Anda di halaman 1dari 67

Evaluacin de patrones para lima

tahit (Citrus latifolia Tanaka) frente a


Citrus tristeza virus (CTV)

Johnny Camilo Beltrn Montoya

Universidad Nacional de Colombia


Facultad, Agronoma (Escuela de posgrados)
Bogot, Colombia
2012
Evaluacin de patrones para lima
tahit (Citrus latifolia Tanaka) frente a
Citrus tristeza virus (CTV)

Johnny Camilo Beltrn Montoya

Trabajo de investigacin presentado como requisito parcial para optar al ttulo de:
Magister en Ciencias agrarias con nfasis en fitoproteccin integrada

Director:
Ph.D., Oscar Arturo Oliveros Garay

Lnea de Investigacin:
Virus de plantas

Universidad Nacional de Colombia


Facultad, Agronoma (Escuela de posgrados)
Bogot, Colombia
2012
Estudiemos y capitalicemos conocimiento!

Lo que aprendemos a hacer y lo que


tenemos en la cabeza es lo nico que nos
queda hasta el da de nuestra muerte. Las
cosas materiales son polvo que arrastra el
viento.

A mi mam, esposa e hijo.

Agradezco el apoyo y tiempo para llevar a


cabo mis estudios.

La felicidad es tan tangible que podemos ser


felices cuando queramos y nos decidamos a
serlo!
Agradecimientos
Al grupo del laboratorio de biotecnologa vegetal de la facultad de agronoma de la
Universidad Nacional de Colombia.

Al profesor Oscar Oliveros agradezco brindarme la posibilidad de trabajar en este


proyecto y por su aporte intelectual.

Al doctor Javier Orduz y su grupo de trabajo por el apoyo y oportuna colaboracin

A Walter Turizo por su oportuna colaboracin y la amistad gestada en el transcurso de


este trabajo.

A mis compaeros de laboratorio por hacer un sano equipo de trabajo.

A Corpoica por poner a disposicin sus instalaciones, enfocadas en la investigacin


especializada de ctricos y por la colaboracin de las personas que hicieron posible este
trabajo.
Resumen y Abstract IX

Resumen

En el presente trabajo se evalu la respuesta de patrones para lima Tahit frente a


infecciones de Citrus tristeza virus. El documento se divide en tres captulos. El primer
captulo es una revisin general del estado del arte de CTV, que abarca generalidades
sobre sus hospederos, distribucin, genoma viral, sntomas que generan las diferentes
cepas y antecedentes de lima Tahit en Colombia. El segundo captulo abarca la
identificacin de cepas de CTV que infectan en campo mediante el uso de primers
especficos de los genes de la polimerasa y p23, y secuenciacin de los productos de
PCR. Los resultados muestran que las cepas de genotipos VT son las de mayor
incidencia, solas o de manera mixta con cepas T30 y T36. El tercer captulo presenta los
resultados de la respuesta de expresin de stemp pitting de lima Tahit injertada sobre
seis patrones diferentes y su relacin con los genotipos de CTV que infectan en campo.
La relacin de dependencia entre patrones, respuesta sintomtica y genotipos de CTV
se realiz mediante test de independencia de chi-cuadrado. Se identific que la
respuesta de stem pitting es dependiente del patrn y de la localidad geogrfica, pero
independiente de la mezcla de cepas que infectaron los ctricos.

Palabras clave: Lima Tahit, CTV, PCR, patrn.

Abstract
This study evaluated the response Tahitian lime grafted in different citrus rootstocks
against Citrus Tristeza Virus infections. The document is divided into three chapters. The
first chapter is an overview of the state of the art of CTV covering their hosts, distribution,
viral genome, symptoms induced by different strains and Tahitian lime characteristics.
The second chapter deals with the identification of CTV isolates that infect field using
PCR and specific primers for polymerase and p23 genes, and sequencing of the PCR
products. Results reveal VT genotypes strains exhibited the highest incidence, alone or
mixed with strains such T30 and T36. The third chapter deals with the response of stem
pitting expression in Tahitian lime grafted on six different rootstocks and their relationship
with CTV genotypes found in the Colombian field. A dependency relationship between
citrus patterns, symptomatic response and CTV genotypes was performed using chi-
square independence. It was found dependency response between stem pitting
rootstocks and geographical locality, but independency relationship of the mixture of
genotypes infecting a specific citrus.
.
Key words: Tahitian lime, CTV, PCR, rootstock.
Contenido XI

Contenido
Tabla de contenido

Resumen ......................................................................................................................... IX

Introduccin .................................................................................................................. 15

Objetivo General............................................................................................................ 17

Objetivos Especficos ................................................................................................... 17

1. Estado del arte........................................................................................................ 18


1.1 Tristeza de los ctricos................................................................................... 18
1.2 Agente causal: Citrus Tristeza Virus.............................................................. 19
1.2.1 Genoma Viral ............................................................................................. 20
1.2.2 Sntomas causados por CTV...................................................................... 22
1.2.3 Transmisin ............................................................................................... 25
1.3 Hospedero: Citrus latifolia Tanaka (Lima Tahit) ............................................ 25
1.4 Bibliografa .................................................................................................... 28

2. Identificacin de cepas de Citrus Tristeza Virus mediante marcadores


moleculares de genotipo especifico en plantas de Citrus latifolia (Tanaka). ........... 34
Resumen ............................................................................................................ 34
2.1 Introduccin .............................................................................................. 35
2.2 Materiales y mtodos .................................................................................... 37
2.2.1Extraccin de ARN, transcripcin reversa (RT) y reaccin en cadena de la
polimerasa (PCR). ............................................................................................... 39
2.3 Resultados .................................................................................................... 41
2.4 Discusin ...................................................................................................... 46
2.5 Bibliografa .................................................................................................... 47

3. Patrones para lima Tahit C. latifolia (Tanaka) frente a la severidad de stem


pitting ocasionado por Citrus Tristeza Virus............................................................... 51
3.1 Introduccin .................................................................................................. 52
3.2 Materiales y mtodos. ................................................................................... 54
3.3 Resultados .................................................................................................... 58
3.4 Discusin ...................................................................................................... 61
3.5 Bibliografia .................................................................................................... 63

Conclusiones ................................................................................................................. 67
Contenido XII

Lista de figuras
Figura 1-1: Distribucin mundial del virus de la tristeza de los ctricos....4
Figura 1-2: Micrografia electrnica de cepas purificadas de CTV.6
Figura 1-3: Organizacin del genoma viral de CTV. Tomado de Karasev et al, 19957
Figura 1-4: Clasificacin de asilamientos de CTV propuesta por Hilf et al., 20059
Figura 1- 5: Clasificacin de asilamientos de CTV propuesta por Sambade et al., 2003.9
Figura 1 6: Sntomas causados por CTV. Tomado de Moreno et al., 2008...11
Figura 2-1: Esquema de toma de muestras y flujo de decisin para seleccionar plantas a evaluar 22
Figura 2-2: Electroforesis en gel de agarosa para visualizar amplicones de VT-POL deCTV (695 pb) de las muestras de
lima Tahit colectadas en el huerto Corpoica La Libertad ...26
Figura 2-3: Electroforesis en gel de agarosa para visualizar amplicones T30 POL de CTV (696 pb) de las muestras de lima
Tahit colectadas en el huerto ubicado en Corpoica La ibertad26
Figura 2-4: Electroforesis en gel de agarosa para visualizar amplicones T36 POL de CTV (714 pb) de las muestras de lima
Tahit colectadas en el huerto ubicado en Corpoica La
Libertad27
Figura 2-5: Electroforesis en gel de agarosa para visualizar amplicones del gen P23 de CTV de las muestras de lima
Tahit colectadas en el huerto ubicado en Corpoica La
Libertad...28
Figura 2-6: Electroforesis en gel de agarosa para visualizar amplicones de CTV (p23) de las muestras de lima tahti
colectadas en el huerto ubicado en Corpoica Nataima..29
Figura 3-1: Patrones micro injertados con lima Tahit y establecidos en campo...39
Figura 3-2: Escala diagramtica para la evaluar la intensidad de acanaladuras de tallo. Tomada de Meissner-Filho et al.
(2002)..40
Figura 3-3: Distribucin de las cepas de CTV que infectaron de manera natural en campo..41
Figura 3-4: Severidad de stem pitting (dimensin 2) vs patrn y localidad (dimensin 1)..44
Figura 3-5: Severidad de stem pitting vs asilamientos de CTV45
Contenido XIII

Lista de tablas
Tabla 2-1: Primers utilizados para deteccin de CTV. Tomado de Hilf et al., 2005 y Sambade et al., 2003.25
Tabla 2-2: Resumen de identidad de las secuencias de las muestras con accesiones del GeneBank.29
Tabla 3-1 Tabla de frecuencia de la severidad en stem pittin en diferentes patrones y dos localidades
diferentes..43
Contenido XIV

Abreviaturas
Abreviatura Trmino
CTV Citrus tristeza virus
SP Stem pitting
QD Quick decline
Introduccin

A nivel mundial los ctricos son cultivados en el subtropico y en el trpico, sin embargo,
las principales zonas productoras del mundo se encuentran ubicadas en el subtrpico
entre los 25 y 40 grados de latitud en ambos hemisferios y se denomina como el cinturn
citrcola conformado por California, Florida, China, Japn, Brasil, Argentina, Australia y
Surfrica. Segn la encuesta Nacional Agropecuaria de 2010, en Colombia hay plantadas
62.409 ha de ctricos, de las cuales 36.943 ha estn sembradas en naranja y 25.466 ha
plantadas entre mandarina, tangelo y limas cidas. El grupo de las limas cidas est
compuesto por la lima Tahit (Citrus latifolia) y el limn pajarito (Citrus aurantifolia), estas
son originarias del archipilago malayo, no toleran bajas temperaturas y alcanzan la
mejor calidad interna y coloracin en las regiones tropicales clidas (Orduz-Rodriguez,
2012). El cultivo de lima Tahit en Colombia tiene altas potencialidades en cuanto a
diversificacin de cultivos y exportacin, el pas tiene tierras aptas para el establecimiento
de cultivos, la demanda interna no est satisfecha y en los momentos de
desabastecimiento es necesario importar limn verdadero, sin embargo, el modelo de
produccin no cuenta con paquetes tecnolgicos que garanticen la sanidad vegetal del y
presenta diversas limitaciones fitosanitarias. En Colombia la tristeza de los ctricos tiene
alto impacto sobre lima tahiti que es uno de los hospederos ms susceptibles. En campo
hay alta presin de fidos vectores, las prcticas de vivero no garantizan material vegetal
libre de virus o como mnimo infectado con cepas suaves y se constituyen como una
fuente de diseminacin regional de enfermedades. Las estrategias de manejo de tristeza
son (1) material vegetal libre de virus, (2) seleccin de patrones para conferir tolerancia,
(3) erradicacin de plantas infectadas con cepas severas, (4) esquemas de proteccin
cruzada (5) movilizacin de material vegetal sano, (6) regulacin oficial sobre los
productores de material vegetal. Mediante estudios previos del centro de investigacin
C.I Corpoica La libertad, se han reconocido patrones para lima tahiti con buen potencial
de adaptacin a condiciones agroecolgicas de las zonas de produccin.
16 Estado del arte.

La limitaciones tecnolgicas del cultivo de lima Tahit esta constituidas principalmente


por la falta de material de propagacin con caractersticas de calidad, resistencia a
enfermedades y adaptacin a condiciones edafoclimticas. El patrn volkameriana es el
ms usado en la citricultura colombiana, tiene ventajas debido a su precocidad, pero el
color de los frutos generados es verde claro, lo que disminuye el inters en el mercado
de exportacin. Lima Tahit en uno de los hospedantes ms sensibles al virus de la
tristeza de los ctricos y esta es una de las principales limitaciones de la longevidad de
los cultivos. En los llanos orientales se reporta tiempo de vida til de los huertos llega
hasta los ocho diez aos mximo causa de la severidad de CTV. En este sentido, el
fortalecimiento tecnolgico para la produccin de limas cidas en Colombia requiere la
evaluacin de patrones y programas de seleccin de materiales promisorios de alta
productividad que generen garantas para aumentar el rea sembrada y la reconversin
de los materiales de produccin que actualmente son utilizados.

En la citricultura moderna el esquema de propagacin se basa en el uso de injertos con


el fin de generar precocidad en la produccin, resistencia a la planta frente a
enfermedades y adaptacin a suelos. El injerto ctrico se compone de un patrn y una
copa. El patrn confiere varias caractersticas de produccin y repuesta a enfermedades
sistmicas a la planta, debe presentar alta compatibilidad con la copa, buena adaptacin
a clima y suelos, confiere ms de 20 caractersticas a la planta ctrica, entre ellas el vigor,
tolerancia a factores abiticos como salinidad, acidez, resistencia o tolerancia frente a
enfermedades como Phytophtora. sp, Citrus Tristeza Virus, Citrus psorosis virus, Citrus
exocortis viroid, entre otros. La copa debe provenir de plantas madres sanas (libres de
virus), con caractersticas de alto rendimiento y calidad de frutos. En el presente trabajo
se evalu la respuesta de patrones para copas de lima Tahit, obtenidas a partir de
yemas libres de virus, respecto al carcter de conferir tolerancia frente a infeccin de
Citrus Tristeza Virus. En trabajos previos realizados por el banco de germoplasma del C.I
Corpoica Palmira se obtuvieron micro-injertos de lima Tahit libres de tristeza de los
ctricos con patrones promisorios en citricultura, el comportamiento de los cuales fue
subsecuentemente evaluado en campo.

La principal fuente de diseminacin de CTV es la movilizacin de material infectado de


ctricos. Los viveros de propagacin en Colombia no cuentan con un programa de
certificacin de yemas libres de virus. La falta de regulacin en el transporte de ctricos
puede generar un flujo de CTV a nivel regional. La diseminacin local es mediada por
Capitulo 1 17

fidos vectores presentes en campo como Aphis gosippy y Toxoptera citricida. Las
medidas de manejo de CTV deben incluir cuarentena de algunas cepas severas,
programas de certificacin de yemas, el uso de patrones tolerantes y proteccin cruzada
con cepas suaves dependiendo de la incidencia y las cepas predominantes de cada zona
(Moreno et al., 2009). El uso de patrones tolerantes a CTV constituye una estrategia de
importancia para el manejo de la tristeza de los ctricos y la modernizacin de la
citricultura del pas. Para generar programas de proteccin cruzada, es necesaria la
identificacin de cepas suaves y la evaluacin de su potencial para la proteccin frente a
cepas severas locales.

En el marco de este trabajo se espera que el material plantado en campo se infecte con
las cepas locales asociados a la regin geogrfica, razn por la cual la evaluacin de
este material se realiz a los dos aos de establecido el cultivo en campo. Durante este
periodo, el material en campo estara expuesto a infecciones por las cepas locales de
CTV que son inoculadas por fidos vectores. Estos rboles probablemente expresan
sntomas de tristeza asociados a la especificidad del genotipo viral, el patrn y la zona de
evaluacin.

El presente trabajo se compone de tres captulos principales. El primero presenta una


revisin general del estado del arte, el segundo es referente a un articulo enfocado en la
identificacin de cepas de CTV en campo infectando lima Tahit, el tercer captulo es un
artculo que trata de la respuesta de las plantas de lima Tahit injertadas sobre varios
patrones frente a la infeccin de campo de cepas de CTV.

Objetivo General

Evaluar la respuesta de patrones para lima Tahit (c. latifolia Tanaka) frente a Citrus
Tristeza Virus (CTV)

Objetivos Especficos

Identificar las cepas de CTV que infectan lima Tahit (C. latifolia) en campo mediante RT-
PCR y secuenciacin.
18 Estado del arte.

Analizar la relacin entre las cepas de CTV detectadas en campo y la respuesta


sintomtica inducida en C. latifolia injertado sobre diferentes patrones.

1. Estado del arte

1.1 Tristeza de los ctricos


La tristeza de los ctricos es una enfermad de origen viral causada por Citrus Tristeza
Virus (CTV). Las sinonimias de esta enfermedad son Citrus quick decline virus (Fawcett
& Wallace, 1946); Citrus seedling yellows virus (Fraser, 1952); Grapefruit stem pitting
virus (Oberholzer et al., 1949) y Lime die-back virus (Hughes & Lister, 1949). Infecta
todas las especies e hbridos de ctricos, incluso hay reportes de infeccin en parientes
de los ctricos, tales como Aeglopsis, Afraegle, Fortunella y Pamburus, Poncirus. Fuera
de las Rutceas, el nico hospedero conocido de CTV, son algunas especies de
Passiflora (Bar Joseph et al., 1989)
Capitulo 1 19

Figura 1-1: Distribucin mundial del virus de la tristeza de los ctricos. CMI (1978)

El primer determinante de dispersin de la tristeza de los ctricos data del siglo XIX
cuando se empez a utilizar Citrus auranti (naranjo agrio) para conferir resistencia frente
a la pudricin de raz causada por Phytophthora sp. Esta experiencia ocasion la
diseminacin de CTV desde zonas endmicas a zonas libres por la movilizacin de
material infectado (Bar Joseph et al., 1989). Las epidemias ms importantes de tristeza
se reportaron en Argentina en 1930, en Brasil en 1937, en California en 1939, en Florida
en 1951, en Espaa 1957, en Israel en 1970 y en Venezuela en 1980, (Webber, 1943;
Davino et al., 2003; Garnsey et al., 2000). En la actualidad CTV se encuentra en la
mayora de las regiones de produccin de ctricos del mundo, este virus se encuentra en
pases de Europa, frica, Asia, Norte Amrica, Oceana y Sur Amrica.

1.2 Agente causal: Citrus Tristeza Virus


Citrus Trizteza Virus pertenece al gnero Closterovirus, familia Closteroviridae. Las
partculas de este virus son descritas como filamentos flexuosos de 10 a 11 nm de
dimetro y 1900 a 2000 nm de longitud. El genoma de CTV est constituido por RNA de
cadena sencilla, de sentido positivo, sin cola de poli-A en el extremo 3' (Bar Joseph y
Lee, 1989). Posee dos protenas de cpside: una protena mayor de 25 kDa que cubre el
95% de la partcula viral y una protena menor (protena divergente) de 27 kDa que cubre
el 5% de la partcula al extremo amino terminal (Granoff & Webster, 1999)

Figura 1-2: Micrografia electrnica de cepas purificadas de CTV. Tomada de:Bar Joseph y Lee, 1989AAB.
20 Estado del arte.

1.2.1 Genoma Viral


El RNA genmico (gRNA) de CTV se encuentra compuesto por 12 marcos de lectura
abiertos (ORFs) y regiones no traducibles (UTRs) en los extremos 5' y 3'. Los ORFs 1a y
1b codifican protenas asociadas a la replicacin. El ORF 1 codifica para metiltransferasa,
dos proteasas y helicasa. 1b codifica RNA polimerasa dependiente de RNA. Estas dos
abarcan la mitad 5' del genoma y son traducidos directamente por el gRNA. Los 10 ORF
adicionales se localizan en el extremo 3' y codifican las protenas p33 (ORF2), p6 (ORF
3), p65 (ORF 4), p61 (ORF 5), p27 (ORF 6), p25 (ORF 7), p18 (ORF 8), p13 (ORF 9), p20
(ORF 10) y p23 (ORF 11). p65 es homologa a protenas de choque trmico y junto con
las protenas de la capside p25 y p27 estn involucradas con el ensamblaje del virin.
p20 est asociada con la acumulacin de cuerpos de inclusin en las clulas infectadas.
La funcin de p33, p18 y p13 se relaciona con la capacidad de inducir infeccin sistmica
en el rango de ctricos hospederos (Tatineni et al., 2011). Los ORFs del extremo 3 de
CTV se expresan a travs de un set de RNAs subgenmicos 3 coterminales los cuales
tienen sus versiones correspondientes de RNA negativo (Hilf et al., 1995).

Figura 1-3: Organizacin del genoma viral de CTV. Tomado de Karasev et al, 1995

La cubierta del virin de CTV se encuentra formada por la protena mayor CP de 23000
Dalton y una protena menor CPm de 21000 Dalton que se encuentran presentes en un
proporcin de 5 a 1(Bar Joseph y Lee, 1989).

CTV tiene el genoma ms largo entre los virus que infectan plantas, presenta variabilidad
diferencial, el extremo 5 tiene mayor variabilidad que extremo 3. Este ltimo es
relativamente conservado (aproximadamente 90% de identidad nucleotdica entre
aislamientos), mientras que la identidad encontrada en el extremo 5 es menor al 70%
(Hilf et al. 2000). Los genomas de CTV secuenciados en su totalidad son: T36 y T30 de
Florida (Karasev et al.,1995; Albiach-Marti et al., 2000), VT de Israel (Mawassi et al.,
1996), T385 de Espaa (Vives et al. 1999), SY568 de California (Yang et al. 1999),
Capitulo 1 21

NUagA de Japn (Suastika et al., 2001), Qaha de Egyto y un aislamiento mexicano. El


genoma de CTV como mnimo tiene tres genes que codifican supresores de
silenciamiento. CP es supresor de silenciamiento intercelular, p23 supresor de
silenciamiento intracelular y P20 supresor de silenciamiento en ambos niveles (Lu et al
2004)

La clasificacin de genotipos de CTV ha identificado dos grupos (Hilf et al., 2005). El


primer grupo denominado VT contiene aislamientos VT, B14, T30 y T3, el segundo grupo
denominado T36, contiene aislamientos B83, B33 y T36. El grupo VT esta compuesto por
determinados subgrupos de aislamientos VT (B370, B152, B1, B370, B59, B79, B219),
B14 (B425, B211, B41), T30 (B213, B348, B270 I, B2) y un subgrupo de aislamientos
T3. El grupo T36 tiene aislamientos B83, B33, T36 (B183, B359, B358). Esta clasificacin
fue propuesta con base en los patrones compartidos de los marcadores genticos
utilizados. Los aislamientos asignados al genotipo T30 tuvieron una mnima variabilidad
en la secuencia de nucletidos entre la secuencia de los marcadores K17 y POL. La
variabilidad entre la secuencia de nucletidos de los marcadores fue mayor para
genotipos asignados al grupo T36.

El gen p23 codifica una protena de 23 KDa, se localiza adyacente al extremo 3' del
genoma de CTV. Este gen no tiene genes homlogos en otros closterovirus. P23 se
acumula en niveles moderados respecto a otras protenas virales (Pappu et al., 1997),
sin embargo el RNA subgenomico de p23 es el segundo ms abndate en el RNA
mensajero viral de los tejidos infectados (Hilf et al., 1995; Navas Castillo et al., 1997) y
se acumula ms rpido que otros RNA sub genmicos en protoplastos infectados, lo que
sugiere que p23 est involucrado en los primeros pasos para la replicacin o
transcripcin (Navas Castillo et al., 1997). Ctricos transgnicos que expresan p23 de
CTV exhiben sintomatologa similar al de plantas infectadas (Ghorebel et al., 2001) lo que
demuestra que p23 se encuentra involucrado en el desarrollo de sntomas y
probablemente juega un papel determinante en la patogenicidad de CTV.

La funcin del gen p23 de CTV es asociada al control de la acumulacin asimtrica del
nmero de hebras de RNA durante la replicacin y es potencial determinante de la
patogenicidad de CTV. La regin 78 80 de p23 se muestra como un marcador til para
diferenciar grupos de aislamientos suaves, severos y atpicos. Los aislamientos suaves
22 Estado del arte.

tienen en la posicin 78 80 de p23 Leu79 y Lys80; los aislamientos severos tienen Ser79 y
Arg80 y los atpicos tienen Gly78 (Sambade et al., 2003)

Figura 1-4: Clasificacin de asilamientos de CTV propuesta por Hilf et al., 2005

Figura 1-5: Clasificacin de asilamientos de CTV propuesta por Sambade et al., 2003.

1.2.2 Sntomas causados por CTV


Los virus que infectan plantas inducen la formacin de diversas estructuras
alteraciones en la clula que estn en funcin de la replicacin del genoma o del
movimiento intracelular de estos. Se pueden formar esferulas, vesculas o cuerpos
multivesiculares, que pueden estar conectados o no con el citoplasma. La especificidad
en los organelos objetivo de los virus vara de acuerdo a la familia y genero (Lalibert et
Capitulo 1 23

al., 2010). Las protenas virales de CTV forman inclusiones citoplasmticas en las clulas
del floema, ests inclusiones estn asociadas con el aumento de numero y tamao de
vacuolas, invaginacin de la membrana nuclear y degradacin de cloroplastos que
ocasionan un desarrollo anormal y el colapso en general de las clulas (Rodriguez et al,
2009; Ecale Zhou et al., 2002).

La infeccin de CTV, se localiza en los conductos vasculares del floema de la planta,


impidiendo el transporte de asimilados a travs de estos (Bar Joseph, 1970). Al interior
de las clulas acompaantes del floema, la cantidad de cuerpos de inclusin vara de
acuerdo a la cepa del virus (Bar Joseph y Lee, 1989). Las infecciones por CTV descritas
en las clulas del floema generan invaginaciones de la membrana nuclear y degradacin
de los cloroplastos (Ecale Zhou et al., 2002).

La expresin sintomtica de las plantas infectadas con CTV es variable y esta difiere de
acuerdo a la interaccin patrn copa y al tipo de cepa viral que caus la infeccin (Bar
Joseph, 1989). Sin embargo, los sntomas esenciales reportados en el mundo estn
asociados a decaimiento rpido (Quick decline - QD) de las especies ctricas injertadas
sobre el patrn C. aurantium en donde se produce necrosis del floema en la unin del
patrn y la copa. El segundo sntoma de importancia es la acanaladura de tallo (stem
pitting - SP), en tallo y ramas de varias especies de ctricos, disminuyendo el vigor de la
planta, el tamao de los frutos y el rendimiento en produccin sin tener en cuenta el
patrn utilizado. El tercer sntoma est asociado a crecimiento retardado (stunting) y
clorosis en la hojas reportado en patrones de C. aurantium, C. limn y C. paradisi Macf
(Garnsey et al., 1987; Sambade et al., 2003). Los determinantes patognicos de CTV an
no estn estrictamente definidos, no es claro si los sntomas son inducidos por una
variante genmica predominante o por una combinacin de variantes genmicas de la
poblacin.
24 Estado del arte.

Figura 16: Sntomas causados por CTV. Tomado de Moreno et al., 2008.a) Sintoma de decaimiento rpido
en naranja dulce propagada sobre naranjo agrio. B) Arboles en diferente estado de declinamiento. c) Sintoma
severo de stem pitting en el tronco de rbol de toronja injertado sobre Poncirius trifoliata. d)Fruto de toronja
pequeos de rbol de toronja injertado sobre Poncirius trifoliata. e) Plantula con crecimiento retardado y
hojas con clorosis. f) Clorosis en las nervaduras de hojas de Citrus macrophylla.g) Stem pitting en el tronco
de plntulas de lima mejicana. h) Lima mejica transgnica expresando p23 (izquierda) y hoja de lima
mejicana no transgnica infectada con CTV.
Capitulo 1 25

1.2.3 Transmisin
La evolucin de los gneros de la familia closteroviridae est asociada con fuerzas de
seleccin ejercidas por sus insectos vectores, resultando en tres linajes principales
asociados a la transmisin de closterovirus por fidos, crinivirus por moscablanca y
ampeovirus por cochinillas (Karasev, 2000). La trasmisin de CTV es semipersistente y
en plantas infectadas est dirigida a clulas asociadas al floema (Martelli et al.2002).
CTV tiene dos vas principales de transmisin. (1) por yemas para propagacin
infectadas con CTV, siendo este el responsable de la dispersin regional. (2) Vectores
del genero Aphis y del genero Toxoptera, siendo los ms reconocidos Toxoptera citricida
y Aphis gossypii (Rocha-Pea et al. 1995). Los factores que influencian la dispersin en
campo estn relacionados con la densidad de poblacin de fidos, las condiciones
ambientales que influencian la dinmica en las poblaciones de los vectores, los
aislamientos virales predominantes en campo y la eficiencia de transmisin por cepas
especficas como en el caso T. citricida que es el vector ms eficiente de aislamientos
severos (Bar Joseph y Lobestein 1972; Marroquin et al, 2004; Hermoso de Mendoza et
al., 1984).

1.3 Hospedero: Citrus latifolia Tanaka (Lima Tahit)


El centro de origen de Citrus latifolia es desconocido, sin embargo se ha llegado a pensar
que este es un hibrido entre lima mejicana (Citrus aurantifolia) y limn (Citrus limn). Este
ctrico es de porte alto con hojas lanceoladas y pecolos alados; sus frutos son ovales,
oblongos o elpticos de piel verde y lisa que al madurar se torna amarilla, generalmente
sin semilla, sus flores son ligeramente violetas y el polen es inviable. C. latifolia es
altamente susceptible a CTV, a los aislamientos que inducen decaimiento rpido (QD) y
los que inducen acanaladuras de tallo y ramas (SP). En los llanos orientales de Colombia
los huertos de produccin de lima Tahit reportan que estos no superan los ocho aos de
produccin a consecuencia de la severas epidemias de tristeza de los ctricos (Mateus et
al., 2010).

Histricamente los patrones utilizados para lima Tahit han presentado dificultades por su
susceptibilidad a la enfermedad tristeza de los ctricos y otros patgenos. En Colombia el
patrn ms utilizado para lima Tahit es Volkameriana (C. volkameriana Ten. Y Pasq.) no
es susceptible a Phytophtora. sp y se reporta con niveles de tolerancia a CTV. Las
26 Estado del arte.

plantas injertadas sobre este patrn son vigorosas, uno de sus atractivos en lima Tahit
es su precocidad, sin embargo una de las limitantes es el color verde plido de sus
frutos, que afecta la demanda de exportacin. El patrn naranjo amargo (C. aurantium
L.) y C. macrophyla son altamente productivos, pero altamente susceptibles a CTV, por
tanto no son promisorios para zonas endmicas de CTV. En Brasil el limn rangpur (C.
limonia Osbeck. (pro sp.)) es ampliamente usado como patrn para lima Tahit por su alta
resistencia a la sequia, precocidad y alta productividad. El limn rugoso (C. jambhirii
Lush), es susceptible a Phytophthora. sp y no es recomendable como patrn para lima
Tahit. Los patrones tradicionales como limn rugoso (C. jambhirii Lush), naranjo agrio
(C.aurantium L.) y naranjo dulce (C. sinensis [L.] Osb.) han sido poco utilizados en la
citricultura colombiana y hoy da no tienen ningn uso debido a su susceptibilidad a
problemas fitosanitarios, en especial a CTV y a gomosis. El patrn Carrizo (C. sinensis x
P. trifoliata (L.)) es un hibrido intergenrico entre naranja dulce por naranja trifoliada,
tolerante a enfermedades sistmicas, susceptible a Citrus Exocortis Virod, ha mostrado
gran potencial productivo en la zona cafetera de Colombia, no obstante, su
comportamiento como patrn para lima Tahit no est bien determinado. Citrumelo
Swingle (C. paradisi x P. trifoliata (L.) Raf.) es un hibrido intergenrico entre toronja por
naranja trifoliada, tiene buen comportamiento en suelos cidos para lima Tahit, en Brasil
induce buenas productividades para lima Tahit y en Colombia supera en produccin a
algunos patrones injertados con madarina Arrayana. El patrn cleopatra (C. reticulata
Blanco.) es susceptible a deficiencias de micronutrientes, produce frutos pequeos y
crece mejor en zonas tropicales que subtropicales, no es prometedor como patrn para
lima Tahit (Campbell, 1979; Campbell 1991, Figueiredo et al 2001) En Colombia
cleopatra ha sido un patrn evaluado para lima Tahti, los huertos evaluados por
Hernandez y Parrado, 2008, se establecieron en 1997 y han alcanzado de manera
gradual el 100% de incidencia. El sntoma ms frecuente encontrado en campo es stem
pitting, no obstante en esta evaluacin no fue posible corroborar el tipo de cepa presente
en campo. Las cepas tipo VT estn asociadas a este tipo sntomas y de acuerdo al
contexto es una cepa ampliamente distribuida y establecida en las zonas de produccin
de ctricos en Colombia. No obstante, algunos rboles del huerto empiezan a colapsar a
partir del ao 8 de establecimiento que podra ocurrir por los eventos de re-inoculacin
del virus por los vectores presentes en campo y el titulo viral, por la interaccin entre
varios tipos de cepas de CTV o por la compatibilidad presente entre el patrn cleopatra y
lima Tahit.
Capitulo 1 27

En Venezuela los patrones cleopatra carrizo, volkameriano y citrumelo preliminarmente


fueron catalogados como promisorios para injertarlos sobre Naranja valencia (C. sinensis
(L.) Osbeck.) por su buen comportamiento frente a CTV (Mendt et al., 1988). Aunque
estas respuestas se dieron en una especie ctrica diferente a lima Tahit, las condiciones
de suelos de Venezuela pueden ser homologables a los de algunas regiones de
Colombia, como es el caso de los llanos orientales. Evaluaciones de patrones como
carrizo, limn volkameriano y cleopatra no presentan efectos sobre la productividad y
calidad de los frutos, sin embargo si hay disminucin de la longevidad; de las plantas
injertadas sobre limn rugoso colapsan alrededor del ao 5 debido a pudriciones de raz;
las plantas de lima Tahit injertadas sobre mandarina cleopatra colapsan entre los aos 5
y 8 probablemente debido a una baja afinidad entre el patrn cleopatra y lima Tahit
(Stenzel y Neves 2004; Figueiredo et al. 2007). No obstante en este ltimo no se tuvo en
cuenta la influencia de CTV sobre la baja longevidad de estos materiales. Una situacin
similar es reportada para lima Tahit injertada sobre el patrn cleopatra, en la cual se
reporta que la longevidad se limita hasta el ao 8 y se atribuye esta situacin a
problemas fitosanitarios como CTV (Quiroga et al., 2010). Las selecciones de Poncirus
trifoliata dentro de las cuales se encuentra el patrn kryder son tolerantes a
enfermedades sistmicas con Citrus Tristeza Virus, Citrus psorosis virus y
Phythophthora; presenta problemas de adaptacin a suelos salinos y susceptible a
exocortis, en lima Tahit presenta porte bajo y menor volumen de la copa. Una de sus
seleccines fly dragon (P. trifoliata var monstrosa) es un patrn enanizante que induce
porte bajo en general y se referencia como tolerante a Phytophtora, SP-CTV y
nematodos, pero susceptible a Citrus exocortis viroid (Sanches-Stuchi, 2007). El patrn
Sunki x English es un hibrido entre la naranja trifoliada y la mandarina Sunki (P.trifoliata
English x C. sunki), es el patrn con mayor resistencia Phythophthora de 90 patrones
evaluados en el Valle del Cauca en la dcada de 1960, en Colombia ha alcanzado un
alto reconocimiento por alcnzar altas producciones injertado sobre naranja Garcia
Valencia en la zona cafetera y en mandarina Oneco; forma plantas de porte medio, alta
calidad de frutos y sanidad de la planta (Orduz-Rodriguez, 2012). Mandarina cleopatra
(Citrus reshi Hort. Ex Tan.) es el patrn ctrico ms utilizado e nivel mundial, es poco
precoz para entrada en produccin, produce frutos de buena calidad, es tolerante a
algunas cepas de Citrus Tristeza Virus, Citrus psorosis virus, Citrus exocortis viroid.
28 Estado del arte.

1.4 Bibliografa
Albiach-Marti, M R., Mawassi, M., Gowda, S., Satyaranayana, T., Shanker, M.E., Almira,
E.C., Vives. M.C., Lpez, C., Guerri, J., Florez, R., Moreno. P., Garnsey, S., M.,
Dawson, W.O. 2000. Sequences of Citrus Tristeza Virus separated in time and space are
essentially identical. J. Virol. 74, 6856- 6865.

Bar Joseph y Lee, R. Descriptions of plant viruses. 1989. AAB.

Bar-Joseph, M. Lobestein, G. Cohen, J. (1970) Partial purification of viruslike particles


assiated with the citrus trsiteza virus. Phytopathology 60: 75-78

Bar Joseph.M y Loebenstein. G .1972. Effects os strain, source plant, and temperatura
on the transmissibility of Citrus Tristeza Virus by meln aphid. Phytopathology 63: 716
720.

Bar-Joseph, M.; Marcus, R.; Lee, R.F. (1989) The continuous challenge of Citrus Tristeza
Virus control.Annual Review of Phytopathology 27, 291-316.

Campbell, C.W. 1979.Tahit lime production in Florida.University of Florida. Florida


Cooperative. Service,EVA.

Campbell, C.W. 1991. Production of the lime (Citrus latifolia, Tanaka).In florida. University
of Florida. Tropical Region 2:184-192.

CMI (1978) Distribution Maps of Plant Diseases No. 289 (edition 5). CAB International,
Wallingford, UK.

Davino, S., Davino, M., Sambade, A., Guardo, M. and Caruso, A.(2003) The first Citrus
Tristeza Virus outbreak found in a relevant citrus producing area of Sicily, Italy. Plant Dis.
87, 314.

Ecale Zhou, C.L., Ammar, E. D., Sheta, H., Kelley, S., Polek, M., Ullman, D.E. 2002
Citrus Tristeza Virus ultraestructure and associated cytopathology in Citrus sinensis and
Citrus aurantifolia Canadian Journal of Botany 80:512-525

Fraser, L. (1952) Seedling yellows, an unreported virus disease of citrus. Agricultural


Gazette of New South Wales 63, 125-131.

Figueiredo, J.O., Stuchi, E.S., Laranjeira, F.F., Donadio, l.C., Tefilo-Sobrinho, J.,
Sempionato, O.R. y Muller, G.W. 2001. Porta-enxertos para lima cida Tahit em duas
regies do Estado de So Paulo. Laranja, v.22, n.1, p.203- 213.
Capitulo 1 29

Garnsey, S. M., D. J. Gumpf, C. N. Roistacher, E. L. Civerolo, R. F. Lee, R. K. Yokomi,


and M. BarJoseph 1987. Toward a standardized evaluation of the biological properties of
Citrus Tristeza Virus.Phytophylactica 19: 151-157.

Garnsey, S.M., Gottwald, T.R., Hilf, M.E., Matos, L. and Borbn, J. (2000) Emergence
and spread of severe strains of Citrus Tristeza Virus isolates in the Dominican Republic.
In: Proceedings of the 14th Conference of the International Organization of Citrus
Virologists (da Graa, J.V., Lee, R.F. and Yokomi, R. K., eds), pp. 5768. Riverside, CA:
IOCV.

Granof, A., y Webster, R. 1999. Encyclopedia of Virology. Second Edition, Vol


2.Academic Press.

Ghorbel, R., Lopez, C., Fagoaga, C., Moreno, P., Navarro, L., Flores, R., y Pea, L. 2001.
Transgenic citris expressing the citris tristeza virus p23 protein exhibit viral-like symptons.
Molecular plant pathology (2001) 2(1), 27 36

Hermoso de Mendoza, A., Ballester-Olmos, J.F. and Pina, J.A. (1984) Transmission of
Citrus Tristeza Virus by aphids (Homoptera, Aphididae) in Spain. In: Proceedings of the
9th Conference of the International Organization of Citrus Virologists (Garnsey, S.M.,
Timmer, L.W. and Dodds, J.A., eds), pp. 2327. Riverside, CA: IOCV.

Hernandez, F., y Quiroga, J. 2008. Anlisis de la influencia del virus de la tristeza de los
citricos CTV, en copas de lima tahit (citrus latifolia Tanaka), injertadas sobre patrn de m
andarina cleopatra (citrus reshni horth. ex tan), en Corpoica, La Libertad. Tesis. Escuela
de Ingeniara Agronmica. Universidad de los llanos. Villavicencio Colombia.

Hilf, M. E and Garnsey, S. M. 2000.Characterization and Classication of Citrus Tristeza


Virus Isolates by Amplication of Multiple Molecular Markers. Fourteenth IOCV
Conference, 2000Citrus Tristeza Virus

Hilf, M.E., Karasev, A.V., Pappu, H.R., Gumpf, D.J., Niblett, C.L. and Garnsey, S.M.
1995. Characterization of citrus tristeza virus subgenomic RNAs in infected tissue.
Virology, 208, 576582.

Hilf, M. E., Mavrodieva, V. A., and Garnsey, S. M. 2005. Genetic marker analysis of a
global collection of isolates of Citrus risteza virus:Characterization and distribution of CTV
genotypes and association withsymptoms. Phytopathology 95:909-917.

Hughes, W.A. y Lister, C.A. (1949) Lime disease in the Gold Coast. Nature 164, 880

Karasev AV, Boyko VP, Gowda S, Nikolaeva OV, Hilf ME, Koonin EV, Nibblet CL, Cline
K,Gumpf DJ, Lee RF, Garnsey SM and Dawson WO (1995) Complete sequence of the
Citrus Tristeza Virus RNA genome. Virology 208, 511520.

Karasev, A.V. (2000). Genetic diversity and evolution of closteroviruses. Annu. Rev.
30 Estado del arte.

Phytopathol.38, 293-324.

Lalibert, J.F., Sanfacon, H. 2010 Cellular remoldeling during plant virus infection. Annu.
Rev. Phytopathol. 48:69-9.

Lu, R., Folimonov.. M., Shinatahu. M., Li, W., Dawson., Ding .S. 2004. Proc. Natl. Acad.

Mateus, D., Pulido, X., Gutierrez, A., y Orduz-Rodriguez, J.O. 2010. Evaluacin
econmica de la produccin de ctricos cultivados en el Piedemonte del Departamento
del Meta durante 12 aos. Orinoquia [online]. 2010, vol.14, n.1.

Marroquin, C., Olmos, A., Gorris, M.T., Bertolini, E., Martinez, C., Carbonell, E.A.,
Hermoso de Mendoza, A., and Cambra, M. (2004). Estimation of the number of aphids
carryng Citrus Tristeza Virus that visit adult citrus trees. Virus Research.

Mawassi, M., Mietkiewska, E., Gofman, R., Yang, G., and Bar-Joseph, M. 1996.Unusual
sequence relationships between two isolates of Citrus Tristeza Virus. J. Gen. Virol.
77:2359-2364.

Mendt, R., F. Ochoa, L. Vilalba, H. Uhlig, G. Perez, A. Cedeno, and T. Barreto 1988.
Evaluation of citrus tristeza virus tolerant rootstocks grafted with Valencia orange in
Venezuela, p. 107-112. In: Proc. 10th Conf. IOCV., IOCV, Riverside.

Moreno, P., Ambros, S., Albiach-Marti, M.R., Guerri, J., Pena, L., 2008. Citrus
tristezavirus: a pathogen that changed the course of the citrus industry. Mol. Plant
Pathol.9, 251268.

Navas Castillo, J., Albiach-Marti, M.R., Godwa, S., Hilf, M.E., Garsney, SM., y Dawson,
W.O. (1997) Kinetics of accumulation of citrus trsiteza virus RNAs. Virology , 199, 25
46.

Oberholzer, P.C.J.; Mattews, I.; Stiemie, S.F. (1949) The decline of grapefruit trees in
South Africa. A preliminary report on so-called "stem pitting". Science Bulletin of the
Department of Agriculture South Africa No. 297.

Orduz-Rodriguez, J.O. 2012. Manual para el Cultivo de Frutales en el Trpico. Capitulo


ctricos. Editorial Produmedios

Pappu, S.S., Febres, V.V., Pappu, H.R., Lee, R.F. and Niblett, C.L. (1997)
Characterization of the 3 proximal gene of the citrus tristeza closterovirus genome. Virus
Res. 47, 5157.

Quiroga - Cardona, Julio., Hernndez- Parrado, F. L., Silva- Herrera, M., Orduz-
Rodrguez, J.O. 2010. Comportamiento de la produccin de lima Tahit (Citrus latifolia
Tanaka), injertada sobre el patrn de Mandarina Cleopatra (Citrus reticulata Blanco) y la
Capitulo 1 31

influencia del virus de la tristeza (CTV) en condiciones del piedemonte del Meta, 1997-
2008. Orinoquia, vol. 14, nm. 1, junio, 2010, pp. 5-15

Rodriguez, P., De Perez, G., Guzman, M., 2009. Deteccin del virus de la tristeza de los
ctricos por serologa, microscopa e hibridacin in situ. Revista Colombiana De
Biotecnologa ISSN: 0123-3475 ed: Instituto De BiotecnologiaIbunv.11 fasc.1 p.94
106.

Rocha-Pea, M.A., Lee, R.F., Lastra, R., Niblett, C.L., Ochoa, F.M., Garnsey, S.M., and
Yokomi, R.K. (1995). Citrus Tristeza Virus and its aphid vector Toxptera citricida:
Threats to citrus production. Plant Disease 79, 437-445.

Ruiz-Ruiz, S., Moreno, P., Guerri, J., and Ambrs, S. 2009. Discrimination between mild
and severe Citrus Tristeza Virus isolates with a rapid and highly specific real-time reverse
transcription-polymerase chain reaction method using TaqMan LNA probes.
Phytopathology 99:307-315.

Sambade, A., Lopez, C., Rubio, L., Flores, R., Guerri, J., Moreno, G. 2003.
Polymorphism of a specific regin in gen p23 of Citrus Tristeza Virus allows
discrimination between mild ans severe isolates. Arch Virol 148: 2325 2340.

Sanches-Stuchi, E. 2007. Trifoliata Flying Dragon: Um excelente porta-enxerto =ara limo


Tahit. Em memria Congreso Embrapa Mandioca e fruticultura Tropipcal-Estacao
experimental de citricultura de Bebedouro. :8-10.

Stenzel, Neusa. M.C., y Neves. C. (2004) Rootstocks for 'Tahit ' lime. Sci. agric.
(Piracicaba, Braz.) [online]. 2004, vol.61, n.2, pp. 151-155. ISSN 0103-
9016. http://dx.doi.org/10.1590/S0103-90162004000200005

Suastika, G., Natsuaki, T., Terui, H., Kano, T., Ieki, H. and Okuda, S.(2001) Nucleotide
sequence of Citrus Tristeza Virus seedling yellows isolate. J. Gen. Plant Pathol. 67, 73
77.

Tatineni, S., Robertson, C., Garnsey, S., y Dawson, W. 2011. A plant virus evolved by
acquiring multiple nonconserved genes to extend its host range. Proc Natl Acad Sci U S
A. 2011 Oct 18;108(42):17366-71. Epub 2011 Oct 10.

Vives, M.C., Rubio, L., Lpez,C., Navas-Castillo, J., Albiach-Marti, M.R., Dawson, W.O.
Guerri, J., Florez , R., Moreno, P. (1999). The complete genome sequence of the major
component of a mild Citrus Tristeza Virus isolate.J. Gen. Virol. 80, 811-816.

Webber, H.J. 1943.The Tristeza Disease of Sour-Orange-Rootstock. Proc.


Am.Soc.Hort.Sci. 43:160-168.
32 Estado del arte.

Yang, Z,N., Mathews, D.M., Dodds, J.A., Mirkov, T.E. (1999). Molecular characterization
of an isolate of Citrus Tristeza Virus that causes severe symptoms in sweet orange.Virus
Genes 19, 131-142.
2. Identificacin de cepas de Citrus Tristeza
Virus mediante marcadores moleculares de
genotipo especifico en plantas de Citrus
latifolia (Tanaka).

Resumen
Citrus Tristeza Virus (CTV) es causa de la enfermedad viral ms deletrea para la
produccin de ctricos a nivel mundial, y usualmente est presente en campo como un
complejo de asilamientos. En este trabajo se identificaron cepas de CTV en dos parcelas
experimentales de lima Tahit generadas por micro-injerto de pices caulinares in vitro
sobre seis patrones diferentes. Las parcelas se establecieron en los centros de
investigacin de Corpoica Nataima (Espinal Tolima - Colombia) y La Libertad
(Villavicencio Meta Colombia). El material se evalu despus de dos aos de
crecimiento en campo. Se emple RT-PCR mediante primers del gen de la polimerasa
que permiten la identificacin de los genotipos especficos VT, T30 y T36, y primers del
gen p23 para discriminar cepas de los grupos suaves y severos. El genotipo VT fue de
mayor incidencia en las dos localidades, mientras que el genotipo T30 se encontr en las
dos localidades pero con menor incidencia en La Libertad. El genotipo T36 se encontr
nicamente en la Libertad. Se identificaron plantas con infecciones mixtas VT/T30 y
VT/T30/T36. Las secuencias nucleotdicas del gen POL corroboraron los resultados
obtenidos por RT-PCR, as los aislamientos colombianos T36 presentaron 99% de
identidad con la secuencia del genoma de T36 registrada en el GeneBank. Sin embargo,
se sugiere corroborar la presencia de este genotipo mediante el uso de marcadores
moleculares de otros genes de CTV.

Abstract
Citrus Tristeza Virus (CTV) is the most damaging virus of citrus in the worldwide. Usually,
it is present in field trees as a complex of isolates. In this study, CTV isolates were
Capitulo 2 35

identified in two experimental tahitan lime plots produced by micro-graffting of caulinar


budwood in vitro on six different rootstocks. Plots were established in research centers of
Nataima (Espinal Tolima Colombia) and La Libertad (Villavicencio Meta
Colombia).The material was evaluated after two years of established crops. RT-PCR was
done using gene polymerase specific molecular markers to identify genotypes VT, T30
and T36 and gene p23 markers to identify mild and severe isolates. Isolates of severe
genotype VT exhibited de higher incidence in the two localities, mean while the isolates of
the mild genotype T30 were found in two localities with less incidence in La Libertad.
Severe genotype T36 was found in La Libertad. Mixed infections VT/T30 and VT/T30/T36
were identified. Nucleotide sequences of gene polymerase of isolates identified as
genotypes VT, T30 and T36 corroborated the obtained results by RT-PCR. Isolates with
genotype T36 showed 99% identity with the genome sequence T36. However, this result
must be confirmed using molecular markers for other genes of CTV.

2.1 Introduccin
El agente causal de la tristeza de los ctricos es Citrus Tristeza Virus (CTV), se encuentra
establecido en todas las reas de produccin y es considerado como el virus ms
limitante en la produccin mundial de ctricos.CTV pertenece al gnero Closterovirus de
la familia Closteroviridae. Las partculas virales son filamentos flexuosos de 10 a 11 nm
de dimetro y 1900 a 2000 nm de longitud, y exhiben una arquitectura particular
rattlesnake por el ensamblaje de dos protenas de capside, CP de 25kD y CPm de 27kD
(Febres et al., 1996). El genoma de CTV es RNA de cadena sencilla con sentido positivo
(Bar Joseph et al1972; Bar Joseph y Lee, 1989).Existen una amplia gama de tcnicas
para deteccin de CTV, siendo las ms frecuentes ELISA, RTPCR y RTqPCR.
Mediante ELISA se utilizan anticuerpos monoclnales y policlnales para discriminar
entre cepas suaves y severas (Garnsey et al., 1978; Gonsalves, et al., 1978; Pearanda
et al., 1996). Las tcnicas moleculares emplean el uso de marcadores especficos para
discriminar el genotipo de las diferentes cepas de CTV. Algunos trabajos han conjugado
la aplicacin de tcnicas de imnunoimpresin, serolgicas y moleculares para el rpido
diagnstico de CTV (Rodriguez et al, 2009).

La variabilidad en la expresin de sntomas es utilizada para diferenciar cepas de CTV.


Las cepas suaves hacen referencia a que solo causan sntomas suaves o son
36 Identificacin de aislamientos de Citrus Tristeza Virus mediante marcadores
moleculares de genotipo especifico en plantas de Citrus latifolia (Tanaka).

asintomticos en el hospedero ctrico indicador. Las cepas severas pueden causar


sntomas de quick decline, stem pitting o ambos, estos pueden variar en la intensidad
(Garnesey et al., 1987).

El RNA genmico (gRNA) de CTV se encuentra compuesto por 12 marcos de lectura


abiertos (ORFs) y regiones no traducibles (UTRs) en las terminaciones 5' y 3'. El primer
ORF se encuentra divido por dos regiones 1a y 1b. 1a codifica replicasas. 1b codifica
RNA polimerasa dependiente de RNA. Estas dos ORFs abarcan la mitad 5' del genoma y
son traducidos directamente por el gRNA. En la mitad 3' se encuentran ubicados 10 ORF
que codifican las protenas p33 (ORF2), p6 (ORF 3), p65 hHSP70 (ORF 4), p61 (ORF
5), p27- CPm (ORF 6), p25 CP (ORF 7), p18 (ORF 8), p13 (ORF 9), p20 (ORF 10) y
p23 (ORF 11). p65 y p62 son homologas a protenas de choque trmico y junto con las
protenas de la capside p25 y p27 estn involucradas con el ensamblaje del virion. p20 es
asociada con la acumulacin de cuerpos de inclusin en las clulas infectadas. La
funcin de p33, p18 y p13 se relaciona con la capacidad de inducir infeccin sistmica en
el rango de ctricos hospederos (Tatineni et al., 2011) y se ha demostrado que no son
necesarias para la replicacin y ensamblaje de los viriones (Satyanarayana et al., 1999,
2000). Los ORFs del extremo 3 de CTV se expresan a travs de un set de RNAs
mensajeros 3- coterminales llamados RNAs subgenmicos (Hilf et al., 1995). Una alta
variabilidad ha sido encontrada en CTV, debido a que la RNA polimerasa dependiente de
RNA - dRpR no posee actividad exonucleasa para correccin de errores en la replicacin
y a eventos de recombinacin (Bar-joseph et al., 1893; Moreno et a., 2008; Cerni et al.,
2007). Anlisis de secuencias de nucletidos muestran que el genoma de CTV es
conservado en los ORF cercanos al extremo 3 con una identidad del 90% entre
aislamientos y con mayor divergencia en los ORFs 1a y 1b cercanos al extremo 5 con
una identidad del 40% entre aislamientos (Albiachi et al., 2000; Lpez et al., 1998;
Mawassi et al.,1996).

La deteccin de un genotipo especifico de CTV es posible mediante PCR con primers


diseados a partir de variantes nucleotdicas del gen RNA polimerasa (Hilf et al., 2005). A
partir de este mtodo de deteccin, CTV ha sido clasificados en tres grupos principales:
VT (B370, B152, B1, B79, B59, B219) que generan sntomas de acanaladuras de tallo y
ramas, T30 (B213, B348, B271, B270-1) que generan sntomas suaves, y T36 (B83, B33,
Capitulo 2 37

T36) que generan decaimiento rpido (Hilf et al., 1999; Hilf y Garnsney 2000; Hilf et al.,
2005). Por otro lado marcadores especficos diseados a partir del polimorfismo del gen
p23 permiten discriminar genotipos severos (VT, Baro B, T 305, T388), suaves (T300,
T312, T32, entre otros) y atpicos (T36, Galego 50, K, entre otros) (Sambade et al.,
2003).

Trabajos de caracterizacin de cepas colombianas de CTV reportan la presencia de


suaves y severas. Las cepas B126 y B165 de Colombia estn relacionadas con
aislamientos que generan acanaladuras de tallo y en anlisis filogenticos muestran
relacin con aislamientos de India y Japn. Las cepas B272 y B274 estn asociadas con
aislamientos suaves T4 y T30 de Florida. La comparacin de secuencias del gen CP de
algunas cepas colombianas con la secuencia del aislamiento T36 indic rangos de
identidad de 93% a 97% (Pearanda et al., 1996). Este estudio preliminar sugiri la
presencia de cepas T36 en cultivos colombianos, sin embargo esta regin del genoma de
CTV es altamente conservada y es necesario evaluar otros marcadores moleculares para
CTV que proporcionen mayor informacin. Los trabajos de deteccin en Colombia
indican una amplia distribucin y una alta incidencia de CTV en general. El uso de
tcnicas serolgicas moleculares para discriminar cepas suaves de severas, han
determinado una amplia distribucin de cepas severas que generan acanaladuras de
tallo (Pearanda et al., 1996; Oliveros et al., 2001; Delgado et at., 2004; Martnez y
Guzmn 2007), la distribucin de cepas suaves es menos amplia y se reportan
principalmente en Mompx (Pearanda et al., 1996). El objetivo del presente trabajo fue
identificar las cepas de CTV que infectan dos poblaciones de lima Tahit ubicadas en dos
posiciones geogrficas diferentes.

2.2 Materiales y mtodos


La muestras se colectaron del centro de investigacin Corpoica Nataima, en el Espinal
(Tolima Colombia) ubicado en las coordenadas 4 12 56 N y 72 56 3 O, a 430
msnm, con una temperatura media de 28 C y una humedad relativa del 70% y del centro
de investigacin Corpoica La Libertad a 2 Km de Villavicencio (Meta Colombia) ubicado
en las coordenadas 9 6' N, 73 34' O, a 320 msnm, con una temperatura media de 27 C
y humedad relativa entre el 70 y el 90%. Cada una de las poblaciones de lima Tahit se
encontraba injertada sobre patrones de seis especies o cultivares hbridos: volkameriano
38 Identificacin de aislamientos de Citrus Tristeza Virus mediante marcadores
moleculares de genotipo especifico en plantas de Citrus latifolia (Tanaka).

(C. volkameriana Ten. Y Pasq.), citrumelo swingle (C. paradisi x P. trifoliata (L.) Raf.),
mandarina cleopatra (C. reticulata Blanco.), sunky x english (Citrus sunki Hort. ex Tan. x
Poncirus trifoliata (L.)) , kryder (Poncirius trifoliata L Raf), y carrizo (C. sinensis x P.
trifoliata (L.)). En campo, cada especie de injerto se distribuy en grupos de seis plantas
y este arreglo se repiti cuatro veces. Las muestras se rotularon de acuerdo al patrn,
numero de repeticin y numero de planta. Se procesaron de la siguiente manera: i) Se
tomaron nervaduras de hojas jvenes y corteza de ramas con tejido verde en los cuatro
puntos cardinales de cada una de las plantas. ii) Se homogeniz en una sola muestra
cada grupo de seis plantas injertadas sobre un mismo patrn.iii) El material vegetal se
macero en nitrgeno liquido iv) Cada grupo de plantas se proceso por RT PCR. iv) En
los grupos de plantas en los que se detectaron cepas de inters varias cepas, se
proces independientemente cada planta (ver figura 1)

Figura 2-1: Esquema de toma de muestras y flujo de decisin para seleccionar plantas a evaluar

El genotipo de cada uno de las cepas de CTV se determin por RT PCR mediante el
uso de parejas primers genotipo especficos para VT, T30 y T36. Los productos RT-PCR
se visualizaron por electroforesis en gel de agarosa al 2% teido con bromuro de etidio.
Los productos de RT PCR fueron secuenciados y las secuencias obtenidas se
compararon con las registradas en el GeneBank. La RT PCR se realiz en un
termociclador BIORAD C1000.
Capitulo 2 39

2.2.1Extraccin de ARN, transcripcin reversa (RT) y reaccin en


cadena de la polimerasa (PCR).
La extraccin de ARN se realiz mediante el protocolo Trizol (Invitrogen). Este consisti
en tres fases: la primera rompimiento de paredes celulares con Trizol, separacin con
cloroformo y gradientes de densidad por centrifugacin. La segunda fase fue de
precipitacin de cidos nuclecos mediante el uso de alcohol isoproplico y gradientes de
densidad por centrifugacin. La tercera fase consisti en el lavado del pellet de ARN con
etanol al 75%. Posteriormente se re suspendi el pellet en 50l de agua grado molecular
tratada con dietil pirocarbonato (DEPC).

Transcripcin reversa
Se realiz en un volumen de 25l que contena 5l de RNA, 1l del primer ramdom
hexamers (Invitrogen), 1l de dNTPs 10mM (Invitrogen) y 8l de agua DEPC, 2l de
Buffer first strand M-MLV 10X (Invitrogen), 2l de DTT 100mM (Invitrogen), 1l RNAasa
Out 40U (Invitrogen), 1l de M-MLV-RT (Invitrogen) y 4l de MgCl2 25mM (Invitrogen). El
RNA se denatur a 65 C por 5 minutos. La reaccin se incub 10 minutos a 25 C, se
sintetiz por 90 minutos a 37 C, y se finaliz 10 minutos a 72 C.

PCR Convencional
La PCR convencional se realiz con los primers de la regin polimerasa en reacciones de
25l. Cada una contena 2.5l de Buffer taq polimerasa 10X sin MgCl2 (Invitrogen), 1l de
dNTPs 10 mM (Invitrogen), 0.25l 10 mM primer sentido, 0.25l 10 mM anti sentido de
los primers CP, VTPOL, T30POL y T36POL segn el caso; 1.5l de MgCl2 50mM
(Invitrogen), 5l de producto de RT. 0.4l de Taq polimerasa 5U/l (Invitrogen) y 14.1l
de agua DEPC. El programa de amplificacin consisti en una temperatura de
denaturacin inicial por 5 minutos a 94 C, posteriormente 35 ciclos a 94 C por 30
segundos, 65 C por 30 segundos y 72 C por 60 segundos. Para finalizar una
temperatura de extensin a 72 C por 10 minutos.

La amplificacin con primers CP indica la presencia general de CTV y es un control


interno de la transcripcin reversa. Los primers VT-POL producen un amplicon de 695pb
e indica la presencia de genotipos severos VT que ocasionan acanaladuras de tallo en
lima Tahit. Los primers T30-POL producen un amplicon de 696pb e indica la presencia
40 Identificacin de aislamientos de Citrus Tristeza Virus mediante marcadores
moleculares de genotipo especifico en plantas de Citrus latifolia (Tanaka).

de genotipos que ocasionan sntomas suaves en lima Tahit. Mientras que los primers
T36-POL permiten la amplificacin de un amplicon de 714pb e indica la presencia de
cepas T36 que ocasionan decaimiento rpido en ctricos injertados sobre naranjo agrio y
lima Tahit (Hilf et al. 2005)

PCR bidireccional
Esta PCR se efectu mediante el uso de primers del ORF p23. Se utilizaron dos parejas
de primers; una pareja externa y una interna. La reaccin se realiz a 25l. Cada una
contena 2.5l de Buffer taq polimerasa 10X sin MgCl2 (Invitrogen), 1l de dNTPs 10 mM
(Invitrogen), Los primers externos (0.25l 10 mM primer pm85 (+), 0.25l 10 mM primer
pm86 (-)), los primers internos (0.25l 10 mM primer pm82 (+), 0.25l 10 mM primer
pm83 (-)), 1.5l de MgCl2 50mM (Invitrogen), 5l de producto de RT. 0.4l de taq
polimerasa 5U/l (Invitrogen) y 14.1l de agua DEPC. . El programa de amplificacin
consisti en una temperatura de denaturacin inicial por 94 C por 120 segundos,
posteriormente 35 ciclos de 94 C por 30 segundos, 50 C por 30 segundos y 72 C por
60 segundos. Para finalizar una temperatura de extensin a 72 C por 120 segundos.

Los primer externos estn basados en secuencias conservadas y los internos son
derivados de secuencias de grupos severos, suaves y atpicos. Los grupos suaves (T32,
T35, T300, T312, T346 y T385) producen amplicones de 612 y 239 a la vez. Los grupos
severos ( VT y Baro B) producen amplicones de 612 y 450 pb a la vez; otras cepas del
grupo severo (T305, T388, C269-6, Cald-CB y Val-CB) producen adicionalmente un
fragmento de 239 pb. Los grupos atpicos (T36 y K ) producen un solo amplicon de 612
pb. (Sambade et al. 2003)
Primer Secuencia
VTPOL (+) gacgctagcgatggtcaagc
VTPOL (-) ctcggctcgctttcttacgt
T36POL (+) atggacgacgaaacaaagaaattg
T36POL (-) tcaacgtgtgttgaatttccca
T30POL (+) gatgctagcgatggtcaaat
T30POL (-) ctcagctcgctttctcacat
P23_PM82 aaacacgataaggcatcgag
P23_PM83 cacttacgttcagtcttgagcg
P23_PM85 ggacaaactttiitttctgtgaacctttc
P23_PM86 gatgaagtggtgttcacggagaactc
Tabla 2-1: Primers de utilizados para deteccin de CTV. Tomado de Hilf et al., 2005 y Sambade et al., 2003
Capitulo 2 41

Secuenciacin
Los productos de PCR previamente purificados fueron secuenciados en un secuenciador
ABI3730 XL por el mtodo Byg Dye Terminator. Dos productos de PCR obtenidos con los
primers utilizados de la regin de polimerasa para cada una de las poblaciones
evaluadas, fueron seleccionados para su secuenciacin.

2.3 Resultados
Todos los grupos de muestras evaluados mediante PCR con primers del gen CP
indicaron infeccin con CTV. En el 100% de las muestras se observaron amplicones
672pb que corresponden al tamao esperado para este amplicon. Lo que indic que por
lo menos una de las seis plantas que conforman cada grupo, estaba infectada con CTV.

En la poblacin del huerto de ctrios de La Libertad (Villavicencio Meta Colombia) se


encontr una alta incidencia de cepas VT respecto a las cepas T30 y T36. El 100% de los
grupos de plantas evaluadas estaban infectadas con cepas VT. El 8 % de los grupos de
plantas evaluadas con el marcador estaban infectadas con cepas T30. El 13 % de los
grupos de plantas evaluadas con cepas T36. Lo anterior constituye evidencia de
infecciones mixtas VT/T30/T36 y VT/T30, las cuales fueron detectadas en los grupos de
platas injertadas sobre los patrones Volkameriano RI, Cleopatra RIII, cleopatra RIV y
carrizo RIV. Este resultado, llev a evaluar la infeccin de estos grupos planta a planta.

En la revaluacin planta a planta se encontr que todas las plantas estaban infectadas
con CTV, y de igual manera se encontr alta incidencia de cepas VT respecto a cepas
T30 y T36. El 100% de las plantas estaban infectadas con cepas VT. Se identificaron
plantas con infecciones mixtas, el 27% (6 plantas) tenan infeccin mixta entre cepas
VT/T30, el 34% (8 plantas) de las plantas se encontraban infectadas con mezcla VT/T36
y el 4% (1 planta) tena infeccin mixta entre cepas VT/T30/T36. El 35% de plantas
restantes estaba infectado nicamente con cepas VT.
42 Identificacin de aislamientos de Citrus Tristeza Virus mediante marcadores
moleculares de genotipo especifico en plantas de Citrus latifolia (Tanaka).

Figura 2-2: Electroforesis en gel de agarosa para visualizar amplicones de VT-POL deCTV (695 pb) de las muestras de
lima Tahit colectadas en el huerto Corpoica La Libertad. Las filas A y B muestran los productos de PCR de pools de seis
plantas injertadas sobre cada patrn. Fila A: Carril 1: Marcador de peso molecular 100 bp (Fermentas). Carril 2 a 5: Kryder
RI a RIV. Carril 6 a 9: Volkameriano RI a RIV. Carril 10 a 13: Sunky x English RI a RIV. Fila B: Carril 1: Marcador de peso
molecular 100 bp (Fermentas). Carril 2 a 5: Citrumelo RI a RIV. Carril 6 a 9: Cleopatra RI a RIV. Carril 10 a 13: Carrizo RI
a RIV. Fila C: Productos de PCR de cada planta de un pool de seis plantas. Carril 1: Marcador de peso molecular 100 bp
(Fermentas). Carril 2: Control positivo Carril 3: Blanco de reaccin.Carril 4 a 8: Cleopatra RIV plantas 1 a 5. Carril 9 a 14:
Cleopatra RIII plantas 1 a 6. Carril 15 a 20: Volkameriano RI plantas 1 a 6. Carril 21 a 24: Carrizo RIV plantas 1 a 4.

Figura 2-3: Electroforesis en gel de agarosa para visualizar amplicones T30 POL de CTV (696 pb) de las muestras de lima
Tahit colectadas en el huerto ubicado en Corpoica La Libertad. Las filas Ay B muestran los productos de PCR de pools
de seis plantas injertadas sobre cada patrn. Fila A: Carril 1: Marcador de peso molecular Fermentas 100pb. Carril 2 a 5:
Kryder RI a RIV. Carril 6 a 9: Volkameriano RI a RIV. Carril 10 a 13: Sunky x English RI a RIV. Fila B: Carril 1: Marcador
de peso molecular Fermentas. Carril 2 a 5: CitrumeloRI a RIV. Carril 6 a 9: Cleopatra RI a RIV. Carril 10 a 13: Carrizo RI
a RIV.Fila C: Las filas Ay B muestran los productos de PCR de pools de seis plantas injertadas sobre cada patrn Carril
1: Marcador de peso molecular Fermentas 100pb. Carril 2: Control positivo Carril 3: Blanco de reaccin .Carril 4 a 9:
Cleopatra RIII platas 1 a 6. Carril 10 a 15:Volkameriano RI Plantas 1 a 6
Capitulo 2 43

Figura 2-4: Electroforesis en gel de agarosa para visualizar amplicones T36 POL de CTV (714 pb) de las muestras de lima
Tahit colectadas en el huerto ubicado en Corpoica La Libertad. La fila A muestra los productos de PCR de pools de seis
plantas injertadas sobre cada patrn. Fila A: Carril 1: Marcador de peso molecular 100 pb (Fermentas). Carril 2 a 5:
Citrumelo RI a RIV. Carril 6 a 9: Cleopatra RI a RIV. Carril 10 a 13:Cariizo RI a RIV. Carril 14 a 17: Sunky x English RI a
RIV. Carril 18 a 19:Cleopatra RI a RII. Las filas B y C muestran productos de PCR de cada planta de un pool de seis
plantas Fila B. Carril 1: Marcador de peso molecular 100pb (Fermentas). Carril 2: Control positivo Carril 3: Blanco de
reaccin Carril 4 a 9: Cleopatra RIII plantas 1 a 6. Carril 10 a 14: Cleopatra RIV plantas 1 a 5. Fila C. Carril 1: Marcador de
peso molecular Fermentas. Carril 2 a 7: Carrizo RIV plata 1 a 6

Cada grupo de muestras se evalu nuevamente con los primers de la regin p23. Se
visualizaron amplicones de 612pb y 412pb en el 96% de las muestras, indicando que
estos grupos de plantas estaban infectados con cepas severas que podran ser tipo VT.
El 4% de las muestras restantes produjo adicionalmente una banda de 239pb, lo que
indicara que estos grupos de muestras podran estar infectados en mezcla de cepas
severas y suaves. Estas dos bandas adicionales se identificaron en los grupos de plantas
volkameriano RI y cleopatra RIII. Se revaluaron estos grupos planta a planta ms los
grupos cleopatra RIV y carrizo RIV en donde no se haba identificado cepas suaves con
los primers de la regin de polimerasa.

En la revaluacin planta a planta en el 73% de las muestras se visualizaron nicamente


amplicones de 612pb y 412pb, lo que indica que estas plantas estaban infectadas con
asilamientos severos presumiblemente VT. En el 27% de las muestras se observ un
amplicon adicional de 239pb, lo que indic que estas plantas se encontraban infectadas
con mezcla de cepas suaves y severas, esto en correspondencia a lo encontrado con los
primers de la regin polimerasa.
44 Identificacin de aislamientos de Citrus Tristeza Virus mediante marcadores
moleculares de genotipo especifico en plantas de Citrus latifolia (Tanaka).

Figura 2-5: Electroforesis en gel de agarosa para visualizar amplicones del gen P23 de CTV de las muestras de lima
Tahit colectadas en el huerto ubicado en Corpoica La Libertad. Las filas Ay B muestran los productos de PCR de pools
de seis plantas injertadas sobre cada patrn. Fila A: Carril 1: Marcador de peso molecular 100 pb (Fermentas) Carril 2 a 5:
Kryder RI a RIV. Carril 6 a 9: Volkameriano RI a RIV. Carril 10 a 13: Sunky x English RI a RIV. Carril 14 a 15: Citrumelo RI
a RII. Fila B: Carril 1: Marcador de peso molecular 100 pb (Fermentas). Carril 2 a 3: Citrumelo RIII a RIV. Carril 4 a 7:
Cleopatra RI a RIV. Carril 8 a 11: Cariizo RI a RIV. Fila C: Productos de PCR de cada planta de un pool de seis plantas.
Carril 1: Marcador de peso molecular 100pb (Fermentas). Carril 2 a 7: Cleopatra RIII Planta 1 a 6. Carril 8 a 12: Cleopatra
RIV Planta 1 a 5. Carril 13 a 18: Volkameriano RI Planta 1 a 6. Carril 19 a 24: Carrizo RIV planta 1 a 6.

En la poblacin del huerto de ctricos de Nataima (Espinal Tolima Colombia), todos los
grupos de injertos evaluados presentaron infeccin por CTV y se detectaron nicamente
cepas VT y T30. La incidencia de cepas VT fue mayor respecto a la incidencia de cepas
T30. El 50% de los grupos de plantas estaban infectadas nicamente con cepas VT y el
50% estaba infectado con mezcla de cepas VT/T30. Se identificaron cuatro grupos de
plantas con mezcla de cepas VT y T30, se escogieron los grupos de plantas
volkameriano RI y kryder RI para evaluar planta a planta. En esta evaluacin de cada
planta se encontr que el 66% de las plantas se encontraban infectadas nicamente con
cepas VT. El 34% de la plantas present infecciones mixtas entre cepas VT/T30. Al
evaluar el grupo de muestras mediante PCR del gen p23, se encontr que el 54%
amplificaron nicamente bandas de 612pb y 412pb indicando la presencia de cepas VT,
el 46 % amplifico una banda adicional de 239 pb que indica la mezcla de cepas suaves y
severas en estos grupos de plantas. Se escogieron dos grupos para evaluarlos planta a
planta (kryder RI y Volkameriano RI), se identific que el 33% de las plantas tenan
infeccin mixta entre cepas suaves y severas, frente al 67% restante que indico infeccin
nicamente con aislamientos suaves.
Capitulo 2 45

Figura 2-6: Electroforesis en gel de agarosa para visualizar amplicones de CTV (p23) de las muestras de lima tahti
colectadas en el huerto ubicado en Corpoica Nataima. Las filas Ay B muestran los productos de PCR de pools de seis
plantas injertadas sobre cada patrn. Fila A: Carril 1: Marcador de peso molecular 100 pb (Fermentas). Carril 2 a 5:
Cirumelo RI a RIV. Carril 6 a 9: Sunky x English RI a RIV. Carril 10 a 13: Carrizo RI a RIV. Fila B:Carril 1: Marcador de
peso molecular 100 pb Fermentas. Carril 2 a 5: Volkameriano RI a RIV.Carril 6 a 9: Kryder RI a RIV. Carril 10 a 13:
Cleopatra RI a RIV. Fila C: Productos de PCR de cada planta de un pool de seis plantas Carril 1: Marcador de peso
molecular 100 pb (Fermentas). Carril 2 a 7: Volkameriano RI plantas 1 a 6. Carril 8 a 13: Kryder RI Plantas 1 a 6.

La secuenciacin directa de los productos de PCR de los grupos severo VT y T36 y del
grupo suave T30 revel una alta identidad con los respectivos aislamientos. Presentaron
porcentajes de identidad del 99% y porcentajes de cobertura entre el 99 y 100% con los
aislamientos registrados en el Genbank (Tabla 2).

Origen Material Muestra Identidad Accesin Identidad% Cobertura% Gaps


LaOrigen
Libertad ClEORIVP5 T36_001 con:
T36 E.U937521,1 99 (%)
100 0
La Libertad CLEORIIIP3 T36_002 :genotipo
T36 E.U937521,1 (%)
99 99 0
La Libertad VOLRIP6 T30_003 T30 AF260651,1 99 100 0
La Libertad CLEORIIIP6 T30_004 T30 AF260651,1 99 100 0
La Libertad VOLRIPI VT_005 VT EU262674,1 99 99 0
La Libertad CLEORIVP5 VT_006 VT EU262674,1 99 100 0
Nataima VOLRIP3 VT_007 VT AY295898,1 99 100 0
Nataima VOLRIP4 VT_008 VT AY295898,1 99 100 0
Nataima VOLRIP3 T30_009 T30 DO3550701 99 99 0
Nataima VOLRIP4 T30_010 T30 DO3550701 99 99 0

Tabla 2-2: Resumen de identidad de las secuencias de las muestras con accesiones del GeneBank
46 Identificacin de aislamientos de Citrus Tristeza Virus mediante marcadores
moleculares de genotipo especifico en plantas de Citrus latifolia (Tanaka).

2.4 Discusin
Los resultados indican que las plantas de los huertos de lima Tahit de La Libertad tienen
infeccin de un complejo de cepas T30, VT y T36, frente a la poblacin de Nataima cuyo
complejo de infeccin se restringe a cepas T30 y VT. La incidencia de infeccin por
cepas del grupo severo VT fue alta en los huertos evaluados, acorde con lo reportado
previamente acerca de su amplia distribucin e incidencia en Colombia (Pearanda et al.,
1996; Oliveros et al., 2010; Delgado et at., 2004; Martnez y Guzmn 2007). Se
identificaron cepas suaves T30 en las dos poblaciones de lima Tahit, y la proporcin de
infeccin fue mayor en Nataima respecto a La Libertad. Esto podra indicar que las cepas
de este tipo posiblemente se han dispersado por el pas, encontrndose inicialmente en
Mompx (Bolivar) y luego en Cundinamarca (Pearanda et al., 1996; Oliveros et al.,
2010). En el presente trabajo, las cepas T30 fueron detectadas en Villavicencio (Meta) y
Espinal (Tolima). Se identificaron cepas T36 en el huerto La Libertad (Villavicencio
Meta) a travs de los marcadores especficos del gen de la polimerasa, esta deteccin
corrobora estudios preliminares que sugieren la presencia de este tipo de cepas
mediante secuencias del gen CP (Pearanda et al., 1996). Las secuencias del gen de la
polimerasa indican identidades entre el 99 y el 100% de las muestras positivas para las
cepas VT, T30 y T36. La deteccin de las cepas T36 es preliminar y debe ser
corroborada con marcadores de otros genes que sean informativos para discriminar este
tipo de cepas. Estudios de infeccin mixta presentes en campo han mostrado que es
frecuente encontrar mezcla de cepas VT/T30, y en casos excepcionales T30/T36 (Roy y
Brlansky, 2004).

Los resultados obtenidos muestran plantas con infecciones mixtas en varias


combinaciones: plantas infectadas con cepas VT/T30, VT/T36 y VT/T30/T36. Se encontr
alta concordancia entre los primers del gen de la polimerasa y los primers del gen p23
para identificar genotipos de CTV. Muestras que indicaron infeccin nicamente con VT
con los primers del gen de la polimerasa, con p23 indicaron que pertenecan al grupo
severo que podr ser VT Barao B.

La notable predominancia en campo de cepas VT respecto a T30 y T36 genera


interrogantes de la forma en que se dio la dinmica de infeccin de CTV. El material fue
plantado al mismo tiempo, sin embargo las proporciones de infeccin son diferentes.
Capitulo 2 47

Hay alguna adaptacin de las diferentes cepas de CTV a los vectores locales? En los
campos de ctricos de Colombia es predominante el vector Toxoptera citricida y se sabe
que este es vector mas eficiente de las cepas de CTV tipo VT, de manera tal que podra
haber una relacin lgica con la dinmica de infeccin, Fue efectiva la produccin de
yemas libres de virus? Realmente no se logro llevar una trazabilidad del material desde la
liberacin en vivero hasta su establecimiento en campo, no obstante se piensa que
probablemente cepas T36 encontradas nicamente en el huerto de La Libertad son
procedentes de campo, ya que de proceder del vivero habra mayor probabilidad de
encontrarla en Nataima y como se mostro este resultado fue negativo. Por qu se da
una delta de incidencia tan alta en tan solo dos aos? El vector Toxoptera citricida tiente
la capacidad de infectar el 95% de una poblacin de ctricos en 2 a 4 aos (Gottwald et
al., 1996), es predominante en campo y probablemente se una de las causas de dicho
comportamiento. No obstante, no tenemos evidencia de la actividad del vector en las
parcelas de estudio para explicar este comportamiento, o s puede tener mayor afinidad
por la transmisin de cepas VT.

Con las secuencias obtenidas fue posible confirmar los resultados obtenidos por RT-PCR
del gen de la polimerasa. Se encontraron valores de incidencia diferentes entre cepas VT
y T30 en las dos reas geogrficas evaluadas. Las plantas de lima Tahit de Nataima
presentaron masivamente infecciones mixtas entre cepas suaves T30 y severos VT. Los
primers del gen p23 mostraron las muestras con infecciones mixtas VT/T30, lo cual se
evidencia por la amplificacin de bandas de 612, 412 y 239 simultneamente(Giampan et
al., 2010).

En la Libertad no fue posible identificar plantas con infeccin exclusiva de cepas del
grupo severo T36 mediante RT-PCR bidireccional del gen p23. Esto debido a que la
totalidad de los ctricos tenan infeccin con cepas del grupo VT en mezcla con otras
cepas. Por lo tanto, la banda de 612pb que indica la infeccin con la cepa T36 nunca la
encontraramos sola a menos de que el ctrico presente nicamente infeccin con
estacepa.

2.5 Bibliografa
Albiach-Marti, M R., Mawassi,M., Gowda, S., Satyaranayana, T., M.E., Shanker, S.,
Almira, E.C., Vives, M.C., Lpez, C.,Guerri, J.,Florez,R., Moreno, P., Garnsey, S., M.,
48 Identificacin de aislamientos de Citrus Tristeza Virus mediante marcadores
moleculares de genotipo especifico en plantas de Citrus latifolia (Tanaka).

Dawson, W.O. 2000. Sequences of Citrus Tristeza Virus separated in time and space are
essentially identical. J. Virol. 74, 6856- 6865.

Bar-Joseph, M., Loebenstein, G. and Cohen, J. (1972) Further purificationand


characterization of threadlike particles associated with thecitrus tristeza disease. Virology,
50, 821828.

Bar-Joseph, M., Marcus, R., Lee, R.F. (1989) The continuous challenge of Citrus Tristeza
Virus control.Annual Review of Phytopathology 27, 291-316.

Cerni, S., Ruscic, J., Nolasco., G, Zivko., G, Krjacic., M, skoric, D. 2007. Stem pittin and
seedling yellows symptoms of Citrus Tristeza Virus infection may be determinate by minor
sequences variants. Virus Genes 36:241-249.

Delgado, J., Guzmn, M., Caicedo, A., Ordz, J. 2004. CTV screening of Colombian
germplasm banks kept in Palmira (Valle del Cauca) and Villavicencio (Meta) and
preliminary estimation of CTV variants by RFLP and SSCP 44 Meeting of the American
Phytopathological Society Caribbean Division La Habana, mayo 24-28. Memorias.

Febres, V.J., Ashoulin, L., Mawassi, M., Frank, A., Bar-Joseph, M., Manjunath, K.L., Lee,
R.F. and Niblett, C.L. 1996.The p27 protein is present at one end of Citrus Tristeza Virus
particles. Phytopathology, 86, 13311335.

Garnsey, S.M., Gonsalves, D., and Purcifull, D. E. 1978. Rapid diagnosis of citrus
Tristeza virus infections by sodium dodecyl ulfate-immunodiffusion procedures.
Phytopathology 68:88-95.

Garnsey, S. M., D. J. Gumpf, C. N. Roistacher, E. L. Civerolo, R. F. Lee, R. K. Yokomi,


and M. BarJoseph 1987. Toward a standardized evaluation of the biological properties of
Citrus Tristeza Virus.Phytophylactica 19: 151-157.

Gonsalves, D., Purcifull, D., Garnsey, S.M. 1978. Purification and serology of Citrus
Tristeza Virus.Phytopathology 68, 553-559.

Hilf, M.E., Karasev, A.V., Pappu, H.R., Gumpf, D.J., Niblett, C.L. and Garnsey, S.M. 1995.
Characterization of citrus tristeza virus subgenomic RNAs in infected tissue. Virology,
208, 576582.

Hilf, M. E y Garnsey, S.M. 2000. Characterization and Classication of Citrus


Tristeza Virus Isolates by Amplication of Multiple Molecular Markers. Fourteenth IOCV
Conference, 2000Citrus Tristeza Virus

Hilf, M.E., Mavrodieva, V. A., and Garnsey, S. M. 2005. Genetic marker analysis of a
global collection of isolates of Citrus Tristeza Virus:Characterization and distribution of
CTV genotypes and association withsymptoms. Phytopathology 95:909-917.
Capitulo 2 49

Lpez, C., Aylln, M. A., Navas-Castillo, J., Guerri, J., Moreno, P., and Flores, R. 1998.
Molecular variability of the 5- and 3-terminal regions of Citrus Tristeza Virus
RNA.Phytopathology 88:685-691.

Martnez, S , Guzmn, M 2007 Serological analysis of Colombian Citrus Tristeza Virus


isolates Phytopathology 97: S175

Mawassi, M., Mietkiewska, E., Gofman, R., Yang, G., and Bar-Joseph, M. 1996.Unusual
sequence relationships between two isolates of Citrus Tristeza Virus.J. Gen. Virol.
77:2359-2364.

Oliveros, O , Torres, J , Morales, G , Guzmn, M , Acosta, O , Pearanda J 2001 Two


common haplotypes of 106 Rev. Colomb. Biotecnol. Vol. XI No. 1 Julio 2009 94-106.
The CPm gene(p27) in Colombian field isolates of the Citrus Tristeza Virus In:
proccedings of the 15th Conference of the International Organization of Citrus virologists
Riverside: IOCV University of California, Abstracts

Oliveros-Garay, O.A, Martinez-Salazar, N-, Torres-Ruiz, Y., Acosta, O. CPm gene


diversity infield isolates of Citrus Tristeza Virus from Colombia.Arch
Virol. 2009;154(12):1933-7

Pearanda, J. Acosta, O. Guzman, M. Barney, A. Pappu, H, Pappu, S. Manjunath, L.


Febre, J. Niblett, L. 1996. Incidence and characterization of mild and severe isolates of
Citrus Tristeza Virus from Colombia. Thirteenth IOCV Conference.

Rodriguez, P., De Perez, G., Guzman, M., 2009. Deteccin del virus de la tristeza de los
ctricos por serologa, microscopa e hibridacin in situ.
Revista Colombiana De Biotecnologa ISSN: 0123-3475 ed: Instituto De
BiotecnologiaIbunv.11 fasc.1 p.94 106.

Roy, A. and Brlansky, R.H. 2004. Genotype classification and molecular evidence for the
presence of mixed infections in Indian Citrus Tristeza Virus isolates. Arch. Virol. 149 (10),
1911-1929

Ruiz-Ruiz, S., Moreno, P., Guerri, J., and Ambrs, S. 2009. Discrimination between mild
and severe Citrus Tristeza Virus isolates with a rapid and highly specific real-time reverse
transcription-polymerase chain reaction method using TaqMan LNA probes.
Phytopathology 99:307-315.

Sambade. A., Lopez, C., Rubio, L., Flores, R., Guerri, J., Moreno, G. 2003.
Polymorphism of a specific regin in gen p23 of Citrus Tristeza Virus allows
discrimination between mild ans severe isolates. Arch Virol 148: 2325 2340.

Satyanayanana, T., Gowda, S., Boyko, V.P., Albiach-Mart, M.R., Mawassi, M., Navas-
Castillo, J., Karasev, A.V., Dolja, V., Hilf, M.E., Lewandowsky, D.J., Moreno, P., Bar-
Joseph, M., Garnsey, S.M. and Dawson, W.O. 1999 An engineered closterovirus RNA
50 Identificacin de aislamientos de Citrus Tristeza Virus mediante marcadores
moleculares de genotipo especifico en plantas de Citrus latifolia (Tanaka).

replicon and analysis of heterologous terminal sequences for replication. Proc. Natl Acad.
Sci. USA, 96, 74337438.

Satyanayanana, T., Gowda, S., Mawassi, M., Albiach-Mart, M.R., Aylln, M.A.,
Robertson, C., Garnsey, S.M. and Dawson, W.O. 2000 Closterovirus encoded HSP70
homolog and p61 in addition to both coat proteins function in efficient virion assembly.
Virology, 278, 253265.

Tatineni, S., Robertson. C, Garnsey, S., y Dawson, W. 2011. A plant virus evolved by
acquiring multiple nonconserved genes to extend its host range. Proc Natl Acad Sci U S
A. 2011 Oct 18;108(42):17366-71. Epub 2011 Oct 10.
3. Patrones para lima Tahit C. latifolia (Tanaka)
frente a la severidad de stem pitting
ocasionado por Citrus Tristeza Virus

Resumen
Citrus Tristeza Virus induce diversos sntomas dependiendo de tipo de aislamiento el
complejo de infecciones mixtas y de la especie y variedad del hospedero ctrico. En el
presente trabajo se evalu la severidad de stem pittin en lima Tahit injertada sobre seis
patrones diferentes. En trabajos preliminares se identificaron las cepas de CTV que
infectaron en campo el material objeto de evaluacin. Se identificaron cepas de VT
predominantes que generan stem pitting solas y en infecciones mixtas con cepas T30 y
T36. La relacin entre la severidad de stem pitting con la localidad, los diferentes
patrones y cepas de CTV se analizaron mediante anlisis de correspondencias mltiples,
tablas de contingencia y test de independencia chi cuadrado. Se encontr que la
severidad de stem pitting est asociada con la localidad geogrfica y el patrn, pero no
con la mezcla de cepas virales. El patrn Kryder injertado con lima Tahit se muestra
prometedor frente a infeccin por CTV para los materiales cultivados en las localidades
de La Libertad y Nataima

Abstract
Citrus Tristeza Virus induces different symptoms, which are related with virus genotype or
mixed infections and type of host specie and variety. This study evaluated the severity of
stem pittin in Tahitian lime grafted on six different patterns. In preliminary work identified
CTV strains that infected field material evaluated. Isolates classified as genotype VT were
the most frequent and they generate stem pitting alone or in mixed infections with isolates
with genotypes T30 and T36. The relationship between the severity of stem pitting with
the geographical locality, the different rootstocks and CTV genotype were analyzed by
multiple correspondence analysis, contingency tables and chi square test of
52 Patrones para lima tahiti Citrus latifolia (Tanaka) frente a la severidad de
stem pitting ocasionado por Citrus Tristeza Virus

independence. The severity of stem pitting depends on the location and rootstocks, but
not the mixture of viral strains. The rootstock Kryder show promise against CTV for La
Libertad and Nataima

3.1 Introduccin
La enfermedad tristeza de los ctricos es causada por Citrus Tristeza Virus (CTV), es un
agente viral limitante para la produccin de ctricos a nivel mundial. Las estrategias de
manejo dependen de las condiciones especficas de cada regin, dado por las cepas
predominantes y la incidencia de CTV. En este sentido las medidas de manejo generales
son: i). Programas de certificacin de yemas libres de virus y cuarentena para evitar la
dispersin de cepas ii) Erradicacin de plantas infectadas cuando las incidencias son
bajas. iii) Uso de patrones tolerantes a cepas de CTV. iv) Esquemas de proteccin
cruzada con aislamientos suaves frente asilamientos severos. (Gottwald et al., 2002;
Moreno et al., 2008; Navarroet al., 2002). Las estrategias de manejo de infecciones por
CTV en la citricultura colombiana son limitadas. La incidencia de CTV en Colombia es
muy alta y no est concentrada en una zona especfica de manera tal que la erradicacin
de plantas no es una opcin. Las cepas severas de CTV son predominantes en el pas
(Pearanda et al., 1996; Oliveros et al., 2001; Delgado et at., 2004; Martnez y Guzmn
2007) y no hay legislacin restrictiva para el flujo de material entre zonas. Las
plataformas de proteccin cruzada exitosas en otros pases no son homologables a la
citricultura del pas. En este orden de ideas las estrategias de manejo que estn al
alcance son la produccin yemas libres de virus y uso de patrones tolerantes a CTV con
buena adaptacin al trpico bajo para el caso especfico de lima Tahit.

La lima Tahit (Citrus latifoliaL.) puede ser originaria del archipilago Malayo, no tiene
semillas y tiene buena adaptacin a regiones tropicales (Castle y Gmitter, 1999), sin
embargo exhibe alta susceptibilidad a la enfermedad tristeza de los ctricos (Campbell,
1979). Al igual que otros ctricos su entrada en produccin es tarda cuando esta
injertada sobre patrones como mandarina cleopatra (Orduz et al., 2006). La produccin
promedio en parcelas experimentales se estima en 15 ton/ha. Sin embargo, a parir del
quinto ao hay disminucin en los rendimientos a causa de problemas fitosanitarios como
CTV (Orduz-Rodriguez et al., 2007; Quiroga et al., 2010).
Capitulo 3 53

Los ctricos se propagan mediante el uso de injertos para conservar las caractersticas de
las plantas madre. El xito de esta forma de propagacin depende de la seleccin del
patrn y del injerto (Agrios, 2005). El uso de patrn confiere varias ventajas como
precocidad en la produccin, mayor vigor y uniformidad de la plantacin, cierto control
sobre la calidad y cantidad de la cosecha para una misma variedad, adaptacin a
problemas fsico-qumicos del suelo y tolerancia o resistencia a plagas y enfermedades
(Orduz y Baquero, 2003). En el presente trabajo se emplearon patrones promisorios
para la citricultura en general, como son Volkameriano, Kryder, Sunky x English,
Cleopatra, Carrizo y Citrumelo (Orduz, 2003; Orduz et al., 2006). Los antecedentes de
comportamiento frente a CTV se describen a continuacin. El patrn Kryder (Poncirius
trifoliata L Raf) ha mostrado tolerancia a la mayora de aislamientos de CTV y Fortunella
crasiflora Swing tolerancia a aislamientos especficos de CTV (Mestre et al., 1997; Rai,
2006). En los protoplastos de materiales de Fortunella hay replicacin del virus, lo que
indica que el movimiento de CTV es lo que se restringe (Albiach-Mart et al., 2004) y se
presenta es tolerancia (Moreira et al., 1949; Yoshida, 1993; Mestreet al., 1997). El patrn
Swingle Citrumelo (Citrus paradisi Macf. x Poncirus trifoliata (L.) Raf) inicialmente fue
reportado como tolerante a CTV (Hutchison., 1974), sin embargo se detect
susceptibilidad de este material frente a los aislamientos severos B3 y B28, y
adicionalmente tiene alta afinidad productiva con lima Tahit (Campbell 1991). El patrn
Carrizo Citrange (Citrus sinensis Osb. x Poncirus trifoliata (L.)) ha reportado niveles de
tolerancia heredados de Poncirus trifoliata (Garnesey et al., 1996) y ha presentado buen
comportamiento frente a CTV injertado con naranja valencia (Mendtet al., 1988). Sunki x
english (Citrus sunkiHort. ex Tan. x Poncirus trifoliata (L.)) podra tener buenos niveles de
tolerancia heredados de Poncirus trifoliata (L.). El limn Volkameriano (Citrus
Volkameriana Ten. y Pasq.) tambin ha presentado buen comportamiento frente a CTV
cuando se injerta con naranja valencia, no obstante hay que tener en cuenta que naranja
valencia es menos susceptible a CTV y es posible que su comportamiento no sea
homologo en lima Tahit. Mandarina Cleopatra (Citrus reshni Horth. Ex Tan)) es
reconocido por niveles de tolerancia a CTV, sin embargo, no presenta alta afinidad con
lima Tahit y la longevidad productiva de las plantas se limita hasta el ao ocho (Stenzel y
Neves 2004; Figueiredo et al. 2007, Quiroga et al., 2010). Cleopatra es uno de los
patrones utilizados con ms frecuencia en Colombia, es un material de precocidad media
en produccin, porte alto que dificulta la cosecha y baja longevidad en campo atribuida a
CTV (Orduz-Rodriguez y Avella 2008).
54 Patrones para lima tahiti Citrus latifolia (Tanaka) frente a la severidad de
stem pitting ocasionado por Citrus Tristeza Virus

Las cepas severas VT son predominantes en campo, generan el sintoma stem pitting
que hacen referencia a acanaladuras en el tallo. Estas se dan por la interrupcin de la
actividad meristematica en reas limitadas del cambium, lo que resulta en un crecimiento
radial irregular (Moreno et al., 2008). Los sntomas que generan estas cepas no colapsan
el rbol, pero afecta su crecimiento y desarrollo, produccin y calidad de los frutos, y las
prdidas ocasionadas por este tipo de cepas alcanzan hasta el 48% en huertos
comerciales de ctricos en Sur Africa (Marais et al., 1996). Las limas cidas son
altamente sensibles a las acanaladuras de tallo. Es posible identificar acanaladuras en el
tallo principal en plantas maduras y en las ramas del tercio medio (McClean y Van Der
Plank, 1955). Las cepas T30 se consideran suaves y en algunos casos se presentan
como asintomticos. Las cepas del genotipo T36 son severas quick decline, que indica
decaimiento rpido sobre todos los ctricos injertados sobre naranjo agrio, es decir un
colapso de la planta. El objetivo de este trabajo fue evaluar la severidad de stem pitting
producida por cepas de CTV infectadas naturalmente en campo sobre seis patrones para
lima Tahit.

3.2 Materiales y mtodos.


Para el desarrollo de este trabajo se establecieron dos parcelas experimentales en
campo. La primera en el centro de investigacin Corpoica Nataima, en el Espinal Tolima
ubicado en las coordenadas 4 12 56 N y 72 56 3 O, a 430 msnm, con una
temperatura media de 28 C y una humedad relativa del 70%. La segunda en el centro
de investigacin Corpoica La Libertad a 2 Km de Villavicencio, ubicado en las
coordenadas 9 6' N, 73 34' O, a 320 msnm, con una temperatura media de 27 C y
humedad relativa entre el 70 y el 90%. La fase de laboratorio del presente estudio se
desarroll en el laboratorio de Biotecnologa vegetal, de la facultad de agronoma, de la
Universidad Nacional de Colombia.

Material vegetal y colecta de muestras


Capitulo 3 55

Volkameriana (Citrus Citrumelo Swingle (Citrus


Volkameriana Ten. y Pasq.) paradisi Macf. x Poncirus
trifoliata (L.) Raf.)

Mandarina cleopatra (Citrus Lima Tahiti Sunki x english (Citrus sunki


reticulata Blanco). (Citrus latifolia Hort. ex Tan. x Poncirus
Tanaka) trifoliata (L.))

Kryder (Poncirus trifoliata Carrizo (Citrus sinensis Osb.


(L.) Raf.) x Poncirus trifoliata (L.)

Injerto Portan injerto


.

Figura 3-1: Patrones micro injertados con lima Tahit y establecidos en campo

El material vegetal se obtuvo del banco de germoplasma de ctricos ubicado en el centro


de investigacin Corpoica Palmira. Seis patrones ctricos (Volkameriano, Kryder, Sunky x
English, Cleopatra, Carrizo y Citrumelo) fueron micro-injertados con lima Tahit y llevadas
a vivero. En campo se establecieron seis plantas por patrn. Las seis plantas se ubicaron
en el mismo surco. Cada grupo de seis plantas se estableci de forma aleatoria y se
ubicaron cuatro repeticiones

La sintomatologa de tristeza se evalu a travs de la intensidad de stem pitting


presente en las ramas del tercio medio de los ctricos. Se tomaron ramas con corteza
verde de 20 cm de largo en cada uno de los ejes cardinales del dosel de cada planta. Las
ramas fueron auto clavadas para facilitar el removimiento de la corteza. Se asigno el
valor de intensidad de acanaladuras de la siguiente manera: 1 = ausencia de
acanaladuras, 2 =escaso o menor nmero de acanaladuras, 3 = moderado numero de
acanaladuras, 4 = muchas acanaladuras superficiales y pocas profundas, 5 = muchas
acanaladuras superficiales y profundas. La escala categrica se utiliz de acuerdo a lo
establecido por Meissner-Filho et al., (2002). La representacin grafica de cada una de
las categoras se presenta en la figura 3-2.
.
56 Patrones para lima tahiti Citrus latifolia (Tanaka) frente a la severidad de
stem pitting ocasionado por Citrus Tristeza Virus

Figura 3-2: Escala diagramtica para la evaluar la intensidad de acanaladuras de tallo. Tomada de Meissner-Filho et al.
(2002).

Asilamientos de CTV

En trabajos preliminares se identificaron cepas de CTV por RT-PCR mediante primers


genotipo especfico. La disposicin de los patrones en campo y la distribucin de las de
CTV que infectaron se muestran en la figura 3-3. La deteccin se realiz sobre grupos de
plantas injertadas sobre el mismo patrn. En los grupos de plantas en que se detectaron
infecciones mixtas se evaluaron planta a planta, lo que indico plantas con infecciones
mixtas de cepas VT/T30, VT/T30/T36 y plantas infectadas solo cepas VT. Los resultados
de la secuenciacin indicaron 99% de identidad de las cepas VT, T30 y T36 con las
secuencias del GeneBank reportadas para cada uno de estos genotipos de CTV.
Capitulo 3 57

Figura 3-3: Distribucin de las cepas de CTV que infectaron de manera natural en campo
58 Patrones para lima tahiti Citrus latifolia (Tanaka) frente a la severidad de
stem pitting ocasionado por Citrus Tristeza Virus

Anlisis de datos

Se utiliz el programa SAS versin 9.0 para realizar tablas de contingencia y anlisis de
correspondencias mltiples. La poblacin evaluada se clasifico por localidad, patrn y
severidad de stem pitting. Se analiz si la respuesta de la severidad de stem pitting
depende estadsticamente del patrn, la localidad y la cepa de CTV. Se realiz el test de
independencia chi cuadrado (X2) con un nivel de significancia de 0,05. Se plante como
hiptesis nula que hay independencia entre la variables de estudio y como hiptesis
alterna que no hay independencia entre las variables.

3.3 Resultados

En la evaluacin general del material plantado en campo no se identificaron


acanaladuras de tallo sobre el tallo principal, esto debido posiblemente a la edad del
material. Sin embargo se identificaron acanaladuras en las ramas del tercio medio del
dosel de las plantas. Las plantas de los dos huertos evaluados mediante la escala de
Meissner-Filho mostraron que la severidad oscilo entre el rangos 2 y 4. Por lo tanto, la
severidad del material evaluado se estim como escaso nmero de acanaladuras -2,
moderado numero- 3, muchas acanaladuras superficiales y poco profundas- 4. No se
identificaron plantas sin acanaladuras en las ramas y tampoco se identificaron ramas con
el grado 5 de severidad segn la escala de referencia.

Localidad Patrn Moderada Pocas V_Sup_P_Prof Total


general
La Libertad Carrizo 12 11 1 24
Citrumelo 10 13 1 24
Clepatra 8 16 24
Kryder 7 16 1 24
SxE 14 5 5 24
Volkameriano 14 8 2 24
Total La Libertad 65 69 10 144
Nataima Carrizo 10 13 1 24
Citrumelo 5 19 24
Clepatra 3 21 24
Kryder 2 22 24
SxE 3 20 1 24
Volkameriano 6 17 1 24
Capitulo 3 59

Total Nataima 29 112 3 144


Total general 94 181 13 288

Tabla 3-1 Tabla de frecuencia de la severidad en stem pittin en diferentes patrones y dos
localidades diferentes. Pocas= (2) escaso nmero de acanaladuras, Intermedio= (3) moderado numero de
acanaladuras, V_Sup_P_Prof = (4) muchas acanaladuras superficiales y pocas profunda

En la Tabla 3-1 se presentan los valores de severidad stem pitting de las plantas en los
dos huertos evaluados. La relacin entre estas variables se describi y analiz mediante
anlisis de correspondencias mltiples. La frecuencia de plantas con severidad grado 2
fue de 78% en Nataima frente a 48% de la Libertad. La frecuencia de severidad grado 3
fue de 45% en La Libertad frente a 20% de Nataima. La frecuencia de severidad grado 4
fue de 7% en La Libertad frente a 2% de Nataima. Respecto a la variedad de patrn, se
observ que el 21% de las plantas injertadas sobre el patrn Sunky x English de La
Libertad presentaron severidad grado 4 frente al 58% que presentaron grado 3 de
severidad. Las plantas injertadas sobre el patrn carrizo presentaron frecuencias
similares de plantas con severidad en grados 2 y 3 en las dos localidades. Los patrones
cleopatra y kryder presentaron las altas frecuencias de severidad grado 2, as: cleopatra
tuvo frecuencia de 88% en Nataima y 67% en La Libertad. Kryder tuvo frecuencia de 92%
en Nataima y 67% en La Libertad.

En la figura 3-3 se muestra la validacin de los datos de la tabla de frecuencias mediante


un grafico de correspondencias mltiples: De acuerdo al aporte de inercia, la dimensin 1
est conformada por las variables localidad y patrn, y la dimensin 2 est conformada
por la variable severidad. La severidad de stem pittin sobre carrizo y volkameriana fue
similar en la Libertad, en el grafico se ubican equidistantes de los puntos de severidad
intermedio y menor. Los patrones cleopatra y kryder muestran cercana con la variable
menor severidad. El patrn Volkameriano est ms relacionado con grado moderado de
severidad en La Libertad y grado menor. En la Tabla 3-1 se presentan los valores de
severidad stem pitting de las plantas en los dos huertos evaluados. de severidad en
Nataima.

La severidad de stem pittin se comporta de manera dependiente del patrn (test de


independencia chi cuadrado pvalor= 0.0195<0.05) y se comporta de manera dependiente
60 Patrones para lima tahiti Citrus latifolia (Tanaka) frente a la severidad de
stem pitting ocasionado por Citrus Tristeza Virus

de su localizacin geogrfica (test de independencia chi cuadrado pvalor=0.049 < 0.05).


A partir de estos resultados se evalu la independencia de la severidad con las cepas
que infectaron en campo. Esta se realiz sobre las detecciones realizadas planta a
planta.

Figura 3-4: Severidad de stem pitting (dimensin 2) vs patrn y localidad (dimensin 1). Menor = (2) escaso
nmero de acanaladuras, Intermedio= (3) moderado numero de acanaladuras, V_Sup_P_Prof = (4) muchas
acanaladuras superficiales y pocas profundas.

Figura 3-5: Severidad de stem pitting vs asilamientos de CTV. Pocas= (2) escaso nmero de acanaladuras,
Intermedio= (3) moderado numero de acanaladuras, V_Sup_P_Prof = (4) muchas acanaladuras
superficiales y pocas profundas
Capitulo 3 61

La expresin de severidad de stem pitiing se comport de manera independiente del la


mezcla de cepas que infectaron(test de independencia chi cuadrado pvalor= 0.3672>
0.05), de manera tal se muestra en grafico 3-4 que las plantas infectadas con cepas VT,
VT/T30 y VT/T36 expresan grados de severidad similares. Una sola planta present
infeccin mixta de cepas VT/T30/T36, sin embargo, su expresin de severidad se ubico
dentro de los mismos rangos que plantas infectadas con otras cepas.

3.4 Discusin
La eliminacin de la corteza a nivel de ramas jvenes, permite evaluar estras o
acanaladuras longitudinales a nivel del tejido vascular acorde a sintomatologa descrita
como sndrome de acanaladura de tallos stem pitting (Meissner-Filho et al.,2002; Magri
et al., 2011). Se encontr que la severidad de CTV es variable segn el patrn y la
localizacin, pero no segn el complejo de cepas virales. La cepa viral predominante en
campo fue VT para las dos localidades. Las plantas en que se identificaron infecciones
con la cepa VT o infecciones mixtas VT/T30, VT/T36 VT/T30/T36 no tuvieron un efecto
sobre la severidad de CTV de acuerdo a la escala de referencia. En el estado fenolgico
en el que se evalan estas plantas, no es posible hacer inferencias para explicar
modulacin de expresin de sntomas mediante procesos de proteccin cruzada.
Tampoco es posible establecer cul de los genotipos virales presentes en una infeccin
mixta, es predominante en las plantas a fin de explicar el comportamiento de severidad
obtenido. El uso de otras escalas como Ndongo Horsfall y Barrat no es aplicable a la
edad de las plantas, ni al estado sanitario, pues con cualquiera de estas es muy posible
confundir otros sntomas generados por CTV con los sntomas causados por otros
disturbios como clorosis en las nervaduras. La escala de Ndongo sera aplicable en
estados ms avanzados de la enfermedad en la planta y fenolgicamente ms
desarrollada. Acorde con lo anterior la escala propuesta por Meissner-Filho et al (2002)
permiti tener una alta resolucin para medir la severidad de la tristeza de los ctricos en
lima Tahit .

El test de chi cuadrado indic que la severidad de stem ptiting se comporta de manera
dependiente del patrn y de la localidad. La dependencia de la localidad se puede
explicar a partir de la diferencia de las condiciones ambientales, aunque no hay un
estadstico certero de la relacin entre las variables ambiente vs severidad. La
62 Patrones para lima tahiti Citrus latifolia (Tanaka) frente a la severidad de
stem pitting ocasionado por Citrus Tristeza Virus

comparacin de los valores de severidad entre las dos localidades, muestra que grupos
de plantas con un mismo patrn infectadas con cepas virales del mismo genotipo
presentan un contraste en la severidad, como lo es el caso del patrn Sunky x English
cuya severidad tiende al mayor grado en La Libertad, situacin que ocurre de manera
general con otros patrones. No obstante no conocemos como ha sido la actividad del
vector en campo y como afectan los eventos de re-inoculacin (Cambra et al., 2002)
sobre la respuesta sintomtica de la planta.

La dependencia del patrn se podra explicar por la tolerancia especfica de la especie de


cada patrn. Se observa que hay consistencia entre las proporciones de las frecuencias
de severidad para algunos patrones entre localidades. La severidad del patrn carrizo fue
muy similar en las dos localidades, se esperaban grados de severidad bajos teniendo en
cuenta que este patrn procede de Poncirus trifoliata (Garnesey et al., 1996), sin
embargo los valores de severidad fueron muy proporcionales entre los grados 2 y 3 para
las dos localidades. El patrn citrumelo que tambin tiene herencia de P. trifoliata
present valores de severidad similares a carrizo en La Libertad y una severidad grado 2
en Nataima. El patrn kryder presenta un alto grado de consistencia con las referencias
de tolerancia (Mestre et al., 1997; Rai, 2006), la severidad grado 2 fue las ms frecuente
entre las plantas de las dos localidades. El nmero de plantas con severidad grado 2 de
los patrones citrumelo, cleopatra, y carrizo fue mayor que el nmero de rboles con
grado 3 de severidad, de manera consistente en las dos localidades. Sin embargo la
frecuencia de severidad grado 2 siempre fue mayor en Nataima, se puede decir que la
severidad de estos patrones es intermedia entre kryder y sunky x english. El patrn limn
volkamieriano se comporto de manera inversa en las dos localidades, en la Libertad se
present un mayor nmero de plantas con severidad grado 3 respecto a las grado 2 y en
Nataima se present una distribucin inversa. El patrn mandarina cleopatra ha sido
caracterizado por exhibir baja afinidad con lima Tahit (Stenzel y Neves 2004;
Figueiredoet al. 2007, Quiroga et al., 2010) y en algunos casos se limita longevidad
atribuida a problemas fitosanitarios como CTV (Orduz-Rodriguez y Avella 2008). Hasta el
momento cleopatra se ubica en un punto intermedio de severidad de CTV y no se hacen
evidentes incompatibilidades.
Capitulo 3 63

En La Libertad se identificaron plantas infectadas con cepas T36 en infeccin mixta con
cepas VT y T30. Sin embargo, no se observ variacin en la expresin de sntomas
asociados a stem pitting. Durante el perodo de realizacin de este estudio, estos
rboles no han desarrollado sntomas de declinacin rpida - quick deckine -. Varios
factores podran estar modulando esta respuesta como son el titulo viral, el estado
fenolgico de las plantas y variables climticas, lo que quiere decir que en un futuro
podran generar la sintomatologa asociada a plantas infectadas con este tipo de cepas y
colapsar.

Al momento podemos inferir que hay patrones prometedores en trminos de baja


severidad frente a CTV, sin embargo el estado fenolgico del material plantado no
permite determinar un mejor patrn. Es necesario que este material de campo contine
con los procesos infeccin de cepas de CTV y se haga un seguimiento en el tiempo tanto
de la dinmica de infeccin como de la respuesta de severidad.

3.5 Bibliografia
Agrios, G.N. 2005. Plant Patology. Fifth Edition .Elsevier American Press. Department of
Plant Pathology.University of Florida. U.S.A. p.922.

Albiach-Mart, M.R., Grosser, J.W., Gowda, S., Mawassi, M., Satyanarayana, T.,
Garnsey, S.M. and Dawson, W.O. 2004 Citrus Tristeza Virus replicates and forms
infectious virions in protoplast of resistant citrus relatives. Mol. Breeding, 14, 117128.

Cambra, M.C., Martnez, M., Marroqun, C., Gorris, M.T., Zaragoza, I.S., Lpez, A.,
Olmos, A., y Hermoso de Mendoza, A. 2002. Epidemiology of Citrus Tristeza Virus
(CTV) in Citrus Varieties Cultivated Under Plastic Net Covers.Fifteenth IOCV Conference,
2002Short Communications.

Campbell, C.W., 1979.Tahit lime production in Florida University of Florida. Florida


Cooperative. Service, EVA.

Campbell, C.W. 1991. Production of the lime (Citrus latifolia, Tanaka). In florida.
University of Florida. Tropical Region 2:184-192.

Castle, W.S. y Gmitter, F.G. 1999.Rootstock and scion selection. En: Citrus health
management. Timmer, L.W. y Duncan, L.W. (eds.). University of Florida, APS Press, pp.
21-35.
64 Patrones para lima tahiti Citrus latifolia (Tanaka) frente a la severidad de
stem pitting ocasionado por Citrus Tristeza Virus

Delgado, J , Guzmn, M , Caicedo, A , Ordz, J 2004 CTV screening of Colombian


germplasm banks kept in Palmira (Valle del Cauca) and Villavicencio (Meta) and
preliminary estimation of CTV variants by RFLP and SSCP 44 Meeting of the American
Phytopathological Society Caribbean Division La Habana, mayo 24-28 Memorias

Garnsey, S.M., Su, H.J. and Tsai, M.C. (1996) Differential susceptibility of pummelo and
Swingle citrumelo to isolates of Citrus Tristeza Virus. In: Proceedings of the 13th
Conference of the International Organization of Citrus Virologists (da Graa, J.V., Moreno,
P. and Yokomi., R.K., eds), pp. 138146. Riverside, CA: IOCV.

Gottwald, T.R., Polek, M. and Riley, K. (2002) History, present incidence, and spatial
distribution of Citrus Tristeza Virus in the California Central Valley.In Proceedings of the
15th Conference of the International Organization of Citrus Virologists (Duran-Vila, N.,
Milne, R.G. and da Graa, J.V., eds), pp. 8394. Riverside, CA: IOCV.

Hutchison, D. J. 1974. Swingle citrumelo-A promising rootstock hybrid. Proc. Fla. State
Hort. Soc. 87:89-91.

Figueiredo, .J.O., Stuchi, E.S., Laranjeira, F.F., Donadio, l.C., Sobrinho, J., Sempionato,
O.R. y Muller, G.W. 2001. Porta-enxertos para lima cida Tahit em duas regies do
Estado de So Paulo. Laranja, v.22, n.1, p.203- 213.

Martnez, S., y Guzmn, M 2007 Serological analysis of Colombian Citrus Tristeza Virus
isolates Phytopathology 97: S175

McClean, A.P.D., y Van Der Plank, J.E. 1955. The role of seedling yellows and stem
pitting in tristeza of citrus.Phytopathology 45:222-224.

Magri, W., Corazza, M ., Zanutto, C., Carvalho-Nunes, W., Mller, G. 2011. SSCP
analysis of Citrus Tristeza Virus protectives isolates in Pra sweet orange clones under
northern Paran state, Brazil conditions. Citrus Research & Technology, Cordeirpolis,
v.32, n.1, p.9-16, 2011

Marais, L. J., Marais, M. L., y Rea, M. 1996. Effect of Citrus Tristeza Stem Pitting on Fruit
Size and Yield of Marsh Grapefruit in Southern Africa. Thirteenth IOCV Conference,
1996- Citrus Tristeza Virus

Meissner-Filho, P.E., Soares-Filho, W., Dos. S., Velame, K.V.C., Diamantino, E.P., y
Diamantino, M.S.A.S. 2002. Reao de porta-enxertos hbridos ao Citrus Tristeza Virus.
Fitopatologia Brasileira 27:312-315. 2002.

Moreira, S, Costa, A.S and Grant, T.J. 1949. Conhecimentos atuais sobre a tristeza dos
citrus. Revista de Agricultura 24:335- 345.

Moreno, P., Ambros, S., Albiach-Marti, M.R., Guerri, J., Pena, L., 2008. Citrus
tristezavirus: a pathogen that changed the course of the citrus industry. Mol. Plant
Pathol.9, 251268.
Capitulo 3 65

Mestre, P.F., Asins, M.I., Carbonell, E.A and Navarro, L. (1997) New gene(s) involved in
the resistance of Poncirus trifoliata (L.) Raf. to Citrus Tristeza Virus. Theor Appl Genet
95:691-695.

Navarro, L., Pina, J.A., Jurez, J., Ballester-Olmos, J.F., Arregui, J.M., Ortega, C.,
Navarro, A., Duran-Vila, N., Guerri, J., Moreno, P., Cambra, M., Medina, A. and
Zaragoza, S. (2002) The Citrus Variety Improvement program in Spain in the period
19752001. In: Proceedings of the 15th Conference of the International Organization of
Citrus Virologists (Duran-Vila, N., Milne, R.G. and da Graa, J.V., eds), pp. 306316.
Riverside, CA: IOCV.

Ndongo, B, Ambang Z, Belibi Messanga L, Ngodo Melingui J, B, Ongono Y. Vigour and


Behaviour of fifteen citrus varieties against tristeza in the forest zone of Cameroon.
Department of Plant Biology Faculty of Sciences, University of Yaound I. Afr. J.
Biotechnology.2007;6(12):1403-1409

Oliveros, O., Torres, J., Morales, G., Guzmn, M., Acosta, O., Pearanda, J. 2001 Two
common haplotypes of 106 Rev. Colomb. Biotecnol. Vol. XI No. 1 Julio 2009 94-106.
The CPm gene(p27) in Colombian field isolates of the Citrus Tristeza Virus In:
proccedings of the 15th Conference of the International Organization of Citrus irologists
Riverside: IOCV University of California, Abstracts

Orduz, J.O, Baquero, J.E. 2003. Aspectos bsicos para el cultivo de los ctricos en el
piedemonte llanero. Revista Achagua 2003; 7(9):7-19

Orduz, J.O. 2003. Evaluacin de patrones en ctricos en suelos cidos en condiciones de


vivero en el Trpico bajo de Colombia. Revista Achagua. 2003; 7(9) 24-27.

Orduz, J.O., Arango, l., Monroy, H., Fischer, G. 2006 Comportamiento de la mandarina.
Arrayana en seis patrones en suelos cidos del piedemonte Llanero de Colombia. Agr.
Col. 2006;24(2):266-273.

Orduz-Rodrguez, J. O., Chacn-Daz, A., Linares-Briceo, V.M. 2007. Evaluacin del


potencial de rendimiento de tres especies y un hbrido de ctricos en la regin del Ariari
del departamento del Meta (Colombia) durante doce aos, 1991- 2003. Revista
ORINOQUIA - Universidad de los Llanos - Villavicencio, Meta. Colombia. Volumen 11 -
N 2.

Orduz-Rodriguez, J., Avella, F. 2008.Comportamiento de 26 cultivares de naranja en


condiciones del piedemonte del Meta, Colombia. Revista Colombiana De Ciencias
Hortcolas - Vol. 2 - No.2 - pp. 157-172.

Pearanda, J., Acosta, O., Guzman-Barney, M., Pappu, H., Pappu, S., Manjunath, L.,
Febre, J., Niblett, L. 1996. Incidence and characterization of mild and severe isolates of
Citrus Tristeza Virus from Colombia. Thirteenth IOCV Conference.
66 Patrones para lima tahiti Citrus latifolia (Tanaka) frente a la severidad de
stem pitting ocasionado por Citrus Tristeza Virus

Quiroga-Cardona, J., Hernndez- Parrado, F.L., Silva- Herrera, M., Orduz-Rodrguez,


J.O. 2010. Comportamiento de la produccin de lima Tahit (Citrus latifolia Tanaka),
injertada sobre el patrn de Mandarina Cleopatra (Citrus reticulata Blanco) y la influencia
delvirus de la tristeza (CTV) en condiciones del piedemonte del Meta, 1997-2008.
Orinoquia, vol. 14, nm. 1, junio, 2010, pp. 5-15

Rai, M. (2006) Refinement of the Citrus Tristeza Virus resistance gene (CTV positional
map in Poncirus trifoliata and eneration of transgenic grapefruit(Citrus paradisi ) plant
lines with candidate resistance genes in this region. Plant Mol. Biol. 61, 399414.

Stenzel, Neusa. M.C., y Neves. C. (2004) Rootstocks for 'Tahit ' lime. Sci. agric.
(Piracicaba, Braz.) [online]. 2004, vol.61, n.2, pp. 151-155. ISSN 0103-
9016. http://dx.doi.org/10.1590/S0103-90162004000200005

Yoshida, T. (1993) Inheritance of immunity to Citrus Tristeza Virus of trifoliate orange in


some citrus intergeneric hybrids.Bull Fruit Tree Res Station 25:33-43
Conclusiones

En campo se identificaron cepas correspondientes a los genotipos VT, T30 y T36. La


cepa VT fue la de mayor incidencia en las dos localidades. La cepa T30 se encontr en
las dos localidades, pero con menor incidencia en La Libertad. La cepa T36 se encontr
nicamente en la Libertad. Se identificaron plantas con infecciones mixtas VT/T30 y
VT/T30/T36. Las secuencias de los productos de PCR corroboraron los resultados
obtenidos. Todas las secuencias presentaron 99% de identidad con las secuencias
registradas en el GeneBank, sin embargo en trabajos posteriores se sugiere corroborar la
presencia de cepas T36 en Colombia mediante otros marcadores moleculares. Se
recomienda realizar seguimiento a los sntomas de los arboles en los que se identific
cepas T36 y T30.

El estudio de la relacin entre el patrn, las cepas de CTV y la severidad de stem pitting
indic que la severidad de stem pitting depende de la localidad y el patrn, pero no de la
mezcla de cepas virales. En estudios posteriores se requiere estudiar los factores que
modulan la respuesta sintomtica de arboles de lima tahti infectados con diferentes
cepas. No obstante esta respuesta podra ser variable en funcin del tiempo y trayectoria
del los arboles en campo. Preliminarmente el patrn Kryder injertado con lima Tahit se
muestra prometedor frente a CTV para las localidades de La Libertad y Nataima, de
acuerdo a la severidad de stem pitting presentada y al movimiento viral restringido de
CTV (Albiach-Mart et al., 2004).