo de la estructura del ADN.
una elevada masa molecular, muchos
millones de daltons. As, por ejemplo: el
genoma humano est formado por 3x10 9

J. L. Snchez Guilln Pgina III-2-4


III) La informacin celular 2) cidos nucleicos

pares de nucletidos. Esto hace que sean


molculas de una gran longitud; por ejemplo:
1,7 m en el caso del virus de la poliomie-
litis y 2,36 m si sumamos todo el ADN de
todos los cromosomas de una clula humana.

El ADN fue aislado por primera vez en


1869, pero hasta 1950 no se empez a
conocer su estructura. Se encuentra en el
ncleo de las clulas eucariotas asociado a
prote nas (histonas y otras) formando la
cromatina, sustancia que constitu ye los
cromosomas y a partir de la cual se Fig. 13 J. Watson y F. Crick.
transcribe la informacin gentica. Tambin
hay ADN en ciertos orgnulos celulares (por
ejemplo: plastos y mitocondrias).

ESTRUCTURA DEL ADN T A

Se pueden distinguir 3 niveles estructurales:

-Estructura primaria: La secuencia de los


nucletidos.
-Estructura secundaria: La doble hlice.
-Estructura terciaria: Collar de perlas,
C G
estructura cristalina, ADN superenrollado.

En las clulas eucariotas, a partir de la


estructura 30, se dan otros niveles de
empaquetamiento de orden superior. Fig. 14 Puentes de hidrgeno (.....) entre
bases complementarias en el ADN.

ESTRUCTURA PRIMARIA DEL ADN.

Es la secuencia de nucletidos de una


cadena o hebra. Es decir, la estructura
primaria del ADN viene determinada por el
orden de los nucletidos en la hebra o
cadena de la molcula. Para indicar la
secuencia de una cadena de ADN es
suficiente con los nombres de las bases o
su inicial (A, T, C, G) en su orden correcto
y los extremos 5' y 3' de la cadena
nucleotdica.

As, por ejemplo:

5'ACGTTTAACGACAAGGACAAGTATTAA3'

La posibilidad de combinar cuatro nucle-


tidos diferentes y la gran longitud que Fig. 15 Modelo de la estructura
pueden tener las cadenas polinucleotdicas, secundaria del ADN.
hacen que pueda haber un elevado nmero
de polinucletidos posibles, lo que determina que el ADN pueda contener el mensaje
biolgico o informacin gentica y explica la diversidad del mensaje gentico de todos
los seres vivos.

J. L. Snchez Guilln Pgina III-2-5


III) La informacin celular 2) cidos nucleicos

ESTRUCTURA SECUNDARIA DEL ADN.

Datos preliminares:

A) A finales de los aos 40 Erwin


CHARGAFF y sus colaboradores estudiaron
los componentes del ADN y emitieron los
siguientes resultados:

La concentracin de bases vara de una


especie a otra. El porcentaje de A, G, C y T
es el mismo en los individuos de la misma
Fig. 16 Doble hlice del ADN.
especie y no por esto el mensaje es el
mismo.

Tejidos diferentes de la misma especie tienen la misma composicin en bases.

La composicin en bases del ADN de una misma especie no vara con la edad del
organismo ni con su estado nutricional ni con las variaciones ambientales.

Las densidades y viscosidades corresponden a la existencia de enlaces de hidrgeno


entre los grupos NH y los grupos CO.

La concentracin de Adenina es igual a la de Timina, y la de Citosina a la de


Guanina. Las dos primeras establecen dos puentes de hidrgeno entre ellas, y las
ltimas tres puentes. La cantidad de purinas es igual a la cantidad de pirimidinas.

B) Por medio del mtodo analtico de difraccin de rayos X, FRANKLIN y WILKINS


observaron una estructura fibrilar de 20 (Amstrongs) de dimetro con repeticiones
cada 3,4 y una mayor cada 34 .

C) WATSON y CRICK postularon en 1953 un modelo tridimensional para la estructura


del ADN que estaba de acuerdo con todos los datos disponibles anteriores: el modelo
de doble hlice. Este modelo, adems de explicar cmo era el ADN, sugera los
mecanismos que explicaban su funcin biolgica y la forma como se replicaba.

Segn el modelo de la doble hlice de


WATSON y CRICK:

11) El ADN estara constituido por dos


cadenas o hebras de polinucletidos enro-
lladas helicoidalmente en sentido dextrgiro
sobre un mismo eje formando una doble
hlice.
21) Ambas cadenas seran antiparalelas, una
ira en sentido 3' 5' y la otra en sentido
inverso, 5' 3'. Fig. 17 Doble hlice del ADN.
31) Los grupos fosfato estaran hacia el

J. L. Snchez Guilln Pgina III-2-6


III) La informacin celular 2) cidos nucleicos

exterior y de este modo sus cargas


negativas interaccionaran con los cationes
A T C G A T C G G G C

presentes en el nucleoplasma dando ms T A G C T A G C C C

T
estabilidad a la molcula.

A
G
primer

C
41) Las bases nitrogenadas estaran hacia el

T
A T C G A T C G G

interior de la hlice con sus planos paralelos T A G C T A G C C

entre s y las bases de cada una de las hli-

C
A
primer

ces estaran apareadas con las de la otra

G
C
A U C G A T C G G G

T
asocindose mediante puentes de hidrgeno.

A
T A G C T A G C C C

51) El apareamiento se realizara nicamente


entre la adenina y la timina, por una parte,
Fig. 18 Replicacin del ADN.
y la guanina Y la citosina, por la otra1 . Por
lo tanto, la estructura primaria de una
cadena estara determinada por la de la otra, ambas cadenas seran complementa-
rias.

La complementariedad de las cadenas sugiere el mecanismo por el cual el ADN se


copia -se replica- para ser trasferido a las clulas hijas. Ambas cadenas o hebras se
pueden separar parcialmente y servir de molde para la sntesis de una nueva cadena
complementaria (sntesis semiconservativa).

PROPIEDADES DE LA ESTRUCTURA SECUNDARIA DEL ADN: DESNATURALIZACIN

Si una disolucin de ADN se calienta


suficientemente ambas cadenas se separan,
pues se rompen los enlaces de hidrgeno
% del par C-G en la muestra

que unen las bases, y el ADN se


desnaturaliza. La temperatura de
desnaturalizacin depende de la proporcin
de bases. A mayor proporcin de C-G,
mayor temperatura de desnaturalizacin,
pues la citosina y la guanina establecen tres
puentes de hidrgeno, mientras que la
adenina y la timina slo dos y, por lo tanto,
a mayor proporcin de C-G, ms puentes de
hidrgeno unirn ambas cadenas. La Temperatura en C

desnaturalizacin se produce tambin


variando el pH o a concentraciones salinas Fig. 19 Temperatura de desnaturalizacin
del ADN en funcin del tanto por ciento de
elevadas. Si se restablecen las condiciones,
citosina-guanina.
el ADN se renaturaliza y ambas cadenas se
unen de nuevo.

ESTRUCTURA TERCIARIA DEL ADN EN LAS CLULAS EUCARIOTAS.

Las grandes molculas de ADN de las clulas eucariotas estn muy empaquetadas o-
cupando as menos espacio en el ncleo celular y adems como mecanismo para
preservar su transcripcin.

Como hemos visto, en las clulas eucariotas el ADN se encuentra en el ncleo

1
El par A-G no puede formarse por ser ambas bases demasiado grandes, y el par C-T por estar a demasiada
distancia.

J. L. Snchez Guilln Pgina III-2-7


III) La informacin celular 2) cidos nucleicos

asociado a ciertas protenas: nucleo-


protenas, formando la cromatina. En la cro- nucleosoma

matina, la doble hlice de ADN se enrolla


alrededor de unas molculas proteicas glo-
bulares, las histonas, formando los nucleoso- ADN
espaciador Histona H1

mas. Cada nucleosoma contiene 8 histonas


y la doble hlice de ADN da dos vueltas a
su alrededor (200 pares de bases). El con- Fig. 20 Fibra nucleosmica en collar de
junto, si no est ms empaquetado an, perlas.
forma una estructura arrosariada llamada
collar de perlas. Ahora bien, los nucleoso-
Histona H1
mas pueden empaquetarse formando fibras
de un grosor de 30 nm (fibra de 30 nm). ADN
Segn el modelo del solenoide las fibras se
forman al enrollarse seis nucleosomas por Ncleo de
vuelta alrededor de un eje formado por las histonas del
nucleosoma

histonas H1.

NIVELES SUPERIORES DE Fig. 21 Nucleosoma.


EMPAQUETAMIENTO

Los siguientes niveles de empaquetamiento


no estn an aclarados del todo pero,
parece ser, que cada fibra se volvera a
enrollar formando un bucle (cada bucle
tendra 50 millones de pares de bases), seis
bucles se empaquetaran asocindose a un
" esqueleto nuclear" producindose un
rosetn, 30 rosetones formaran una espiral
y 20 espirales formaran una cromtida.
Todo ello producira un gran acortamiento
de las largas cadenas de ADN. Fig. 22 Empaquetamiento de los
nucleosomas formando una fibra de 30nm,
En los espermatozoides el ADN se encuen- segn el modelo del solenoide.
tra an mucho ms empaquetado, se dice
que tiene " estructura cristalina".

Los ADN de las bacterias, virus, mitocon-


drias y plastos no presentan estructuras tan
complejas y no estn asociados a histonas,
aunque s estn asociados a otras
protenas.

TIPOS DE ADN

Segn su estructura se distinguen los


siguientes tipos de ADN: Fig. 23 Cromosomas de una clula en
divisin. Cada cromosoma tiene dos
- Monocatenarios o de una cadena; por cromtidas. En los cromosomas el ADN est
ejemplo los de algunos virus. fuertemente empaquetado y asociado a
protenas.
- Bicatenarios, con dos hebras o cadenas
(algunos virus, las bacterias y los
eucariotas).

J. L. Snchez Guilln Pgina III-2-8


III) La informacin celular 2) cidos nucleicos

A su vez, y en ambos casos, el ADN puede ser:

- Lineal, como por ejemplo el del ncleo de las clulas eucariotas y el de algunos
virus.
- Circular, como el de las mitocondrias, cloroplastos, bacterias y algunos virus.

EL ARN (RNA). DIFERENCIAS CON EL ADN

El ARN, cido ribonucleico, es un polirribonucletido que, a diferencia del ADN, no


contiene ni desoxirribosa ni timina, pero s ribosa y uracilo. El ARN no forma dobles
cadenas, salvo en ciertos virus (por ej. los reovirus). Lo que no quita que su estruc-
tura espacial pueda ser en ciertos casos muy compleja.

CLASES DE ARN

Por su estructura y su funcin se distinguen tres clases de ARN:

- El ARNm (ARN mensajero) es un polirri-


bonucletido constituido por una nica
cadena sin ninguna estructura de orden
superior. Su masa molecular suele ser
elevada. Este ARN se sinteti za en el ncleo
celular y pasa al citoplasma transportando la
informacin para la sntesis de prote nas.
La duracin de los ARNm en el citoplasma
celular es de escasos minutos siendo degra-
dados rpidamente por enzimas espec ficas.

- El ARNt (ARN de transferencia) transporta


los aminocidos para la sntesis de
protenas. Est formado por una sola
cadena, aunque en ciertas zonas se encuen-
tra replegada y asociada internamente
mediante puentes de hidrgeno entre bases
complementarias. Su peso molecular es del Fig. 24 ARNt. La lnea es la cadena de
orden de 25.000 da. Est formado por entre polinucletidos y los rectngulos las bases o
70 y 90 nucletidos y constituye el 15 % los pares de bases. 1) brazo aceptor de ami-
nocidos; 2) bucle anticodon.
del total del ARN de la clula. Se sintetiza
en el ncleo y sale hacia el citoplasma para
realizar su funcin. En el ARNt podemos distinguir un brazo aceptor de aminocidos
abierto y un bucle anticodon.

El ARNr (ARN ribosomal) es el ARN de los ribosomas, cuya funcin es poco


conocida.

Los ARN vricos. Algunos virus tienen como material gentico ARN bicatenario.

J. L. Snchez Guilln Pgina III-2-9


III) La informacin celular 2) cidos nucleicos

ESTRUCTURAS TERCIARIA Y SUPERIOR DEL ADN (SUPERENROLLAMIENTO)

Dos cromtidas 2x10


vueltas de espiral

1 vuelta de espiral
(30 rosetones)

1 rosetn (6 bucles)

1 bucle

Fibra de 30 nm

Collar de perlas
(nucleosoma)

ADN

J. L. Snchez Guilln Pgina III-2-10


III) La informacin celular 3) El gen

3) EL ADN COMO PORTADOR DE LA INFORMACIN GENTICA.

)QU ES LA GENTICA MOLECULAR?

Definiremos la Gentica como la parte de la Biologa que se ocupa del estudio de la


herencia biolgica, intentando explicar los mecanismos y circunstancias mediante los
cuales se rige la transmisin de los caracteres de generacin en generacin. La
gentica molecular estudia estos procesos desde un punto de vista qumico.

)CUL ES LA NATURALEZA DEL MATERIAL GENTICO

I) LOS EXPERIMENTOS DE GRIFFITH: La bacteria Diplococcus pneumoniae es un


pneu-mococo, una bacteria causante de enfermedades. Existen dos cepas, la S
(Smooth = lisa), virulenta, y la R (rough = rugosa), no virulenta. Las bacterias S,
vivas, producen la muerte en los ratones, pero no la producen si estn muertas. Las
segundas no son capaces de desarrollar la enfermedad. En 1928 Griffith realiz con
estas bacterias las siguientes experiencias:

Experiencia 1: Al inyec- Experiencia 2: La Experiencia 4: Al inyec-


Experiencia 3: Al inyec-
tar en ratones (2) bac- inyeccin (2) de tar a los ratones (2)
tar bacterias S viru-
terias del tipo S (viru- bacterias R no una mezcla de bacte-
lentas muertas, por
lentas) (1) se produce virulentas (1) no tena rias no virulentas R y
tratamiento con calor
la muerte de los ani- efectos sobre los S, virulentas, muertas
(2), los ratones no
males por neumona animales (3). Un por calor (1), los
desarrollaban la enfer-
(3). Un cultivo poste- cultivo de tejidos del ratones desarrollan la
medad (3). Un culti vo
rior (4) detectaba la animal despus de la enfermedad y mueren
de tejidos del animal
presencia de bacterias inyeccin no detectaba (3). En los cultivos se
no detectaba bacterias
S en el animal muerto. la presencia de bac- observan bacterias de
(4).
terias de ninguna de tipo S y R (4).
las cepas (4).

J. L. Snchez Guilln Pgina III-3-1


III) La informacin celular 3) El gen

II) LOS EXPERIMENTOS DE AVERY y


colaboradores.: En 1944. AVERY, MCLEOD
y MCCARTY, se propusieron encontrar cul
era el componente que transmita el
carcter heredable y llegaron a la conclusin
de que era el ADN de las bacterias S
muertas por el calor el que transformaba las
bacterias R en S. Demostraron as que el
ADN era la molcula que contena la
informacin necesaria para que las bacterias
S fueran virulentas y que, a pesar de estar
muertas, su ADN no estaba destruido y
poda pasar al medio y de aqu a las
bacterias de cepa R, integrndose en el Fig. 1 Oswald Avery (1877 1955).
genoma de stas y transformndolas en
virulentas.

CONCEPTO CLSICO Y MOLECULAR DE


LOS GENES

Para Mendel (1822-1884) los genes eran


considerados como factores hereditarios que
determinaban las caracters ticas externas de
los seres vivos. En su poca se ignoraba su
composicin qu mica o su localizacin. Para
poder referirse a ellos fueron denominados
mediante letras. As, en los guisantes, el Fig. 2 Imagen de un cromosoma. Al lado,
gen A determina que las semillas sean de esquema del cromosoma nmero 9 humano
color amarillo y el gen a hace que sean mostrando la posicin aproximada del gen
que determina los grupos sanguneos ABO.
verdes. Pero nadie saba qu era lo que
haca que los guisantes fueran verdes o
amarillos ni cmo lo haca. Esto es, no se
saba la naturaleza de los factores heredi-
tarios ni cul era su mecanismo de actua-
cin.

En 1901 los estudios de GARROD sobre la


alcaptonuria permitieron empezar a conocer
cmo actuaban los genes y las experiencias
de GRIFFITH (en 1928) y AVERY (en 1943),
que ya hemos estudiado, descubrieron que
los genes estaban localizados en el ADN.

III) LOS ESTUDIOS DE GARROD: La


alcaptonuria es una enfermedad hereditaria
recesiva debida a una alteracin en el meta-
bolismo celular que determina la aparicin Fig. 3 A. E. Garrod
del cido homogent sico. Este cido provoca
al oxidarse el ennegrecimiento de la orina y

J. L. Snchez Guilln Pgina III-3-2


III) La informacin celular 3) El gen

un color grisceo en los cartla gos y


ligamentos, tambin puede llegar a producir
artritis.

El cido homogentsico aparece en el


metabolismo del aminocido fenilalanina. Por
la accin de diversas enzimas la fenilalanina
se transforma en tirosina, otro aminocido,
despus, en cido polihidroxifenilpirvico y,
finalmente, en cido homogentsico.
Fig. 4 cido homogentsico.

Fenilalanina Tirosina cido polihidroxife-


nilpirvico cido Homogentsico

En las personas sanas el cido homogent -


3 ADN 5
sico es transformado por la enzima homo-
gentsi co-oxidasa en el cido 4-maleil-ace- T A C G T T A C G A A T G C T T A A A T C

toactico que, posteriormente, se transfor- HMet Gln Cys Leu Arg - Ile-OH

mar en acetil-CoA, que ser degradada en pptido

el Ciclo de Krebs a CO2 y H2 O.


Fig. 5 Colinealidad entre un fragmento de
ADN y un pptido.
GARROD lleg a la conclusin de que el
gen normal (A) produce la enzima necesaria,
mientras que el gen (a) recesivo no la EL DOGMA CENTRAL DE
produce. sta era la primera vez que se LA BIOLOGA
MOLECULAR
relacionaba un gen con una enzima y, por
tanto, con una reaccin.
ADN
De aqu surgi la hiptesis: un gen-una
enzima. Ahora bien, debido a que hay
enzimas formadas por dos o ms cadenas
ARN
polipept dicas, la hiptesis se reformul
como: un gen-un polipeptido.

Polipptido

HIPTESIS DE LA COLINEALIDAD DE CRICK

Una vez establecido el paralelismo entre Carcter


genes y enzimas y tras ser propuesto, en
1.953, el modelo de doble hlice por Watson
y Crick, este ltimo propuso la denominada Fig. 6 Dogma central de la biologa
Hiptesis de colinealidad de CRICK: molecular.

" Existe una correspondencia entre la secuencia de nucletidos del gen y la


secuencia de aminocidos de la enzima codificada".

J. L. Snchez Guilln Pgina III-3-3


III) La informacin celular 4) Sint. protenas

4) TRASCRIPCIN Y TRADUCCIN DE LA INFORMACIN GENTICA

CONCEPTO MOLECULAR DEL GEN. ESTRUCTURA DE LOS GENES EN EUCARIOTAS

Concepto molecular de gen: La mayora de los genes son fragmentos de la molcula


de ADN que determinan la sntesis de una protena, otros realizan funciones
reguladoras.

Estructura de los genes en eucariotas: La estructura de los genes en eucariotas es


compleja. La secuencia de nucletidos que constituye un gen, y los propios genes
entre s, no se disponen linealmente en los cromosomas sino espaciados por
fragmentos de ADN que no poseen informacin que pueda ser transcrita. En todo
gen, adems, distinguiremos las siguientes regiones:

- La regin promotora o promotor (P)


- La regin codificadora (C)
- La regin terminadora o terminador (T)

C Molcula de ADN
P T

Gen 1
Gen 2
P T
P T C
C

Gen 3

Regin codificadora

Promotor E1 I1 E2 I2 E3 Terminador

ATG TAG
TAC ATC

Estructura del Gen 2

Fig. 1 Estructura de un gen. P) regin promotora; C) regin codificadora; T) regin terminadora; E)


exones; I) intrones.

a)La regin promotora es una porcin del ADN situada al principio del gen y que, sin
codificar ningn aminocido, sirve para que las enzimas que realizan la
transcripcin reconozcan el principio del gen.

b)La regin codificadora es la parte del gen que contiene la informacin para la
sntesis de la protena. En la regin codificadora van a existir fragmentos de
ADN que no contienen informacin: los intrones, y fragmentos que s que
contienen informacin: los exones. Considerando la hebra 5'-> 3 ', el principio
de esta regin viene marcado por la secuencia de bases nitrogenadas ATG y
el final por una de estas tres tripletas: TAA, TAG, TGA; tripletas que se

J. L. Snchez Guilln Pgina III-4-1


III) La informacin celular 4) Sint. protenas

denominan de paro, sin sentido o secuencias stop.

c)La regin terminadora. Marca el final del gen.

TRANSCRIPCIN DE LA INFORMACIN DEL ADN


1 2
El ADN se encuentra en el ncleo celular y
la sntesis de protenas tiene lugar en el 3
ncleo

citoplasma, en el hialoplasma concretamente. 4 AAAAAAAAAAAAA

Es por esto que la informacin contenida en 5 AAAAAAAAAAAAA

la estructura primaria del ADN debe


Citoplasma
transcribirse a una molcula de ARN deno-
AAAAAAAAAAAAA

minada ARN mensajero (ARNm). Tambin se 6


7
sintetizan en el ncleo el ARNr y el ARNt ,
necesarios para la sntesis proteica. Fig. 2 Transcripcin y traduccin de un
gen en eucariotas. 1) ADN; 2) ARN
Los procesos de sntesis de ARN a partir polimerasa; 3) ARNmp ; 4) ARNm ; 5) ARNm
maduro; 6) Protena; 7) Ribosoma.
del ADN constituyen la transcripcin de la
informacin gentica.

MECANISMO DE LA TRANSCRIPCIN EN EUCARIOTAS

Destaquemos, en primer lugar, que para cada gen, slo una de las cadenas, de las
dos que posee el ADN, se transcribe. El mecanismo se realiza de la siguiente manera:

ARN mensajero ARN polimerasa

A U G C ADN
C G
G
Direccin de la trascripcin
5 A
U
C
C
G T C C A G T G C T T
A A A G A
U C A G G U C A C G A A
A U

U U

A
G
A C

Nucletidos trifosfato

Fig. 3 Trascripcin del ADN (sntesis de ARNm).

1. Iniciacin: Una ARN-polimerasa comienza la sntesis del precursor del ARN a


partir de unas seales de iniciacin "secuencias de consenso " que se encuentran en
el ADN

2. Alargamiento: La sntesis de la cadena contina en direccin 5' 3'. Despus de 30


nucletidos se le aade al ARN una cabeza (caperuza o lder) de metil-GTP en el

J. L. Snchez Guilln Pgina III-4-2


III) La informacin celular 4) Sint. protenas

extremo 5'. Esta cabeza parece tener una


funcin protectora para que las enzimas
ARNpolimerasa

exonucleasas que destruyen los ARN no lo


ataquen. Una vez que esto ha ocurrido, T A C G A A C C G T T G C A C A T C

A U G C U U G G C A A C G U G
contina la sntesis del ARN en direccin 5
3

3. Finalizacin: Una vez que la enzima (ARN m-GTP

polimerasa) llega a la regin terminadora del


Fig. 4 Alargamiento.
gen, finaliza la snte sis del ARN. Entonces,
una poliA-polimerasa aade una serie de
nucletidos con adenina, la cola poliA, y el
ARN, llamado ahora ARNm precursor, se
poliA-polimerasa
libera.

4. Maduracin: El ARNm precursor contiene m-GTP A U G C U C G U G U A G A A A A A

tanto exones como intrones. Se trata, por lo


tanto, de un ARNm no apto para que la ARNm precursor

informacin que contiene sea traducida y se


sintetice la correspondiente molcula proteica. Fig. 5 Adicin de la cola de poli A.
En el proceso de maduracin un sistema
enzimtico reconoce, corta y retira los
intrones y las ARN-ligasas unen los exones,
formndose el ARNm maduro.

Regin codificadora del gen

ADN
Promotor E1 I1 E2 I2 E3 Terminador

ATC TAG

Cabeza E1 I1 E2 I2 E3 cola
ARNm AAAAAA
precursor AUG UAG

Cabeza cola
ARNm
maduro AAAAAA
AUG UAG

Fig. 6 Mecanismo de maduracin del ARNm.

Todo esto se ha producido en el ncleo celular. El ARNm maduro, que a partir de


ahora ser simplemente el ARNm o, tambin, el transcrito, pasar al hialoplasma donde
su informacin servir para la sntesis de una protena concreta. Esto es, la informa-
cin que se encuentra en forma de una cadena de nucletidos se traducir a una
cadena de aminocidos.

J. L. Snchez Guilln Pgina III-4-3


III) La informacin celular 4) Sint. protenas

LA TRANSCRIPCIN EN PROCARIOTAS: 1

DIFERENCIAS CON EUCARIOTAS


b
3
a 2

10) En los procariotas el ARNm no tiene ni 4

caperuza ni cola. c

20) Tampoco tiene intrones y por lo tanto no 5

requiere de un mecanismo de maduracin. d

30) Al mismo tiempo que el ARNm se


transcribe se est ya traduciendo. Fig. 7 Transcripcin y traduccin en
40) Los genes son policistrnicos, esto es, procariotas. 1) ADN; 2) ARNm; 3) Sub. menor
del ribosoma; 4) sub. mayor; 5) protena. a)
un ARNm contienen informacin para varias
Extremo 5'; b) extremo 3'; c) extremo
protenas. carboxilo; d) extremo amino (P.A.U. junio del
99).

EL CDIGO GENTICO AAAAAA


AUG CAA UGC UUA CGA AUU UAG

El ARNm tiene una estructura primaria 1 2 3 4 5 6 stop

complementaria de una de las cadenas del


H Met Gln Cys Leu Arg Ile - OH
ADN. Esta disposicin de las bases nitroge-
nadas en el ARNm es la que codifica la
Fig. 8 Ejemplo de codificacin de un
secuencia de aminocidos de la protena. pptido de seis aminocidos.

CRICK demostr que los aminocidos en las protenas van a estar codificados por
secuencias de tres bases nitrogenadas consecutivas de las cadenas de ARNm, a partir
de la secuencia de iniciacin AUG, complementaria de la secuencia de iniciacin TAC
del ADN. Cada una de estas secuencias de tres bases se llaman tripletas o codo-
nes. Debe de tenerse en cuenta que, al haber en las protenas 20 aminocidos
distintos, una o dos bases no seran suficientes para codificarlos. Al tener los cidos
nucleicos cuatro bases diferentes (la adenina, la guanina, la citosina y el uracilo), que
representaremos por A, G, C y U respectivamente, existirn 64 codones o
combinaciones de tres bases y como solamente hay 20 aminocidos distintos, se
deduce, que varias tripletas codificarn un mismo aminocido.

Este cdigo, que relaciona la secuencia de bases del ARN con la secuencia de
aminocidos en las protenas, recibe el nombre de cdigo gentico.

CARACTERSTICAS DEL CDIGO GENTICO

10 El cdigo gentico es universal. Todos los seres vivos lo emplean; con ciertas
excepciones, por ejemplo, el de las mitocondrias, que tiene algunas diferencias.
20 Se trata de un cdigo degenerado pues el nmero de tripletas (64) es superior al
de aminocidos existentes en las prote nas (20).
30 Existen tres tripletas que no codifican ningn aminocido, son las tripletas " sin
sentido", de " paro" o " stop". Estas tripletas marcan el final de la regin a
traducir, esto es, el final de la molcula proteica.
40 La secuencia AUG codifica el principio de la regin que se va a traducir y al
mismo tiempo sirve para codificar al aminocido metionina. Por lo tanto, todas
las protenas comienzan por la metionina. Ahora bien, posteriormente, esta
metionina que ocupa la posicin inicial puede ser eliminada.

J. L. Snchez Guilln Pgina III-4-4


III) La informacin celular 4) Sint. protenas

EL CDIGO GENTICO

Segunda base
U C A G
P Phe UUU Ser UCU Tyr UAU Cys UGU U T
r U Phe UUC Ser UCC Tyr UAC Cys UGC C e
i Leu UUA Ser UCA Stop UAA Stop UGA A r
m Leu UUG Ser UCG Stop UAG Trp UGG G c
e Leu CUU Pro CCU His CAU Arg CGU U e
r C Leu CUC Pro CCC His CAC Arg CGC C r
a Leu CUA Pro CCA Gln CAA Arg CGA A a
Leu CUG Pro CCG Gln CAG Arg CGG G
b Ile AUU Thr ACU Asn AAU Ser AGU U b
a A Ile AUC Thr ACC Asn AAC Ser AGC C a
s Ile AUA Thr ACA Lys AAA Arg AGA A s
e Met AUG Thr ACG Lys AAG Arg AGG G e
Val GUU Ala GCU Asp GAU Gly GGU U
G Val GUC Ala GCC Asp GAC Gly GGC C
Val GUA Ala GCA Glu GAA Gly GGA A
Val GUG Ala GCG Glu GAG Gly GGG G

EL CDIGO GENTICO (orden alfabtico)

AMINOCIDO TRIPLETA O CODN


Alanina (Ala) GCU, GCC, GCA, GCG
Arginina (Arg) CGU, CGC, CGA, CGG, AGA, AGG
Asparragina (Asn) AAU, AAC
cido asprtico (Asp) GAU, GAC
Cistena (Cys) UGU, UGC
cido glutmico (Glu) GAA, GAC
Glutamina (Gln) CAA, CAG
Glicocola (Gly) GGU, GGC, GGA, GGG
Histidina (His) CAU, CAC
Isoleucina (Ile) AUU, AUC, AUA,
Leucina (Leu UUA, UUG, CUU, CUC, CUA, CUG
Lisina (Lys) AAA, AAG
Metionina (Met) AUG
Fenilalanina (Phe) UUU, UUC
Prolina (Pro) CCU, CCC, CCA, CCG
Serina (Ser) UCU, UCC, UCA, UCG, AGU, AGC
Treonina (Thr) ACU, ACC, ACA, ACG
Triptfano (Trp) UGG
Tirosina (Tyr) UAU, UAC
Valina (Val) GUU, GUC, GUA, GUG

Sin sentido (Stop) UAA, UAG, UGA

J. L. Snchez Guilln Pgina III-4-5


III) La informacin celular 4) Sint. protenas

MECANISMO DE LA TRADUCCIN DE LA
INFORMACIN GENTICA.

Consiste en la sntesis de una protena a Aminocido

partir de la informacin contenida en el


UAC
ARNm. Se trata de un proceso que se
ARNt
produce en el hialoplasma. Consta de las
siguientes fases:

M
10) Activacin de los aminocidos: La Bucle del et
anticodn
formacin del enlace peptdico es un
proceso endergnico. Para que pueda Fig. 9 ARN de transferencia unido a un
realizarse, los aminocidos (aa) deben de ser aminocido tipo. Ver la posicin que ocupa el
activados, activacin que se realiza por anticodn.
medio del GTP segn la siguiente ecuacin:

COOH

aa + GTP aa-GMP + PPi


H2N C CH2

Los aminocidos activados se unen a una


molcula de ARNt (ARN de transferencia). Anticodn

Estos polinucletidos poseen en su Codn

estructura una secuencia de tres bases, el


anticodn, complementaria de los
correspondientes codones o tripletas del Fig. 10 Iniciacin de la traduccin:
ARNm. Cada aminocido se une, por lo Acoplamiento entre la enzima, el ARNt de un
aminocido, la fenilalanina, por ejemplo, y el
tanto, a un ARNt especfico, que ser aquel
aminocido.
que lleve el anticodn correspondiente.
Subunidad menor del ribosoma

20) Iniciacin: La subunidad pequea del 5


P A
AAAAAAAAAAA 3

ribosoma se une a la regin lder del ARNm AUG CAA UGC UUA CGA UAG

UAC
y el ARNm se desplaza hasta que al llegar al
Codn

codn AUG, que codifica el principio de la Anticodn


ARNt ARNm

protena. Se les une el complejo formado


por el ARNt -metionina. La unin se produce M
et

entre el codn del ARNm y el anticodn del 1er aminocido

ARNt que transporta el aminocido. Por


Fig. 11 Traduccin: Iniciacin.
ltimo, se une la subunidad mayor a la
menor completndose el ribosoma.
Subunidad menor del ribosoma

P A
30) Elongacin. Consta de los siguientes 5 AAAAAAAAAAA 3

AUG CAA UGC UUA CGA UAG


pasos: UAC GUU

a) El complejo ARNt -aminocido 2 (ARNt -aa2 )


se sita enfrente del codn correspon- M Gl
et n
diente. La regin del ribosoma en la
que se une se le llama regin
Fig. 12 Traduccin: Elongacin 1.
aminoacil (A).

J. L. Snchez Guilln Pgina III-4-6


III) La informacin celular 4) Sint. protenas

b) Se forma el enlace peptdico y la


metionina se une al segundo ami- P A ARNm
AAAAAAAAAAA 3
nocido (aa2 ).
5
AUG CAAUGC UUA CGA UAG
UAC GUU

c) El ARNm se traslada como la cinta de una


mquina de escribir y el complejo
ARNt2 -aa2 -met queda situado en la Gl
n-
M
regin peptidil del ribosoma y la et

posicin aminoacil queda libre para la


Fig. 13 Traduccin: Elongacin 2.
entrada del complejo ARNt -aa3 . El
ARNt de la metionina se libera.
P A ARNm

De esta manera se van a ir aadiendo el 5


AUG CAA UGC UUA CGA UAG
AAAAAAAAAAA 3

resto de los aminocidos que constituyen la GUU

C
protena hasta llegar al codn de finaliza- UA

cin.
Gl
n-
M
40) Finalizacin: Cuando el ribosoma llega al et

codn de finalizacin, uno de los codones


Fig. 14 Traduccin: Elongacin 3.
sin sentido: UAA, UAG, UGA, la protena
se libera y las subunidades del ribosoma se
disocian y se separan del ARNm.
ARNm P A
5 AAAAAAAAAAA

AUG CAA UGC UUA CGA UAG


La estructura terciaria y cuaternaria de las GCU

protenas se va adquiriendo segn estas se AA


U

van sintetizando

Es de destacar, que varios ribosomas, de 4 Arg-Leu-Cys-Gln-Met

a 6, a veces incluso 100, pueden estar


Fig. 15 Traduccin: Finalizacin.
traduciendo al mismo tiempo una cadena de
ARNm. La funcin de los ribosomas no se
conoce con exactitud, pero, podra ser, la
de recibir las instrucciones genticas y
traducirlas a prote nas. Para ello es necesa-
rio que se unan al ARNm, procesen la infor-
macin, incorporen los aminocidos y los ribosoma

unan entre s mediante enlaces peptdicos.

pptido

Fig. 16 Actuacin de varios ribosomas


sobre un mismo ARNm.

J. L. Snchez Guilln Pgina III-4-7


III) La informacin celular 4) Sint. protenas

TRADUCCIN DE LA INFORMACIN GENTICA

1-Iniciacin Subunidad menor del ribosoma

P A
5 AAAAAAAAAAA 3

Unin del ARNt que transporta la AUG CAA UGC UUA CGA UAG

metionina. La unin se produce UAC Codn

entre el codn del ARNm y el antico- Anticodn


ARNt ARNm

dn del ARNt .

M
et
1er aminocido

2-Elongacin
Subunidad menor del ribosoma

P A
5 AAAAAAAAAAA 3

Unin del complejo ARNt -Gln (Gluta- AUG CAA UGC UUA CGA UAG
UAC GUU
mina) a la regin aminoacil (A) del
ribosoma.

M Gl
et n

Formacin del enlace peptdico 5


P A ARNm
AAAAAAAAAAA 3

AUG CAA UGC UUA CGA UAG


entre el grupo carboxilo de la me- GUU

tionina (Met) y el grupo amino del UA


C

segundo aminocido: la glutamina


(Gln). El ARNt de la metionina se
Gl
n-
libera. M
et

El ARNm se traslada hacia el codn


P A ARNm
AAAAAAAAAAA 3
siguiente, el 31. El complejo ARNt - 5
AUG CAA UGC UUA CGA UAG
Gln-Met queda situado en la regin GUU ACG

peptidil (P) del ribosoma y la posi-


cin aminoacil (A) queda libre,
entrando el complejo ARNt -Cys del Gl Cy
n- s
M
et
siguiente aminocido (cistena).

J. L. Snchez Guilln Pgina III-4-8


III) La informacin celular 4) Sint. protenas

(continuacin)

Formacin del enlace peptdico P A ARNm


5 AAAAAAAAAAA 3
entre el grupo carboxilo del dipptido AUG CAA UGC UUA CGA UAG
ACG
(Met-Gln) y el grupo amino de la U
GU
cistena (Cys). Liberacin del ARNt
de la glutamina.
Cy
s-
Gl
n-
M
et

Desplazamiento del ARNm a la si- P A ARNm


5 AAAAAAAAAAA 3

guiente posicin y entrada del com- AUG CAA UGC UUA CGA UAG
ACG
plejo ARNt -Leu, correspondiente al AAU

cuarto aminocido: leucina.

Cy
El proceso contina as hasta llegar s-
Gl
n-
M Leu
et
al codn de finalizacin (UAG).

3-Finalizacin
ARNm P A
5 AAAAAAAAAAA 3

AUG CAA UGC UUA CGA UAG


GCU
El ribosoma llega al codn de finali-
U
AA
zacin, uno de los codones sin
sentido. El pptido se encuentra ya
totalmente sintetizado. Arg-Leu-Cys-Gln-Met

Subunidad menor
La cadena polipeptdica se libera y
las subunidades del ribosoma se
disocian y se separan del ARNm. 5
ARNm
AAAAAAAAAAA 3

AUG CAA UGC UUA CGA UAG

Subunidad mayor del


ribosoma
Arg-Leu-Cys-Gln-Met
(pptido sintetizado)

J. L. Snchez Guilln Pgina III-4-9


III) La informacin celular 4) Sint. protenas

REGULACIN DE LA ACCIN DE LOS GENES: HIPTESIS DEL OPERN

Todas las clulas de un organismo pluricelular, excepto los gametos, poseen la misma
informacin gentica. Ahora bien, no todos los genes se encuentran activos durante el ciclo
celular. Muchos genes no actan nunca y otros actan slo en determinados momentos, pu-
diendo permanecer durante largos periodos de tiempo inactivos. Para poder comprender el
mecanismo de accin de los genes veamos a continuacin estos dos modelos de regulacin:

I) Regulacin de la actuacin del opern LAC en la bacteria Escherichia coli

La -galactosidasa es una enzima que


rompe el enlace O-glicosdico entre la Opern LAC

galactosa y la glucosa en la lactosa. Si


Regulador
no hay lactosa en el medio, E. coli ape- Operador Gen x Gen y Gen a

nas dispone de unas pocas molculas de


enzima, una o dos solamente. Sin ARNm

embargo, si aadimos lactosa al medio Si no hay lactosa los


Genes no se transcriben
donde se encuentra la bacteria, al cabo
de unos pocos minutos los niveles de -
galactosidasa suben hasta alcanzar las
5000 molculas por clula,
aproximadamente. Aparecen adems
Represor activo
otras dos enzimas: una permeasa que
facilita la absorcin de la lactosa a Fig. 17 Regulacin del opern LAC en E. coli. Si
travs de la membrana plasmtica de la no hay lactosa el represor est activo, se une al
clula y una transacetilasa, necesaria operador, y los genes estructurales no se transcriben.

tambin para el metabolismo de la


lactosa.

Jacob y Monod interpretaron estos


resultados planteando la hiptesis del Opern LAC

Regulador
opern. Segn esta hiptesis la Operador Gen x Gen y Gen a
actividad de varios genes que codifican
ARNm
enzimas relacionadas entre s, genes
Transcripcin
estructurales, sera desencadenada por
la accin de un gen operador , contiguo
a los genes estructu rales en la molcula Represor
Traduccin
de ADN. El conjunto formado por los
genes estructu rales y el gen operador
recibe el nombre de opern. Si el gen Represor
inactivo
operador se encuentra libre, los genes
Lactosa
estructu rales se transcriben. A su vez, Enzimas para
metabolizar la lactosa
el gen operador estara controlado por
un gen regulador, que puede estar Fig. 18 Regulacin del opern LAC en E. coli. Si
situado lejos del opern. Este gen va a hay lactosa, sta se une al represor, lo inactiva, y los
sintetizar un ARNm que servir para la genes estructurales se transcriben, sintetizndose las
enzimas que metabolizan la lactosa.
sntesis de una protena: el represor. Si
el represor se encuentra activo se unir
al gen operador inhibindolo, con lo que

J. L. Snchez Guilln Pgina III-4-10


III) La informacin celular 4) Sint. protenas

los genes estructurales no se transcribirn.

El opern LAC en E. coli constara de tres genes estructurales que codificaran respectiva-
mente: la -galactosidasa (gen z), la permeasa (gen y) y la transacetilasa (gen a). Si no hay
lactosa en el medio, el gen regulador se Opern reprimible

traducira en una protena, el represor,


Regulador
con dos centros activos. Por uno de Operador Gen a Gen b Gen c

ellos sera capaz de unirse al gen


ARNm
operador inhibiendo la sntesis de los
ARNm codificados por los genes
enzimas
estructurales z, y, a. Por el otro centro Represor
inactivo

activo podra unirse a la lactosa cuando


la hubiese. La lactosa cambiara la Va metablica del triptfano

estructura del represor inactivndolo e


impidiendo que ste pudiese unirse al
gen operador. De esta manera los genes triptfano

estructurales se transcribiran
producindose la sntesis de las tres
enzimas que metabolizan la lactosa en Fig. 19 Opern reprimible: El regulador sintetiza
un represor inactivo que no se puede unir al operador.
E. coli. Los genes estructurales se trascriben y se traducen,
sintetizndose las enzimas necesarias para la sntesis de
la sustacia A: triptfano, en este caso.
II) Los operones reprimibles.

Como es el caso de la regulacin de Opern reprimible

los genes responsables de los procesos


Regulador
Operador Gen a Gen b Gen c

de sntesis. Supongamos que la clula Los genes no se trascriben


ARNm
necesita producir una determinada
cantidad de una sustancia A y que no
interesa que haya un exceso de A ni Represor
inactivo
que sta falte. Supongamos tambin que
para sintetizar A se necesitan tres cuando ya hay suficiente triptfano

enzimas: a, b y c. En estos casos, la Represor


activo

protena que acta como represor del triptfano

gen operador se encuentra normalmante


en estado inactivo, permitiendo que los
Fig. 20 Opern reprimible: Cuando ya hay un
genes a, b y c se transcriban y que A exceso de triptfano, ste se une al represor y lo activa.
se sintetice. Cuando A alcanza unos El represor activo se une al operador y los genes a, b
niveles elevados, se une al represor, y c no se transcriben.
activndolo. El represor activo se une
al operador y los genes estructurales a,
b y c no se transcriben. Esto hace descender la cantidad de A, con lo que el represor vuelve
a estar inactivo, los genes estructurales vuelven a traducirse y vuelve a sintetizarse A. De
esta manera la clula mantiene unas determinadas cantidades de A.

Como se ve, se trata de un mecanismo que funciona como un termostato, manteniendo


unos niveles adecuados de una determinada sustancia, en este caso A, necesaria para la
clula.

J. L. Snchez Guilln Pgina III-4-11


III) La informacin celular 5) Replicacin del ADN

5) LA REPLICACIN DEL ADN

)CMO ES EL PROCESO DE REPLICACIN DEL ADN?

El ADN es una molcula formada por dos


hebras complementarias y antiparalelas. Una
de las primeras dudas que se plantearon fue Replicacin

la de cmo se replicaba el ADN. A este


respecto haba dos hiptesis:
ADN original ADN original ADN copia
10) El ADN se replica de manera conserva-
tiva. Esto es, cada hebra de ADN forma una Fig. 1 Replicacin conservativa.
copia y una clula hija recibe la molcula
original y la otra clula recibe la copia.
20) El ADN se replica de manera semiconser-
vativa. Cada hebra de ADN forma una hebra Replicacin

complementaria y cada clula hija recibe una


molcula de ADN que consta de una hebra
original y de su complementaria sintetizada
de nuevo. ADN original ADN copia
y original
ADN original
y copia

Esta controversia fue resuelta por Fig. 2 Replicacin semiconservativa.


MESELSON y STAHL con una serie de
elegantes experiencias.

EXPERIENCIAS DE MESELSON Y STAHL.

3
3

2 2

1
1

15 N- 15N

15 N- 15N 14 N- 14N

Se cultivan bacterias E. coli en un medio con 15


N (nitrgeno A continuacin, se cultivan las bacterias en nitrgeno 14 (14N)
pesado) durante cierto tiempo para que todo el ADN est ms ligero durante 30 minutos, lo que dura un ciclo de replica-
formado por dos hebras de 15
N (15 N-15 N) ms pesadas. Si se cin. Si la hiptesis de la sntesis conservativa fuese la co-
centrifu ga, este ADN ms pesado migra hacia el fondo del tubo rrecta, se debera obtener lo que se ve en la figura, una banda
y se obtiene el resultado que se observa en la figura. de ADN pesado (15 N-15 N) y otra con ADN ligero (14 N-14 N) pero...

3 3

2 2

1 1

14N -15N 15N -14N 14N -15N


14N- 14N 14N- 14N 15N -14N

.. lo que se obtiene en realidad es lo que se observa en la Adems, si se da otro ciclo de replicacin en 14


N, se obtiene
figura: una sola banda en posicin intermedia, pues est una banda de ADN mixto ( N- N) y otra de ADN (14 N-14 N), lo
14 15

formada por ADN mixto (15 N-14 N). Esto es, todas las clulas hijas que tambin est de acuerdo con la hiptesis de la sntesis
tienen un ADN con una hebra con 15
N y otra con 14
N. La semiconservativa.
hiptesis de la sntesis semiconservativa es la correcta.

J. L. Snchez Guilln Pgina III-5-1


III) La informacin celular 5) Replicacin del ADN

LA REPLICACIN SEMICONSERVATIVA DEL


ADN EN EUCARIOTAS

Cuando una clula se divide, o cuando se


originan los gametos, las nuevas clulas que Cromosoma: arriba, en procariotas, abajo, en eucariotas.

se forman deben contener la informacin


gentica que les permita sintetizar todas las
enzimas y el resto de las prote nas
necesarias para realizar sus funciones vitales.
sta es la principal razn por la que el ADN
debe replicarse. Fig. 3 Replicacin del ADN en procariotas
y en eucariotas. En procariotas slo hay un
ojo de replicacin, mientras que en eucariotas
La replicacin del ADN es el proceso segn hay varios.
el cual una molcula de ADN de doble hlice
da lugar a otras dos molculas de ADN con
la misma secuencia de bases.

En la clula procaritica la replicacin parte


de un nico punto y progresa en ambas
direcciones hasta completarse. En la clula
eucaritica el proceso de replicacin del Fig. 4 Microfotografa al MET de un
ADN no empieza por los extremos de la fragmento de la doble hlice de un cromosoma
de eucariota replicndose.
molcula sino que parte de varios puntos a
la vez y progresa en ambas direcciones
formando los llamados ojos de replicacin.
Primero se separan las dos hebras y, una Ojos de replicacin

vez separadas, van entrando los


nucletidostrifosfato complementarios de
cada uno de los de las hebras originales del Cromosoma
(doble hlice de ADN)
ADN. Las enzimas ADN polimerasas los replisomas

unen entre s formando una hebra de ADN


complementaria de cada una de las hebras Fig. 5 Cromosoma de eucariota
replicndose. El replisoma es un complejo
del ADN original. Se dice que la sntesis de formado por todas las enzimas que intervienen
ADN es semiconservativa porque cada una en el proceso de replicacin.
de las molculas de ADN " hijas" est forma-
da por una hebra de ADN original y otra
complementaria sintetizada de nuevo. Hebra de ADN
A
C ATP asa
T

Es de destacar que la direccin en la que Helicasa

progresa la replicacin es la misma en


ambas hebras. Ahora bien, las enzimas que
unen los nucletidos slo pueden efectuar la
unin en direccin 5' 3'. Esto nos indica
que ambas hebras, al ser antiparalelas, A Protenas
Topoisomerasa

deben de sintetizarse de diferente manera. G estabilizadoras


T ADN polimerasas

a) Sntesis continua de la hebra en direccin Fig. 6 Enzimas y otras protenas que


5' 3'. La sntesis de esta hebra no plantea forman el replisoma. Se muestra en este
ningn problema. As, una vez separadas esquema un detalle del recuadro de la figura
anterior.
ambas hebras, la ADN pol. III (una de las

J. L. Snchez Guilln Pgina III-5-2


III) La informacin celular 5) Replicacin del ADN

enzimas que unen los nucletidos) va a


elongar la cadena en direccin 5' 3' a partir
de un primer o fragmento de ARN que
despus ser eliminado. A

U
T

A
C

G
G

C
A

T
A

T
C

G
C

G
G

C
T

A
T

A
G

C
C
G
A
T
C
G
C G T T G C A C

b) Sntesis discontinua. La hebra comple-


mentaria no se va a replicar en sentido
3' 5' sino que se replica discontinuamente Fig. 7 Sntesis continua.
en direccin 5' 3'. Los diferentes fragmen-
tos sintetizados, llamados fragmentos de
Okazaki, son posteriormente unidos entre s.

El proceso es complejo y consiste en lo si-


guiente: En primer lugar se sintetiza un pe-
queo fragmento de ARN, fragmento deno-
minado primer. Partiendo de este primer se A T C G A A C C G T T G C A C C G T T G C

sintetiza un fragmento de ADN en direccin T A G C T U G G C C G T G G C A A

5' 3'. Al llegar al primer del fragmento 1er fragmento sintetizado 2 fragmento sintetizado

A A
anteriormente sintetizado, ste es degradado
y se rellena el hueco con ADN. Se dice que
Fig. 8 Sntesis discontinua.
la replicacin es discontinua porque el ADN
se va a ir sintetizando en fragmentos que,
posteriormente, son soldados uno al otro.

A T C G A T C G G G C

T A G C T A G C C C G

A T C G A T C G G
T A G C T A G C C

A U C G A T C G G G

T A G C T A G C C C

Fig. 9 Replicacin del ADN. Acontecimientos que se dan en un replisoma.

J. L. Snchez Guilln Pgina III-5-3


III) La informacin celular 6) Ciclo celular. Mitosis.

6) EL CICLO CELULAR. LA MITOSIS

se
La vida de una clula consta de dos etapas P
ro
fa

fas
e
Meta

diferentes: interfase y divisin Anafase

Telofase

La interfase es una etapa muy larga en la


cual tiene lugar el crecimiento de la clula y
Interfase Divisin

el desarrollo de las actividades metablicas


normales. La divisin es una etapa corta. El Fig. 1 El ciclo celular (P.A.U. de junio de
1995).
conjunto de ambas componen el ciclo celu-
lar.

PERIODOS DE LA INTERFASE

La interfase es de gran importancia para la


Ciclo celular
clula. No es un momento de reposo, pues
en ella tiene lugar una gran actividad
metablica. La interfase se puede subdividir
para su estudio en tres periodos: G1 , S y
G2 .
Fig. 2 Aspecto de la clula durante el ciclo
celular.
El periodo G1 sigue a la mitosis anterior y
corresponde a la fase de desarrollo de la
Interfase

clula. Los cromosomas se encuentran


Cantidad de ADN enpg

esparcidos en el interior del ncleo celular


asociados a las histonas formando las fibras
Mitosis

nucleosmicas. Los genes se transcriben de 4

acuerdo con las necesidades metablicas que


presenta la clula en cada momento. En el 0 5 15
10

citoplasma se suceden los diferentes Tiempo en u.a.

procesos metablicos y los orgnulos celula-


Fig. 3 Variacin de la cantidad de ADN
res se forman tambin en este periodo. de una clula durante un ciclo celular
completo.
El periodo S es el de sntesis de ADN. En
l, la doble hlice se abre en diversos puntos
llamados ojos de replicacin, es en ellos
donde se produce la snte sis del ADN.
Simultneamente se transcriben los genes
necesarios.

El periodo G2 es el que antecede a la mito-


sis. En este periodo los cromosomas estn
ya duplicados, es decir, estn formados por
Fig. 4 Figuras de mitosis. 1) profase, 2)
dos cromtidas con uniones a nivel del metafase, 3) anafase, 4) telofase.
centrmero.

J. L. Snchez Guilln Pgina III-6-1


III) La informacin celular 6) Ciclo celular. Mitosis.

LA DIVISIN CELULAR

La divisin celular es un proceso biolgico que en los seres unicelulares permite su


multiplicacin y en los pluricelulares el crecimiento, el desarrollo, la regeneracin de
rganos y tejidos y las funciones de reproduccin.

En una divisin celular tpica, la clula


inicial, clula madre, divide su ncleo en dos
ncleos hijos con la misma informacin
gentica que, adems, es la misma que la de
la clula madre. Al dividirse la clula, el cito-
plasma y los diferentes orgnulos celulares
quedan repartidos y durante la posterior
interfase se producirn nuevos orgnulos a
partir de los que cada clula hija ha recibido.
Por consiguiente, en una divisin celular hay
que distinguir dos aspectos distintos:

-Divisin del ncleo: cariocinesis o mitosis. Fig. 5 Clulas del meristemo de la raz de
-Divisin del citoplasma: citocinesis o citodi- ajo: 1) Profase; 2) Anafase; 3) Metafase; 4)
Interfase; 5) Telofase (citocinesis).
resis.

A partir de la fase M o de mitosis, la clula puede entrar de nuevo en la fase G1 y


dividirse otra vez o en entrar en la llamada fase G0 en Ia que sufre una serie de
trasformaciones que conducen a Ia diferenciacin celular. Por ejemplo, las clulas
epiteliales se dividen continuamente pero las clulas que dan lugar a las neuronas
entran en fase G0 se diferencian, se transforman en neuronas y ya no se dividen.
Otros tipos celulares como los hepatocitos estn en fase G0 pero si son debidamente
estimulados pueden recuperar la capacidad de divisin y pasar de G0 a G1.

DURACIN DEL CICLO CELULAR

La duracin de los periodos G1 , S, G2 y de la mitosis (M) depende del tipo de clula


que se trate. As, en clulas del epitelio humano la duracin es de 8 horas, en otros
tipos de clulas puede ser de varios das o incluso meses. Tambin depende de las
condiciones fisiolgicas y de determinados factores y, en particular, la temperatura.

Un caso tpico de duracin de un ciclo celular es el de los cultivos de clulas HeLa


en las que un ciclo celular dura 20 horas y cada fase tiene la siguiente duracin:

G1..... 8 horas
S ..... 6 horas
G2..... 5 horas
M...... 1 hora

J. L. Snchez Guilln Pgina III-6-2


III) La informacin celular 6) Ciclo celular. Mitosis.

Trasformaciones del cromosoma durante el ciclo celular.

NOR
Ojo de replicacin Trascripcin

Cromosoma

S
Centrmero G1 G2 Cromtidas

e Pro
f as fas
e
lo
Te

5
Anafase Metafase

LA MITOSIS. FASES

Aunque la mitosis es un proceso continuo se acostumbra a dividirlo, para su estudio


y reconocimiento, en cuatro fases distintas llamadas: profase, metafase, anafase y
telofase.

Es de destacar, que, aunque el estudio lo haremos en una clula animal, este


proceso se produce de una manera similar en las clulas vegetales. Las diferencias se
irn indicando a lo largo de la explicacin.

Fig. 6 Fases de la mitosis vistas al microscopio ptico. A, profase; B, metafase (visin polar); C, metafase
(visin ecuatorial); D, anafase; E, telofase.

J. L. Snchez Guilln Pgina III-6-3


III) La informacin celular 6) Ciclo celular. Mitosis.

PROFASE

Es la fase ms larga (1 a 2 horas en el


pice de raz) y en ella se suceden una
serie de fenmenos tanto en el ncleo como
en el citoplasma.

La envoltura nuclear empieza a fragmen-


tarse y los nucleolos van desapareciendo
progresivamente.

Debido al superenrollamineto de la croma- Fig. 7 Clulas en diversas fases del ciclo


tina se produce una condensacin del celular (M.O.).
material gentico y los cromosmas se van
haciendo cada vez ms visibles. Puesto que
el ADN se replic en el periodo S de la
interfase, cada cromosoma est formado por
dos cromtidas unidas por el centromero.

En las clulas animales el par de centriolos


se ha dividido en interfase y ha dado lugar
a dos pares de centriolos que constituirn
los focos de unas ordenaciones radiales de
microtubulos: los steres. Los dos steres
que al principio estn juntos se separan a Fig. 8 Interfase.

polos opuestos de la clula y los haces de


microtubulos que surgen de ellos se alargan
y forman un huso mittico o huso
acromtico bipolar. Las clulas vegetales no
tienen centriolos y el huso acromtico se
forma a partir del centrosoma. Estos husos
sin centriolo se llaman husos anastrales y
estn menos centrados en los polos.

Los tbulos del huso se forman a partir de


las molculas del citoesqueleto. ste se Fig. 9 Inicio de la profase.
desorganiza y la clula adquiere una forma
ms redondeada.

METAFASE

Es una fase corta (5 a 15 minutos en el


pice de la raz del ajo). El huso mittico ya
est perfectamente desarrollado. Los
cinetcoros de los cromosomas interaccionan
por medio de unos microtbulos con los fila-
mentos del huso y los cromosomas son Fig. 10 Metafase.
alineados en la placa ecuatorial de la clula o
placa metafsica. En esta fase los cromosomas se encuentran todos en la zona

J. L. Snchez Guilln Pgina III-6-4


III) La informacin celular 6) Ciclo celular. Mitosis.

ecuatorial, orientados perpendicularmente a los microtbulos que forman el huso


acromtico constituyendo la denominada placa ecuatorial.

Esta es la fase ms adecuada para la observacin de los cromosomas. Para ello se


rompe la clula, por ejemplo: mediante choque osmtico, si ello es posible, y los
cromosomas se tien, se aplasta para que se extiendan y a continuacin se foto gra-
fan.

ANAFASE

Es la fase ms corta (2 a 10 minutos en


el pice de raz). Los cinetcoros se
separan y cada cromtida es arrastrada
hacia un polo de la clula. El movimiento
parece ser que se produce por un
desensamblaje de los microtbulos. Al
desplazarse cada cromtida, sus brazos se
retrasan formando estructu ras en V con los
Fig. 11 Anafase.
vrtices dirigidos hacia los polos.

TELOFASE

Su duracin en el pice de raz de ajo es


de 10 a 30 minutos. Los cromosomas son
revestidos por fragmentos del retculo
endoplasmtico que terminarn soldndose
para constituir la envoltura nuclear. Poco a
poco los cromosomas van descondensn-
dose y se desfiguran adquiriendo el ncleo
un aspecto cada vez ms interfsico, los
nucleolos comienzan a reaparecer. Los
microtbulos del huso se agrupan en haces
por la aparicin en la regin media de
cilindros de una sustancia densa y pierden Fig. 12 Telofase.
sus conexiones con los polos. Finalmente
los cilindros se fusionan en un solo haz y la
clula se divide en dos.

J. L. Snchez Guilln Pgina III-6-5


III) La informacin celular 6) Ciclo celular. Mitosis.

ESQUEMA GENERAL DE LA MITOSIS

1) Interfase 2) Profase

3) Metafase 4) Anafase

5) Telofase 6) Interfase

J. L. Snchez Guilln Pgina III-6-6


III) La informacin celular 6) Ciclo celular. Mitosis.

CITOCINESIS

La divisin del citoplasma se inicia ya al


final de la anafase y contina a lo largo de
la telofase. Se produce de manera distinta
en las clulas animales y en las vegetales.
En las clulas animales tiene lugar por simple
estrangulacin de la clula a nivel del
ecuador del huso. La estrangulacin se lleva
a cabo gracias a prote nas ligadas a la
membrana que formarn un anillo contrctil.
En las clulas vegetales aparece un sistema
Fig. 13 Citocinesis en una clula animal.
de fibras formado por microtbulos en forma
de barril: el fragmoplasto. En su plano
ecuatorial se depositan pequeas vescu las
que provienen de los dictiosomas del aparato
de Golgi. Estas vesculas contienen sus-
tancias pcticas que formarn la lmina
media. Todo ello crece de dentro a fuera. La
divisin no es completa entre ambas clulas
hijas, mantenindose algunos poros de
comunicacin: los plasmodesmos, al quedar Fig. 14 Citocinesis en una clula animal.
capturados entre las vesculas elementos del
retculo. Posteriormente se depositan el
resto de las capas que forman la pared
celular. Es ms, cada clula hija depositar a
su alrededor una nueva pared celular. Las
paredes celulares de las clulas vegetales se
estiran y se rompen permitiendo a las clulas
hijas crecer.

Por ltimo indicar que en algunos hongos a


Fig. 15 Citocinesis en una clula vegetal. a)
la cariocinesis no le sucede la citodiresis. Se Fragmoplasto; b) disctiosoma; c) lmina media.
forman as masas, llamadas plasmodios, que
contienen una gran cantidad de ncleos Metafase
Profase

envueltos en una sola membrana.

Metafase

SIGNIFICADO BIOLGICO DE LA MITOSIS


Telofase

- A nivel gentico representa un sistema de


reparto equitativo e idntico de la Citocinesis

informacin gentica. Ambas clulas hijas


tendrn la misma informacin gentica, que
es la misma que posea la clula madre. Fig. 16 Figuras de mitosis.

J. L. Snchez Guilln Pgina III-6-7


III) La informacin celular 6) Ciclo celular. Mitosis.

- A nivel celular la mitosis permite la Interfase

perpetuacin de una estirpe celular y la Metafase

formacin de colonias de clulas (clones


Anafase
celulares).

- A nivel orgnico la mitosis permite el


crecimiento y desarrollo de los tejidos y de Profase

los rganos de los seres pluricelulares y la


reparacin y regeneracin de los mismos. De
esta manera, todas las clulas de un
organismo pluricelular, a excepcin de las Fig. 17 Figuras de mitosis.
clulas sexuales, dispondrn de idntica
informacin gentica.

J. L. Snchez Guilln Pgina III-6-8


III) La informacin celular 7) Cromosomas

7) LOS CROMOSOMAS MITTICOS

Durante la mitosis las cromtidas se replie-


gan sobre s mismas en tal grado que
surgen pequeos cuerpos dobles perfecta-
mente visibles al microscopio: son los
cromosomas metafsicos.

Normalmente, los cromosomas son difci les


de observar, pues se presentan en la clula
en gran nmero. Pero haciendo preparacio-
nes adecuadas pueden aislarse y Fig. 1 Clulas de raz de ajo en pro-
fotografiarse. ceso de divisin.

Su tamao es variable: segn las clulas, el


cromosoma de que se trate, del momento
funcional, etc. No obstante, oscila,
aproximadamente, entre 0,2 a 50 de lon-
gitud por 0,2 a 2 de dimetro. En la
especie humana entre 4 y 6 .

Fig. 2 Cromosoma.
CARACTERSTICAS MORFOLGICAS DEL
CROMOSOMA

En cada cromosoma mittico podemos


distinguir:

Las cromtidas.- son estructuras idnticas en


morfologa e informacin ya que contienen
cada una una molcula de ADN. Las crom-
Fig. 3 Estructura de un cromosoma meta-
tidas estn unidas por el centrmero. fsico: 1) centrmero; 2 brazo; 3) cromtida;
Morfolgicamente se puede decir que el 4) telmeros; 5) satlite; 6) zona del
cromosoma es el conjunto de dos organizador nucleolar (NOR). (P.A.U. sep. 97
cromtidas y genticamente cada cromtida y jun. 98).
tiene el valor de un cromosoma. Es-
tructuralmente, cada cromtida est consti-
tuida por un esqueleto proteico, situado en
el interior, alrededor del cual se disponen
muy apelotonados el ADN y las prote nas
que forman el cromosoma.

El centrmero.- Es la regin que se fija al


huso acromtico durante la mitosis. Se
encuentra en un estrechamiento llamada
constriccin primaria, que divide a cada
cromtida del cromosoma en dos brazos. En
el centrmero se encuentran los cinetocoros:
zonas discoidales situadas a ambos lados del
centrmero que durante la divisin celular Fig. 4 Morfologa de un cromosoma. a)
tienen como funcin hacer que los micro- brazo corto; b) centrmero; c) brazo largo; d)
tbulos del huso se unan a los cromosomas. telmero; e) cinetocoro; f) bandas; g) NOR; h)
Los cinetocoros son tambin centros satlite (SAT).
organizadores de microtbulos, igual que los

J. L. Snchez Guilln Pgina III-7-1


III) La informacin celular 7) Cromosomas

centriolos o el centrosoma de las clulas vegetales.

Los telmeros.- Al extremo de cada brazo del cromosoma se le denomina telmero.


El ADN de los telmeros no se transcribe y en cada proceso de divisin celular se
acorta. Cuando los telmeros desaparecen el cromosoma sigue acortndose y la clula
pierde informacin gentica til y degenera. Los telmeros seran, por lo tanto, una
suerte de "reloj celular" que determinara el nmero de ciclos celulares que puede
tener una clula. En las clulas cancerosas, una enzima, la telomerasa, regenera los
telmeros; esta es la razn, al parecer, de que estas clulas puedan dividirse
indefinidamente.

El organizador nucleolar.- En algunos cromosomas se encuentra la regin del


organizador nucleolar (NOR). En ella se sitan los genes que se transcriben como
ARNr, con lo que se promueve la formacin del nuclolo y de los ribosomas. Esta
zona no se espiraliza tanto y por eso se ve ms clara.

EI satlite (SAT).- Es el segmento del cromosoma entre el organizador nucleolar y el


telmero correspondiente. Slo poseen satlite aquellos cromososmas que tienen NOR.

CLASIFICACIN DE LOS CROMOSOMAS POR LA POSICIN DEL CENTRMERO

Los cromosomas son orgnulos constantes


en nmero, forma y caractersticas. Pero los
cromosomas de una clula pueden ser
diferentes unos de otros. Esta diferencia
est, sobre todo, en la posicin del centr-
mero, que es variable, lo que permite clasifi-
car a los cromosomas metafsicos en meta- Metacntrico Submetacntrico acrocntrico Telocntrico

cntricos, submetacntricos, acrocntricos y


telocntricos, segn tengan el centrmero en Fig. 5 Clasificacin de los cromosomas por
la posicin del centrmero.
medio, desplazado hacia uno de los brazos,
casi en el extremo o en el extremo,
respectivamente.

EL CARIOTIPO

Se llama cariotipo al nmero, forma y


tamao de los cromosomas de una
determinada especie. Esto es, al conjunto de
los cromosomas de una clula. Los
cromosomas de una clula pueden ser ob-
servados al microscopio ptico, foto grafiados
y sobre estas fotografas pueden contarse y
medirse con toda facilidad. Los cromosomas
pueden recortarse de la foto grafa y
ordenarse por su tamao, de mayor a
menor, y por la posicin del centrmero.
Esta distribucin ordenada de los crom- Fig. 6 Placa metafsica obtenida a partir
osomas recibe el nombre de ideograma. El de una clula humana en divisin.
estudio de los cariotipos ha permitido descu-
brir los siguientes aspectos importantes:

J. L. Snchez Guilln Pgina III-7-2


III) La informacin celular 7) Cromosomas

11) El nmero de cromosomas es fijo para


cada especie animal o vegetal (Ley de la
constancia de los cromosomas). As, por
ejemplo, las clulas humanas tienen 46 crom-
osomas, 48 las del chimpanc, 12 las de la
mosca comn, 2 las de la lombriz intestinal
del caballo, etc. El nmero de cromosomas
oscila en los seres vivos entre 2 y varios
cientos. Es de destacar que este nmero no
est en relacin con la mayor o menor com-
plejidad evolutiva del organismo.

21) El nmero de cromosomas de las clulas


Fig. 7 Ideograma del cariotipo de una
somticas (no reproductoras) de la mayora mujer.
de los animales, plantas y hongos es
siempre par, excepto si se tienen anomalas
en el nmero de cromosomas, ya que cada
clula somtica dispone de dos juegos de
cromosomas y cada cromosoma de una serie
tiene su homlogo en la otra. En los
ideogramas los cromosomas se agrupan por
parejas de homlogos. Los cromosomas
homlogos provienen cada uno de un proge-
nitor. Es por esto que contienen informacin
para los mismos caracteres pero no necesa-
riamente la misma informacin, pues uno de
los progenitores ha podido aportar un gen
para un carcter y el otro progenitor otro
gen diferente. Fig. 8 Ideograma del cariotipo de un
hombre.
31) El nmero de cromosomas de cada serie
recibe el nombre de nmero haploide o n y,
como ya se ha dicho, ha sido heredado de
Especie n
uno de los progenitores. En la especie huma-
na n=23. El nmero total de cromosomas La especie humana... 46
es el nmero diploide o 2n. As, en la El chimpanc. 48
especie humana 2n = 46. Siendo n y 2n las El perro... 78
frmulas cromosmicas haploide y diploide Toro/vaca... 60
Gallo/gallina... 78
respectivamente. Rana.... 26
Mosca.. 12
41) En muchos grupos de seres vivos, por Maz. 20
ejemplo en los mamferos, los cariotipos del Trigo. 46
macho y de la hembra son diferentes. As Algodn 52
la mujer tiene dos cromosomas X (XX-
homogamtica) y el hombre tiene un Fig. 9 Nmero de cromosomas de clulas
diploides de diferentes especies.
cromosoma X y otro Y (heterogamtico- XY).
Estos cromosomas que determinan el sexo
se llaman, por ser distintos, heterocromo-
somas. En las aves es al contrario, el macho es homogamtico (ZZ) y la hembra
heterogamtica (ZW). El resto de los cromosomas que no determinan el sexo son los
autosomas.

El estudio del cariotipo tiene un gran inters en medicina porque algunos sndromes

J. L. Snchez Guilln Pgina III-7-3


III) La informacin celular 7) Cromosomas

son debidos a cromosomas de ms, de menos o a cromosomas incompletos. En


particular, la llamada trisoma 21 o sndrome de Down en la que el individuo
afectado presenta tres cromosomas 21 en lugar de dos y por lo tanto, su cariotipo
tiene 47 cromosomas en lugar de los 46 de la frmula diploide normal. Estas altera-
ciones en el nmero de cromosomas del cariotipo y sus causas sern estudiadas ms
adelante.

J. L. Snchez Guilln Pgina III-7-4


III) La informacin celular 8) Meiosis

8) LA MEIOSIS

LA MEIOSIS: CONCEPTO

La meiosis es un mecanismo de divisin


celular que permite la obtencin a partir de Fig. 1 La meiosis consta de dos divisiones
clulas diploides (2n) de clulas haploides (n) celulares sucesivas con una sola replicacin del
con diferentes combinaciones de genes. material gentico.

OBJETIVOS DE LA MEIOSIS

La meiosis no es un tipo de divisin celular


diferente de la mitosis o una alternativa a
sta. La meiosis tiene objetivos diferentes.
Uno de estos objetivos es la reduccin del
nmero de cromosomas. Otro de sus obje-
tivos es el de establecer reestructuraciones
en los cromosomas homlogos mediante
intercambios de material gentico. Por lo
tanto, la meiosis no es una simple divisin
celular. La meiosis est directamente
relacionada con la sexualidad y tiene, como Fig. 2 Evolucin de los cromosomas de una
veremos ms adelante, un profundo sentido clula durante la meiosis (P.A.U. de junio y
para la supervivencia y evolucin de las septiembre de 1995).
especies.

MECANISMO DE LA MEIOSIS

La meiosis consta de dos divisiones sucesivas de la clula con una nica replicacin
del ADN. El producto final son cuatro clulas con n cromosomas.

Fig. 3 Figuras de meiosis desordenadas (P.A.U. de junio de 1997).

J. L. Snchez Guilln Pgina III-8-1


III) La informacin celular 8) Meiosis

DIVISIN I

PROFASE I

En esta fase suceden los acontecimientos


ms caractersticos de la meiosis. La envol-
tura nuclear se conserva hasta el final de la
fase que es cuando se desintegra, al mismo
tiempo desaparece el nucleolo y se forma el
huso.

Fig. 4 Profase I: Leptoteno.


Dada su duracin y complejidad se subdi-
vide en cinco etapas: leptoteno, zigoteno,
paquiteno, diploteno y diacinesis.

Leptoteno: Los cromosomas aparecen como


largos filamentos que de trecho en trecho
presentan unos grnulos: los crommeros.
Cada cromosoma ya est constituido por
dos cromtidas, pero an no se observan
bien diferenciadas al microscopio ptico, y
se encuentran unidos en diversos puntos a
Fig. 5 Profase I: Zigoteno.
la envoltura nuclear.

Zigoteno: En esta etapa los cromosomas


homlogos se aparean punto por punto en
toda su longitud. Este apareamiento puede
comenzar bien por el centro o por los
extremos y continuar a todo lo largo. Cuan-
do los homlogos se aparean cada gen
queda yuxtapuesto con su homlogo.
Fig. 6 Intercambio de fragmentos entre
Paquiteno: Los pares de cromosomas cromtidas homlogas por sobrecruzamiento
homlogos aparecen ntimamente unidos: entre cromosomas homlogos.

bivalentes. Se puede ya observar que cada


cromosoma tiene sus dos cromtidas.
Mientras estn estrechamente unidos tienen
lugar roturas entre cromtidas prximas de
cromosomas homlogos que intercambian
material cromosmico. Este intercambio se
llama entrecruzamiento o sobrecruzamiento
(crossing-over) y supone una redistribucin
cromosmica del material gentico. Aunque quiasma

los sobrecruzamientos se producen en esta


Fig. 7 Quiasmas entre cromosomas homlo-
fase no an visibles y se apreciarn ms
gos.
tarde en forma de quiasmas.

J. L. Snchez Guilln Pgina III-8-2


III) La informacin celular 8) Meiosis

Diploteno: Los bivalentes inician su separa-


cin, aunque se mantienen unidos por los
puntos donde tuvo lugar el sobrecruzamiento,
estas uniones reciben ahora el nombre de
quiasmas y permiten ver los puntos en los
que hubo sobrecruzamientos. En cada par de
cromosomas homlogos pueden persistir uno o
varios quiasmas, todo depende de cuntos
sobrecruzamientos hayan tenido lugar a lo
largo del bivalente. Fig. 8 Profase I: Diacinesis.

Diacinesis: Las cromtidas aparecen muy con-


densadas preparndose para la metafase. La separacin entre bivalentes persiste y
permanecen los quiasmas.

Al final de la profase la envoltura nuclear ha desaparecido totalmente y ya se ha


formado el huso acromtico.

Fig. 9 Figuras de la profase de la primera divisin de la meiosis (P.A.U. de sept. de 1999).

METAFASE I

Los bivalentes se disponen sobre el ecuador


del huso, pero lo hacen de tal forma que los
dos cinetocoros que tiene cada homlogo se
orientan hacia el mismo polo, que es el
opuesto hacia el que se orientan los dos
cinetocoros del otro homlogo.

Fig. 10 Meiosis: Metafase I.


ANAFASE I

Los cromosomas slo presentan un centrmero para las dos cromtidas. Debido a
esto, se separan a polos opuesto cromosomas completos con sus dos cromtidas. No
se separan 2n cromtidas, sino n cromosomas dobles. Esta disyuncin o separacin
de los cromosomas da lugar a una reduccin cromosmica. Como consecuencia,
desaparecen los quiasmas.

J. L. Snchez Guilln Pgina III-8-3


III) La informacin celular 8) Meiosis

La distribucin al azar de los cromosomas


es una de las fuentes de variabilidad, ya que
pueden producirse como consecuencia de
este proceso una gran cantidad de gametos
(2 n, siendo n el nmero haploide).

TELOFASE I

Es una telofase normal pero que da lugar a


dos clulas hijas cuyos ncleos tienen cada
uno n cromosomas con dos cromtidas. Fig. 11 Meiosis: Anafase I.

INTERFASE

Puede ser variable en su duracin, incluso


puede faltar por completo de manera que
tras la telofase I se inicia sin interrupcin la
segunda divisin. En cualquier caso, nunca
hay sntesis de ADN; es decir, es una
interfase sin periodo S.
Fig. 12 Meiosis: Anafase I. ( P.A.U. de
junio de 1998).

B) DIVISIN II

Es una mitosis normal en la que las dos clulas anteriores separan en la anafase II
las cromtidas de sus n cromosomas. Surgen as 4 clulas con n cromtidas cada
una.

Profase II Metafase II Anafase II Telofase II

Fig. 13 Segunda divisin de la meiosis.

J. L. Snchez Guilln Pgina III-8-4


III) La informacin celular 8) Meiosis

SIGNIFICADO BIOLGICO DE LA MEIOSIS

A nivel gentico. El sobrecruzamiento da lugar a nuevas combinaciones de genes en


los cromosomas, es responsable de la recombinacin gentica. Por otra parte, cada
una de las cuatro clulas finales dispone de un conjunto de n cromtidas que no es
idntico al de las otras. Tanto el sobrecruzamiento como el reparto de las cromtidas
dependen del azar y dan lugar a que cada una de las cuatro clulas resultantes tenga
una coleccin de genes diferentes. Estas colecciones de genes se vern ms adelante
sometidas a las presiones de la seleccin natural de tal forma que solamente
sobrevivirn las mejores. A nivel gentico, la meiosis es una de las fuentes de
variabilidad de la informacin.

A nivel celular. La meiosis da lugar a la reduccin cromosmica. Las clulas diploides


se convierten en haploides.

A nivel orgnico. Las clulas haploides resultantes de la meiosis se van a convertir en


las clulas sexuales reproductoras: los gametos o en clulas asexuales reproductoras:
las esporas. La meiosis es un mecanismo directamente implicado en la formacin de
gametos y esporas. En muchos organismos los gametos llevan cromosomas sexuales
diferentes y son los responsables de la determinacin del sexo, en estos casos la
meiosis est implicada en los procesos de diferenciacin sexual.

DIFERENCIAS ENTRE LA MITOSIS Y LA MEIOSIS


(CUADRO RESUMEN)

MITOSIS MEIOSIS

A nivel gentico

Segregacin al azar de los cromosomas


Reparto exacto del material gentico. homlogos y sobrecruzamiento como fuente
de variabilidad gentica.

A nivel celular

Como consecuencia de lo anterior se Produce una reduccin del juego de


forman clulas genticamente cromosomas a la mitad exacta de los
iguales. cromosomas homlogos

A nivel orgnico

Se da este tipo de divisin en los


organismos unicelulares para su Sirve para la formacin de las clulas
reproduccin asexual y en pluricelulares reproductoras sexuales: los gametos, o
para su desarrollo, crecimiento y la las clulas reproductoras asexuales: las
reparacin y regeneracin de tejidos y esporas.
rganos.

J. L. Snchez Guilln Pgina III-8-5


III) La informacin celular 8) Meiosis

PRIMERA DIVISIN DE LA MEIOSIS

1) Interfase 2) Profase I. Leptoteno

4) Profase I. Diacinesis.
3) Profase I. Zigoteno

5) Metafase I 6) Anafase I

7) Telofase I 8) Interfase

J. L. Snchez Guilln Pgina III-8-6


III) La informacin celular 8) Meiosis

SEGUNDA DIVISIN DE LA MEIOSIS

9) Profase II 10) Metafase II

11) Anafase II 12) Telofase II

J. L. Snchez Guilln Pgina III-8-7


III) La informacin celular 9) Reproduccin

9) LA REPRODUCCIN

CONCEPTO DE REPRODUCCIN

La reproduccin tiene por objetivo la


Reproduccin
procreacin de nuevos individuos a partir de
los existentes. Es un fenmeno por el cual
los seres vivos producen a expensas de su
Organismo Clulas aisladas
propio cuerpo una clula o un grupo de clu- adulto o grupos de clulas
las que mediante un proceso de desarrollo
se transformarn en un nuevo organismo
Desarrollo
semejante al de origen.

En los seres vivos se dan formas muy Fig. 1 Ciclo biolgico o ciclo vital.
diversas de reproduccin. No obstante, se
pueden agrupar en dos modalidades dife-
rentes: I I I

- Reproduccin asexual
- Reproduccin sexual

La reproduccin asexual. No existen ni


fecundacin ni gametos. Se lleva a cabo a
partir de clulas somticas ya que del I

organismo progenitor se separan determina- Reproduccin sexual Reproduccin asexual

das partes de su cuerpo, puede ser tambin


una sola clula, que estn destinadas a Fig. 2 Reproduccin sexual y asexual.

formar un nuevo individuo completo.

La reproduccin asexual fue, probablemente, el primer mecanismo de reproduccin


que tuvieron los seres vivos, pues no requiere procesos tan complejos como los que
se necesitan en la reproduccin sexual.

La reproduccin asexual se presenta preferentemente en los organismos vegetales y


en los unicelulares, mientras que en los animales se da, sobre todo, en los menos
evolucionados.

La reproduccin sexual. Se caracteriza por la produccin de clulas especializadas


haploides: las clulas sexuales o gametos. Normalmente estas clulas no pueden
desarrollarse por s mismas y dar un nuevo individuo, necesitan unirse para formar
una clula mixta de ncleo diploide, el zigoto o clula huevo. El proceso de fusin de
ambos gametos para formar el zigoto recibe el nombre de fecundacin.

J. L. Snchez Guilln Pgina III-9-1


III) La informacin celular 9) Reproduccin

La reproduccin sexual es la forma ms


extendida e importante de reproduccin. Tipos de reproduccin asexual

Prcticamente todos los seres vivos, incluso


los organismos unicelulares, tienen reproduc- Biparticin Fragmentacin Gemacin Esporulacin

cin sexual. La reproduccin sexual est


ntimamente relacionada con la evolucin
de los organismos.

DIFERENCIAS ENTRE AMBOS TIPOS DE


REPRODUCCIN Fig. 3 Tipos de reproduccin asexual.

Diferencias formales:

- La reproduccin asexual se lleva a cabo a


partir de clulas somticas.

Cantidad de ADN de cada clula en pg.


- En la reproduccin sexual intervienen R1
R1

clulas germinales especializadas: los


gametos. GG FF R2
R2

Diferencias genticas:

- Reproduccin asexual: No produce 0 5 10 15


tiempo en unidades arbitrarias

variabilidad gentica al existir slo mitosis.


Fig. 4 Variacin de la cantidad de ADN en
- Reproduccin sexual: Produce variabilidad
una clula que ha seguido un ciclo haplonte
gentica mediante la recombinacin gentica completo. G) Formacin de gametos por
en la meiosis y mediante la fecundacin. mitosis; F) Fecundacin; R1 y R2) Citocinesis 1
y 2 de la meiosis.

CICLOS BIOLGICOS

Un ciclo biolgico o ciclo vital es la serie


progresiva de cambios que experimenta un
individuo o una sucesin de stos entre dos
procesos de fecundacin

Segn la posicin relativa que adquieran la


fecundacin y la meiosis dentro del ciclo
biolgico de un ser vivo podremos clasificar
su ciclo biolgico como: haplonte, diplontes
o diplohaplonte.

Haplontes. En este tipo de ciclo biolgico el


zigoto diploide originado por fecundacin Fig. 5 Ciclo haplonte. R!) Meiosis.
experimenta la meiosis (R!) y da lugar a
cuatro clulas haploides o esporas asexuadas

J. L. Snchez Guilln Pgina III-9-2


III) La informacin celular 9) Reproduccin

que se desarrollan dando origen a un indivi-


duo adulto haploide (n). ste formar
gametos sin mediar la meiosis. Se trata de
un ciclo en el que la meiosis se encuentra
inmediatamente despus de la fecundacin.
Son haplontes algunas especies de algas,
hongos y protistas.

Diplontes. Con los diplontes sucede todo lo


contrario ya que la meiosis (R!) no est
despus de la fecundacin sino que la
Fig. 6 Ciclo diplonte. R!) Meiosis.
precede. El individuo adulto es diploide (2n)
y slo los gametos son haploides (n). Tienen
un ciclo diplonte los animales y algunas
especies de unicelulares, de algas y de hongos.

Diplohaplontes o haplodiploides. Del zigoto


se desarrolla, como en los diplontes, una
generacin diploide en la que tiene lugar la
meiosis (R!), no para producir gametos, sino
para dar clulas haploides, esporas, cada una
de las cuales desarrolla un organismo haploi-
de productor de gametos. En algunas espe-
cies, como Ulva lactuca, las generaciones
haploide y diploide son morfolgicamente
semejantes. En otras, como ocurre con los
musgos, helechos y plantas superiores, Fig. 7 Ciclo diplohaplonte. R!) Meiosis.
ambas generaciones presentan diferentes
aspectos. Los ciclos diplohaplontes son
caractersti cos de la mayora de los vegeta-
les.
d1
f
E A

x500

x500
EJEMPLO DE UN CICLO HAPLONTE x1/5 b1

x500
En la figura 8 vemos el ciclo haplonte en
un alga. El zigoto (A), 2n, en lugar de b2
D
desarrollarse y dar lugar al alga, sufre la
primera (b1) y la segunda divisin de la X 1/10
x500

meiosis (b2) dando cuatro clulas haploides c


(B). Estas (B) se desarrollan (c) y cada una B x500

forma un organismo haploide (D). En ciertas


Fig. 8 Ciclo biolgico haplonte de un
zonas de este (D1 ), sin necesidad de meio-
alga. A) Zigoto; b1 y b2) meiosis; B) esporas
sis, se producen los gametos (E). La unin haploides; c) Fase de desarrollo; D) organismo
de los gametos, fecundacin (f), da lugar al haploide; d1) rganos reproductores; E)
zigoto (A), cerrndose el ciclo. gametos; f) fecundacin .

J. L. Snchez Guilln Pgina III-9-3


III) La informacin celular 9) Reproduccin

EJEMPLO DE UN CICLO DIPLONTE: LAS


AVES

Vemos en la figura 9, como ejemplo de


ciclo diplonte, el caso de las aves, que sera
extensible al de muchos otros animales. En
ellas, los adultos son diploides y por meiosis
producen gametos haploides. Estos se unen
(fecundacin) y producen un zigoto diploide,
que se desarrolla y da un nuevo individuo.

En este tipo de ciclo predomina la fase


diploide, mientras que la fase haploide queda Fig. 9 Ciclo biolgico diplonte. Todos los
reducida a los gametos. elementos del ciclo son diploides, excepto los
gametos. La fecundacin se produce
inmediatamente despus de la meiosis

EJEMPLO DE UN CICLO DIPLOHAPLONTE: LOS MUSGOS

Los musgos, tal y como frecuentemente los vemos, forman unas matitas almoha-
dilladas. Cada matita: gametofito, tiene n cromosomas y est constituida por una
serie de ramitas con pequeas hojas de color verde. En los extremos de algunas
ramitas se desarrollan los rganos reproducto-
res masculinos: los anteridios, en el interior Espora (n)

de los cuales, sin necesidad de la meiosis, se Esporofito (2n)

Gametofito (n)

forman los gametos masculinos: los antero-


zoides. En los extremos de otras ramitas se
forman los rganos reproductores femeninos:
los arquegonios, y en su interior una nica
oosfera
anterozoide
Gametofito (n)

clula reproductora femenina: la oosfera. En


Gametos (n)

condiciones de humedad se abren los Zigoto (2n)

anteridios y salen los anterozoides, flagelados,


que nadan hasta los arquegonios y fecundan Fig. 10 Ciclo biolgico diplohaplonte de un
musgo sp.
la oosfera. Se forma as una clula con 2n
cromosomas: el zigoto. A partir de ste se
desarrolla una estructu ra 2n: el esporofito,
formado por un filamento y una cpsula. En el interior de la cpsula se produce la
meiosis, formndose clulas con n cromosomas. Estas clulas darn lugar a las
esporas, tambin con n cromosomas, a partir de las cuales se desarrollar el game-
tofito cerrndose el ciclo.

Vemos que en los musgos la fase haploide o gametofito predomina sobre la fase
diploide o esporofito. Por el contrario, en lo helechos, es la fase diploide la
predominante y la fase haploide queda reducida a una simple laminilla de pequeo
tamao. Un caso extremo de reduccin se observa en las plantas con flor: las
fanergamas.

J. L. Snchez Guilln Pgina III-9-4


III) La informacin celular 9) Reproduccin

REPRODUCCIN SEXUAL

Como ya se ha dicho, en la reproduccin sexual intervienen gametos y es un


proceso que produce variabilidad gentica mediante la recombinacin gentica en la
meiosis y mediante la fecundacin.

FORMACIN DE LOS GAMETOS

En los seres unicelulares los gametos se forman a partir de la propia clula por un
proceso de meiosis y diferenciacin.

En los seres pluricelulares se forman en rganos especializados. En las plantas estos


rganos reciben el nombre de gametangios. stos se llaman anteridios si producen
gametos masculino: anterozoides, y arquegonios si producen gametos femeninos:
oosferas. En los animales los rganos productores de los gametos son las gnadas:
testculos, las gnadas masculinas donde se forman los espermatozoides y ovarios
las femeninas, donde se forman los vulos.

GAMETOGNESIS EN LOS ANIMALES

La transformacin de las clulas germinales en gametos constituye la gametognesis.

En los animales la gametognesis da lugar a gametos femeninos: vulos, en las hem-


bras, y gametos masculinos: espermatozoides, en los machos. La formacin de vulos
y espermatozoides son procesos que presentan grandes similitudes. No obstante,
existen importantes diferencias, por lo que hay que distinguir una gametognesis
masculina: espermatognesis y una gametognesis femenina: ovognesis.

a) ESPERMATOGNESIS

La formacin de los espermatozoides tiene a


b c
lugar en las gnadas masculinas: los test - d

culos. En los vertebrados y en los insectos


los testcu los son rganos compuestos por
numerosos tbulos seminferos que con-
vergen en conductos comunes que llevan el
esperma maduro al exterior. El examen
microscpico de estos tbulos seminfe ros
e
(Figura 11 ) permite reconocer fcilmente el
curso de la espermatognesis y distinguir sus
diferentes fases.

Fig. 11 Espermatognesis en un tubo


10) Fase de proliferacin o multiplicacin:
seminfero. a) Espermatogonias. b)
Pegadas a la pared del tbulo se encuentran Espermatocito primario. c) Espermatocito
unas pequeas clulas (2n) que se multi- secundario. d) Espermtida. e)
plican activamente por mitosis, son las Espermatozoides.
espermatogonias.

J. L. Snchez Guilln Pgina III-9-5


III) La informacin celular 9) Reproduccin

20) Fase de crecimiento: Las espermatogo-


nias que quedan hacia la luz del tbulo
experimentan una etapa de crecimiento y 1

pasan a denominarse espermatocitos prima- Espermatogonias (2n)


rios o de primer orden.

30) Fase de maduracin: Los espermatocitos 2

primarios van a sufrir la primera divisin de


Espermatocitos I (2n)
la meiosis transformndose en esper-
3-1
matocitos secundarios. La segunda divisin 3 Espermatocitos II (n)

de la meiosis produce unas clulas haploides 3-2


Espermtidas (n)
llamadas espermtidas; por cada espermato-
cito primario se producen cuatro
Espermatozoides (n)
espermtidas. 4

40) Fase de diferenciacin o espermiognesis:


Las espermtidas no son todava los Fig. 12 Espermatognesis: 1) Fase de
gametos, antes deben experimentar una serie proliferacin. 2) Fase de crecimiento. 3) Fase
de transformaciones anatmicas, etapa de maduracin. 3-1) 1 divisin de la meiosis.
3-2) 2 divisin de la meiosis. 4) Fase de
llamada espermiognesis, al final de la cual
diferenciacin.
quedarn convertidas en espermatozoides.
stos estn formados por las siguientes
partes: cabeza, pieza intermedia y la cola o
flagelo.

En ciertos animales, como los crustceos


decpodos, los espermatozoides no tienen
flagelo, siendo incapaces de nadar.

b) OVOGNESIS
Seccintransversal
Seccin transversaldel
del
flagelode
flagelo deun
un
espermatozoide
El desarrollo de los vulos tiene lugar en espermatozoide

las gnadas femeninas: los ovarios. En este


rgano, las clulas madres germinales sufren Fig. 13 Estructura del espermatozoide.
un complicado proceso en el que se pueden
distinguir las siguientes fases:

10) Fase de proliferacin o multiplicacin:


Las clulas madres germinales (2n) se
multiplican por mitosis dando ovogonias
(2n).

20) Fase de crecimiento: Las ovogonias


atraviesan una fase de crecimiento y se
convierten en ovocitos de primer orden a b c d

(ovocitos I), tambin con 2n cromosomas. A


diferencia de la espermatognesis el creci-
Fig. 14 Espermatozoides de a) cobaya; b) ave
miento es considerable, ya que el vulo es
sp. ; c) y d) crustceos.
el gameto portador de la mayora de las
sustancias necesarias para el desarrollo del

J. L. Snchez Guilln Pgina III-9-6


III) La informacin celular 9) Reproduccin

embrin. Folculos
primarios Folculos
secundarios

30) Fase de maduracin: Una vez que el


ovocito primario ha completado su
crecimiento est ya preparado para atravesar Folculo de
Graff

las dos divisiones de la meiosis y Cuerpo lteo en


degeneracin

transformarse en una clula haploide con n


Ovocito

cromosomas: la ovtida. Ovulacin

Cuerpo
lteo

Una peculiaridad muy importante de la


ovognesis es que durante la meiosis el Fig. 15 Ovario mostrando las diversas fases
ovocito no se divide en cuatro clulas de desarrollo de los folculos durante el ciclo
iguales sino que la mayora del citoplasma ovrico.
queda en una sola de ellas, la que dar
lugar al vulo. As, cada ovocito primario da
lugar a un nico vulo. Las otras tres clulas Clula madre
restantes, muy pequeas, se denominan cor- germinal (2n)

psculos polares y se trata en realidad de


gametos abortivos que permanecen un Ovogonias (2n)

tiempo adosados al vulo hasta que termi-


nan por atrofiarse y desaparecer.

40) Fase de diferenciacin: La ovtida se Ovocito I (2n)


transforma en el vulo. En general no se
trata de una fase de transformaciones tan Corpsculo
Ovocito II (n) polar (n)
acusadas como las que suceden en el
espermatozoide.
Ovtida vulo (n)

El vulo es una clula haploide de gran


tamao, pues almacena sustancias nutriti vas Fig. 16 Ovognesis.
en forma de granos de vitelo. Como
cualquier otra clula est recubierto por la
membrana plasmtica. Pero en la mayor
parte de los animales existen otras mem-
Corpsculo polar
branas de gran espesor envolviendo a la
membrana plasmtica. Corona radiada

Capa pelcida

FECUNDACIN EN ANIMALES
Ncleo
Concepto: Se da el nombre de fecundacin
a la fusin de los dos gametos seguida por
la unin de sus ncleos.
Citoplasma

Consecuencias: La fusin de los gametos


Fig. 17 vulo.
activa al vulo, de manera que ste empieza
a desarrollarse. La unin de los dos ncleos
da lugar a un slo ncleo diploide en el que se mezclan las informaciones genticas
de dos progenitores diferentes. Por lo tanto, la fecundacin acarrea dos fenmenos
diferentes: la activacin del huevo y la mezcla de caracteres hereditarios.

J. L. Snchez Guilln Pgina III-9-7


III) La informacin celular 9) Reproduccin

1 2 3 4 5

Fig. 18 Fecundacin en animales. 1) Contacto; 2) fin de la meiosis del ovocito y expulsin de


21 corpsculo polar; 3) y 4) fusin de ambos ncleos; 5) primera divisin del zigoto.

FORMACIN DE LOS GAMETOS EN LAS PLANTAS CON FLOR

Las plantas con flor reciben el nombre de fanergamas. Estas plantas han conse-
guido que su reproduccin no dependa del medio acutico, como sucede en las algas,
musgos y helechos. Para ello se valen de dos "inventos" evolutivos de gran impor-
tancia:

11- La polinizacin asociada con la aparicin de las flores.


21- La semilla y el fruto.

MORFOLOGA DE LA FLOR

Definiremos la flor como el aparato reproductor de las fanergamas.

En esencia, la flor es un tallo


sobre el que se disponen una serie
de rganos que tienen diferentes
aspectos segn la funcin que
Estambre (androceo)
realizan. Todos estos rganos se Ptalo (corola)

encuentran situados sobre un


ensanchamiento del pednculo floral Perianto

llamado receptculo. En una flor


hermafrodita tpica vamos a encon- Spalo (cliz) Carpelo (gineceo)

trar, de afuera hacia dentro, las


siguientes partes:

10- Una envuelta formada por unas Fig. 19 Morfologa de una flor hermafrodita tpica.
hojitas de color verde, los spalos,
el conjunto de los cuales recibe el
nombre de cliz.

J. L. Snchez Guilln Pgina III-9-8


III) La informacin celular 9) Reproduccin

20- Una segunda envuelta formada por una Saco polnico


antera
serie de piezas, frecuentemente coloreadas,
y que reciben el nombre de ptalos. Al
conjunto de los ptalos se le denomina: la
corola. Su funcin es la de atraer a los
animales, insectos, por ejemplo, que deben
polinizar a la planta. teca

Cliz y corola forman el perianto y son filamento

piezas estriles que envuelven a los elemen-


tos sexuales: los estambres y los carpelos.
Fig. 20 Partes de un estambre y corte de
30 Al conjunto de los estambres se denomi- una antera.
na: el androceo. El androceo es el aparato
reproductor masculino. Cada estambre
consta, a su vez, de un filamento por el que
est unido al resto de la flor y de una
antera. Cada antera est formada por dos
tecas repletas de granos de polen.

40- Los carpelos forman el gineceo o aparato


sexual femenino de la planta. En un carpelo
distinguiremos tres partes: Ovario, estilo,
estigma. En el interior del ovario se encuen-
tran los rudimentos seminales que contienen
el gameto femenino u vulo.

Fig. 21 Partes de un carpelo.


FORMACIN DE LOS GAMETOS EN LAS
PLANTAS CON FLOR
Clula madre del
grano de polen
Formacin del grano de polen. En los estam-
bres cada teca tiene dos sacos polnicos en Meiosis 1 Divisin

cuyo interior estn las clulas madres de los


granos de polen. Cada una de stas formar
por meiosis cuatro clulas haploides con un
slo ncleo: las microesporas masculinas. Meiosis 2 Divisin

Microsporas

Cada microespora dar lugar a un grano de masculinas

polen. Para ello se rodea de dos envueltas:


una ms interna y delgada, la intina, y otra
muy gruesa, la exina, decorada con relieves
Grano de polen
caractersti cos en cada especie. El ncleo
(n) se va a dividir por mitosis dando dos
ncleos n: el ncleo generativo y el ncleo Fig. 22 Formacin del grano de polen.
vegetativo.

J. L. Snchez Guilln Pgina III-9-9


III) La informacin celular 9) Reproduccin

nucela

Exina

intina
Clula madre del
saco embrionario

primina

secundina
funculo
ncleos

micropilo

Fig. 23 Grano de polen. Fig. 24 Rudimento seminal (vulo).

Formacin del saco embrionario. En los carpelos, en el interior de los ovarios, se


encuentran los rudimentos seminales u vulos. Cada uno est unido al ovario por el
funculo y protegido por dos envueltas
celulares: una ms externa, la primina, y
otra ms interna, la secundina. Ambas lo
rodean dejando un orificio: el micropilo. Ms antpodas

al interior encontramos una masa de clulas:


centrales
la nucela, una de las clulas de la nucela: la
clula madre del saco embrionario, se sinrgidas

desarrolla considerablemente y por meiosis


oosfera
da cuatro clulas con n cromosomas.
Generalmente, tres de ellas degeneran y la
que perdura se divide varias veces (tres,
normalmente) formando el saco embrionario. Fig. 25 Saco embrionario.
Cada saco embrionario contiene ocho clulas
(n). Las tres superiores son las sinrgidas,
una de las sinrgidas, la central, es el gameto femenino u oosfera; otras dos son las
centrales, y en la parte opuesta a las sinrgidas, se encuentran las ant podas. Las
dos sinrgidas y las tres antpo das no tienen ninguna funcin y despus de la
fecundacin desaparecen.

2n n n n n

meiosis 1mitosis 2mitosis 3 mitosis

Fig. 26 Formacin del saco embrionario.

FECUNDACIN EN LAS PLANTAS CON FLOR

Una vez el grano de polen ha llegado al estigma de la flor sta produce sustancias

J. L. Snchez Guilln Pgina III-9-10


III) La informacin celular 9) Reproduccin

que van a provocar la formacin por parte


del grano de polen de un largo tubo: el tubo
polnico. ste penetra por el estigma y se
dirige hacia el micropilo. Por el interior del
tubo polni co se trasladan el ncleo
vegetativo y el ncleo generativo. Este anterozoides

ltimo, segn va descendiendo al encuentro


de la oosfera, se divide por mitosis en dos
ncleos; se forman as los dos anterozoides n. vegetativo

o gametos masculinos. Una vez que el tubo


polnico ha contactado con uno de los
sacos embrionarios presentes en el ovario, el Fig. 27 Formacin del tubo polnico.
ncleo vegetativo desaparece y ambos
anterozoides pasan al interior del saco
embrionario. Uno de los anterozoides se
fusiona con la oosfera y formar un ncleo
2n que dar lugar al embrin; el otro se une
con los dos ncleos centrales del saco 3n

embrionario formando un ncleo 3n que dar 2n

lugar al tejido nutritivo de la semilla llamado:


albumen o endospermo. Vemos que en el
interior del saco embrionario se produce una
doble fecundacin.
Fig. 28 Fecundacin.

ovario

vulo

ciruela

Fig. 29 Origen de las diferentes partes de un


fruto de ciruela.

embrin endospermo

cotiledn embrin

Semilla de juda Fruto del trigo

Fig. 30 Semilla de juda y fruto de trigo.

J. L. Snchez Guilln Pgina III-9-11


III) La informacin celular 10) Mutaciones

10) LAS MUTACIONES

MUTACIONES

Son cambios en la informacin hereditaria.


Pueden producirse en clulas somticas o en
clulas germinales (las ms trascendentales).
La mutacin es un cambio en el material
gentico. Por lo tanto, slo son heredables
cuando afectan a las clulas germinales; si
afectan a las clulas somticas se extinguen,
por lo general con el individuo, a menos que
se trate de un organismo con reproduccin Fig. 1 Drosophila. Mutante con alas
asexual. vestigiales (izd.) y mosca normal (dch.).

Pueden ser: naturales (espontneas) o


inducidas (provocadas artificialmente con ADN original
radiaciones, sustancias qumicas u otros
A T C G A A C C G T T G C A C
agentes mutgenos). T A G C T T G G C A A C G T G

Se distinguen tres tipos de mutaciones


segn la extensin del material gentico Agente fsico
o qumico
afectado:

-Gnicas o puntuales A T C G A A C C G T T G C A C
T A G C T T G G A A A C G T G
-Cromosmicas estructurales
-Cromosmicas numricas o genmicas ADN con mutacin gnica

1) Mutaciones gnicas: Son aquellas que Fig. 2 Mutacin gnica.


producen alteraciones en la secuencia de
nucletidos de un gen. Existen varios tipos:

a) Sustituciones de pares de bases. stas


pueden ser:

- Transiciones: Es el cambio en un
nucletido de una base prica por 1) Transicin Nuevas cadenas

otra prica o de una pirimidnica por


otra pirimidni ca.
- Transversiones: Es el cambio de una
base prica por una pirimidnica o
viceversa. 2) Transversin Nuevas cadenas

b) Perdida o insercin de nucletidos, lo que Fig. 3 Mutaciones gnicas por sustitucin:


induce a un corrimiento en el orden de transicin y transversin.
lectura. Pueden ser:

J. L. Snchez Guilln Pgina III-10-1


III) La informacin celular 10) Mutaciones

- Adiciones gnicas: Es la insercin de


nucletidos en la secuencia del gen.
- Deleciones gnicas: Es la prdida de
nucletidos.

Las sustituciones provocan la alteracin de


un nico triplete y, por tanto, salvo que
indiquen un triplete de parada, o un
aminocido del centro activo de una enzima,
pueden no ser perjudiciales. Sin embargo, las
mutaciones que impliquen un corrimiento en
el orden de lectura, adiciones o deleciones,
salvo que se compensen entre s, pueden
Fig. 4 Glbulos rojos de una persona con
alterar la secuencia de aminocidos de la
anemia falciforme.
protena codificada y sus consecuencias
suelen ser graves.

Consecuencias de una adicin: Corrimiento en el orden de lectura.

Consecuencias de una sustitucin ADN original

ADN ARNm Aminocido Consecuencias


T A C G T T A C G A A T G C T T A A A T A
Original -A-C-A- -U-G-U- Cys Ninguna, pues el codn
codifica el mismo
Mutado -A-C-G- -U-G-C- Cys aminocido. A U G C A A U G C U U A C G A A U U U A U

Original -A-C-A- -U-G-U- Cys Sustitucin de un -Met-Gln-Cys-Leu-Arg-Ile-Tyr-


aminocido por otro, pues
Mutado -A-C-C- -U-G-G- Trp el codn codifica un
aminocido distinto. ADN mutado
Original -A-C-A- -U-G-U- Cys Generacin de una seal
de stop. T A C G T T A A C G A A T G C T T A A A T
C
Mutado -A-C-T- -U-G-A- Stop

A U G C A A U U G C U U A C G A A U U U A G

-Met-Gln-Leu-Leu-Thr-Asn-Leu-

Fig. 6 Consecuencias de una sustitucin. Fig. 5 Consecuencias de una adicin.

2) Mutaciones cromosmicas estructurales: Son los cambios en la estructura interna


de los cromosomas. Se pueden agrupar en dos tipos:

a) Las que suponen prdida o duplicacin de segmentos:

- Delecin cromosmica: Es la prdida de un segmento de un cromosoma.


- Duplicacin cromosmica: Es la repeticin de un segmento del cromosoma.

b) Las que suponen variaciones en la distribucin de los segmentos de los


cromosomas.

- Inversiones: Un segmento cromosmico de un cromosoma se encuentra


situado en posicin invertida.
- Translocaciones: Un segmento cromosmico de un cromosoma se encuentra
situado en otro cromosoma.

J. L. Snchez Guilln Pgina III-10-2


III) La informacin celular 10) Mutaciones

a a
a a
b b
b b
c c
c c

d d
d d
e e
e
e
f f
f
f
g
g d
h e
i f

Deficiencia o delecin Duplicacin

a 1 a 1
a a
b 2 b 2
b b
c 3 c 3
c c

d 4 d 4
d d
e 5 e 5
f 6 f h e h

g 7 g i f g
h 6 g f
i 7 h e
i i

Traslocacin Inversin

ORIGEN DE ALGUNAS MUTACIONES Delecin

CROMOSMICAS ESTRUCTURALES

Todos los cambios estructurales que se produ- Inversin

cen en los cromosomas pueden explicarse por la


rotura y reunin de sus fragmentos. Fig. 7 1er caso.

Podemos considerar 3 casos posibles, el primero


se refiere a un solo cromosoma y los dos
ltimos a parejas de cromosomas. Duplicacin

a) Roturas que afectan a un cromosoma:


Delecin

1er caso.- Si la rotura se produce dentro de un Fig. 8 2 caso.


brazo del cromosoma los fragmentos pueden reu-
nirse dando lugar a una delecin o a una inver-
sin ms un fragmento sin centrmero (acntrico)
que se pierde.

b) Roturas que afectan a cromosomas distintos:


Traslocacin

21 caso.- Si la rotura afecta a dos cromosomas


homlogos simultneamente. Despus de la rotura
Fig. 9 3er caso.
la reunin de los fragmentos puede producir
una duplicacin ms una delecin.

J. L. Snchez Guilln Pgina III-10-3


III) La informacin celular 10) Mutaciones

3er caso.- Afecta a dos cromosomas no homlogos. Despus de la rotura se produce un


intercambio de fragmentos dando lugar a una translocacin entre cromosomas no homlogos:
translocacin recpro ca.

Efecto fenotpico de las mutaciones cromosmicas estructurales: Las deleciones y


duplicaciones producen un cambio en la cantidad de genes y por tanto tienen efectos
fenot picos, por lo general deletreos. Sin embargo las inversiones y translocaciones
no suelen tener efecto fenotpico, pues el individuo tiene los genes correctos,
aunque de las translocaciones pueden derivarse problemas de fertilidad por
apareamiento defectuoso de los cromosomas durante la gametognesis o la aparicin
de descendientes con anomalas.

Ejemplo de mutacin cromosmica estructural: En la especie humana, una delecin particular


en el cromosoma 5 provoca el sndro me " cri du chat" (grito de gato) que se
caracteriza por microcefalia, retraso mental profundo y detencin del crecimiento.

Importancia evolutiva de las mutaciones cromosmicas estructurales.- La delecin


apenas tiene importancia evolutiva, mientras que la duplicacin en cambio posee una
importancia evolutiva grande. A su vez, las inversiones y translocaciones estn
tambin asociadas de una forma importante a la evolucin, por ejemplo la fusin de
dos cromosomas acrocntricos puede dar lugar a uno metacntrico, como ha ocurrido
con el cromosoma 2 de la especie humana, que es el resultado de la fusin de dos
cromosomas de un mono antepasado antropomorfo. Distintos genes de hemofilia se
han adquirido por duplicaciones en el transcurso de la evolucin.

3) Mutaciones cromosmicas numricas: Son alteraciones en el nmero de los


cromosomas propios de la especie. Pueden ser: Euploidas y Aneuploidas

a) Euploida: Cuando afecta al nmero de juegos completos de cromosomas con


relacin al nmero normal de cromosomas de la especie.

Las euploidas se pueden clasificar por el nmero de cromosomas que se tengan en:

-Monoploida o haploida: Si las clulas presentan un solo juego (n) de


cromosomas.
-Poliploida: Si presentan ms de dos juegos; pudiendo ser: triploides (3n),
tetraploides (4n), etc.

Tambin se pueden clasificar por la procedencia de los cromosomas en:

-Autopoliploida. Si todos los juegos proceden de la misma especie.


-Alopoliploida. Si los juegos proceden de la hibridacin de dos especies.

Origen de las euploidas.- Si durante la meiosis se produce en algunas clulas la no


disyuncin de todos los cromosomas homlogos se originarn dos gametos con 2n
cromosomas y dos gametos sin cromosomas (0). La unin de estos gametos entre s
o con gametos n, puede producir zigotos haploides, triploides o tetraploides (n+0,
n+2n, 2n +2n). En las plantas pueden conseguirse tetraploides, experimentalmente,
por tratamientos con colchicina.

Efectos fenotpicos de las euploidas.- En general, las anomalas en los euploides


son menores que en los aneuploides, en los que los efectos fenot picos son mayores
al no mantenerse equilibradas las dosis relativas de genes.

J. L. Snchez Guilln Pgina III-10-4


III) La informacin celular 10) Mutaciones

8 Cromosomas 12 Cromosomas 16 Cromosomas

Cariotipo Cariotipo Cariotipo

1 2 1 2 1 2

3 4 3 4 3 4

Diploide 2n Triploide 3n Tetraploide 4n

Fig. 10 Autopoliploidas en una especie con 2n=8 cromosomas.

b) Aneuploidias: Se dan cuando est afectada slo una parte del juego cromosmico
y el zigoto presenta cromosomas de ms o de menos. Las aneuploidas pueden darse
tanto en los autosomas (por ejemplo: el Sndrome de Down), como en los heterocro-
mosomas o cromosomas sexuales (por ejemplo: el sndrome de Turner o el sndro me
de Klinefelter).

stas alteraciones se denominan:

- Monosomas: si falta uno de los cromosomas de la pareja de homlogos.


- Trisomas: si se tienen tres cromosomas en lugar de los dos normales.
- Tetrasomas: si se tienen 4. Etc.

Ejemplo de trisoma: el Sndrome de Down o


trisoma 21 . Existe un tipo de trisoma particu-
larmente corriente en la especie humana, es la
llamada trisoma 21 o sndrome de Down
(tambin conocida como mongolismo). Las perso-
nas que presentan este sn drome se caracterizan
por tener retraso mental, cuerpo corto, dedos
cortos y gruesos, lengua hinchada y un pliegue
en el prpado parecido al de las razas mongli-
cas. Est demostrada la relacin entre el sn -
drome de Down y una avanzada edad en la
madre. En ciertos casos de mongolismo el indivi-
duo presenta una placa metafsica normal con
Fig. 11 Ideograma del cariotipo de una clula
46 cromosomas, pero uno de los cromosomas
de una persona con trisoma 21.
del grupo 13-15 es mayor, por lo que se cree
que lo que ha sucedido es una translocacin de

J. L. Snchez Guilln Pgina III-10-5


III) La informacin celular 10) Mutaciones

uno de los cromosomas 21 en exceso a uno de


los cromosomas del grupo 13-15. Parece ser que
las trisomas se originan por una no disyuncin par 21

de los cromosomas en la primera divisin de la No disyuncin del


par 21. DI

meiosis (ver figura).


-

21 21

Importancia evolutiva de las aneuploidas.- D II

Tienen ms importancia evolutiva que las


anteriores de cara a la obtencin de nuevas
especies. 21
21 21

Formacin de un zigoto con


21 21 21
trisoma 21 por unin entre un
espermatozoide con un 21 y un
vulo con dos 21, originado por
una no disyuncin del par 21 en
la primera divisin de la meiosis.

Fig. 12 Trisoma 21 originada por una no


disyuncin del par 21 en la anafase de la 1
divisin de la meiosis del ovocito primario.

Las aneuploidas y sus consecuencias en la meiosis


Cariotipo normal Nulismico

1 2 3 4 1 2 3 4

Contenido cromosmico de los Contenido cromosmico de los


gametos o de las esporas: n gametos o de las esporas: n-1
cromosomas. cromosomas.

Monosmico Trismico

1 2 3 4 1 2 3 4

Contenido cromosmico de los Contenido cromosmico de los


gametos o de las esporas: n y gametos o de las esporas: n y
n-1 cromosomas. n+1 cromosomas.

Tetrasmico Doble trismico

1 2 3 4 1 2 3 4

Contenido cromosmico de los Contenido cromosmico de los


gametos o de las esporas: n+1 gametos o de las esporas: n,
cromosomas. n+1 y n+2 cromosomas.

J. L. Snchez Guilln Pgina III-10-6


III) La informacin celular 10) Mutaciones

LAS ANEUPLOIDAS MS IMPORTANTES EN LA ESPECIE HUMANA Y SUS EFECTOS

Aneuploidas en los autosomas


Sndrome Mutacin Caractersticas fenotpicas
Sndrome de Down Trisoma del par 21 Ojos oblicuos, retraso mental, cabeza
ancha y cara redondeada.
Sndrome de Edw ards Trisoma del par 18 Boca y nariz pequeas, deficiencia
mental, lesiones cardacas, membrana
interdigital. Poca viabilidad.
Sndrome de Patau Trisoma del par 13 Labio leporino, paladar hendido, defi-
ciencias cerebrales y cardiovasculares.
Poca viabilidad.

Aneuploidas en los cromosomas sexuales


Sndrome Mutacin Caractersticas fenotpicas
Sndrome de Klinefelter Uno o ms cromosomas X en Sexo masculino. Esterilidad,
exceso (XXY, XXXY,..). deficiencias mentales y algunos
caracteres sexuales secundarios
femeninos.
Sndrome de Turner Monosoma del cromosoma Sexo femenino con un slo cro-
X. mosoma X, esterilidad, baja
estatura, trax ancho.
Sndrome de doble Y Dos cromosomas Y (XYY) Varones de estatura elevada, se
relaciona con una mayor agresi-
vidad, bajo coeficiente mental.
Sndrome de triple X Tres cromosomas X Sexo femenino con rganos
genitales atrofiados, fertilidad
limitada. Bajo coeficiente mental.

J. L. Snchez Guilln Pgina III-10-7


III) La informacin celular 10) Mutaciones

AGENTES MUTGENOS

Un agente mutgeno es todo factor capaz de aumentar la frecuencia de mutacin


natural. Existen diversos factores, tanto fsicos como qumicos, capaces de actuar
como agentes mutgenos. En realidad, actuarn como agentes mutgenos todos
aquellos agentes capaces de alterar el material gentico y en particular, aquellos que
alteren la secuencia del ADN. Los principales agentes mutgenos son:

a) Agentes fsicos:

-Las radiaciones electromagnticas como los rayos X y los rayos gamma.


-Las radiaciones corpusculares como los rayos , los rayos y los flujos de protones
o neutrones que generan los reactores nucleares u otras fuentes de radiactividad
natural o artificial.
-Ciertos factores fsicos como los ultrasonidos, los choque trmicos, la centrifugacin,
etc.

b) Agentes qumicos:
- Los anlogos de las bases nitrogenadas.
- El cido nitroso (HNO2 ), porque desamina ciertas bases nitrogenadas.
- Los alcaloides como la cafena, la nicotina, etc.
- El gas mostaza, el agua oxigenada (H2 O2 ), el ciclamato, etc.

MUTACIONES Y EVOLUCIN

La evolucin se debe a aquellos procesos por los que las poblaciones cambian sus
caractersticas genticas a lo largo del tiempo. Se llama " pool" gnico de una
poblacin al conjunto de genes de la misma, formado por todos los alelos de los
genes que tienen los individuos que la constituyen. Una combinacin favorable de
alelos en un individuo favorece su supervivencia y por tanto su reproduccin y su
extensin en la poblacin.

La mutacin es la fuente primaria de


variacin, pero no la nica. La recombinacin
gnica incrementa la variabilidad. La mayora
de los cambios evolutivos se producen por
acumulacin gradual de mutaciones en los 1

genes y por variaciones en su nmero y


organizacin. Ahora bien, la mayor parte de
las mutaciones gnicas son deletreas
(mortales) y las que se han mantenido es
porque producen una mejora y son las Fig. 13 Las aves gigantes provienen todas
ellas de antepasados comunes.
esenciales para la evolucin.

La separacin entre los miembros de una


poblacin impide el intercambio gentico entre los mismos. Esto produce cada vez
ms diferenciacin al tener que adaptarse a ambientes distintos. Cuando con el
tiempo se acumulan diferencias que impiden la reproduccin entre los miembros de
esos grupos decimos que se trata de especies distintas.

J. L. Snchez Guilln Pgina III-10-8


III) La informacin celular 10) Mutaciones

Parece ser que los seres, a lo largo del tiempo, han ido aumentando la cantidad de
genes (duplicaciones) lo que ha supuesto que sobre estos genes duplicados pudieran
generarse mutaciones con un menor riesgo y favorecer el proceso de creacin de
variabilidad. As, en eucariotas, la cantidad de ADN es mayor que en otros grupos y
mayor que la necesaria para contener la informacin gentica.

EL CNCER: ENFERMEDAD GENTICA

CONCEPTO DE CNCER Y SU RELACIN CON EL ADN

Se desarrolla un tumor cuando se produce una multiplicacin y crecimiento irregular


de las clulas. En general, los tumores pueden ser:

-Tumores benignos: Localizados y sin crecimiento indefinido.


-Tumores malignos: Son aquellos tumores que crecen invadiendo y destruyendo
a los dems tejidos.

El cncer es una enfermedad o un conjunto de ellas que consiste en la


multiplicacin de ciertas clulas alteradas que forman tumores malignos y pueden
emigrar a otros puntos a travs del sistema linftico o circulatorio: metstasis.

Las clulas cancerosas crecen a gran velocidad, tienen protenas de membrana


distintas, presentan alteraciones en la forma e invaden a los tejidos prximos. El paso
de clula normal a cancerosa se denomina transformacin cancerosa. Puede deberse a:

- Mutaciones.
- Influencia de factores ambientales.
- Presencia de ciertos genes (protooncogenes) que pasan a oncogenes al sufrir
una mutacin.
- Presencia de ciertos genes (antioncogenes) o genes inhibidores o supresores
de la divisin celular.

1) Cncer producido por virus Se conocen virus que favorecen o facilitan la aparicin
de clulas cancergenas, debido a que producen mutaciones y algunas de estas
mutaciones pueden ser cancerge nas.

2) Cncer producido por sustancias


qumicas o por radiaciones. En humanos, la
mayora de los cnceres estn
fundamentalmente relacionados con agentes
cancerge nos como:

Radiaciones UV, X y nucleares


Alquitrn
Ahumados
Pan tostado chamuscado
Amianto
Cncer de
Cloruro de vinilo Cncer de piel pulmn
Anilinas
Algunos conservantes y edulcorantes Fig. 14 Agentes fsicos y qumicos
artificiales productores de cncer.
Bebidas alcohlicas (sobre todo de

J. L. Snchez Guilln Pgina III-10-9


III) La informacin celular 10) Mutaciones

alta graduacin)
Tabaco (pulmn)

Los agentes mutgenos pueden ser cancergenos. No son de efectos inmediatos. Es


necesario que acten repetidamente y que se presenten otros factores para que se
produzca la transformacin de una clula normal en cancerosa.

J. L. Snchez Guilln Pgina III-10-10


III) La informacin celular 11) Herencia gentica

11) LA HERENCIA GENTICA

CONCEPTO DE GENTICA

Definiremos la gentica como la parte de la Biologa que se ocupa del estudio de la


herencia biolgica, intentando explicar los mecanismos y circunstancias mediante los
cuales se rige la transmisin de los caracteres de generacin en generacin.

ALELOS

Para un gen pueden existir a veces diferentes variedades que pueden dar lugar a
caractersticas distintas en el individuo. As, por ejemplo, en el guisante, el gen A
determina que los guisantes sean de color amarillo y el gen a determina que sean de
color verde.

Se llaman alelos a las distintas variedades de un gen para un carcter; A y a son


genes alelos para el carcter que determina el color en los guisantes.

RELACIONES ALLICAS: HOMOCIGOSIS Y HETEROCIGOSIS

Los individuos diploides poseen en sus


clulas dos juegos de cromosomas
homlogos, uno aportado por el gameto
masculino y el otro por el gameto femenino. A A a a A a

Dado que los genes residen en los


cromosomas, resulta evidente que para cada
carcter el individuo tendr dos genes. Si en
ambos cromosomas homlogos reside el
Heterocigtico
mismo alelo diremos que el individuo es Homocigticos

homocigtico para ese carcter. Por ejemplo,


un guisante que tenga como genes para el Fig. 1 Homocigosis y heterocigosis.
color AA, es homocigtico, tambin lo es el
que tenga aa. Por el contrario, si en cada homlogo hay un alelo distinto, el individuo
ser heterocigtico para ese carcter. Por ejemplo, los guisantes Aa seran
heterocigticos.

DOMINANCIA Y RECESIVIDAD. CODOMINANCIA

Los individuos homocigticos manifestarn el carcter externo que viene definido por
sus genes. As, los guisantes AA sern amarillos y los aa sern verdes.

J. L. Snchez Guilln Pgina III-11-1


III) La informacin celular 11) Herencia gentica

Sin embargo, cuando tratamos del


fenmeno de la heterocigosis se plantea la
pregunta de )cul ser la resultante de Aa
AA aa
ambos alelos? Generalmente, en los
heterocigticos slo se manifiesta el carcter
definido por uno de los dos alelos. Dicho Fig. 2 Dominancia en el color de la piel de
alelo se dice que es el dominante, mientras los guisantes. El hbrido, Aa, es de color
que le otro, que slo se manifiesta en amarillo.
homocigosis, se dice que es el alelo
recesivo. En el caso del color de los
guisantes, A, el que determina el color
amarillo, es dominante sobre el alelo a, que
determina el color verde. El heterocigoto Aa
presenta color amarillo. Vemos que el efecto
de la dominancia enmascara uno de los
genes en el heterocigtico.

Hay algunos caso en los que ambos alelos


se hacen patentes en el heterocigtico; se
dice entonces que son codominantes. Por Fig. 3 Dondiego de noche (Mirabilis jalapa).
ejemplo, en el hombre, el alelo IA determina
el grupo sanguneo A y el alelo IB el grupo
B. Un individuo IA IA pertenece al grupo A,
IBIB al grupo B y el heterocigtico IAIB al AB.

IA IA ....... Homocigtico ...... Grupo A


IBIB ....... Homocigtico ...... Grupo B
IA IB ....... Heterocigtico ..... Grupo AB
RR BB RB

En otros casos, como en el del color de las


flores del dondiego de noche (Mirabilis Fig. 4 Herencia intermedia en el color de las
jalapa), los heterocigticos RB (R, rojo y B, flores del dondiego de noche (Mirabilis jalapa).
blanco) para el color de las flores, son
rosas. Se dice que ambos genes presentan
herencia intermedia, pues el heterocigtico
manifiesta una mezcla de ambos genes.

CMO SE REPRESENTAN LOS GENES?

Como hemos visto, los genes se


representan mediante letras. En el caso de
Fig. 5 Drosophila. Izquierda, mutante con
ser slo dos los alelos de un gen, uno
alas vestigiales (vg) y derecha, mosca de alas
dominante y otro recesivo, lo que es lo ms normales (vg+ ).
corriente, le asignaremos una letra
mayscula al gen dominante, por ejemplo

J. L. Snchez Guilln Pgina III-11-2


III) La informacin celular 11) Herencia gentica

(A), y la misma letra en minsculas al recesivo (a).

Cuando los genes que se conocen en una especie son numerosos, como es el caso
de la mosca del vinagre, Drosophila, se pueden asignar una o dos letras minsculas
seguidas del signo ms (+) para el dominante (por ejemplo vg +, alas normales) y la
misma o las mismas letras sin el signo ms (+) al recesivo (vg, alas vestigiales).

En el caso de herencia intermedia, ambos genes se representan mediante la inicial


en maysculas (R, color rojo de la flor en el dondiego y B, color blanco de la flor).

En el caso de codominancia, como es el de los grupos sanguneos A y B, se


indican mediante una letra en maysculas (I) para ambos y un superndice que los
distinga (IA para el que determina el grupo A e IB para el B).

GENOTIPO Y FENOTIPO

Los caracteres externos que exhibe un individuo constituyen su fenotipo mientras


que los genes que determinan ese fenotipo son su genotipo. En los guisantes, el
color amarillo de las semillas es el fenotipo, que est determinado por el genotipo
AA o el Aa, el fenotipo verde est determinado por el genotipo aa.

El fenotipo de un individuo no depende solamente de su genotipo, sino tambin de


las circunstancias ambientales. Se puede afirmar que el fenotipo es el resultado de la
accin de los genes expresada en un ambiente determinado.

FENOTIPO = GENOTIPO + AMBIENTE

Las flores de la hortensia pueden ser azules, si las plantas son cultivadas en tierra
cida, y de color rosa si la tierra es alcalina. El pH del suelo incide, en este caso,
sobre el fenotipo.

Otro curioso ejemplo de la accin del ambiente lo tenemos en los conejos de la raza
Himalaya. Si estos conejos son criados en su ambiente natural, fro, desarrollan un
pigmento negro en la punta de la nariz y en los extremos de las orejas y de las
patas. Los mismos conejos criados en una temperatura clida pierden todo el
pigmento y son totalmente blancos. Se ha demostrado que si una regin del cuerpo
de estos conejos es enfriada artificialmente durante algunos das aparece en ella la
pigmentacin. En la raza Himalaya, el gen para el color del pelo determina la
presencia de una enzima que hace posible la aparicin del pigmento; esta enzima es,
sin embargo, muy sensible a la temperatura, siendo inactivada por las altas
temperaturas, lo que conduce a la falta de pigmentacin. Las partes ms fras del
cuerpo de estos animales son siempre las extremidades, lo que explica la curiosa
distribucin del pigmento.

Es de destacar que a la hora de escribir el genotipo, en el caso del heterocigtico,

J. L. Snchez Guilln Pgina III-11-3


III) La informacin celular 11) Herencia gentica

siempre se indica primero el gen dominante y despus el recesivo y nunca al revs


(Aa, Nn o vg + vg y no aA, nN o vvg + ). Cuando uno de los genes del genotipo no se
conozca, lo indicaremos mediante una raya. Por ejemplo, si en los cobayas el pelo
negro (N) domina sobre el blanco (n), si tenemos un cobaya de pelo negro, podr
ser, si no tenemos ms datos, tanto NN como Nn. Esto es, su genotipo ser N-.

HERENCIA DE UN SOLO CARCTER

A) 1 LEY DE MENDEL. LEY DE LA


UNIFORMIDAD DE LOS HBRIDOS DE LA
PRIMERA GENERACIN FILIAL. AA X aa Progenitores

Cuando se cruzan dos variedades,


A a Gametos
individuos de raza pura, ambos para un
determinado carcter (homocigotos), todos
los hbridos de la primera generacin son
iguales fenotpica y genotpicamente. Aa F1

Mendel lleg a esta conclusin al cruzar


variedades puras (homocigticas) de
Fig. 6 1 Ley de Mendel.
guisantes amarillas y verdes, pues siempre
obtena de este cruzamiento variedades de
guisante amarillas.
Aa X Aa F1

B) 2 LEY DE MENDEL. LEY DE LA


SEGREGACIN DE LOS GENES QUE
FORMAN LA PAREJA DE ALELOS DE LA F1. A a A a Gametos

F2
Mendel tom plantas procedentes de las
semillas de la primera generacin (F1 ) del A a
experimento anterior, amarillas, Aa, y las
A AA Aa
poliniz entre s. Del cruce obtuvo semillas
amarillas y verdes en la proporcin 3:1
a Aa aa
(75% amarillas y 25% verdes). As pues,
aunque el alelo que determina la coloracin
verde de las semillas pareca haber Fig. 7 2 Ley de Mendel.
desaparecido en la primera generacin filial,
vuelve a manifestarse en esta segunda
generacin.

RETROCRUZAMIENTO

El retrocruzamiento permite determinar si un individuo que exhibe el fenotipo del gen


dominante es homocigtico (AA) o heterocigtico (Aa). El nombre de retrocruzamiento

J. L. Snchez Guilln Pgina III-11-4


III) La informacin celular 11) Herencia gentica

se debe a que para saber si los


Amarillo Verde
descendientes de la F2 son homocigticos o F1 A? aa

heterocigticos se cruzan con el parental


homocigtico recesivo (aa). Gametos A ? a

As, para saber si una planta de guisantes ?=A ?=a

amarilla es AA o Aa, la cruzaremos con una a


a
planta verde (aa). Si los descendientes son Amarillo
Amarillo
A
todos amarillos, esto querr decir que la AA A Aa

planta problema es homocigtica (AA) y si Amarillo


50% Verde
A Aa a aa
la mitad son amarillos y la otra mitad
verdes, la planta ser heterocigtica (Aa).

Fig. 8 Retrocruzamiento.

HERENCIA DE DOS CARACTERES


SIMULTANEAMENTE

A) GENES LOCALIZADOS EN PARES DE


A a

B b

CROMOSOMAS HOMLOGOS DISTINTOS

En los guisantes, los genes A y a


determinan el color y los genes B y b A A a a

determinan la textura de la piel (B, lisa y b, B b B b

rugosa). El locus (locus= lugar, localizacin)


para los genes que determinan estos dos
caracteres se encuentra en pares de Fig. 9 Gametos que forma un dihbrido
(Aa,Bb) cuando los genes que determinan
cromosomas homlogos distintos. ambos caracteres son independientes.

Cuando los genes no alelos, genes que


determinan dos caracteres distintos, se AaBb
AaBb X
encuentran en pares de cromosomas
homlogos diferentes, como es el caso del
color y de la textura de los guisantes, se
AB Ab aB ab AB Ab aB ab
transmiten a la F2 independientemente unos
de otros. AB Ab aB ab

AB AA,BB AA,Bb Aa,BB Aa,Bb


A esta conclusin lleg Mendel en su 3
Ley contabilizando los descendientes de los Ab AA,Bb AA,bb Aa,Bb Aa,bb
cruzamientos de la autopolinizacin de una
planta amarillo, lisa, doble heterocigtica aB Aa,BB Aa,Bb aa,BB aa,Bb
(Aa,Bb), al obtener una segregacin: 9:3:3:1.
ab Aa,Bb Aa,bb aa,Bb aa,bb

9, amarillos, lisos;
3, amarillos, rugosos; Fig. 10 3 Ley de Mendel. Segregacin
3, verdes, lisos; 9:3:3:1 que demuestra que ambos caracteres,
color de la piel y textura, son independientes.
1, verde, rugoso.

J. L. Snchez Guilln Pgina III-11-5


III) La informacin celular 11) Herencia gentica

Esto hoy se entiende porque sabemos que


los cromosomas emigran aleatoriamente a
los polos y durante la anafase I se separan
los cromosomas homlogos de cada par. A

B
a

Despus, en la anafase II, se separan las


cromtidas de cada cromosoma y se forman
cuatro clases de gametos, cada uno de los
cuales posee n cromosomas. Puesto que su
A a

distribucin se realiza totalmente al azar, una B b

planta que sea (Aa,Bb) podr agrupar los


genes de cuatro formas diferentes (Fig. 9) y
formar cuatro tipos de gametos: (A,B), (A,b), Fig. 11 Gametos que forma un dihbrido
(Aa,Bb) cuando los genes que determinan
(a,B) y (a,b), todos ellos en el mismo
ambos caracteres se encuentran ligados con
porcentaje: 25%. ligamiento absoluto.

B) GENES LOCALIZADOS EN EL MISMO


PAR DE CROMOSOMAS HOMLOGOS.
A a A a A A a a
LIGAMIENTO Y RECOMBINACIN.
B b B b B b B b

Los genes que se encuentran en el mismo


cromosoma se dice que son genes ligados.
Todos los genes que se encuentran en un
A A a a

mismo cromosoma constitu yen un grupo de


ligamiento. p
B

r
b

r
B

p
b p) parentales
r) recombinantes

B1) LIGAMIENTO ABSOLUTO


Fig. 12 Gametos que forma un dihbrido
(Aa,Bb) cuando los genes que determinan
Si los genes ligados estn muy prximos, ambos caracteres se encuentran ligados con
lo ms probable ser que durante la profase ligamiento relativo y hay recombinacin entre
ellos.
I de la meiosis no se produzca ningn sobre-
cruzamiento entre ellos y pasarn juntos a
los gametos sin separarse. En este caso
diremos que el ligamiento es absoluto. A a

B b

As, supongamos dos genes ligados a y b,


y un individuo diheterocigtico Aa,Bb en el
que los genes A y B estn en un cromoso-
ma y a y b en el homlogo. Podremos A a

representar los genes en los cromosomas


como se indica en la Fig. 11 . Estos genes, B b

al estar muy prximos, lo ms probable ser


que no haya sobrecruzamiento entre los loci Fig. 13 Gametos que forma un dihbrido
(Aa,Bb) cuando los genes que determinan
a y b, los gametos recibirn o el cromosoma
ambos caracteres se encuentran ligados con
con A,B o el que porte a,b. Por lo tanto, se ligamiento relativo y no hay recombinacin
formarn slo dos clases de gametos: A,B y entre ellos.
a,b (ver Fig. 11 ).

J. L. Snchez Guilln Pgina III-11-6


III) La informacin celular 11) Herencia gentica

B2) LIGAMIENTO RELATIVO: ENTRECRUZAMIENTO CROMOSMICO Y


RECOMBINACIN

Si los loci ligados se encuentran lo suficientemente separados, en la profase I de la


meiosis, podr producirse un sobrecruzamiento entre ellos, lo que dar lugar a que se
formen cuatro tipos de gametos (ver Fig. 12 ), mientras que en otras no se producir, y
slo se formarn dos tipos de gametos (ver Fig. 13 ).

Obsrvese que, de los cuatro gametos surgidos de la meiosis con sobrecruzamiento,


dos de ellos tienen los genes ligados de la misma manera que en los cromosomas de
los progenitores, son los gametos parentales (p), los otros dos gametos llevan las
cromtidas producto del sobrecruzamiento y se les llama gametos recombinantes (r).

La probabilidad de que se produzca un sobrecruzamiento entre genes ligados depen-


de de la distancia que separa los loci en el cromosoma. Entre loci muy prximos ser
difcil que se produzca recombinacin y la probabilidad de que los gametos lleven las
cromtidas recombinantes ser baja. Por el contrario, entre dos loci muy alejados el
sobrecruzamiento ser muy probable por lo que la cantidad de gametos recombinantes
se acercar al 50% del total de los gametos producidos.

Es de destacar que en el macho de Drosophila no se producen sobrecruzamientos.

FRECUENCIA DE RECOMBINACIN. MAPAS CROMOSMICOS

La probabilidad de los gametos recom-


binantes para un par de genes ligados es un
eb
valor constante que depende, principalmente,
de la distancia a la que se encuentren los
20
genes en el cromosoma. Esta probabilidad
recibe el nombre de frecuencia de
44 cu
recombinacin. La frecuencia de
recombinacin entre dos genes ligados es
igual a la suma de las frecuencias de los 24

gametos recombinantes. La unidad de


medida de la frecuencia de recombinacin es se
el centimorgan ().
Fig. 14 Distancias relativas de los genes
1 = 1% de recombinacin ligados en Drosophila: eb (cuerpo bano); cu
(alas curvadas); se (ojos color sepia). Estas
distancias se han establecido en base a la
Si dos genes ligados se encuentran alejados frecuencia de recombinacin entre estos tres
en un cromosoma su frecuencia de genes.
recombinacin ser alta, prxima al 50%, y
baja si se encuentran prximos.

Veamos un ejemplo con los siguientes genes en Drosophila: el gen cu, que da lugar

J. L. Snchez Guilln Pgina III-11-7


III) La informacin celular 11) Herencia gentica

a alas anormales curvadas, el gen se, que produce ojos de color sepia, frente a los
normales de color rojo, y el gen eb que produce una coloracin bano del cuerpo.
Todos ellos son genes ligados. Las frecuencias de recombinacin son respectiva-
mente:

se con cu ...... 24% ...... 24


se con eb ...... 44% ...... 44
cu con eb ...... 20% ...... 20

Lgicamente, esto nos indica que se y eb son los ms alejados entre s y que cu
se encuentra entre ambos (ver Fig. 14).

De acuerdo con esto podremos establecer el orden en que se encuentran estos tres
genes en el cromosoma y tambin las distancias relativas medidas en centimorgan.

Las frecuencias de recombinacin han permitido elaborar mapas cromosmicos. Estos


mapas indican la situacin y la distancia relativa a la que se encuentran los genes en
el cromosoma.

LA DETERMINACIN DEL SEXO

Es sabido que en la especie humana el sexo viene determinado por la pareja


cromosmica XY. Ahora bien, en la naturaleza, existen diferentes mecanismos para la
determinacin del sexo. As:

a) Determinacin sexual debida a un par de genes; como ocurre, por ejemplo, en las
plantas dioicas.

b) Determinacin sexual por cromosomas


Mujer Hombre
sexuales. En este caso, el sexo depende de
XX XY
la presencia o ausencia de determinados
cromosomas. En el reino animal, los
sistemas ms frecuentes de determinacin
X X Y
sexual son:

- Sistema XX-XY. Como el del hombre y el


resto de los mamferos. En el que el sexo
femenino tiene dos cromosomas iguales XX
(homogamtico); por lo que todos los
gametos llevarn el cromosoma X. El sexo XX XY
masculino posee un conjunto XY
(heterogamtico); por lo que dar lugar a dos
tipos de gametos, la mitad con el Fig. 15 Determinacin del sexo en la
cromosoma X y la otra mitad con el especie humana.
cromosoma Y.

- Sistema ZZ-ZW. Se da en aves, reptiles, etc. En este caso el macho es el sexo


homogamtico (ZZ) y la hembra el heterogamtico (ZW).

J. L. Snchez Guilln Pgina III-11-8


III) La informacin celular 11) Herencia gentica

- Sistema XX-XO. La hembra es homogamtica XX y el macho heterogamtico (XO)


posee un slo cromosoma X y no tiene cromosoma Y. Se da en liblulas,
saltamontes...

c) Sexo por haploidia: Los huevos fecundados (diploides) dan lugar a hembras y los
no fecundados (haploides) a machos. Ejemplo: las abejas.

d) Sexo debido al equilibrio gentico: Drosophila posee un sistema XX-XY pero el


cromosoma Y no determina el sexo masculino, aunque sea necesario para la
fertilidad. La determinacin sexual se encuentra en los autosomas y depende de la
relacin numrica entre el nmero de cromosomas X y el de juegos autosmicos (A).

X/A < 0,5.................Supermacho


X/A = 0,5 ................Macho
X/A entre 0,5 y 1.......Intersexo
X/A = 1.....................Hembra
X/A > 1.....................Superhembra

e) Sexo debido a factores ambientales. En ciertos casos, por ejemplo, en ciertas


especies de cocodrilos, el sexo se determina en funcin de la temperatura de
incubacin de los huevos.

f) Inversin sexual. El sexo depende de la proporcin de machos y hembras


existentes en la poblacin o de la edad. As, ciertos peces cuando son jvenes
tienen un sexo y de adultos tienen otro.

LA HERENCIA LIGADA AL SEXO EN LA ESPECIE HUMANA

Los cromosomas sexuales, adems de los genes que determinan el sexo, tienen
tambin otros genes que no tienen nada que ver con los caracteres sexuales. Estos
genes son los genes ligados al sexo.

En la especie humana, el cromosoma Y, al ser de menor tamao, posee menos


informacin que el cromosoma X. Esta es la razn de que la mayora de los
caracteres ligados al sexo que se conocen sean caracteres ligados al cromosoma X.
As, en el cromosoma X se han detectado hasta 150 loci, algunos de ellos
portadores de ciertas anomalas.

- Herencia ligada al cromosoma Y

Un gen ligado al cromosoma Y se manifestar en todos los hombres que lo lleven y


slo en los hombres, independientemente de que sea dominante o recesivo. Entre los
pocos casos que se conocen de anormalidad hereditaria ligada al cromosoma Y
tenemos la hipertricosis del pabelln auricular. Se trata de un carcter cuyo gen
determina la aparicin de pelo en el pabelln de la oreja.

J. L. Snchez Guilln Pgina III-11-9


III) La informacin celular 11) Herencia gentica

- Herencia ligada al cromosoma X


Mujer Hombre
XHXh XHY
Los genes dominantes ligados al
cromosoma X son muy poco frecuentes. Se
trata de un tipo de herencia que se XH Xh XH Y
caracteriza por que los varones afectados
transmiten el carcter a todas sus hijas y a
ninguno de sus hijos. Las mujeres afectadas
lo transmiten a la mitad de sus hijos y a la XH Y
mitad de sus hijas. Un ejemplo de este tipo
de herencia es la hipofosfatemis (raquitismo XH XHXH XHY
que no cede con la administracin de
vitamina D). Xh XHXh XhY

Los genes recesivos ligados al cromosoma Fig. 16 Herencia de la hemofilia en la


X slo se manifiestan en la mujer, en el especie humana. Posible descendencia entre una
caso de que estn en homocigosis, en el mujer portadora y un hombre no hemoflico.
hombre se manifestarn siempre.

Un ejemplo tpico es el de la hemofilia. Se


trata de una enfermedad hereditaria
caracterizada por ausencia en la sangre de Mujer Hombre
XHXH Xh Y
las personas que la padecen de un factor
necesario para su coagulacin. Las personas
hemoflicas, sin un tratamiento adecuado,
XH Xh Y
estn expuestas a graves hemorragias. Esta
grave enfermedad es bien conocida debido a
que la reina Victoria de Inglaterra (que era
portadora del gen) lo transmiti a uno de
sus hijos (muerto de una hemorragia tras Xh Y
una cada) y a dos de sus hijas,
responsables de que la enfermedad se XH XHXh XH Y
extendiera entre varias casas reales
europeas.
Fig. 17 Herencia de la hemofilia en la
El gen de la hemofilia, que representaremos especie humana. Posible descendencia entre una
como X h, es recesivo respecto al gen mujer normal, no portadora y un hombre
hemoflico.
normal, X H. Se han conocido muy pocos
casos de mujeres hemoflicas, y esto por
dos razones:

- En primer lugar, porque para que se produzca una mujer hemofli ca es necesario
que el padre sea homoflico y la madre portadora o hemoflica. El gen de la hemofi-
lia no es muy frecuente en la poblacin humana, lo que hace raras estas uniones.

- Por otra parte, algunos autores indican que el gen de la hemofilia podra tener
efectos letales, mortales, en homocigosis. Aunque estudios recientes parecen
desmentirlo.

A pesar de todo se han citado algunos caso de mujeres hemofli cas. Una de ellas

J. L. Snchez Guilln Pgina III-11-10


III) La informacin celular 11) Herencia gentica

lleg incluso a tener descendencia y sobrevivi a la hemorragia postparto. Esto se


interpreta como una consecuencia de los distintos grados de expresividad (capacidad
para manifestarse fenotpicamente) que puede tener un gen. El cuadro siguiente nos
informa respecto a los genotipos y fenotipos posibles y en las figuras 16 y 17
tenemos dos ejemplos de herencia del carcter.

Genotipos Fenotipos
X HX H Mujer normal
X HX h Mujer portadora
X hX h Mujer hemoflica )letal?
X HY Hombre normal
X hY Hombre hemoflico

Otro caso conocido de herencia ligada al cromosoma X es el daltonismo o ceguera


para los colores rojo y verde. Las personas que tienen esta anomala se caracterizan
por no poder distinguir ambos colores uno del otro. Su herencia se explica
considerndolo tambin como un carcter que viene determinado por un gen recesivo
ligado al cromosoma X. Otra grave enfermedad hereditaria ligada al cromosoma X y
recesiva es la distrofia muscular de Duchenne.

HERENCIA INFLUIDA POR EL SEXO

Existen caracteres, como la calvicie en la especie humana y la presencia o ausencia


de cuernos en algunas razas ovinas, que estn determinados por genes situados en la
parte homloga de los cromosomas sexuales o bien en los autosomas, y cuya
manifestacin depende del sexo. La calvicie, por ejemplo, es dominante en el hombre
y recesiva en la mujer

Genotipos Fenotipos
Hombres Mujeres
CC Normal Normal
Cc Calvo Normal
cc Calvo Calva

OTROS TIPOS DE HERENCIA

ALELISMO MLTIPLE (ALELOMORFOS MLTIPLES)

Hasta aqu slo se ha contemplado la posibilidad de que existan dos alelos


diferentes para cada gen. Pero, puesto que un gen puede ser modificado por el
proceso de mutacin, tericamente es posible que en una poblacin de individuos
existan varios alelos para un gen. Este fenmeno se denomina alelismo mltiple y el
conjunto de alelos pertenecientes el mismo locus constituye una serie allica.

J. L. Snchez Guilln Pgina III-11-11


III) La informacin celular 11) Herencia gentica

Un caso de alelismo mltiple bien conocido es el de los genes que determinan los
grupos sanguneos en la especie humana o sistema ABO. Se trata de tres genes
alelos IA , IB e i. IA e IB son codominantes y ambos son dominantes respecto al gen i,
que es recesivo. El gen IA da lugar al grupo sanguneo A, el gen IB da lugar al B y
el gen i, en homocigosis, da lugar al grupo O. Si IA e IB estn juntos en el mismo
individuo, este ser del grupo AB. Los diferentes fenotipos y genotipos posibles para
estos tres genes alelos se encuentran en el cuadro.

CUADRO
GENOTIPOS FENOTIPOS
IAIA , IAi A
IBIB, IBi B
IAIB AB
ii O

ALELOS LETALES (FACTORES LETALES)

En ciertos casos las mutaciones que se producen dan lugar a genes que, por la
razn que sea, hacen que el individuo no sea viable. Esto es, producen su muerte
bien en el periodo prenatal o postnatal, antes de que el individuo alcance la madurez
y pueda reproducirse. Estos genes se denominan genes letales. Un alelo letal
dominante nunca ser heredable porque el individuo que lo posee nunca llegar a la
madurez y no podr dejar descendencia. Los alelos letales dominantes se originan por
mutacin de un gen normal y son eliminados en la misma generacin en la que
aparecen. Por el contrario, los genes letales recesivos quedan enmascarados bajo la
condicin de heterocigosis y en un cruzamiento entre heterocigotos la cuarta parte de
los descendientes morirn.

Por ejemplo, supongamos que del gen L, normal, existe un alelo l, letal. En un cruce
entre dos individuos heterocigticos para este gen, obtendremos el siguiente cuadro
gamtico:

CUADRO GAMTICO
/ L l
L normal normal
LL Ll
l normal morirn
Ll ll

POLIGENIA (HERENCIA MULTIFACTORIAL)

Cuando estudiamos el carcter color de la piel del guisante, vimos que slo caban
dos fenotipos posibles: verde y amarillo. Esto es debido a que el carcter viene

J. L. Snchez Guilln Pgina III-11-12


III) La informacin celular 11) Herencia gentica

determinado nicamente por un par de genes alelos.

No obstante, la mayora de los caracteres presentan una variacin continua del


fenotipo sin que podamos establecer grupos claramente distinguibles. Los ejemplos
son numerosos: estatura, peso, color del pelo o de los ojos, produccin de leche en
el ganado vacuno, etc.

Si cuantificamos estos caracteres, si ello es


posible, veremos que sus valores siguen una
distribucin normal, tambin llamada campana
de Gauss, con unos pocos individuos en los

Nmero de individuos
valores extremos y un gran nmero en los
centrales.

Esto suele ser debido a que estos carac-


teres, que llamaremos mtricos o cuantita-
tivos, estn controlados por un gran nmero
de genes no alelos situados en el mismo o Peso en Kg

en distinto par de cromosomas. Los ca- Fig. 18 Campana de Gauss.


racteres controlados por varios genes no
alelos se llaman polignicos.

Un ejemplo de carcter polignico es el de la pigmentacin de la piel en la especie


humana que se explica por la accin de alelos con efecto acumulativo. En principio
se pens que el color de la piel era controlado por dos pares de genes.

-N1 N1 ,N2 N2 (piel muy oscura)


-n1 n1 ,n 2 n2 (piel muy clara)

Otras combinaciones daran pieles intermedias. Ejemplo: N1 n1 , N2 n2 .

Un carcter polignico determina la formacin de un gran nmero de fenotipos. As,


por ejemplo, en el caso de que un carcter venga determinado por tres genes: A, B,
C y sus correspondientes alelos recesivos: a, b, c; un individuo triheterocigtico
Aa,Bb,Cc podr formar 8 tipos de gametos diferentes. Si lo cruzamos con una
hembra tambin triheterocigtica el nmero de genotipos posibles ser de 27.

El nmero de gametos que puede producir un heterocigoto es igual a 2 n siendo n el


nmero de loci que controlan el carcter.

Por ltimo, indicar que la accin del ambiente modifica la expresin del genotipo y
suaviza las discontinuidades entre los fenotipos. Debido a todo esto los caracteres
que vienen determinados por varios genes no alelos presentan una distribucin que
sigue la forma de la curva de Gauss.

LA HERENCIA NO NUCLEAR

No debemos olvidar que los plastos y las mitocondrias poseen material gentico.
Este ADN no nuclear contiene informacin que tambin ser transmitida a la descen-

J. L. Snchez Guilln Pgina III-11-13


III) La informacin celular 11) Herencia gentica

dencia. Ahora bien, tanto en los animales como en los vegetales, las mitocondrias y
los plastos son transmitidos nicamente por el gameto femenino, ya que del esper-
matozoide slo pasan al zigoto el ncleo y en ciertos casos el citocentro. El ADN no
nuclear dar lugar a una herencia materna o de influencia exclusivamente materna.

Por ejemplo, en el dondiego de noche (Mirabilis jalapa), la distribucin de la clorofila


vara de una rama a otra y por lo tanto el color ms verde o ms blanco de las
hojas. Algunas ramas tienen hojas de color blanco por no tener clorofila en sus
cloroplastos, otras son slo verdes y otras variegadas (verdes y blancas). Si
fecundamos flores de una rama verde, la descendencia ser verde;
independientemente de la procedencia del polen. Si fecundamos flores de ramas de
hojas blancas, la descendencia ser blanca. Si la rama es de hojas variegadas, saldrn
plantas verdes, blancas o, la mayora, variegadas.

La explicacin se encuentra en que en los sacos embrionario que se producen en las


flores de las ramas de hojas blancas no hay cloroplastos con la capacidad para
fabricar clorofila. En las flores de las ramas variegadas hay dos tipos de cloroplastos:
unos que fabrican clorofila y otros no. Segn se repartan entre las clulas hijas, unas
llevarn un tipo de cloroplastos, otras el otro tipo y la mayora una mezcla de
ambos. Las flores de ramas de hojas slo verdes poseen cloroplastos con la
capacidad de fabricar la clorofila y no tienen cloroplastos del otro tipo; por lo tanto,
los descendientes que se produzcan a partir de flores de estas ramas tendrn hojas
exclusivamente verdes.

GENTICA HUMANA

MTODOS DE EXAMEN GENTICO

La transmisin de los caracteres


hereditarios en el hombre sigue las mismas
II
leyes que las que son aplicables con 1 2 3 4

carcter general al resto de los seres vivos.


IIII
Algunos caracteres son dominantes, y otros
5 6 7 8 9 10
recesivos; existen caracteres monognicos y,
III
III
la mayora, polignicos; genes letales, y
alteraciones genticas tanto gnicas como 11 12 13

cromosmicas de lo ms diversas. En el
hombre, no obstante, todas estas Fig. 19 Ejemplo de genealoga.
alteraciones tienen casi siempre una gran
importancia por las graves consecuencias
que pueden tener para la descendencia.

Como en el hombre no pueden hacerse experiencias como las que hizo Mendel se
necesitan otras tcnicas para el estudio de la gentica humana. Los principales mtodos
son:

J. L. Snchez Guilln Pgina III-11-14


III) La informacin celular 11) Herencia gentica

- Examen del rbol genealgico: El estudio de los ascendientes y de los descendientes


de un individuo puede darnos una informacin muy valiosa. Se trata en particular de
un mtodo inestimable para la deteccin de las enfermedades hereditarias y para
poder predecir su aparicin en los hijos.

Veamos el siguiente caso: El I


Epiteloma adenoides cysticun es 1 2

una enfermedad hereditaria que


produce en el rostro pequeos
II
ndulos coloreados, en el resto del 1 2 3 4 5 6 7 8 9

cuerpo hay tambin tumores de


dimensin variable. El rbol III
Sanos

genealgico de una familia en la 1 2 3 4 5 6

que varios individuos presentaban Enfermos

la enfermedad se representa a Fig. 20 rbol genealgico de una familia con epiteloma.


continuacin.

El anlisis de la informacin proporcionada por este rbol nos va a permitir sacar las
siguientes conclusiones:

1) El gen responsable de la enfermedad es dominante, pues en el caso de ser recesi-


vo, 1 y 2 tendran que ser homocigticos y sus descendientes seran todos enfer-
mos.

2) Si mediante T representamos el gen que determina la enfermedad y con t el gen


normal, tendremos los siguientes genotipos (G).

TABLA
Generacin I Generacin II Generacin III
G G G
1 Tt 1 tt 1 Tt o TT
2 Tt 2 Tt o TT 2 tt
3 tt 3 Tt o TT
4 Tt o TT 4 Tt o TT
5 Tt o TT 5 tt
6 tt 6 Tt o TT
7 tt
8 Tt
9 tt

En un rbol genealgico, los hombres (o los machos en las especies animales o


vegetales) se representan mediante un cuadrado, las mujeres (o las hembras si se
trata de otras especies diferentes de la especie humana) se representan mediante un
crculo. Los cruzamientos se indican mediante una lnea horizontal y los hijos por

J. L. Snchez Guilln Pgina III-11-15


III) La informacin celular 11) Herencia gentica

lneas que parten del trazo horizontal. Los integrantes de cada generacin se
numeran correlativamente y las diferentes generaciones se indican al margen mediante
nmeros romanos.

Ejemplos de caracteres genticos mendelianos en la especie humana

A a
D d

E e F f

Algunos fenotipos en la especie humana. A y a) Lengua plegada y recta; D y d) lbulo de la oreja libre y
pegado; E y e) lnea frontal del pelo en pico y recto; F y f) pulgar curvado y recto.

- Gemeologa: Los gemelos procedentes de un mismo zigoto, gemelos univitelinos,


tienen en sus cromosomas la misma informacin gentica, son genticamente idnticos.
El estudio de las diferencias fenotpi cas que presentan aquellos gemelos que, por las
causas que sean, han vivido separados, ha permitido conocer los aspectos del
fenotipo debidos a los genes y los debidos al medio ambiente. Sobre todo en los
rasgos psicolgicos en los que es muy difcil delimitar lo que es heredable y lo que
es ambiental o cultural.

Por el contrario, los mellizos proceden de zigotos distintos. Si se han criado juntos
habrn sido sometidos a influencias ambientales muy parecidas y las diferencias que
presenten sern debidas a sus diferencias genticas.

- Exmenes citogenticos: Estn basados en el estudio del cariotipo. Estos exmenes


pueden permitir la deteccin de anomalas cromosmicas an antes de que se mani-
fiesten. En particular, son fcilmente detectables las aneuploidas (sndromes de
Down, Turner y Klinefelter) y las mutaciones debidas a la alteracin de la estructura
de los cromosomas. Estas ltimas se detectan por los apareamientos anormales que
se producen en la meiosis.

J. L. Snchez Guilln Pgina III-11-16


III) La informacin celular 11) Herencia gentica

Sobre todo es interesante el estudio cromosmico de las clulas que se encuentran


en las vellosidades de la placenta y en el lquido amnitico, tcnica esta ltima que
se conoce como amniocentesis, pues permite la deteccin precoz de las anomalas
cromosmicas.

La amniocentesis consiste en una puncin


que se realiza durante el embarazo a travs
del abdomen hasta llegar al lqui do amniti-
co. Se extrae con una jeringuilla una cierta
cantidad de lquido. ste contiene clulas
fetales que, sometidas a cultivo en un
medio adecuado, entran en divisin. El trata-
miento con colchicina bloquea las divisiones
celulares en metafase. Preparaciones
microscpicas de estas clulas son
fotografiadas y sus cariotipos analizados.
Fig. 21 Amniocentesis.

J. L. Snchez Guilln Pgina III-11-17


III) La informacin celular 12) Gentica aplicada

12) GENTICA APLICADA

INGENIERA GENTICA

Se trata de una serie de tcnicas que se


basan en la introduccin de genes en el
genoma de un individuo que no los presente.
1 2

Estas tcnicas fundamentalmente son: 3

a) Transferencia de genes de una especie a


4
otra: Hay tcnicas por las que se pueden
transferir genes de una especie a otra. As,
mediante un vector apropiado, que puede ser
un plsmido o un virus, se puede introducir
un gen de una especie en otra diferente. Fig. 1 Transferencia de genes mediante el
Con estas tcnicas se pueden pasar genes uso de un plsmido de una bacteria. 1)
de eucariotas a eucariotas, de eucariotas a Extraccin de un plsmido de una bacteria; 2)
procariotas y de procariotas a procariotas. unin del plsmido y el gen de otra especie
Por ejemplo: se puede introducir en bacterias que se quiere introducir; 3) introduccin del
el gen que produce la insulina humana. De gen en clulas del organismo receptor usando el
plsmido como vector; 4) transferencia de las
esta manera las bacterias producen
clulas con el nuevo gen al organismo receptor.
fcilmente y en abundancia esta hormona.

b) Tcnica de la PCR: Tambin existen


mtodos para amplificar una determinada
secuencia o fragmento de ADN. La ms
conocida es la tcnica de la reaccin en
cadena de la polimerasa PCR. As se
consigue multiplicar un determinado
fragmento de ADN millones de veces para
poder tener una cantidad suficiente para
estudiarlo. Sin esta tcnica seran imposibles
los estudios de ADN para el reconocimiento
de la paternidad o en caso de delito, pues la
cantidad de ADN presente en las clulas es
tan pequea, del orden de picogramos, que Fig. 2 Tcnica de la PCR. Replicacin en
se necesitara una gran cantidad de material cadena del ADN para su obtencin en
celular para tener una cantidad apreciable de cantidades adecuadas para posteriores anlisis.
ADN.

Todo esto ha servido para el desarrollo de la ingeniera gentica, ya que aparte de


conocer los aspectos moleculares ms ntimos de la actividad biolgica, se han
encontrado numerosas aplicaciones en distintos campos de la industria, la medicina, la
farmacologa, la agricultura, la ganadera, etc...

LA INGENIERA GENTICA Y LA TERAPIA DE ENFERMEDADES HUMANAS

Hay en los humanos numerosas enfermedades de carcter hereditario o relacionadas


con alteraciones genticas. En la mayora de los casos ni siquiera se han identificado
los genes responsables y en muy pocos casos se dispone del mecanismo para
incorporar el gen correcto a las clulas del individuo afectado. No obstante existen

J. L. Snchez Guilln Pgina III-12-1


III) La informacin celular 12) Gentica aplicada

varias lneas de investigacin que se basan en:

11) Transferir un gen humano normal a una bacteria, obteniendo de ella la


sustancia necesaria para luego inocularla en el enfermo.

21) Transferir un gen correcto a las clulas de una persona: terapia de clulas
somticas.

31) En el futuro, si el gen se hiciera llegar a un vulo, un espermatozoide o el


zigoto, todas las clulas del individuo tendran el gen normal: Terapia de clulas
germinales (no es legal).

Todas estas terapias estn sometidas a cambios muy rpidos. Veamos algunos
ejemplos en los que ya en la actualidad se emplean estas tcnicas o estn en fase de
ensayo o investigacin.

1) Sustancias humanas producidas por bacterias

En la actualidad, una de las tcnicas de ingeniera gentica ms empleada consiste


en la produccin de sustancias humanas por bacterias a las que se les ha introducido
el gen correspondiente. Entre las sustancias que ya se obtienen mediante esta tcnica
estn:

- La insulina.- Es una hormona formada por dos pptidos. El pptido A (21


aminocido) y el pptido B (30 aminocidos). Los genes que codifican ambos
pptidos se aslan de clulas humanas y se introducen en estirpes bacterianas
diferentes. Cada clon sintetiza uno de los polipptidos. stos se aslan, se
purifican, se activan los grupos -SH para que se unan los dos pptidos y
obtenemos insulina humana.

- La hormona del crecimiento.- Es un polipptido de 191 aminocidos. Se utiliza


una tcnica similar al ejemplo anterior.

- El interfern.- Es una protena de peso molecular entre 16.000 y 20.000,


con una cadena glucosdica. En la actualidad se ha conseguido aislar el ADN
responsable del interfern en leucocitos y linfoblastos infectados. El problema
es que se obtiene una produccin baja a causa de la inestabilidad de la
molcula.

- El factor VIII de la coagulacin.

2) La ingeniera gentica en humanos

Esta tcnica se basa en la introduccin de un gen correcto en las clulas humanas


para sustituir un gen deficiente. Algunos casos en los que esta tcnica est en
estudio o en proceso de ensayo son:

* La Talasemia.- Grupo de enfermedades relacionadas con la presencia de hemoglobi-


na distinta de la normal.

- Tratamiento: retirar clulas de la mdula sea del enfermo, introducir en ellas


el gen correcto mediante un virus, volverlas al torrente circulatorio.

- Dificultades: La seleccin de las clulas que producen hemoglobina entre

J. L. Snchez Guilln Pgina III-12-2


III) La informacin celular 12) Gentica aplicada

todas las clulas de la mdula, es difcil.

- Los genes introducidos se expresan poco.


- Las alteraciones en su manifestacin son peligrosas.

* La carencia de la enzima Adenosin Desaminasa (ADA).- Fallo en los leucocitos.


Enfermedad de los nios burbuja o inmunodeficiencia combinada grave (SCID).

- Tratamiento: semejante al de la Talasemia.

3) Enfermedades sometidas a ensayos clnicos de terapia gnica

* Cncer: melanoma, rin, ovario, neuroblastoma, garganta, pulmn, cerebro,


hgado, mama, colon, prstata, leucemia, linfoma...
* Fibrosis qustica
* Hemofilia
* Artritis reumatoide

LA INGENIERA GENTICA Y LA PRODUCCIN AGRCOLA Y ANIMAL

Llamamos organismos transgnicos a aquellos que se desarrollan a partir de una


clula en la que se han introducido genes extraos.

El objetivo de estas tcnicas es obtener caractersticas "tiles" de otros organismos.


Estas caractersticas pueden ser muy variadas.

Fue una tcnica difcil por la impermeabilidad de las membranas de las clulas
eucariotas animales y por la pared celulsica de las vegetales, aunque cada vez hay
mejores tcnicas para resolver estos problemas.

La tcnica ms empleada es la de microinyeccin (introduccin de ADN mediante


microjeringa y micromanipulador).

1) Ejemplos del empleo de estas tcnicas en


la produccin agrcola: Bacteria con el plsmido
transportador del gen Planta transgnica

Las tcnicas ms empleadas en las plantas


son:

* Uso de pistolas con microbalas de metal


recubiertas de ADN.

* Uso como vector de un plsmido de una


1 2 3
bacteria simbionte que produce tumores.

Mediante estas tcnicas se han obtenido o Fig. 3 Uso como vector de un plsmido de
se est en vas de obtener: una bacteria simbionte.

a) Variedades transgnicas del maz que:

J. L. Snchez Guilln Pgina III-12-3


III) La informacin celular 12) Gentica aplicada

* Resisten heladas.- incorporacin de


un gen de un pez resistente al fro.

* Resisten plagas.- incorporacin de


un gen del trigo. Microbala
recubierta de ADN

* Resisten herbicidas.- incorporacin


de un gen bacteriano. Fig. 4 Transferencia de genes mediante
disparo de microbalas impregnadas en ADN

b) Variedades transgnicas del trigo que:

* Son ms nutritivas.

* Resistentes a plagas y herbicidas.


Incorporacin de varios genes de
insectos y bacterias.
Planta de maz en El barrenador del
la que se ha tallo del maz
c) Variedades de tomate que maduran ms introducido un gen ingiere la planta
que produce la modificada.
lentamente por anulacin de un gen que protena Cry

regula la maduracin por haberlo introducido


en sentido contrario, se producen dos ARNm
complementarios que hibridan y no se
traducen.

d) Plantas de tabaco transgnicas: Se est La protena causa la


trabajando en la insercin de "genes nif" lisis de los tejidos del
barrenador del maz.
que posibilitaran el aprovechamiento directo
del N2 atmosfrico. Se usa esta planta Dos o tres das
porque es una planta muy maleable. despus el
barrenador del maz
muere.

2) Ejemplos del empleo de estas tcnicas en Fig. 5 Bacillus thuringiensis es una bacteria
la produccin animal: que se encuentra en los suelos en todo el
mundo. Esta bacteria produce una protena
En los animales estas tcnicas se emplean Cry) que mata en forma selectiva un grupo
especfico de insectos. La protena Cry es
ms en peces porque la fecundacin es
txico para el aparato digestivo de los insectos
externa. Las tcnicas ms comunes son:
sensibles. Una vez ingeridas, las enzimas
digestivas del insecto activan la frmula txica
* La microinyeccin de los genes en
de la protena. Las protenas Cry se ligan a
el zigoto. "receptores" especficos del revestimiento
interno de los intestinos y daan las clulas.
* Campos elctricos que hacen Los insectos dejan de comer dos horas despus
permeable la membrana y permiten la de haber ingerido el primer bocado y, si han
entrada de material gentico. comido suficiente cantidad de toxina, mueren
dos o tres das despus. Durante ms de treinta
Mediante estas tcnicas se han obtenido o aos se han aplicado con xito en una serie de
se est en vas de obtener: cultivos diversas frmulas lquidas y granuladas
de Bt contra lepidpteros (orugas).
* Carpas transgnicas que crecen de La insercin en el maz del gen procedente de
un 20 a un 40% ms rpido. Se Bacillus thurigiensis, que codifica esta protena
consiguen introduciendo el gen de la txica para el insecto, que provoca la
hormona del crecimiento de la trucha enfermedad conocida como taladro del maz,
arco iris. Se estimula aadiendo Cinc hace que esta planta se vuelva resistente al
a la dieta. insecto.

* Salmones transgnicos.- Resisten

J. L. Snchez Guilln Pgina III-12-4


III) La informacin celular 12) Gentica aplicada

mejor las temperaturas bajas. Se consigue por incorporacin de un gen de una


especie de platija del rtico.

* En mamferos se han conseguido


ratones que carecan de la hormona
del crecimiento por mutacin del gen
productor de la misma por
introduccin en el zigoto de estos
ratones del gen de la hormona del
ADN a transferir.
Microinyeccin del ADN
en la clula receptora.

crecimiento de la rata. Los ratones


transgnicos conseguidos producen Fig. 6 Microinyeccin de genes en el
800 veces ms hormona que los interior de un zigoto receptor.
normales. El gen de la rata no se
introduce en el lugar propio, sino en
otro.

RIESGOS Y ASPECTOS TICOS DE LAS TCNICAS DE INGENIERA GENTICA

* BIOSANITARIOS.- La mayora de los productos se destinan al consumo


humano y an no se puede afirmar que no sean perjudiciales para la salud.

* BIOTICO.- )Hay derecho a monopolizar el uso de la informacin gentica


presente en la naturaleza?

* BIOTECNOLGICO.- )Qu pasara si el material gentico de un virus tumoral


terminara formando parte del genoma de alguna bacteria simbionte del ser
humano? )Y si los genes que permiten la resistencia a los antibiticos entraran
en el genoma de los patgenos? )O si los microorganismos inocuos adquirieran
los genes para producir toxinas potentes como la difteria, el clera, el
botulismo o el ttanos?

EL PROYECTO GENOMA HUMANO

El estudio del Genoma Humano comenz en EEUU en 1990, pero hoy hay centros
en numerosos pases implicados en el proceso. El objetivo es secuenciar
completamente el ADN. Ahora bien, esto representa un enorme trabajo pues el
genoma humano se compone de 3X10 9 de pares de bases. Si representsemos cada
base por un carcter (A, T, C, G), para poder escribirlo en un libro (a 80x50 = 4000
caracteres por pgina), necesitaramos un libro de 750 000 pginas.

LMITES A LOS RIESGOS E IMPLICACIONES TICAS DE LA INGENIERA GENTICA

Existe un Comit Internacional de Biotica de la Unesco fundado en 1993 por


Federico Mayor Zaragoza.

Los criterios establecidos son:

* Lmites por motivos ecolgicos y de sanidad.


* Lmites por motivos ticos y morales.
* Lmites por motivos sociales.
* Lmites por motivos polticos.

La organizacin HUGO defiende que slo se puedan patentar las secuencias de ADN
de las que se sepa su funcin.

J. L. Snchez Guilln Pgina III-12-5


IV) Microbiologa 1) Microbiologa

IV

1-MICROBIOLOGA y BIOTECNOLOGA

1. CONCEPTO DE MICROORGANISMO

Los microorganismos o microbios son organismos de pequeo tamao, observables


nicamente con la ayuda del microscopio. La Microbiologa es la rama de la Biologa
que se encarga del estudio de los microorganismos.

TIPOS DE MICROORGANISMOS Y CLASIFICACIN

Los microorganismos se clasifican en:

CLASES DE MICROORGANISMOS

a) Microorganismos con Procariotas Arqueobacterias


organizacin celular Eubacterias

- Poseen membrana celular


- Tienen como cidos nucleicos tanto
ADN como ARN).

Eucariotas Protozoos
Algas microscpicas
Hongos microscpicos

b) Microorganismos sin organizacin celular Virus


Viroides
- No poseen membranas Priones
- Nunca estn presentes los dos cidos nucleicos juntos
(ADN o ARN).
- Son parsitos estrictos de los que tienen organizacin
celular, pues carecen de metabolismo.

Fig. 1 1) Procariota (bacteria); 2, 3, 4 y 5) Protozoos; 6) Alga microscpica; 7) Hongo microscpico


(levadura); 8 y 9) Virus. Cada organismo est a un aumento diferente.

J. L. Snchez Guilln Pgina IV-1-1


IV) Microbiologa 1) Microbiologa

2. LAS BACTERIAS

CLASIFICACIN, MORFOLOGA,
FISIOLOGA Y ECOLOGA BACTERIANAS

1) ARQUEOBACTERIAS: Bacterias con-


sideradas "fsiles vivientes" pues viven en
hbitats que parecen corresponder con los
que existieron en la Tierra primitiva, por
ejemplo, se encuentran en ambientes Fig. 2 Ejemplo de organismo procaritico
termales donde se alcanzan temperaturas por (bacteria) muy aumentada.
encima del punto de ebullicin del agua, en
fumarolas, etc. Un ejemplo es el de
Pyrococcus furiosus que tiene su ptimo de
crecimiento a 104 1C. Tambin pueden vivir
en medios halfilos (muy salados), por
ejemplo: Halobacterium, que son halfilos
estrictos.

2) EUBACTERIAS: Son las bacterias tpi cas.


Por ejemplo Escherichia coli. Se trata de mi-
croorganismos unicelulares procariotas, cuyo Fig. 3 1) Cocos. 2) Bacilos. 3) Vibrios. 4)
tamao oscila entre 1 y 10 micras (como Espirilos.
son muy pequeas no necesitan
citoesqueleto), adaptados a vivir en cualquier
ambiente, terrestre o acutico, pues en las
diferentes estirpes bacterianas pueden
observarse todas las formas de nutricin
conocidas. Las hay auttrofas: fotosintticas
y quimiosintticas, y hetertrofas: saprfitas,
simbiticas y parasitarias. Esta notable
diversidad de funciones convierte a las
bacterias en organismos indispensables para
el mantenimiento del equilibrio ecolgico, ya
que, como se ver ms adelante, Fig. 4 Bacilos (x2000).

contribuyen al mantenimiento de los ciclos


biogeoqumicos que permiten el reciclaje de
la materia en la biosfera.

La mayor parte de las bacterias adoptan


formas caractersticas, aunque en ocasiones
la configuracin puede verse influida por las
condiciones del medio de cultivo. Son
unicelulares, pero tambin aparecen agru-
padas cuando se mantienen unidas tras la
biparticin. Entre las formas ms comunes
destacan las siguientes: Fig. 5 Bacilos (muy aumentados) .

* Cocos, de aspecto redondeado, que aparecen aislados o en grupos de dos: diploco-

J. L. Snchez Guilln Pgina IV-1-2


IV) Microbiologa 1) Microbiologa

cos, otras veces forman cadenas


arrosariadas: estreptococos, grupos arraci-
mados: estafilococos, o masas cbicas:
sarcinas. Esta diversidad depende de que la
divisin de las clulas se d a lo largo de
uno, dos o tres ejes.

Las bacterias con forma de cocos tienen


una relacin superficie/volumen mnima, son
bacterias con poca relacin con el exterior,
muy resistentes y se transmiten por el aire.
Son pequeas y exigentes con el medio de Fig. 6 Asociaciones de cocos (bacterias
esfricas).
cultivo. Suelen ser patgenas: Streptococcus,
Staphylococcus, etc.
Informacin: El estudio de las bacterias se
realiza mediante cultivos, que consisten
* Bacilos, alargados y cilndricos, en forma en esencia, en extractos nutritivos
de bastn; a veces se presentan en cadenas estriles, ya sean lquidos o slidos. Los
lineales o ramificadas. Presentan mayor rela- lqui dos, preparados en tubos de ensayo
cin superficie/volumen que los cocos y debidamente tapados con algodn graso y
esterilizados, suelen ser caldo de carne,
obtienen nutrientes con mucha mayor efecti-
suero sangu neo y sangre, enriquecidos
vidad, por lo que pueden vivir en lugares con ciertas sustancias sin las cuales no
pobres en nutrientes (vas urinarias, pueden reproducirse (aminocidos,
agua ....). Por el contrario, son menos peptona, etc.). Los slidos se obtienen a
resistentes, susceptibles a los cambios am- partir de los lquidos mediante adicin de
agar-agar o gelatina en caliente, luego se
bientales y no pueden transmitirse por el
vierte sobre tubos de ensayo inclinados o
aire, slo lo hacen por lquidos o superficies sobre cajas de Petri; posteriormente se
hmedas. Los ms grandes (Baccillus y esterilizan, se siembran utilizando el asa
Clostridium) desarrollan endosporas para de platino y se colocan en la estufa de
resistir los perodos de condiciones preca- cultivo a la temperatura adecuada que
favorezca su multiplicacin.
rias.

* Espirilos, con forma de hlice o espiral; las


espiroquetas tienen un aspecto similar, pero
con la espiral ms acusada. Las formas
espirales se mueven en medios viscosos
avanzando en tornillo. Su dimetro es muy
pequeo, lo hace que puedan atravesar las
mucosas; por ejemplo: Treponema pallidum,
causante de la sfilis. Son ms sensibles a
las condiciones ambientales que los bacilos,
por eso cuando son patgenas se transmiten Fig. 7 Cultivos de bacterias en cpsula de
Petri y en tubo de ensayo.
por contacto directo (va sexual) o mediante
vectores, normalmente artrpodos
hematfagos.

* Vibrios, que son muy cortos y curvados, en forma de coma. Ejemplo: Vibrio
cholerae.

J. L. Snchez Guilln Pgina IV-1-3


IV) Microbiologa 1) Microbiologa

ESTRUCTURA DE UNA BACTERIA TIPO 2


1 3

4
5

La ultraestructura y la actividad fisiolgica


de las bacterias solo se puede apreciar con
7

el microscopio electrnico en conjuncin con


las tcnicas bioqumicas y citolgicas 8

adecuadas, como la ultracentrifugacin, 6

tcnicas isotpicas de marcaje, utilizacin de Fig. 8 1) Cpsula; 2) pared; 3) membrana;


medios de cultivo diferenciales, etc. 4) mesosomas; 5) ribosomas; 6) flagelo; 7)
ADN, cromosoma o genoma; 8) plsmidos.

Los componentes estructurales bsicos de


las bacterias son: Polisacridos

* Pared bacteriana: Estructura presente en


todas las bacterias. Es una envoltura rgida
exterior a la membrana. Da forma a la
bacteria y sobre todo soporta las fuertes
presiones osmticas de su interior.
Pptido glucano
Membrana plasmtica Membrana externa

Los componentes fundamentales de la


1) Glicolpidos. 2) Fosfolpidos y otros lpidos

pared son los peptidoglucanos o murenas,


formados por anillos de polisacridos Fig. 9 Estructura de la pared de una
bacteria Gram negativa.
complejos enlazados con oligopptidos. Ade-
ms contiene otros elementos diferentes
segn pertenezca al grupo de las Gram Pptidoglucano
Anillo de polisacrido Oligopptido

negativas o al de las Gram positivas:

En las Gram negativas hay una sola capa


de pptidoglucanos sobre la que se dispone
una membrana externa constituida por una
capa de fosfol pidos y otra de glicolpi dos
asociados, estos ltimos, a polisacridos que
Membrana plasmtica

se proyectan hacia el exterior. Fig. 10 Estructura de la pared de una


bacteria Gram positiva.

En las bacterias Gram positivas la red de


peptidoglucanos origina varias capas su-
perpuestas, es gruesa y homognea y no hay Polisacrido
Oligopptido

membrana externa.

* Cpsula bacteriana. En numerosas bac-


terias se forma en la parte externa de la
pared una cpsula viscosa compuesta por
Fig. 11 Los pptidoglucanos de la pared
sustancias glucdi cas. Esta envoltura, que se bacteriana estn formados por anillos de un
presenta en casi todas las bacterias patge- polisacrido complejo enlazados por un
oligopptido.
nas, las protege de la desecacin y de la
fagocitosis por los leucocitos del hospeda-

J. L. Snchez Guilln Pgina IV-1-4


IV) Microbiologa 1) Microbiologa

dor, as como del ataque de los INFORMACIN


anticuerpos, lo que aumenta la Observacin de microorganismos. Tincin de Gram:
virulencia de las bacterias encapsuladas. Fundamento

La presencia de la cpsula no es, sin


INTRODUCCIN
embargo, un carcter diferenciador,
pues determinadas bacterias pueden o El tamao de la mayora de las clulas bacterianas es tal
que resultan difciles de ver con el microscopio ptico. La
no formarla en funcin de los medios
principal dificultad es la falta de contraste entre la clula y
de cultivo. el medio que la rodea. El modo ms simple de aumentar el
contraste es la utilizacin de colorantes.
Si se desea simplemente aumentar el contraste de las
Informacin: Algunos antibiticos actan clulas para la microscopa, son suficientes los procedi-
sobre los componentes moleculares de la mientos que usan un solo colorante llamados de tincin
pared; por ejemplo, la lisozima (presente en simple. Sin embargo, a menudo se utilizan mtodos que no
las lgrimas, moco nasal y en la mayora tienen de igual modo todas las clulas, es el proceso
de los tejidos y secreciones) que acta rom- denominado tincin diferencial. Uno muy usado en
piendo los enlaces glucos dicos de los microbiologa es la tincin Gram. Basndose en su
pptidoglucanos, lo que provoca la lisis por reaccin a la tincin Gram, las bacterias pueden dividirse
smosis de la bacteria; otros, como la en dos grupos: grampositivas y gramnegativas. Esta
penicilina, son antibiticos bacteriostti cos tincin tiene gran importancia en taxonoma bacteriana ya
porque inhiben la sntesis de los pptidoglu- que indica diferencias fundamentales de la pared celular de
canos y, por ello, interrumpen el crecimiento las distintas bacterias.
bacteriano. Para explicar el mecanismo de la tincin de gram se han
propuesto varias hiptesis fundadas en la naturaleza
qumica de las paredes celulares de los microorganismos.

TINCIN DE GRAM.

* Membrana. Es una envoltura que Mtodo.


Extensin: En un porta bien limpio (con alcohol, papel de
rodea al citoplasma. Est constituida
filtro y flameado) se coloca una gota de agua destilada a la
por una membrana de tipo unitario de que, con el asa de siembra, previamente esterilizada a la
75 de espesor. Su estructura es llama, se lleva una pequea cantidad de suspensin de
idntica a la de las clulas eucariotas, bacterias o, en su caso, de una colonia.
Con el asa se extiende la gota y las bacterias sobre el porta
variando slo en algunas de las y se fija la extensin por el calor, calentando suavemente a
molculas que la componen; por la llama del mechero hasta que se seque.
ejemplo, en la membrana bacteriana no
Coloracin:
hay esteroides. Una particularidad que
a) 1 minuto en cristal violeta de Hucker (colorante inicial)
presenta la membrana bacteriana es la b) se lava con agua destilada
existencia de unos repliegues internos c) 1 minuto en lugol (mordiente)
que reciben el nombre de mesosomas. d) se decolora con alcohol de 951 (decolorante)
e) se lava con agua destilada
f) 1 minuto en fucsina (colorante de contraste)
Las funciones de la membrana g) se lava con agua corriente
plasmtica bacteriana son las mismas h) se seca suavemente y sin frotar con papel de filtro
Una vez que la preparacin est totalmente seca, poner
que en la clula eucariota, es decir, una gota muy pequea de aceite de cedro y observar al
limitan la bacteria y regulan el paso de microscopio con el objetivo de inmersin.
sustancias nutritivas. Los mesosomas
Observacin:
incrementan la superficie de la
Las bacterias que aparecen coloreadas de violeta son
membrana plasmtica y adems tienen Gram+ y las que aparecen coloreadas de rojo ms o
gran importancia en la fisiologa menos intenso, son Gram-.

bacteriana, puesto que en ellos hay


gran cantidad de enzimas responsables

J. L. Snchez Guilln Pgina IV-1-5


IV) Microbiologa 1) Microbiologa

de importantes funciones celulares, entre las que destacan las siguientes:

- Transporte de los electrones, mediante el conjunto de transportadores de la


cadena respiratoria, y fosforilacin oxidativa.
- Sntesis de diversos componentes de la membrana, la pared y la cpsula.
- Contienen los pigmentos fotosintticos y dems componentes de los
fotosistemas.
- La ADN polimerasa de los mesosomas regula el proceso de duplicacin del
ADN.

* Ribosomas. Son corpsculos similares a los de las clulas eucariticas, aunque de


menor tamao (su velocidad de sedimentacin es de 70 S), compuestos por una
subunidad pequea de (30 S) y otra mayor de (50 S). Se encuentran dispersos en el
protoplasma bacteriano, aislados o asociados en cadenas de ARNm (polirribosomas), y
se encargan de la snte sis de protenas.

* Cromosoma bacteriano. El ADN de la bacteria est constituido por una sola


molcula en doble hlice (esta molcula es muy grande en comparacin con el tamao
de la bacteria), circular, superenrollada y asociada a protenas no histonas. Suele
estar unida a los mesosomas. En las clulas bacterianas puede haber tambin una o
varias molculas de ADN circular extracromosmico de menor masa molecular que el
cromosoma denominadas plsmidos. Estos plsmidos, en algunas bacterias, pueden
tener genes que las protegen de los antibiticos o tambin genes que intervienen en
los procesos de reproduccin (plsmido F). Flagelo

* Inclusiones. En el protoplasma bacteriano


se encuentra una gran variedad de granula-
ciones, que cumplen, generalmente, la
funcin de depsitos de sustancias de
reserva.

* Flagelos. Son apndices filiformes de


mayor longitud que la bacteria que permiten Fig. 12 Estructura del motor flagelar de una
su locomocin. Se presentan en nmero y bacteria.

disposicin variable y estn formados por


fibrillas proteicas compuestas de una prote -
na llamada flagelina.

* Fimbrias o pili. Son filamentos huecos,


delgados y rectos, situados en la superficie
de determinadas bacterias y cuya funcin no
est relacionada con la locomocin, sino con
la adherencia a los substratos y el inter-
cambio de fragmentos de ADN durante la
conjugacin. Fig. 13 Fimbrias o pili en una bacteria.

J. L. Snchez Guilln Pgina IV-1-6


IV) Microbiologa 1) Microbiologa

FUNCIONES DE NUTRICIN EN LAS BACTERIAS

La mayor parte de las bacterias son hetertrofas y deben tomar el alimento orgnico
sintetizado por otros organismos. La obtencin del alimento la hacen por diversos
caminos:

* Las bacterias de vida libre suelen ser saprfitas, viven sobre materia orgnica
muerta.

* Muchas viven en relacin estrecha con otros organismos. De ellas, la mayora son
comensales y no causan daos ni aportan beneficios a su husped; algunas son
parsitas (producen enfermedades) y otras son simbiontes (establecen relaciones con
otros organimos con beneficio mutuo).

Otras bacterias son auttrofas y utilizan compuestos inorgnicos para su nutricin:

* Las auttrofas fotosintticas, como las bacterias sulfurosas verdes y purpreas. No


utilizan agua como dador de electrones en la fotosntesis, sino otros compuestos,
como el sulfuro de hidrgeno, y por lo tanto no producen oxgeno. Al poseer
pigmentos que absorben luz casi infrarroja, pueden realizar la fotosntesis
prcticamente sin luz visible.

* Las auttrofas quimiosintticas, a diferencia de las fotosintticas, utilizan la energa


que desprenden ciertos compuestos inorgnicos al oxidarse.

Independientemente del tipo de nutricin, las bacterias pueden necesitar el oxgeno


atmosfrico (bacterias aerobias) o no (bacterias anaerobias). Para algunas bacterias
anaerobias el oxgeno es un gas venenoso (anaerobias estrictas), otras lo utilizan
cuando est presente, aunque pueden vivir sin l (anaerobias facultativas).

FUNCIONES DE RELACIN EN LAS BACTERIAS

Las bacterias responden a un nmero elevado de estmulos ambientales diversos


mediante modificaciones de su actividad metablica o de su comportamiento. Ciertas
clases, ante los estmulos adversos del ambiente, provocan la formacin de esporas
de resistencia, que, al ser intracelulares, se denominan endosporas.

Las endosporas bacterianas son estructuras destinadas a proteger el ADN y el resto


del contenido protoplasmtico, cuya actividad metablica se reduce al estado de vida
latente; pueden resistir temperaturas de hasta 801C y soportan la accin de diversos
agentes fsicos y qumicos. En condiciones favorables germinan y dan lugar a una
nueva bacteria (forma vegetativa).

Pero la respuesta ms generalizada consiste en movimientos de acercamiento o dis-


tanciamiento respecto a la fuente de los estmulos (taxias) que pueden ser de varios
tipos: flagelar, de reptacin o flexuosos (parecido al de las serpientes, pero en
espiral).

J. L. Snchez Guilln Pgina IV-1-7


IV) Microbiologa 1) Microbiologa

FUNCIONES DE REPRODUCCIN Y GENTICA BACTERIANA

* Reproduccin por biparticin: Generalmente cromosoma

las bacterias se multiplican por biparticin o


divisin binaria; tras la replicacin del ADN, mesosoma

que est dirigida por la ADN polimerasa de Replicacin

los mesosomas, la pared bacteriana crece


hasta formar un tabique transversal
separador de las dos nuevas bacterias. divisin

Ahora bien, adems de este tipo de repro-


duccin asexual, las bacterias poseen Fig. 14 Ciclo de reproduccin asexual por
tambin un conjunto de mecanismos, defini- biparticin de un bacteria.
dos como parasexuales, mediante los cuales
se intercambian fragmentos de ADN; esta Informacin: La transformacin bacteriana
transferencia de informacin gentica de una fue descrita en primer lugar por Griffith
(1920) y ms tarde por Avery, McLeod y
bacteria a otra puede realizarse por conju-
McCarty en 1944, y es responsable, por
gacin, transformacin o transduccin: ejemplo, en el caso de Streptococcus
pneumoniae, de la transformacin de
* Conjugacin. Es un mecanismo mediante cepas bacterianas no virulentas (cepas R)
en virulentas (cepas S), cuando se culti -
el cual una bacteria donadora (bacteria F+ van en medios que contienen fragmentos
por tener un plsmido llamado plsmido F) bacterianos procedentes de la cepa S
transmite a travs de las fimbrias o pili el destruida previamente por el calor.
plsmido F o tambin un fragmento de su
ADN a otra bacteria receptora (a la que
llamaremos F- por no tener el plsmido F).
cromosoma

La bacteria F- se convertir as en F+ al plsmido F cromosoma plsmido F

tener el plsmido F e incluso podr adquirir


genes de la bacteria F+ que hayan pasado F+ F+

junto con el plsmido F.


pili

* Transformacin. Consiste en el intercambio F+


F-

gentico producido cuando una bacteria es cromosoma plsmido F

capaz de captar fragmentos de ADN de otra Fig. 15 Conjugacin entre una bacteria F+
bacteria que se encuentran dispersos en el y otra F-. El factor F (crculos pequeos) pasa
medio donde vive. Slo algunas bacterias a travs de un pili.
pueden ser transformadas. Las que pueden
serlo se dice que son competentes.

* Transduccin.. En este caso la transferen- 2

cia de material gentico de una bacteria a 1

otra, se realiza a travs de un virus


bacterifago que por azar lleva un trozo de
ADN bacteriano y se comporta como un 3

vector intermediario entre las dos bacterias


4
(ver ciclo ltico de un fago). El virus, al
infectar a otra bacteria, le puede transmitir Fig. 16 Transduccin: 1) Fijacin del fago
parte del genoma de la bacteria a la bacteria; 2) Respuesta ltica; 3)
anteriormente infectada. Transduccin del fragmento de ADN a otra
bacteria; 4) Integracin del ADN en el genoma.

J. L. Snchez Guilln Pgina IV-1-8


IV) Microbiologa 1) Microbiologa

Mecanismos parasexuales de reproduccin bacteriana

Conjugacin Transformacin Transduccin

Fago

F- F+ F- Hfr

Cepa S

F+ F+

Cepa R

Informacin: Las bacterias donadoras son las que poseen, adems del cromosoma bacteriano, pequeas
cadenas de ADN de doble hlice y circulares, denominadas episomas o factores F. Estas bacterias se denomi-
nan F+ cuando el factor F est separado del cromosoma; pero, en ocasiones, este factor puede integrarse en
el cromosoma, que se abre y se transforma en una cadena lineal, con lo que la bacteria F+ queda convertida
en Hfr (alta frecuencia de recombinacin). Las bacterias receptoras carecen de episomas y se denominan F- .

Durante la conjugacin uno de los factores F de una bacteria F+ pasa a travs de las fimbrias a una
bacteria F- , que se cambia en F+ y adquiere la capacidad de formar estos pili sexuales, mientras que la
bacteria F+, como posee varias copias del episoma no pierde su condicin de donadora.

Las bacterias Hfr, sin embargo, pueden transferir la totalidad o parte de su ADN cromosmico a travs de las
fimbrias a una bacteria F- . Para ello, previamente, deben duplicar su ADN cromosmico, junto con el episoma
que lleva integrado, y una de las copias del cromosoma puede trasladarse a una bacteria F- (generalmente
slo pasan fragmentos cromosmicos debido a la fragilidad de las fimbrias).

El factor F suele permanecer en la bacteria Hfr, ya que se encuentra inserto en la regin terminal del
cromosoma que casi nunca circula a travs de las fimbrias, porque stas se destruyen antes de que les de
tiempo a pasar. Los genes que han logrado atravesar el pili se integran en el cromosoma de la bacteria F-, que
de esta forma adquiere caracteres de la Hfr (se producen fenmenos de sobrecruzamiento y recombinacin
gnica entre el cromosoma y los fragmentos).

J. L. Snchez Guilln Pgina IV-1-9


IV) Microbiologa 1) Microbiologa

3. MICROORGANISMOS SIN ORGANIZACIN CELULAR: LOS VIRUS

LOS VIRUS: CONCEPTO

Los virus son organismos dotados de extraordinaria simplicidad, pertenecen a un


nivel de organizacin subcelular, y marcan la barrera entre lo vivo y lo inerte. No se
nutren, no se relacionan, carecen de metabolismo propio y para reproducirse utilizan
la maquinaria metablica de la clula a la que parasitan; su simplicidad estructural y
funcional los convierte en parsitos intracelulares obligados, tanto de bacterias
(bacterifagos o fagos), como de las clulas animales y vegetales.

Las partculas vricas, llamadas tambin viriones, estn constituidas por una
molcula de ADN o ARN, nunca los dos en un mismo virus, contenida en el interior
de una cpsula proteica y, en ocasiones, una envoltura membranosa.

Informacin: En realidad, los virus pueden considerarse como fragmentos independizados del genoma celular
que han adquirido los genes necesarios para rodearse de una envoltura protectora y poseen la capacidad de
desplazarse de una clula a otra. Mientras que los transposones son genes que se desplazan de un sitio a otro
del cromosoma de una clula , los virus representaran a otro grupo de genes similares, pero que por haber
adquirido la cpsula protectora se aventuraron a dar "saltos" mayores.

La destruccin celular es la consecuencia de la infeccin provocada por el virus, y las repercusiones para el
organismo dependen de la importancia del tejido lesionado; as, mientras el virus de la gripe causa la des-
truccin de clulas de la mucosa respiratoria y " no reviste gravedad", el virus de la rabia, sin embargo,
destruye neuronas y puede ser mortal si alcanza los centros vitales del encfalo; otros, como el virus del SIDA,
destruyen el sistema inmunitario, y el organismo queda expuesto a todo tipo de infecciones oportunistas que
terminan por causar la muerte.

ESTRUCTURA Y CARACTERSTICAS DE LOS VIRUS

Como ya se ha dicho, todo virus est formado por una envuelta proteica: la cpsida
y por un cido nucleico; adems, algunos virus ms complejos pueden tener una
envoltura membranosa de lpidos y protenas.

Los virus son muy pequeos y slo son visibles mediante microscopa electrnica.
Su tamao oscila desde los 10 nm, en los pequeos virus de la poliomielitis, hasta
los 300 nm en el virus de la viruela, el mosaico del tabaco -TMV- y otros. Se
diferencian entre ellos, adems de por el tamao, por las caractersticas estructurales
de la cubierta (la cpsida), por la naturaleza de su cido nucleico, el modo de
penetracin en la clula hospedadora y el mecanismo de replicacin.

3.1) Constitucin y morfologa de la cpsida

Todos los virus presentan, sin excepcin, una envoltura proteica, denominada,
cpsida, compuesta por el ensamblaje de una o varias subunidades proteicas llamadas
capsmeros, dispuestas a menudo en varias capas concntricas.

La geometra de la cpsida es uno de los criterios que permite clasificar los virus
en cuatro grupos: icosadricos, helicoidales, complejos y con envoltura.

J. L. Snchez Guilln Pgina IV-1-10


IV) Microbiologa 1) Microbiologa

* Icosadricos: son los virus de aspecto


esfrico, cuya cpsida adopta la estructura
de un icosaedro (poliedro de 20 caras
triangulares, 30 aristas y 12 vrtices); por
ejemplo: los adenovirus, el virus de la polio
y los picornavirus.

* Helicoidales o cilndricos: estn


representados por el virus del mosaico del
tabaco y el virus de la rabia; presentan un
Fig. 17 Virus. 1 y 2) Virus icosadricos; 3)
aspecto alargado, que en realidad
Virus complejo; 4) Virus helicoidal; 5) Virus
corresponde a un cilindro hueco, donde los con envoltura.
capsmeros se ensamblan siguiendo un
ordenamiento helicoidal, similar a los
peldaos de una escalera de caracol.

* Complejos, como bacterifagos (virus


parsitos de bacterias) que parecen adoptar
las dos estructuras anteriores. Al igual que
los icosadricos poseen una regin icosadrica
llamada cabeza donde se aloja el ADN y una
cola formada por una banda de simetra Fig. 18 Virus helicoidal. Virus del mosaico
helicoidal en cuyo interior se encuentra un del tabaco. 1) ARN viral; 2) cpsida;
eje tubular. La cola est terminada en un
conjunto de fibras y espinas caudales que
constituyen el sistema de anclaje del virus a
la bacteria a la que infecta.

* Virus con envoltura membranosa: La


mayora de los virus animales, como los de
la gripe, la viruela, la hepatitis, el virus del
SIDA, etc. poseen, adems de la cpsida,
una envoltura membranosa que no es mas
que un fragmento de la membrana
plasmtica de la clula hospedadora que el
Fig. 19 Virus helicoidal. Virus del mosaico
virus arrastra al abandonarla mediante un
del tabaco.
proceso de gemacin. La bicapa lipdica que
forma esta envoltura posee un conjunto de
glucoprote nas codificadas por el virus y dis-
cabeza
puestas hacia el exterior, a modo de
genoma
espculas, que constituyen su sistema de fibras
cola
anclaje en los receptores de membrana de
las clulas hospedadoras y, por tanto, median
en el mecanismo de penetracin por
endocitosis o por fusin de membranas. La
envoltura membranosa es muy importante placa
basal

desde el punto de vista inmunolgico


Fig. 20 Virus con cpsida compleja:
Bacterifago.

J. L. Snchez Guilln Pgina IV-1-11


IV) Microbiologa 1) Microbiologa

3.2) El cido nucleico

Es el componente esencial del virus y puede ser ADN monocatenario, por ejemplo,
en el fago O-X-174, o ADN bicatenario, como el fago T4 y los adenovirus; pero
tambin existen virus con ARN bicatenario (los reovirus) y otros portadores de ARN
monocatenario, como es el caso de los virulentos retrovirus, entre los que se
encuentran el de la gripe, el sarampin, la rabia, el SIDA y determinados virus onc-
genos causantes de ciertos tipos de cncer (sarcoma de Rous, determinadas leuce-
mias, etc.). Este ltimo grupo contiene, adems de los otros componentes
mencionados, un enzima particular llamado retrotranscriptasa o transcriptasa inversa,
que le va a permitir transcribir su ARN en un ADN dentro de la clula infectada.

El material gentico viral


Tipo de cido Cpsida Envoltura Ejemplo
Virus nucleico

Virus ARN Helicoidal No Mosaico del


vegetales monocatenario tabaco

Bacterifagos ADN Compleja No Bacteri-


bicatenario fago T4

Virus De todos los Icosadricos Frecuente Gripe,


animales tipos SIDA, etc.

MECANISMOS DE REPLICACIN: CICLO VITAL DE LOS VIRUS

Aunque el genoma de un virus contiene escaso nmero de genes, es suficiente para


inhibir la expresin gnica de la clula hospedadora y obligarla a transcribir y traducir
su breve mensaje. El modo de penetracin , los mecanismos y los compartimentos
celulares utilizados para la replicacin, son diferentes en los distintos tipos de virus.
De todos ellos, se pondrn como ejemplo el de los retrovirus y los bacterifagos.

a) Ciclo vital de un retrovirus: El VIH causante del SIDA.

Los retrovirus son un grupo especial de


virus animales cuyo cido nucleico es ARN,
poseen envoltura y la enzima transcriptasa a
inversa.

EL VIH es un retrovirus relativamente b


complejo. Est constituido por una
membrana lipdica con glucoprotenas
dispuestas hacia el exterior a modo de
c
espnas. En el interior encontramos una d
cpsida proteica que encierra el material
gentico, formado por dos molculas de ARN Fig. 21 Virus del S.I.D.A.: a) envoltura
membranosa; b) cpsida ; c) cido nucleico
monocatenario y se encuentran ligadas, cada
(ARN); d) espculas proticas.
una de ellas, a una molcula de una enzima,
la transcriptasa inversa.

J. L. Snchez Guilln Pgina IV-1-12


IV) Microbiologa 1) Microbiologa

Ciclo vital del virus del SIDA

1 6a

6b
3

4
7
8

Informacin: El VIH ataca preferentemente a los linfocitos T4. Las fases de este proceso son:

10) Contacto entre las espculas de su envoltura membranosa y los receptores de la clula hospedadora. Estas
permiten la fusin de membranas, introduciendo en su interior la cpside con el material gentico.
20) Una vez en el interior, el virus se despoja de su cpsida protica y quedan libres las hebras de ARN y la
enzima retrotranscriptasa que transporta.
30) La retrotranscriptasa, tambin llamada transcriptasa inversa, primero hace una copia en ADN de la cadena
de ARN, es decir, invierte el proceso normal de transcripcin de ADN a ARN, originando una hlice hbrida
ARN-ADN.
40) La hlice hbrida ARN-ADN es utilizada por la misma enzima para generar una doble hlice de ADN (previa
degradacin del ARN).
50) Las dobles cadenas de ADN vricas entran en el ncleo y se insertan en el cromosoma celular, donde
puede permanecer en estado latente en forma de provirus durante un tiempo ms o menos prolongado.
60) Finalmente se transcriben y se traducen utilizando la maquinaria metablica de la clula y origina nuevas
copias de ARN vrico, protenas de la cpsida y de la envoltura y enzimas retrotranscriptasas.
70) Estos componentes se ensamblan, y...
80) los virus abandonan la clula mediante un proceso de gemacin que les permite adquirir de nuevo su
recubrimiento membranoso.

Todos estos procesos pueden ser lentos, originando tan slo un descenso de la actividad metablica del
hospedador, o rpidos, con lo que la salida masiva de virus termina con la lisis de la clula.

J. L. Snchez Guilln Pgina IV-1-13


IV) Microbiologa 1) Microbiologa

b) Ciclo vital del fago T4.

El bacterifago T4 es un virus complejo con una cabeza icosadrica y una cola en la


que hay una placa basal y fibras de fijacin. El genoma se compone de una molcula
de ADN bicatenaria que se encuentra profusamente empaquetada dentro de la cabeza.

El fago se fija en la pared bacteriana, en cabeza

las regiones denominadas puntos de genoma

adherencia, a travs de los cuales inyecta su cola fibras

ADN mediante la contraccin de la vaina de


la cola. Una vez en el protoplasma
bacteriano, el ADN puede seguir dos
caminos: multiplicarse y originar nuevos virus
(va ltica), con lo que se produce la des- placa
basal
truccin de la bacteria, o integrarse en el
cromosoma bacteriano y adoptar la forma de Fig. 22 Fago T4 (bacteriofago).
profago (va lisognica).

i) Ciclo ltico.

1) Fijacin y entrada 2) Multiplicacin 3) Lisis y liberacin

1) Fijacin y entrada: El bacterifago fija su cola a receptores espec ficos de la pared de la bacteria, donde una enzima localizada

en la cola del virus debilita los enlaces de las molculas de la pared. A continuacin, el fago contrae la vaina helicoidal, lo que

provoca la inyeccin del contenido de la cabeza a travs del eje tubular de la cola del fago: el cido nucleico del virus penetra en

la clula.

2) Multiplicacin: Una vez dentro, el ADN del virus, utilizando nucletidos y la enzima ARNpolimerasa de la bacteria, dirige la

sntesis de gran cantidad de ARNm viral. Este ARNm viral sirve de base para la snte sis de protenas del virus (capsmeros,

endonucleasas, endolisinas). El ADN vrico, utilizando los complejos enzimticos de la bacteria, se replica muchas veces. Tanto los

cidos nucleicos replicados como el resto de los componentes vricos que se han sintetizado se ensamblan, dando lugar a nuevos

virus.

3) Lisis y liberacin. En una bacteria pueden formarse unos 100 bacterifagos, que salen al exterior debido a la accin de la

endolisina, enzima que lisa la pared bacteriana. Debido a ello, se produce la ruptura de la pared bacteriana y la muerte de la

clula. Los virus quedan libres para infectar nuevas clulas.

ii) Ciclo lisognico.

No siempre se produce la lisis inmediata de la clula. Hay fagos atemperados o


atenuados que se integran en el ADN bacteriano por entrecruzamiento de dos
regiones idnticas del fago y de la bacteria, del mismo modo a como ocurre en los
plsmidos. Estos fagos integrados se denominan profagos, y se replican pasivamente
con el ADN de la bacteria. Las bacterias capaces de establecer esa relacin con los

J. L. Snchez Guilln Pgina IV-1-14


IV) Microbiologa 1) Microbiologa

fagos atenuados se denominan lisognicas.

El ADN del profago puede permanecer en


forma latente durante varias generaciones de
1) Respuesta ltica.
la bacteria, hasta que un estmulo induzca
la separacin del profago, lo que iniciar un
ciclo ltico tpico. Mientras la clula posea el
ADN profago ser inmune frente a
infecciones de este mismo virus. Otros virus
2) Respuesta lisognica.

que no son bacterifagos pueden tambin Fig. 23 Ciclos ltico y lisognico de un


tener ciclos lisognicos. fago.

VIROIDES Los viroides son de menor tamao que


cualquiera de los genomas vricos
conocidos, pero suficiente para poder
Son extremadamente sencillos y forman un codificar una protena, pero no se cree
escaln inferior a los virus. Son simplemente que lo hagan, ya que el ARN de los
genomas desnudos, ARN de una cadena viroides carece de seales que se
necesitan para la traduccin del ARN a
(pero en forma de horquilla, pues hay com-
una protena. Por lo tanto su informacin
plementariedad entre sus bases, simulando no se traduce, solo se replica. Parece
un ARN doble para protegerse de los enzi- probable que sea la ARNpolimerasa del
mas hidrolti cos celulares que atacan a los hospedador, que est en el ncleo de las
ARN simples) y no presentan cpsida protei- plantas, la que replica el genoma del
viroide. No est claro cmo se
ca. Solamente causan enfermedades en los
transmiten entre clulas ( dada la pared
vegetales. Han producido prdidas econmi- celular de las clulas vegetales), y mucho
cas importantes: en cultivos de patata en menos entre individuos.
USA y en cocoteros en Filipinas.

LOS PRIONES: De estos "organismos" sabemos an menos. Se descubren en 1983 como agentes causantes
de afecciones neuronales espordicas. Ahora aumenta su inters debido al mal de las vacas locas.
Es una partcula infecciosa protenica (protena patolgica). Las pruebas obtenidas hasta el momento
parecen indicar que el prin carece de cido nuclico.
Se conocen dos enfermedades causadas por priones: La Tembladera, una alteracin neurolgica de ovejas y
cabras, conocida desde el siglo XVII y la enfermedad de Creutzfeld-Jacob, una rara demencia humana. Los
priones tambin se consideran agentes probables de otras enfermedades humanas que afectan al sistema
nervioso: el Kuru, observado slo en tribus de Nueva Guinea, asocindose al canibalismo tradicional (la
enfermedad fue desapareciendo conforme cesaban las prcticas necrfagas).
La enfermedad de Creutzfeld-Jacob en individuos menores de 35 aos se relacion con el consumo de
subproductos de vacas enfermas, que estaban alimentadas con piensos fabricados con restos de ovejas con
tembladera.
La infeccin por priones no provoca una respuesta inmunitaria, debido a que el prin est dentro de nuestras
propias clulas. El agente causante es una protena propia de la membrana plasmtica de las neuronas. Se
sabe que est codificada por un gen del cromosoma 20. Esta protena sufre una alteracin que la convierte en
patolgica (prin) Las protenas defectuosas actan como agentes infecciosos que cambian las protenas
normales en defectuosas. La aparicin de la demencia es consecuencia de que se acumulan cristalizadas en las
neuronas provocando su destruccin y muerte.
Comparando las dos protenas, normal y patolgica, se comprueba que tienen la misma secuencia de
aminocidos (estructura primaria), pero tienen un plegamiento distinto.
Se han encontrado casos de transmisin hereditaria de la enfermedad, debido a una mutacin puntual que
implica modificacin en la estructura primaria de la protena, sustituyndose una prolina por una leucina.

J. L. Snchez Guilln Pgina IV-1-15


IV) Microbiologa 1) Microbiologa

CLASIFICACIN DE LOS VIRUS (slo para consultar)

Los criterios bsicos de clasificacin son el tipo de cido nucleico que contienen, el tipo de cpsida, la
posesin de envolturas membranosas y el tipo de clula a la que parasita. Segn este ltimo criterio
existen virus animales, virus vegetales y virus bacterianos o bacterifagos. Las caractersticas ms
frecuentes de cada grupo ya se han visto en la pgina .

A continuacin, y a modo de consulta veamos los ms importantes grupos de virus animales.

Clasificacin de los virus parsitos de clulas animales

N1 Familia cido nucleico Envoltura Gnero y especie Enfermedad

1 Papovaviridae ADN-bc circular Desnudos Virus del papiloma hu- Verrugas


(Papovairus) mano

2 Poxviridae ADN-bc circular Envueltos Virus de la viruela Viruela


(Poxvirus)

3 Herpesviridae ADN-bc lineal Envueltos Virus de herpes simple I Grietas en los labios y
(Herpesvirus) y II herpes genital

Virus de la varicela Varicela y herpes zoster


zoster

4 Adenoviridae ADN-bc lineal Desnudos Adenovirus humano Infecciones respiratorias,


(Adenovirus) entricas y oftlmicas

5 Parvoviridae ADN-mc lineal Desnudos Virus adenoasociados Infecciones en roedores


(Parvovirus)

6 Reoviridae ARN-bc Desnudos Rotavirus Diarreas infantiles


(Reovirus)

7 Orthomixoviri- ARN-mc Envueltos Virus de la gripe Gripe


dae
(Ortomixovirus)

8 Paramixoviridae ARN-mc Envueltos Virus de la parotiditis Paperas (parotiditis)


(Paramixovirus)

Virus de sarampin Sarampin

9 Rhabdoviridae ARN-mc Envueltos Virus de la rabia Rabia


(Rabdovirus)

10 Picornaviridae ARN-mc Desnudos Enterovirus (virus de la Polio, miocarditis, pericar-


(Picornavirus) polio, Coxsakie y Echo ditis, gastroenteritis, me-
ningoencefalitis.

11 Togaviridae ARN-mc Envueltos Virus de la rubola Rubola


(Togavirus)

12 Retrovirus ARN-mc Envueltos Virus de la inmunodefi- SIDA


(Retrovirus) ciencia humana (VIH-1
y VIH-2)

Virus de la leucemia de Leucemia de las clulas T


las clulas T

J. L. Snchez Guilln Pgina IV-1-16


IV) Microbiologa 1) Microbiologa

Forma de los virus que parasitan clulas animales

Leyenda: 1) Papovavirus; 2) Poxvirus; 3) Herpesvirus; 4) Adenovirus; 5) Parvovirus; 6) Reovirus;


7) Ortomixovirus; 8) Paramixovirus; 9) Rabdovirus; 10) Picornavirus; 11) Togavirus; 12) Retrovirus.

J. L. Snchez Guilln Pgina IV-1-17


IV) Microbiologa 1) Microbiologa

Informacin: Modalidades de transcripcin de los virus animales

Los virus animales pueden clasificarse por su material gentico y por la forma de sintetizar su ARN
mensajero.

Grupo I: Tienen como material gentico ADN de cadena doble (hebras + y -). La hebra (-) se transcribe en
un ARNm. Ejemplo: virus del herpes.

Grupo II: Tienen como material gentico ADN de cadena simple (+ -). La hebra de ADN sintetiza una
molcula complementaria de ADN formndose un ADN de cadena doble. De estas dos hebras, la hebra (-) se
transcribe en un ARNm. Ejemplo: Parvovirus.

Grupo III: Tienen como material gentico ARN de cadena doble (hebras + y -). De estas dos hebras, la hebra
(-) sirve de molde para la sntesis de un ARNm complementario. Ejemplo: Reovirus.

Grupo IV: Tienen como material gentico ARN de cadena simple (hebra +). Esta hebra de ARN sintetiza una
molcula complementaria de ARN: hebra (-) que sirve de molde para sintetizar un ARNm complementario.
Ejemplo: Virus de la polio de los primates.

Grupo V: Tienen como material gentico ARN de cadena simple (hebra -). Esta hebra de ARN sirve de molde
para sintetizar un ARNm complementario. Ejemplo: Gripe.

Grupo VI: Tienen como material gentico ARN de cadena simple (hebra +). Esta hebra de ARN sirve de
molde para sintetizar un ADN complementario: hebra (-) que a su vez sirve de molde para sintetizar un ADN
+. Se forma as un ADN de doble cadena (+ y -). La hebra de ADN (-) se transcribe formndose un
ARNm+. Ejemplo: Retrovirus.

Modalidades de transcripcin de los virus de clulas animales

I- Herpes
II- Parvovirus
III- Reovirus ADN
IV- Polio de los ARN
primates
V- Gripe Lnea fina,
cadena que no
VI- V.I.H. se transcribe

Fig. 24

J. L. Snchez Guilln Pgina IV-1-18


IV) Microbiologa 1) Microbiologa

4. MICROORGANISMOS CON ORGANIZACIN CELULAR EUCARIOTA

PROTOZOOS
cil

vp Mn
Son organismos formados por una sola mn vp

clula, es decir, poseen la estructura tpica


de una clula eucaritica animal, aunque en
ocasiones presentan una mayor complejidad vg

en su organizacin. Tienen una membrana


plasmtica que los rodea y delimita, algunos Fig. 25 Paramecio, ciliado de las aguas
dulces. vp) Vacuola pulstil. vd) Vacuola
forman un caparazn duro, calizo o silceo,
digestiva. cil) Cilios. Mn) Macroncleo. mn)
o bien una fina envoltura de quitina. Microncleo.

ESTUDIO DE UN PROTOZOO: EL PARAMECIO. Los ciliados:


Los protozoos como el paramecio que presentan
Mirando con el microscopio una infusin o agua de cilios para su movimiento se conocen con el
una charca puede observarse fcilmente el paramecio nombre de ciliados. Otros ciliados que abundan en
(Paramecium ssp.). Tiene forma de suela de zapato y al agua de charcas son:
de su cuerpo salen muchos cilios, dispuestos en filas
a lo largo de toda su superficie, que le sirven para * Las Vorticelas, con cuerpo en forma de
nadar. campana y un largo pednculo que puede
arrollarse en espiral como un muelle. Forman
A un lado del cuerpo hay una abertura, la boca o colonias.
citostoma, que da acceso a un embudo que se * Los Stentor, con forma de trompeta, que
estrecha hacia el interior. Sirve para su alimentacin: pueden medir hasta 1 mm. Se suelen fijar a
con los cilios provoca un remolino que arrastra las races, etc. por su extremo puntiagudo.
partculas alimenticias hacia el fondo del embudo,
donde se forma un vacuola digestiva que engloba las Otros protozoos:
partculas ingeridas. * La Ameba, que vive en las charcas. Forma
gruesos pseudpodos para moverse y capturar su
En su citoplasma podemos distinguir: alimento: bacterias, algas, etc. Los protozoos que
forman pseudpodos se denominan rizpodos.
* Unas pequeas cavidades esfricas, ms o menos Adems de la ameba existe Entamoeba histolytica
numerosas, llamadas vacuolas digestivas. que es parsita del hombre donde origina la
* En cada extremo del cuerpo se halla una vacuola disentera amebiana
pulstil, de forma estrellada, que presenta movimientos * El Trypanosoma, protozoo de forma alargada y
rtmicos de contraccin y cuya misin es expulsar de con un largo flagelo para su movimiento. Vive
la clula los productos de deshecho de la digestin y parsito en la sangre de algunos mamferos
agua. africanos de donde puede pasar al hombre por
* Un par de ncleos: uno grande (macroncleo) y otro picadura de la mosca tse-ts. En el hombre origina
pequeo (microncleo). la enfermedad del sueo.

Se reproducen asexualmente por divisin simple. Se Los protozoos con flagelos: flagelados.
han observado procesos sexuales (conjugacin) en los * Plasmodium, que produce en el hombre la
cuales dos paramecios se unen por el citostoma y a enfermedad de la malaria o paludismo. Se
travs de l realizan un intercambio de material nuclear, introduce en la sangre mediante la picadura de la
separndose despus. Aunque en este proceso no hembra del mosquito Anopheles , quien a su vez
haya variacin numrica, se considera una reproduccin lo toma de otros individuos enfermos. De esta
sexual por el intercambio de material nuclear, que es forma la enfermedad se transmite de individuos
lo esencial de la sexualidad. enfermos a otros sanos por la picadura del
mosquito. El plasmodio, una vez en la sangre,
Cuando falta agua, se rodea de una membrana pasa al interior de los glbulos rojos donde se
gruesa, donde permanece con vida latente, pudiendo divide por esporulacin y destruye las clulas
resistir largas temporadas hasta que nuevamente haya sanguneas.
agua, este proceso se conoce como enquistamiento.

J. L. Snchez Guilln Pgina IV-1-19


IV) Microbiologa 1) Microbiologa

Fig. 26 Diferentes especies de protozoos. 1) Paramecio; 2) Stentor; 3) Ciliado sp.; 4) Vorticela; 5) Ameba.

Su forma y tamao son variables, pero casi


todos ellos son microscpicos por lo que
deben observarse al microscopio.

Algunos viven libres en aguas dulce o


saladas. Cuando se deseca el medio en que
viven forman un caparazn y se enquistan.
Otros viven parsitos en animales o vegeta-
les produciendo enfermedades, o bien,
simbiosis con ellos.

Se suelen reproducir por biparticin simple,


aunque algunos tienen otras modalidades e Fig. 27 Euglena.
incluso se conocen procesos de reproduccin
sexual.

ALGAS MICROSCPICAS UNICELULARES

Formadas por una sola clula. Viven en el


agua y son capaces de realizar la fotosnte -
sis. Entre ellas podemos citar las Diatomeas,
que viven tanto en el mar como en el agua
dulce y poseen un caparazn de slice
(frstula) constituido por dos piezas que
encajan como una caja y su tapadera. Algu-
nas algas unicelulares, como Euglena viridis,
Fig. 28 Diatomeas.
tienen flagelos con los que se desplazan en
el agua. Las algas unicelulares forman parte
importante del llamado plancton.

J. L. Snchez Guilln Pgina IV-1-20


IV) Microbiologa 1) Microbiologa

HONGOS MICROSCPICOS

Bajo esta denominacin se incluye un


esporangios
amplio grupo de organismos de gran hete-
rogeneidad. Entre las caractersticas comu-
nes a todos los hongos pueden destacarse: hifas

a) Estar formados por una o ms


clulas eucariotas.
b) Encontrarse desprovistos de Fig. 29 Hifas y esporangios del Mucor,
clorofila u otro pigmento fotosinttico. hongo que coloniza el pan hmedo.
c) La pared celular no es de celulosa
sino de quitina.

Los hongos son organismos hetertrofos


que necesitan para su nutricin sustancias
orgnicas ya elaboradas; la mayora son
saprfitos - se desarrollan sobre materia
orgnica en descomposicin - y otros son
parsitos que producen enfermedades en el
hombre y otros animales y vegetales.
Fig. 30 Clula de levadura.
Dentro de los hongos podemos encontrarlos
unicelulares (levaduras) y pluricelulares
(mohos), estos tienen una estructura deno-
minada " talo" y que suele estar constituida
por una serie de filamentos denominados
" hifas", que pueden ser ramificadas y tabica-
das, formando, en su conjunto, una estruc-
tura denominada " micelio".

Su reproduccin puede ser sexual o asexual


(gemacin, esporulacin, fragmentacin) y su
Fig. 31 Clula de levadura dividindose por
clasificacin es compleja y se puede realizar
gemacin.
atendiendo a diferentes caracteres

APLICACIONES Y PAPEL EN EL ECOSISTE- conidiforos

MA

El papel que los hongos ejercen en la


naturaleza resulta de gran importancia, sobre
todo si tenemos en cuenta su actividad
descomponedora en los ecosistemas
(reciclaje de materia orgnica). Tambin hifas

tienen una parte fundamental en la actividad


humana. As, es conocido su papel en la Fig. 32 Hifas y conidiforos de Penicillium.
alimentacin, la agricultura, silvicultura, Este hongo aparece sobre pan hmedo y
industria qumica, enfermedades, etc. naranjas enmohecidas.

J. L. Snchez Guilln Pgina IV-1-21


IV) Microbiologa 1) Microbiologa

Los hongos son capaces de descomponer algunos materiales fabricados y usados por
el hombre a partir de materiales de origen orgnicos (vegetal y animal); reciclan por
tanto estos materiales como si se tratara de la materia orgnica que forma parte del
ecosistema (biodeterioro).

Por otra parte, desde hace cientos de aos el hombre ha utilizado diferentes
especies de hongos para la transformacin de alimentos, un claro ejemplo son las
levaduras utilizadas en la elaboracin de la cerveza y del vino (Saccharomyces), de
los quesos (algunas especies de Penicillium), del pan, etc.

Los hongos son muy importantes en la industria qumica como productores de


numerosas sustancias como vitaminas, cortisonas, cidos orgnicos y sobre todo
antibiticos (en este sentido cabe recordar
que la penicilina fue descubierta por R H H
S
Fleming a partir de una especie de
1 N CH3
Penicillium). H 2 3

Los hongos tambin pueden ser agentes N CH3

patgenos directos sobre el ser humano, son O


causantes de numerosas micosis superficiales COOH
en la piel, uas, pelo, etc. y micosis
profundas con mayor riesgo para la salud. Fig. 33 Penicilina. 1) Grupo amino libre;
Tambin puede haber alergias micgenas 2) Anillo -lactmico; 3) Anillo de tiazolina; R)
Radical que determina las propiedades
provocando molestias respiratorias (por las farmacolgicas.
esporas).

J. L. Snchez Guilln Pgina IV-1-22


IV) Microbiologa 1) Microbiologa

5. INTERVENCIN DE LOS MICROORGANISMOS EN LAS TRANSFORMACIONES O


CICLOS BIOGEOQUMICOS.

Las bacterias y los hongos son los microorganismos que, junto a los productores,
permiten la existencia del ciclo de la materia en la biosfera. Su funcin es
descomponer la materia orgnica procedente de restos vegetales, cadveres y
excrementos, convirtindola en materia inorgnica que vuelve a ser utilizada por los
productores.

La actividad de los descomponedores en la biosfera permite que la materia se recicle


y no se disperse en las sucesivas transferencias, como ocurre con la energa.

Muchos de los elementos qumicos que componen los materiales terrestres estn
sometidos a unos circuitos cclicos que consisten, bsicamente, en que pasan de
formar parte de materia inorgnica inerte a formar parte de materia constitutiva de
seres vivos y de stos, posteriormente, de nuevo a materia inorgnica inerte,
cerrndose el ciclo. Estos ciclos de la materia son los ciclos biogeoqumicos.

Como ejemplos de ciclos biogeoqumicos, y el papel que desempean los


microorganismos en ellos, estudiaremos el ciclo del carbono y el ciclo del nitrgeno:

A) EL CICLO DEL CARBONO

Mediante el proceso de fotosntesis, las plantas toman el carbono en forma de CO2


de la atmsfera o del agua, asimilndolo durante la fase oscura de dicho proceso
para formar molculas orgnicas. Parte del carbono vuelve al medio inerte en la misma
forma de CO2 como resultado de la respiracin tanto de las propias plantas como de
los organismos consumidores y descomponedores. Los desechos, restos o cadveres
que contienen carbono vuelven tambin al medio inorgnico por accin de los
descomponedores (bacterias y hongos).

Combustin CO2

Vegetales Descomponedores
P Fotosntesis Respiracin
e (Bacterias
C
t a Hongos)
r r Compuestos
b
l orgnicos
e n
o

Consumidores

Compuestos
orgnicos

Fig. 34 El ciclo del carbono.

J. L. Snchez Guilln Pgina IV-1-23


IV) Microbiologa 1) Microbiologa

Una parte muy importante del carbono, puede tardar millones de aos en
incorporarse al medio inerte. Es el caso del carbono que llega a formar parte del
petrleo y del carbn mineral. Este carbono puede volver al ciclo por combustin de
estos combustibles fsiles.

B) EL CICLO DEL NITRGENO

La fuente principal de nitrgeno es la atmsfera, de la que este gas constituye un


78%; sin embargo, este nitrgeno atmosfrico slo puede ser fijado por un grupo de
bacterias fijadoras del nitrgeno que transforman este gas en compuestos
nitrogenados utilizados directamente por las plantas. Entre el grupo de bacterias
fijadoras del nitrgeno est el gnero Rhizobium que se encuentra en simbiosis con las
races de las plantas leguminosas (guisantes, judas, trboles, alfalfa, etc.), estas
bacterias se introducen en los tejidos del vegetal, donde proliferan y desarrollan una
especie de ndulos fijadores del nitrgeno.

El resto de las plantas depende del nitrgeno que se encuentra en el suelo, de


donde lo toman en forma de nitratos.

Cuando un organismo muere, el nitrgeno de los restos orgnicos, como son las
protenas y los cidos nucleicos, por accin de bacterias y hongos presentes en el
suelo, se convierte en amoniaco o in amonio (amonificacin).

Otros grupos de bacterias del suelo oxidan los iones amonio a nitritos y
finalmente las bacterias nitrificantes oxidan los nitritos a nitratos. Los nitratos son ya
fcilmente absorbidos por las races de las plantas y utilizados para formar molculas
nitrgenadas (protenas y cidos nucleicos). Mediante las cadenas trficas posteriores,
el nitrgeno asimilado en estas molculas del vegetal pasa a los animales.

Existe un grupo de bacterias desnitrificantes que en condiciones anaerobias y de


inundacin, convierten los nitratos del suelo en nitrgeno molecular, que escapa a la
atmsfera. Por eso los agricultores drenan las tierras para reducir la desnitrificacin y
aaden fertilizantes para incrementar los niveles de nitrgeno del suelo.

Bacterias y
hongos

Animales

Bacterias Sustancias
Suelos nitrogenadas
fijadoras
de orgnicas:
Nitrgeno Nitratos
nitrgeno -Protenas
atmosfrico Nitritos
de los
suelos Sales - cidos
amoniacales nuclicos

Vegetales
Algas

Fig. 35 El ciclo del nitrgeno.

J. L. Snchez Guilln Pgina IV-1-24


IV) Microbiologa 1) Microbiologa

6. LOS MICROORGANISMOS COMO AGENTES DE ENFERMEDADES INFECCIOSAS

La mayora de los microorganismos son inocuos para los dems seres vivos.
Muchos de ellos incluso se han adaptado a las condiciones especiales que tienen los
tejidos de los animales viviendo en ellos, en su piel, en sus conductos digestivos o
respiratorios; son la denominada flora normal. Sin embargo, los microbios ms
conocidos son aquellos que producen enfermedades infecciosas en las plantas, en los
animales y en la especie humana. Estos son los microorganismos patgenos.

El grado de patogenidad se denomina virulencia y se mide, generalmente, por el


nmero de microorganismos necesarios para desarrollar la enfermedad. Hay
microorganismos que normalmente no son patgenos pero pueden serlo cuando
disminuyen los mecanismos defensivos de un animal: son los microorganismos
oportunistas.

Robert Koch (1843-1910) fue el primero en comprobar que una bacteria era la causante de una enfermedad
infecciosa, el carbunco en ovinos. Estableci cuatro postulados que constituyen la base de las investigaciones
mdicas para establecer el tratamiento de las infecciones:

1)El organismo especfico ha de encontrarse siempre asociado a la enfermedad.


2)El organismo tiene que ser aislado y obtenido en cultivo puro en el laboratorio.
3)Este cultivo puro inoculado en un animal susceptible de ser infectado produce la enfermedad.
4)Se debe recuperar el organismo del animal infectado experimentalmente en cultivo puro.

Otros aportes de la labor investigadora de Koch fueron el descubrimiento de los cultivos en medios slidos
y el descubrimiento de los agentes causantes de la tuberculosis (llamado desde entonces bacilo de Koch) y
del clera.

V AS DE INFECCIN

El primer paso en una infeccin es la colonizacin por parte de los microorganismos


de tegumentos y mucosas corporales, donde deben competir con otros
microorganismos comensales. Los que superan esta primera fase con ms xito son
los que producen las enfermedades ms contagiosas.

La entrada de microorganismos en el cuerpo del hospedador puede tener lugar a


travs de distintas vas:

- Heridas o abrasiones en los tegumentos.


- Roturas microscpicas en las mucosas.
- Picaduras de artrpodos (arcnidos e insectos, principalmente).
- Adherencia especfica del microorganismo a las clulas del hospedador y paso a
travs de clulas epiteliales.
- En determinadas circunstancias, algunos microorganismos forman colonias muy
numerosas en los tegumentos, las cuales son responsables de una lesin epitelial,
producindose inflamacin y rotura, a travs de la cual penetran.

Una vez dentro, los microbios tienen que reproducirse, ya sea en una lesin
superficial, ya sea en un tejido especfico al que son conducidos por va linftica o

J. L. Snchez Guilln Pgina IV-1-25


IV) Microbiologa 1) Microbiologa

sangunea. En esta primera fase tienen que superar los mecanismos defensivos del
hospedador, lo que incluye la inflamacin, la detencin en los ganglios linfticos y su
eliminacin de la sangre por accin de los fagocitos. Si consiguen superarlos, se
desarrolla la enfermedad. El tiempo que transcurre desde que penetran hasta la
manifestacin de los sntomas de enfermedad se denomina perodo de incubacin.

Las infecciones pueden ser superficiales, si el microorganismo se multiplica en las


clulas epiteliales de la zona de entrada, o sistmicas si alcanzan los vasos
sanguneos y se multiplican en varios rganos a la vez.

Factores de patogenicidad. Toxinas

Segn la infeccin va progresando, se empiezan a manifestar los sntomas de la


enfermedad. Esto nos indica que el hospedador ya ha sufrido una lesin por diversas
causas:

* La proliferacin de los microorganismos

El crecimiento del nmero de clulas microbianas puede conllevar dos clases de


peligro: de un lado, se puede crear una competencia entre el microbio y las clulas
del hospedador por un determinado nutriente; de otro lado, se puede producir el
bloqueo de vasos sanguneos o un dao directo sobre las clulas del hospedador

* Produccin de toxinas

Las toxinas son sustancias venenosas de bajo peso molecular, que pueden ser
excretadas al medio (exotoxinas), como la del botulismo o el ttanos, o retenidas
dentro de la clula (endotoxinas). Estas toxinas pueden provocar daos locales,
cuando son muy especficas, o difundirse y causar lesin sistmica.

* La produccin de enzimas extracelulares como la lecitinasa que hidroliza los


lpidos de membrana de las clulas husped; las hemolisinas que lisan los glbulos
rojos, liberando al plasma su hemoglobina, etc.

J. L. Snchez Guilln Pgina IV-1-26


IV) Microbiologa 1) Microbiologa

7. BIOTECNOLOGA

La biotecnologa es el conjunto de procesos industriales que se sirve de microorga-


nismos o de clulas procedentes de animales o vegetales para obtener determinados
productos comerciales o para realizar importantes transformaciones qumicas.

La biotecnologa se ocupa, entre otros, de procesos tan diferentes como la


clonacin, la terapia gnica, la inseminacin in vitro, la obtencin de bebidas
alcohlicas, etc.

Aunque el trmino es moderno, rene tcnicas y mtodos conocidos desde la


antigedad. Por ejemplo, la fabricacin del pan, que ya realizaban los antiguos
egipcios, la mejora de las razas de animales y la obtencin de plantas con mayor
produccin de frutos.

El trmino biotecnologa se comenz a usar a finales de los aos setenta, tras la


aparicin de la ingeniera gentica, que se basa en la manipulacin del material
gentico de las clulas.

En la actualidad, con la expansin de la biotecnologa y los mtodos de


manipulacin gentica, los microorganismos han sido modificados para fabricar
productos tiles que los microorganismos no producen de manera natural.

BIOTECNOLOGAS APLICADAS A LA MEJORA DEL MEDIO AMBIENTE

Diversas tcnicas biotecnolgicas permiten resolver, de diferentes y novedosas


maneras, el problema de la contaminacin ambiental.

Se pueden utilizar diversos microorganismos para afrontar problemas de tratamiento


y control de la contaminacin qumica de distintos ecosistemas. La ingeniera
gentica permite combinar las caractersticas de estos microorganismos para aumentar
su eficacia o generar microbios recombinantes con nuevas caractersticas.

Aunque muchos microorganismos diferentes juegan un papel esencial en los


equilibrios ambientales, la mayora de las aplicaciones biotecnolgicas actuales se
realizan con ciertos tipos de bacterias.

Algunas de las aplicaciones de la biotecnologa a la mejora del medio ambiente son


las siguientes:

- Eliminacin de metales pesados.


- Eliminacin de mareas negras.
- Obtencin de energa no contaminante.
- Tratamiento de residuos urbanos e industriales.
- Tratamiento de diferentes tipos de contaminacin asociados a la industria del
petrleo.
- Tratamiento de la contaminacin producida por herbicidas, pesticidas e
insecticidas.
- Depuracin de aguas residuales.

J. L. Snchez Guilln Pgina IV-1-27


IV) Microbiologa 1) Microbiologa

Control de mareas negras

Se llama marea negra al vertido masivo de petrleo debido a un accidente durante el transporte del petrleo
en grandes barcos.

Es posible utilizar bacterias que digieren los hidrocarburos que forman el petrleo y los transforman en
sustancias qumicas nada o menos contaminantes. Aunque generalmente cada tipo de bacteria utiliza una
clase de hidrocarburo, se intenta combinar las caractersticas de varias bacterias para conseguir una bacteria
recombinante capaz de transformar muchos hidrocarburos diferentes.

Eliminacin de metales pesados

Los iones metlicos de los elementos pesados (por ejemplo, mercurio, cinc, nquel, cobre, plomo) movilizados
por la accin humana a distintos ecosistemas constituyen el tipo de contaminacin ms grave del planeta.
Los efectos contaminantes de los metales pesados superan en cuanta la suma de todos los dems tipos de
contaminacin qumica.

Gracias a la ingeniera gentica se han desarrollado bacterias que pueden vivir en presencia de metales
pesados y eliminarlos mediante diversas reacciones qumicas.

BIOTECNOLOGAS APLICADAS A LA MEJORA DE LA SALUD

La biotecnologa tiene en la salud humana, entre otros, los siguientes campos de


aplicacin:
- Prevencin de enfermedades hereditarias.
- Terapia gnica.
- Produccin de vacunas.
- Obtencin de anticuerpos monoclonales e interferones.
- Produccin de hormonas (por ejemplo insulina y hormona del crecimiento).
- Produccin de antibiticos y otros productos farmacuticos.

Antibiticos

La palabra antibitico designa a aquellas sustancias que, producidas por determinados microorganismos,
pueden acabar con la vida de otros.

En 1929, Alexander Fleming descubri estas sustancias. Estaba trabajando con Staphylococcus aureus y su
cultivo se contamin con un hongo del gnero Penicillium, de forma que las colonias rodeadas por ste
moran. Fleming supuso que el hongo produca alguna sustancia antibacteriana, por lo que hizo un filtrado,
descubriendo as, la penicilina. Fue incapaz de purificarla, dado que era qumicamente inestable, lo que se
hizo aos ms tarde, gracias al desarrollo de un proceso industrial adecuado.

Desde 1945 se han aislado cientos de antibiticos producidos por hongos del gnero Penicillium y bacterias
de los gneros Bacillus y Streptomyces.

El gran problema de la actualidad es que han comenzado a desarrollarse a un ritmo alarmante cepas de
patgenos resistentes a antibiticos e, incluso, cepas multirresistentes a varios antibiticos simultneamente,
por lo que hay que encontrar otros nuevos, o modificar los existentes para que recobren su eficacia, lo que
constituye el gran reto de la biotecnologa.

J. L. Snchez Guilln Pgina IV-1-28


IV) Microbiologa 1) Microbiologa

Hormonas

Las personas que sufren diabetes mellitus deben inyectarse insulina varias veces al da. Hasta 1983 la
insulina que utilizaban las personas diabticas era insulina de cerdo purificada (diferente de la humana). Desde
esa fecha se utiliza insulina obtenida por ingeniera gentica: se ha introducido el gen de la insulina humana
en la bacteria Escherichia coli, que la produce en cantidades masivas y con las mismas caractersticas. La
insulina es la primera protena fabricada por ingeniera gentica y comercializada.
Tambin por ingeniera gentica se obtiene la hormona del crecimiento.
Otras hormonas como la testosterona y progesterona, hormonas sexuales masculina y femenina, utilizada
sta ltima en la fabricacin de frmacos anticonceptivos se obtienen de la fermentacin de ciertas levaduras.

Fabricacin del yogur


BIOTECNOLOGAS DE LOS ALIMENTOS Se utiliza leche, que fermenta mediante deter-
minadas cepas de las bacterias Lactobacillus y
El hombre desde la antigedad ha obtenido Streptococcus que transforman la lactosa en
productos alimenticios con la intervencin de cido lctico. El cido lctico es el causante
los microorganismos, a pesar de desconocer de la precipitacin de las protenas de la
su existencia. Hoy da gracias al leche. Ambos microorganismos necesitan una
conocimiento de sus caractersticas y temperatura de 45C para desarrollarse al
metabolismo, son explotados industrialmente mximo, por eso la leche se envasa en
caliente para que despus siga el proceso de
en la fabricacin de numerosos alimentos y
fermentacin en la estufa a dicha temperatura.
bebidas. Por ejemplo:
El pH del yogur (despus del enfriamiento a 4
C) es alrededor de 4, este medio cido
impide el crecimiento de otras bacterias.
Pan. Actualmente la produccin de yogures se ha
Yogur. especializado en gran cantidad de sabores e
Queso. incluso en el enriquecimiento de nuevas bacte-
Mantequilla. rias.
Vinagre.
Vino.
Cerveza.
Fabricacin de cerveza
Encurti dos. Es un proceso que se conoce desde antiguo,
Produccin de protenas para piensos de ya que, al parecer, los babilonios fueron los
animales domsticos. primeros en elaborar la cerveza.
Sntesis de vitaminas que se aaden a Se basa en la fermentacin alcohlica que
los alimentos o en compuestos farma- realizan las levaduras del gnero Saccharo-
cuticos. (Por ejemplo la vitamina B12 es myces.
producida industrialmente a partir de La cerveza se obtiene por fermentacin de
bacterias y la riboflavina es producida por la cebada realizada por las levaduras S.
cerevisae o S. carlsbergensis. Los granos de
diversos microorganismos como bacterias
cebada se ponen a remojo, de forma que
y hongos).
germinan y generan amilasas suficientes que
Sntesis de aminocidos que se utilizan
hidrolizan el almidn. Despus se secan, lo que
como aditivos alimentarios. (Ejemplos de constituye la malta, la cual se puede
aminocidos producidos por fermentacin almacenar hasta su uso. Con la malta se
microbiana son el cido glutmico, la obtiene el mosto de cerveza, al cual se
lisina, la glicina, la metionina y la alanina). adiciona el lpulo, encargado de dar a la
cerveza el sabor amargo y de conservarla del
crecimiento bacteriano. Es entonces cuando se
aade el inculo, que fermenta durante cinco a
diez das a temperatura y pH adecuados.

J. L. Snchez Guilln Pgina IV-1-29


V) Inmunologa 1) Inmunologa

INMUNOLOGA

(1)
CONCEPTO DE INMUNIDAD

Conjunto de mecanismos que un individuo posee para enfrentarse a la invasin de


cualquier cuerpo extrao y para hacer frente a la aparicin de tumores.

Esta cualidad se adquiere antes del nacimiento y se madura y afianza en los


primeros aos de vida. En los vertebrados implica que los organismos diferencian lo
propio de lo ajeno, es decir reconocen todos sus tipos celulares.

El Sistema Inmune es el responsable de conferir inmunidad. Este sistema, presente


en invertebrados, alcanza su mxima complejidad en los primates y seres humanos.
La ciencia encargada de estudiar estos procesos se denomina Inmunologa.

EL SISTEMA INMUNE

Es un sistema biolgico complejo. Se adenoides

encuentra distribuido por todos los rganos y amgdalas


ganglios linfticos
fluidos vasculares e intersticiales, excepto el
cerebro, concentrndose en rganos
especializados como la mdula sea, el bazo,
el timo y los ndulos linfticos. timo
bazo
Presenta componentes celulares: linfocitos,
macrfagos y granulocitos y molculas placas de Peyer

solubles: anticuerpos, linfocinas y comple- (intestino delgado)

mento.
apndice

Es el responsable de conferir la inmunidad mdula sea


al actuar de forma coordinada todos sus
componentes.

Las clulas y molculas que participan en la


defensa inmune llegan a la mayor parte de
los tejidos por el torrente sanguneo que
pueden abandonar a travs de las paredes de Fig. 1 Situacin de los rganos del sistema
los capilares y al que pueden regresar por inmune en la especie humana.
el sistema linftico.

(1) Lectura: http://www.ugr.es/~eianez/inmuno/cap_01.htm

J. L. Snchez Guilln Pgina V-1-1


V) Inmunologa 1) Inmunologa

FUNCIONES DE LOS RGANOS LINFOIDES

rganos
linfoides

Secundarios
Primarios
En ellos las
Origen,
clulas inmunes
desarrollo y
maduras son
maduracin de
activadas por los
las clulas del
antgenos
sistema inmune

Mdula sea Timo Adenoides, Ganglios


amgdalas y linfticos
Origen de las Maduracin de placas de y bazo
clulas del los linfocitos T Peyer Activacin de los
sistema
Activacin de los linfocitos T y B
inmunolgico
linfocitos por los
antgenos

Fig. 2 Funcin de los diferentes rganos linfoides del sistema inmunitario.

DEFENSAS DEL ORGANISMO FRENTE A LA INFECCIN

Mecanismos de
defensa

Mecanismos Mecanismos
Innatos adquiridos

Mecanismos Mecanismos
Innatos externos Innatos internos

Barreras fsicas Clulas fagocitarias:


Celulares: linfocitos
Barreras qumicas - Neutrfilo (pus)
Moleculares: anticuerpos
Flora autctona - Macrfago
Clulas asesinas
Interfern
Complemento

Fig. 3 Defensas del organismo.

J. L. Snchez Guilln Pgina V-1-2


V) Inmunologa 1) Inmunologa

DEFENSAS INESPECFICAS O MECANISMOS INNATOS.

Estn presentes en el organismo de forma natural y se definen como el conjunto de


mecanismos que tienden a evitar la invasin de los microorganismos. Son de dos
tipos: unos impiden la entrada del agente invasor y otros lo combate una vez que ha
penetrado.

MECANISMOS INNATOS EXTERNOS:

* Barreras fsicas.

La piel en los animales, que gracias a la capa de queratina, que sufre continuas
descamaciones, evita que penetren o proliferen colonias de microorganismos. As,
slo los espirilos con su efecto de barrena pueden atravesar las mucosas.

* Barreras qumicas.

- Los orificios naturales estn tapizados por mucosas que segregan mucus con la
finalidad de englobar partculas extraas para su expulsin. El moco posee adems
sustancias que engaan a ciertos virus, hacindoles creer que ya han penetrado dentro
de la clula, el virus suelta su cido nucleico que se pierde en el exterior.

- Tambin, la presencia de fluidos en ciertas zonas, por ejemplo: las lgrimas, en los
ojos o la saliva en la boca, que lavan y arrastran los microorganismos impidiendo que
se instalen o que penetren. Adems, estos fluidos contienen sustancias antimicro-
bianas; por ejemplo: la saliva contiene lisozima, el semen, espermina, etc. Como
curiosidad se puede decir que las infecciones oculares son ms frecuentes en los
hombres que en las mujeres.

- Las secreciones de sustancias que modifican el pH dificultan la supervivencia de los


grmenes. Un ejemplo es el HCl del estmago que no tiene una funcin digestiva sino
antimicrobiana o la secrecin de cidos grasos en la piel o de cido lctico.

* Flora autctona.

Los microorganismos presentes de una manera natural en ciertas partes de nuestro


organismo, por ejemplo, las bacterias que forman la flora intestinal, impiden que otros
se instalen, segregando sustancias o estableciendo competencia por los nutrientes.

MECANISMOS INNATOS INTERNOS

En caso de que el agente extrao logre


salvar los anteriores obstculos intervienen
respuestas tanto celulares como acelulares.

Clulas asesinas naturales (Natural Killer -


NK). Son clulas linfoides que se parecen
a los linfocitos y que provocan la muerte
de los microorganismos, clulas infectadas,
clulas tumorales o clulas ajenas. No se Clula Natural killer Clula atacada

sabe cmo las reconocen. Las destruyen


unindose a ellas y fabricando " perforina" Fig. 4 Actuacin de las clulas NK.
una protena que, como su propio

J. L. Snchez Guilln Pgina V-1-3


V) Inmunologa 1) Inmunologa

nombre indica, crea agujeros en la membrana de las clulas atacadas matndolas.


Son pues clulas citolticas.

Interfern. Son molculas de naturaleza proteica segregadas por las clulas


infectadas por virus, que captadas por las clulas adyacentes, las estimulan a
sintetizar enzimas antivirales evitando la proliferacin viral, inhibiendo la replicacin
del genoma vrico, inhibiendo la sntesis de protenas o activando a las clulas NK
para destruir a las clulas infectadas.

El Complemento. Formado por complejos macromoleculares de protenas que se


sintetizan en el hgado y circulan por la sangre donde constituyen un 15% de la
fraccin de inmunoglobulina del suero. Consta de un conjunto de molculas
plasmticas implicadas en una danza bioqumica coordinada, cuya funcin es
potenciar la respuesta inflamatoria, facilitar la fagocitosis y dirigir la lisis de clulas,
incluyendo la apoptosis (el suicidio celular). Cuando se activa alguno de sus
componentes por diversas sustancias como polisacridos o anticuerpos, se originan
una serie de reacciones en cadena. El complemento es uno de los componentes
fundamentales de la respuesta inmunitaria en la defensa ante un agente hostil.

La respuesta inflamatoria es parte de la inmunidad innata y se presenta cuando los


tejidos son lesionados por bacterias, traumas, toxinas, calor o cualquier otra causa.
Las sustancias qumicas, incluyendo la histamina, bradiquinina, serotonina y otras,
son liberadas por el tejido daado y hacen que los vasos sanguneos derramen
lquido en los tejidos, lo que deriva en una inflamacin localizada. Esto ayuda a
delimitar y aislar la sustancia extraa del contacto con otros tejidos corporales.

Clulas responsables de
la inmunidad innata

Macrfago Clulas natural Neutrfilo


asesinas (natural
killer)

-Fagocitosis. Fagocitosis y
Citotxicas.
-Activacin de los eliminacin de
linfocitos T microorganismos.

Fig. 5 Clulas responsables de la inmunidad innata interna.

DEFENSAS ESPECFICAS O MECANISMOS ADQUIRIDOS.

A lo largo del proceso evolutivo muchos microorganismos se han hecho parsitos


celulares, incluso de las clulas que nos defienden de ellos, los macrfagos. En estas
circunstancias, la respuesta innata no es eficaz. Es por esto que se han desarrollado

J. L. Snchez Guilln Pgina V-1-4


V) Inmunologa 1) Inmunologa

defensas especficas contra ellos. Estas defensas las lleva a cabo el Sistema
Inmunitario y al contrario que los mecanismos inespecficos, que siempre estn
presentes, nicamente se desarrollan como respuesta a la invasin por un agente
extrao concreto. Estas respuestas son celulares: linfocitos y humorales: anticuerpos.

La caracterstica de este sistema es que nos defiende especficamente de parsitos,


rganos trasplantados, clulas cancerosas, microorganismos y sustancias txicas
fabricadas por ellos.

Los individuos nacen con un sistema inmunolgico capaz de responder ante lo propio
y lo ajeno. Durante las primeras fases del desarrollo este sistema "aprende" a
reconocer lo propio y esta capacidad se denomina tolerancia inmunolgica, cuando
esta tolerancia se pierde aparecen las enfermedades autoinmunes. En ocasiones
pueden producirse reacciones de hipersensibilidad: alergias, que son respuestas del
sistema inmunitario a sustancias que en principio son inocuas (por ejemplo: el polen).

Las clulas y las sustancias que se comportan como extraas para el organismo y
contra las cuales ste desarrolla una respuesta inmune especfica se llaman
antgenos. Casi cualquier macromolcula (protena o polisacrido, ms concretamente)
con masa molecular de 5000 da o ms puede desencadenar la respuesta inmunitaria,
siempre que sea extraa al receptor.

Los ndulos linfticos sirven como filtro de la circulacin a los microbios, partculas
extraas, restos tisulares y clulas muertas. Contienen linfocitos y macrfagos y es en
su interior donde ocurren las interacciones responsables de la respuesta inmune.

LAS CLULAS DEL SISTEMA INMUNITARIO ADQUIRIDO

1) Los linfocitos Son clulas sanguneas que se desarrollan a partir de las clulas
madres hematopoyticas, presentes en la mdula roja de ciertos huesos, clulas
pluripotenciales que dan lugar a todos los tipos de clulas sanguneas: glbulos rojos
(heritrocitos), glbulos blancos (leucocitos) y plaquetas.

Los lifocitos, uno de los tipos de leucocitos,


son los responsables de la especificidad
inmunitaria. Se encuentran en grandes
cantidades en la sangre, linfa y rganos
linfoides (timo, ndulos linfticos, bazo y
apndice). Hay varios tipos:

* Los linfocitos B. Llamados as por madurar


en el bazo. Se piensa que cada individuo
tiene del orden de 100 000 000 de linfocitos
B diferentes capaces cada uno de producir un
anticuerpo distinto. A lo largo del proceso de
respuesta inmunitaria, por la actuacin tanto
de los macrfagos como de los linfocitos T Fig. 6 Linfocito T (microscopio de barrido).
ayudadores, se van a ir transformando en:

Linfocitos B --->Linfoblastos B --->Clulas plasmticas--->Clulas plasmticas de memoria

Las clulas plasmticas son las clulas productoras de anticuerpos y responsables por
lo tanto de la respuesta humoral.

J. L. Snchez Guilln Pgina V-1-5


V) Inmunologa 1) Inmunologa

* Linfocitos T. Llamados as por madurar en


el timo. Existen varios tipos que llevan a Receptores T

cabo distintas funciones. As:

a) Los linfocitos T ayudadores que se Molculas


sealizadoras
Lifoblasto T
caracterizan por tener en su membrana unas Linfocito T
ayudador
ayudador

molculas, glicoprote nas, llamadas re-


ceptores T. Estos interaccionarn con las
clulas presetadoras de antgeno (ma- Linfocito T Macrfago u otra

crfagos y otras) producindose, igual que


ayudador clula presentadora
del antgeno

ocurra con los linfocitos B, una serie de


transformaciones: Fig. 7 La interaccin entre un macrfago y
un linfocitos T ayudador, trasforma a este en
linfoblasto T productor de molculas
sealizadoras.
Linfocitos T ayudadores -----> Linfoblastos T
ayudadores---> Linfoblasto T de memoria

Los linfoblastos T ayudadores son las clulas que producirn las molculas sealiza-
doras que desencadenarn la transformacin de los linfoblastos B en clulas plasm-
ticas productoras de anticuerpos.

b) Linfocitos T DTA que tienen en su membrana el llamado Complejo mayor de


histocompatibilidad (HLA-II). Al interaccionar con los macrfagos infectados que lleven
el mismo HLA-II se transformarn en linfoblastos TCDA. Los linfoblastos TCDA
producirn sustancias qumicas capaces de trasformar los macrfagos en clulas
enfadadas, clulas de gran capacidad fagocitaria.

Linfocito TCDA (HLA II) <- --Interaccin-------> Macrfago (HLA II)


Linfocito TCDA (HLA II) ------pasa a---> Linfoblasto TCDA (HLA II)
Macrfago (HLA II) ----------> Clula enfadada

c) Los lifocitos T citotxicos que expresan en su membrana el CMH (HLA I). Estos
linfocitos, al interaccionar con un macrfago (HLA-I) infectado, desencadenarn las
siguientes transformaciones:

Macrfago HLA-I <- --Interaccin-----> Linfocito T citotxico


Linfocito T citotxico ----pasa a ----> Linfoblasto T citotxico

Los linfoblastos T citotxicos son capaces de destruir virus y clulas tumorales.


Estas ltimas son destruidas por la secrecin de molculas que las perforan
vacindose su contenido.

2) Los macrfagos: Los macrfagos son CMH


Antgeno

clulas que se desplazan con movimiento


ameboide entre las clulas de los tejidos Virus

fagocitando a los microorganismos,


degradndolos y exponiendo molculas del
microorganismo o fragmentos de estas en su
superficie unidas a unas molculas glicopro- Macrfago fagocitando
un virus
Macrfago presentador
del antgeno.

teicas presentes en la membrana de todas


las clulas denominadas molculas del Fig. 8 Macrfago fagocitando un virus y
Complejo Mayor de Histocompatibilidad presentando los antgenos unidos al CTM
(complejo mayor de histocompatibilidad).
(CMT). Es as como los linfocitos T pueden

J. L. Snchez Guilln Pgina V-1-6


V) Inmunologa 1) Inmunologa

reconocer que un agente extrao ha penetrado en el organismo. Las clulas


presentadoras de ant geno pueden ser macrfagos u otras clulas del organismo.

As pues, puede decirse que el sistema inmunitario slo reconoce lo


"ajeno" si es presentado por lo "propio".

LOS ANTICUERPOS. ESTRUCTURA DE LOS Cadena pesada (H)

ANTICUERPOS. Cadena ligera (L)

Zona bisagra

Los anticuerpos (Ac) o inmunoglobulinas


son prote nas globulares que participan en
la defensa contra bacterias y parsitos
mayores. Circulan por la sangre y penetran
en los fluidos corporales donde se unen
espec ficamente al antgeno que provoc Glcido Glcido
su formacin
Parte variable
Son prtidos, glucoprotenas (gamma glo- Parte constante

bulinas). Son molculas formadas por una o Enlaces disulfuro

varias unidades estructurales bsicas, segn


Fig. 9 Unidad estructural bsica de un
el tipo de anticuerpo. Cada unidad esta for-
anticuerpo.
mada por cuatro cadenas polipptidicas
iguales dos a dos. Dos cadenas pesadas (H)
y dos ligeras (L) y una cadena glucdica
unida a cada una las cadenas pesadas. Las
uniones entre las subunidades proteicas se
establecen por puentes disulfuro.

Tanto en las cadenas ligeras como en las


cadenas pesadas hay dos porciones, la
porcin variable (en gris en la figura) dife-
rente en cada anticuerpo y la porcin
constante (en blanco).

La porcin variable es la encargada de


reconocer al antgeno y de unirse a l. Al
haber tantos tipos de antge nos, debe de
haber tambin muchos tipos de anticuerpos
que se distinguirn por su regin variable. Fig. 10 Modelo molecular de la unidad
Es por esto que esta regin debe de tener estructural bsica de un anticuerpo.
una gran posibilidad de variacin.

La regin constante tiene funcin estructural y tiene menos variacin, aunque hay
nueve tipos de regiones constantes distintas. De la regin constante va a depender,
en cierto modo, la localizacin del anticuerpo. As, segn la regin constante que
tengan unos van a localizarse en la saliva, otros pueden pasar la placenta, etc. La
regin constante es tambin la parte que desencadena la respuesta celular. As, los
anticuerpos se unen a los microorganismos por su parte variable, esto hace cambiar
la regin constante y este cambio es detectado por los macrfagos que fagocitarn
aquello que lleve anticuerpos pegados, por lo que los anticuerpos libres en la sangre
no desencadenarn la respuesta celular.

Los anticuerpos tienen adems una zona bisagra. Esta zona es de gran importancia

J. L. Snchez Guilln Pgina V-1-7


V) Inmunologa 1) Inmunologa

pues debido a ella se pueden adaptar mejor y unirse mejor al antgeno. Ahora bien,
al tener en ambos extremos regiones variables va a poder unirse a dos antgenos
diferentes.

Tipos de anticuerpos

Hay cinco tipos: Ig M, Ig G, Ig A, Ig D e Ig E . Se diferencian en estructura, mo-


mento de la infeccin en el que aparecen, actividad y lugar donde se encuentran
(sangre, leche, saliva, etc.)

Los de tipo M (Ig M) son los primeros que


se producen frente a una infeccin. No tienen
regiones bisagra, por lo que no se adaptan bien
al antgeno. Ahora bien, al ser tan grandes y
tener tantos puntos de unin, si no se unen
por una parte, se unir por otra y por eso son Cadena J
eficaces. Aparecen tambin en la superficie de
los linfocitos T como "antenas" para recibir los
anticuerpos.

Los de tipo G (Ig G) se generan despus. Al


tener regiones bisagra protegen ms eficaz-
Fig. 11 Anticuerpo Ig M, anticuerpos de
mente que los de tipo M. Pueden atravesar la
baja afinidad. Son los primeros que aparecen
placenta y proteger al feto de las infecciones
despus de la infeccin.
pues los fetos no tienen sistema inmunitario
especfico, si lo tienen innato. La presencia de
anticuerpos G indica que la infeccin es un Componente
proceso antiguo. secretor

Tipo A (Ig A): Aparecen despus de los M.


Son de alta afinidad. No se encuentran en gran
cantidad en el suero pero s en las secrecio-
nes, saliva y moco, pues atraviesan las mu-
Cadena J
cosas. Pueden tambin pasar a la leche y
proteger a los lactantes. La pieza secretora y la
especial configuracin que pueden adoptar los Fig. 12 Anticuerpo Ig A de alta afinidad,
protege y evita que sean degradados en ciertas aparecen en las secreciones como la saliva o
zonas, como en el intestino, donde existen el moco.
proteasas que podran destruirlos.

Tipo D (Ig D): Sustituyen a los M. Tienen la misma funcin que estos pero tienen ms
afinidad y se unen ms fuertemente. Aparecen tambin como antenas en la superficie de los
linfocitos B cuando estos contactan con el antgeno.

Tipo E (Ig E): Son de alta afinidad. Tienen tambin la capacidad de salir a las secreciones.
Tienen mala fama, pues median en los procesos alrgicos y de anafilaxis (alergia a huevos,
mariscos, polen...). Su funcin es la de eliminar parsitos, sobre todo gusanos. Promueven
la accin de los mastocitos y de los eosinfilos que producen protenas que vacan a los
gusanos. Es de destacar que las infestaciones por protozoos y gusanos son ms corrientes
que las infecciones bacterianas.

J. L. Snchez Guilln Pgina V-1-8


V) Inmunologa 1) Inmunologa

LA RESPUESTA INMUNITARIA ADQUIRIDA

Los organismos que desarrollan inmunidad adquirida van a reaccionar


desencadenando dos tipos de respuesta:

La respuesta inmunitaria humoral: El objetivo de esta respuesta es la produccin de


anticuerpos por las clulas plasmticas. Estos se fijarn a los organismos y molculas
extraas con capacidad antignica provocando una serie de reacciones que
conducirn a la destruccin de los agentes extraos, que sern fagocitados por los
macrfagos fundamentalmente. Esta respuesta se dirige sobre todo a los agentes
extraos, virus, por ejemplo, que salen de las clulas infectadas para infectar nuevas
clulas.

La respuesta inmunitaria celular: La respuesta humoral es poco eficaz si lo que se


trata es de destruir a los agentes extraos que estn en el interior de las clulas del
propio organismo. La respuesta celular va dirigida a destruir estas clulas infectadas
y a evitar que los agentes extraos puedan seguir reproduciendose en ellas.

Ambas respuestas actan coordinadamente contra los agentes patgenos circulan-


tes, los que se encuentran en el interior de las clulas y las toxinas producidas por
ellos.

La respuesta
inmunitaria

Humoral Celular

Objetivo:
produccin de Dirigida a destruir
anticuerpos por las clulas
las clulas infectadas para
plasmticas. evitar que puedan
seguir generando
nuevos agentes
infecciosos.
Dirigida a agentes
extraos, virus,
por ejemplo, que
salen de las
clulas infectadas
para infectar otras
clulas.

Fig. 13 La respuesta inmunitaria adquirida.

J. L. Snchez Guilln Pgina V-1-9


V) Inmunologa 1) Inmunologa

LA RESPUESTA INMUNITARIA I (La respuesta humoral)

1) La respuesta humoral comienza cuando un CMH Antgeno

macrfago o una clula emparentada fagocita a un


microorganismo y lo degrada, presentando partculas Virus

del microorganismo o ant genos en la superficie de su


membrana unidos al CMH (complejo mayor de
histocompatibilidad). El macrfago producir unas sus-
Macrfago
tancias qumicas llamadas interleucinas. fagocitando un virus Macrfago presentador
del antgeno.

Interleucinas
2) Si un linfocito B que lleve en su membrana un
Antgeno Ig-M
anticuerpo (Ig-M) que se pueda acoplar al antge no del
macrfago establece contacto con este, las interleuci-
nas, lo transformarn en linfoblasto B que se divide
activamente y en poco tiempo alcanza un elevado
nmero.

Macrfago presentador del Linfoblasto


Linfocito BBespecfico
especfico
antgeno.

Interleucinas Receptor de
3) Lo mismo sucede con los linfocitos T ayudadores Antgeno la clula T

(helpers). En contacto con el macrfago y por accin


de las interleucinas se transforman en linfoblastos T
ayudadores que se dividen tambin activamente y
producen molculas sealizadoras (citoquininas).

Macrfago presentador del Linfocito t (ayudador)


Linfoblasto T (ayudador)
antgeno.

Molculas Anticuerpos tipo A


4) Estas molculas transforman los lifoblastos B en sealizadoras Ig-A

clulas plasmticas, mayores y con gran cantidad de


retculo endoplasmtico granular. Estas, al principio,
producen anticuerpos M (Ig-M). Pero si contina la
Linfoblasto T
accin de las molculas sealizadoras, empiezan a pro- ayudador

ducir anticuerpos A (Ig-A) mucho ms activos.

Clula plasmtica

5) Estos anticuerpos se fijan al agente extrao (un Anticuerpos Virus

Macrfago
Macrfago
virus, en este caso) de manera especfi ca y lo marcan fagocitando los virus

para que pueda ser localizado, identificado y fagocitado


por los macrfagos y otras clulas fagocitarias.

Clula plasmtica

Despus de haber destrudo al microorganismo los linfoblastos T ayudadores y las clulas plasmticas
desaparecen, pero algunas clulas, clulas B de memoria y linfoblastos T de memoria, permanecen durante largo
tiempo para responder de inmediato a futuras entradas del agente invasor (memoria inmunolgica).

J. L. Snchez Guilln Pgina V-1-10


V) Inmunologa 1) Inmunologa

LA RESPUESTA INMUNITARIA II (La respuesta celular)

1a) La respuesta celular presenta dos vas


Antgeno Ig-M
diferentes. La primera comienza, como la
respuesta humoral, cuando un macrfago
infectado exhibe fragmentos vricos u otro
tipo de antgeno en su superficie que son
reconocidos por los linfocitos T DTA.

Esta interaccin transforma a los lifocitos T


DTA en linfoblastos T DTA. Macrfago presentador del Linfoblasto T DTA
Linfocito T DTA
antgeno.

2a) Los linfoblastos T DTA actan sobre los


Clula infectada
macrfagos activndolos y trasformndolos
en clulas enfadadas. Estas clulas tienen
una gran capacidad fagocitaria y son
refractarias al parsito intracelular no
infectndose por el microorganismo.

Clula enfadada Virus

1b) Una segunda va celular parte de los Ig-M


Antgeno
linfocitos T citotxicos. Estos, al inte-
raccionar con un macrfago que presente
los antgenos unidos al CMH, se trans-
forman en linfoblastos T citotxicos

Macrfago presentador del Linfocito T citotxico


antgeno. Linfoblasto T citotxico

2b) Los linfoblastos T citotxicos son capa-


ces de destruir a clulas infectadas por el vi-
rus y a clulas tumorales, mediante la
produccin de protenas que se instalan en
las membranas produciendo agujeros en
ellas.

Lifoblasto T citotxico Clula infectada o tumoral

Despus de haber destru do las clulas infectadas, las clulas citot xicas desaparencen, pero algunas clulas
citotxicas de memoria permanecen durante ms o menos tiempo para responder de inmediato a futu ras
entradas del microorganismo invasor (memoria inmunolgica).

J. L. Snchez Guilln Pgina V-1-11


V) Inmunologa 1) Inmunologa

La respuesta
humoral

Macrfago
(fagocitan a los patgenos)
Interleucinas
Interleucinas

Linfocito B Linfocito T ayudador

Linfoblasto B Molculas Linfoblasto T ayudador


sealizadoras

Linfoblasto T ayudador
Anticuerpos de memoria
Clula plasmtica

Se unen a los
Clula plasmtica de patgenos. Los
memoria macrfagos los
fagocitan

Fig. 14 La respuesta inmunitaria humoral.

La respuesta
celular

Macrfago
(fagocitan a los patgenos)
Activacin
Activacin

Linfocito T DTA Linfocito T citotxico

Linfoblasto T DTA Linfoblasto T citotxico

Clula enfadada Destruccin de


clulas infectadas o
tumorales

Clula enfadada de Fagocitosis de Clula citotxica de


memoria clulas infectadas memoria

Fig. 15 La respuesta inmunitaria celular.

J. L. Snchez Guilln Pgina V-1-12


V) Inmunologa 1) Inmunologa

LA ESPECIFICIDAD ANTIGNICA Y SELECCIN CLONAL

El Sistema Inmunitario puede distinguir


antgenos muy similares entre s, por ejem-
plo dos protenas que nicamente se dife-
rencien en un aminocido.

Por lo tanto el Sistema Inmunitario puede


responder a millones de antgenos extraos
diferentes de una manera altamente espe-
cfica mediante la produccin de anticuer-
pos que reaccionan slo con el antge no
que ha inducido su formacin.

)Cmo puede ser que teniendo slo unas


decenas de miles de genes en nuestras clu-
las podamos generar hasta 100.000 .000
anticuerpos diferentes?

Esto es debido a que durante el desarrollo,


cuando se generan los lifocitos B, se pro-
ducen combinaciones y recombinaciones
entre los genes que producen los protme-
ros que forman los anticuerpos. De esta
manera se generan hasta 100.000.000 de
lifocitos B diferentes, cada uno de estos Fig. 16 Especificidad antignica y seleccin
linfocito B tiene en su superficie celular clonal.
unos receptores que se adaptan espec fica-
mente a un antge no distinto.

Posteriormente, si un antgeno se une a uno de estos receptores, el linfocito se


activa y se reproduce produciendo un clon de clulas que tendrn todas ellas la
misma especificidad antignica (Teora de la seleccin clonal). Es decir, la llegada de
un antge no extrao estimula selectivamente a aquellas clulas que presentan unos
receptores complementarios y especfi cos del antgeno y por consiguiente listas
para dar una respuesta al mismo.

LA REACCIN ANT GENO ANTICUERPO

Las zonas del antgeno que se unen especfi camente con el anticuerpo o con el
receptor de un linfocito, se denominan determinantes antignicos. Cada antgeno
puede presentar varios determinantes antignicos diferentes que estimulan la
produccin de anticuerpos y la repuesta de los linfocitos. Estas estructuras qumi -
cas, los determinantes antignicos, son los responsables de la especificidad de la
respuesta inmunitaria.

Al entrar en contacto antgeno y anticuerpo se unen mediante enlaces no covalen-


tes (F. Van der Waals, Uniones hidrofbicas, E. hidrgeno) y se desencadenan una
serie de procesos capaces de neutralizarlo y eliminarlo. La unin entre ellos es

J. L. Snchez Guilln Pgina V-1-13


V) Inmunologa 1) Inmunologa

reversible, depende de sus concentraciones y tambin de la afinidad, cuanto mayor


sea sta, ms proporcin de molculas estarn unidas. Las reacciones ms
importantes entre antgeno y anticuerpo son las siguientes:

Precipitacin: Al unirse ant genos y anticuer- Antgeno

pos solubles forman agregados insolubles


que precipitan, lo que inacti va a los antge -
nos.

Anticuerpo

Precipitado

Aglutinacin: El anticuerpo se une a ant ge-


nos situados en la superficie de una clula. Microorganismo Anticuerpo

Como los anticuerpos tienen dos puntos de


unin, los microorganismos forman agrega-
Aglutinado
dos y ya no pueden infectar otras las clu-
las.

Neutralizacin: Anti cuerpos situados en la Antgenos


Antgenos
membrana plasmtica bloquean la accin de
los ant genos contra la clula. As, los
ant ge nos no se pueden unir a las clulas y
Anticuerpos
matarlas.

Clula protegida Clula no protegida (muere)

Opsonizacin: Consiste en la fagocitosis de


los aglutinados de patgenos, de las clulas
infectadas o de las clulas tumorales por los
macrfagos, que son atrados por la
presencia de anticuerpos especficos que se
han unido a sus antgenos.

Clula fagocitaria Aglutinado


de virus

La unin antgeno-anticuerpo no es suficiente para la eliminacin del agente extrao contra el que luchamos. Se
precisa la colaboracin de otros elementos (complemento, clulas fagocitarias y clulas NK). El conglomerado
antgeno-anticuerpo puede as ser fagocitado por las clulas del Sistema Retculo Endotelial (S.R.E.) o por las
Natural Killer. Las molculas del Complemento, al unirse al complejo formado por antgenos y anticuerpos, pueden
estimular la fagocitosis por parte de los macrfagos.

J. L. Snchez Guilln Pgina V-1-14


V) Inmunologa 1) Inmunologa

INMUNOESTIMULACIN: VACUNAS Y SUEROS

Aunque el Sistema Inmunitario est capacitado para combatir y eliminar clulas o


molculas ajenas, las enfermedades infecciosas siguen siendo una de las principales
causas de mortalidad, sobre todo en pases subdesarrollados. En los ms
industrializados se est produciendo un aumento de enfermedades que se crean
controladas como la tuberculosis, o la aparicin de otras como el SIDA. Es pues
una preocupacin actual la prevencin de las enfermedades.

Denominamos profilaxis al conjunto de medidas tomadas para prevenir la


enfermedad.

Los mecanismos para conseguir inmunidad los podemos resumir en:

a) Inmunidad inespecfica o resistencia natural.

La resistencia natural tiene una gran importancia para la proteccin del individuo que
se encuentra en un sistema ecolgico donde la agresin biolgica es constante, pero
sin un desarrollo de la inmunidad adquirida no habra supervivencia.

Puede darse por ausencia de receptores en las clulas que faciliten la entrada del
microorganismo. As, por ejemplo la especie humana y el resto de los primates son
infectados por poliovirus porque en sus membranas tienen receptores que permiten
la fijacin de estos virus, en cambio los poliovirus no afectan a los conejos que no
presentan tales receptores en sus clulas.

b) La inmunidad adquirida activa.

- Espontnea: Cuando el propio sujeto desarrolla la respuesta frente a antgenos


concretos al estar en contacto con el agente, aunque el individuo no presente
sntomas de la enfermedad.

- Artificial: Como la que se adquiere con la vacunacin.

c) Inmunidad adquirida pasiva.

Se consigue cuando hay transferencia de anticuerpos fabricados activamente por


otro individuo. Puede ser:

- Espontnea: Cuando el paso de anticuerpos es de la madre al feto a travs de la


placenta o por absorcin de la leche materna en los primeros das de lactancia.

- Artificial: La inmunidad adquirida pasiva se denomina artificial cuando los


anticuerpos se administran en preparados biolgicos, como en el caso de los sueros.

J. L. Snchez Guilln Pgina V-1-15


V) Inmunologa 1) Inmunologa

VACUNAS

Son preparados antignicos constituidos por microorganismos no virulentos, muertos


o por molculas de estos desprovistas de toxicidad. Se obtienen a partir de
microorganismos u otros agentes infecciosos e inducen en el individuo una
inmunidad adquirida activa frente a esos agentes inoculados, con un mnimo de
riesgos y de reacciones locales y generales. Su objetivo es desencadenar la
produccin de clulas inmunitarias de memoria.

Las vacunas deben tener dos propiedades:

- Eficacia, pues tienen que desencadenar la respuesta inmune correcta.

- Inocuidad, la vacuna debe estar desprovista de poder patgeno, logrando este


objetivo sin interferir en la respuesta inmune.

SUEROS

Mediante los sueros se consigue una inmunidad inmediata ya que los preparados
biolgicos que inoculamos contienen los anticuerpos especficos que la urgencia
precisa. Es una intervencin rpida menos duradera e intensa que la provocada por
la vacunacin.

El paciente no participa en la elaboracin de molculas, es por tanto una inmunidad


adquirida pasiva.

Existen dos tipos de sueros:

- Sueros homlogos: Son sueros obtenidos de humanos que poseen anticuerpos para
un determinado antgeno.

- Sueros heterlogos: Proceden de otras especies pero contienen anticuerpos para


patgenos humanos. De esta manera se obtiene, por ejemplo, las antitoxinas, que
son sueros frente al veneno de las serpientes, escorpiones, araas, etc.

SEROVACUNACIN

Conjunto de medidas preventivas que combinan la vacunacin con los tratamientos


con sueros adecuados.

Este procedimiento combina la administracin del suero preciso con la vacunacin.


El suero contiene anticuerpos que actan en los primeros momentos de urgencia y,
posteriormente, se desencadena la inmunidad activa producida por la vacuna. Se
emplea, por ejemplo, en el tratamiento del ttanos, del botulismo y de la rabia.

J. L. Snchez Guilln Pgina V-1-16


V) Inmunologa 1) Inmunologa

INMUNOPATOLOGA

Descripcin del concepto de enfermedad autoinmune y algunos tipos de ellas.

Las clulas del sistema inmunitario linfocitos, macrfagos y otras han de aprender a
tolerar cada clula y cada protena del organismo sin dejar de atacar por ello a los
invasores externos.

No obstante, se puede dar el caso de que algunos linfocitos inmaduros respondan


ante elementos del propio cuerpo. Ahora bien, normalmente, si una clula inmunitaria
reacciona ante un producto del propio organismo mientras se est formando en el
timo o en la mdula sea, suele ser destruida o, al menos, inactivada por el propio
organismo. Sin embargo, a pesar de este mecanismo de seguridad, algunos
linfocitos pueden escapar a la inactivacin o destruccin y desencadenar una
respuesta inmunitaria contra molculas o clulas del propio organismo generndose
una enfermedad autoinmunitaria.

Las enfermedades de autoinmunidad pueden afectar a cualquier rgano, si bien


algunos se ven afectados con ms frecuencia que otros; por ejemplo: la sustancia
blanca del cerebro y de la mdula espinal, en la esclerosis mltiple, los
revestimientos de las articulaciones, en la artritis reumatoide, las clulas secretoras
de insulina, en la diabetes mellitus juvenil. Ciertas enfermedades autoinmunes
destruyen las conexiones entre nervios y msculo (miastenia gravis) y otras
producen un exceso de hormona tiroidea en la glndula tiroides (enfermedad de
Graves). Las hay que producen ampollas en la piel (pnfigo vulgar) o que destruyen
los riones y otros rganos (lupus eritematoso sistmico).

Fenmenos de hipersensibilidad: alergias.

La respuesta alrgica es una intensa reaccin de ciertos componentes del sistema


inmunitario contra una sustancia extraa que por lo general es inofensiva.

Nota: )Por qu la seleccin natural ha permitido que la alergia se haya extendido tanto? Se sabe
que ciertos rasgos de la alergia solo vuelven a darse cuando el sistema inmunitario intenta erradicar
parsitos. As, el cuerpo sintetiza cantidades elevadas de anticuerpos de tipo IgE tanto ante la
presencia de alrgenos como ante la de parsitos. Frente a otro tipo de invasores recurre a otro tipo
de anticuerpos.

Una hiptesis podra ser que el cuerpo desarroll en su origen la respuesta alrgica para hacer
frente a los parsitos. Las personas capacitadas por su dotacin gentica para organizar un ataque
inmunitario eficaz contra esos organismos sobreviviran mejor que quienes carecieran de ese
mecanismo defensivo, habran tenido mayor descendencia y sus hijos habran transmitido a su vez
a los suyos esos genes. As se extendera entre la poblacin humana el sistema de defensa contra
los parsitos. Esta capacidad de defensa ha permanecido til all donde abundan los parsitos. Sin
embargo, el sistema inmunitario de quienes ya no se encuentran con esos organismos reacciona
ahora libremente -aunque de forma contraproducente- ante otras sustancias como el polen. En
respaldo de esta tesis se ha observado que la alergia es menos comn en las naciones en vas de
desarrollo que en las industrializadas pero la investigacin realizada en animales de experimentacin
para someter a prueba la hiptesis no ha resuelto nada.

Se sabe que alrgenos diferentes provocan sntomas dispares, en parte porque


atacan al sistema inmunitario en diferentes puntos del organismo.

J. L. Snchez Guilln Pgina V-1-17


V) Inmunologa 1) Inmunologa

En el tracto respiratorio superior la respuesta inmunitaria errnea produce


estornudos y congestin nasal: rinitis alrgica. En el tracto respiratorio inferior puede
causar constriccin y obstruccin de los bronquios, participando, por lo tanto, en el
desarrollo de sntomas asmticos. En el tracto gastrointestinal la actividad
inmunitaria provoca a veces nauseas, espasmos abdominales, diarrea y vmitos. Por
ltimo, si un alrgeno introducido por cualquier va llega a la circulacin sangunea
puede inducir anafilaxis.

Aunque las manifestaciones externas de la respuesta alrgica varan, sta siempre


se pone en marcha mediante un proceso silencioso de sensibilizacin. Este proceso
empieza cuando los macrfagos (2) degradan el alrgeno (1) y muestran los
fragmentos resultantes a los linfocitos T (3). Estos segregan interleucinas (4) que
hacen que los linfocitos B maduren y se transformen en clulas plasmticas que
secretan inmunoglobulinas (5). Estos anticuerpos se unen a sus receptores en los
mastocitos (6) -glbulos blancos no circulantes que se encuentran en el tejido
conjuntivo- y en los basfilos circulantes en sangre (7).

3 Linfocito T
1 alrgeno

Linfocito B

2 macrfago 5 anticuerpos

4 Molculas
sealizadoras
Vaso
sanguneo

*
*
* * *
7 Basfilos 6 Mastocitos
*
Histamina

Fig. 17 La respuesta alrgica.

En posteriores contactos entre el alrgeno y el organismo las molculas de alrgeno


se unen a anticuerpos IgE de los mastocitos con lo que se desencadenan una serie
de reacciones que llevan a la secrecin por parte de los mastocitos de histamina y
otras sustancias que sern los responsables de muchos sntomas alrgicos.

J. L. Snchez Guilln Pgina V-1-18


V) Inmunologa 1) Inmunologa

El cncer y la respuesta inmunitaria.

Las clulas cancergenas se parecen a las clulas normales del cuerpo en muchos
aspectos. An as, actan como clulas extraas, reproducindose rpidamente e
invadiendo los tejidos. Adems, las clulas cancergenas tienen antgenos en su
superficie celular que difieren de los antgenos de las clulas normales y pueden ser
identificadas como extraas por lo que, quizs, el organismo pueda organizar una
respuesta inmunitaria.

Cada vez hay ms pruebas que indican que el cncer no slo puede inducir una
respuesta inmunitaria sino que es un hecho que sta se podra producir de modo
que las clulas cancergenas fuesen suprimidas mucho antes de que se detecte el
cncer. Los cnceres que se desarrollan representaran fallos ocasionales del
sistema inmunitario. Por lo tanto, si se refuerza la respuesta inmunitaria, se podr
avanzar en el proceso de lucha contra el cncer.

El S.I.D.A y sus efectos en el sistema inmune.

Estructura del V.I.H.

El virus del S.l.D.A. 1 es un retrovirus,


conocido como virus de la inmunodeficiencia
a
humana (VIH). Est constituido por dos
molculas de RNA acompaadas de dos o
ms molculas del enzima retrotranscriptasa
b
(o transcriptasa inversa). Rodeando a la
zona central hay dos envolturas proteni cas
distintas que, a su vez, estn rodeadas por
una bicapa lipdi ca con glucoprotenas c
d
insertas. Las porciones proteni cas de las
molculas superficiales contienen regiones Fig. 18 Virus del S.I.D.A.: a) envoltura
constantes idnticas de una cepa del virus a membranosa; b) cpsida ; c) cido nucleico
otra y regiones variables. (ARN); d) espculas proteicas.

Ciclo del V.I.H.

Cuando el VIH entra en el organismo, las glucoprotenas externas se unen a las

1
Fue identificado por primera vez en 1981 al observar la aparicin en hombres jvenes de un
tumor maligno (Sarcoma de Kaposi) que afecta a los revestimientos endoteliales de los vasos
sanguneos y que hasta entonces slo se haba observado en hombres de edad avanzada.

En la misma poca y tambin en hombres jvenes se detecta un incremento de neumonas e


infecciones fatales del tracto intestinal causadas por protistas ubicuos pero habitualmente inocuos.
Anteriormente estas enfermedades se haban observado en pacientes cancerosos y en receptores de
transplantes cuyos sistemas inmunes haban sido suprimidos. Estos hechos sugeran que la causa era
una supresin masiva del sistema inmune.

Las primeras imgenes del virus al microscopio electrnico se identificaron, en febrero de 1983, en el
Instituto Pasteur de Pars por el profesor Luc Montaigner.

J. L. Snchez Guilln Pgina V-1-19


V) Inmunologa 1) Inmunologa

molculas CD4 de los linfocitos T cooperadores (tambin puede infectar macrfagos),


sin embargo, para entrar en el interior del linfocito necesita fusionarse con la mem-
brana celular (1). En 1996, un equipo de trabajo del Instituto Nacional de Alergias y
Enfermedades Infecciosas de EEUU, encabezado por Edward Berger, identific en la
cara exterior de la membrana de los linfocitos T una protena, a la que
denominaron fusina, que permite la entrada del VIH en la clula2 .

Juntamente con la fusina, estos dos ltimos aos se han descubierto otras
molculas, de funcin similar, que se denominan correceptores3 .

Una vez dentro de la clula, el RNA se libera de la cpsula que lo contiene (2), y
la transcriptasa inversa cataliza la transcripcin inversa sintetizando un ADN
complementario del ARN viral (3 y 4). Este ADN se incorpora a un cromosoma de
la clula hospedadora (5), en esta etapa el virus es extremadamente sensible a los
inhibidores de dicha enzima. A continuacin comienza a replicarse (6) originando
nuevas partculas virales que salen del linfocito T (8) e invaden a otros linfocitos u
a otras clulas. Frecuentemente el linfocito T resulta destruido.

1 6a

6b
3

4
7
8

Fig. 19 Infeccin de una clula por el virus del SIDA (ciclo del VIH).

2
La hipottica funcin normal de esta protena se desconoce, se sabe que est formada por 352
aminocidos y que pertenece al grupo de las protenas receptoras G, conocidas como facilitadoras de la
entrada en la clula de los virus y otros agentes patgenos. Se sospecha que los macrfagos tienen una
protena similar.

3
Recientemente se ha visto que. entre los mecanismos que explican la resistencia de algunas
personas probablemente inmunes a la infeccin, existe tambin una causa gentica. Alrededor de un 1%
de la poblacin europea es deficiente para alguno de aquellos correceptores y, por tanto, resistente a la
infeccin por VIH.

J. L. Snchez Guilln Pgina V-1-20


V) Inmunologa 1) Inmunologa

Se sabe que la replicacin del VIH se produce desde las fases muy precoces de la
infeccin y en tasas muy elevadas, por medio de continuados ciclos de infeccin. Si
el seropositivo no enferma hasta transcurrido un tiempo es porque el organismo
dispone de herramientas eficaces para hacerle frente.

En un solo da pueden originarse en una persona infectada del orden de 1000


millones de nuevas partculas vricas, producindose cada 48 a 72 horas la
renovacin de buena parte de los virus circulantes y de los linfocitos infectados.
Esta situacin se amplifica enormemente la variabilidad gentica del virus, la cual se
produce como consecuencia de los errores de copia que tienen lugar durante la
transferencia de informacin desde el ARN viral hasta el ADN. Muchas de las
variantes genticas originadas por mutacin resultan no ser viables, pero algunas s
lo son y llegan a formar un cmulo de variantes que explicara por qu finalmente
el sistema inmunitario acaba por fracasar, ante la imposibilidad de mantener una
lucha contra un enemigo tan inestable.

Algunas de las formas mutantes del virus implican cambios en la estructura de los
pptidos que actan como determinantes antignicos. Aunque muchos de estos
cambios no parecen afectar a la actividad del sistema inmunitario, distintos
investigadores han sugerido que algunos pueden hacer que determinado pptido se
vuelva invisible a las defensas del organismo (mutantes elusivos). Este
encadenamiento de determinantes antignicos variables y mutantes escurridizos
explicara la pervivencia de la infeccin y la dificultad de erradicarla (adems de
complicar la bsqueda de vacunas).

Transmisin del V.I.H.

Los estudios epidemiolgicos realizados en Europa, Amrica, frica y Australia han


documentado de forma reiterada que solamente hay tres formas de transmisin del
V.I.H.

- Por relacin sexual (homosexual, bisexual, heterosexual) con personas


infectadas
- Por contacto con la sangre, hemoderivados, semen y los rganos
transplantados de personas infectadas
- Por transmisin de madre infectada a hijo. La mayor parte de las veces
antes del nacimiento y quizs durante el parto (transmisin perinatal)

Prcticas de riesgo.