Available online at www.sciencedirect.

com
BRAIN,
BEHAVIOR,
and IMMUNITY
Brain, Behavior, and Immunity 22 (2008) 573589
www.elsevier.com/locate/ybrbi

Synergistic and additive actions of a psychosocial stressor

and endotoxin challenge: Circulating and brain cytokines,
plasma corticosterone and behavioral changes in mice
Julie Gibb a, Shawn Hayley a, Reno Gandhi a, Michael O. Poulter b, Hymie Anisman a,*

a
Institute of Neuroscience, Carleton University, LSRB/1125 Colonial By Drive, Ottawa, Ont., Canada K1S 5B6
b
Cell Biology Research Group, Robarts Research Institute, 100 Perth Drive, London, Ontario, Canada N6A 5K8

Received 2 October 2007; received in revised form 28 November 2007; accepted 1 December 2007
Available online 10 January 2008

Abstract

Activation of the inammatory immune response may provoke neuroendocrine and central neurochemical eects that are reminiscent
of those elicited by traditional stressors, and when administered concurrently may have synergistic eects. The present investigation
assessed whether a psychosocial stressor, comprising social disruption, would augment the eects of lipopolysaccharide in mice. It
was indeed observed that the social disruption engendered by a period of 24 weeks of social isolation (but not 17 days of this treat-
ment) followed by regrouping, enhanced the eects of lipopolysaccharide (LPS: 10 lg) in the provocation of sickness behavior, as well as
plasma corticosterone, IL-6, TNF-a and IL-10 levels. Similar eects were not apparent with respect to IL-1b, IL-4, or IFN-c. Synergy
between LPS and other stressors (restraint, tail pinch, and loud noise) was not apparent with respect to sickness or plasma corticosterone,
provisionally suggesting that social stressors, such as regrouping, may be more powerful or may engage unique neural or neuroendocrine
circuits that favour synergistic outcomes. Within the CNS, the LPS and the regrouping stressor synergistically enhanced NE utilization
within the prefrontal cortex, and additively inuenced hippocampal NE utilization. In contrast to the eects on circulating cytokines, the
LPS-induced elevation of IL-1b, IL-6 and TNF-a mRNA expression in the hippocampus, PFC and nucleus tractus solitarius was dimin-
ished in animals that had experienced the regrouping stressor. In view of the combined actions of LPS challenge and a social stressor,
these data are interpreted as suggesting that models of depression based on immune activation ought to consider the stressor backdrop
upon which immune challenges are imposed.
 2007 Elsevier Inc. All rights reserved.

Keywords: Psychosocial stress; LPS; Cytokine; Corticosterone; Sickness; Depression; Mice

1. Introduction Hayley et al., 2005). Among other things, these treatments

Activation of the inammatory immune system has been
implicated in the evolution of depressive- and anxiety-like
states (Anisman and Merali, 2003; Hayley et al., 2005; Rai-
son et al., 2006). In this regard, pro-inammatory cyto-
kines, such as interleukin-1b (IL-1b), elicit behavioral,
neuroendocrine and neurochemical responses reminiscent
of those provoked by traditional stressors as well as those
associated with major depressive illness (Dunn et al., 2005;
*
Corresponding author. Fax: +1613 520 4052.
E-mail address: hanisman@ccs.carleton.ca (H. Anisman).
stimulate hypothalamicpituitaryadrenal (HPA) function-
ing, reected by increased brain corticotropin releasing
hormone (CRH) and circulating glucocorticoid levels,
and increased monoamine turnover in several stressor-sen-
sitive brain regions (Linthorst et al., 1995; Merali et al.,
1997; Schiepers et al., 2005). As well, cytokines promote
anhedonia, a key feature of depression (Anisman and Mer-
ali, 1999; Hayley et al., 2005), and engender sickness behav-
iors (e.g., piloerection, ptosis, anorexia, reduced social and
exploratory behaviors) (Dantzer, 2001; Konsman et al.,
2002) that might reect neurovegetative features of
depression.

0889-1591/$ - see front matter  2007 Elsevier Inc. All rights reserved.
doi:10.1016/j.bbi.2007.12.001
574 J. Gibb et al. / Brain, Behavior, and Immunity 22 (2008) 573589
Like cytokines, the bacterial endotoxin, lipopolysaccha-
ride (LPS), is a potent HPA activator, and elicits marked
sickness behavior (Dantzer, 2001; Dantzer et al., 1998; Yir-
miya, 1996). When LPS is systemically administered, acti-
vation of Toll-like receptor-4 (TLR-4) on immune cells
occurs, provoking the release of IL-1b along with a cascade
of other cytokines, such as IL-6 and TNF-a (Konsman
et al., 2002; Laamme and Rivest, 2001; Rivest, 2003).
These cytokines are thought to inuence central neuronal
processes, thus promoting behavioral changes (Dantzer,
2001; Kelley et al., 2003; Konsman et al., 2002).
The responses to immunogenic stimuli, such as LPS,
appear to be contextually-dependent being appreciably
increased among animals that had been exposed to a psycho-
social stressor (Avitsur et al., 2001, 2005; Carobrez et al.,
2002; Engler et al., 2005; Quan et al., 2001). In this regard,
socially stressed animals exhibited higher IL-1b and TNF-
a mRNA expression in the spleen and brain compared to
non-stressed animals (Quan et al., 2001). It appeared that
social stressors, by engendering a functional glucocorticoid
resistance, might have resulted in failure to inhibit the pro-
duction of pro-inammatory cytokines that might otherwise
have rendered animals susceptible to endotoxic shock (Avit-
sur et al., 2001; Merlot et al., 2004; Quan et al., 2001; Stefan-
ski, 2000). As in the case of LPS, the eects of the viral
imitator, poly I:C, as well as that of interferon-a (IFN-a),
on sickness behavior, plasma corticosterone and brain
monoamine turnover were synergistically increased among
mice that were transferred from isolated to grouped hous-
ing, a treatment that promoted distress related to social dis-
ruption (Anisman et al., 2007a; Gandhi et al., 2007).
In light of the potential additive or interactive eects of
immune activation and a social stressor, the purpose of the
present investigation was two-fold. First, it was of interest
to assess several conditions that might be necessary for the
emergence of additive or synergistic actions of LPS and a
social stressor (induced by regrouping animals for 1 h after
a prolonged period of isolation) on sickness behaviors, cir-
culating corticosterone, and circulating cytokine levels.
Specically, as dierent stressor types may engage dierent
neural circuits (Herman and Cullinan, 1997; Day et al.,
1999; Hayley et al., 2005), we assessed whether the synergy
between LPS and a social stressor, comprising regrouping
mice after a period of isolation, would extend to non-social
stressors (e.g., restraint, tail pinch and loud bursts of
noise). Furthermore, as a distinction has been made con-
cerning the impact of nonphysical vs. physical interaction
that might be fundamental in dominance hierarchies being
established (Bailey et al., 2004; Merlot et al., 2004; Pardon
et al., 2004; Stefanski, 2000), we determined whether phys-
ical contact during regrouping was necessary to elicit the
synergistic eects following the endotoxin challenge. Sec-
ond, given the presumed depressive-like eects of immune
activation, we evaluated whether cytokine mRNA expres-
sion, central monoamine utilization and levels, and mRNA
expression of several serotonin (5-HT) receptor subtypes
were modied by LPS and the regrouping stressor within
stressor-sensitive brain regions (prefrontal cortex and hip-
pocampus) that have been implicated in major depression
(Anisman et al., 2007b). As well, as the nucleus tractus sol-
itarius (NTS) is fundamental in the circuitry between vagal
aerents and various aspects of the brain, and may be a
mediator of the central actions of peripheral cytokines
(Bluthe et al., 1996; Ek et al., 1998), it was of interest to
establish whether cytokine mRNA expression would be
engendered at this site as a function of the stressor and
LPS treatments.
2. Materials and methods
2.1. Subjects
Each study involved naive, male CD-1 mice obtained from Charles
River Canada (St. Constant, Que.) at 4550 days of age. Mice were housed
4 per cage, and permitted approximately 2 weeks to acclimatize to the lab-
oratory prior to serving as experimental subjects. The vivarium was main-
tained on a 12 h light/dark cycle in a temperature (21 C) controlled room
with food and water freely available. All experiments complied with the
guidelines set by the Canadian Council on Animal Care and were
approved by the Carleton University Animal Care Committee.
2.2. Experiment 1: eects of LPS and social disturbance on sickness
behaviors, plasma corticosterone and cytokine levels
Mice (n = 89/group) were randomly assigned to 3 separate condi-
tions, namely isolation followed by regrouping of cage mates, continuous
isolation, or continuous grouped housing. For the isolated mice, animals
that had originally been housed in groups of 4 were placed in individual
cages. After a 14 day period, the isolated mice were reunited with their ori-
ginal cage mates and allowed to physically interact for 1 h in a novel cage.
A second set of isolated mice remained in isolation, and a third set of mice
were maintained in the grouped condition throughout the study, and other
than cage changes, were undisturbed.
Following the 1 h regrouping period (or an equivalent time for the con-
tinued isolation and grouped conditions), animals were intraperitoneally
(i.p.) injected with either saline or one of several doses of the bacterial
endotoxin, LPS (1, 5 or 10 lg in a volume of 0.3 ml; Sigma L-3755 from
Escherichia coli serotype O26:B6). Animals were then individually placed
in clean cages and sickness behavior monitored, (as will be described in
the general methods) every 15 min over the 1.5 h post-injection period,
and were then decapitated. Trunk blood was collected, centrifuged and
the plasma stored at 80 C for subsequent corticosterone and cytokine
determinations.
As earlier studies had indicated that transferring mice from grouped to
isolated housing did not inuence the behavioral, neuroendocrine and
brain neurochemical changes elicited by either poly I:C or IFN-a (Anis-
man et al., 2007a,b; Gandhi et al., 2007), in the present investigation, a
group transferred from grouped to isolated housing was typically not
included. However, as the eects of LPS and transferring mice from
grouped to isolated conditions (and vice versa) were not previously
assessed with respect to brain cytokine mRNA expression, both these con-
ditions were included in assessing central cytokine mRNA expression
(Experiment 6).
2.3. Experiment 2: inuence of isolation duration prior to
regrouping
It has been suggested that regrouping mice following a period of isola-
tion reects a social stressor brought about by the re-establishment of
social hierarchies. The results of Experiment 1 had indicated that isolation
itself (i.e., in the absence of regrouping), even for a period as long as 2
 J. Gibb et al. / Brain, Behavior, and Immunity 22 (2008) 573589
weeks had only modest eects with respect to the actions of LPS. How-
ever, if social restructuring was the primary stressor associated regrouping
following a period of isolation, then it might be expected that the eects of
the isolation followed by regrouping would be minimal among mice that
had been isolated for relatively brief periods. Thus, Experiment 2 deter-
mined whether the duration of social isolation prior to regrouping (1, 3,
7 or 14 days) would inuence the eects of LPS on subsequent behavioral
and corticosterone responses. The procedure of reuniting cage mates was
the same as that described in Experiment 1. As in the previous experiment,
isolated (for 14 days) and group-housed animals served as controls, and
remained undisturbed in their home cages. After the 1 h regrouping ses-
sion, or equivalent time for control groups, mice were challenged i.p. with
either saline or 10 lg of LPS (n = 8/group). Once again, animals were
monitored for sickness behavior every 15 min for 1.5 h post-injection
and were then decapitated and trunk blood was collected for analyses of
plasma corticosterone and cytokine levels.
2.4. Experiment 3: inuence of regrouping vs other types of stressor
To determine whether the eects observed in the preceding experiments
were unique to a regrouping stressor, a further experiment compared the
eects of LPS among mice that were regrouped following a 2 week isola-
tion period, to that of 5 min of tail pinch, loud noise (startle stimuli)
applied over 6 min and continued isolation (n = 8/group). Mice exposed
to the noise stressor were placed in an acrylic cylindrical tube (inside diam-
eter of 3.2 cm, and overall length of 7.5 cm) that was placed in an insulated
startle chamber (Med Associates, Vermont). After an acclimatization per-
iod of 2.5 min, mice were exposed to bursts of noise of various intensities
(65105 dB) every 30 seconds for 10 trials. The tail pinch stressor involved
placing mice in a novel cage with a small fold-back binder clip fastened at
the base of the tail for a period of 5 min. A gauze pad was placed between
the tail and the clip to avoid tissue damage. Immediately following their
respective treatments, mice were challenged with saline (i.p.) or LPS
(5 lg or 10 lg). Animals were monitored for sickness behavior for 1.5 h
post-injection, and were then decapitated. Trunk blood was collected for
corticosterone analyses, as described earlier.
2.5. Experiment 4: inuence of physical contact upon regrouping
The study assessed whether physical contact upon regrouping was a
necessary condition for the combined actions of the stressor and LPS
treatments to occur. Mice were randomly assigned to 5 separate condi-
tions; namely, (a) regrouping and allowed physical contact following a
14 day period of isolation (as described in the preceding studies), (b)
regrouping following the 14 day isolation period, but mice were separated
from each other by a metal mesh partition (apertures were 0.5 0.5 cm).
Thus, olfactory, visual and auditory stimulation could be obtained from
one another, but physical interaction was not possible (c) continued iso-
lated, but the metal mesh partition was present to control for the novelty
of the surroundings, (d) continued isolation, and (e) continued group
housing. Following the 1 h regrouping session, or equivalent time for
the control groups, mice were injected (i.p.) with either saline or with
5 lg or 10 lg of LPS (n = 811/group) and monitored for sickness behav-
ior for 1.5 h prior to being decapitated. Blood was collected for determi-
nation of corticosterone levels.
2.6. Experiment 5: monoamine variations associated with LPS and
social disruption
In view of the supposition that depressive illness may be related to
monoamine variations, the individual and combined eects of LPS and
reuniting mice after a period of isolation were evaluated with respect to
variations of NE and 5-HT levels and on their metabolites (as an index
of utilization). Mice were assigned to either a grouped housed or individu-
ally housed condition as described in the preceding studies. A third group
of mice was isolated for a 2 week period, after which they were reunited for
1 h as described earlier. One hour after being reunited (in the case of the
575
isolated mice transferred to group housing), mice of each group received
an i.p. injection of either 5.0 or 10 lg of LPS or an equivalent volume of
saline (n = 810/group). Mice were then returned to their homecages and
were then sacriced 1.5 h post-injection Following euthanization, brains
were rapidly removed and placed on a stainless steel matrix
(1 1.5 .75 in.) situated on top of a block of ice. The brain matrix had
a series of slots (spaced 500 lm apart) that served as guides for razor
blades, to provide coronal brain sections. Tissue from the medial PFC
and hippocampus were collected by micro-punch using a hollow 20-gauge
microdissection needle, following the mouse atlas of Franklin and Paxinos
(1997). Tissue was ash frozen in isopentane cooled on dry ice, and then
stored at 80 C until later HPLC analysis to determine the concentrations
of NE and 5-HT and their respective metabolites, MHPG and 5-HIAA.
2.7. Experiment 6: inuence of regrouping on central cytokine
mRNA expression
Consistent with the view that inammatory factors may contribute to
depressive illness (Hayley et al., 2005; Dantzer, 2001; Raison et al., 2006),
the central neurochemical, neuroendocrine and circulating cytokine alter-
ations elicited by immune challenge were enhanced when applied on a
stressor backdrop. However, little information is available concerning
the conjoint eects of these treatments on central cytokine mRNA expres-
sion. Furthermore, although various 5-HT receptors have been associated
with depression, data are unavailable concerning the conjoint eects of
inammatory factors and a regrouping stressor on central 5-HT receptor
variations. Thus, a further study was conducted to assess whether the
change of housing (regrouping) and LPS treatments would inuence brain
cytokine and cytokine receptor mRNA expression (IL-1b, IL-6, TNF-a,
IL-10, IL-1R1, and IL-6R) as well as that of 5-HT1A, 5-HT2A, 5-HT1B
and 5-HT2C receptors. To this end, mice (n = 32) were housed in groups
of 4 or were isolated for a period of 2 weeks, as described earlier. Animals
were then maintained in the same housing condition (i.e., remained iso-
lated or remained group housed) or were transferred from grouped to indi-
vidual housing or transferred from individual to group housing. In the
latter instance, mice were regrouped with their original cage mates. Fol-
lowing a 1 h period, mice were injected i.p. with either vehicle or LPS
(10 lg) and then decapitated 3 h later under clean conditions. As peak
sickness and corticosterone levels are reached by 1.5 h, an additional
1.5 h was allowed in order to detect variations of mRNA expression in
brain. Thereafter brain tissue was extracted, as described in Experiment
5, ash frozen and stored at 80 C for subsequent QPCR analyses. In
addition to the hippocampus and PFC, the paraventricular nucleus of
the hypothalamus (PVN), and the nucleus tractus solitarius (NTS), were
also dissected and assayed.
2.8. Sickness behavior
Sickness behavior was scored for 10 sec at 15 min intervals over a 1.5 h
period following injection. Animals were evaluated with respect to the
presence or absence of the following symptoms: lethargy (demonstrated
by diminished locomotion and exploratory activities; curled body pos-
ture), ptosis (drooping eyelids), and pilo erection (rued and greasy fur,
typically at the neck). Animals were rated on a 4-point scale (0 = no sick-
ness symptoms, 1 = 1 symptom present, 2 = 2 symptoms present, 3 = 3
symptoms present). This procedure was found to provide less than 10%
variability between raters blind to the treatment mice received and was
highly correlated with other methods of scoring sickness (e.g., assessing
severity of each symptom independently) (see Gandhi et al., 2007).
2.9. Plasma corticosterone analysis
Following decapitation, plasma was collected and stored at 80 C
until being assayed using a commercial radioimmunoassay RIA kit
(ICN Biomedicals, CA). For each study, corticosterone levels were deter-
mined, in duplicate, in a single run to avoid inter-assay variability, and
intra-assay variability was less than 10%.
576 J. Gibb et al. / Brain, Behavior, and Immunity 22 (2008) 573589
2.10. Plasma cytokine analyses
Plasma cytokines (pro-inammatory, including TNF-a, IL-1b, IL-6,
and the anti-inammatory, IL-10) were analyzed using a custom-designed
Beadlyte Mouse Multi-Cytokine Detection kit (Upstate, Cell Signaling
Solutions, Cat # 48-004), in combination with the Luminex 100 system.
The assay is a suspension based bead array system in which sets of micro-
spheres (5.6 lm beads) are internally dyed with dierent ratios of uoro-
phores, each conjugated to a dierent capture probe (cytokine specic
antibody). Following incubation, a classication laser identies the partic-
ular cytokine bound and a second reporter laser quanties the signal
present.
A Beadlyte Mouse Multi-Cytokine Detection System 2 kit (Upstate,
Cell Signalling, Lake Placid, NY, Cat # 48-004) was used in conjunction
with the Luminex 100 system for cytokine determinations. A mouse dilu-
ent kit (Cat # 43-007) was used to dilute plasma supernatants and a serial
dilution series performed to cover a range of standards (from 0 to 5000 pg/
ml). Then, 25 ll of Beadlyte Cytokine Assay Buer was placed in each well
followed by addition of 25 ll of diluent and 25 ll of plasma. The lter
plate was then incubated on a shaker for 20 min and vortexed. To nalize
the initial reaction, 25 ll of bead solution was added to each well and the
plate covered and vortexed. Following overnight incubation, samples were
washed twice and 25 ll of Biotin, a conjugated Beadlyte Anti-Mouse
Cytokine cocktail (comprising antibodies against mouse IL-1, IL-6,
TNF-a, IFN-c, IL-4 and IL-10), was added to each well and then incu-
bated for 1.5 h at room temperature. Thereafter, 25 ll of diluted beadlyte
streptavidinphycoerythrin was added and incubated for 30 min on a plate
shaker. Finally, 25 ll of Beadlyte stop solution was added, samples were
then resuspended in sheath uid, and cytokine levels quantied using
the Luminex 100 instrument. The lower level of detection using this pro-
cedure ranged from 0.1 pg/ml (TNF-a) to 3.2 pg/ml (IL-10). Assays were
performed in duplicate and yielded less than 10% intra- and inter-assay
variability.
2.11. Central monoamine determinations
Levels of NE, 5-HT and their metabolites, 3-methoxy-4-hydroxyphe-
nylglycol (MHPG) and 5-hydroxyindoleacetic acid (5-HIAA), respec-
tively, were determined by high-performance liquid chromatography
(HPLC) as we previously described (Hayley et al., 1999). Tissue punches
were sonicated in a solution derived from an initial mix of 500 mL of
HPLC grade water, 5.0 mL methanol, 0.0186 EDTA and 14.17 g of
monochloroacetic acid. Following centrifugation, 20 ll of supernatant
was passed through a system consisting of M-600 pump (Milford,
MA), guard column, radial compression column (5 m, c18 reverse phase,
8 mm 10 cm) as well as three cell coulometric electrochemical detectors
(ESA model 5100A) at a ow rate of 1.5 ml/min (14001600 psi). The
mobile phase used for separation was made up of 1.3 g of heptane sul-
fonic acid, 0.1 g of disodium EDTA, 6.5 ml of triethylamine and nally
35 ml of acetonitrile. After ltering (using .22-mm lter paper) and deg-
assing the mobile phase, the pH levels were adjusted to 2.5 using phos-
phoric acid. The height and area of the peaks were determined through a
Hewlett-Packard integrator. The protein content of each sample was
assessed using bicinchoninic acid in addition to a protein kit (Pierce Sci-
entic, Brockville, Ont.), and a spectrophotometer (Brinkman, PC800
colorimeter). The lower limit of detection for the monoamines and
metabolites was 5.0 pg/ml.
2.12. Reverse transcription-quantitative polymerase chain reaction
analysis (RT-QPCR)
Total brain RNA was isolated and puried by standard methodolo-
gies employing Trizol according to the manufacturers protocol (Invitro-
gen; Burlington, Ont., Canada). The total RNA was then reverse
transcribed using Superscript II reverse transcriptase (Invitrogen; Bur-
lington, Ont.). Aliquots of this reaction were then used in simultaneous
QPCR reactions.
For QPCR, SYBR green detection was used according to the manufac-
turers protocol (Stratagene Brilliant QPCR kit). A Stratagene MX-4000
real time thermocycler was used to collect the data. All PCR primer pairs
used generated amplicons between 129 and 200 bp. Amplicon identity was
checked by restriction analysis. Primer eciency was measured from the
slope relation between absolute copy number or RNA quantity and the
cycle threshold using the MX-4000 software. All primer pairs had a min-
imum of 90% percent eciency.
Primers that amplify synaptophysin mRNA were used as a control to
normalize the data. This mRNA species has been shown, even under
extreme perturbations (static epilepsy), to be a stably expressed house-
keeping gene (Chen et al., 2001), and we have found this gene stable in
human suicide brain (Merali et al., 2004) and in mouse brain of stressed
mice (Anisman et al., 2007a,b). To assure that synaptophysin was an ade-
quate house-keeping gene, two additional house-keeping genes, cyclophy-
lin and GAPDH, were also assessed in PFC samples. The cycle thresholds
for these genes correlated highly (r > 0.85), attesting to the validity of
using synaptophysin alone. Although there was inter-subject variability
in the cycle threshold (Ct) for synaptophysin, there were no signicant dif-
ferences in the average Ct across the treatment groups (Fs < 1) within any
of the brain regions examined. To compensate for inter-individual vari-
ability that ordinarily exists within the assay, the expression of each spe-
cies was normalized by subtracting its Ct from the synaptophysin Ct.
The normalized Ct values (denoted as Ctn) for each mRNA species were
averaged for each brain region.
Primer sequences were as follows: Synaptophysin, forward:
GGACGTGGTGAATCAGCTGG, reverse: GGCGAAGATGGCAAA
GACC; Mus Ppia (cyclophylin A), forward: ATTCATGTGCCAG
GGTGGTG, reverse: CCGTTTGTGTTTGGTCCAGC, Mus IL-1b, for-
ward: TGTCTGAAGCAGCTATGGCAAC: reverse: CTGCCTGAAGC
TCTTGTTGATG; Mus IL-1R1, forward: ATGAGTTACCCGAGGTC
CAGTG; reverse: TACTCGTGTGACCGGATATTGC1; Mus IL-6, for-
ward: TCTTGGGACTGATGCTGGTG, reverse: CAGAATTGCC
ATTGCACAACTC; Mus IL-6R, forward: CTCTCCAACCACGAA
GGCTG, reverse: TGCAACGCACAGTGACACTATG; Mus TNF-a,
forward: CTC AGCCTCTTCTCATTCCTGC, reverse: GCCATAGA
ACTGATGAGAGGG; Mus IL-10, forward: AATTCCCTGGGTGA
GAAGCTG; reverse: TCATGGCCTTGTAGACACCTTG; Mus 5-
HT1A (Htr1a) forward: TCACCTTGAGTTTGCAGCCTC; reverse:
GCAGGAGTTGGAAGCACTTAGG, Mus 5-HT1B (Htr1b) forward:
GTCAAAGTGCGAGTCTCAGACG; reverse: ACAGATAGGCATC
ACCAGGGAG; Mus 5-HT2A (Htr2a) forward: TGCCACCAACTA
TTTCCTGATG; reverse: ACATCCAGGTAAATCCAGACGG, Mus 5-
HT2C (Htr2c) forward: GTTCAATTCGCGGACTAAGGC; reverse:
GTCAACGGGATGAAGAATGCC, Mus p11, forward: GCTCT
TCCAAGGACTGCTGC; reverse: GGTCCTCCTTTGTCAAGTGGTC.
2.13. Statistical analyses
Elevated sickness behavior scores were not apparent until 3045 min
post-injection. As these scores were highly correlated over time, scores
from 45 to 90 min were averaged to create a composite sickness score,
which was analyzed using a two-factor (stressor condition LPS treat-
ment) between-subjects analysis of variance (ANOVA). Plasma cytokines
(IL-1b, IL-6 and TNF-a, and IL-10), plasma corticosterone levels, brain
monoamine and metabolite levels, as well as the mRNA expression for
each of the cytokines, the 5-HT receptors and 5-HTT, were analyzed inde-
pendently using similar between-subject ANOVAs. Experiment 6, which
involved analysis of mRNA expression of brain cytokines and their recep-
tors, comprised a complete factorial design in which mice were initially
isolated or group housed and then transferred to one or the other of these
conditions before being treated with LPS or saline. Following the proce-
dure described by Livak and Schmittgen (2001), the Ctn values were con-
verted to fold changes relative to mice in the groupgroup condition that
had been treated with vehicle. The analyses of the mRNA fold changes for
each cytokine, as well as for 5-HT receptors, in each brain region com-
prised a between subjects ANOVA in which, initial housing, subsequent
housing condition, and endotoxin treatment each served as between group
 J. Gibb et al. / Brain, Behavior, and Immunity 22 (2008) 573589
variables. Follow-up comparisons of the means comprising main eects or
simple eects of signicant interactions were conducted using t tests with
Bonferonni corrections to maintain a at 0.05.
3. Results
3.1. Experiment 1: behavioral, corticosterone and circulating
cytokine eects associated with a social stressor and LPS
treatment
The initial study assessed the inuence of LPS coupled
with regrouping mice following a 2 week period of isolation
on sickness behaviors, corticosterone variations, as well as
circulating cytokine levels. In each instance, the eects of
the LPS treatment were elevated among mice that had
experienced the regrouping stressor.
3.1.1. Sickness behavior and plasma corticosterone
Both sickness behavior and plasma corticosterone were
signicantly inuenced by the stressor condition,
F(2, 94) = 4.32 and 28.41, p < .02 and .0001, respectively,
and by the LPS treatment, F(3, 94) = 20.15, 25.84,
ps < .0001. As seen in Fig. 1, and conrmed by the fol-
low-up comparisons, LPS dose-dependently increased sick-
ness and corticosterone. Moreover, among animals that
had been regrouped following a 2-week period of isolation,
sickness scores (upper panel) and plasma corticosterone
levels (lower panel) were greater than in mice that had
been maintained in the isolated or in the group-housed
condition. Although the stressor LPS interaction did
not reach statistical signicance, it is noteworthy that at
the moderate doses (1.0 and 5.0 lg), sickness behaviors
were more pronounced in the regrouped mice than in iso-
lated or grouped animals. These eects were clearly more
pronounced with respect to plasma corticosterone levels.
Indeed, in the isolated and grouped animals the lower
doses of LPS provoked only modest corticosterone eleva-
tions, whereas these eects were more pronounced in the
regrouped mice. As regrouping alone increased corticoste-
rone, it seems that the LPS and social stressors had
additive eects on sickness behaviors and plasma cortico-
sterone levels.
3.1.2. Plasma cytokine analysis
Circulating IL-6 and TNF-a levels were signicantly
inuenced by the LPS treatment, F(3, 44) = 13.05, 6.12,
ps < .001, respectively, and IL-6 levels also varied as a
function of the stressor condition, F(2, 44) = 6.40, p < .05.
Follow-up comparisons conrmed that LPS dose-depen-
dently increased plasma IL-6 and TNF-a levels. Moreover,
mice that were regrouped following isolation demonstrated
higher levels of IL-6 than did animals that remained group
housed (see Fig. 2). In neither case was the interaction
between the LPS treatment and the regrouping stressor sta-
tistically signicant, suggesting that the stressor and LPS
treatments additively inuenced IL-6 levels. However, as
seen in Fig. 1, the conjoint eects of the LPS and the
577
Saline
1g LPS
5g LPS
10g LPS
Mean sickness scores
Grouped Isolated Regrouped
Saline
1g LPS
Plasma corticosterone (g/dL)
5g LPS
10g LPS
Grouped Isolated Regrouped
Fig. 1. Mean (SEM) sickness score (upper panel) and plasma
corticosterone concentrations (lower panel) among CD-1 mice that had
been group housed, isolated or isolated for 2 weeks and then reunited with
their cagemates (regrouped) prior to being treated with saline or LPS (1, 5
or 10 lg). *p < .01 relative to saline treated mice. op < .05 relative to
grouped and isolated mice that had received comparable LPS treatments.
regrouping on IL-6 levels were primarily evident at the
10 lg dose of LPS.
In addition to the IL-6 and TNF-a changes, circulating
IL-10 levels varied as a function of the regrouping stres-
sor LPS treatment interaction, F(6, 44) = 2.70, p < .05.
The follow-up comparisons of the simple eects comprising
this interaction indicated that among the grouped and indi-
vidually housed animals, LPS modestly increased IL-10
levels, but this outcome did not reach statistical signi-
cance. In contrast, as depicted in Fig. 2 (lowest panel),
among mice that had been regrouped after a period of iso-
lation, the 5 and 10 lg doses of LPS signicantly increased
IL-10 levels, although the observed eects were relatively
variable.
Unlike the eects on IL-6, TNF-a and IL-10, levels of
circulating IL-1b measured 1.5 h after LPS treatment were
not aected by the endotoxin treatment, the regrouping, or
their interaction (data not shown).
578 J. Gibb et al. / Brain, Behavior, and Immunity 22 (2008) 573589

mental in accounting for the additive or synergistic eects

Saline
elicited by LPS in mice that had experienced regrouping.
1g LPS Sickness behavior was, indeed, found to vary as a function
5g LPS of the interaction between the regrouping condition and
10g LPS
LPS treatment F(5, 83) = 2.85, p < .05. As seen in Fig. 3,
and conrmed by the follow-up comparisons, the endo-
toxin challenge elicited higher sickness scores than did sal-
ine across all stressor conditions. Moreover, the sickness
scores elicited by LPS in mice that had been isolated for
7 or 14 days before regrouping signicantly exceeded that
of mice that had been continuously housed in isolation or
in the grouped condition, or mice that had experienced
only 3 days of isolation before regrouping.
Grouped Isolated Regrouped Plasma corticosterone levels were signicantly increased
by the LPS treatment, F(1, 83) = 134.76, p < .0001, and
varied as a function of the regrouping condition,
F(5, 82) = 4.21, p < .002. Subsequent analyses revealed that
Plasma cytokine S.E.M. (pg/mL)

Saline
1g LPS 7 or 14 days of isolation followed by regrouping elicited
5g LPS
10g LPS
higher plasma corticosterone levels than did 1 day of isola-
tion, or that evident in mice that had been continuously

Saline
10g LPS

Grouped Isolated Regrouped

Saline
1g LPS
5g LPS
10g LPS

Saline
10g LPS

Grouped Isolated Regrouped

Fig. 2. Mean (SEM) plasma concentrations of IL-6 (upper panel), TNF-

a (middle paned) and IL-10 (lowest panel) among CD-1 mice that had been
group housed, isolated or isolated for 2 weeks and then reunited with their
cagemates for 1 h (regrouped) prior to being treated with saline or LPS (1, 5
or 10 lg). *p < .01 relative to saline treated mice. op < .05 relative to
grouped and isolated mice that had received comparable LPS treatments.

3.2. Experiment 2: inuence of various periods of isolation
prior to regrouping on behavioral and neuroendocrine
variations elicited by LPS
Analyses were undertaken to assess whether the dura-
tion of isolation prior to subsequent regrouping was funda-
Fig. 3. Mean (SEM) sickness score (upper panel) and plasma cortico-
sterone concentrations (lower panel) among CD-1 mice that had been
group housed, isolated or isolated for various periods (1, 3, 7 or 14 days)
then reunited with their cagemates (regrouped) for 1 h prior to being
treated with saline or LPS (10 lg). *p < .01 relative to saline treated mice.
o
p < .05 relative to grouped and isolated mice that had received compa-
rable LPS treatments.
 J. Gibb et al. / Brain, Behavior, and Immunity 22 (2008) 573589
isolated or group housed. Thus, as depicted in Fig. 3 (lower
panel), the dierent social isolation conditions and the LPS
treatments had additive eects on plasma corticosterone
levels.
3.3. Experiment 3: sickness behaviors and corticosterone
variations associated with LPS coupled with social or non-
social stressors
This study assessed whether the interactive or additive
eects of regrouping and LPS would also be evident in
response to non-social stressors, namely tail pinch or loud
noise. Sickness scores varied as a function of the stressor
condition, F(2, 105) = 4.01, p < .005 and LPS treatment,
F(2, 105) = 46.44, p < .0001. In particular, as seen in
Fig. 4 (upper panel), LPS treatment dose-dependently
increased sickness scores, with 10 lg of LPS inducing
greater sickness than did a 5.0 lg dose, which in turn,
induced greater sickness than did saline. The lower dose
of LPS was most eective in dierentiating responses
among mice that had been regrouped relative to each of
Saline
5g LPS
10g LPS
Mean sickness scores
Grouped Isolated Pinch Noise Regrouped
Saline
Plasma corticosterone (g/dL)
5g LPS
10g LPS
Grouped Isolated Pinch Noise Regrouped
Fig. 4. Mean (SEM) sickness score (upper panel) and plasma cortico-
sterone concentrations (lower panel) among CD-1 mice that had been
group housed, isolated, exposed to tail pinch, restraint or regrouping for
1 h after a 2-week period of isolation prior to being treated with saline or
LPS (5 or 10 lg). *p < .01 relative to saline treated mice. op < .05 relative
to grouped and isolated mice that had received comparable LPS
treatments.
579
the remaining groups. Specically, at this dose the sickness
associated with LPS in the regrouped mice was more pro-
nounced than among non-stressed mice or those that had
been exposed to tail pinch or loud noise. At the higher dose
LPS provoked a marked sickness response in mice contin-
uously isolated, and hence the eects of regrouping were no
longer evident. However, the dierence from grouped mice,
or those exposed to tail pinch or noise continued to be
evident.
As seen in Fig. 4 (lower panel), circulating corticoste-
rone levels were also signicantly inuenced by the LPS
treatment, F(2, 103) = 26.06, p < .0001 and the stressor
condition, F(4, 103) = 13.16, p < .0001. The follow-up com-
parisons conrmed that both the 5 and 10 lg doses of LPS
elicited higher corticosterone levels than that evident in sal-
ine-treated mice. As well, regrouping elicited a rise of cor-
ticosterone levels relative to that seen in mice exposed to
the noise and the tail pinch stressors 1.5 h earlier, or that
apparent in isolated and group-housed controls. Thus, it
appears that the psychosocial stressor acted additively with
the LPS in aecting circulating corticosterone levels. Simi-
lar eects were not apparent in mice that had been
restrained or exposed to the noise stressor. As well, in a
separate study (n = 8/group) in which we assessed the
eects of the restraint plus LPS, virtually identical results
were apparent. Specically, it was again found that LPS
and the regrouping stressor acted additively, whereas
restraint did not inuence the eects of LPS on either sick-
ness or plasma corticosterone levels (data not shown).
3.4. Experiment 4: physical vs. nonphysical contact combined
with LPS challenge: behavioral and corticosterone eects
This study assessed whether the eects of LPS following
regrouping were dependent on physical contact occurring
between mice (possibly reecting dominance hierarchies
being re-established). To this end, prior to treatment with
LPS (or saline) mice were regrouped as in the preceding
studies; however, for some animals physical contact was
possible, whereas for other mice physical contact was pre-
vented by a metal mesh partition.
Mean sickness scores, depicted in Fig. 5 (upper panel),
varied as a function of the regrouping stressor condition,
F(4, 117) = 3.77, p < .01 and LPS treatment, F(2, 117) =
69.80, p < .0001. As well, the regrouping LPS treatment
approached statistical signicance, F(8, 117) = 1.86,
p = .07, g2 = .05. Follow-up comparisons indicated that
the LPS treatments dose-dependently increased sickness
behaviors, with the 10 lg dosage being more eective than
the 5 lg dose. As the interaction between the regrouping
stressor and LPS treatment approached signicance (and
accounted for moderate variance), follow-up tests were con-
ducted of the simple eects that had been predicted based
on the preceding studies. These comparisons indicated that
10 lg LPS induced greater sickness in mice that had been
isolated and then regrouped relative to each of the remain-
ing conditions, including mice that been isolated and then
580 J. Gibb et al. / Brain, Behavior, and Immunity 22 (2008) 573589

Saline to ascertain whether physical contact inuenced the

5g LPS response to LPS treatment. It is interesting, however, that
10g LPS at the 5 lg dose the cortisol levels among mice that were
Mean sickness scores

regrouped (and permitted social contact) exceeded that of

mice that were isolated or group housed. Likewise, this
LPS dose in association with regrouping where physical
contact was not possible increased corticosterone relative
to mice that received saline and moderately higher
(p = .07) than in mice that received a similar dose of LPS
but were not socially stressed.

3.5. Experiment 5: monoamine determinations

Grouped Isolated Novelty Social Physical
Contact Contact
The purpose of this study was to assess the individual
Saline and combined actions of LPS and the regrouping stres-
Plasma corticosterone (g/dL)

5g LPS sor on monoamine levels and utilization in two brain

10g LPS
regions that have been implicated in depression, notably
the PFC and hippocampus. The mean concentrations of
MHPG in the PFC and hippocampus for each of the
treatment groups are shown in Fig. 6. Within the

Saline
5g LPS
10g LPS
Grouped Isolated Novelty Social Physical
Contact Contact

Fig. 5. Mean (SEM) sickness score (upper panel) and plasma cortico-
sterone concentrations (lower panel) among CD-1 mice that had been
group housed, isolated, exposed to a novel environment, regrouped with
MHPG S.E.M. (ng/mg protein)

cage mates after a 2-week period of isolation under conditions where

social (but not physical) contact was possible, or where physical contact
was possible (physical). Thereafter, mice were treated with saline or LPS (5
or 10 lg). *p < .01 relative to saline treated mice. op < .05 relative to
grouped and isolated mice that had received comparable LPS treatments.

Grouped Isolated Regrouped

regrouped without physical contact being possible. Evi-
dently, for the augmented LPS-induced sickness to become
apparent, physical contact was a necessary condition during Saline
the regrouping period. 5g LPS
Circulating corticosterone levels were signicantly inu- 10g LPS
enced by the regrouping stressor condition, F(4, 115) =
6.11, p < .001 and by the LPS treatment, F(2, 115) =
19.25, p < .0001. Subsequent follow-up analyses revealed
that regrouping where physical interaction was possible
resulted in greater corticosterone levels than that associ-
ated with either regrouping without physical contact, expo-
sure to the novel environment without contact with other
mice, or remaining in the isolated or group-housed condi-
tion (see Fig. 5, lower panel). In addition, the LPS treat-
ment dose dependently increased plasma corticosterone Grouped Isolated Regrouped
levels in each of the conditions, with the most pronounced
eect being elicited by the 10 lg dose. As simply regrouping Fig. 6. Mean (SEM) MHPG concentrations within the prefrontal cortex
mice induced a marked increase of corticosterone, beyond (upper panel) and hippocampus (lower panel) among CD-1 mice that had
been group housed, isolated or isolated for 2 weeks and then reunited with
that seen when physical contact was prevented, the further their cagemates (regrouped) prior to being treated with saline or LPS (5 or
contribution of LPS to the rise of corticosterone was lim- 10 lg). *p < .01 relative to saline treated mice. op < .05 relative to grouped
ited. Given potential ceiling eects, however, it is dicult and isolated mice that had received comparable LPS treatments.
 J. Gibb et al. / Brain, Behavior, and Immunity 22 (2008) 573589
PFC, the accumulation of MHPG was altered by both
the LPS treatment and the regrouping condition,
F(2, 68) = 5.86 and 10.61, p < .01, respectively. The fol-
low-up comparisons indicated that the 10 lg dose of
LPS signicantly increased the metabolite accumulation
relative to saline-treated mice. As well, MHPG levels
were elevated among mice that had been regrouped rel-
ative to both the individually and group-housed mice. In
eect, the treatments had additive eects so that the
MHPG changes evident in LPS treated mice that had
been regrouped were higher than among mice that
received only one of these treatments (see Fig. 6, upper
panel). The levels of NE, as well as that of 5-HT or 5-
HIAA were not signicantly inuenced by the treatments
(data not shown).
The accumulation of MHPG within the hippocampus
was increased by the LPS treatment, F(2, 69) = 6.10,
p < .01. The follow-up tests indicated that only the 10 lg
dose increased the accumulation of this metabolite. The
eect of the housing manipulation was not statistically sig-
nicant. However, as depicted in Fig. 6 (lower panel), in
mice that had been treated with saline there was absolutely
no eect of the housing manipulation, whereas in the LPS
treated animals the eects of the change in housing was
more prominent. Indeed, despite the fact that the
LPS housing interaction was not signicant, follow-up
analyses indicated that at the 5 lg dose, MHPG accumula-
tion among regrouped mice signicantly exceeded that
produced by the endotoxin in isolated mice, and the dier-
ence from group-housed mice approached signicance
(p < .08). Finally, the prole of 5-HIAA variations within
the hippocampus was almost identical to that of MHPG,
but only the main eect of the drug treatment was signif-
icant, F(2, 68) = 3.06, p = .05 (data not shown). LPS did
not aect 5-HIAA accumulation among grouped mice,
whereas the 10 lg dose increased 5-HIAA accumulation
in both the isolated and regrouped mice. In the latter
instance, the 5.0 lg dosage also provoked a moderate
increase of 5-HIAA relative to vehicle animals (p < .08)
and a signicantly greater increase than that seen in the
isolated condition. In eect, as in the case of MHPG, it
appeared that 5-HIAA variations were subject to the com-
bined eects of the LPS and the housing condition, but the
magnitude of the observed outcome was moderate as
reected by the variance accounted for by this interaction
(g2 was 5.1%). Finally, unlike 5-HIAA, the levels of 5-HT
were not aected by either of the treatments (data not
shown; F < 1).
3.6. Experiment 6: RT-QPCR for cytokine and cytokine
receptors
The LPS treatment markedly inuenced brain cytokine
and cytokine receptor mRNA expression in the mPFC
and hippocampus. However, the augmented eects of
LPS associated with a change in housing condition were
not evident. To the contrary, more often than not, the
581
increased cytokine mRNA expression associated with
LPS treatment was inhibited among animals that were
exposed to the regrouping stressor.
3.6.1. Hippocampus
The fold changes for IL-1b, IL-6, and TNF-a mRNA
expression within the hippocampus as a function of the
treatment conditions is shown in Fig. 7. In the case of
IL-1b, IL-6, and TNF-a, LPS signicantly increased
mRNA expression of these cytokines, F(1, 23) = 43.64,
25.75, 58.65. Moreover, both fold changes of IL-6 and
TNF-a mRNA associated with LPS treatment were further
moderated by the initial housing, and regrouping condi-
tion, F(1, 23) = 3.72 and 4.76, p < .05. In both instances
LPS increased mRNA expression of these pro-inamma-
tory cytokines, but contrary to expectation, the eect of
the endotoxin was less pronounced among isolated mice
that had been transferred to the grouped condition, com-
pared to the other housing conditions. A similar prole
was apparent in the case of IL-1b mRNA expression
(Fig. 7), but this eect did not reach statistical signicance
(p > .10).
Analyses of IL-1R1 and IL-6R fold changes indicated
that the LPS treatment produced a modest rise of the
receptor expression, but in neither case was the eect signif-
icant. Likewise, the fold changes for these cytokine recep-
tors did not vary as a function of the LPS initial
housing regrouping interaction (F < 1), although there
was tendency for the IL-1R1 fold change following LPS
treatment to be moderately increased in mice that had ini-
tially been isolated and then transferred to the grouped
condition. Finally, analysis of the anti-inammatory cyto-
kine, IL-10, within the hippocampus indicated that its
mRNA expression was in relatively low abundance
(M SEM = 16.39 0.16) and hence variations of this
cytokine were not considered to be meaningful, and hence
not considered further.
3.6.2. Medial prefrontal cortex
In the main, the eects of the treatments on cytokine
mRNA expression within the PFC were similar to those
seen within the hippocampus, although these eects were
generally weaker, and in some instances the small N pre-
cluded detection of signicant interactions.
The mRNA expression of IL-1b, IL-6 and TNF-a
within the PFC was increased by the LPS treatment,
F(1, 24) = 29.85, 33.47 and 52.50, ps < .001, but the ini-
tial housing regrouping stressor LPS treatment inter-
action was not statistically signicant. However, in the
case of IL-1b and to a lesser extent in the case of
TNF-a, the magnitude of the eect was less pronounced
among mice housed in isolation and then transferred to
the group condition (see Fig. 8). Indeed, whereas LPS
ordinarily elicited a 1014 fold increases of IL-1b, among
those mice that had been transferred from the isolated to
the grouped condition only a 4-fold increase was evident.
In the case of TNF-a within the mPFC, the analysis
582 J. Gibb et al. / Brain, Behavior, and Immunity 22 (2008) 573589

Saline Saline
10g LPS 10g LPS

Saline Saline
10g LPS 10g LPS

Fig. 7. Mean (SEM) hippocampal fold changes of mRNA expression of IL-1b, IL-1R1, IL-6 and TNF-a among CD-1 mice that had been group housed
throughout the study (GG), isolated (2 weeks) throughout the study (II), group housed and then transferred to isolation for 1 h (GI), or isolated for 2
weeks and then reunited with their cage mates (regrouped) for 1 h (IG). Thereafter, mice were treated with saline or LPS (10 lg). Fold changes are
presented relative to that of mice in the Group-Group condition that had been treated with saline. *p < .05 relative to saline treated mice, op < .05 relative
to all other LPS-treated groups, p < .05 relative to II mice treated with LPS, p < .05 relative GG mice treated with LPS.

indicated that the fold change varied as a function of the
LPS initial housing interaction, F(1, 24) = 5.33, p = .05.
Once again, the follow-up tests indicated that LPS
increased TNF-a mRNA expression, but this outcome
was less pronounced than among mice that had initially
been housed in isolation than in those mice that had
been housed in groups.
As in the case of the cytokines, analyses of IL-1R1
and IL-6R within the PFC indicated that LPS increased
the mRNA expression of these receptors, F(1, 24) =
38.54, 15.02, ps < .001, respectively. As well, IL-1R1 fold
change varied as a function of the Initial hous-
ing regrouping condition LPS interaction, F(1, 24) =
5.69, p < .05. The follow-up tests conrmed that among
mice that were initially isolated and then transferred to
the grouped condition, IL-1R1 fold change was higher
than in animals that had been isolated or grouped
throughout.
3.6.3. Nucleus tractus solitarius (NTS)
The analyses of mRNA fold changes for the various
cytokines within the NTS indicated that IL-1b, IL-6 and
TNF-a mRNA expression varied as a function of the initial
housing stressor (regrouping) LPS treatment interac-
tion, F(1, 24) = 7.08, 15.08, 7.22, ps < .05, respectively.
The follow-up tests once again revealed that LPS increased
the expression of these pro-inammatory cytokines among
mice that had been grouped or isolated throughout the
study. However, as depicted in Fig. 9, among mice that
had been transferred from the isolated to the group condi-
tion, the cytokine mRNA increase elicited by LPS was
diminished relative to that of the other housing conditions.
It was further observed that LPS increased IL-1R1 and IL-
6R mRNA expression, F(1, 24) = 66.10, 8.65, ps < .001,
but these eects were not moderated by the housing condi-
tion. Finally, although IL-10 appeared in higher abun-
dance within the NTS than in other regions, the mRNA
 J. Gibb et al. / Brain, Behavior, and Immunity 22 (2008) 573589 583

Fig. 8. Mean (SEM) fold changes of prefrontal cortical mRNA expression of IL-1b, IL-1R1, IL-6 and TNF-a among CD-1 mice that had been group
housed throughout the study (GG), isolated (2 weeks) throughout the study (II), group housed and then transferred to isolation for 1 h (GI), or
isolated for 2 weeks and then reunited with their cage mates (regrouped) for 1 h (IG). Thereafter, mice were treated with saline or LPS (10 lg). Thereafter,
mice were treated with vehicle or LPS (10 lg). Fold changes are presented relative to that of mice in the Group-Group condition that had been treated with
saline. *p < .05 relative to saline treated mice, op < .05 relative to all other LPS-treated groups, p < .05 relative to II and GI mice treated with LPS,

p < .05 relative to GG and GI mice treated with LPS.

expression for this cytokine was unaected by the LPS
treatment.
3.6.4. Paraventricular nucleus (PVN)
The IL-1b and IL-6 fold changes varied as a function of
the initial housing regrouping LPS interaction,
F(1, 24) = 4.05, 7.01, ps < .05. The follow-up tests con-
rmed that LPS increased the fold changes of mRNA
expression of these cytokines in the grouped and in the iso-
lated mice. However, among mice that were transferred
from one housing condition to another, the LPS-induced
cytokine elevations were precluded (in view of the similar-
ity of the PVN data to those of other brain regions, the
data are not shown for the PVN).
The expression of IL-1R1 and IL-6R, as well as TNF-a,
varied as a function of the LPS test day housing condi-
tion, F(1, 24) = 9.22, 5.05, and 8.26, p < .05. In each
instance, the follow-up tests indicated that LPS increased
mRNA expression in mice that had been group housed
prior to LPS treatment, but not among mice that had been
isolated during the period immediately before LPS
treatment.
3.6.5. Serotonergic changes associated with LPS and social
stressor treatments
Relative to the vehicle treatment, administration of LPS
increased the mRNA fold change of 5-HT1A, F(1, 24) =
4.18, p < .05, but the magnitude of the eect was small
(M + SEM = .25 + .08 and .42 + .09, respectively). The
mRNA expression of 5-HT2A, 5-HT2C, 5-HT1B or p11
was not signicantly aected by either the LPS treatment
or the isolation condition. Furthermore, it was clear that
the LPS treatment did not interact with the stressor in pro-
moting the 5-HT receptor changes (data not shown).
584 J. Gibb et al. / Brain, Behavior, and Immunity 22 (2008) 573589

Fig. 9. Nucleus tractus solitarius (NTS) fold changes of hippocampal mRNA expression (Mean SEM) of IL-1b, IL-1R1, IL-6 and TNF-a among CD-1
mice that had been group housed throughout the study (GG), isolated (2 weeks) throughout the study (II), group housed and then transferred to
isolation for 1 h (GI), or isolated for 2 weeks and then reunited with their cage mates (regrouped) for 1 h (IG). Thereafter, mice were treated with saline
or LPS (10 lg). Fold changes are presented relative to that of mice in the GroupGroup condition that had been treated with saline. *p < .05 relative to
saline treated mice. op < .05 relative to all other LPS-treated groups, p < .05 relative to II mice treated with LPS, p < .05 relative GG mice treated with
LPS.

Indeed, the interaction accounted for only a small amount
of the variance (g2 < .01), and hence it is unlikely that the
absence of signicant interaction eects was attributable
to the small number of subjects used. As in the hippocam-
pus, the LPS and stressor exposure did not signicantly
inuence 5-HT receptor mRNA expression within the
mPFC (data not shown).
4. Discussion
Activation of the inammatory immune response,
through the exogenous administration of either pro-inam-
matory cytokines or LPS, produces behavioral and neuro-
chemical responses reminiscent of those elicited by
psychogenic and neurogenic challenges (Anisman and Mer-
ali, 1999; Hayley et al., 2005). It had been suggested that
when applied concurrently, immune activation and stress-
ors may have additive or synergistic eects that can inu-
ence the evolution of behavioral disturbances, including
depressive-like states (Anisman et al., 2005).
The present ndings are consistent with earlier reports
indicating that social disturbances act as particularly pro-
found stressors that inuence cytokine and circulating glu-
cocorticoid levels in response to a bacterial endotoxin
challenge (i.e. Avitsur et al., 2001, 2005; Merlot et al.,
2003; Quan et al., 2001). Specically, a social stressor that
comprised regrouping mice following a period of isolation
elicited a marked rise of corticosterone that was still appar-
ent 1.5 h after treatment cessation. This contrasts with the
relatively transient increase of corticosterone associated
with stressors such as loud noise or tail pinch (Michaud
et al., 2003; Windle et al., 1997), and indeed an elevation
of corticosterone was not evident 1.5 h after noise or tail
pinch termination in the present investigation.
The sickness behaviors as well as the plasma corticoste-
rone and cytokine elevations elicited by LPS were further
 J. Gibb et al. / Brain, Behavior, and Immunity 22 (2008) 573589
increased among mice that had been regrouped following a
period of isolation. In order for the eects of LPS on sick-
ness and corticosterone levels to be enhanced, a lengthy
period of isolation (7 or 14 days) prior to regrouping was
necessary. Furthermore, the augmented sickness eects of
LPS were evident primarily when reintroduction to cage
mates permitted physical contact. Together, these ndings
suggest that a change of housing condition itself was not
sucient to engender the additive or synergistic eects,
and instead a manipulation that encourages social distur-
bance (possibly reecting re-establishment of social hierar-
chies) was most eective in this regard. To be sure, in the
present investigation plasma corticosterone and brain neu-
rochemical changes were assessed at only a single time
point following the treatments. It is certainly possible that
treatments, such as isolation alone, might have inuenced
the time course (i.e., time to normalization) of the sickness
and that of the neuroendocrine and neurotransmitter alter-
ations. Likewise, in assessing the combined eects of LPS
and the social regrouping, it might have been advantageous
to use a lower dose of LPS, thereby permitting assessment
of the potential synergistic eects of these treatments under
conditions where the eects of LPS were modest.
Mice are social animals, and it is believed that social iso-
lation is a relatively stressful experience (Bartolomucci
et al., 2001; Kim and Kirkpatrick, 1996; Weiss et al.,
2004) that can engender pathophysiological outcomes,
including altered HPA activity and may accelerate the
course of autoimmune disorders and the growth of trans-
planted tumors (Chida et al., 2005; Liu and Wang, 2005;
Wu et al., 2000). It appears, as well, that although pro-
longed isolation might not aect basal corticosterone levels
and immune functioning, it may engender higher levels of
emotional reactivity and a hyperactive HPA response to
subsequent psychosocial stressors (Bartolomucci et al.,
2003; Weiss et al., 2004). In the present investigation, isola-
tion itself did not alter the response to LPS relative to that
evident among group-housed mice. Nevertheless, it is pos-
sible that prolonged isolation primed neural circuits or
immune factors so that subsequent regrouping elicited lar-
ger corticosterone eects than would otherwise have been
observed.
Studies assessing the impact of social stressors have
made the distinction between physical attack and the threat
of attack (for a review see Martinez et al., 1998). In the
absence of physical encounters, animals under the threat
of attack (by having olfactory, visual and auditory contact
with conspecics) exhibit emotional responses similar to
those elicited by an attack itself. However, it has also been
reported that physical contact elicited corticosterone levels
that exceeded those provoked by sensory (nonphysical)
contact (Bailey et al., 2004; Merlot et al., 2004; Pardon
et al., 2004; Stefanski, 2000). The possibility exists that
the higher corticosterone levels seen in the physical contact
group in the present study were due to the injuries sus-
tained during the regrouping period, as opposed to the
stress of physical contact per se. Yet, it was also reported
585
that wounded and non-wounded animals did not dier
with respect to corticosterone levels following social defeat
(Merlot et al., 2004; Sheridan et al., 2000). Moreover, in a
separate study (data not shown) we observed that among
mice that engaged in ghting (and incurred wounds over
the preceding 24 h), which frequently occurs even in the
absence of experimental manipulations, LPS did not dier-
entially inuence plasma corticosterone and sickness
behaviors in dominant (non-wounded) and submissive
(wounded) animals. Of course, this does not mean that
incurring wounds would not lead to altered HPA or cyto-
kine functioning, but rather that within the constraints of
the present investigation (for ethical reasons animals that
were markedly wounded were separated from the aggres-
sive cage mate), these physiological measures were unaf-
fected. It would, of course, be expected that experiencing
chronic or severe aggression might alter corticosterone
and immune functioning (Bartolomucci et al., 2005).
Although the sickness behaviors elicited by LPS were
appreciably enhanced among mice that had experienced
the stress of regrouping, such an outcome was not apparent
among animals that had been exposed to other psychogenic
and neurogenic stressors, such as tail pinch, loud noise, and
restraint. To be sure, direct comparisons between stressors
are not entirely appropriate given their qualitatively dier-
ent eects, and the fact that the corticosterone variations
associated with the psychosocial stressor were more persis-
tent than those associated with loud noise or tail pinch.
Indeed, synergy between cytokines and stressors are not
restricted to psychosocial challenges (social disruption),
as synergistic eects on monoamine release were observed
between cytokines and a mild neurogenic stressor (Merali
et al., 1997). Nevertheless, the present ndings suggest that
social disturbances may be particularly potent in this
regard. At the same time it is acknowledged that social
stressors may inuence distinct neural pathways relative
to other stressors, just as the neural circuits activated by
systemic, neurogenic and other psychogenic stressors are
not identical (Herman and Cullinan, 1997; Hayley et al.,
2001; Morrow et al., 2000).
Systemically administered LPS ordinarily increases cir-
culating levels of pro-inammatory cytokines, such as IL-
6 and TNF-a (Dantzer, 2001; Goujon et al., 1995; Johnson
et al., 2002), and both psychogenic and psychosocial stress-
ors also increase circulating IL-6 levels (LeMay et al., 1990;
Merlot et al., 2003; Puch et al., 1999). Thus, it is not partic-
ularly surprising that the combination of these two treat-
ments would have still greater eects on circulating IL-6
levels. In fact, in the present investigation, as previously
observed in response to the viral imitator, poly I:C (Gandhi
et al., 2007), these treatments synergistically inuenced the
circulating levels of IL-6. Furthermore, consistent with ear-
lier reports (Tuchscherer et al., 2006; Turrin et al., 2001),
LPS increased circulating TNF-a levels, but the TNF-a
changes associated with the combined LPS and stressor
treatments were more variable than those of IL-6, and con-
sequently the interaction between the LPS and the stressor
586 J. Gibb et al. / Brain, Behavior, and Immunity 22 (2008) 573589
treatment was not signicant. In addition to eects on IL-6,
both LPS and stressors increased IL-10 levels (Connor
et al., 2005), and in the present investigation the synergistic
increase of IL-6 elicited by LPS and regrouping was accom-
panied by an increase of IL-10. The elevation of the anti-
inammatory cytokine likely represents a regulatory
response to limit the actions of IL-6, including the provo-
cation of acute phase reactants.
The eects of systemic LPS treatment are not limited to
variations of corticosterone or circulating cytokine levels,
but are known to increase central cytokine expression
(Teeling et al., 2007; Turrin et al., 2001). In this regard,
in the present investigation, LPS increased the mRNA
expression of IL-1b, IL-6, and TNF-a, as well as that of
cytokine receptors, namely IL-1R1 and IL-6R. Impor-
tantly, these eects were not only apparent within the
NTS, but were also evident within the PFC and hippocam-
pus, both of which have been implicated as important
regions associated with major depressive disorder (Duman
and Monteggia, 2006). Unexpectedly, however, among
mice that had received the LPS treatment after being trans-
ferred from isolated to grouped housing (and to some
extent transfer from grouped to isolated conditions), pro-
inammatory mRNA expression in brain was less pro-
nounced than among mice that received the LPS treatment
and maintained in groups or in isolation. It is uncertain
why social regrouping attenuated the eects of LPS on cen-
tral cytokine mRNA expression, nor is it clear what the
implications of this suppression might be for central neuro-
nal functioning. It is possible that elevated peripheral cyto-
kines, through some form of negative feedback, inhibited
central cytokine synthesis. In this regard, cytokine signal-
ing within the brain may be negatively regulated by sup-
pressors of cytokine signaling (SOCS) through eects on
JAK/STAT pathways (Planas et al., 2006; Wang and
Campbell, 2002). Centrally, SOCS-3 activation is provoked
in association with neurological disturbances, such as
stroke or brain ischemia (Planas et al., 2006) and by the
peripheral administration of LPS (Lebel, et al., 2000). In
the latter instance the SOCS-3 activation was most promi-
nent in circumventricular organs, ependymal lining cells,
and along the endothelium of brain blood vessels, but
was less likely to be elevated in deep parenchymal aspects
of the brain. Although speculative, it is possible that the
combined action of LPS and regrouping, either through
sucient peripheral cytokine eects or by aecting central
SOCS-3 production, provoked central actions on this
inhibitory process.
An alternative accounting for the eects of LPS plus the
regrouping stressor on brain cytokine mRNA expression is
that elevated corticosterone levels associated with the com-
bined treatments may have been responsible for the sup-
pression. If this were the case, however, then one might
question why such an eect was directly opposite to that
seen in the periphery. It seems that although corticosterone
may inuence macrophage activity, and hence reduce circu-
lating cytokine levels, a continued social stressor may insti-
gate a functional glucocorticoid resistance, thus facilitating
the increase of cytokine levels associated with a concomi-
tant bacterial challenge (Avitsur et al., 2001; Merlot
et al., 2004; Quan et al., 2001; Stefanski, 2000). Such an
inhibitory process might not be present in brain, and hence
the elevated corticosterone might act to reduce the cytokine
mRNA expression evident in response to the combined
LPS stressor challenge. Of course, given that cytokine-
elicited sickness behaviors are mediated by central pro-
cesses (Konsman et al., 2002), this explanation still begs
the question as to why social regrouping augmented sick-
ness behavior elicited by LPS and yet resulted in the dimi-
nution of cytokine mRNA expression within the NTS,
PFC, hippocampus, and to a lesser extent within the
PVN. One obvious explanation to account for this nding
is that the sickness involves direct eects of circulating
cytokines on brain functioning, possibly gaining access at
circumventricular sites. It may be particularly relevant that
peripheral LPS may stimulate the release of cytokines from
endothelial cells thus increasing their presence centrally
without increasing de novo synthesis in brain (Verma
et al., 2006). It is likewise possible that the stressor
increased blood brain barrier permeability (Skultetyova
et al., 1998), thereby increasing entry of peripheral cyto-
kines into brain, hence increasing sickness without a paral-
lel change of central cytokine synthesis.
Finally, given the presumed involvement of monoamine
functioning in major depressive disorder (Millan, 2006;
Nutt, 2002), it was of interest to determine whether LPS
and stressor exposure, or the combination of these treat-
ments, would inuence central NE and 5-HT turnover, as
well as 5-HT receptor mRNA expression. Indeed, LPS
increased hippocampal NE and 5-HT utilization as well
as that of NE in the PFC, but synergy between the stressor
and LPS was only evident with respect to hippocampal
MHPG accumulation. These ndings are consistent with
earlier reports indicating that systemic or central IL-1b
administration stimulated in vivo hypothalamic and hippo-
campal NE, DA and 5-HT release (Linthorst et al., 1995;
Mohankumar and Quadri, 1993), as well as 5-HT release
at several limbic sites (Linthorst et al., 1995; Merali
et al., 1997; Shintani et al., 1993; Song et al., 1999). In fact,
when measured in vivo using microdialysis coupled with
HPLC, it had been shown that stressors increased mono-
amine release induced by IL-1b (Merali et al., 1997; Song
et al., 1999). Inasmuch as dynamic variations of 5-HT
are more readily detected through in vivo analyses than
through post-mortem procedures that involved only a sin-
gle time point, the absence of a synergy between LPS and
social stressors ought to be considered cautiously.
Although depression has been associated with altered 5-
HT receptor density and mRNA expression, inconsistent
ndings have been reported concerning the nature of these
changes in both post-mortem analyses (controls vs sui-
cides) and in imaging studies (e.g., Stockmeier, 2003). In
the present investigation, LPS modestly increased 5-HT1A
mRNA expression in the hippocampus, as often observed
 J. Gibb et al. / Brain, Behavior, and Immunity 22 (2008) 573589
in depressed suicides. However, LPS did not aect the
mRNA expression of other 5-HT receptor subtypes,
despite the fact that expression of this receptor subtype
was reduced in the hippocampus of depressed/suicides
(Svenningsson et al., 2006). Of course, the LPS treatment
represents an acute manipulation, whereas 5-HT receptor
changes reported in depression likely represent the eects
of a chronic illness or the factors (e.g., stress) associated
with this illness. Thus, it is premature at this point to dis-
miss a role for 5-HT receptor changes that might be elicited
by inammatory factors in the evolution of depressive
symptoms.
In the present investigation we focused on central mono-
amine disturbances elicited by LPS and the regrouping
stressor. Yet, it has long been known that immune activa-
tion has profound eects on circulating catecholamines
(Nance and Sanders, 2007), and LPS has been shown to
promote release of catecholamine from phagocytes, and
to increase enzymatic activity related to catecholamine syn-
thesis and degradation (Flierl et al., 2007). Given the inter-
actions that occur between immune and catecholamine
systems, a role for peripheral epinephrine or norepineph-
rine in modulating the sickness behaviors induced by LPS
plus stressors ought to be considered.
5. Conclusion
One of the limitations of the present investigation is that
cytokine levels were measured at only a single time follow-
ing the stressor/LPS challenge, and it is possible that
dynamic variations of circulating cytokines may have been
missed. In this regard, the present data do not speak to
temporal variations of pro- and anti-inammatory levels.
Further to this point, although LPS has been reported to
increase circulating IL-1b levels (Dantzer, 2001; Goujon
et al., 1995; Johnson et al., 2002), this outcome tends to
occur (or at least to be more pronounced) at lengthier inter-
vals following treatment (Bobrowski et al., 2005). In the
present investigation, cytokines were only measured 1.5 h
following the LPS challenge, but in other studies we
observed that 2.5 h following LPS treatment plasma IL-
1b levels were markedly increased (Hayley et al., submitted
for publication). It might also be noted at this juncture,
that in the present investigation sickness, corticosterone
and plasma cytokines were determined 1.5 h following
the LPS treatment. However, as the expression of the latter
requires a lengthier period, brain cytokine and 5-HT
mRNA expression was assessed at 2.5 h following the
treatment. Given the dierent time courses for the eects
of LPS on these systems, it is dicult to relate them directly
to one another.
Finally, the behavioral measure assessed in the present
investigation comprised motor activity and sickness behav-
ior, neither of which captures key symptoms (e.g., anhedo-
nia) of depression, although they may be relevant to the
neurovegetative features associated with the illness. Thus,
although the present ndings are informative with respect
587
to the impact of stressors coupled with LPS challenge, they
do not speak directly to processes that reect the more fun-
damental aspects of major depressive disorder (see Hayley
et al., 2005).
These caveats notwithstanding, the present investigation
demonstrated that when applied concurrently, the regroup-
ing stressor and LPS-induced immune activation, had addi-
tive or synergistic eects on behavioral and neuroendocrine
processes, as well as on circulating pro- and anti-inamma-
tory cytokines. Yet, when the central eects of LPS were
examined, it appeared that regrouping inhibited the LPS-
provoked increase of pro-inammatory cytokine mRNA
expression. The functional signicance of this inhibition
of brain cytokine synthesis is uncertain. Nevertheless, given
the presumed involvement of cytokines in the evolution of
depressive illness, as well as processes related to neuroplas-
ticity, the present ndings point to the importance of
assessing the impact of immune challenges in the context
of background conditions (e.g., ongoing stressors).
Acknowledgments
This research was supported by grants from the Cana-
dian Institutes of Health Research. H. Anisman and S.
Hayley hold Canada Research Chairs in Neuroscience.
References
Anisman, H., Merali, Z., 2003. Cytokines, stress and depressive illness:
brain-immune interactions. Ann. Med. 35, 211.
Anisman, H., Merali, Z., 1999. Anhedonic and anxiogenic eects of
cytokine exposure. Adv. Exp. Med. Biol. 461, 199233.
Anisman, H., Poulter, M.O., Gandhi, R., Merali, Z., Hayley, S., 2007a.
Interferon-alpha eects are exaggerated when administered on a
psychosocial stressor backdrop: cytokine, corticosterone and brain
monoamine variations. J. Neuroimmunol. 186, 4553.
Anisman, H., Prakash, P., Merali, Z., Poulter, M.O., 2007b. Corticotropin
releasing hormone receptor alterations elicited by acute and chronic
unpredictable stressor challenges in stressor-susceptible and resilient
strains of mice. Behav. Brain Res. 181, 180190.
Anisman, H., Merali, Z., Poulter, M.O., Hayley, S., 2005. Cytokines as a
precipitant of depressive illness: animal and human studies. Curr.
Pharm. Des. 11, 963972.
Avitsur, R., Kavelaars, A., Heijnen, C., Sheridan, J.F., 2005. Social stress
and the regulation of tumor necrosis factor-alpha secretion. Brain
Behav. Immun. 19, 311317.
Avitsur, R., Stark, J.L., Sheridan, J.F., 2001. Social stress induces
glucocorticoid resistance in subordinate animals. Horm. Behav. 39,
247257.
Bailey, M.T., Avitsur, R., Engler, H., Padgett, D.A., Sheridan, J.F., 2004.
Physical defeat reduces the sensitivity of murine splenocytes to the
suppressive eects of corticosterone. Brain Behav. Immun. 18, 416424.
Bartolomucci, A., Palanza, P., Gaspani, L., Limiroli, E., Panerai, A.E.,
Ceresini, G., et al., 2001. Social status in mice: behavioral, endocrine
and immune changes are context dependent. Physiol. Behav. 73, 401
410.
Bartolomucci, A., Palanza, P., Sacerdote, P., Ceresini, G., Chirieleison,
A., Panerai, A.E., et al., 2003. Individual housing induces altered
immuno-endocrine responses to psychological stress in male mice.
Psychoneuroendocrinology 28, 540558.
Bartolomucci, A., Palanza, P., Sacerdote, P., Panerai, A.E., Sgoifo, A.,
Dantzer, R., Parmigiani, S., 2005. Social factors and individual
588 J. Gibb et al. / Brain, Behavior, and Immunity 22 (2008) 573589
vulnerability to chronic stress exposure. Neurosci. Biobehav. Rev. 29,
6781.
Bluthe, R.M., Michaud, B., Kelley, K.W., Dantzer, R., 1996. Vagotomy
attenuates behavioral eects of interleukin-1 injected peripherally but
not centrally. Neuroreport 7, 14851488.
Bobrowski, W.F., McDue, J.E., Sobocinski, G., Chupka, J., Olle, E.,
Bowman, A., et al., 2005. Comparative methods for multiplex analysis
of cytokine protein expression in plasma of lipopolysaccharide-treated
mice. Cytokine 32, 194198.
Carobrez, S.G., Gasparotto, O.C., Buwalda, B., Bohus, B., 2002. Long-
term consequences of social stress on corticosterone and IL-1beta
levels in endotoxin-challenged rats. Physiol. Behav. 76, 99105.
Chen, J., Sochivko, D., Beck, H., Marechal, D., Wiestler, O.D., Becker,
A.J., 2001. Activity-induced expression of common reference genes in
individual cns neurons. Lab. Invest. 81, 913916.
Chida, Y., Sudo, N., Kubo, C., 2005. Social isolation stress exacerbates
autoimmune disease in MRL/lpr mice. J. Neuroimmunol. 158, 138
144.
Connor, T.J., Brewer, C., Kelly, J.P., Harkin, A., 2005. Acute stress
suppresses pro-inammatory cytokines TNF-alpha and IL-1 beta
independent of a catecholamine-driven increase in IL-10 production. J.
Neuroimmunol. 159, 119128.
Dantzer, R., 2001. Cytokine-induced sickness behavior: mechanisms and
implications. Ann. N.Y. Acad. Sci. 933, 222234.
Day, H.E., Curran, E.J., Watson Jr., S.J., Akil, H., 1999. Distinct
neurochemical populations in the rat central nucleus of the amygdala
and bed nucleus of the stria terminalis: evidence for their selective
activation by interleukin-1beta. J. Comp. Neurol. 413, 113128.
Dantzer, R., Bluthe, R.M., Laye, S., Bret-Dibat, J.L., Parnet, P., Kelley,
K.W., 1998. Cytokines and sickness behavior. Ann. NY Acad. Sci.
840, 586590.
Duman, R.S., Monteggia, L.M., 2006. A neurotrophic model for stress-
related mood disorders. Biol. Psychiat. 59, 11161127.
Dunn, A.J., Swiergiel, A.H., de Beaurepaire, R., 2005. Cytokines as
mediators of depression: what can we learn from animal studies?
Neurosci. Biobehav. Rev. 29, 891909.
Ek, M., Kurosawa, M., Lundeberg, T., Ericsson, A., 1998. Activation of
vagal aerents after intravenous injection of interleukin-1beta: role of
endogenous prostaglandins. J. Neurosci. 18, 94719479.
Engler, H., Engler, A., Bailey, M.T., Sheridan, J.F., 2005. Tissue-
specic alterations in the glucocorticoid sensitivity of immune cells
following repeated social defeat in mice. J. Neuroimmunol. 163,
110119.
Flierl, M.A., Rittirsch, D., Nadeau, B.A., Chen, A.J., Sarma, J.V.,
Zetoune, F.S., McGuire, S.R., List, R.P., Day, D.E., Hoesel, L.M.,
Gao, H., Van Rooijen, N., Huber-Lang, M.S., Neubig, R.R., Ward,
P.A., 2007. Phagocyte-derived catecholamines enhance acute inam-
matory injury. Nature 449, 721725.
Franklin, K.B.J., Paxinos, G., 1997. A Stereotaxic Atlas of the Mouse
Brain. Academic Press, San Diego, CA.
Gandhi, R., Hayley, S., Gibb, J., Merali, Z., Anisman, H., 2007. Inuence
of poly I:C on sickness behaviors, plasma cytokines, corticosterone
and central monoamine activity: moderation by social stressors. Brain
Behav. Immun. 21, 477489.
Goujon, E., Parnet, P., Laye, S., Combe, C., Kelley, K.W., Dantzer, R.,
1995. Stress downregulates lipopolysaccharide-induced expression of
proinammatory cytokines in the spleen, pituitary, and brain of mice.
Brain Behav. Immun. 9, 292303.
Hayley, S., Borowski, T., Merali, Z., Anisman, H., 2001. Central
monoamine activity in genetically distinct strains of mice following a
psychogenic stressor: eects of predator exposure. Brain Res. 892, 293
300.
Hayley, S., Brebner, K., Lacosta, S., Merali, Z., Anisman, H., 1999.
Sensitization to the eects of tumor necrosis factor-a: neuroendocrine,
central monoamine, and behavioral variations. J. Neurosci. 19, 5654
5665.
Hayley, S., Mangano, M., Strickland, M., Anisman, H., submitted for
publication. Lipopolysaccharide and a social stressor inuence behav-
iour, corticosterone and cytokine levels: divergent actions in cycloox-
ygenase-2 decient mice and wild type controls. J. Neuroimmunol.
Hayley, S., Poulter, M.O., Merali, Z., Anisman, H., 2005. The pathogen-
esis of clinical depression: stressor- and cytokine-induced alterations of
neuroplasticity. Neuroscience 135, 659678.
Herman, J.P., Cullinan, W.E., 1997. Neurocircuitry of stress: central
control of hypothalamopituitaryadrenocortical axis. Trends Neuro-
sci. 20, 7884.
Johnson, J.D., OConnor, K.A., Deak, T., Stark, M., Watkins, L.R.,
Maier, S.F., 2002. Prior stressor exposure sensitizes LPS-induced
cytokine production. Brain Behav. Immun. 16, 461476.
Kelley, K.W., Bluthe, R.M., Dantzer, R., Zhou, J.H., Shen, W.H.,
Johnson, R.W., et al., 2003. Cytokine-induced sickness behavior.
Brain Behav. Immun. 17, S112S118.
Kim, J.W., Kirkpatrick, B., 1996. Social isolation in animal models of
relevance to neuropsychiatric disorders. Biol. Psychiat. 40, 918922.
Konsman, J.P., Parnet, P., Dantzer, R., 2002. Cytokine-induced sickness
behavior: mechanisms and implications. Trends Neurosci. 25, 154159.
Laamme, N., Rivest, S., 2001. Toll-like receptor 4: The missing link of
the cerebral innate immune response triggered by circulating gram-
negative bacterial cell wall components. FASEB J. 15, 155163.
Lebel, E., Vallieres, L., Rivest, S., 2000. Selective involvement of
interleukin-6 in the transcriptional activation of the suppressor of
cytokine signaling-3 in the brain during systemic immune challenges.
Endocrinology 141, 37493763.
LeMay, L.G., Vander, A.J., Kluger, M.J., 1990. The eects of psycho-
logical stress on plasma interleukin-6 activity in rats. Physiol. Behav.
47, 957961.
Linthorst, A.C.E., Flachskamm, C., Muller-Preuss, P., Holsboer, F.,
Reul, J.M.H.M., 1995. Eect of bacterial endotoxin and interleukin-1b
on hippocampal serotonergic neurotransmission, behavioral activity,
and free corticosterone levels: an in vivo microdialysis study. J.
Neurosci. 15, 29202934.
Liu, H., Wang, Z., 2005. Eects of social isolation stress on immune
response and survival time of mouse with liver cancer. World J.
Gastroenterol. 11, 59025904.
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression
data using real-time quantitative PCR and the 2(-Delta Delta C(T))
Method. Methods 25, 402408.
Martinez, M., Calvo-Torrent, A., Pico-Alfonso, M.A., 1998. Social defeat
and subordination as models of social stress in laboratory rodents: a
review. Aggress. Behav. 24, 241.
Merali, Z., Du, L., Hrdina, P., Palkovits, M., Faludi, G., Poulter, M.O.,
Anisman, H., 2004. Dysregulation in the suicide brain: mRNA
expression of Corticotropin Releasing Hormone Receptors and
GABAA Receptor subunits in Frontal Cortical Brain Region. J.
Neurosci. 24, 14781485.
Merali, Z., Lacosta, S., Anisman, H., 1997. Eects of interleukin-1beta
and mild stress on alterations of norepinephrine, dopamine and
serotonin neurotransmission: a regional microdialysis study. Brain
Res. 761, 225235.
Merlot, E., Moze, E., Dantzer, R., Neveu, P.J., 2004. Cytokine production
by spleen cells after social defeat in mice: activation of T cells and
reduced inhibition by glucocorticoids. Stress 7, 5561.
Merlot, E., Moze, E., Dantzer, R., Neveu, P.J., 2003. Importance of
ghting in the immune eects of social defeat. Physiol. Behav. 80, 351
357.
Michaud, D.S., McLean, J., Keith, S.E., Ferrarotto, C., Hayley, S., Khan,
S.A., Anisman, H., Merali, Z., 2003. Dierential impact of audiogenic
stressors on Lewis and Fischer rats: behavioral, neurochemical, and
endocrine variations. Neuropsychopharmacology 28, 10681081.
Millan, M.J., 2006. Multi-target strategies for the improved treatment of
depressive states: conceptual foundations and neuronal substrates,
drug discovery and therapeutic application. Pharmacol. Ther. 110,
135370.
MohanKumar, P.S., Quadri, S.K., 1993. Systemic administration of
interleukin-1 stimulates norepinephrine release in the paraventricular
nucleus. Life Sci. 52, 19611967.
 J. Gibb et al. / Brain, Behavior, and Immunity 22 (2008) 573589
Morrow, B.A., Redmond, A.J., Roth, R.H., Elsworth, J.D., 2000. The
predator odor, TMT, displays a unique, stress-like pattern of dopa-
minergic and endocrinological activation in the rat. Brain Res. 864,
146151.
Nance, D.M., Sanders, V.M., 2007. Autonomic innervation and regula-
tion of the immune system (1987-2007). Brain Behav. Immun. 21, 736
745.
Nutt, D.J., 2002. The neuropharmacology of serotonin and noradrenaline
in depression. Int. Clin. Psychopharmacol. 17, S1S12.
Pardon, M.C., Kendall, D.A., Perez-Diaz, F., Duxon, M.S., Marsden,
C.A., 2004. Repeated sensory contact with aggressive mice rapidly
leads to an anticipatory increase in core body temperature and physical
activity that precedes the onset of aversive responding. Eur. J.
Neurosci. 20, 10331050.
Planas, A.M., Gorina, R., Chamorro, A., 2006. Signalling pathways
mediating inammatory responses in brain ischaemia. Biochem. Soc.
Trans. 4, 12671270.
Puch, C.R., Nguyen, K.T., Gonyea, J.L., Fleshner, M., Watkins, L.R.,
Maier, S.F., et al., 1999. Role of interleukin-1 beta in impairment of
contextual fear conditioning caused by social isolation. Behav. Brain
Res. 106, 109118.
Quan, N., Avitsur, R., Stark, J.L., He, L., Shah, M., Caligiuri, M., et al.,
2001. Social stress increases the susceptibility to endotoxic shock. J.
Neuroimmunol. 115, 3645.
Raison, C.L., Capuron, L., Miller, A.H., 2006. Cytokines sing the blues:
inammation and the pathogenesis of depression. Trends Immunol.
27, 2431.
Rivest, S., 2003. Molecular insights on the cerebral innate immune system.
Brain Behav. Immun. 17, 1319.
Schiepers, O.J.G., Wichers, M.C., Maes, M., 2005. Cytokines and major
depression. Prog. Neuropsychopharmacol. Biol. Psychiatry 29, 201
217.
Sheridan, J.F., Stark, J.L., Avitsur, R., Padgett, D.A., 2000. Social
disruption, immunity, and susceptibility to viral infection. Role of
glucocorticoid insensitivity and NGF. Ann. NY Acad. Sci. 917, 894905.
Shintani, F., Kanba, S., Nakaki, T., Nibuya, M., Kinoshita, N., Suzuki,
E., et al., 1993. Interleukin-1 beta augments release of norepinephrine,
dopamine, and serotonin in the rat anterior hypothalamus. J.
Neurosci. 13, 35743581.
Skultetyova, I., Tokarev, D., Jezova, D., 1998. Stress-induced increase in
blood-brain barrier permeability in control and monosodium gluta-
mate-treated rats. Brain Res. Bull. 45, 175178.
589
Song, C., Merali, Z., Anisman, H., 1999. Variations of nucleus accumbens
dopamine and serotonin following systemic interleukin-1, interleukin-2
or interleukin-6 treatment. Neuroscience 88, 823836.
Stefanski, V., 2000. Social stress in laboratory rats: hormonal responses
and immune cell distribution. Psychoneuroendocrinology 25, 389406.
Stockmeier, C.A., 2003. Involvement of serotonin in depression: evidence
from postmortem and imaging studies of serotonin receptors and the
serotonin transporter. J. Psychiatr. Res. 37, 357373.
Svenningsson, P., Chergui, K., Rachle, I., Flajolet, M., Zhang, X., El
Yacoubi, M., et al., 2006. Alterations in 5-HT1B receptor function by
p11 in depression-like states. Science 311, 7780.
Teeling, J.L., Felton, L.M., Deacon, R.M., Cunningham, C., Rawlings,
J.N., Perry, V.H., 2007. Sub-pyrogenic systemic inammation impacts
on brain and behavior, independent of cytokines. Brain Behav.
Immun. 21, 836850.
Tuchscherer, M., Kanitz, E., Puppe, B., Tuchscherer, A., 2006. Early
social isolation alters behavioral and physiological responses to an
endotoxin challenge in piglets. Horm. Behav. 50, 753761.
Turrin, N.P., Gayle, D., Ilyin, S.E., Flynn, M.C., Langhans, W.,
Schwartz, G.J., Plata-Salaman, C.R., 2001. Pro-inammatory and
anti-inammatory cytokine mRNA induction in the periphery and
brain following intraperitoneal administration of bacterial lipopoly-
saccharide. Brain Res. Bull. 54, 443453.
Verma, S., Nakaoke, R., Dohgu, S., Banks, W.A., 2006. Release of
cytokines by brain endothelial cells: a polarized response to lipopoly-
saccharide. Brain Behav. Immun. 20, 449455.
Wang, J., Campbell, I.L., 2002. Cytokine signaling in the brain: putting a
SOCS in it? J. Neurosci. Res. 67, 423427.
Weiss, I.C., Pryce, C.R., Jongen-Relo, A.L., Nanz-Bahr, N.I., Feldon, J.,
2004. Eect of social isolation on stress-related behavioral and
neuroendocrine state in the rat. Behav. Brain Res. 152, 279295.
Windle, R.J., Wood, S., Shanks, N., Perks, P., Conde, G.L., da Costa,
A.P., Ingram, C.D., Lightman, S.L., 1997. Endocrine and behavioural
responses to noise stress: comparison of virgin and lactating female
rats during non-disrupted maternal activity. J. Neuroendocrinol. 9,
407414.
Wu, W., Yamaura, T., Murakami, K., Murata, J., Matsumoto, K.,
Watanabe, H., et al., 2000. Social isolation stress enhanced liver
metastasis of murine colon 26-L5 carcinoma cells by suppressing
immune responses in mice. Life Sci. 66, 18271838.
Yirmiya, R., 1996. Endotoxin produces a depressive-like episode in rats.
Brain Res. 711, 163174.