Brain Research (2017) 1-5 Lauren Earley
Reduction of calpain induced tau
phosphorylation and
neurofibrillary tangles to avert
neurodegeneration in Alzheimers
disease
Lauren M. Earley
Methods and Materials
PCR amplification/PCR cleanup/PCR
screening of insert
PCR amplification and for calpain-
ASD with Taq DNA polymerase was
performed in 100 ul of solution containing
1.0 ul of 1 kb tTemplate DNA (New
England biolabsNEB), 2.0 ul of forward
primer (.00079 uM) CALP_XbaI.S: 5 (GG
GTTCTTAGAATTAAGTATTAGACAAA
AAAGAAAATTTG) 3 and 2.0 ul of
reverse primer (12ng.00093 uM)
CALP_PstI.A: 3
(TCTATCATTACCTGCATGCAC
ATGTAAAGC) 5), 12x GoTaq green 50 ul
(Promega), and 45ul of ddH2O. Purified
recombinant calpain plasmid was performed
in 50ul of solution containing 1ul of purified
DNA, 1ul of forward (.00079uM) and
reverse primer (12ng),.00093uM) 1x goTaq
green 25ul ( 20uM dNTPs, 1.5uM MgCl2, 1x
Buffer, 1x Taq polymerase)(Promega), and
ddH20 22ul. Forward primer Sequence 5
TCTAGAGGGTTCTTAGAATTAAGTAT
TAGACAAAAAAGAAAATTTG 3
Reverse Primer sequence 3
CTGCAGTCTATCATTACCTGCATGCA
CATGTAAAGC 5. PCR was performed
under the following conditions: initial
denaturation (94 degrees) 5 min, initial
annealing (50C), initial extension (60C) 2
min, 5 min, 8 min respectfully.
Ddenaturation (94C) for 5 min, initial
Page |1
annealing (50C) 2 min, annealing (50C),
extension (60C) 2 min, initial extension
(60C) 8 min, 5 min, extension (60C) 8
min, with final extension (60C) at 8 min.
PCR purification was performed according
to the instructions found with the QIAquick
PCR purification kit (Qiagen). Step 2 in the
procedure was omitted and QIAquick 50 uL
of elution buffer was addedcolumn was
eluted with 50ulL of EB buffer. to QIAquick
membrane.
Restriction digest/ Restriction
mapping of insert
Restriction digestion of 30ul purified
calpain-ASD PCR product with 1.2ul XbaI
(0.5U) and 0.8ul PstI (0.5U) (NEB) were
performed in 4ul of reaction buffer #3
(1x)(NEB) supplemented with 4ul of bovine
serum albumin (1x) (BSA)(NEB). Contents
combined and placed in 37 C water bath for
1 hour. For restriction mapping 10uL of
Xbal/Pstl digested plasmid and 1uL of uncut
plasmid, and 1kb ladder were ran in
electrophoresis gel for analysis.
Agarose gel electrophoresis/ gel
purification
A 0.8% gel was prepared with 0.4 g Formatted: Subscript
of agarose, 40mL ofin 1x TAE, 1 ul ofwith
EtBr. solution was prepared and poured in
electrophoresis apparatus to set. Amplified Formatted: Font: (Default) Times New Roman, 12 pt
Calpain-ASD PCR product was loaded in
the well and ran for 1 hour at 100 volts with
1kb ladder (New England BiolabNEB). A 1 Formatted: Font: (Default) Times New Roman, 12 pt
% agarose gel was also used in 1x TAE at
100 volts for 45 min. with 1kb ladder. for
gel purification. used. Purification of Gel
extraction and purification performed
according to instructions found in the
QIAquick gel purification kit (Qiagen) wi.
 Brain Research (2017) 1-5 Lauren Earley Page |2

th exceptions. Steps 5 and 14 were were combined and placed in ice for 30 min.
omitted from the procedure.. With step 10 Bacteria was heat-shocked for 30 sec. in
column was allowed to sit for 5 min.For step
10 in the procedure the QIAquick column Fig. 1 Calpain
sat for 5min. Optional step 9 was amplification Gel
used.followed and the cColumn was eluted electrophoresis. 0.8%
agarose gel for 1 hour
with 30uL of EB buffer. with 1X TAE buffer.
Calpain-ASD band
Restriction digest/ Restriction
appears at 1.5 kb band.
mapping of insert
Restriction digestion of 30ul purified
calpain-ASD PCR product with 1.2ul XbaI 42C water bath and . pPlaced back on ice
(0.5U/ul) and 0.8ul PstI (0.5U/ul) (NEB) for 2 min. Contents was sShaken in 250ul of
were performed in 4ul of reaction buffer #3 soc.SOC medium for 1 hour at 37C. 50ul
(1x)(NEB), loading dye (1x) 8ul, of X-gal (25.5mg/ulL /ul) was added to agar
supplemented with 4ul of bovine serum plates, spread with glass beads, and placed
albumin (1x) (BSA)(NEB). Contents in incubator. and bBacteria plated on agar
combined and place in 37 C water bath for plates at 20ul and 200ul on LB-AMP plates
1 hour. For restriction mapping 10uL of RE and i. Incubated at 37C for 18hrs.
digested plasmid and 1uL of uncut plasmid,
and 1kb ladder were ran in electrophoreisis
gel for analysis. Samples of single colonies of
transformed E.coli DH5 were placed in 4
Contents stored in -20C freezer. Materials
tubes containing 3ul of LB-AMP. Two
purchased at New England Biolabs.
recombinant calpain-ASD/pUC19 colonies
Ligation/ Transformation (white colonies #1 and #2) from
transformation, one vector only colony (blue
DNA ligation with 15-ul Xbal/Pstl colony) from transformation, and 1
cut calpain-ASD gene was incubated with 1 recombinant colony (white colony) from
ul Xbal/Pstl cut phosphatase-treated pUC19 control plate. Cultures were incubated at
in 2ul 1X T4 DNA ligase reaction buffer 37C in shaker overnight at 225rpm.
(50mM Tris-HCl, pH 7.5, 10 mM MgCl2,
1mM ATP, 10 mM dithiolthreitol), 1ul DNA
ligase enzyme (NEB), 1ul ddH2O.
Reactants were placed in PCR
machineincubated overnight (18hrs) at 16C
and. Then set at 65C for 10 min to heat kill
ligase.
Materials procured from New
England Biolabs. Transformation was
performed with 50ul of E.coli DH5 cells
and , 10ul of recombinant calpain-ASD
pUC19 DNAligation mixture. , CcContents
 Brain Research (2017) 1-5 Lauren Earley Page |3

Miniprep/ Glycerol stocks Supernantant was removed leaving

remaining a pellet. Sequencing For
Glycerol stock 500-ul bacteria cell
sequencing, 3ul of sample was obtained in
tubes with a . DNA concentration of 295
mg/ml. Sample was sent away for
sequencing (Genewiz sequencing service).
Forward primer M13F and reverse primer
M13R were used. Results of sequencing
were blast aligned with with against the
calpain-ASD sequence for analysis..

Results Fig. 2 Gel purification

of Calpain-ASD gene
To determine cCalpains
1% agarose gel at 100
volts for
involvement NFTs and has been 45 min.
shown to with 1X
TAE Buffer. Band for
be an attribute to tau phosphorylation in
calpain-ASD purified is
thewhich are known causes atof1.5kb. 2.0-
neurodegeneration in Alzheimers disease. 1.5-
culture combined with 150 ul 80% glycerol We have attempted to clone the calpain gene 1.0-
(18%). Solution placed in freezer for for further studyanalysis. The cCalpain- 0.5-
storage at -80C. Mini prep 1.5ul of ASD gene was isolated and amplified .in
order to retrieve numerous copies of the
recombinant calpain-ASD pUC19 gene to clone. This was achieved through
bacteria in centrifuge for 3 min. at room PCR using goTaq green with forward and
temperature. Miniprep performed according
1kb Calpain-ASD
to instructions for QIAprep spin miniprep kit PCR Product
(Qiagen). Final step 30ul of buffer EB was reverse primers containing restriction
used. enzymes..

Sequencing/ Blast/DNA precipitation

DNA precipitation 30ul purified

DNA plasmid (22.9 mg/ml) diluted 1:to
100ulL, 1ul of glycogen (0.052mg), 10ul
sodium acetate (0.077M), 275ul 95% 1kb Calpain-ASD
PCR Product
ethanol, 70 ul ddH2O. All reagents were
combined and incubated for 15 min. on ice.
Contents were cCentrifuged at 13.3 RPM for
5 min. in -4C. Supernuatant was removed
and 1 ml of 70% alcohol was added and . 1.5-
cCentrifuged for an additional 5 min. 1.0-

0.5-
 Brain Research (2017) 1-5 Lauren Earley
After, PCR gel electrophoresis was used to
verify gene and to purify. (Results from
calpain amplification gel shown in figure
1.Fig. 1) Gel shows in a thick band around
1.5kb which is about the size of the gene.
This verifies that the target gene was
amplified and isolated.
To purify the calpain-ASD gene an
electrophoresis gel was run used toand
purify and ied to isolate desired size of the
isolated gene to clone. This gel resulted in a
thick band around 1.5kb as expected (Figure
2). The bBand was cut out and dissolved in
order to purify the band of interest. Calpain-
Page |4
ASD was successfully isolated and purified.
Xbal/Pstl digested calpain-ASD and
pUC19 Calpain-ASD genes wereas isolated
and amplified in order to retrieve numerous
copies of the gene to clone. This was
achieved through PCR using goTaq green
with forward and reverse primers. After
PCR gel electrophoresis was to verify gene
and to purify. (Fig. 1 & 2) Gel resulted in a
thick band around 1.5kb which is about the
size of the gene. This verifies that the target
gene was amplified and isolated.
R.E digest of Ccalpain-ASD and
pUC19 were digested with Xbal and Pstl
restriction enzymes to have complimentary
recognition sites for ligation. was performed
in order to have recognition sites for DNA
ligase so the calpain-ASD gene can be
inserted into the pUC 19 vector to create
recombinant plasmid to be cloned. were
ligated and used to transform E. Coli DH5
alpha. Xbal and Pstl restriction enzymes we
placed with insert and vector along with
reaction buffer and BSA and incubated for 1
hour to perform a digest. Results werewas
run in gel for purification (Fig.ure 2). Thick
band was found at 1.5kb compared to
ladder. Results indicate that product was
properly digested.
 Brain Research (2017) 1-5 Lauren Earley Page |5

In order to insert Xbal/Pstl digested from the culture toto allow for testing of
calpain-ASD in to and pUC19 vector a presence of calpain-ASD insert in pUC19
ligase reaction was performed. pUC19 was vector.
treated wih phosphatase. Both vector and
Instructions provided by mini prep
insert were combined with 1X ligase buffer
kit were used and plasmid was successful
and DNA ligase enzyme treated with
purified and isolated.
phosphatase and placed in PCR machine
overnight. Ligated calpain-ASD/pUC19 White Blue
weremixture was used to transform E. coli Plate # 1 1White 15
Blue Formatted Table
DH4 alpha bacterial cells. This would allow Plate
Plate #2
#1 51 116
15
for bacteria to take up the recombinant
Positive
Plate #2 336
5 0116
plasmid and replicate it in order to clone our # Control Abs Abs 260nm/280nm Formatted Table
calpain-ASD gene. E. Coli and recombinant Positive 260nm 336 280nm 0 Ratio
plasmid were combined then placed on ice. 1 Control 0.023 0.026 0.885
Then were placed in soc. medium and 2 0.059 0.049 1.204
shaken for 1 hour. X-gal was added to LB- 3 0.055 0.043 1.279
AMP plates to determine if recombinante 4 0.015 0.013 1.154
plasmid was present.and bacteria was plated Purified cloned recombinant calpain-
and incubated. Colonies were produced as ASD plasmid was analyzed to verify the
shown in (Table 1). Plate 1 shows one white calpain-ASD gene was inserted into the
colony and plate two shows 5 white pUC19 vector.Plasmid was analyzed by
colonies. This indicates that there were that spectrophotometer A Spectrophotometer
at least six colonies were an insert is present was used to determine the 260nm/280 ratio
in thewith recombinant plasmid. and the concentration to verify insert was
presentdetermine purity of DNA. The
results were as presented in Table 2. White
Table 1. Colony Counts of bacteria colonies #1 and #2 were tested along with
transformed with ligation mixture recombinant calpain- Blue colony #2 and a white colony for a
ASD, number of colonies found on each plate. White
colonies indicate that an insert is present in the plasmid. positive control.
Blue colonies indicate no insert in the plasmid.

Samples were taken from 2 white

colonies, 1 blue colony, and the white
Table 2. Spectrophotometer Results of recombinant
control colonies to grow bacterial cultures. Calpain-ASD/pUC19 plasmid.
A in order to have numerous copies of our
recombinant plasmid. s Small sample of
colonies were taken andthe cultures placed
in medium and allowed to grow. A portion
were as placed aside and combined with
glycerol for long term storage.
Recombinant cloned calpain-ASD
purification was performed with mini-prep
QIA-mini prep kit. Plasmid was purified
 Brain Research (2017) 1-5 Lauren Earley Page |6

Spectrophotometer results from each colony sample. This Fig. 3 and Fig. 4 Gel
includes two colony samples from our cloned plasmids and electrophoresis of PCR
a negative and positive control. 1-white colony, 2-white product of purified
colony #2, 3-Blue colony #2, 4-Positive control. product to verify
# Abs Abs 260nm/280nm calpain-ASD was
cloned. White colony
260nm 280nm Ratio (and Xbal/Pstl digest
1 0.023 0.026 0.885 recombinant genomic
2 0.059 0.049 1.204 DNA isolated from
3 0.055 0.043 1.279 recombinant calpain-
ASD gene and pUC19.
4 0.015 0.013 1.154 WC#1) and white
colony #2 (WC#2), white colonies taken from bacteria
# Abs 260nm Concentration culture of recombinant calpain-ASD/pUC19. Blue colony Formatted Table
1 0.023 115.0mg/ml (BC), vector with no insert, negative control. Positive
2 0.059 295.0mg/ml control (from bacteria culture as negative control. PC),
white colony with verified insert, positive control. ,
3 0.055 275.0mg/ml positive control. 1kb, 1 kb ladder1 kb ladder (1kb). Run in
4 0.015 75.0mg/ml 1% agarose gel for 45 min. at 100 volts with 1X TAE
All 260nm/280nm ratios are below 1.8 buffer.
which we can conclude that we do not have
pure DNA. Implies significant
contamination in the sample.
Concentrations are present in Table 3.
-8.0kb Table 3. 1:100 dilution, final concentration of the Formatted: Font: 9 pt
-4.0kb plasmid samples. 1-white colony, 2-white colony #2,
-3.0kb
3-Blue colony #2, 4-Positive control.
-2.0kb
# Abs 260nm Concentration
1 0.023 115.0mg/ml
2 0.059 295.0mg/ml
3 0.055 275.0mg/ml
4 0.015 75.0mg/ml

PCR Verification of cloned calpain-ASD &

2.0- R.E.Digest
1kb WC#2 WC#1 BC PC
1.5-
1.0-
PCR
1kb WC#2 WC#1 BC PC
R.E. Digest Verification of Insert
 Brain Research (2017) 1-5
Fig. 5 & 6 Blast Analysis of sequenced of purified
cloned calpain-ASD compared to pUC19 and
other vectors. Ggeneral data to find match in DNA
sequence. Shows 97% match wiwith expression
vector pFerX8.th vector.
To determine whether the isolated calpain-
ASD insert was properly ligated with
pUC19 vector and successfully cloned, PCR
and Xbal/Pstl digestion were performed.
Figures 3&4 depict electrophoresis gels to
verify the presence of the calpain-ASD
insert in the pUC19 vector. Purified PCR
products and R.E. digest products were
used. All PCR samples including negative
control (BC) exhibit a band at 1.5kb. This
eludes to contamination within the sample.
The initial calpain-ASD insert 1,689bp,
therefore the negative control (BC) should
not have a band at 1.5kb if the insert is not
present. Xbal/Pstl digestionR.E digest
resulted in white colony 2 (WC#2)
exhibiting a band between 1.5kb, 2.0kb, and
3.0kb. White Colony one (WC#1) was void
of any bands. Blue colony (BC), the
negative control, shows a dark band at 3.0kb
and faint bands at 4.0kb and 8.0kb. Uncut
plasmid was originally included in the gel
Lauren Earley Page |7
but was not able to be visualized.
Appearance of band in negative control
(BC) implies significant contamination
within the sample. All other results are
inconclusive due to the electrophoresis gel Formatted: Font: Bold
being unreadable.
PCR
To further verify the presence of the calpain-
1kb WC#2 WC#1 BC PC
ASD sequence in the pUC19 vector 3ul of
sample were sent out to be sequenced.
Forward and reverse sequencing was
compared to Blast data base. Calpain-ASD
did not return as a result of the sequence.
When compared with other vectors and
pUC19 a 97% alignment with expression
vector pFerX8 (fig. 5).
To further verify the presence of the
calpain-ASD sequence in the pUC19 vector
3ul of sample were sent out to be sequenced.
Forward and reverse sequencing was
compared to Blast data base. Calpain-ASD
did not return as a result of the sequence.
When compared with other vectors and
pUC19 a 97% alignment result returned (fig.
5&6).
We can conclude that the calpain-
ASD gene was not cloned and is not present
in the pUC19 vector. Most likely we just
have an empty vector.
Discussion
Overall our early electrophoresis gels
show that we did amplify, isolate and purify
the calpain-ASD gene. However, we were
not successful in transforming a bacterium
with the recombinant calpain-ASD/pUC19
plasmid. We were not able to successfully
clone the calpain-ASD gene. Results eluded
a lot toto significant contamination in the
sample. We were successful in PCR to gain
 Brain Research (2017) 1-5 Lauren Earley Page |8

copies of the gene with proper restriction

digestion of the gene and the vector. Fig. 1
& 2 show the proper size band for the
calpain-ASD gene. Ligation seems to be
faulty. It is possible that the vector to insert
ratio is skewed. In the future we can take a
spectrophotometer reading to determine the
concentration to verify we have the correct
ration. In future experiments more
precautions will be taken in order to avoid
cross contamination of samples. Different
purification techniques could be used in
order to further ensure isolation of calpain
gene.
Other studies have shown calpain-
ASD is possible to be cloned so we know
cloning of this gene is a possibility in order
to use the gene for future endeavors. Further
study is needed to connect calpain I and II
and tau phosphorylation. Knowledge of the
etiology of calpains influence on formation
of NFTs can further our understanding of
the causes of AD based on abnormal
calcium homeostasis, hence providing an
avenue for future treatment development.