ORIGINAL ARTICLE

Detection of Carbapenemase Encoding Genes

in Enterobacteriace, Pseudomonas aeruginosa, and
Acinetobacter baumanii Isolated from Patients at
Intensive Care Unit Cipto Mangunkusumo Hospital in 2011

Anis Karuniawati, Yulia R. Saharman, Delly C. Lestari

Department of Microbiology, Fauclty of Medicine, University of Indonesia, Jakarta, Indonesia.

Correspondence mail:
Department of Microbiology, Fauclty of Medicine, University of Indonesia. Jl. Pegangsaan Timur 16, Jakarta 10430,
Indonesia. email: akaruniawati@yahoo.com.

ABSTRAK
Tujuan: untuk menentukan prevalensi gen yang mengode karbapenemase (blaIMP-1, blaVIM-2,
blaKPC-2, blaOXA-48, dan blaNDM-1) pada mikroorganisme patogen resisten terhadap karbapenem, yakni
Enterobacteriaceae, Pseudomonas aeruginosa dan Acinetobacter baumanii yang diisolasi dari pasien di ICU
RSCM pada tahun 2011. Metode: gen pengode karbapenemase diperiksa di laboratorium mikrobiologi klinik
(LMK) FKUI/RSCM. Untuk mendeteksi gen yang resisten, digunakan metode PCR dupleks dan simpleks.
Hasil: ditemukan bahwa 4 (5%) galur P. aeruginosa membawa gen blaIMP-1 dan seluruhnya diisolasi dari
sputum. Prevalensi resistensi karbapenem pada bakteri Gram-negatif yang diisolasi dari ICU RSCM adalah 27,6%
untuk Enterobacteriaceae, 21,9% untuk P. aeruginosa dan 50,5% untuk A. baumannii. Gen pengode metallo--
laktamase New Delhi ditemukan pada 1 sediaan K. pneumonia yang juga diisolasi dari sputum. Gen lainnya, yakni
blaKPC-2, blaVIM-2, dan blaOXA-48 tidak ditemukan pada isolasi apa pun. Tidak adanya gen lain menunjukkan
bahwa mekanisme lain mungkin berperan dalam terjadinya resistensi karbapenem pada mikroorganisme pathogen
yang diisolasi dari ICU-RSCM. Penelitian ini membuktikan bahwa prevalensi bakteri Gram-negatif yang resisten
terhadap karbapenem di ICU RSCM pada tahun 2011 ternyata cukup tinggi. Gen pengode karbapenemase, yang
ditemukan pada bakteri Gram-negatif yang resisten terhadap karbapenem adalah blaIMP-1 dan blaNDM-1.

Kata kunci: Enterobacteriaceae, P. aeruginosa, A. baumanii, gen pengode karbapenemase.

ABSTRACT
Aim: to determine the prevalence of carbapenemase encoding genes (blaIMP-1, blaVIM-2, blaKPC-2,
blaOXA-48, and blaNDM-1) of carbapenem-resistant Enterobacteriaceae, Pseudomonas aeruginosa and
Acinetobacter baumanii isolated from the intensive care unit patients as pathogens, in Cipto Mangunkusumo hospital
(ICU-RSCM) in 2011. Methods: we examined the carbapenemase encoding genes in the clinical microbiology
laboratory (LMK FKUI/RSCM). Duplex- and simplex PCR methods were conducted to detect the resistant
genes. Results: we found 4 (5%) P. aeruginosa strains carry blaIMP-1 gene and all were isolated from sputum
specimens. The prevalence of carbapenem resistant among Gram-negative bacilli isolated from ICU-RSCM, are
Enterobacteriaceae 27.6%, P. aeruginosa 21.9%, and A. baumannii 50.5%. The New Delhi Metallo--lactamase
encoding gene (blaNDM-1) was detected in 1 K. pneumonia isolated from sputum as well. The other genes, i.e.
blaKPC-2, blaVIM-2, and blaOXA-48 were not found in any isolates. The absence of other genes indicated that
other mechanisms may play a role in the occurrence of carbapenem resistance in pathogens isolated in ICU-
RSCM. Conclusion: this study confirmed that the prevalence of carbapenems resistant Gram-negative bacilli in

Acta Medica Indonesiana - The Indonesian Journal of Internal Medicine 101

Anis Karuniawati
ICU-RSCM in 2011 was high. The carbapenemase encoding genes, which were detected among the carbapenems
resistant Gram-negative bacilli, were blaIMP-1 and blaNDM-1.
Key words: Enterobacteriaceae, P. aeruginosa, A. baumanii, carbapenemase encoding genes.
INTRODUCTION
Antibiotic use and misuse are particularly high
in hospitals where doctors treat many patients
without any indication of infection or suspected
infection. In many cases, patients are treated
without proper microbiological diagnosis, so the
attending doctor does not really know what the
cause of the patients illness is.1 In the past few
decades an alarming increase in the prevalence
of resistant antimicrobial pathogens of serious
hospital acquired infections has been shown
worldwide, including Indonesia. The prevalence
of multidrug-resistant organisms isolated in
the intensive care unit (ICU) setting may be
significantly higher than in other hospital wards.2
Cipto Mangunkusumo Hospital is a 1,200
bed academic hospital, affiliated to the Faculty of
Medicine, Universitas Indonesia. It is generally
considered to be the top referral centre of
specialist medical care and of specialist training
in all medical disciplines in Indonesia. ICU
is one of the facilities with 80 admissions of
critically ill patients per month. In 2008, many
of microorganisms causing infection in the ICU
are multidrug-resistant organisms (MDROs)
including methicillin resistant Staphylococcus
aureus (MRSA, 8.8%) and extended spectrum
-lactamase (ESBL) producing Gram-negative
bacilli (16.5%).3
Currently the use of broad spectrum
antibiotics, especially carbapenems, is increasing
due to the high prevalence of multidrug resistant
pathogens. The data on the prevalence of
carbapenem resistant and the carbapenemase
encoding genes in Indonesia is not yet available.
The objectives of study is to determine the
prevalence of carbapenem resistant organisms and
the carbapenemase encoding genes (blaIMP-1,
blaVIM-2, blaKPC-2, blaOXA-48, and
blaNDM-1) of Enterobacteriaceae, Pseudomonas
aeruginosa and Acinetobacter baumanii isolated
from patients in the intensive care unit of Cipto
Mangunkusumo Hospital (ICU-RSCM) in 2011,
102
Acta Med Indones-Indones J Intern Med
were examined in the clinical microbiology
laboratory, Department of Microbiology, Faculty
of Medicine, Universitas Indonesia, Cipto
Mangunkusumo Hospital (LMK FKUI/RSCM).
METHODS
Bacteria. For optimization and control
positive of the multiplex-PCR, we used some well
characterized strains. The strains were Klebsiella
pneumoniae carrying blaNDM-1; Pseudomonas
aeruginosa carrying blaVIM-2; Enterobacter
cloacae carrying blaOXA-48; and Klebsiella
pneumoniae carrying blaIMP-1. Those strains
were purchased from Service de Bactriologie-
Virologie, INSERM U914 Emerging Resistance
to Antibiotics, Hpital de Bictre, Assistance
Publique/Hpitaux de Paris, Facult de Mdecine
Paris-Sud, Universit Paris XI, 94275 K.-Bictre,
France, through the correspondence with Dr.
Laurent Poirel. The positive control used for
blaKPC-1 gene was Klebsiella pneumoniae ATCC
BAA 1708 (Oxoid).
The clinical species from the family
Enterobacteriaceae, Pseudomonas aeruginosa
and Acinetobacter baumanii were recultured from
the stock collection of the clinical microbiology
laboratory, Department of Microbiology, Faculty
of Medicine, Universitas Indonesia, Cipto
Mangunkusumo Hospital (LMK FKUI/RSCM).
All those Gram-negative bacilli were isolated
from patients in ICU-RSCM in 2011. All bacteria
were reidentified biochemically and retested for
the drug susceptibility tests using disk diffusion
methods according to updated CLSI.
Prevalence of carbapenems resistant
Gram-negative bacilli. Data about isolates and
the susceptibility tests were retrieved from the
WHONET 5.6 software used in LMK-FKUI/
RSCM. The stocks used in this study were only
the carbapenem-resistant strains.
DNA extraction. The DNA extraction was
performed from fresh culture using boiling
techniques.
Vol 45 Number 2 April 2013 Detection of Carbapenemase encoding genes in ICU patients

Table1. Oligonucleotides used in this study3

Primers Sequences Genes Size (bp)

IMP-F GGAATAGAGTGGCTTAAYTCT blaIMP-1 232
IMP-R CGGTTTAAYAAAACAACCACC
VIM-F GATGGTGTTTGGTCGCATA blaVIM-2 390
VIM-R CGAATGCGCAGCACCAG
KPC-Fm CGTCTAGTTCTGCTGTCTTG blaKPC-2 798
KPC-Rm CTTGTCATCCTTGTTAGGCG
OXA-F GCGTGGTTAAGGATGAACAC blaOXA-48 438
OXA-R CATCAAGTTCAACCCAACCG
NDM-F GGTTTGGCGATCTGGTTTTC blaNDM-1 621
NDM-R CGGAATGGCTCATCACGATC

PCR method. The primers used in this Committee (Letter no. 705/H2.F1/ETIK/2012).
study (Table 1) are based on primers published Role of The Funding Source
by Poirel et al.4 The PCR mixtures were 10X The sponsor of the study had no role in
PCR Buffer 2.5 l, 25 mM MgCl2 1 l, 10 mM study design, data collection, data analysis,
dNTPmix 0.6 l, 5XQ solution 5 l, 100 M data interpretation or writing of the report. The
each primers 1 l (except OXA 0.4 l), Hotstar corresponding author had full access to all the
DNA polymerase 0.15 l, DNA sample 2 l, and data in the study and had final responsibility for
DNase free water. The thermal cycling conditions the decision to submit for publication.
of each reactions are stated in Table 2. The
amplicon were analyzed by electrophoresis in a
RESULTS
1.5% agarose gel.
Eighty one strains from the stock collection
Ethical Clearance were reconfirmed as Gram-negative bacilli and
This study has passed ethical evaluation by resistant to at least one agent of carbapenem
the Faculty of Medicine, Universitas Indonesia class (imipenem or meropenem or doripenem).
and Cipto Mangunkusumo Hospital Ethics The strains were collected from hospital-
acquired infection cases in the ICU of Cipto
Table 2. The thermal cycling conditions used in the Mangunkusumo Hosiptal in 2011 with the
amplification reactions specimens types stated in Table 3. Most of
Primers Temperature Time Cycle the bacteria were isolated from sputum (61) of
IMP and VIM 95 C
0
15 minutes 1x patients with pneumonia.
940C 30 seconds 36x Based on the data retrieved from the
530C 20 seconds WHONET 5.6 software used in LMK-FKUI/
720C 50 seconds RSCM, the prevalence of carbapenems
720C 5 minutes 1x (imipenem/meropenem/doripenem) resistance
KPC and OXA 95 C
0
15 minutes 1x among Gram-negative bacilli isolated from
940C 30 seconds 40x ICU-RSCM, were Enterobacteriaceae 27.6%,
500C 30 seconds Pseudomonas aeruginosa 21.9%, and of
720C 50 seconds Acinetobacter baumanii 50.5%.
75 C
0
5 minutes 1x Positive controls yielded expected bands and
NDM 950C 15 minutes 1x confirmed the specificity of the PCR primers
94 C
0
30 seconds 40x used (Figure 1). The primer pairs were tested
500C 30 seconds in simplex PCR (only one gene screened, for
720C 50 seconds blaNDM-1 gene) and with a multiplex approach.
750C 5 minutes 1x We could not use all primers in single reaction

103
Anis Karuniawati Acta Med Indones-Indones J Intern Med

Table 3. Number of bacteria and the specimen types from which the bacteria were isolated

Bacteria No. of isolates Specimen types No. of speciments

Enterobacteriaceae
-- Klebsiella pneumonia 18 Sputum 11
Intra Abdominal 1
Urine 2
Swab 1
Tissue 3
-- Escherichia coli 2 Urine 2
-- Klebsiella oxytoca 1 Sputum 1
-- Enterobacter cloacae 1 Swab 1
-- Citrobacter freundii 1 Sputum 1
-- Proteus mirabilis 1 Pus 1
-- Salmonella arizonae 1 Blood 1
-- Serratia odorifera 1 Lokhia 1
-- Edwardsiella tarda 1 Swab 1

Pseudomonas aeruginosa 21 Sputum 16

Tissue 1
Urine 2
Wound swab 1
Cerebrospinal fluid 1

Acinetobacter baumanii 42 Sputum 34

Blood 6
Urine 1
Tissue 1

390bp 798bp 621bp

232bp bp
438bp
bp

A B C

Figure 1. Agarose gel electrophoresis (2%) used for separation of the different multiplex PCR products. Lanes
labeled K- correspond to blank controls. (A) Results of multiplex no. 1 detecting blaIMP-1 and blaVIM-2 genes;
lane multi, the DNA sample was containing both genes. (B) Results of multiplex no. 2 detecting blaKPC-2 and
blaOXA-48 genes;. (C) Results of multiplex no. 3 detecting blaNDM-1 gene. The size of each amplicon is indicated
on the right. The ladder used is the 100 kb DNA ladder (Thermo Scientific).

104
Vol 45 Number 2 April 2013 Detection of Carbapenemase encoding genes in ICU patients
but should be separated in three conditions.
We found 4 (5%) isolates carry blaIMP-1
gene and all of them are Pseudomonas aeruginosa.
From these 4-blaIMP-1-positives Pseudomonas
aeruginosa, all were isolated from sputum
specimens. The New Delhi metallo--lactamase
(blaNDM-1) gene was found in 1 Klebsiella
pneumonia, which is isolated from sputum
specimen. None of other genes, blaVIM-2;
blaKPC-2; and blaOXA-48, were identified in
all bacteria investigated in this study.
DISCUSSION
Resistance rates are increasing among several
Gram-negative bacteria, especially in the family
Enterobacteriaceae, Pseudomonas aeruginosa
and Acinetobacter baumanii. The presence of
these resistant organisms has been limited the
choice of appropriate antibiotic therapy. There
are three mechanism of resistance against
-lactam antibiotic, including carbapenems. These
mechanisms are the production of -lactamase
which cleave the amide bond of the -lactam ring,
the possession of an altered or acquired penicillin
binding protein with low affinity for -lactams
and over expression of efflux pump mechanism.4
The production of -lactamase
(carbapenemase) enzyme is the most common
mechanism of resistance. There are many genes
responsible for this and the most frequent genes
are carried by class 1 integrons, i.e. serine--
lactamase class A (KPC), serine--lactamase
class D (OXA), and metallo--lactamase class
B (VIM, IMP, NDM, and NDM-1). Among
those genes, IMP and VIM types have been
identified distantly related geographical areas
among many different Enterobacteriacea and
Pseudomonas spp. The emergence of the Ambler
class A KPC -lactamase is mostly reported in
Klebsiella pneumonia, but it could be found
also in Pseudomonas aeruginosa, Escherichia
coli, and Acinetobacter baumannii in the United
States, Israel, and Greece.2
There are limited studies about molecular
epidemiology of resistance pathogens in Asia,
particularly in Indonesia. This study is the first
investigation about the genotype prevalence of
carbapenems resistant Gram-negative bacilli in
Indonesia. Based on the disk diffusion methods
(CLSI, 2012), the prevalence of carbapenems
resistance among Gram-negative bacilli isolated
from ICU-RSCM in 2011, are Enterobacteriaceae
27.6%, Pseudomonas aeruginosa 21.9%, and
of Acinetobacter baumanii 50.5%. A study
conducted in National Taiwan University Hospital
in 2005 reported that 49% from 81 Acinetobacter
spp. from clinical specimens were carbapenem-
resistant.5
Simplex- and Duplex-PCR methods were
conducted to find the resistant genes, and we
found 4 (5%) isolates carry blaIMP-1 gene
and all of them are Pseudomonas aeruginosa.
Plasmid-mediated imipenem (IMP)-type
carbapenemases is a form of metallo--lactamse,
which consists of nearly 20 varieties currently.
These enzymes were established in Japan in the
1990s, in Enterobacteriaceae, Pseudomonas
sp., and Acinetobacter sp. and had emerged
widely throughout Asia, Europe, and America.
The enzymes hydrolyze all -lactams except
monobactams, and evade all -lactam inhibitors
currently available.6
The New Delhi metallo--lactamase
(blaNDM-1) gene was found in 1 Klebsiella
pneumonia, which is isolated from sputum
specimen. The blaNDM-1 gene was originally
described in Klebsiella pneumoniae from New
Delhi in 2009. Currently the gene widespread
in other Enterobacteriaceae and Acinetobacter
baumannii, and in other countries including
United States and United Kingdom.5,6
No other genes were identified in all samples.
The absence of other genes indicate that other
mechanisms play a role in the occurrence of
carbapenems resistance in pathogens isolated in
ICU-RSCM. The DNA of all bacterial isolates
should be sequenced to know the exact resistance
mechanisms.
CONCLUSION
This study confirmed that the prevalence of
carbapenem-resistant Gram-negative bacilli in
ICU-RSCM in 2011 is high. The carbapenemase
encoding genes, which were detected among the
carbapenems resistant Gram- negative bacilli,
were blaIMP-1 and blaNDM-1. Further studies
should be done to elucidate the resistance
mechanisms occurring in other isolates.
105
Anis Karuniawati Acta Med Indones-Indones J Intern Med

ACKNOWLEDGMENTS
This work was fully supported by Universitas
Indonesia research grant (Hibah Madya UI
2012).

REFFERENCES
1. Lestari ES. Antimicrobial resistance in Indonesia;
Prevalence, determinant and genetic basis. Rotterdam:
Erasmus University; 2009. Dissertation.
2. Siege JD, Jackson M. Healthcare infection control
practices advisory committee. Management of
multidrug-resistant organisms in health care settings.
Am J Infect Control. 2007;35 (10 Suppl 2):S165-93.
3. Saharman YR. Bakteri orofaring dan bakteri lingkungan
sebagai penyebab ventilator associated pneumonia
(VAP) di ruang ICU/HCU RSUPN-CM. Jakarta:
Universitas Indonesia; 2008.
4. Poirel L, Walsh TR, Cuvillier V, Nordmann P. Multiplex
PCR for detection of acquired carbapenemase genes.
Diag Microbiol Infect Dis. 2011;70:11923.
5. Lin Yu-Chi, Sheng WH, Chen YC, et al. Differences
in carbapenem resistance genes among Acinetobacter
baumannii, Acinetobacter genospecies 3 and
Acinetobacter genospecies 13TU in Taiwan. Int J
Antimicrobiol Agents. 2010;35:43943.
6. Barie PS. Multidrud-resistant organisms and antibiotic
management. Surg Clin N Am. 2012;92:34591.

106