Anda di halaman 1dari 57

ISSN 0482-5004

Impact Factor 2012: 0.864


Thomson Reuters Journal Citation Reports,
Science Edition (2012)

REVISTA BRASILEIRA DE REUMATOLOGIA


BRAZILIAN JOURNAL OF RHEUMATOLOGY
JULY/AUGUST 2013 Volume 53 Number 4
JULHO/AGOSTO 2013 Volume 53 Nmero 4

www.reumatologia.com.br
REVISTA BRASILEIRA DE
REUMATOLOGIA
www.reumatologia.com.br

Volume 53. Number 4. July/August 2013


Volume 53. Nmero 4. Julho/Agosto 2013

CONTENTS | SUMRIO
Editorial | Editorial

The Impact Factor


O Fator de Impacto
Max Victor Carioca Freitas, Roberto Ezequiel Heymann ............................................................................ 321

Original Articles | Artigos Originais

Association between the ultrasonographic and clinical findings in the hips of patients with
juvenile idiopathic arthritis
Associao entre achados ultrassonogrficos e clnicos do quadril de pacientes com artrite idioptica juvenil
Vanessa Bugni Miotto e Silva, Giampaolo Faquin, Aline Niccio, Rodrigo Regacini, Henrique Lederman,
Maria Odete Esteves Hilrio, Maria Teresa de Sande e Lemos Ramos Ascenso Terreri .............................. 322

Psychiatric symptoms in patients with systemic lupus erythematosus: frequency and


association with disease activity using the Adult Psychiatric Morbidity Questionnaire
Sintomas psiquitricos em pacientes com lpus eritematoso sistmico: frequncia e associao com atividade
da doena com o uso do Questionrio de Morbidade Psiquitrica em Adultos
Snia Maria da Rosa Beltro, Luciana Beltro Gigante, Dbora Beltro Zimmer,
Paulo Roberto Zimmermann, Deonilson Schmoeller, Fbio Batistella, Henrique Luiz Staub ......................... 328

Assessment of enthesopathy in patients with fibromyalgia by using new sonographic


enthesitis index
Avaliao de entesopatia em pacientes com fibromialgia por meio do novo ndice ultrassonogrfico de entesite
Fuat Ozkan, Betul Bakan, Mehmet Fatih Inci, Fatih Kocturk, Gozde Yildirim Cetin, Murvet Yuksel,
Mehmet Sayarlioglu ................................................................................................................................... 335

Association between the rs7700944 polymorphism in the TIM-4 gene and rheumatoid
arthritis in Zahedan, southeast Iran
Associao entre o polimorfismo rs7700944 no gene TIM-4 e artrite reumatoide em Zahedan, sudeste do Ir
Zahra Zakeri, Mohammad Hashemi, Seyed Mohammad Ebrahim Pourhosseini,
Ebrahim Eskandari-Nasab, Gholamreza Bahari, Mohsen Taheri .............................................................. 341

Profile of paediatric rheumatology specialists and services in the state of So Paulo


Perfil de especialistas e de servios em reumatologia peditrica no estado de So Paulo
Maria Teresa Terreria, Lcia M. A. Campos, Eunice M. Okuda, Clovis A. Silva, Silvana B. Sacchetti,
Roberto Marini, Virginia P. Ferriani, Maria Heloiza Ventura, Taciana Fernandes, Juliana O. Sato,
Elizabeth C. Fernandes, Claudio Len, Cssia Barbosa, Ana Paola Lotito, Maria Carolina dos Santos,
Ndia E. Aikawa, Mrcia Fac, Daniela Piotto, Vanessa Bugni, Ktia T. Kozu, Paulo R. Romanelli,
Adriana M. E. Sallum, Marlia Febronio, Melissa Fraga, Cludia S. Magalhes ....................................... 346

RBR 53(4) - Arquivo livro (Impressa).indb 11 21/10/2013 18:21:12


Anti-synthetase syndrome: anti-PL-7, anti-PL-12 and anti-EJ
Sndrome antissintetase: anti-PL-7, anti-PL-12 e anti-EJ
Fernando Henrique Carlos de Souza, Marcela Gran Pina Cruellas, Mauricio Levy-Neto,
Samuel Katsuyuki Shinjo ........................................................................................................................... 352

Review Articles | Artigos de Reviso

Systematic review of infliximab-induced autoantibodies and systemic lupus erythematosus


Reviso sistemtica da induo de autoanticorpos e lpus eritematoso pelo infliximabe
Joo Luiz Pereira Vaz, Carlos Augusto Ferreira Andrade, Alessandra Cardoso Pereira,
Maria de Ftima M. Martins, Roger Abramino Levy ................................................................................. 358

Case Reports | Relatos de Caso

Testicular vasculitis a rare manifestation of rheumatoid arthritis


Vasculite testicular uma rara manifestao da artrite reumatoide
Alexandre Wagner S. de Souza, Daniela Pereira Rosa, Ana Letcia Pirozzi Buosi,
Ana Ceclia Diniz Oliveira, Jamil Natour ......................................................................................................... 365

Camptocormia secondary to polymyositis


Camptocormia secundria polimiosite
Melina Andrade Mattar, Joara Martins da Silva Gordo, Ari Stiel Radu Halpern,
Samuel Katsuyuki Shinjo .......................................................................................................................... 368

Brief communication | Comunicao breve

Lipid profile in adult patients with idiopathic juvenile arthritis


Perfil lipdico em pacientes adultos com artrite idioptica juvenil
Thelma Larocca Skare, Marilia Barreto Silva, Paulo Negreiros ....................................................................... 371

RBR 53(4) - Arquivo livro (Impressa).indb 12 21/10/2013 18:21:12


R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 2 1

REVISTA BRASILEIRA DE
REUMATOLOGIA
www.reumatologia.com.br

Editorial

O Fator de Impacto

Desde sua criao, a Revista Brasileira de Reumatologia (RBR) ul- dador do Institute for Scientific Information (ISI), com o
trapassou vrios desafios graas tenacidade, ao esforo e ao objetivo de refletir o nmero mdio de citaes de artigos
sacrifcio de editores, revisores e autores, que contriburam cientficos publicados em determinados peridicos indexa-
para que chegasse ao elevado padro cientfico atual e conse- dos ao ISI. Desde 1972 os FIs tm sido calculados anual-
quente prestgio nacional e internacional. mente, e os resultados so publicados no JCR. O FI uma
O primeiro grande reconhecimento nacional ocorreu em ferramenta muito usada para classificar os peridicos de
junho de 2004, com sua incluso na coleo da Scientific Elec- uma mesma rea de atuao, dando-se mais importncia
tronic Library Online-Brasil (SciELO-Brasil), o que inseriu a aos peridicos com FI maior em detrimento dos que
RBR em uma base de dados eletrnica que conta com uma apresentam um FI baixo. Dessa forma, um artigo publicado
coleo selecionadssima de peridicos cientficos brasileiros. em uma revista de FI maior teoricamente ter maior re-
Ao ser indexada no MEDLINE, em 2010, a RBR foi includa percusso, prestgio e visibilidade. por esse motivo que
na base de dados da U.S. National Library of Medicine, que observamos o enorme esforo empregado pelos autores
contm mais de 19 milhes de referncias de artigos de pe- para conseguirem publicar seus resultados em revistas de
ridicos em cincias biomdicas do mundo todo, o que lhe FI elevado.
conferiu reconhecimento internacional. Este ser nosso objetivo a partir de agora: elevar o FI
Sua indexao em julho de 2012 no Web of Science, base da RBR. No ser fcil, mas j vem contando com grande
de dados da Thompson Reuters, foi importante para que a colaborao e esforo de autores nacionais e internacionais,
RBR passasse a ter o seu Fator de Impacto (FI) medido pelo editores e revisores.
Journal of Citation Reports (JCR), tambm da Thompson Reuters.
E a RBR acabou de receber seu primeiro FI, de 0,864, o que a Max Victor Carioca Freitas
ranqueou como o 12 peridico nacional cientfico de sade Roberto Ezequiel Heymann
dentre as publicaes brasileiras indexadas. Editores-chefe
Mas qual o significado disso? Qual a importncia dis- Revista Brasileira de Reumatologia
so? O FI uma medida criada por Eugene Garfield, o fun- 2013 Elsevier Editora Ltda. Todos os direitos reservados.

0482-5004/$ - see front matter. 2013 Elsevier Editora Ltda. Todos os direitos reservados.

RBR 53(4) - Arquivo livro (Impressa).indb 321 21/10/2013 18:21:22


R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 2 2 3 2 7

REVISTA BRASILEIRA DE
REUMATOLOGIA
www.reumatologia.com.br

Artigo original

Associao entre achados ultrassonogrficos e clnicos do


quadril de pacientes com artrite idioptica juvenil

Vanessa Bugni Miotto e Silvaa, Giampaolo Faquina, Aline Niccioa, Rodrigo Regacinib,
Henrique Ledermanb, Maria Odete Esteves Hilrioa,
Maria Teresa de Sande e Lemos Ramos Ascenso Terreria,*
a
Disciplina de Alergia, Imunologia Clnica e Reumatologia, Setor de Reumatologia Peditrica, Departamento de Pediatria, Escola Paulista de
Medicina, Universidade Federal de So Paulo, So Paulo, SP, Brasil
b
Departamento de Diagnstico por Imagem, Escola Paulista de Medicina, Universidade Federal de So Paulo, So Paulo, SP, Brasil

informaes resumo

Histrico do artigo: Objetivo: Descrever os achados ultrassonogrficos do quadril em pacientes com artrite idio-
Recebido em 26 de abril de 2012 ptica juvenil (AIJ) e sua associao com sinais, sintomas e atividade da doena.
Aceito em 7 de janeiro de 2013 Materiais e mtodos: Estudo retrospectivo com 92 pacientes com AIJ. Foram avaliados os sub-
tipos da doena, a idade de incio, o tempo de evoluo, a atividade da doena e as manifes-
Palavras-chave: taes clnicas do envolvimento do quadril. A avaliao ultrassonogrfica foi realizada na
Ultrassonografia rotina dos pacientes, e as imagens foram analisadas por dois ultrassonografistas cegos em
Quadril relao s condies clnicas dos pacientes.
Artrite idioptica juvenil Resultados: Do total de 92 pacientes, 69,6% eram meninas, com mdia de idade de 12,4 5,1
Sinovite subclnica anos. Trinta e trs (35,9%) apresentaram subtipo oligoarticular persistente e trinta (32,6%)
poliarticular com fator reumatoide negativo. Quarenta e quatro (47,8%) apresentaram sinal
e/ou sintoma relacionado ao quadril. Vinte e nove (31,5%) apresentaram alteraes ultras-
sonogrficas, com sinovite subclnica em 34,4%. As alteraes ultrassonogrficas se asso-
ciaram com presena de sinais e/ou sintomas do quadril (P = 0,021), especialmente limita-
o articular (P = 0,006), mas no com atividade (P = 0,948) ou subtipo de doena (P = 0,108).
Sinovite clnica se associou com comprometimento poliarticular (P = 0,002) e atividade de
doena (P = 0,017). No houve associao entre sinovite subclnica e as variveis estudadas.
Concluso: O acometimento clnico do quadril na AIJ, especialmente a limitao articular,
est associado sinovite na avaliao por US, independente do subtipo e da atividade da
doena. Os profissionais de sade devem estar atentos possibilidade de doena silenciosa
com sinovite subclnica, que pode contribuir para a deteriorao da articulao do quadril.
2013 Elsevier Editora Ltda. Todos os direitos reservados.

* Autor para correspondncia.


E-mail: teterreri@terra.com.br (M.T.S.L.R.A. Terreri).
0482-5004/$ - see front matter. 2013 Elsevier Editora Ltda. Todos os direitos reservados.

RBR 53(4) - Arquivo livro (Impressa).indb 322 21/10/2013 18:21:22


R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 2 2 3 2 7 323

Association between the ultrasonographic and clinical findings in the


hips of patients with juvenile idiopathic arthritis

abstract

Keywords: Objective: To describe the ultrasonographic (US) findings in the hips of patients with ju-
Ultrasonography venile idiopathic arthritis (JIA) and the association between these findings and the signs,
Hip symptoms, and activity of the disease.
Juvenile idiopathic arthritis Materials and methods: The present retrospective study included 92 patients with JIA. The
Subclinical synovitis disease subtypes, age at disease onset, length of disease progression, disease activity, and
clinical manifestations of the hip pathology were assessed. US examinations were routine-
ly performed, and the images were analysed by two ultrasonographers who were blinded
to the patients clinical conditions.
Results: Of the 92 patients included in the study, 69.6% were girls, and the average age was
12.4 5.1 years. Thirty-three (35.9%) participants exhibited the persistent oligoarticular
subtype, and 30 (32.6%) exhibited the rheumatoid factor (RF)-negative polyarticular sub-
type. Forty-four participants exhibited signs and/or symptoms of hip pathology. Twenty-
nine (31.5%) participants exhibited abnormal US findings, and 34.4% exhibited subclinical
synovitis. The US alterations exhibited an association with subclinical synovitis in 34.4% of
the cases. The US alterations bore a correlation with the presence of hip-related signs and/
or symptoms (P = 0.021), particularly joint limitations (P = 0.006), but were not correlated
with the disease activity (P = 0.948) or subtype (P = 0.108). Clinical synovitis was associated
with polyarticular involvement (P = 0.002) and disease activity (P = 0.017). Subclinical syno-
vitis was not correlated with the investigated variables.
Conclusion: Clinical affection of the hip in JIA, particularly joint limitation, is associated with
synovitis (revealed by US assessment) independently of the activity and subtype of the dis-
ease. Therefore, healthcare professionals should consider the possible occurrence of silent
disease and subclinical synovitis, which might contribute to hip deterioration.
2013 Elsevier Editora Ltda. All rights reserved.

A ultrassonografia (US) de quadril til para deteco de


Introduo derrame articular e sinovite e avalia as alteraes de modo
mais precoce e sensvel que a radiografia, alm de ser um
A artrite idioptica juvenil (AIJ) a doena reumtica crni- mtodo no invasivo, rpido e de baixo custo; entretanto,
ca mais frequente na infncia, caracterizada por artrite em observador e aparelho dependente.2,5,8-10 Estudo de Friedman
crianas e adolescentes de at 16 anos de idade, com dura- e Gruber mostrou que o espao articular ultrassonogrfico foi
o maior ou igual a seis semanas, sendo um diagnstico de significativamente maior em pacientes com artrite reumatoi-
excluso.1 Seu espectro clnico amplo e atualmente clas- de juvenil soronegativa quando comparados com controles
sificada segundo a International League of Association for Rheu- saudveis (0,6 x 0,43 cm, P < 0,001).2 A US tambm pode detec-
matology (ILAR) em sete subtipos, de acordo com as caracte- tar sinovite subclnica, descrita quando h derrame articular
rsticas do paciente no incio e na evoluo aps seis meses ou espessamento sinovial em paciente assintomtico e com
de doena.1 exame clnico normal.8,10,11
O envolvimento do quadril na AIJ varia de 30-50% e mais O objetivo deste estudo foi descrever os achados ultrasso-
comum em pacientes jovens, nos primeiros dez anos de do- nogrficos da articulao do quadril em pacientes com AIJ e
ena, nos subtipos poliarticular e sistmico e na doena ati- sua associao com sinais, sintomas e atividade da doena.
va persistente.2-4 A presena de artrite no quadril representa
fator de mau prognstico, uma vez que uma articulao
importante para a marcha e a sustentao do peso corporal Pacientes e mtodos
e seu comprometimento pode levar incapacidade funcio-
nal.3,5,6 Por isso, o envolvimento do quadril impe uma terapia Foi realizado um estudo retrospectivo com 92 pacientes que
mais agressiva, com a administrao de drogas modificadoras preenchiam os critrios diagnsticos do ILAR1 para AIJ com
do curso da doena e agentes biolgicos.4,7 pelo menos seis meses de evoluo, acompanhados no am-
A observao clnica de derrame articular do quadril dif- bulatrio de Reumatologia Peditrica.
cil sem o uso de exames de imagem devido sua localizao Realizou-se uma reviso de pronturios e foram conside-
em planos profundos e dificuldade de palpao.2,5 Sintomas rados os dados demogrficos e clnicos dos pacientes. Foram
como dor, dor irradiada, claudicao e limitao podem se avaliados os subtipos da AIJ, idade de incio e tempo de evo-
manifestar quando h envolvimento dessa articulao; en- luo da doena. Em relao s manifestaes clnicas do en-
tretanto, muitos pacientes so assintomticos.3,5 volvimento de quadril, foram consideradas dor, dor irradiada,

RBR 53(4) - Arquivo livro (Impressa).indb 323 21/10/2013 18:21:23


324 R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 2 2 3 2 7

limitao de movimento e claudicao. A atividade de doena


foi avaliada de acordo com os critrios de Wallace et al.12
Foram includos na avaliao ultrassonogrfica exames re-
alizados pelos pacientes no setor de radiologia da instituio,
no perodo de 2008 a 2010. A US foi realizada dentro da rotina
anual dos pacientes, independente da presena de sintomas
ou quando havia dvida no exame fsico. Foram utilizados apa-
relhos Siemens Sonoline Antares e Philips Envisor, com trans-
dutor linear com frequncia entre 8-12 MHz, locado paralelo
ao colo femoral (plano longitudinal). As imagens foram arma-
zenadas no momento da realizao do exame, e aquelas com A
boa qualidade para avaliao foram analisadas conjuntamente
por dois radiologistas experientes em US musculoesqueltica,
cegos em relao s condies clnicas dos pacientes.
Derrame articular e/ou sinovite foram definidos como a
presena de derrame articular e/ou hipertrofia sinovial e clas-
sificados de acordo com parmetros modificados de Szkudla-
rek et al.13 Foi realizada tambm a medida do recesso anterior
do quadril (RAQ), a partir da distncia entre o colo femoral e a
cpsula articular3 (fig. 1).
Grau 0 (normal): a cpsula sinovial acompanha a curvatura
da cortical ssea femoral.
Grau 1 (leve): a cpsula sinovial no acompanha a curvatura
da cortical ssea femoral, porm permanece cncava ou
B
retificada.
Grau 2 (moderado/grave): a cpsula sinovial est abaulada,
ou seja, sua curvatura invertida em relao curvatura da
cortical ssea femoral.
Foi considerada alterao ultrassonogrfica quando o pa-
ciente apresentou grau 2 na avaliao. Na presena de alte-
rao ultrassonogrfica e ausncia de sinais e/ou sintomas
clnicos, a sinovite foi considerada subclnica e na presena
de alterao ultrassonogrfica e presena de sinais e/ou sin-
tomas clnicos, a sinovite foi considerada clnica.
O estudo foi aprovado pelo Comit de tica em Pesquisa da
instituio. Foi realizada anlise descritiva da populao do
estudo por meio de frequncias relativa e absoluta, mdias e C
desvio padro de acordo com a distribuio de cada varivel.
Para avaliar a associao entre os dados clnicos e as altera- Figura 1 Graduao do recesso anterior quadril (RAQ). (a)
es ultrassonogrficas, foram utilizados os testes de Fisher e Grau 0 (normal): a cpsula sinovial acompanha a curvatura
qui quadrado de Pearson para as variveis categricas, o tes- da cortical ssea femoral; (b) Grau 1 (leve): a cpsula
te t de Student para as variveis contnuas paramtricas e o sinovial no acompanha a curvatura da cortical ssea
teste de Mann-Whitney para as variveis contnuas no para- femoral, porm permanece cncava ou retificada; (c) Grau
mtricas. Foram considerados estatisticamente significantes 2 (moderado/grave): a cpsula sinovial est abaulada, ou
valores de P < 0,05. seja, sua curvatura invertida em relao curvatura da
cortical ssea femoral.

Resultados

Dos 92 pacientes includos no estudo, 69,6% eram meninas, Em relao avaliao ultrassonogrfica, 15 (16,3%) apre-
com mdia de idade na avaliao de 12,4 5,1 anos. Trinta e sentaram grau 0, 48 (52,2%) grau 1 e 29 (31,5%) grau 2. Dos
trs (35,9%) apresentaram subtipo oligoarticular persistente 29 pacientes que apresentaram alteraes ultrassonogrfi-
e trinta (32,6%), poliarticular com fator reumatoide (FR) ne- cas (grau 2), 10 (34,5%) apresentaram sinovite subclnica e 19
gativo. Os dados demogrficos e clnicos esto relacionados (65,5%) sinovite clnica.
na tabela 1. Foram avaliados 184 RAQs (direito e esquerdo), sendo pos-
Quarenta e quatro (47,8%) pacientes apresentaram sinal e/ svel a medida do RAQ de 137 recessos, com mdia de 5,9 2,5
ou sintoma relacionado ao quadril. Desses, 38 (86,4%) apre- mm. Desses 137 recessos, 98 apresentaram medida do RAQ
sentaram limitao articular, 13 (29,5%) apresentaram dor, 6 6 mm e 39 apresentaram RAQ > 6 mm. Houve diferena de 2
(13,6%) apresentaram dor irradiada e 6 (13,6%) apresentaram mm ou mais entre os recessos direito e esquerdo em 18 reces-
claudicao. sos avaliados.

RBR 53(4) - Arquivo livro (Impressa).indb 324 21/10/2013 18:21:23


R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 2 2 3 2 7 325

Em relao aos pacientes com alteraes ultrassonogrfi-


Tabela 1 Dados demogrficos e clnicos dos pacientes
com artrite idioptica juvenil (n = 92) cas do quadril, observamos associao entre sinovite clnica
e o comprometimento poliarticular, que incluiu os subtipos
Mdia de idade atual em anos DP 12,4 5,1
poliarticular com FR positivo ou negativo e oligoarticular es-
Mdia de idade de incio em anos DP 6,2 3,8
Mdia de tempo de evoluo em anos DP 6,2 4,1 tendido (P = 0,002) e a doena ativa (0,017) (tabela 3).
Feminino, n (%) 64 (69,6)
Tipo evolutivo de AIJ, n (%)
Oligoarticular persistente 33 (35,9) Discusso
Oligoarticular estendido 7 (7,6)
Poliarticular FR positivo 7 (7,6)
O quadril uma articulao frequentemente acometida na
Poliarticular FR negativo 30 (32,6)
Sistmico 6 (6,5) AIJ e merece ateno especial, pois considerada uma articu-
Artrite relacionada entesite 9 (9,8) lao nobre que determina o prognstico da doena e indica
Atividade de doena, n (%) mudanas para um tratamento mais agressivo. Observamos
Ativa 49 (53,3) que quase metade dos pacientes apresentaram manifesta-
Inativa com medicao 32 (34,8) es clnicas de acometimento dessa articulao, sendo a
Inativa sem medicao 11 (12)
limitao articular o sinal e/ou sintoma mais encontrado. En-
AIJ, artrite idioptica juvenil, DP, desvio padro; FR, fator reumatoide. tretanto, um tero dos pacientes no apresentou quaisquer
manifestaes clnicas, mas o exame ultrassonogrfico reve-
As alteraes na US de quadril se associaram com pre- lou sinovite, caracterizando a sinovite subclnica.
sena de sinais e/ou sintomas nessa articulao (P = 0,021), Na literatura, o envolvimento clnico de quadril est des-
especialmente a limitao (P = 0,006), mas no com a ativida- crito em 20-50% dos casos de AIJ.4,7,14,15 Batthish et al. obser-
de (P = 0,948) ou o subtipo de doena (P = 0,108). No houve varam 51% de acometimento durante o seguimento por 24
diferenas em relao s alteraes ultrassonogrficas com a meses.14 Rostom et al. observaram um acometimento clni-
idade de incio da doena (P = 0,072) e o tempo de evoluo da co bilateral em 85% dos casos, e este foi mais frequente nos
doena (P = 0,260) (tabela 2 ). subtipos poliarticular e na artrite relacionada entesite.4 Em
nosso estudo observamos 47,8% de acometimento clnico do
quadril, compatvel com a literatura (38-63%).3 Observamos
Tabela 2 Alteraes ultrassonografia de quadril e dados tambm que em 41,3% dos pacientes o envolvimento do qua-
clnicos dos pacientes com artrite idioptica juvenil (n = 92) dril foi bilateral, frequncia semelhante da literatura (25-
US de US de P 85%).2,4 Em relao ao subtipo de AIJ em que ocorre maior aco-
quadril com quadril sem metimento do quadril tambm encontramos o poliarticular,
alteraes alteraes
(n = 29) (n = 63)
Mdia de idade de incio 7,3 4,3 5,7 3,5 0,072a Tabela 3 Caractersticas dos pacientes com artrite
em anos DP idioptica juvenil em relao sinovite subclnica
Mdia de tempo de 74 5,9 4,1 0,260a e sinovite clnica detectadas ultrassonografia de
evoluo em anos DP quadril (n = 29)
Subtipo AIJ 0,108b
Sinovite Sinovite P
Oligoarticular 6 27
subclnica clnica
persistente
(n = 10) (n = 19)
Poliarticular FR 16 28
negativo ou positivo/ Mdia de idade de incio 6,9 4,7 7,5 4,2 0,701a
Oligoarticular em anos DP
estendido Mdia de tempo de 6 3,6 7,4 4,2 0,403a
Artrite relacionada 5 4 evoluo em anos DP
entesite Subtipo AIJ 0,003b
Sistmico 2 4 Oligoarticular 5 1
Atividade de doena 0,948b persistente
Ativa 15 34 Poliarticular FR 2 14
Inativa com medicao 11 21 negativo ou positivo/
Inativa sem medicao 3 8 Oligoarticular
Sinais e/ou sintomas 19 25 0,021c estendido
clnicos relacionados Artrite relacionada a 3 2
ao quadril entesite
Dor 7 6 0,103b Sistmico 0 2
Dor irradiada 2 4 1b Atividade de doena 0,018b
Claudicao 3 3 0,375b Ativa 2 13
Limitao 18 20 0,006c Inativa com medicao 7 4
Inativa sem medicao 1 2
US, ultrassonografia; DP, desvio padro; AIJ, artrite idioptica
juvenil; FR, fator reumatoide. DP, desvio padro; AIJ, artrite idioptica juvenil; FR, fator
a
Teste t de Student . reumatoide.
b
Teste exato de Fisher. a
Teste de Mann Whitney
c
Teste do qui-quadrado de Pearson. b
Teste exato de Fisher.

RBR 53(4) - Arquivo livro (Impressa).indb 325 21/10/2013 18:21:23


326 R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 2 2 3 2 7

alm do oligoarticular estendido. O acometimento do quadril medidas dos RAQ maior que 6 milmetros. Friedman & Gruber
ocorre mais em pacientes com idade precoce de incio da do- descreveram uma correlao positiva entre a medida do espa-
ena e em pacientes com maior durao da doena, fato que o anecoico e a limitao do movimento articular de quadril.2
no observamos em nossa casustica.3 Fedrizzi et al. avaliaram 53 pacientes com AIJ e 10 controles
O sinal e/ou sintoma mais encontrado foi a limitao do e observaram que quase 50% dos pacientes apresentaram
quadril. A artrite de quadril leva diminuio progressiva do alterao de quadril, caracterizado por distenso da cpsula
espao articular e consequente limitao articular at total an- articular, (forma convexa), aumento da ecogenicidade, e RAQ
quilose em alguns casos. Enquanto a limitao articular pode maior que 6 mm.3
ser facilmente detectada pelo exame fsico, a presena de der- Nosso estudo apresenta algumas limitaes. um estudo
rame articular no possvel devido ao fato dessa articulao retrospectivo, baseado em anlise de pronturios e a con-
se encontrar em planos mais profundos, impedindo a deteco cordncia inter e intraobservador entre os radiologistas no
de derrame articular. A avaliao com radiografia falha uma foi avaliada. Alm disso, no foi realizada a US com Power
vez que as alteraes radiolgicas, como eroses e reduo do Doppler (PD), que avalia a medida do fluxo sanguneo sino-
espao, aparecem tardiamente, alm de no fornecer boa in- vial. Estudos recentes mostram que esse fluxo ao PD positivo
formao sobre a presena de derrame articular e sinovite.3 A pode estar associado atividade e progresso da doena ar-
US de quadril supre essas dificuldades e realizada rotinei- ticular em pacientes com artrite reumatoide e artrite idiop-
ramente em nosso servio a intervalos anuais. Ela de fcil tica juvenil, apesar de ainda no haver validao dos escores
utilizao, baixo custo e possibilita a deteco da doena do de classificao.19-23
quadril previamente ao desenvolvimento de danos. Est bem- Por fim, importante lembrar que o acometimento de
-estabelecido que a US seriada pode suplementar a avaliao quadril na AIJ leva a dificuldades psicossociais, com limita-
clnica na determinao da atividade da AIJ e avaliar a resposta o fsica e dor crnica levando a um prejuzo importante na
teraputica, especialmente no acometimento do quadril.7,16 qualidade de vida desses pacientes.24 Os profissionais de sa-
Em nosso estudo, as alteraes ultrassonogrficas se as- de devem estar atentos possibilidade de doena silenciosa,
sociaram com a presena de sinais e/ou sintomas, mais es- com sinovite subclnica, que pode contribuir para a deteriora-
pecificamente com a limitao do quadril. Entretanto, 31,5% o da articulao do quadril.
dos pacientes no apresentou qualquer manifestao clnica, Estudos prospectivos e com maior nmero de pacientes,
mas a US revelou sinovite, caracterizando a sinovite subclni- alm do uso da US com PD e ressonncia magntica, podem
ca. Na literatura, descrita frequncia de 19,8%.3 Alguns estu- ser importantes para determinar com maior preciso o prog-
dos incluram apenas joelhos, tornozelos, punhos e pequenas nstico dos pacientes com acometimento da articulao do
articulaes.11,17,18 Dependendo da articulao avaliada US, quadril.
a concordncia entre os achados de exame fsico e a US pode
ser mais baixa. Pequenas articulaes de mos e ps so as-
REFERNCIAS
sociadas maior discordncia.17
A sinovite clnica se associou com o subtipo poliarticular e
a doena ativa. A sinovite subclnica no esteve associada
1. Petty RE, Southwood TR, Manners P, Baum J, Glass DN,
atividade de doena. Frosch et al. tambm no encontraram
Goldenberg J, et al. International League of Associations
relao entre sinovite subclnica e atividade de doena.8 Esses
for Rheumatology classification of juvenile idiopathic
achados sugerem que pacientes com o subtipo poliarticular arthritis: second revision, Edmonton, 2001. J Rheumatol.
com sinais e/ou sintomas do quadril devem ser avaliados cui- 2004;31(2):390-2.
dadosamente, uma vez que a presena de sinais e/ou sintomas 2. Friedman S, Gruber M. Ultrasonography of the hip in the
est associada a alteraes ultrassonogrficas, e no somente evaluation of children with seronegative juvenile rheumatoid
sequela de doena. Alm disso, a sinovite subclnica pode es- arthritis. J Rheumatol. 2002;29:629-32.
3. Fedrizzi MS, Ronchezel MV, Hilario MOE, Lederman H, Sawaya
tar presente em pacientes ativos ou inativos, o que justifica a
S, Goldenberg J, et al. Ultrasonography in the early diagnosis
investigao peridica da articulao com exames de imagem
of hip joint involvement in juvenile rheumatoid arthritis. J
em todos os pacientes, independente da atividade da AIJ. Rheumatol. 1997;24:1820-5.
A no identificao da sinovite US no paciente com AIJ 4. Rostom S, Amine B, Bensabbah R, Abouqal R, Hajjaj-Hassouni
pode levar ao atraso do diagnstico e do tratamento, ou levar N. Hip involvement in juvenile idiopathic arthritis. Clin
ao subtratamento da doena com baixos nveis de atividade. Rheumatol. 2008;27(6):791-4.
A presena de sinovite subclnica pode ser responsvel pela 5. Bruns A, Iwakami WCT, Ciconelli RM, Fernandes ARC. Hip
diseases: clinical evaluation and imaging exams. Rev Bras
manuteno da deteriorao estrutural em pacientes com AIJ
Reumatol. 2003;43(2):96-103.
em remisso clnica e laboratorial, fato reconhecido em artri- 6. Ravelli A, Martini A. Early predictors of outcome in juvenile
te reumatoide.11,19,20 Tambm a presena de sinovite subclnica idiopathic arthritis. Clin Exp Rheumatol. 2003;21(5 Suppl
pode alterar a classificao do paciente com AIJ, e o paciente 31):S89-93.
pode ser equivocamente diagnosticado como tendo subtipo 7. Spencer CH, Bernstein BH. Hip disease in juvenile
oligoarticular e ter na realidade a forma poliarticular, o que rheumatoid arthritis. Curr Opin Rheumatol. 2002;14(5):536-41.
8. Frosch M, Foell D, Ganser G, Roth J. Arthrosonography of
indicaria um tratamento mais agressivo.11,17
hip and knee joints in the follow up of juvenile rheumatoid
Ao avaliar o exame de US importante realizar a medida
arthritis. Ann Rheum Dis. 2003;62:242-4.
do RAQ que, segundo a literatura, tem valor de normalidade 9. Bakhaus M, Burmester G-R, Gerber T, Grassi W, Machold KP,
at 6 mm.3,8 Em nosso estudo, a mdia das medidas do RAQ Swen WA, et al. Guidelines for musculoskeletal ultrasound in
para todos os pacientes foi de 5,9 mm 2,5 mm, com 29% das rheumatology. Ann Rheum Dis. 2001;60:641-9.

RBR 53(4) - Arquivo livro (Impressa).indb 326 21/10/2013 18:21:23


R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 2 2 3 2 7 327

10. Martinoli C,Valle M,Malattia C,Beatrice-Damasio M,Tagliafico idiopathic arthritis: a pilot study. Rheumatology (Oxford).
A. Paediatric musculoskeletal US beyond the hip joint. Pediatr 2010;49(1):123-7.
Radiol. 2011;41(Suppl1):S113-24. 18. Breton S, Jousse-Joulin S, Cangemi C, de Parscau L,
11. Magni-Manzoni S, Epis O, Ravelli A, Klersy C, Veisconti C, Lanni Colin D, Bressolette L, et al. Comparison of clinical and
S, et al. Comparison of clinical versus ultrasound-determined ultrasonographic evaluations for peripheral synovitis
synovitis in juvenile idiopathic arthritis. Arthritis Rheum. in juvenile idiopathic arthritis. Semin Arthritis Rheum.
2009;61(11):1497-504. 2011;41(2):272-8.
12. Wallace CA, Giannini EH, Huang B, Itert L, Ruperto N; 19. Brown AK, Quinn MA, Karim Z, Conaghan PG, Peterfy CG,
Childhood Arthritis Rheumatology Research Alliance; Hensor E, et al. Presence of significant synovitis in rheumatoid
Pediatric Rheumatology Collaborative Study Group; arthritis patients with disease-modifying antirheumatic
Paediatric Rheumatology International Trials Organization. drug-induced clinical remission: evidence from an imaging
American College of Rheumatology provisional criteria study may explain structural progression. Arthritis Rheum.
for defining clinical inactive disease in select categories of 2006;54(12):3761-73.
juvenile idiopathic arthritis. Arthritis Care Res (Hoboken). 20. Brown AK, Conaghan PG, Karim Z, Quinn MA, Ikeda K, Peterfy
2011;63(7):929-36. CG, et al. An explanation for the apparent dissociation
13. Szkudlarek M, Court-Payen M, Jacobsen S, Klarlund M, between clinical remission and continued structural
Thomsen HS, Ostergaard M. Interobserver agreement in deterioration in rheumatoid arthritis. Arthritis Rheum.
ultrasonography of the finger and toe joints in rheumatoid 2008;58(10):2958-67.
arthritis. Arthritis Rheum. 2003;48(4):955-62. 21. Sprchez M, Fodor D, Miu N. The role of Power Doppler
14. Batthish M, Feldman BM, Babyn PS, Tyrrell PN, Schneider R. ultrasonography in comparison with biological markers in the
Predictors of hip disease in the systemic arthritis subtype of evaluation of disease activity in Juvenile Idiopathic Arthritis.
juvenile idiopathic arthritis. J Rheumatol. 2011;38(5):954-8. Med Ultrason. 2010;12(2):97-103.
15. Flat B, Lien G, Smerdel A, Vinje O, Dale K, Johnston V, et al. 22. Breton S, Jousse-Joulin S, Cangemi C, de Parscau L, Colin D,
Prognostic factors in juvenile rheumatoid arthritis: a case- Bressolette L, et al. Comparison of clinical and ultrasonographic
control study revealing early predictors and outcome after 14.9 evaluations for peripheral synovitis in juvenile idiopathic
years. J Rheumatol. 2003;30(2):386-93. arthritis. Semin Arthritis Rheum. 2011;41:272-8.
16. Damasio MB, Malattia C, Martini A, Tom P. Synovial and 23. Yoshimi R, Hama M Takase K, Ihata A, Kishimoto D, Terauchi
inflammatory diseases in childhood: role of new imaging K, et al. Ultrasonography is a potent tool for the prediction
modalities in the assessment of patients with juvenile of progressive joint destruction during clinical remission of
idiopathic arthritis. Pediatr Radiol. 2010;40(6):985-98. rheumatoid arthritis. Mod Rheumatol. 2012;23(3):456-65.
17. Haslam KE, McCann LJ, Wyatt S, Wakefield RJ. The detection of 24. Harris CM, Baum J.Involvement of the hip in juvenile
subclinical synovitis by ultrasound in oligoarticular juvenile rheumatoid arthritis. J Bone Joint Surg Am. 1988;70(6):821-33.

RBR 53(4) - Arquivo livro (Impressa).indb 327 21/10/2013 18:21:23


R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 2 8 3 3 4

REVISTA BRASILEIRA DE
REUMATOLOGIA
www.reumatologia.com.br

Artigo original

Sintomas psiquitricos em pacientes com lpus eritematoso


sistmico: frequncia e associao com atividade da doena com
o uso do Questionrio de Morbidade Psiquitrica em Adultos

Snia Maria da Rosa Beltroa, Luciana Beltro Gigantea, Dbora Beltro Zimmera,
Paulo Roberto Zimmermannb, Deonilson Schmoellerb, Fbio Batistellab,
Henrique Luiz Staubb,*
a
Clnica Sensorial Tratamentos Complementares, Porto Alegre, RS, Brasil
b
Faculdade de Medicina, Pontifcia Universidade Catlica do Rio Grande do Sul, Porto Alegre, RS, Brasil

informaes resumo

Histrico do artigo: Introduo: Enquanto os critrios de neurolpus esto bem-estabelecidos, manifestaes


Recebido em 1 de agosto de 2012 psiquitricas globais so de frequncia varivel em pacientes com lpus eritematoso sist-
Aceito em 30 de janeiro de 2013 mico (LES); suas relaes com atividade da doena e prognstico so desconhecidas.
Objetivo: Avaliar a frequncia de sintomas psiquitricos no LES utilizando o Questionrio de
Palavras-chave: Morbidade Psiquitrica em Adultos (QMPA); correlacionar alteraes no QMPA com ativida-
Lpus eritematoso sistmico de da doena e variveis socioeconmicas.
Sintomas psiquitricos Materiais e mtodos: Este estudo transversal avaliou pacientes com LES ativo ou inativo
Questionrio de Morbidade quanto prevalncia de sintomas psiquitricos utilizando, pela primeira vez, o QMPA. Oito
Psiquitrica em Adultos ou mais respostas afirmativas entre 45 perguntas definiram um QMPA como anormal. Os
SLEDAI pacientes foram classificados de acordo com os critrios do American College of Rheumatology
de 1997, e o grau de atividade da doena foi mensurado pelo SLEDAI.
Resultados: Participaram do estudo 72 pacientes com LES, dos quais 68 eram do sexo femini-
no (94,4%). A mdia de idade foi de 46,1 anos ( 12 DP). A frequncia de QMPA anormal foi de
89%. Entre os 64 pacientes lpicos com QMPA alterado, 60 (93,7%) apresentavam distrbios
mentais comuns, a maioria ansiedade e somatizao. No houve correlao de sintomas
psiquitricos com atividade da doena (P = 0,46; rs = 0,09) ou com histria de psicose e/ou
convulses atribuveis ao LES (P = 1,00). Sintomas psiquitricos tambm no se correlacio-
naram com idade de incio da doena (rs = 0,16) ou durao da doena (rs = 0,11). Houve
associao de QMPA anormal com baixo nvel educacional (P=0,02), mas no com renda
familiar destinada ao paciente (P = 0,24).
Concluso: A frequncia de sintomas psiquitricos medidos pelo QMPA foi alta em nossa
populao com LES. Um QMPA anormal esteve dissociado da atividade do LES, mas se asso-
ciou com baixo nvel educacional.
2013 Elsevier Editora Ltda. Todos os direitos reservados.

* Autor para correspondncia.


E-mail: henriquestaub@terra.com.br (H.L. Staub).
0482-5004/$ - see front matter. 2013 Elsevier Editora Ltda. Todos os direitos reservados.

RBR 53(4) - Arquivo livro (Impressa).indb 328 21/10/2013 18:21:23


R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 2 8 3 3 4 329

Psychiatric symptoms in patients with systemic lupus erythematosus:


frequency and association with disease activity using the Adult
Psychiatric Morbidity Questionnaire

abstract

Keywords: Introduction: While the neurolupus criteria are well-established, global psychiatric manifes-
Systemic lupus erythematosus tations are of variable frequency in patients with systemic lupus erythematosus (SLE); their
Psychiatric symptoms relation with disease activity is unknown.
Adult Psychiatric Morbidity Objective: To evaluate the frequency of psychiatric symptoms in SLE using the Adult Psychi-
Questionnaire atric Morbidity Questionnaire (APMQ); to correlate APMQ changes with disease activity and
SLEDAI socio-economic variables.
Materials and methods: This cross-sectional study evaluated patients with active or inactive
SLE as to the prevalence of psychiatric symptoms utilizing, for the first time, the APMQ.
Eight or more affirmative replies out of 45 questions defined the APMQ as abnormal. Pa-
tients were classified according to the American Collge of Rheumatology 1997 criteria, and
disease activity was measured by the SLEDAI.
Results: Seventy-two SLE patients entered the study, being 68 females (94.4%). Mean age was
46.1 years ( 12 SD). The frequency of abnormal APMQ was of 89%. Out of the 64 SLE patients
with altered APMQ, 60 (93.7%) had common mental disorders, mostly anxiety and somati-
zation. There was no correlation of psychiatric symptoms with active disease (rs = 0.09; P =
0.46), or with history of psychosis and/or seizures attributable to SLE (P = 1.00). Psychiatric
symptoms also did not correlate with age at disease onset (rs = 0.16) or disease duration
(rs = 0.11). There was an association of abnormal APMQ with low education level (P = 0.02),
but not with family income allotted to the patient (P = 0.24).
Conclusion: The frequency of psychiatric symptoms measured by the APMQ was high in our
SLE population. An abnormal APMQ was disconnected from SLE activity, but it did associate
with low education level.
2013 Elsevier Editora Ltda. All rights reserved.

Survey Short Form 36 tornou-se o mtodo mais comumente


Introduo utilizado nesse grupo de pacientes.8
A avaliao psicomtrica dos pacientes com LES pode ser
O lpus eritematoso sistmico (LES) uma doena multissis- obtida com o uso da escala de Wechsler7 e do inventrio de sin-
tmica crnica de evoluo imprevisvel. Fatores genticos, tomas cognitivos.9,10 Os distrbios mentais comuns (DMC, aqui
hormonais e ambientais esto envolvidos em sua etiologia. A incluindo transtornos depressivos, de ansiedade e somatofor-
influncia de fatores psicolgicos na atividade e no prognsti- mes) podem, por sua vez, ser avaliados pelo DSM-IV (Diagnostic
co da doena matria a ser considerada.1 and Statistical Manual of Mental Disorders, Fourth Edition),11 mas
Convulses e psicose so critrios clssicos para LES neu- tambm por escalas de depresso, ansiedade e/ou estresse,12
ropsiquitrico, ocorrendo em at 20% dos casos.2 No geral, escalas socioeconmicas13 e escalas de personalidade.14 No
manifestaes neuropsiquitricas podem ser vistas em 9 a h mtodo consensual para avaliar os sintomas psiquitricos
80% dos casos.3 Cefaleia a manifestao neurolgica mais no LES, e tal multiplicidade de abordagens torna complicada a
frequente, e o acidente vascular cerebral, a mais grave.4 Anti- compreenso da morbidade psquica de tais pacientes.
corpos antineuronais,5 assim como anticorpos contra recep- O questionrio de morbidade psiquitrica do adulto
tores NR2,6 foram associados recentemente a envolvimento (QMPA), descrito em 1982,15 um instrumento estruturado em
cerebral em pacientes com LES. Alm de vasculite, as sn- fatores, de modo a caracterizar sintomas de DMC ou psicose.
dromes neuropsiquitricas complexas do LES podem tambm Embora cada fator do QMPA no seja diagnstico por si pr-
ser consequncia de isquemia, aterosclerose precoce ou mor- prio, pode representar uma dimenso psicopatolgica poten-
bidades associadas.7 cialmente til no rastreamento de doenas psquicas.
Enquanto as sndromes orgnicas neuropsiquitricas so At o momento, O QMPA no havia sido utilizado na tria-
bem-conhecidas nos pacientes com LES, a frequncia global gem de morbidade psiquitrica em pacientes com doen-
de sintomas psiquitricos nesse pacientes tema polmico. a crnica autoimune. Neste estudo, objetivamos utilizar o
Fadiga, fibromialgia, disfuno cognitiva e depresso so to- QMPA na avaliao de sintomas psiquitricos em pacientes
dos contribuintes para a baixa qualidade de vida nos pacien- com LES. Em paralelo, procurou-se investigar a correlao de
tes com LES. Esses distrbios geram considerveis distores escores do QMPA com atividade de doena, histria de psicose
na avaliao psicolgica desses pacientes.7 Uma variedade de e/ou convulses atribuveis ao LES, idade de incio da doena,
instrumentos foram desenvolvidos para avaliar a qualidade durao da doena, nvel educacional e renda familiar desti-
de vida dos pacientes com LES; entre eles, o Medical Outcomes nada ao paciente.

RBR 53(4) - Arquivo livro (Impressa).indb 329 21/10/2013 18:21:24


330 R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 2 8 3 3 4

14. Considerou cometer suicdio?


Materiais e mtodos 15. Percebeu que estava fora de controle, afetado por do-
ena mental?
Amostra 16. Esteve incapacitado de trabalhar por nervosismos ou
doena mental?
Este estudo transversal incluiu pacientes com LES em acom- 17. Percebeu que estava com dificuldade para falar ou en-
panhamento no Ambulatrio de LES do Servio de Reumato- xergar normalmente?
logia, Hospital So Lucas da Pontifcia Universidade Catlica 18. Permaneceu trancado em um quarto para evitar se en-
do Rio Grande do Sul (PUCRS). Arrolamos pacientes durante contrar com qualquer pessoa?
os dois ltimos anos. Os critrios de incluso foram: a) pa- 19. Embriagou-se pelo menos uma vez na semana?
cientes com 15 ou mais anos de idade, de ambos os sexos que 20. Bebeu todos os dias?
concordaram em participar do estudo; b) pacientes com no 21. Apresentou palpitao ou aperto cardaco?
mnimo 4 dos 11 critrios do American College of Rheumatology 22. Sofreu de ansiedade?
1997 para classificao de LES.16 Pacientes com dados clnicos 23. Preocupou-se em estar doente?
ou laboratoriais insuficientes para a avaliao de atividade da 24. Teve um ataque aps susto ou contrariedade?
doena foram excludos. 25. Teve medo de coisas, animais, escuro ou locais fechados?
Os pacientes com LES responderam o questionrio psi- 26. Teve que assegurar que as portas estavam fechadas
quitrico e uma entrevista baseada em dados demogrficos. aps as ter trancado?
Todos os pacientes autorizaram o uso dos pronturios mdi- 27. Ouviu vozes ou enxergou coisas que outras pessoas
cos para determinar o grau de atividade lpica (Systemic Lupus no viram?
Erythematosus Disease Index Activity, SLEDAI). Todos os pacien- 28. Falou coisas que no faziam sentido?
tes assinaram um termo de consentimento informado. O es- 29. Falou ou riu sozinho?
tudo foi aprovado pelo Comit de tica do Hospital So Lucas 30. Sentiu que estivesse sendo seguido? Percebeu que as
da PUCRS (CEP/PUCRS 08/044469). pessoas lhe desejam m sorte?
31. Sentiu-se controlado telepaticamente por rdio ou es-
Medidas pritos?
32. Assumiu posturas no usuais por um longo perodo?
Os dados clnicos e demogrficos dos pacientes com LES fo- 33. Sentiu-se muito alegre sem nenhuma razo aparente?
ram obtidos por entrevista e pronturios mdicos. As vari- 34. Cantou ou falou sem parar?
veis demogrficas incluram idade, sexo, raa, perfil socioeco- 35. Utilizou medicamentos para dormir ou se acalmar?
nmico e nvel educacional. 36. Sentiu-se incapaz de frequentar a escola?
Os sintomas psiquitricos foram avaliados utilizando-se os 37. Apresentou episdios de loucura?
45 itens do QMPA.17 A escala agrupa sintomas em fatores para 38. Apresentou retardo mental?
distinguir indivduos com caractersticas de ansiedade/soma- 39. Apresentou mania de limpeza?
tizao ou irritabilidade/depresso (DMC) daqueles com psi- 40. Foi tratado para doena mental ou ansiedade?
cose, esta ltima manifesta por delrio, quadros paranoides e 41. Apresentou convulses caindo ao cho com contratu-
alucinaes auditivas. As alternativas de respostas foram sim ras musculares?
ou no, s quais foram atribudos valores 1 ou 0, respectiva- 42. Usou drogas? Quais?
mente. As primeiras 43 questes dizem respeito a sintomas 43. Consumiu bebida alcolica exageradamente?
prprios do indivduo que est sendo entrevistado, enquanto Algum em sua famlia...
as ltimas duas questes (44 e 45) referem-se a sintomas que 44. No sabe como se vestir? Urinou ou evacuou na roupa?
poderiam estar presentes em qualquer membro da famlia. 45. No fala, no caminha ou no reconhece as pessoas?
As 45 questes includas no QMPA foram assim procedidas:
No rastreamento de psicopatias, questes do QMPA como
Desde o ltimo ano... as de nmero 3, 4, 5, 7, 8, 9 e 21 agrupam sintomas mais pro-
1.Tem tido diminuio do apetite? priamente relacionados ao fator ansiedade/somatizao; por
2. Tem tido dificuldade para dormir? sua vez, as questes 6, 7, 10, 13, 14 e 18 congregam sintomas
3. Tem sofrido de zumbido nos ouvidos ou agonia mental? mais atrelados ao fator irritabilidade/depresso. As questes
4. Tem apresentado enxaqueca ou cefaleia? 27, 30 e 31 agrupam sintomas pertinentes a transtornos psi-
5. Tem percebido fraqueza nas pernas ou dor nervosa? cticos.
6. Tem se tornado agressivo, explodindo facilmente? O QMPA foi considerado positivo para presena de sinto-
7. Tem se sentido deprimido ou desmotivado? mas psiquitricos se o paciente apresentou oito ou mais res-
8. Tem sentido um n na garganta, queimao ou plenitu- postas afirmativas.17 O questionrio foi aplicado pelo autora
de estomacal? ou por dois psiclogos treinados.
9. Tem percebido tremor ou frio nas mos? A atividade da doena foi avaliada pelo SLEDAI; 24 vari-
10. Tem frequentemente surtos de irritabilidade? veis clnicas foram estudadas. A pontuao estratificada por
11. Tem dificuldade de entendimento, aprendizado ou me- peso para nove sistemas orgnicos foi utilizada como segue: 8
mria? para sistema nervoso central e sistema vascular, 4 para renal
12. Tem consumido bebidas alcolicas? e musculoesqueltico, 2 para seroso, dermatolgico, imunol-
13. s vezes fica parado, chorando muito? gico, e 1 para constitucional e hematolgico. Um SLEDAI su-

RBR 53(4) - Arquivo livro (Impressa).indb 330 21/10/2013 18:21:24


R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 2 8 3 3 4 331

perior a 4 foi considerado compatvel com doena ativa.18 Os


Tabela 1 Caractersticas clnicas e demogrficas dos
dados clnicos e laboratoriais para clculo do SLEDAI foram pacientes com lpus eritematoso sistmico
obtidos em at 10 dias, no mximo, da avaliao pelo QMPA.
Caractersticas Total (n = 72)
As seguintes variveis foram tambm correlacionadas
com os escores de QMPA: histria prvia de psicose e/ou con- Mulheres 68 (94,4%)
Brancos 60 (83,3%)
vulses atribudas ao LES de acordo com os dados mdicos;
Idade mdia 46,1 (DP12)
idade de incio da doena; durao da doena; nvel educacio- Idade de incio da doena (anos)
nal (sendo baixo nvel educacional at ensino fundamental, Antes de 20 8 (11,1%)
e alto nvel educacional o ensino mdio ou superior); e renda 21-40 47 (65,3%)
familiar destinada ao paciente (em salrio mnimo brasileiro). Acima de 40 17 (23,6%)
Durao da doena (anos)
Acima de 5 23 (32%)
Anlise dos dados
6-10 17 (24%)
11-15 10 (14%)
Anlise estatstica quantitativa foi realizada utilizando-se o 16-20 11 (15%)
programa SPSS 13.0, considerando-se o nvel de significn- 21-25 2 (3%%)
cia em 5%. As variveis foram descritas por meio de mdias Acima de 25 9 (12%)
e desvio-padro ou de frequncias absolutas ou relativas. A Nvel educacionala
Baixo nvel educacional 47 (65,2%)
anlise estatstica incluiu teste t Student e teste de Mann-
Alto nvel educacional 25 (34,7%)
-Whitney para variveis contnuas, e qui-quadrado ou teste
Renda familiar destinada ao paciente (vezes o salrio mnimo)
de Fisher para variveis categricas. O teste de Spearman foi At 1,5 58 (80,5%)
utilizado para calcular o coeficiente de correlao. 1,6-3 10 (14%)
3,1-4,5 4 (5,5%)

n, nmero amostral; DP, desvio padro.


Resultados a
Baixo nvel educacional: at ensino fundamental; alto nvel
educacional: ensino mdio ou superior.
A amostra final consistiu de 72 pacientes com LES, 68 (94,4%)
mulheres e 60 (83,3%) da etnia branca. A mdia de idade foi
46,1 anos (DP 12). A mdia de idade de incio da doena foi
Tabela 2 Associao entre escores do Questionrio de
35 anos, e a durao mdia da doena foi de 13 anos. Aproxi-
Morbidade Psiquitrica em Adultos (QMPA) e ndice de
madamente metade dos pacientes apresentava doena por atividade do lpus eritematoso sistmico
10 anos ou menos; um tero tinha menos de 5 anos de do-
Varivel QMPA alto QMPA normal Pa
ena. Em relao ao nvel educacional, 47 pacientes (65,2%)
(n = 64) (n = 8)
no alcanaram o nvel mdio. Em 80,5% dos casos, a renda
SLEDAI alto (n = 27) 25 (92,6%) 2 (7,4%) 0, 23
familiar destinada ao paciente foi de 1,5 vezes ou menos o
SLEDAI normal (n = 45) 39 (86,7%) 6 (13,3%)
salrio mnimo brasileiro. A grande maioria dos pacientes
(96%) estavam utilizando corticoesteroides. A tabela 1 apre- n, nmero amostral; QMPA alto, questionrio de morbidade
psiquitrica em 8.
senta as caractersticas demogrficas e clnicas dos nossos a
Teste do qui-quadrado; SLEDAI alto: ndice de atividade do lpus
pacientes com LES.
eritematoso sistmico 4.
A prevalncia total de QMPA alterado foi de 89% em nos-
sa populao lpica (64 pacientes). Sessenta dos 64 pacientes
(93,7%) com sintomas psiquitricos foram classificados como correlacionaram com idade de incio da doena (rs = 0,16; P =
casos de DMC, e 4 (6,3%) como tendo psicose. Entre os 60 pa- 0,2) ou durao da doena (rs = 0,11; P = 0,3).
cientes com DMC, 50 (83,3%) apresentavam sintomas de an- A associao de sintomas psiquitricos com nvel educa-
siedade/somatizao, enquanto 10 pacientes (16,7%) demons- cional e renda familiar destinada ao paciente apresentada
travam irritabilidade ou sintomas de depresso. na tabela 3. Houve associao significativa entre escore alto
Entre todos os pacientes com LES, 27 (37,5%) apresentavam de QMPA e baixo nvel educacional, mas no com renda fami-
doena ativa (SLEDAI > 4). A tabela 2 mostra a relao dos es- liar destinada ao paciente.
cores de QMPA com atividade lpica medida pelo SLEDAI. Sin-
tomas psiquitricos no se associaram com escores elevados
do SLEDAI. Discusso
A figura 1 apresenta a distribuio grfica dos pacientes de
acordo com os escores alcanados no QMPA e SLEDAI, con- O QMPA um instrumento de triagem para morbidade psi-
siderando-se variveis quantitativas e o coeficiente de cor- quitrica descrito h aproximadamente trs dcadas.15,19 A in-
relao de Spearman (rs). No houve correlao significativa terdependncia das variveis e as propriedades psicomtricas
entre os escores de QMPA e SLEDAI. A linha reta no pde ser do QMPA, determinadas por anlise multivariada, indicaram
estimada, uma vez que o rs foi inferior a 0,5. que os fatores do questionrio foram consonantes com as
Entre os 72 pacientes com LES, 12 (16,6%) tinham histrico respectivas psicopatias (DMC, psicoses) definidas na prtica
de psicose e/ou convulses atribuveis doena. No houve clnica.15,17,19 Em registros populacionais com ponto de corte
associao entre escore elevado de QMPA e esta varivel (P = 6/7, o mtodo mostrou boa sensibilidade (75% a 93%), espe-
1,00, teste de Fisher). Sintomas psiquitricos tambm no se cificidade varivel (entre 53% e 94%) e um kappa de 0,88.15,17,19

RBR 53(4) - Arquivo livro (Impressa).indb 331 21/10/2013 18:21:24


332 R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 2 8 3 3 4

Nossos pacientes com LES foram predominantemente mu-


50,00
rs=0,09 lheres (94,4%) e brancos (83,3%), com mdia de idade de 46,1
P=0,46
anos. A literatura mostra uma incidncia aumentada de LES
40,00 em mulheres no brancas entre 20-30 anos.28 Nossos dados
mostram semelhana com a literatura em relao a predo-
mnio do sexo feminino, mas diferem em relao raa.28 Em
30,00
concordncia com nossos dados, Chahade et al. documenta-
SLEDAI

ram uma incidncia aumentada de LES em caucasianos do


sudeste do Brasil.29
20,00
Aproximadamente dois teros do nosso grupo de pa-
cientes lpicos iniciaram com a doena entre 20 e 40 anos
10,00 de idade, achados compatveis com a literatura americana.30
Aproximadamente um tero apresentava doena com menos
de 5 anos de durao. Nossa populao lpica, amplamente
0,00 dependente do sistema pblico de sade, tinha, em termos
0,00 5,00 10,00 15,00 20,00 25,00 30,00 gerais, um baixo nvel educacional: 62,5% dos pacientes no
QMPA frequentaram o ensino mdio. Em 80,5% dos casos a renda
familiar destinada ao paciente era 1,5 vezes o salrio mni-
Figura 1 Distribuio dos pacientes lpicos de acordo com mo ou menos. Resumidamente, esta amostra representativa
os escores do questionrio de morbidade psiquitrica do de um centro tercirio pblico de uma grande cidade sulina
adulto (QMPA) e do SLEDAI (systemic lupus erythematosus (maioria branca, baixa renda, baixo nvel educacional).
activity index). A frequncia de sintomas psiquitricos avaliados pelo
rs, coeficiente de correlao de Spearman; P, teste t de QMPA foi bastante alta em nossa populao com LES (89%).
Student. De interesse, a prevalncia de distrbios psiquitricos pelo
QMPA foi previamente avaliada em 6746 indivduos de trs
reas metropolitanas do Brasil (Braslia, So Paulo e Porto Ale-
Tabela 3 Associao de morbidade psiquitrica com gre). A frequncia de psicopatologia (maioria transtornos de
nvel educacional e renda familiar destinada ao paciente ansiedade) variou de 19% (So Paulo) at 34% (Braslia e Por-
Varivel QMPA QMPA P to Alegre). O relato31 compreende a primeira investigao de
positivo negativo doena mental em populao urbana, e instigou nosso atual
(n = 64) (n = 8) interesse em rastrear morbidade psiquitrica no LES por meio
Nvel educacional do QMPA. Como visto, a prevalncia de QMPA anormal dife-
Nvel educacional alto 19 (76%) 6 (24%) 0,02a riu amplamente quando uma amostra da populao geral31
Nvel educacional baixo 45 (96%) 2 (4%) comparada, mesmo que indiretamente, com um grupo espe-
Renda familiar destinada ao paciente
cfico de pacientes com LES.
Reais / dlaresb 517 / 284,06 767 / 421,42 0,24c
Salrio mnimo brasileiro 1,11 1,64
A prevalncia de 89% de QMPA anormal nos nossos pa-
cientes com LES pode estar superestimada. O teste pode ser
QMPA positivo, escore do questionrio de morbidade psiquitrica
hipersensvel, detectando sintomas de sndromes funcionais
em adultos 8; n, nmero da amostra; Nvel educacional alto,
ensino mdio ou faculdade; Nvel educacional baixo, at ensino
(questes 2, 4, 9 e 21, por exemplo) ou queixas orgnicas do
fundamental. LES (questes 1, 41). Em um estudo hospitalar incluindo trinta
a
Teste do qui-quadrado. pacientes com LES, a prevalncia de desordens psiquitricas
b
1 real = 0,54 dlar americano. utilizando-se outro mtodo (Presumptive Stressful Life Event
c
Teste de Mann-Whitney. Scale) foi de 50%, de acordo com estudo de 1999.32 Em uma
amostra brasileira de pacientes lpicos avaliada por escalas
Nos ltimos anos, a escala foi utilizada em um amplo con- tradicionais, alteraes cognitivas, ansiedade e/ou depresso
texto: para estudar a relao da sade mental dos pais com a foram vistos em 75% dos casos, uma frequncia semelhante
sade mental das crianas;19 para acessar o efeito das variveis nossa no que se refere a DMC.33
socioeconmicas e do ambiente familiar na sade mental das Entre nossos 64 pacientes com sintomas psiquitricos,
crianas;20 para avaliar a epidemiologia do uso de psicotrpicos houve uma predominncia macia de DMC (93,7%) em com-
na cidade de So Paulo;21 para estudar a sade mental de mes parao com psicose (6,3%). Entre o grupo das DMC, a maioria
de crianas desnutridas;22 para avaliar o impacto de traba- dos pacientes (83,3%) se enquadrou no grupo de ansiedade/
lhos informais na sade mental das mulheres;23 para verificar somatizao, e os restantes na categoria de irritabilidade/de-
o efeito de atividades domsticas e do trabalho remunerado presso. No grande grupo de pacientes com o fator ansiedade/
nos sintomas psiquitricos;24 para avaliar os sintomas de de- somatizao, sintomas atribuveis ao LES como fadiga e fra-
presso e ansiedade entre empregadas domsticas;25 para do- queza nas pernas34 foram tambm computados em nosso
cumentar os efeitos da desigualdade social na prevalncia de estudo (questo 5 do QMPA); esta sobreposio de sintomas
desordens psiquitricas na Bahia, Brasil;26 para rastrear morbi- psiquitricos e orgnicos pode ter gerado um vis de confuso
dade psiquitrica em gestantes sob uso de bebidas alcolicas.27 em nossa anlise.
O estudo atual utiliza, pela primeira vez, o QMPA na verificao Nossos dados no demonstraram correlao dos escores
de sintomas psiquitricos em pacientes com LES. QMPA com atividade de doena medida pelo SLEDAI. De 83

RBR 53(4) - Arquivo livro (Impressa).indb 332 21/10/2013 18:21:24


R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 2 8 3 3 4 333

pacientes chilenos com LES avaliados para morbidade psiqui- nossa amostra de LES), bem como na diferenciao de DMC
trica por meio do DSM-IV e escala de sofrimento psicolgico, com psicoses. Em pacientes com QMPA alterado, diagnsticos
44,6% apresentaram diagnsticos psiquitricos, particular- psiquitricos mais especficos podem potencialmente ser ob-
mente episdios depressivos maiores. semelhana de nosso tidos em um futuro estudo longitudinal.
estudo, no houve correlao entre distrbios psiquitricos e Entretanto, nosso estudo tem limitaes que devem ser
atividade da doena.35 mencionadas, sendo o delineamento transversal a primeira
Trs estudos, que tambm utilizaram outras metodolo- delas. A ausncia de grupo-controle sem LES restringiu a an-
gias que no o QMPA, corroboraram a ausncia de associa- lise estatstica. O baixo nmero de pacientes com psicose no
o entre morbidade psiquitrica e atividade de doena.32,33,36 possibilitou anlise de subgrupos de pacientes com QMPA al-
Esses achados sugerem que o sofrimento psicolgico destes terados. A maioria de nossos pacientes (96%) estava sob uso
pacientes, manifesto principalmente por DMC, poderia ser de corticoides, o que no tornou factvel associar estatistica-
de etiologia multifatorial, incluindo cronicidade da doena, mente sintomas psiquitricos com o uso destes frmacos.
tratamento e variveis socioeconmicas. 32,33,36 Alguns relatos Sabidamente, o uso de corticosteroides est associado a
brasileiros, de fato, demonstraram piora dos sintomas de LES distrbios do sono, cognio e comportamento.46 Estratifica-
em decorrncia de fatores psicolgicos.37-39 De acordo com To- o para dose de corticoide poderia ter sido efetuada em nos-
loza et al., os mtodos atuais de aferio de atividade de do- so estudo, uma vez que a dose est relacionada frequncia
ena e do dano orgnico no LES no so capazes de capturar de sintomas psiquitricos; entretanto, a dosagem no parece
a qualidade de vida relacionada sade destes pacientes.40 estar associada severidade ou durao dos achados psiqui-
De grande interesse, tambm no observamos uma asso- tricos.46 Nossos pacientes com LES no foram subdivididos
ciao de QMPA alterado com histria prvia de psicose e/ou quanto ao uso de psicotrpicos, dada a tambm alta frequ-
convulses, critrios clssicos de LES.2,41 Poderamos ento in- ncia de uso destes frmacos; alm disso, uma grande varie-
ferir que os sintomas psiquitricos correntemente captados dade de psicotrpicos foi utilizada por diferentes pacientes,
pelo QMPA no esto de forma direta relacionados a histrico tornando difcil a estratificao. O fato de termos avaliado
de neurolpus. uma populao especfica de LES de centro tercirio (no geral
A literatura mostra que quanto mais precoce se inicia o com baixo nvel de educao escolar e baixa renda) tambm
LES, mais srios os achados clnicos tendem a ser.42 Embora restringe nossos resultados. Como limitao do QMPA per si,
esperssemos escores mais altos de QMPA em pacientes com o mtodo avaliou sintomas presentes apenas no ltimo ano.
doena precoce, essa correlao no foi encontrada em nosso Em resumo, um QMPA anormal foi altamente frequente
estudo. Considerando-se dados prvios confirmando um efei- em nossos pacientes com LES. O teste pode ser hipersen-
to cumulativo de dano cerebral em pacientes com LES,43 uma svel; de qualquer modo, esses dados trazem discusso a
associao de sintomas psiquitricos com maior durao de necessidade de programas de rastreamentos mais agressivos
doena seria plausvel, mas esta correlao tambm no foi para distrbios psicolgicos em pacientes com LES. Um QMPA
evidente em nossa casustica. anormal no se correlacionou com doena ativa, e a associa-
Uma correlao de morbidade psiquitrica com baixo n- o de teste alterado com baixo nvel educacional requer elu-
vel educacional (inferior ao ensino mdio) foi verificada em cidao. Estudos complementares so necessrios para con-
nosso estudo. Em outras palavras, pacientes com LES e ele- firmar a utilidade do QMPA como instrumento rastreador de
vado nvel educacional foram menos suscetveis a respostas morbidade psiquitrica em pacientes com LES.
afirmativas no QMPA. possvel, tambm, que os indivduos
com menor nvel de educao tenham tido mais dificuldades
REFERNCIAS
em lidar com a extenso e a complexidade do questionrio,
resultando em vis de respostas positivas.
Onze pacientes brasileiros com LES foram recentemente
1. Sato EI, Bonf ED, Costallat LTL, Silva NA, Brenol JCT, Santiago
avaliados quanto funo neuropsicolgica por meio do mi-
MB, et al. Brazilian consensus for treatment of systemic lupus
ni-mental, inventrio neuropsiquitrico e outros testes. Um erythematosus. Braz J Rheumatol. 2002;42(6):362-70.
definido acometimento das funes cognitivas foi documen- 2. American College of Rheumatology. The American College
tado, e estas alteraes tambm se relacionaram a um baixo of Rheumatology nomenclature and cases definitions
nvel de educao. Digno de nota, sintomas de irritabilidade/ for neuropsychiatric lupus syndromes. Arthritis Rheum.
depresso e alucinaes foram particularmente frequentes 1999;42(4):599-608.
nestes indivduos.44 3. Brey RL. Neuropsychiatric lupus - clinical and imaging
aspects. Bull NYU Hosp Jt Dis. 2007;65(3):194-9.
Nossos dados no confirmaram uma correlao de QMPA
4. Mitsikostas DD, Sfikakis PP, Goadsby PJ. A meta-analysis for
alterado com renda familiar destinada ao paciente com LES. headache in systemic lupus erythematosus: the evidence
De acordo com estudo recente, doena crnica, baixo nvel and the myth. Brain. 2004;127(Pt5):1200-9.
educacional e baixo poder aquisitivo predispuseram a de- 5. Cojocaru IM, Cojocaru M, Botnaru L, Miu G, Sapira V, Tanasescu
presso, ansiedade e distrbios somatoformes no LES.45 Estas R. Detection of serum of IgG anti-neuronal antibodies in
discrepncias acerca do papel do poder aquisitivo nos trans- systemic lupus erythematosus patients with central nervous
system manifestations. Rom J Intern Med. 2010;48(3):267-9.
tornos psiquitricos de pacientes lpicos devem ser clareadas
6. Lauvsnes MB, Omdal R. Systemic lupus erythematosus, the
em estudos futuros.
brain, and anti-NR2 antibodies. J Neurol. 2012;259(4):622-9.
Embora desprovido de propriedades diagnsticas, o QMPA, 7. Mikdashi J, Handwerger B. Predictors of neuropsychiatric
com sua ampla estrutura em fatores, pareceu mtodo til no damage in systemic lupus erythematosus: data from the
rastreamento de DMC (que predominaram fortemente em Maryland lupus cohort. Rheumatology. 2004; 43(12):1555-60.

RBR 53(4) - Arquivo livro (Impressa).indb 333 21/10/2013 18:21:24


334 R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 2 8 3 3 4

8. Kiani AN, Petri M. Quality-of-life measurements versus 27. Pinheiro SN, Laprega MR, Furtado EF. Psychiatric morbidity
disease activity in systemic lupus erythematosus. Curr and alcohol use by pregnant women in a public obstetric
Rheumatol Rep. 2010;12(4):250-8. service. Rev Saude Publica. 2005;39(4):593-8.
9. Emori A, Matsushima E, Aihara O, Ohta K, Koike R, Miyasaka 28. Danchenko N, Satia JA, Anthony MS. Epidemiology of
N, Kato M. Cognitive dysfunction in systemic lupus systemic lupus erythematosus: a comparison of worldwide
erythematosus. Psychiatry Clin Neurosci. 2005;59(5):584-9. disease burden. Lupus. 2006;15(5):308-18.
10. Ad Hoc Committee on Lupus Response Criteria: Cognition 29. Chahade WH, Sato E, Moura Jr JE, Costallat LT, Andrade LE.
Sub-committee, Mikdashi JA, Esdaile JM, Alarcn GS, Crofford Systemic lupus erythematosus in Sao Paulo/Brazil: a clinical
L, Fessler BJ, Shanberg L, et al. Proposed response criteria for and laboratory overview. Lupus. 1995;4(2):100-3.
neurocognitive impairment in systemic lupus erythematosus 30. Petri M. Epidemiology of systemic lupus erythematosus. Best
clinical trials. Lupus. 2007;16(6):418-25. Pract Res Clin Rheumatol. 2002;16(5):847-58.
11. Matsukawa Y. Neuropsychiatric lupus (CNS lupus and PNS 31. Almeida-Filho N, Mari JJ, Coutinho E, Frana JF, Fernandes J,
lupus). Nihon Rinsho. 2009; 67(3):531-5. Andreoli SB, et al. Brazilian multicentric study of psychiatric
12. Roebuck-Spencer TM, Yarboro C, Nowak M, Takada K, Jacobs morbidity. Methodological features and prevalence estimates.
G, Lapteva L, et al. Use of computadorized assessment to Br J Psychiatry. 1997;171:524-9.
predict neuropsychological functioning and emotional 32. Purandare KN, Wagle AC, Parker SR. Psychiatric morbidity
distress in patients with systemic lupus erythematosus. in patients with systemic lupus erythematosus. QJM.
Arthritis Rheum. 2006;55(3):434-41. 1999;92(5):283-6.
13. Vu TV, Escalante A. A comparison of the quality of life 33. Appenzeller S, Costallat LTL. Primary manifestations of
of patients with systemic lupus erythematosus with central nervous system in systemic lupus erythematosus.
and without endstage renal disease. J Rheumatol. Braz J Rheumatol. 2003;43(1):20-5.
1999;26(12):2595-601. 34. Jump RL, Robinson ME, Armstrong AE, Barnes EV, Kilbourn
14. Sabbatini F, Borghi F. Psychological study of systemic lupus KM, Richards HB. Fatigue in systemic lupus erythematosus:
erythematosus. Minerva Psichiatr. 1987;28(2):133-6. contributions of disease activity, pain, depression, and
15. De Almeida-Filho N. Internal migration and mental disorders: perceived social support. J Rheumatol. 2005;32(9):1699-705.
new evidence for an old hypothesis. Acta Psiquiatr Psicol Am 35. Jarpa E, Babul M, Caldern J, Gonzlez M, Martnez ME,
Lat. 1982;28(1):21-9. Bravo-Zehnder M, et al. Common mental disorders and
16. Hochberg MC. Updating the American College of psychological distress in systemic lupus erythematosus are
Rheumatology revised criteria for the classification not associated with disease activity. Lupus. 2011;20(1):58-66.
of systemic lupus erythematosus. Arthritis Rheum. 36. Ayache DC, Costa IP. Personality traits and associated
1997;40(9):1725. changes in women with lupus. Braz J Rheumatol.
17. Andreoli SB, Mari JJ, Blay SL, de Almeida-Filho N, Coutinho 2009;49(6):643-57.
E, Frana J, et al. The factor structure of the adult psychiatry 37. Ayache DCG, Costa IP. Changes of personality in systemic
morbidity questionnaire in a community sample of Brazilian lupus erythematosus. Braz J Rheumatol. 2005;45(5):313-8.
cities. Rev Saude Publica. 1994;28(4):249-60. 38. Reis MG, Costa IP. Health-related quality of life in patients
18. Bombardier C, Gladman DD, Urowitz MB, Caron D, Chang DH, with systemic lupus erythematosus of the Brazilian Mid-
and the Committee on Prognosis Studies in SLE. Derivation of West. Braz J Rheumatol. 2010;50(4):408-22.
SLEDAI: a disease activity index for lupus patients. Arthritis 39. Freire EAM, Souto LM, Ciconelli RM. Measures of evaluation
Rheum. 1992;35(6):630-40. in systemic lupus erythematosus. Braz J Rheumatol.
19. De Almeida-Filho N, Santana V de S, de Souza AL, Jacobina RR. 2011;51(1):70-80.
Relation between the parents mental health and the mental 40. Toloza SM, Jolly M, Alarcn GS. Quality-of-life measurements
health of children in an urban population of Salvador-Bahia. in multiethnic patients with systemic lupus erythematosus:
Acta Psiquiatr Psicol Am Lat. 1985;31(3):211-21. cross-cultural issues. Curr Rheumatol Rep. 2010;12(4):237-49.
20. de Sousa Bastos AC, de Almeida-Filho N. Socioeconomic 41. Bertsias GK, Boumpas DT. Pathogenesis, diagnosis and
variables, family milieu, and child mental health in an urban management of neuropsychiatric SLE manifestations. Nat
area of Salvador (Bahia), Brazil. Acta Psiquiatr Psicol Am Lat. Rev Rheumatol. 2010;6(6):358-67.
1990;36(3-4):147-54. 42. Marai I, Levi Y, Shoenfeld Y. Morbidity and mortality in systemic
21. Mari JJ, Almeida-Filho N, Coutinho E, Andreoli SB, Miranda CT, lupus erythematosus. Harefuah. 2001;140(12):1177-80.
Streiner D. The epidemiology of psychotropic use in the city 43. Hanly JG, Urowitz MB, Su L, Bae SC, Gordon C, Wallace DJ,
of So Paulo. Psychol Med. 1993;23(2):467-74. et al. Systemic Lupus International Collaborating Clinics
22. de Miranda CT, Turecki G, Mari J de J, Andreoli SB, Marcolim (SLICC). Prospective analysis of neuropsychiatric events
MA, Goihman S, et al. Mental health of the mothers of in an international disease inception cohort of patients
malnourished children. Int J Epidemiol. 1996;25(1):128-33. with systemic lupus erythematosus. Ann Rheum Dis.
23. Santana VS, Loomis D, Newman B, Harlow SD. Informal jobs: 2010;69(3):529-35.
another occupational hazard for womens mental health? Int 44. De Melo LF, Da-Silva SL. Neuropsychological assessment of
J Epidemiol. 1997;26(6):1236-42. cognitive disorders in patients with fybromialgia, rheumatoid
24. Santana VS, Loomis DP, Newman B. Housework, paid work and arthritis, and systemic lupus erythematosus. Braz J
psychiatric symptoms. Rev Saude Publica. 2001;35(1):16-22. Rheumatol. 2012;52(2):175-8.
25. Sales EC, Santana VS. Depressive and anxiety symptoms 45. Coelho FM, Pinheiro RT, Horta BL, Magalhes PV, Garcias CM,
among housemaids. Am J Ind Med. 2003;44(6):685-91. Silva CV. Common mental disorders and non-communicable
26. Almeida-Filho N, Lessa I, Magalhes L, Arajo MJ, Aquino E, diseases in adults: a population-based study. Cad Saude
James SA, et al. Social inequality and depressive disorders Publica. 2009;25(1):59-67.
in Bahia, Brazil: interactions of gender, ethnicity, and social 46. Warrington TP, Bostwick JM. Psychiatric adverse effects of
class. Soc Sci Med. 2004;59(7):1339-53. corticosteroids. Mayo Clin Proc. 2006;81(10):1361-7.

RBR 53(4) - Arquivo livro (Impressa).indb 334 21/10/2013 18:21:24


R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 3 5 3 4 0

REVISTA BRASILEIRA DE
REUMATOLOGIA
www.reumatologia.com.br

Artigo original

Avaliao de entesopatia em pacientes com fibromialgia por


meio do novo ndice ultrassonogrfico de entesite

Fuat Ozkana,*, Betul Bakanb, Mehmet Fatih Incia, Fatih Kocturkc, Gozde Yildirim Cetind,
Murvet Yuksela, Mehmet Sayarlioglud
a
Departamento de Radiologia, Faculdade de Medicina, Kahramanmaras Sutcu Imam University, Kahramanmaras, Turquia
b
Departamento de Medicina Fsica e Reabilitao, Faculdade de Medicina, Kahramanmaras Sutcu Imam University, Kahramanmaras, Turquia
c
Clnica de Neurologia, Kahramanmaras State Hospital, Kahramanmaras, Turquia
d
Departamento de Radiologia, Faculdade de Medicina, Kahramanmaras Sutcu Imam University, Kahramanmaras, Turquia

informaes resumo

Histrico do artigo: Objetivo: Determinar a frequncia de entesopatia na fibromialgia (FM) utilizando um m-


Recebido em 4 de setembro de 2012 todo de ultrassonografia (US) recm-desenvolvido, o escore Madrid Sonography Enthesitis
Aceito em 17 de fevereiro de 2013 Index (MASEI).
Mtodos: Este estudo foi realizado em 38 pacientes com FM consecutivos e 48 controles
Palavras-chave: saudveis pareados para idade e sexo. Seis stios de nteses (tuberosidade do olcrano, po-
Ultrassom los superior e inferior da patela, tuberosidade tibial, polos superior e inferior do calcneo)
Fibromialgia nos dois membros inferiores foram avaliados. Todos os achados da US foram identifica-
Entesopatia dos de acordo com o escore MASEI. Os escores de pacientes e controles foram compara-
Diagnstico dos usando-se o teste t de Student e o teste U de Mann-Whitney. A validade foi analisada
pela curva receiver operating characteristic (ROC). Valores de P < 0,05 foram considerados
significativos.
Resultados: O escore total de entesite foi 7,39 4,99 (mdia DP) para os pacientes com FM
e 3,7 3,22 para os controles saudveis (P < 0,001). A curva ROC estabeleceu um escore de
US > 3,5 no grupo de FM como o melhor ponto de corte para diferenciar casos de controles.
No houve correlao estatisticamente significativa entre o escore MASEI e a durao da
FM, e a localizao dos pontos dolorosos.
Concluses: Erros no diagnstico de FM so prejudiciais aos pacientes e comunidade, e a
presena de entesopatia entre pacientes com FM crescente. Sua deteco por meio do
escore MASEI pode ser til para discriminar pacientes com FM, cujos sintomas e sinais so
mal definidos, para evitar equvoco de tratamento.
2013 Elsevier Editora Ltda. Todos os direitos reservados.

* Autor para correspondncia.


E-mail: drfozkan@yahoo.com (F. Ozkan).
0482-5004/$ - see front matter. 2013 Elsevier Editora Ltda. Todos os direitos reservados.

RBR 53(4) - Arquivo livro (Impressa).indb 335 21/10/2013 18:21:24


336 R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 3 5 3 4 0

Assessment of enthesopathy in patients with fibromyalgia by using new


sonographic enthesitis index

abstract

Keywords: Objective: The aim of the present study is to determine the frequency of enthesopathy in
Ultrasound fibromyalgia (FM) by using a newly developed ultrasonography (US) method, the Madrid
Fibromyalgia Sonography Enthesitis Index (MASEI).
Enthesopathy Methods: This study was conducted on 38 consecutive patients with FM and 48 healthy
Diagnosis sex- and age-matched controls. Six entheseal sites (olecranon tuberosity, superior and in-
ferior poles of patella, tibial tuberosity, superior and inferior poles of calcaneus) on both
lower limbs were evaluated. All US findings were identified according to MASEI. Scores of
patients and controls were compared by Students t-test and Mann-Whitney U-test. Validity
was analysed by receiver operating characteristic curve. Values of P < 0.05 were considered
significant.
Results: Total enthesitis score was 7.39 4.99 (mean SD) among FM patients and 3.7 3.22
among healthy controls (P < 0.001). The receiver operating characteristic curve established
an ultrasound score of > 3.5 in the FM group as the best cut-off point to differentiate be-
tween cases and controls. No statistically significant correlation was found between the
MASEI score and the FM disease duration, and the location of the tender points.
Conclusions: Misdiagnoses of FM are harmful to patients and the community, and the pres-
ence of enthesopathy among FM patients increases. Its detection with the MASEI score may
help to discriminate FM patients presenting with ill-defined symptoms and signs, in order
to prevent mistreatment.
2013 Elsevier Editora Ltda. All rights reserved.

(Madrid Sonography Enthesitis Index) que, em comparao ao


Introduo GUESS, contm parmetros adicionais que incluem power Do-
ppler (PD) US e exame de membros superiores.9 Um estudo
A fibromialgia (FM) um distrbio enigmtico, em geral, cha- recente avaliou o comprometimento de ntese em pacientes
mado de sndrome, pois os pacientes apresentam dor disse- com FM; no entanto, os resultados da pesquisa no foram
minada e mltiplos sintomas somticos.1,2 Trata-se de uma totalmente satisfatrios.10 Isso pode ter resultado do uso,
das causas mais comuns de consulta ao reumatologista de- naquele estudo, do ndice MASES (Maastricht Ankylosing Spon-
pois da osteoartrite, achando-se associada a substancial mor- dylitis Enthesitis Score), cuja concordncia intraobservador tem
bidade e incapacidade, o que representa um nus econmico sido relatada como moderada em pacientes com espondiloar-
para os sistemas de sade.3 trite, com um coeficiente de correlao intraclasse de 0,56 (IC
O diagnstico de FM pode ser difcil, pois engloba um 95%: 0,34-0,82).11,12
amplo espectro de sintomas, tais como fadiga, cefaleia, sn- O presente estudo teve por objetivo determinar a frequncia
drome do intestino irritvel, distrbios do sono, parestesias, de entesopatia na FM primria por meio do uso do escore MASEI.
fraqueza muscular, disfuno vesical, depresso e ansiedade,
que podem ser confundidos com outras doenas reumticas
e no reumticas.3 Consequentemente, o diagnstico diferen- Materiais e mtodos
cial com vrias outras condies mdicas se faz necessrio.
Por outro lado, o achado de sorologia anormal ou de altera- Este estudo avaliou 38 pacientes com FM primria (idade
es radiogrficas no exclui o diagnstico de FM.3 Esse um mdia, 38,8 9,1 anos; 36 mulheres e 2 homens) e 48 contro-
ponto importante, pois a FM pode acompanhar distrbios les saudveis pareados para sexo e idade (idade mdia, 36,5
reumticos, tais como artrite reumatoide, lpus eritematoso 9,91 anos; 46 mulheres e 2 homens).
sistmico e sndrome de Sjgren,4,5 sendo o atraso no diagns- O diagnstico de FM foi baseado nos critrios de
tico ou mesmo o erro de diagnstico um problema comum e classificao do American College of Rheumatology (ACR) de
subestimado.3 1990.13 Os critrios de excluso foram: pacientes com FM
No campo da ultrassonografia (US), o recente desenvolvi- concomitante a outro diagnstico confirmado; evidncia
mento de transdutores de alta resoluo possibilitou a ava- clnica de artrite; idade < 18 anos; neuropatia perifrica de
liao de entesite de maneira mais precisa do que o exame membros superiores; histria recente de traumatismo grave
clnico. H vrios relatos que descrevem o uso de US para a na ntese investigada; cirurgia de joelho, tornozelo ou coto-
determinao das caractersticas da entesite de membros in- velo; injeo de corticosteroide nas estruturas examinadas.
feriores usando o sistema GUESS (Glasgow Ultrasound Enthe- Os pacientes arrolados neste estudo foram encaminha-
sitis Scoring System).6-8 Recentemente, um novo escore para dos do ambulatrio de reumatologia do nosso hospital uni-
avaliao de ntese por US foi desenvolvido o escore MASEI versitrio. Este estudo foi aprovado pelo comit de tica lo-

RBR 53(4) - Arquivo livro (Impressa).indb 336 21/10/2013 18:21:25


R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 3 5 3 4 0 337

cal do nosso hospital. Alm disso, os pacientes e controles A estatstica descritiva incluiu mdia e desvio padro (DP)
receberam informao sobre o exame a que seriam subme- das variveis contnuas, e percentagens e propores das ca-
tidos e todos assinaram o termo de consentimento livre e tegricas. O teste t de Student foi usado para comparar vari-
informado. O exame fsico incluiu a contagem dos pontos veis contnuas distribudas simetricamente entre os grupos,
dolorosos de acordo com os critrios do ACR, a contagem das sendo o teste de Mann-Whitney usado para as distribuies
articulaes dolorosas e edemaciadas, e o exame da coluna assimtricas. O coeficiente de correlao de Spearman foi
vertebral em busca de dor. Todas as US foram realizadas por usado para a anlise de correlao. A curva receiver operating
um radiologista experiente treinado em US musculoesque- characteristic (ROC) foi usada para calcular os diferentes n-
ltica, que desconhecia os dados clnicos, em cmara escu- veis de valor preditivo positivo (VPP), valor preditivo negativo
ra. As US foram realizadas aps repouso de 20 minutos na (VPN), sensibilidade e especificidade em cada ponto de corte
sala de avaliao de US, pois estudos j mostraram que uma usando o escore MASEI total. Adotou-se o nvel de significn-
simples caminhada aumenta significativamente o escore de cia estatstica P < 0,05.
ntese avaliado com US em indivduos saudveis.14
As US foram realizadas com o aparelho Aplio XG (Toshi-
ba Medical Systems, Co, Ltd, Ottowara, Japo) equipado com
um transdutor linear PLT-1204AX de 5-12 MHz. As anorma- TT O
lidades foram quantificadas por meio do escore MASEI,9 que
explora de maneira sistemtica seis nteses bilateralmente
(i.e., fscia plantar proximal, tendo de Aquiles distal, liga-
mento patelar distal e proximal, quadrceps distal e tendo
de trceps braquial) em cada paciente. Todas as US para a
aplicao do escore MASEI foram realizadas usando-se uma
tcnica padro j descrita anteriormente.15,16 O exame ul-
Figura 2 Ultrassonografia de mulher de 39 anos com
trassonogrfico avaliou as seguintes leses elementares de
calcificao da ntese do tendo do trceps. Plano
ntese: espessura; estrutura; calcificaes; bursas; eroses;
longitudinal do tendo do trceps (TT) mostrando
e sinal de PD US na bursa ou em toda a extenso do tendo
calcificao (setas).
(perfil sseo cortical, intratendo e paratendo na insero
O, olcrano.
da ntese) (figs. 1-4).9 Eroso ssea foi definida como inter-
rupo cortical com um defeito no contorno no devido a
ruptura traumtica do tendo (figs. 1 e 4). Para evitar ani-
sotropia de fibra acstica, foi feito um esforo para garantir TA
que os planos avaliados no exame de US fossem paralelos s
fibras do tendo. O fluxo sanguneo foi examinado em cada
ntese usando-se PD, cujos parmetros foram estabelecidos
C
com uma frequncia de repetio de pulso de 750 Hz e um
filtro de parede baixo (fig. 3). O ganho de cor foi ajustado para
logo abaixo do nvel da manifestao de artefatos.
Os escores MASEI foram tambm correlacionados sepa-
radamente com a durao da FM, usando-se o coeficiente de
Figura 3 Ultrassonografia de mulher de 29 anos com sinal
correlao de Spearman.
de Doppler anormal na ntese do tendo de Aquiles. Plano
Os escores MASEI totais e a durao da FM foram compa-
longitudinal do tendo de Aquiles (TA) mostrando sinal de
rados entre os diferentes subgrupos de pacientes com FM de
Doppler anormal (seta) na ntese.
acordo com a localizao de alguns pontos dolorosos, inclu-
C, calcneo
sive no cotovelo e joelho.

TA
C PA
C
C

a b

Figura 1 Ultrassonografia de mulher de 35 anos de idade Figura 4 Ultrassonografia de mulher de 34 anos com
com eroso na ntese do tendo de Aquiles. (a) Plano eroso da ntese da aponeurose plantar. Plano longitudinal
longitudinal do tendo de Aquiles (TA) mostrando eroso da fscia plantar (PA) mostrando uma eroso (seta) na
(seta) na ntese; (b) plano transversal mostrando eroso (seta). ntese.
C, calcneo. C, calcneo.

RBR 53(4) - Arquivo livro (Impressa).indb 337 21/10/2013 18:21:25


338 R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 3 5 3 4 0

com comprometimento de joelho vs. pacientes sem, no grupo


Resultados de pacientes com FM todos os valores de P > 0,05).
Nossos escores foram mais baixos quando comparados
A tabela 1 mostra as caractersticas demogrficas e a mdia aos de espondiloartropatias, uma vez que a FM apresenta me-
DP do escore MASEI para os grupos de pacientes com FM e nor frequncia de entesopatia. Decidimos, ento, restabelecer
controle. Tais mdias diferiram estatisticamente, sendo 7,39 o ponto de corte para diferenciar entre casos e controles. A
4,99 (variao, 1-23) e 3,7 3,22 (variao, 0-15), respectivamen- curva ROC foi realizada usando o escore MASEI geral. A rea
te para os grupos de pacientes com FM e controle (P < 0,001). sob a curva ROC foi 0,75 (IC 95%: 0,648-0,852; P < 0,001). Quan-
H vrias tipos de leses elementares em cada stio de n- do se utilizou o ponto de corte 3,5, sensibilidade, especifici-
tese. As leses elementares mais comumente detectadas em dade, VPP e VPN foram 74%, 58%, 58% e 73%, respectivamente.
cada stio de ntese foram: calcificao da ntese do olcrano Tal ponto de corte foi excedido por 74% dos pacientes com FM
(34%) no tendo do trceps; espessura do tendo do quadrceps e 41% dos indivduos do grupo controle.
> 6,1 mm (29%) na ntese do tendo do quadrceps; espessura As espessuras dos tendes foram comparadas e seus va-
do ligamento patelar > 4 mm na ntese do ligamento patelar lores mdios no apresentaram diferena significativa entre
proximal (8%) e distal (17%); calcificao da ntese do polo pacientes com FM e controles (todos os valores de P > 0,05).
posterior do calcneo (54%) na ntese do tendo de Aquiles; e
calcificao da ntese na eroso do polo inferior do calcneo
(11%) na ntese da aponeurose plantar. A tabela 2 mostra as Discusso
leses elementares bilaterais/unilaterais mais comumente
detectadas em cada stio. No geral, um total de 456 stios de O principal achado deste estudo foi uma frequncia de enteso-
ntese em 38 pacientes com FM foram examinados por meio patia significativamente maior em pacientes com FM, quando
de US. Todos os pacientes com FM tinham pelo menos uma comparados aos controles, a despeito dos pontos dolorosos en-
leso. Os maiores nmeros de leses elementares nos stios volvidos. Alm disso, no houve diferena entre os pacientes
de ntese foram: calcificao (106/456, 23%); espessamento com relao aos escores MASEI e a durao da doena.
(46/456, 10%); eroso (20/456, 4%); bursite (3/456, 0,6%) e sinal A entesite foi considerada a leso primria da espondi-
de PD US (1/456, 0,2%). loartropatia.9 Como as radiografias e o exame fsico no so
A tabela 3 mostra o escore MASEI em cada ntese afetada. suficientemente sensveis para detectar os sinais precoces
Os pacientes com FM apresentaram mdias DP dos escores
significativamente maiores do que os controles ao se com-
parar todos os stios de nteses exceto a ntese do tendo Tabela 2 Comprometimento bilateral ou unilateral das
patelar proximal e a ntese da aponeurose plantar (todos os leses elementares mais comumente detectadas em
valores de P < 0,05). Os escores MASEI da ntese do tendo cada stio de ntese
patelar proximal e da ntese da aponeurose plantar no dife- ntese comprometida Bilateral Unilateral
riram estatisticamente entre os pacientes com FM e os con- (n) (n)
troles (P > 0,05).
Calcificao do tendo do trceps 5 10
A durao mdia da doena foi de 5,6 4,67 anos. No Espessamento do tendo do 8
houve correlao estatisticamente significativa entre o escore quadrceps
MASEI e a durao da FM (r = 0,197; P > 0,05). Espessamento do ligamento patelar 2 4
As localizaes de alguns pontos dolorosos, incluindo co- (ntese do ligamento patelar
tovelo e joelho, foram analisadas em termos de comprome- proximal)
Espessamento do ligamento patelar 5 4
timento de ntese. Os escores MASEI totais e a durao da
(ntese do ligamento patelar
FM foram comparados entre diferentes subgrupos de pacien- distal)
tes com FM de acordo com as localizaes de alguns pontos Calcificao do tendo de Aquiles 16 7
dolorosos, incluindo cotovelo e joelho. No houve diferena Calcificao da fscia plantar 2 2
estatstica entre escores MASEI e durao da FM nos diferen- n, nmero de pacientes.
tes subgrupos de pacientes com FM de acordo com o compro-
metimento desses pontos dolorosos (por exemplo, pacientes

Tabela 3 Escore Madrid Sonography Enthesitis Index


(MASEI) de ntese comprometida.a
Tabela 1 Dados demogrficos e resultados do escore
ntese comprometida Grupo FM Grupo P
Madrid Sonography Enthesitis Index (MASEI)
controle
Grupo FM Grupo controle
Tendo do trceps 0,71 0,89 0,27 0,67 0,003
Indivduos (n) 38 48 Tendo do quadrceps 2,02 2,56 0,56 1,0 0,002
Mulher/homem (n) 36/2 46/2 Tendo patelar proximal 0,15 0,36 0,33 0,63 0,18
Idade, anos (mdia DP) 38,8 9,1 36,5 9,91 Tendo patelar distal 1,18 1,52 0,43 0,76 0,014
Faixa de idade, anos 20-57 20-60 Tendo de Aquiles 2,65 2,08 1,43 1,97 0,007
Escore MASEI (mdia DP) 7,39 4,99a 3,7 3,22 Fscia plantar 0,63 0,99 0,66 1,27 0,89
DP, desvio padro; FM, fibromialgia. FM, fibromialgia.
a
P < 0,001 vs. Controles. a
Valores expressos como mdia DP.

RBR 53(4) - Arquivo livro (Impressa).indb 338 21/10/2013 18:21:25


R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 3 5 3 4 0 339

do comprometimento da ntese,6,17 a US de alta resoluo em pacientes com FM. Tal achado conflita com os dados de
amplamente usada como tcnica de imagem para diagnos- estudo recente,10 no qual o sinal do PD foi detectado em sete
ticar entesopatia.18 A sensibilidade da US de alta resoluo (23,3%) pacientes com FM. Uma possvel explicao a de que
para detectar entesite j est bem estabelecida em pacientes no h na literatura consenso sobre os parmetros timos do
com espondiloartropatia.9,19,20 H apenas um estudo sobre o Doppler para entesite.23 Os diferentes tipos de equipamento
envolvimento de ntese em pacientes com FM na literatura.10 de US usados podem tambm explicar parte das diferenas
Os autores investigaram a utilidade da PD US para discrimi- observadas, pois no h informao sobre a confiabilidade
nar entre polientesite psoritica e FM usando as definies de inter-equipamento para avaliao de entesite.23
entesopatia do estudo OMERACT (Outcome Measures in Rheu- A FM uma sndrome clnica especfica e bem conhecida.
matology Clinical Trials).21 Os pacientes com FM primria e pso- Entretanto, seu diagnstico diferencial com espondiloartropa-
rase ou FM associada com artrite psoritica e aqueles com tia, doena do tecido conjuntivo e artrite inflamatria ainda
polientesite psoritica podem apresentar quase que as mes- representa um desafio para os clnicos gerais. Alguns de seus
mas caractersticas clnicas, correndo o risco de serem mal sintomas, como dor lombar, so comuns a outras doenas, po-
diagnosticados e tratados de modo equivocado.1 dendo causar confuso, em especial por no haver achado labo-
Os autores tambm relataram que a avaliao das nteses ratorial ou de imagem que seja considerado caracterstico para
perifricas com PD US distingue pacientes com artrite psori- o diagnstico.3 Assim, os novos critrios diagnsticos de 2010
tica de pacientes com FM em termos do nmero e distribui- foram propostos, incluindo problemas cognitivos e sintomas
o dos stios envolvidos.10 Em seu estudo, o envolvimento da somticos que no haviam sido nem mesmo considerados nos
insero da fscia plantar s foi observado em um paciente. critrios do ACR de 1990.3,24 Entretanto, exceto pela contagem
Embora em nosso estudo o comprometimento daquele ten- de pontos dolorosos, esses critrios no so constantemente
do tenha sido visto em dez pacientes com FM, tal diferena adotados pelos mdicos de cuidados bsicos, e nem mesmo
no alcanou significado estatstico (Tabela 2). De maneira se- por reumatologistas.3 A contagem de pontos dolorosos pareceu
melhante, em termos de envolvimento de ntese do tendo til para diagnosticar FM, mas sabe-se que ela nem sempre
patelar proximal, a diferena entre os grupos no foi estatis- muito precisa. Os novos critrios de diagnstico e investigao
ticamente significativa, sendo tal achado consistente com os do comprometimento subclnico de nteses com o sistema de
do nosso estudo.10 Entretanto, aqueles autores relataram que escore MASEI podem auxiliar no diagnstico de FM.
nunca encontraram eroses sseas nos stios de nteses em A despeito da ocorrncia de dor por todo o corpo, no h
pacientes com FM, embora, no nosso estudo, elas estivessem sinais bvios de leso tissular em pacientes com FM. Estudos
presentes em 4% dos stios de nteses dos pacientes com FM. mostraram que pacientes com sndromes dolorosas crni-
Por outro lado, o aspecto hipoecoico do tendo como um com- cas (FM, osteoartrite), aps a injeo intramuscular de solu-
ponente de alteraes estruturais no sistema de escore MASEI o salina hipertnica, apresentam disseminao da sensa-
nunca foi identificado em nossos pacientes com FM, embora o de dor para muito mais reas corporais do que controles
relatado em 7% naquele estudo.10 Tais diferenas entre os dois saudveis, o que bastante sugestivo de hipersensibilidade
estudos podem estar associadas com a avaliao da ntese, central.25,26 Por outro lado, a entesite historicamente foi con-
que influenciada pela posio do paciente e pelas tcnicas de siderada um distrbio de stio de ligao focal; entretanto, as
imagem. Como previamente mencionado, realizou-se esforo nteses e os tecidos adjacentes podem formar mini rgos,
para garantir que os planos do exame de US fossem paralelos chamados de rgos-ntese.27 Tal conceito de rgo-ntese
s fibras do tendo para evitar o aparecimento de estruturas claramente relevante para a compreenso das tendinopa-
teciduais dependentes do ngulo (anisotropia). Se tal regra no tias insercionais de Aquiles.27 Estudos mostraram que as fibras
considerada, o tendo pode se tornar hipoecoico nos ngulos nervosas do coxim adiposo de Kager, uma parte integrante do
maiores, sendo erroneamente interpretado como patolgico.22 rgo-ntese do tendo de Aquiles, acham-se em clara as-
No nosso estudo, os escores MASEI no apresentaram uma sociao com mastcitos. A interao neuralmastcito pode
distribuio homognea nas seis nteses examinadas (Tabela levar liberao de componentes de mastcitos que podem
2), sendo mais frequentemente maiores na ntese do tendo modular a dor.28 Talvez tais mecanismos de dor possam expli-
de Aquiles nos dois grupos, e relativamente mais baixos nas car o envolvimento do rgo-ntese em pacientes com FM.
nteses do tendo patelar proximal e da aponeurose plantar. Os escores MASEI variam de 0 a 136, um valor 18 tendo
Tais achados foram consistentes com dados de estudo recen- sido estabelecido como o melhor ponto de corte para diferen-
te,10 podendo estar associados com fatores mecnicos anat- ciar entre casos e controles saudveis (sensibilidade de 83,3%
micos locais da interface p-solo. possvel que a existncia e especificidade de 82.8%) na literatura.9 Entretanto, nossos
de uma camada mais grossa de pele e tecido subcutneo re- escores foram mais baixos quando comparados aos de espon-
cobrindo a aponeurose plantar desempenhe importante pa- diloartropatia, devido menor frequncia de entesopatia em
pel na reduo da sensibilidade do US.16 Escores mais altos na pacientes com FM. Portanto, decidimos reestabelecer o ponto
ntese do tendo de Aquiles nos dois grupos podem resultar de corte para diferenciar casos de controles. Embora a curva
da maior frequncia de calcificaes no tendo. A leso ele- ROC tenha estabelecido um escore US 3,5 no grupo de FM
mentar mais comumente detectada na ntese do tendo de como o melhor ponto de corte, a especificidade mais baixa
Aquiles a calcificao, achado bastante comum em indiv- (58%) desse ponto pode ser questionada. No est claro por-
duos assintomticos. que os valores obtidos neste estudo so to baixos e porque
H evidncia de que o PD melhore significativamente a diferem tanto daqueles vistos normalmente em outros rela-
preciso do US na avaliao da entesite.8 No presente estudo, tos. Um estudo maior usando tal ponto de corte deve ser rea-
uma frequncia mais baixa do sinal do PD (3%) foi identificada lizado para valid-lo.

RBR 53(4) - Arquivo livro (Impressa).indb 339 21/10/2013 18:21:25


340 R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 3 5 3 4 0

Alm do nmero relativamente pequeno de pacientes, peripheral joints, enthesitis, and dactylitis. J Rheumatol.
nosso estudo tem outras limitaes. Os grupos foram pare- 2007;34(8):1740-5.
ados quanto a ndice de massa corporal, um fator que pode 12. Ozkan F, Inci M, Ozyurt K, Bakan B. Psoriatic arthritis and
sonographic entheseal index. J Rheumatol. 2012. [In Press]
influenciar o escore de ntese. Assim, no detectamos dife-
doi:10.3899/jrheum.120634.
renas claras entre os casos e controles quanto ao ndice de 13. Wolfe F, Smythe HA, Yunus MB, Bennett RM, Bombardier C,
massa corporal. Goldenberg DL, et al. The American College of Rheumatology
Concluindo, este o primeiro estudo a mostrar entesopa- 1990 Criteria for the Classification of Fibromyalgia. Report
tia significativa em pacientes com FM. Erros no diagnstico of the Multicenter Criteria Committee. Arthritis Rheum.
de FM so prejudiciais aos pacientes e comunidade, e a pre- 1990;33(2):160-72.
14. Meric JC, Grandgeorge Y, Lotito G, Pham T. Walking before
sena de entesopatia entre pacientes com FM crescente. Sua
an ultrasound assessment increases the enthesis score
deteco por meio do escore MASEI pode ser til para dis-
significantly. J Rheumatol. 2011;38(5):961.
criminar pacientes com FM, cujos sintomas e sinais so mal 15. Ozkan F, Cetin GY, Bakan B, Kalender AM, Yuksel M, Ekerbicer
definidos, para evitar equvoco de tratamento. HC, et al. Sonographic Evaluation of Subclinical Entheseal
Involvement in Patients with Behets Disease. AJR. 2012. [In
Press] doi: 10.2214/AJR.12.8576.
Conflitos de interesse 16. Ozkan F, Cetin GY, Inci MF, Bakan B, Yuksel M, Ekerbicer
HC, et al. Increased Enthesopathy in Patients with Familial
Mediterranean Fever: Evaluating with New Sonographic
Os autores declaram no haver conflitos de interesse.
Enthesitis Index. J Ultrasound Med. [In press].
17. Bicer A. Musculoskeletal Findings in Behcets Disease. Pathology
REFERNCIAS research international. 2012;2012:653806.
18. Falsetti P, Acciai C, Lenzi L, Frediani B. Ultrasound of
enthesopathy in rheumatic diseases. Mod Rheumatol.
1. Marchesoni A, Atzeni F, Spadaro A, Lubrano E, Provenzano 2009;19(2):103-13.
G, Cauli A, et al. Identification of the clinical features 19. De Miguel E, Munoz-Fernandez S, Castillo C, Cobo-Ibanez T,
distinguishing psoriatic arthritis and fibromyalgia. J Martin-Mola E. Diagnostic accuracy of enthesis ultrasound
Rheumatol. 2012;39(4):849-55. in the diagnosis of early spondyloarthritis. Ann Rheum Dis.
2. Bliddal H, Danneskiold-Samsoe B. Chronic widespread pain 2011;70(3):434-9.
in the spectrum of rheumatological diseases. Best Pract Res 20. De Miguel E, Cobo T, Munoz-Fernandez S, Falcao S, Steinerova
Clin Rheumatol. 2007;21(3):391-402. M, Martin-Mola E. Value of ultrasound exploration of entesis
3. Di Franco M, Iannuccelli C, Bazzichi L, Atzeni F, Consensi A, in the diagnostic classification of the spondyloartrhopathies.
Salaffi F, et al. Misdiagnosis in fibromyalgia: a multicentre Development of Madrid sonography enthesitis index (MASEI).
study. Clin Exp Rheumatol. 2011;29(6Suppl 69):S104-8. Ann Rheum Dis. 2007;66:394.
4. Almodovar R, Carmona L, Zarco P, Collantes E, Gonzalez C, 21. Wakefield RJ, Balint PV, Szkudlarek M, Filippucci E, Backhaus
Mulero J, et al. Fibromyalgia in patients with ankylosing M, DAgostino MA, et al. Musculoskeletal ultrasound including
spondylitis: prevalence and utility of the measures of activity, definitions for ultrasonographic pathology. J Rheumatol.
function and radiological damage. Clin Exp Rheumatol. 2010; 2005;32(12):2485-7.
28(6Suppl 63):S33-9. 22. Rutten MJ, Jager GJ, Blickman JG. From the RSNA refresher
5. Azevedo VF, Paiva Edos S, Felippe LR, Moreira RA. Occurrence courses: US of the rotator cuff: pitfalls, limitations, and artifacts.
of fibromyalgia in patients with ankylosing spondylitis. Rev Radiographics. 2006;26(2):589-604.
Bras Reumatol. 2010;50(6):646-50. 23. Gandjbakhch F, Terslev L, Joshua F, Wakefield RJ, Naredo E,
6. Hatemi G, Fresko I, Tascilar K, Yazici H. Increased DAgostino MA, et al. Ultrasound in the evaluation of enthesitis:
enthesopathy among Behcets syndrome patients with acne status and perspectives. Arthritis Res Ther. 2011;13(6):R188.
and arthritis: an ultrasonography study. Arthritis Rheum. 24. Wolfe F, Clauw DJ, Fitzcharles MA, Goldenberg DL, Katz
2008;58(5):1539-45. RS, Mease P, et al. The American College of Rheumatology
7. Kerimoglu U, Hayran M, Ergen FB, Kirkpantur A, Turgan preliminary diagnostic criteria for fibromyalgia and
C. Sonographic evaluation of entheseal sites of the lower measurement of symptom severity. Arthritis Care Res.
extremity in patients undergoing hemodialysis. J Clin 2010;62(5):600-10.
Ultrasound. 2007;35(8):417-23. 25. Srensen J, Graven-Nielsen T, Henriksson KG, Bengtsson
8. Gutierrez M, Filippucci E, De Angelis R, Salaffi F, Filosa G, M, Arendt-Nielsen L. Hyperexcitability in fibromyalgia. J
Ruta S, et al. Subclinical entheseal involvement in patients Rheumatol. 1998;25(1):152-5.
with psoriasis: an ultrasound study. Semin Arthritis Rheum. 26. Curatolo M, Arendt-Nielsen L, Petersen-Felix S. Central
2011;40(5):407-12. hypersensitivity in chronic pain: mechanisms and clinical
9. de Miguel E, Cobo T, Munoz-Fernandez S, Naredo E, Uson J, implications. Phys Med Rehabil Clin N Am. 2006;17(2):287-302.
Acebes JC, et al. Validity of enthesis ultrasound assessment in 27. Benjamin M, Moriggl B, Brenner E, Emery P, McGonagle D,
spondyloarthropathy. Ann Rheum Dis. 2009;68(2):169-74. Redman S. The enthesis organ concept: why enthesopathies
10. Marchesoni A, O DEL, Rotunno L, G DEM, Manara M. Entheseal may not present as focal insertional disorders. Arthritis Rheum.
power Doppler ultrasonography: a comparison of psoriatic 2004;50(10):3306-13.
arthritis and fibromyalgia. J Rheumatol Suppl. 2012;89:29-31. 28. Benjamin M, Toumi H, Ralphs JR, Bydder G, Best TM, Milz S.
11. Gladman DD, Inman RD, Cook RJ, Maksymowych WP, Braun J, Where tendons and ligaments meet bone: attachment sites
Davis JC, et al. International spondyloarthritis interobserver (entheses) in relation to exercise and/or mechanical load. J
reliability exercise the INSPIRE study: II. Assessment of Anat. 2006;208(4):471-90.

RBR 53(4) - Arquivo livro (Impressa).indb 340 21/10/2013 18:21:25


R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 4 1 3 4 5

REVISTA BRASILEIRA DE
REUMATOLOGIA
www.reumatologia.com.br

Artigo original

Associao entre o polimorfismo rs7700944 no gene TIM-4 e


artrite reumatoide em Zahedan, sudeste do Ir

Zahra Zakeria, Mohammad Hashemib,c,*, Seyed Mohammad Ebrahim Pourhosseinia,


Ebrahim Eskandari-Nasabc, Gholamreza Baharic, Mohsen Taherid
a
Departamento de Medicina Interna, Faculdade de Medicina, Zahedan University of Medical Sciences, Zahedan, Ir
b
Centro de Pesquisa Celular e Molecular, Zahedan University of Medical Sciences, Zahedan, Ir
c
Departamento de Bioqumica Clnica, Faculdade de Medicina, Zahedan University of Medical Sciences, Zahedan, Ir
d
Centro de Pesquisa de Doenas Genticas No Comunicveis, Zahedan University of Medical Sciences, Zahedan, Ir

informaes resumo

Histrico do artigo: Introduo: Recentemente, relatou-se uma associao entre artrite reumatoide (AR) e a variante
Recebido em 11 de setembro de 2012 rs7700944 G>A nos domnios imunoglobulina e mucina de clulas T (TIM-4).
Aceito em 17 de fevereiro de 2013 Objetivo: Investigar o impacto desse polimorfismo na suscetibilidade a AR em uma amostra da
populao iraniana.
Palavras-chave: Pacientes e mtodos: Este estudo caso-controle foi conduzido em 120 pacientes com AR e 120
Artrite reumatoide indivduos saudveis. O polimorfismo rs7700944 do gene TIM-4 foi determinado usando-se o
TIM-4 ensaio tetra amplification refractory mutation system-polymerase chain reaction (T-ARMS-PCR).
Polimorfismo Resultados: No se observou diferena significativa quanto ao polimorfismo rs7700944 do gene
TIM-4 entre os pacientes com AR e os indivduos saudveis. Nas mulheres, no houve associa-
o significativa quanto ao polimorfismo rs7700944 do gene TIM-4 nos dois grupos. Nos ho-
mens, o gentipo GA+AA, em comparao ao GG, aumentou o risco para AR (OR = 5,15; IC 95%
= 1,30-20,48; P = 0,020). Alm disso, os resultados mostraram que o alelo rs7700944 A aumentou
o risco para AR (OR = 4,39; IC 95% = 1,43-13,54; P = 0,009).
Concluso: Nossos resultados no confirmam a existncia de associao entre AR e o polimor-
fismo rs7700944 do gene TIM-4. Uma interao entre esse polimorfismo e sexo sugere uma as-
sociao sexo-especfica entre AR e esse polimorfismo de nucleotdeo nico, que ainda requer
elucidao.
2013 Elsevier Editora Ltda. Todos os direitos reservados.

Association between the rs7700944 polymorphism in the TIM-4 gene


and rheumatoid arthritis in Zahedan, southeast Iran

abstract

Keywords: Introduction: Recently, an association between rheumatoid arthritis (RA) and the rs7700944
Vasculitis G>A variant in the T-cell immunoglobulin and mucin domains 4 (TIM-4) has been reported.
Adolescent Objective: The present study aimed at investigating the impact of that polymorphism on
Cutaneous lupus erythematosus susceptibility to RA in a sample of the Iranian population.
Patients and methods: This case-control study was conducted on 120 patients with RA and

* Autor para correspondncia.


E-mail: mhd.hashemi@gmail.com; hashemim@zaums.ac.ir (M. Hashemi).
0482-5004/$ - see front matter. 2013 Elsevier Editora Ltda. Todos os direitos reservados.

RBR 53(4) - Arquivo livro (Impressa).indb 341 21/10/2013 18:21:25


342 R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 4 1 3 4 5

120 healthy subjects. The rs7700944 polymorphism in the TIM-4 gene was determined us-
ing tetra amplification refractory mutation system-polymerase chain reaction (T-ARMS-
PCR) assay.
Results: No significant difference was observed regarding the rs7700944 polymorphism of
the TIM-4 gene between patients with RA and normal individuals. In females, no significant
association was found between the groups concerning the rs7700944 polymorphism of the
TIM-4 gene. In males, the GA+AA genotype increased the risk of RA in comparison with the
GG genotype (OR = 5.15, 95% CI = 1.30-20.48, P = 0.020). Furthermore the results showed that
the rs7700944 A allele increased the risk of RA (OR = 4.39, 95% CI = 1.43-13.54, P = 0.009).
Conclusion: Our results do not support an association between the rs7700944 polymorphism
of the TIM-4 gene and RA. An interaction between this polymorphism and sex suggests a
sex-specific association between this single nucleotide polymorphism and RA, which re-
mains to be fully elucidated.
2013 Elsevier Editora Ltda. All rights reserved.

Introduo Material e mtodos

A artrite reumatoide (AR) uma doena inflamatria crnica Pacientes


que resulta em leso grave da cartilagem e destruio ssea
nas articulaes sinoviais. Embora sua etiologia ainda seja Analisamos a possvel associao entre o polimorfismo
desconhecida, considera-se que a AR sofra influncia de uma rs7700944 do gene TIM-4 e a suscetibilidade para AR em 120
combinao de fatores genticos e ambientais.1,2 Estima-se pacientes (104 mulheres e 16 homens) com idade mdia de
que a AR afete cerca de 1% da populao adulta do mundo, e 44,8 12,8 anos, que atendessem aos critrios do American
que fatores genticos representem 60% do risco da doena.3 College of Rheumatology (ACR) para diagnstico de AR.16 Todos
A famlia dos genes portadores dos domnios mucina e os participantes eram pacientes da Clnica de Reumatologia
imunoglobulina de clulas T (T-cell immunoglobulin domain and da Universidade de Cincias Mdicas de Zahedan.2,17,18 O gru-
mucin domain TIM) consiste de trs genes localizados no cro- po controle consistiu de 120 indivduos saudveis (85 mulhe-
mossomo 5q23. Trs dos membros da famlia (TIM-1, TIM-3 e res e 35 homens) com idade mdia de 44,9 12,4 anos e que
TIM-4) so conservados no camundongo e no homem, e codi- no tivessem familiares com AR. O comit de tica da Uni-
ficam glicoprotenas de clulas superficiais com motifs estru- versidade de Cincias Mdicas de Zahedan aprovou o projeto.
turais comuns. Os genes da famlia TIM codificam protenas Todos os pacientes e participantes saudveis assinaram o ter-
que so expressas por clulas T e contm um domnio IgV- mo de consentimento livre e informado. Amostras de sangue
-like e um mucin-like e mostraram-se capazes de regular a foram colhidas dos pacientes e controles saudveis em tubos
imunidade adaptativa.4,5 Na-EDTA. O DNA genmico foi extrado de amostras de san-
O gene TIM-4 foi identificado como um ligante natural para gue perifrico colhido em tubos contendo EDTA, como descri-
TIM-1, e a interao de TIM-1 e TIM-4 estimula a proliferao e to em publicao anterior.18
a ativao de clulas T.6 O gene TIM-4 um receptor fosfatidil- As sequncias genmicas do TIM-4 (NT_023133.13) foram
serina (PS) expresso em clulas maduras de apresentao de obtidas do National Center for Biotechnology Information (NCBI,
antgeno, que aumenta a atividade fagoctica de clulas apop- http://www.ncbi.nlm.nih.gov). Procuramos os polimorfismos
tticas por macrfagos para manter a homeostase.7 O gene e desenhamos os primers para o ensaio tetra amplification re-
TIM-4 desempenha papel essencial no controle da imunidade fractory mutation system-polymerase chain reaction (T-ARMS-
adaptativa atravs da regulao do clearance de clulas antge- -PCR), que um mtodo simples e rpido para detectar
no-especficas.8 No camundongo, a falta do TIM-4 dificulta o polimorfismo de nucleotdeo nico (SNP, sigla em ingls)19
clearance de corpos apoptticos in vivo, levando a desregulao (tabela 1). A figura 1 mostra a representao esquemtica.
da ativao linfoctica e sinais de autoimunidade sistmica,9 A reao em cadeia da polimerase (PCR) foi realizada com
indicando que o gene TIM-4 possa estar associado susceti- a utilizao de premix PCR comercialmente disponvel (Ac-
bilidade a doenas alrgicas e autoimunes. Os polimorfismos cuPower PCR PreMix; BIONEER, Daejeon, Coreia) segundo as
dos genes TIM-1 e TIM-3 mostraram-se associados com sus- instrues do fabricante. Resumidamente, 1 L de template
cetibilidade a AR.10-14 de DNA (~100 ng/L), 1 L de cada primer (10 pmol/L) e 15
H alguns dados sobre a associao dos polimorfismos do L de gua sem DNase foram adicionados ao AccuPower PCR
gene TIM-4 e o risco para AR. Recentemente, Xu et al.15 encon- PreMix.
traram uma associao entre a suscetibilidade para AR e o po- Realizou-se a amplificao com um estgio de desnatura-
limorfismo rs7700944 do gene TIM-4 em populaes chinesas o inicial a 95 C por 5 minutos, seguido por 30 ciclos de 30
de etnias Han e Hui. Assim, este estudo teve por objetivo ava- segundos a 95 C, 22 segundos a 62 C, e 25 segundos a 72 C,
liar o impacto do polimorfismo rs7700944 do gene TIM-4 na com etapa final a 72 C por 10 minutos. Os produtos da PCR
suscetibilidade a AR em uma amostra da populao iraniana. foram verificados em gel agarose 2,0% contendo 0,5 g/mL de

RBR 53(4) - Arquivo livro (Impressa).indb 342 21/10/2013 18:21:26


R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 4 1 3 4 5 343

Tabela 1 As sequncias de primers utilizadas para a deteco do polimorfismo rs7700944 do gene TIM-4 por meio do
ensaio T-ARMS-PCR
Primers Sequncia (5 a 3) Tamanho dos amplicons
FO TCTGGTGTCTTCCTGTCTAGCTCCTTAG 364 bp
RO TTGTGAGCAATTGTCTGAATCTATGAGG
FI (alelo G) CTAATGAGGCAAGACAATAAAGTGTGTCAG 168 bp
RI (alelo A) TCTCTTTGGTGCTTGAACCTGAGATT 252 bp

FO, forward outer; RO, reverse outer; FI, forward inner; RI, reverse inner.

FO
O
Resultados
FI / RI
G/A
G//A
No houve diferena significativa entre os grupos com relao
RO
Control band;; 364 bp
p idade (P = 0,815), mas houve com relao ao sexo (P < 0,05).
A tabela 2 mostra o gentipo e as frequncias allicas do
A allele;; 252 bp
p
polimorfismo rs7700944 em pacientes com AR e em controles.
G allele;; 168 bp
p Os grupos no diferiram significativamente quanto ao poli-
morfismo rs7700944 do gene TIM-4 (2 = 2,253; P = 0,324). Esse
Figura 1 Representao esquemtica do ensaio de polimorfismo no se associou a suscetibilidade a AR nem a
reao em cadeia da polimerase (T-ARMS-PCR) para proteo contra AR em modelos testados de herana codomi-
deteco do polimorfismo rs7700944 do gene TIM-4. nante (OR = 1,17; IC 95% = 0,68-2,01; P = 0,557, GA vs. GG; e OR
Dois primers forward e dois reverse foram usados para = 3,07; IC 95% = 0,55-17,02; P = 0,200; AA vs. GG), dominante
gerar trs potenciais produtos de PCR. Os primers FO e (OR = 1,25, IC 95% = 0,74-2,13; P = 0,410; GA+AA vs. GG) e reces-
os RO forneceram um produto de 364 bp (faixa controle). siva (OR = 2,90; IC 95% = 0,53-15,98; P = 0,221; AA vs. GG+GA)
Os primers FO e os RI amplificaram o alelo A, gerando (tabela 2).
um produto de 252 bp, e os primers FI e RO geraram um Os grupos tambm no diferiram significativamente quan-
produto de 168-bp para o alelo G. to frequncia allica (2 = 1,79; P = 0,180). O gentipo no poli-
morfismo rs7700944 do gene TIM-4 nos grupos caso e controle
estava em HWE (2 = 0,794; P = 0.372; e 2 = 1,762; P = 0,183,
brometo de etdio. Fotografias foram feitas (fig. 2). Para confir- respectivamente).
mar a qualidade da genotipagem, todos os polimorfismos em Realizou-se anlise do polimorfismo rs7700944 do gene
amostras aleatrias foram regenotipados. TIM-4, tendo sexo como covarivel e ajustando-se para idade
(tabela 3). Nas mulheres, no se observou associao signifi-
Anlise estatstica cativa nos grupos quanto ao polimorfismo rs7700944 do gene
TIM-4. Nos homens, o gentipo GA+AA aumentou o risco para
A anlise estatstica foi realizada usando-se o programa SPSS AR em comparao ao GG (OR = 5,15; IC 95% = 1,30-20,48; P
18. O equilbrio HardyWeinberg (HWE) foi estimado separa- = 0,020). Alm disso, os resultados mostraram que o alelo
damente para casos e controles. As associaes entre genti- rs7700944 A aumentou o risco para AR (OR = 4,39; IC 95% =
pos do gene TIM-4 e AR foram avaliadas por odds ratio (OR) e
intervalos de confiana a 95% (IC 95%) de anlises de regres-
so logstica ajustadas para sexo e idade. Tabela 2 Gentipo e frequncias allicas do
polimorfismo rs7700944 do gene TIM-4 em indivduos
com artrite reumatoide e saudveis
a
rs7700944 AR n (%) Controle OR P
G>A n (%) (IC 95%)
Codominante
GG 68 (56,6) 77 (64,2) 1,00
GA 47 (39,2) 41(34,2) 1,17 (0,68-2,01) 0,557
AA 5 (4,2) 2 (1,6) 3,07 (0,55-17,02) 0,200
Dominante
GG 68 (56,6) 77 (64,2) 1,00
GA+AA 52 (43,4) 43 (35,8) 1,25 (0,74-2,13) 0,410
Recessivo
GG+GA 115 (95,8) 118 (98,4) 1,00
AA 5 (4,2) 2 (1,6) 2,90 (0,53-15,98) 0,221
Figura 2 Fotografia do produto de PCR do polimorfismo Alelo
G 183 (76,3) 195 (81,3) 1,00
rs7700944 do gene TIM-4. Os tamanhos dos produtos
A 57 (23,7) 45 (18,7) 1,35(0,87-2,09) 0,181
foram de 168 bp para o alelo G, 252 bp para o alelo A e 364
bp para dois primers outer (faixa de controle). Linha M, AR, artrite reumatoide; OR, odds ratio; IC 95%, intervalos de
confiana de 95%.
marcador de DNA; linha 1, rs7700944 GG; linha 2, GA; linha a
Ajustado para sexo e idade.
3, AA.

RBR 53(4) - Arquivo livro (Impressa).indb 343 21/10/2013 18:21:26


344 R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 4 1 3 4 5

Tabela 3 Gentipo e frequncias allicas do polimorfismo rs7700944 do gene TIM-4 em indivduos com artrite
reumatoide e saudveis, distribudos por sexo
rs7700944 Feminino Masculino P
a a
Caso (n) Controle (n) OR (IC 95%) P Caso (n) Controle (n) OR (IC 95%)
Codominante
GG 60 48 1,00 8 29 1,00
GA 41 35 0,94 (0,52-1,69) 0,85 6 6 3,77 (0,89-15,97) 0,071
AA 3 2 1,19 (0,19-7,77) 0,89 2 0
Dominante
GG 60 48 1,00 8 29 1,00
GA+AA 44 37 0,95 (0,53-1,70) 0,87 8 6 5,15 (1,30-20,48) 0,020
Recessivo
GG+GA 101 83 1,00 14 35 1,00
AA 3 2 1,17 (0,20-7,20) 0,87 2 0
Alelo
G 161 131 1,00 22 58 1,00
A 47 39 0,98 (0,60-1,59) 0,96 10 6 4,39 (1,43-13,54) 0,009

OR, odds ratio; IC 95%, intervalo de confiana de 95%.


a
Ajustado para idade.

1,43-13,54; P = 0,009). Descobrimos ainda uma interao en- noma de clulas renais,23 cncer gstrico,24 suscetibilidade a
tre polimorfismo rs7700944 e sexo, sugerindo uma associao doenas e carcinoma hepatocelular associado com infeco
sexo-especfica entre esse SNP e AR. pelo vrus da hepatite B.25 Polimorfismo do gene TIM-1 foi as-
sociado com AR,13,14,26 rinite alrgica27 e DA.21
Uma das limitaes do nosso estudo foi o tamanho rela-
Discusso tivamente pequeno da amostra, em particular, na anlise de
gentipo e sexo. Outra limitao foi a diferena estatstica sig-
O presente estudo avaliou a associao do polimorfismo nificativa quanto ao sexo entre os pacientes e os controles.
rs7700944 do gene TIM-4 com a suscetibilidade a AR em possvel que tal diferena no tenha um impacto significativo
uma amostra da populao iraniana. No se observou as- nos resultados, uma vez que sexo foi utilizado como covari-
sociao significativa entre polimorfismo rs7700944 e AR. O vel na anlise de regresso.
gentipo GA+AA, em comparao ao GG, aumentou o ris- Concluindo, no se observou associao significativa entre
co de AR em homens, sugerindo a existncia de associao o polimorfismo rs7700944 do gene TIM-4 e AR em uma amos-
sexo-especfica entre esse SNP e AR. Os estudos sobre os po- tra da populao iraniana. No entanto, identificou-se uma in-
limorfismos do gene TIM-4 e AR so poucos e controversos. terao entre polimorfismo rs7700944 e sexo, sugerindo uma
Xu et al.15 investigaram o polimorfismo rs7700944 de ntron associao sexo-especfica entre esse SNP e AR. Tal associa-
do gene TIM-4 em populaes chinesas de etnias Han e Hui. o sexo-especfica entre o polimorfismo rs7700944 e AR deve
Os autores relataram que o gentipo GA do polimorfismo ser interpretadacom cautela, devido ao pequeno tamanho da
rs7700944 aumentou o risco de AR na populao chinesa de amostra. Estudos adicionais sobre tal associao com amos-
etnia Han, mas mostrou-se protetor na populao chinesa tras maiores e diferentes etnias so necessrios para confir-
de etnia Hui. De maneira semelhante, o gentipo GG foi o mar nossos achados.
gentipo de risco para AR na etnia Hui, mas pode ser um
gentipo protetor na etnia Han.15 Embora o alelo G tenha
se mostrado mais frequente nas duas etnias, o alelo do po- Agradecimentos
limorfismo rs7700944 que representa risco para AR diferiu
nas duas populaes como se segue: na etnia Hui, o alelo Este estudo recebeu suporte da Universidade de Cincias
de risco foi o G (OR = 1,823; IC 95% = 1,330-2,498; P < 0,01), Mdicas de Zahedan. Agradecemos a todos os participantes
enquanto na etnia Han, indivduos com o alelo A nesse stio do estudo.
de SNP mostraram-se mais suscetveis a AR (OR = 1,930; IC
95% = 1,412-2,636; P < 0,01).15
Segundo nossos achados, o gentipo AA no foi comum. Conflitos de interesse
Nossos resultados esto de acordo com aqueles relatados por
Xu et al.,15 que descobriram que o gentipo AA no era co- Os autores declaram no haver conflitos de interesse.
mum nas populaes chinesas Han e Hui. Descobrimos ain-
da que existe uma interao entre polimorfismo rs7700944 e REFERNCIAS
sexo, sugerindo uma associao sexo-especfica entre esse
SNP e AR.
Polimorfismos do gene TIM-4 foram associados com 1. Ghelani AM, Samanta A, Jones AC, Mastana SS. Association
asma20 e dermatite atpica (DA).21 Polimorfismos do gene TIM- analysis of TNFR2, VDR, A2M, GSTT1, GSTM1, and ACE genes
3 foram associados com AR,10-12 cncer de pncreas,22 carci- with rheumatoid arthritis in South Asians and Caucasians

RBR 53(4) - Arquivo livro (Impressa).indb 344 21/10/2013 18:21:26


R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 4 1 3 4 5 345

of East Midlands in the United Kingdom. Rheumatol Int. with rheumatoid arthritis susceptibility in Chinese Han and
2011;31(10):1355-61. Hui populations. Int J Immunogenet. 2012;39(5):409-13.
2. Hashemi M, Moazeni-Roodi AK, Fazaeli A, Sandoughi M, 16. Arnett FC, Edworthy SM, Bloch DA, McShane DJ, Fries JF,
Taheri M, Bardestani GR, et al. The L55M polymorphism of Cooper NS, et al. The American Rheumatism Association 1987
paraoxonase-1 is a risk factor for rheumatoid arthritis. Genet revised criteria for the classification of rheumatoid arthritis.
Mol Res. 2010;9(3):1735-41. Arthritis Rheum. 1988;31(3):315-24.
3. Turesson C, Matteson EL. Genetics of rheumatoid arthritis. 17. Sandoughi M, Fazaeli A, Bardestani G, Hashemi M.
Mayo Clin Proc. 2006;81(1):94-101. Frequency of HLA-DRB1 alleles in rheumatoid arthritis
4. Kuchroo VK, Umetsu DT, DeKruyff RH, Freeman GJ. The TIM patients in Zahedan, southeast Iran. Ann Saudi Med.
gene family: emerging roles in immunity and disease. Nat 2011;31(2):171-3.
Rev Immunol. 2003;3(6):454-62. 18. Hashemi M, Moazeni-Roodi AK, Fazaeli A, Sandoughi
5. Meyers JH, Sabatos CA, Chakravarti S, Kuchroo VK. The TIM M, Bardestani GR, Kordi-Tamandani DM, et al. Lack of
gene family regulates autoimmune and allergic diseases. association between paraoxonase-1 Q192R polymorphism
Trends Mol Med. 2005;11(8):362-9. and rheumatoid arthritis in southeast Iran. Genet Mol Res.
6. Meyers JH, Chakravarti S, Schlesinger D, Illes Z, Waldner H, 2010;9(1):333-9.
Umetsu SE, et al. TIM-4 is the ligand for TIM-1, and the TIM-1- 19. Hashemi M, Moazeni-Roodi A, Bahari A, Taheri M. A
TIM-4 interaction regulates T cell proliferation. Nat Immunol. Tetra-Primer Amplification Refractory Mutation System-
2005;6(5):455-64. Polymerase Chain Reaction for the Detection of rs8099917
7. Nurtanio N, Yang PC. Role of TIM-4 in innate or adaptive IL28B Genotype. Nucleosides Nucleotides Nucleic Acids.
immune response. N Am J Med Sci. 2011;3(5):217-21. 2012;31(1):55-60.
8. Albacker LA, Karisola P, Chang YJ, Umetsu SE, Zhou M, Akbari 20. Zhao B, Abdelmoudjib G, Li J, Li H, Wei C, Gong Y, et al. Two
O, et al. TIM-4, a receptor for phosphatidylserine, controls polymorphisms in the TIM-4 gene are associated with
adaptive immunity by regulating the removal of antigen- asthma in a Chinese Han population. Int J Immunogenet.
specific T cells. J Immunol. 2010;185(11):6839-49. 2011;38(1):31-5.
9. Rodriguez-Manzanet R, Sanjuan MA, Wu HY, Quintana FJ, 21. Page NS, Jones G, Stewart GJ. Genetic association studies
Xiao S, Anderson AC, et al. T and B cell hyperactivity and between the T cell immunoglobulin mucin (TIM) gene locus
autoimmunity associated with niche-specific defects in and childhood atopic dermatitis. Int Arch Allergy Immunol.
apoptotic body clearance in TIM-4-deficient mice. Proc Natl 2006;141(4):331-6.
Acad Sci USA. 2010;107(19):8706-11. 22. Tong D, Zhou Y, Chen W, Deng Y, Li L, Jia Z, et al. T cell
10. Chae SC, Park YR, Shim SC, Yoon KS, Chung HT. The immunoglobulin- and mucin-domain-containing molecule 3
polymorphisms of Th1 cell surface gene Tim-3 are associated gene polymorphisms and susceptibility to pancreatic cancer.
in a Korean population with rheumatoid arthritis. Immunol Mol Biol Rep 2012.
Lett. 2004;95(1):91-5. 23. Cai C, Wang L, Wu Z, Li M, Chen W, Sun Y. T-cell
11. Xu J, Yang Y, Liu X, Wang Y. The -1541 C>T and +4259 G>T immunoglobulin- and mucin-domain-containing molecule 3
of TIM-3 polymorphisms are associated with rheumatoid gene polymorphisms and renal cell carcinoma. DNA Cell Biol.
arthritis susceptibility in a Chinese Hui population. Int J 2012;31(7):1285-9.
Immunogenet. 2011;38(6):513-8. 24. Cao B, Zhu L, Zhu S, Li D, Zhang C, Xu C, et al. Genetic
12. Song YW, Im CH, Park JH, Lee YJ, Lee EY, Lee EB, et al. variations and haplotypes in TIM-3 gene and the risk
T-cell immunoglobulin and mucin domain 3 genetic of gastric cancer. Cancer Immunol Immunother. 2010;
polymorphisms are associated with rheumatoid arthritis 59(12):1851-7.
independent of a shared epitope status. Hum Immunol. 25. Li Z, Liu Z, Zhang G, Han Q, Li N, Zhu Q, et al. TIM3 gene
2011;72(8):652-5. polymorphisms in patients with chronic hepatitis B virus
13. Xu JR, Yang Y, Liu XM, Sun JY, Wang YJ. Polymorphisms of infection: impact on disease susceptibility and hepatocellular
the TIM-1 gene are associated with rheumatoid arthritis in carcinoma traits. Tissue Antigens. 2012;80(2):151-7.
the Chinese Hui minority ethnic population. Genet Mol Res. 26. Chae SC, Park YR, Song JH, Shim SC, Yoon KS, Chung
2012;11(1):61-9. HT. The polymorphisms of Tim-1 promoter region are
14. Chae SC, Song JH, Shim SC, Yoon KS, Chung HT. The exon associated with rheumatoid arthritis in a Korean population.
4 variations of Tim-1 gene are associated with rheumatoid Immunogenetics. 2005;56(10):696-701.
arthritis in a Korean population. Biochem Biophys Res 27. Mou Z, Shi J, Tan Y, Xu R, Zhao Z, Xu G, et al. Association
Commun. 2004;315(4):971-5. between TIM-1 gene polymorphisms and allergic rhinitis in
15. Xu J, Yang Y, Liu X, Wang Y. Genetic variation and significant a Han Chinese population. J Investig Allergol Clin Immunol.
association of polymorphism rs7700944 G>A of TIM-4 gene 2010;20(1):3-8.

RBR 53(4) - Arquivo livro (Impressa).indb 345 21/10/2013 18:21:26


R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 4 6 3 5 1

REVISTA BRASILEIRA DE
REUMATOLOGIA
www.reumatologia.com.br

Artigo original

Perfil de especialistas e de servios em reumatologia


peditrica no estado de So Paulo

Maria Teresa Terreria, Lcia M. A. Camposb,*, Eunice M. Okudac, Clovis A. Silvab,


Silvana B. Sacchettic, Roberto Marinid, Virginia P. Ferrianie, Maria Heloiza Venturaf,
Taciana Fernandesg, Juliana O. Satoh, Elizabeth C. Fernandesb, Claudio Lena,
Cssia Barbosaa, Ana Paola Lotitob, Maria Carolina dos Santosc, Ndia E. Aikawab,
Mrcia Faci, Daniela Piottoa, Vanessa Bugnia, Ktia T. Kozub, Paulo R. Romanellii,
Adriana M. E. Sallumb, Marlia Febroniob, Melissa Fragaa, Cludia S. Magalhesh
a
Setor de Reumatologia Peditrica, Departamento de Pediatria, Universidade Federal de So Paulo, So Paulo, SP, Brasil
b
Unidade de Reumatologia Peditrica, Instituto da Criana, Hospital das Clnicas, Faculdade de Medicina, Universidade de So Paulo,
So Paulo, SP, Brasil
c
Setor de Reumatologia, Departamento de Pediatria, Santa Casa de Misericrdia de So Paulo, So Paulo, SP, Brasil
d
Unidade de Reumatologia Peditrica, Universidade Estadual de Campinas, Campinas, SP, Brasil
e
Servio de Imunologia, Alergia e Reumatologia, Departamento de Puericultura e Pediatria, Faculdade de Medicina de Ribeiro Preto,
Universidade de So Paulo, Ribeiro Preto, SP, Brasil
f
Setor de Reumatologia Peditrica, Santa Casa de Misericrdia de Santos, Santos, SP, Brasil
g
Servio de Reumatologia Peditrica, Hospital Estadual de Bauru, Faculdade de Medicina de Botucatu, Botucatu, SP, Brasil
h
Disciplina de Reumatologia Peditrica, Faculdade de Medicina de Botucatu, Botucatu, SP, Brasil
i
Clnica Privada Exclusiva

informaes resumo

Histrico do artigo: Introduo: A reumatologia peditrica (RP) uma especialidade emergente, com nmero
Recebido em 17 de setembro de 2012 restrito de especialistas, e ainda no conta com uma casustica brasileira sobre o perfil dos
Aceito em 17 de fevereiro de 2013 pacientes atendidos e as informaes sobre a formao de profissionais capacitados.
Objetivo: Estudar o perfil dos especialistas e dos servios em RP e as caractersticas dos
Palavras-chave: pacientes com doenas reumticas nessa faixa etria a fim de estimar a situao atual no
Reumatologia peditrica estado de So Paulo (ESP).
Epidemiologia Pacientes e mtodos: No ano de 2010 o departamento cientfico de RP da Sociedade de Pe-
Registro diatria de So Paulo encaminhou um questionrio respondido por 24/31 especialistas com
ttulo de especializao em RP que atuam no ESP e por 8/12 instituies com atendimento
nesta especialidade.
Resultados: A maioria (91%) dos profissionais exerce suas atividades em instituies pbli-
cas. Clnicas privadas (28,6%) e instituies (37,5%) relataram no ter acesso ao exame de
capilaroscopia e 50% das clnicas privadas no tem acesso acupuntura. A mdia de tempo
de prtica profissional na especialidade foi de 9,4 anos, sendo 67% deles ps-graduados.
Sete (87,5%) instituies pblicas atuam na rea de ensino, formando novos reumatolo-
gistas peditricos. Cinco (62,5%) delas tm ps-graduao. Dois teros dos especialistas

* Autor para correspondncia.


E-mail: lucia@arrudacampos.com (L.M.A. Campos).
0482-5004/$ - see front matter. 2013 Elsevier Editora Ltda. Todos os direitos reservados.

RBR 53(4) - Arquivo livro (Impressa).indb 346 21/10/2013 18:21:26


R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 4 6 3 5 1 347

utilizam imunossupressores e agentes biolgicos de uso restrito pela Secretaria da Sade.


A doena mais atendida foi artrite idioptica juvenil (29,1%-34,5%), seguida de lpus eri-
tematoso sistmico juvenil (LESJ) (11,6%-12,3%) e febre reumtica (9,1%-15,9%). Vasculites
(prpura de Henoch Schnlein, Wegener, Takayasu) e sndromes autoinflamatrias foram
mais incidentes nas instituies pblicas (P = 0,03; P = 0,04; P = 0,002 e P < 0,0001, respec-
tivamente). O LESJ foi a doena com maior mortalidade (68% dos bitos), principalmente
por infeco.
Concluso: A RP no ESP conta com um nmero expressivo de especialistas ps-graduados,
que atuam especialmente em instituies de ensino, com infraestrutura adequada ao aten-
dimento de pacientes de alta complexidade.
2013 Elsevier Editora Ltda. Todos os direitos reservados.

Profile of paediatric rheumatology specialists and services in the state of


So Paulo

abstract

Keywords: Introduction: Paediatric rheumatology (PR) is an emerging specialty, practised by a limited


Paediatric rheumatology number of specialists. Currently, there is neither a record of the profile of rheumatology
Epidemiology patients being treated in Brazil nor data on the training of qualified rheumatology profes-
Registry sionals in the country.
Objective: To investigate the profile of PR specialists and services, as well as the character-
istics of paediatric patients with rheumatic diseases, for estimating the current state of
rheumatology in the state of So Paulo.
Patients and methods: In 2010, the scientific department of PR of the Paediatric Society of So
Paulo administered a questionnaire that was answered by 24/31 accredited specialists in PR
practising in state of So Paulo and by 8/21 institutions that provide PR care.
Results: Most (91%) of the surveyed professionals practise in public institutions. Private
clinics (28.6%) and public institutions (37.5%) reported not having access to nailfold capil-
laroscopy, and 50% of the private clinics reported not having access to acupuncture. The
average duration of professional practise in PR was 9.4 years, and 67% of the physicians had
attended postgraduate programmes. Seven (87.5%) public institutions perform teaching ac-
tivities, in which new paediatric rheumatologists are trained, and five (62.5%) offer post-
graduate programmes. Two-thirds of the surveyed specialists use immunosuppressants
and biological agents classified as restricted use by the Health Secretariat. The disease
most frequently reported was juvenile idiopathic arthritis (29.1-34.5%), followed by juvenile
systemic lupus erythematosus (JSLE) (11.6-12.3%) and rheumatic fever (9.1-15.9%). The in-
cidence of vasculitis (including Henoch-Schnlein purpura, Wegeners granulomatosis, and
Takayasus arteritis) and autoinflammatory syndromes was higher in public institutions
compared to other institutions (P = 0.03, P = 0.04, P = 0.002, and P < 0.0001, respectively).
Patients with JSLE had the highest mortality rate (68% of deaths), mainly due to infection.
Conclusion: The field of PR in the state of So Paulo has a significant number of specialists
with postgraduate degrees who mostly practise at teaching institutions with infrastruc-
tures appropriate for the care of high-complexity patients.
2013 Elsevier Editora Ltda. All rights reserved.

Tambm pouco se sabe sobre a formao de profissionais capa-


Introduo citados ao atendimento de crianas com doenas reumticas.
A Sociedade de Pediatria de So Paulo (SPSP) tem, h mais
A reumatologia peditrica (RP) uma especialidade emer- de duas dcadas, um departamento de reumatologia peditri-
gente em franco crescimento, ainda com nmero restrito de ca que inclui, na maioria dos casos, profissionais de servios
especialistas. H necessidade de treinamento e atualizao acadmicos, cuja misso de prover atualizao, educao
frequente dos especialistas mediante a expanso do espectro continuada e propiciar frum de discusso de condutas, ro-
de doenas e de novos tratamentos. tinas e protocolos, melhorando a assistncia dos pacientes
Esta especialidade, dedicada ao conhecimento das doenas peditricos com doenas reumticas.
reumticas na infncia e na adolescncia, ainda necessita de Com o intuito de estimar a situao atual no estado de So
uma casustica brasileira sobre o perfil dos pacientes atendidos. Paulo (ESP), nossos objetivos foram, por meio de um inquri-

RBR 53(4) - Arquivo livro (Impressa).indb 347 21/10/2013 18:21:26


348 R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 4 6 3 5 1

to, estudar o perfil dos especialistas, dos servios em RP e as (77,4%) profissionais que participaram deste estudo. Foram
caractersticas dos pacientes com doenas reumticas nessa obtidos dados de oito instituies pblicas de RP do ESP (seis
faixa etria. servios universitrios e dois hospitais pblicos, um deles li-
gado ao ensino).
Dos profissionais participantes, 18 (75%) atendiam em ser-
Pacientes e mtodos vio universitrio e clnica privada, dois (8,3%) apenas em ser-
vio universitrio, dois (8,3%) apenas em clnica privada, um
No ano de 2010, o ncleo gerencial do departamento cientfico (4,2%) em hospital pblico com ensino e clnica privada e um
de RP da SPSP desenvolveu um questionrio a ser respondido (4,2%) atendia em hospital pblico no ligado ao ensino.
por mdicos pediatras do ESP que exercem suas atividades Dos 21 profissionais de clnicas privadas, trs (14,3%)
profissionais relacionadas RP, seja em consultrio, clnica ou atendem pacientes adultos e peditricos com doenas reu-
ambulatrio ou ainda em instituies pblicas ou privadas. mticas e 18 (85,7%) somente pacientes peditricos. Onze
O questionrio foi apresentado aos demais membros do de- (52,4%) dos profissionais consultam tanto pacientes de pe-
partamento cientfico, que tiveram a oportunidade de sugerir diatria geral quanto de RP. Todos os profissionais tm acesso
modificaes no mesmo antes de aprov-lo. a hospitais para internaes e a laboratrios de anlises cl-
O questionrio foi encaminhado por via eletrnica a 31 nicas e de exames reumatolgicos, alm de acesso a exames
profissionais com ttulo de especializao com rea de atu- de imagem (radiografia simples, ultrassonografia, tomografia
ao em RP, que atuam no ESP. A primeira parte do questio- computadorizada, ressonncia nuclear magntica e densito-
nrio abrangeu questes relativas ao atendimento prestado metria ssea). Seis (28,6%) reumatologistas peditricos no
por esses especialistas em seus locais de trabalho privados: tm acesso capilaroscopia periungueal. Em relao in-
nmero total de pacientes atendidos e nmero de pacientes filtrao articular, 12 (57,1%) profissionais indicam tal pro-
por patologia especfica (em seguimento e aqueles atendidos cedimento.
pela primeira vez no ano de 2010); a ocorrncia de bitos em Dezoito (85,7%) dos 21 profissionais que exercem a espe-
2009 e 2010 (nmero de casos e causas dos bitos); o tempo cialidade em clnicas privadas realizam infuso endovenosa
total de prtica em RP e o tempo despendido por semana com corticosteroides e imunossupressores e 14 (66,7%) pres-
nesse tipo de atividade, disponibilidade de recursos de su- crevem agentes biolgicos. Sete (50%) dos 14 reumatologis-
porte (hospital para internao, realizao de exames sub- tas peditricos que utilizam agentes biolgicos realizam as
sidirios, apoio de equipe multiprofissional e de mdicos de infuses em sistema de hospital dia. Acesso equipe multi-
outras especialidades), utilizao de medicamentos biolgi- profissional constou em: fisioterapia (95,8%), nutrio (87,5%),
cos, realizao de procedimentos invasivos e participao psicologia (83,3%), fonoaudiologia (66,7%) e odontologia (50%).
em encontros cientficos. O acesso a outras especialidades mdicas foi observado em:
O preenchimento da segunda parte do questionrio foi neurologia (100%), oftalmologia (100%), nefrologia (100%), or-
destinado exclusivamente aos responsveis pelas institui- topedia (100%), cirurgia peditrica (95,8%), cardiologia (91,7%),
es com atendimento em RP e abrangeu questes relativas dermatologia (91,7%), hematologia (91,7%), vascular (79,2%),
ao servio prestado nesses locais: tipo de instituio (univer- terapia intensiva (79,2%) e acupuntura (50%).
sitria, pblica ou privada, ligada ou no ao ensino), tempo de O tempo de prtica do profissional na especialidade, nas
existncia, nmero total de pacientes e nmero de pacientes instituies e clnicas privadas, variou de 0,5 a 26 anos (mdia
por patologia especfica (em seguimento e aqueles atendidos de 9,4 anos). Dos 24 profissionais especialistas, trs so livre-
pela primeira vez no ano de 2010); a ocorrncia de bitos em -docentes, dois so docentes, oito so doutores, trs so mes-
2009 e 2010 (nmero de casos e causas dos bitos); a carga tres e oito no tm ps-graduao stricto sensu. Com exceo
semanal de atendimento ambulatorial; disponibilidade de de um profissional, todos os demais (95,8%) participaram de
recursos de suporte (nmero de leitos para internao, rea- eventos cientficos (nacionais ou internacionais) para atuali-
lizao de exames subsidirios, apoio de equipe multiprofis- zao profissional nos dois anos anteriores ao estudo.
sional e de mdicos de outras especialidades e presena de Todas as instituies tm ambulatrios e leitos de inter-
centro de pesquisa na prpria instituio); utilizao de medi- nao. A carga horria ambulatorial varia de 4-24 horas se-
camentos biolgicos;disponibilidade de recursos diagnsticos manais. Trs (37,5%) instituies das oito participantes pos-
e teraputicos e realizao de procedimentos invasivos, alm suem laboratrio prprio de reumatologia e trs (37,5%) no
de participao em atividades de ensino (nmero de mdicos tm como realizar o exame de capilaroscopia periungueal.
com ttulo de especializao com rea de atuao em RP, re- Cinco (62,5%) instituies realizam infiltraes articulares e
sidentes, estagirios e ps-graduandos atuais e j formados trs (37,5%) realizam bipsias. Sete (87,5%) das oito institui-
pela instituio). es utilizam agentes biolgicos em seus pacientes. Todas as
Os mdicos tiveram um prazo de dois meses para preencher oito instituies tm equipe multiprofissional e dispem da
as informaes e retorn-las ao ncleo gerencial do departa- assessoria de mdicos de outras especialidades.
mento de RP da SPSP (MTT, LMAC, EMO) para anlise dos dados. Sete (87,5%) instituies pblicas atuam na rea de ensino,
formando novos reumatologistas peditricos e recebendo, nos
respectivos servios, residentes e estagirios de pediatria e re-
Resultados sidentes e inscritos em curso de especializao em RP. Cinco
(62,5%) das oito instituies tm ps-graduao (tabela 1). Seis
O questionrio foi distribudo a 31 especialistas em RP que (75%) instituies tm centro de pesquisa geral e trs (37,5%)
atuam no ESP. Sete no responderam, resultando em 24 dispem de centro de pesquisa em reumatologia.

RBR 53(4) - Arquivo livro (Impressa).indb 348 21/10/2013 18:21:27


R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 4 6 3 5 1 349

pacientes acompanhados em instituies pblicas) e 13 em


Tabela 1 Caractersticas das atividades ligadas ao
ensino em reumatologia peditrica (RP) das instituies 2010 (12 em pacientes acompanhados em instituies pbli-
pblicas no ano de 2010 e desde sua formao cas) (tabela 3).
Caractersticas Em 2010 (n) Totala (n)
Instituies de ensino 7 7 Discusso
Instituies com ps-graduao 5 5
Profissionais com ttulo em RP 29 48
Residentes em RP 9 50 Este estudo objetivou avaliar a capacitao de profissionais
Estagirios em RP 10 118 e a abrangncia do atendimento bem como os diagnsticos
Ps-graduandos em RP 27 72 especficos na RP do ESP. Apesar de sete dos 31 profissionais
Reumatologistas pediatras com 18 18 no terem respondido ao questionrio enviado, a amostra foi
atividade simultnea em clnica
considerada bastante representativa da especialidade atuan-
privada
te, uma vez que mais de trs quartos dos profissionais res-
a
nmero total desde a formao das instituies. ponderam ao inqurito.
Observamos que expressiva maioria dos profissionais
A mdia de tempo de existncia dos servios de RP das exercem suas atividades em instituies pblicas, de forma
instituies pblicas foi de 22 anos (variao de 1-43 anos), exclusiva ou no. Isso traduz a grande complexidade que
e o nmero total de pacientes acompanhados e diagnostica- caracteriza a RP, exigindo interface com outros profissionais
dos com doenas reumticas nesses servios, a partir de sua ligados sade e a constante atualizao por parte de seus
formao, foi de 19.078. A mdia de tempo de existncia dos especialistas.
servios de RP nas clnicas privadas foi de 7,3 anos (variao A maior parte dos profissionais atende exclusivamente
de 0,5-25 anos) e o nmero total de pacientes diagnosticados crianas e adolescentes, uma vez que todos os profissionais
e acompanhados com doenas reumticas nesses servios foi da casustica so pediatras. Por outro lado, metade dos pro-
de 5.094. Portanto, o nmero total de pacientes (instituies fissionais no atende exclusivamente pacientes com doenas
pblicas e clnicas privadas) foi de 24.172. No ano de 2010, ano reumticas em suas clnicas privadas. Isso pode ser explicado
do trmino de incluso de pacientes, tivemos 1.427 casos no- por diferentes motivos: o nmero de pacientes com doenas
vos diagnosticados (tabela 2). Observamos que a artrite idio- reumticas representa um pequeno percentual da clnica
ptica juvenil e a febre reumtica foram mais incidentes nas peditrica geral; alm disso, os elevados custos inerentes ao
clnicas privadas, enquanto a prpura de Henoch-Schenlein, tratamento e acompanhamento destes casos motivo fre-
granulomatose de Wegener, arterite de Takayasu e as sndro- quente de encaminhamento desses pacientes s instituies
mes autoinflamatrias foram mais incidentes nas institui- pblicas. Em uma grande proporo dos casos, h necessida-
es pblicas. de de referncia terciria, pois so exigidos mtodos diagns-
Em relao aos bitos em clnicas privadas e instituies ticos avanados e tratamentos complexos. Essas instituies
pblicas, foram observados nove bitos em 2009 (todos em contam, em sua maioria com estrutura humana e material
para o atendimento em RP. Em inqurito norte-americano, foi
observado que trs quartos dos reumatologistas peditricos
usavam pelo menos 90% do seu tempo cuidando de crianas
Tabela 2 Casos novos no ano de 2010 distribudos
e adolescentes.1
por patologias reumticas em instituies pblicas e
clnicas privadas Chamou a ateno o menor acesso ao exame de capilaros-
copia periungueal, em comparao a outros exames comple-
Patologias Instituies Clnicas Total P
pblicas privadas (n = mentares, tanto nas clnicas privadas quanto nas instituies.
(n = 519) (n = 908) 1.427) A capilaroscopia tem se revelado, nos ltimos anos, como de
grande utilidade no diagnstico e seguimento de pacientes
Artrite idioptica 151 (29,1) 313 (34,5) 464 0,037
juvenil
com doenas reumticas, em especial para casos de esclero-
Lpus eritematoso 60 (11,6) 112 (12,3) 172 0,665 dermia sistmica e dermatomiosite juvenil.2,3 A menor dis-
sistmico juvenil ponibilidade desse procedimento em nosso meio revela que
Febre reumtica 47 (9,1) 144 (15,9) 191 0,0003
Dermatomiosite 25 (4,8) 33 (3,6) 58 0,276
juvenil
Prpura de Henoch- 145 (27,9) 207 (22,8) 352 0,030 Tabela 3 Causas de bitos em pacientes com doenas
Schnlein reumticas em 2009 e 2010
Doena de Kawasaki 17 (3,3) 37 (4,0) 54 0,446
Causas 2009 (n = 9) 2010 (n = 13)
Poliarterite nodosa 9 (1,7) 7 (0,8) 16 0,096
Granulomatose de 4 (0,8) 1 (0,1) 5 0,042 Infeco 4 LESJ / 1 DMJ / 4 LESJ
Wegener 1 AIJ
Arterite de Takayasu 9 (1,7) 2 (0,2) 11 0,002 Atividade de doena 1 DMJ / 1 AIJ 4 LESJ / 1 AIJ /
Esclerodermia 24 (4,6) 41 (4,5) 65 0,924 1 AT / 1 FR
juvenil Atividade de doena e infeco 1 LESJ 2 LESJ
Sndromes 28 (5,4) 11 (1,2) 39 < 0,0001
LESJ, lpus eritematoso sistmico juvenil; DMJ, dermatomiosite
autoinflamatrias
juvenil; AIJ, artrite idioptica juvenil; AT, arterite de Takayasu; FR,
Dados expressos em n (%). febre reumtica.

RBR 53(4) - Arquivo livro (Impressa).indb 349 21/10/2013 18:21:27


350 R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 4 6 3 5 1

ainda h uma carncia de equipamentos e de treinamento cas. Pode-se atribuir esse fato ao atraso no diagnstico e enca-
de especialistas nesta rea e, consequentemente, um cam- minhamento dos pacientes aos servios tercirios, piorando
po para formao de novos profissionais. Da mesma forma, o prognstico dos mesmos, alm do encaminhamento dos
pode-se notar menor acesso por parte dos profissionais de RP, casos de maior gravidade a esses servios.
em clnicas privadas, a servios que exigem uma maior es- Apesar do perfil traado neste estudo, ele conta com al-
pecializao e recursos tcnicos, como acupuntura e terapia gumas limitaes, como o fato de no ter sido estendido
intensiva. totalidade dos profissionais em RP do ESP, uma vez que o
Quanto ao tratamento, cerca de dois teros dos especia- acesso ao inqurito foi restrito aos profissionais cadastrados
listas utilizam medicamentos, como imunossupressores e na SPSP como especialistas, excluindo-se os profissionais reu-
agentes biolgicos, de uso restrito pela Secretaria da Sade matologistas com atuao em pacientes adultos que tambm
em virtude de seu alto custo. Esses medicamentos foram res- atendem crianas e adolescentes. Tambm no foi possvel
ponsveis, nos ltimos anos, por grande benefcio no controle avaliar toda a casustica de pacientes peditricos com doen-
da atividade da doena dos pacientes reumticos.4-6 Uma das as reumticas, tendo em vista que parte dessa populao faz
aquisies teraputicas mais recentes, para esses pacientes, seguimento na rede bsica ou com outros especialistas, como
foi a administrao endovenosa dessas medicaes em siste- ortopedistas, pediatras generalistas e reumatologistas com
ma de hospital dia, utilizado por 50% dos profissionais parti- atuao em pacientes adultos. Existem as limitaes ineren-
cipantes, diminuindo assim o tempo de permanncia em am- tes ao mtodo de envio de questionrios por e-mail, mesmo
biente hospitalar e, consequentemente, o risco de infeces. com a prvia discusso e divulgao do protocolo em reuni-
Apesar de o perodo de prtica dos especialistas em RP ter es do departamento cientfico de RP da SPSP, e respectivas
sido, em mdia, de 9,4 anos, todos (com exceo de um pro- atas e do contato direto com os profissionais, cujas respos-
fissional) participaram de eventos cientficos para atualizao tas suscitaram dvidas por ocasio da tabulao dos dados.
nos ltimos dois anos, confirmando a necessidade de cont- Por fim, pacientes que possam eventualmente ter passado
nua renovao de conhecimento nesta especialidade, mesmo em consulta com dois mdicos ou em duas instituies di-
para aqueles com maior tempo de experincia e titulao ferentes, podem ter provocado um vis, uma vez que pode
mais elevada. Em relao formao de novos profissionais, ter ocorrido, involuntariamente, duplicidade de registro, pois
quase a totalidade das instituies pblicas atuam na rea de os dados foram coletados em anonimato, com delineamento
ensino e pesquisa, podendo ser observado um expressivo n- retrospectivo.
mero de estudantes de ps-graduao em RP no ESP, muitos Conclumos que a RP no ESP conta com nmero expressi-
provenientes de outros estados. vo de especialistas e profissionais ps-graduados, que atuam
Embora dados a respeito da incidncia ou prevalncia das especialmente em instituies de ensino, com infraestrutura
patologias reumticas no Brasil, e particularmente no ESP, adequada ao atendimento de pacientes de alta complexida-
sejam inexistentes, podemos observar que a doena mais de. A mudana na prevalncia das doenas reumticas no
atendida pelos especialistas em RP que participaram deste ESP reflete novas situaes de vida da populao e servios
estudo foi a artrite idioptica juvenil (AIJ), seguida de lpus de sade. Com o aumento progressivo de doenas crnicas
eritematoso sistmico juvenil (LESJ), como descrito na lite- dentro da clnica peditrica, surge a necessidade de servios
ratura internacional.7-9 importante enfatizar que a febre especializados nas diferentes reas, permitindo referenciar
reumtica (FR), outrora considerada a patologia reumtica de esses pacientes em tempo oportuno.
maior prevalncia em pases em desenvolvimento,10 vem ten- A expectativa que a iniciativa deste projeto piloto possa
do sua frequncia reduzida no ESP. Isso reflete, possivelmen- ser estendida ao mbito nacional, para que o perfil da RP bra-
te, a melhoria das condies de vida da populao e a maior sileira seja conhecido, identificando-se as regies deficientes
conscientizao dos profissionais de sade da rede bsica de profissionais nesta rea e as necessidades e condies de
em relao preveno da FR. Recentemente, o Ministrio da cada servio no atendimento aos pacientes reumticos, for-
Sade publicou as diretrizes para o diagnstico e tratamento necendo, assim, dados mais objetivos para a melhor adequa-
da FR, tratando-se de mais uma ferramenta para divulgar os o de recursos humanos e materiais, incluindo a demanda e
mtodos de preveno da doena por meio da profilaxia pri- suprimento de tratamento para as doenas reumticas.
mria, e possibilitar o diagnstico e tratamento mais acurado
dessa patologia pelo prprio profissional da rede de ateno
primria.11 Surpreendentemente, a febre reumtica foi mais Conflitos de interesse
incidente nas clnicas privadas quando comparada s ins-
tituies pblicas. Por outro lado, as vasculites e sndromes Os autores declaram no haver conflitos de interesse.
autoinflamatrias foram mais incidentes nas instituies p-
blicas, provavelmente pela complexidade dos casos.
REFERNCIAS
Nesta casustica, o LESJ foi a doena com maior taxa de
mortalidade, correspondendo a 68% dos bitos dos pacientes
com doenas reumticas nos anos de 2009 e 2010. A litera-
1. Henrickson M. Policy challenges for the pediatric
tura mdica confirma essa patologia como de alta gravida-
rheumatology workforce: Part II. Health care system delivery
de, com grande risco de mortalidade.12,13 A principal causa de
and workforce supply. Henrickson Pediatric Rheumatology
bito nesses pacientes foi a infeco, isolada ou associada 2011;9(1):24.
atividade da doena, como tambm relatado na literatura.14 2. Nascif AK, Terreri MT, Len CA, Andrade LE, Hilrio MO.
Expressiva maioria dos bitos ocorreu nas instituies pbli- Inflammatory myopathies in childhood: correlation between

RBR 53(4) - Arquivo livro (Impressa).indb 350 21/10/2013 18:21:27


R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 4 6 3 5 1 351

nailfoldcapillaroscopyfindings and clinical and laboratory 9. Rosenberg AM. Longitudinal analysis of a


data. J Pediatr. (Rio J).2006;82(1):40-5. pediatric rheumatology clinic population. J
3. Ingegnoli F, Zeni S, Gerloni V, Fantini F. Capillaroscopic Rheumatol.2005;32(10):1992-2001.
observations in childhoodrheumatic diseasesand healthy 10. Sztajnbok FR, Serra CR, Rodrigues MC, Mendoza E. Rheumatic
controls. Clin Exp Rheumatol.2005;23(6):905-11. diseases in adolescence. J Pediatr. (Rio J) 2001;77(Supl.2):s234-s44.
4. Hayward K, Wallace CA. Recent developments in anti- 11. Barbosa PJ, Muller RE, Latado AL, Achutti AC, Ramos AIO,
rheumaticdrugs in pediatrics: treatment of juvenile Weksler C, et al. Diretrizes brasileiras para diagnstico,
idiopathic arthritis. Arthritis Res Ther.2009;11(1):216. tratamento e preveno da febre reumtica da Sociedade
5. Gurion R, Lehman TJ, Moorthy LN. Systemic arthritis in Brasileira de Cardiologia, da Sociedade Brasileira de Pediatria
children: a review of clinical presentation and treatment. Int e da Sociedade Brasileira de Reumatologia. Arq Bras
J Inflam.2012; 271569. [Published online 2011 December 25] Cardiol.2009;93(3 supl.4):1-18.
doi:10.1155/2012/271569. 12. Hashkes PJ, Wright BM, Lauer MS, Worley SE, Tang AS, Roettcher
6. Woo P. Theoretical and practical basis for early aggressive PA, et al. Mortality outcomes in pediatric rheumatology in the
therapy in pediatric autoimmune disorders. Curr Opin US. Arthritis Rheum. 2010; 62(2):599-608.
Rheumatol.2009;21(5):552-7. 13. Tucker LB, Uribe AG, Fernndez M, Vil LM, McGwin G, Apte M, et
7. Huemer C, Huemer M, Dorner T, Falger J, Schacherl H, al. Adolescent onset oflupusresults in more aggressive disease
Bernecker M, et al. Incidenceof pediatricrheumatic and worse outcomes: results of a nested matched case-control
diseasesin a regional population in Austria. J study within LUMINA, a multiethnic US cohort (LUMINA LVII).
Rheumatol.2001;28(9):2116-9. Lupus.2008;17(4):314-22.
8. Denardo BA, Tucker LB, Miller LC, Szer IS, Schaller JG. 14. Faco MM, Leone C, Campos LM, Febrnio MV, Marques HH,
Demography of a regional pediatric rheumatology patient Silva CA. Risk factors associated with the death of patients
population. Affiliated Childrens Arthritis Centers of New hospitalized for juvenile systemiclupus erythematosus. Braz J
England. J Rheumatol.1994;21(8):1553-61. Med Biol Res.2007;40(7):993-1002.

RBR 53(4) - Arquivo livro (Impressa).indb 351 21/10/2013 18:21:27


R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 5 2 3 5 7

REVISTA BRASILEIRA DE
REUMATOLOGIA
www.reumatologia.com.br

Artigo original

Sndrome antissintetase: anti-PL-7, anti-PL-12 e anti-EJ

Fernando Henrique Carlos de Souzaa, Marcela Gran Pina Cruellasb, Mauricio Levy-Netoa,
Samuel Katsuyuki Shinjoa,*
a
Servio de Reumatologia, Hospital das Clnicas, Faculdade de Medicina, Universidade de So Paulo, So Paulo, SP, Brasil
b
Disciplina de Reumatologia, Faculdade de Medicina, Universidade de So Paulo, So Paulo, SP, Brasil

informaes resumo

Histrico do artigo: Objetivos: Devido escassez de trabalhos na literatura, realizamos anlise de uma srie de
Recebido em 20 de julho de 2012 pacientes com sndrome antissintetase (SAS) do tipo anti-PL-7, PL-12 e EJ.
Aceito em 19 de fevereiro de 2013 Mtodos: Estudo de coorte, retrospectivo, envolvendo 20 pacientes com SAS (8 com anti-
-PL-7, 6 com PL-12, 6 com EJ), em acompanhamento em nosso servio, entre 1982 e 2012.
Palavras-chave: Resultados: A mdia de idade dos pacientes ao incio da doena foi de 38,5 12,9 anos, e
Aminoacil-tRNA sintetases a durao da doena de 4,5 6,4 anos. Setenta por cento dos pacientes eram brancos e
Miopatia inflamatria 85% eram mulheres. Sintomas constitucionais ocorreram em 90% dos casos. Todos apre-
Miosite sentavam fraqueza muscular objetiva dos membros; ao diagnstico, 30% encontravam-
Sndrome antissintetase -se acamados e 65% com disfagia alta. Envolvimento articular, pulmonar e fenmeno de
Raynaud ocorreram, respectivamente, em 50%, 40% e 65% dos casos; mais da metade dos
pacientes apresentava pneumopatia incipiente, opacidade em vidro-fosco e/ou fibrose
pulmonar. No houve casos de envolvimento neurolgico e/ou cardaco. Todos receberam
prednisona e, como poupadores dessa medicao, diferentes imunossupressores, depen-
dendo da tolerncia, efeitos colaterais e/ou refratariedade da doena. De relevncia, os
pacientes com anti-EJ apresentaram maiores taxas de recidiva. Dois pacientes evoluram
para bito ao longo do seguimento, e um paciente teve neoplasia mamria na ocasio do
diagnstico da doena.
Concluses: A SAS (anti-PL-7, PL-12 e EJ) afetou predominantemente mulheres brancas.
Embora os autoanticorpos descritos no presente estudo estejam mais relacionados com o
acometimento pulmonar comparativamente ao articular, nossos pacientes apresentaram
uma porcentagem significativa de ambos e com percentagem alta de miopatia. Alm disso,
houve menor taxa de mortalidade.
2013 Elsevier Editora Ltda. Todos os direitos reservados.

Anti-synthetase syndrome: anti-PL-7, anti-PL-12 and anti-EJ

abstract

Keywords: Objectives: Due to the scarcity of studies in the literature, we conducted an analysis of a
Aminoacyl-tRNA synthetases series of patients with the anti-PL-7, PL-12 and EJ types of antisynthetase syndrome (ASS).
Inflammatory myopathy Methods: We conducted a retrospective cohort study of 20 patients with ASS (8 with anti-
Myositis PL-7, 6 with PL-12, 6 with EJ) monitored in our department between 1982 and 2012.
Antisynthetase syndrome Results: The mean patient age at disease onset was 38.5 12.9 years, and the disease dura-

* Autor para correspondncia.


E-mail: samuel.shinjo@gmail.com (S.K. Shinjo).
0482-5004/$ - see front matter. 2013 Elsevier Editora Ltda. Todos os direitos reservados.

RBR 53(4) - Arquivo livro (Impressa).indb 352 21/10/2013 18:21:27


R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 5 2 3 5 7 353

tion was 4.5 6.4 years. Of all the patients, 70% were white and 85% were female. Constitu-
tional symptoms occurred in 90% of cases. All patients presented objective muscle weak-
ness in the limbs; in addition, 30% were bedridden and 65% demonstrated high dysphagia
at diagnosis. Joint and pulmonary involvement and Raynauds phenomenon occurred in
50%, 40% and 65% of cases, respectively, with more than half of the patients presenting
incipient pneumopathy, ground-glass opacity and/or pulmonary fibrosis. There were no
cases of neurological and/or cardiac involvement. All patients received prednisone or other
immunosuppressants depending on tolerance, side effects and/or disease refractoriness.
Importantly, patients with the anti-EJ type of ASS demonstrated higher rates of recurrence.
Two patients died during follow-up, and 1 patient had breast cancer at the time of diagnosis.
Conclusions: ASS (anti-PL-7, PL-12 and EJ) was found to predominantly affect white women.
Although the autoantibodies described in the present study are more related to pulmo-
nary than joint involvement, our patients showed a significant percentage of both types
of involvement and a high percentage of myopathy. We also observed a low mortality rate.
2013 Elsevier Editora Ltda. All rights reserved.

muscular proximal dos membros (grau 0: ausncia de contra-


Introduo o muscular; grau I: sinais de discreta contratilidade; grau II:
movimentos de amplitude normal, porm no vence a ao
A sndrome antissintetase (SAS) uma miopatia inflama- da gravidade; grau III: movimentos de amplitude normal con-
tria idioptica caracterizada pela presena de anticor- tra a ao da gravidade; grau IV: mobilidade integral contra a
pos anti-aminoacil-tRNA sintetases, como anti-Jo-1 (histi- ao da gravidade e de certo grau de resistncia; grau V: mobi-
dil-), anti-PL-7 (treonil-), anti-PL-12 (alanil-), anti-EJ (glicil-), lidade completa contra resistncia acentuada e contra a ao
anti-OJ (isoleucil-), entre outros.1-3 Dentre esses autoanticor- da gravidade), alm de envolvimento neurolgico ou cardaco.
pos, o mais frequente o anti-Jo-1.1-3 Os exames laboratoriais analisados referem-se ao incio do
Clinicamente, a SAS caracterizada por envolvimento diagnstico da doena e antes da introduo de corticosteroi-
muscular (miosite), pulmonar (doena pulmonar intersticial) de. A creatinoquinase (valor de referncia: 24-173 U/L) e al-
e articular (artrite), alm de febre, fenmeno de Raynaud e dolase (1,0-7,5 U/L) foram dados obtidos por mtodo cintico
mos de mecnico.1-3 automatizado.
A prevalncia da SAS na populao geral desconhecida, Para a anlise dos autoanticorpos, utilizamos os soros ar-
pois se trata de uma sndrome rara. Alm disso, h escassez mazenados em freezer (20 C) que foram coletados de rotina,
de trabalhos epidemiolgicos em SAS. Quando presentes, na ocasio do diagnstico de SAS. EsSes autoanticorpos foram
baseiam-se principalmente em SAS anti-Jo-1,3-7 enquanto as determinados utilizando kit comercial de fase slida immu-
SAS contra outras aminoacil-tRNA sintetases se restringem a nobloting, uma linha de imunoensaio qualitativo para a de-
poucos relatos de casos.8-11 teco de 11 autoanticorpos imunoglobulina G humana (IgG)
No presente estudo, apresentamos uma srie de pacientes contra antgenos miosite especficos ou associados em soro
com SAS anti-PL-7, anti-PL-12 e anti-EJ. ou plasma (Euroimmun, Lbeck, Alemanha). Para aumentar a
especificidade do mtodo, seguimos o protocolo do fabricante.
A positividade da reao foi definida arbitrariamente como
Pacientes e mtodos sendo negativa, fraca (+/+++), moderada (++/+++) ou intensa
(+++/+++) por dois pesquisadores independentes (MGPC e
Dos 222 pacientes com diagnstico firmado de miopatia in- SKS), e para tanto, foram includos controles positivo e nega-
flamatria idioptica, foram identificados e analisados 20 pa- tivo como referncia. Para o presente estudo, consideramos
cientes com SAS anti-PL-7, anti-PL-12 ou anti-EJ, em acompa- apenas os casos com positividade moderada a intensa.
nhamento em nosso servio tercirio, no perodo entre 1980 e Exames complementares (radiografia de trax, tomografia
2012. Todos os 20 pacientes preenchiam os critrios de Bohan computadorizada de trax, eletrocardiograma, eletroneuro-
e Peter,12 e apresentavam febre no incio da doena, fenme- miografia, bipsia muscular de bceps braquial ou msculo
no de Raynaud, mos de mecnico, envolvimento muscular, vasto lateral da coxa) foram realizados como procedimento
pulmonar e/ou articular. O estudo foi aprovado pela comisso de rotina nas consultas mdicas iniciais para o diagnstico
de tica local (Protocolo de Pesquisa HC n 0039/10). de SAS.
Os dados demogrficos, teraputicos, clnicos e laborato- A recidiva da doena foi definida como a recorrncia de
riais foram obtidos por meio de uma reviso sistemtica dos manifestaes clnicas e/ou aumento de nvel srico de enzi-
pronturios dos pacientes. Como manifestaes clnicas, os mas musculares atribudas atividade da doena, progresso
seguintes parmetros foram analisados: sintomas constitu- de leso pulmonar (clnica ou radiolgica), aps a excluso de
cionais, alteraes cutneas (helitropo, ppulas de Gottron, possveis processos neoplsicos ou infecciosos.
fenmeno de Raynaud), acometimento articular (artralgia e/ Corticosteroide foi a terapia inicial utilizada (prednisona
ou artrite), presena de disfagia, disfonia, dispneia e fora 1 mg/kg/dia, oral), seguida de reduo progressiva da dose de

RBR 53(4) - Arquivo livro (Impressa).indb 353 21/10/2013 18:21:27


354 R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 5 2 3 5 7

acordo com resultados clnicos e laboratoriais. Em casos de Em relao ao tratamento inicial, todos os pacientes rece-
gravidade da doena (progresso da dispneia, disfagia, perda beram corticosteroide (prednisona 1 mg/kg/dia) e sete pacien-
significativa de fora muscular), foi realizada pulsoterapia tes (35,0%) receberam pulsoterapia adicional de metilpredni-
com metilprednisolona (1 g/dia por trs dias consecutivos) e/ solona, necessidade maior no subgrupo anti-EJ (tabela 2).
ou imunoglobulina intravenosa humana (1 g/kg/dia por dois Vrios imunossupressores foram utilizados, dependendo
dias consecutivos). da tolerncia, efeitos colaterais e refratariedade: azatioprina
Como poupadores de corticosteroides, os seguintes imu- (55,0%), metotrexato (25,0%), ciclosporina (5,0%) ou imunoglo-
nossupressores foram utilizados: azatioprina (2-3 mg/kg/dia), bulina intravenosa humana (5,0%). Ciclofosfamida parenteral
metotrexato (20-25 mg/semana), ciclosporina (2-4 mg/kg/dia), (25,0%) foi realizada como monoterapia ou em associao a
micofenolato de mofetil (2-3 g/dia), leflunomida (20 mg/dia), outros imunossupressores, visando o tratamento do quadro
ciclofosfamida intravenosa mensal (0,5-1,0 g/m2 de superfcie pulmonar.
corprea) e difosfato de cloroquina (3-4 mg/kg/dia).
Os resultados foram expressos como mdia desvio-pa-
dro (DP), mediana [interquatil] ou porcentagens (%). Tabela 1 Caractersticas demogrficas, clnicas
e laboratoriais dos 20 pacientes com a sndrome
antissintetase anti-PL-7, anti-PL-12 ou anti-EJ
Resultados Total Anti-PL-7 Anti- Anti-EJ
(n = 20) (n = 8) PL-12 (n = 6)
Vinte pacientes consecutivos com SAS foram analisados (n = 6)
ao longo de 32 anos. Entre os autoanticorpos analisados, Sexo feminino 17 (85,0) 8 (100,0) 3 (50,0) 6 (100,0)
oito pacientes apresentavam anti-PL-7, seis apresentavam Cor branca 14 (70,0) 6 (75,0) 3 (50,0) 5 (83,3)
anti-PL-12, e outros seis, anti-EJ. Da populao total anali- Mdia de idade ao 38,5 12,9 38,4 10,0 40,3 36,7
diagnstico 17,3 13,5
sada, no houve casos de anti-OJ, motivo pelo qual no ser
Durao mdia da 4,5 6,4 1,5 0,5 3,5 2,1 9,0 10,7
abordado no presente trabalho. Todos os pacientes apre- doena
sentavam positividade tambm para fator antincleo (FAN Sintomas constitucionais 18 (90,0) 8 (100,0) 5 (83,3) 5 (83,3)
- Hep2) com ttulo 1/200 [padro nuclear homogneo em Acometimento cutneo
6 (30%) casos, e citoplasmtico em 15 (75%) dos casos]. A Helitropo 10 (50,0) 3 (37,5) 3 (50,0) 4 (66,7)
tabela 1 mostra as caractersticas demogrficas, clnicas e Ppulas de Gottron 8 (40,0) 3 (37,5) 1 (16,7) 4 (66,7)
Fenmeno de Raynaud 8 (40,0%) 4 (50,0) 2 (33,3) 2 (33,3)
laboratoriais destes pacientes.
Acometimento muscular
A SAS afetou predominantemente indivduos de cor bran-
Membros superiores
ca (70%), sexo feminino (85%), com a mdia de idade ao incio Grau V 3 (15) 1 (12,5) 2 (33,3) 1 (16,7)
da doena de 38,5 12,9 anos (variao: 17 a 63 anos), e com Grau IV 12 (60,0) 4 (50,0) 4 (66,7) 4 (66,7)
a durao mdia da doena de 4,5 6,4 anos (variao: 1-30 Grau III 5 (35,0) 3 (37,5) 0 1 (16,7)
anos). Em nossa casustica todas as pacientes do grupo anti Grau II ou I 0 0 0 0
PL-7 e anti-EJ eram do sexo feminino. Membros inferiores
Grau V 0 0 0 0
Sintomas constitucionais foram evidenciados em 90%
Grau IV 14 (70,0) 5 (63,5) 4 (66,7) 5 (83,3)
dos casos, sendo 100% em pacientes com anti-PL-7. Envol-
Grau III 6 (30,0) 3 (37,5) 2 (33,3) 1 (16,7)
vimento articular, cutneo e fenmeno de Raynaud aconte- Grau II ou I 0 0 0 0
ceram em aproximadamente metade dos pacientes. Todos Acamados 6 (30,0) 4 (50,0) 1 (16,7) 1 (16,7)
os pacientes apresentavam fraqueza muscular objetiva dos Acometimento articular 10 (50,0) 4 (50,0) 3 (50,0) 5 (83,3)
membros (superiores e/ou inferiores), a maioria com grau III Acometimento do TGI
ou IV e nenhum com grau I ou II. Sendo fatores de progns- Disfagia 13 (65,0) 6 (75,0) 2 (33,3) 2 (33,3)
Acometimento do TR 13 (65,0) 5(63,5) 4 (66,7) 4 (66,7)
tico da doena, 30% encontravam-se acamados e dois tero
Disfonia 3 (15,0) 1 (12,5) 1 (16,7) 1 (16,7)
com disfagia alta na ocasio do diagnstico. O acometimen- Dispneia 10 (50,0) 4 (50,0) 3 (50,0) 3 (50,0)
to do trato respiratrio superior ocorreu em 15% dos casos, Acometimento 0 0 0 0
enquanto a dispneia (moderada a grandes esforos) em me- neurolgico
tade dos casos, igualmente distribudos em todos os grupos. Acometimento cardaco 0 0 0 0
No houve casos de envolvimento neurolgico e/ou cardaco Creatinoquinase (U/L) 1124 3350 812 2787
[812-8500] [1079-5400] [45-1040] [1000-
(sndrome coronariana, trombose venosa profunda ou aci-
3500]
dente cerebrovascular).
Aldolase (U/L) 28,4 34,5 15,7 87,4
O nvel srico de creatinoquinase e aldolase no incio da [15,7-55,9] [20,8-73,9] [4-39] [15,7-
doena foi de 1124 [812-8500] U/L e 28,4 [15,7-55,9] U/L, res- 159,0]
pectivamente. Os maiores valores foram evidenciados no sub- TC trax
grupo anti-EJ. Vidro-fosco (%) 9 (45,0) 4 (50,0) 2 (33,3) 3 (50,0)
Em relao ao achado de imagens pulmonares (tomogra- Ndulos (%) 2 (10,0) 1 (16,7) 1 (10,0) 0
Fibrose bibasal (%) 3 (15,0) 2 (25,0) 0 1 (16,7)
fia computadorizada), quase metade dos pacientes tinha evi-
dncia de pneumopatia incipiente, leses em vidro-fosco e/ IVIG, imunoglobulina intravenosa humana; TC, tomografia
ou fibrose pulmonar basal. Os pacientes anti-PL-7 foram os computadorizada; TGI, trato gastrintestinal; TR, trato respiratrio.
Resultados expressos em mdia desvio padro, mediana
que demonstraram maior acometimento pulmonar, com pre-
[interquatil] ou percentagens (%)
dominncia de leses em vidro-fosco.

RBR 53(4) - Arquivo livro (Impressa).indb 354 21/10/2013 18:21:27


R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 5 2 3 5 7 355

comercial em nosso estudo para a definio desses autoan-


Tabela 2 Tratamento medicamentoso e evoluo dos
20 pacientes com a sndrome antissintetase anti-PL-7, ticorpos,.
anti-PL-12 ou anti-EJ As manifestaes clnicas da SAS se traduzem caracte-
risticamente em miosite, doena intersticial pulmonar e/ou
Total Anti-PL-7 Anti-PL-12 Anti-EJ
(n = 20) (n = 8) (n = 6) (n = 6) envolvimento articular. A presena de febre, fenmeno de
Raynaud e mos de mecnico tambm pode ser observada.17,18
Metilprednisolona 7 (35,0) 1 (12,5) 2 (33,3) 4 (66,7)
O acometimento muscular encontrado em mais de 90%
Prednisona 20 (100,0) 8 (100,0) 6 (100,0) 6 (100,0)
Azatioprina 11 (55,0) 4 (50,0) 2 (33,3) 5 (83,3) dos casos com manifestaes de mialgias, fraqueza muscular,
Metotrexato 5 (25,0) 1 (12,5) 4 (66,7) 0 atrofia e fibrose. O sintoma inicial, em geral, envolve fraqueza
Ciclosporina 1 (5,0) 0 1 (16,7) 0 muscular proximal dos membros.1 Essas alteraes so evi-
Ciclofosfamida 5 (25,0) 1 (12,5) 2 (33,3) 2 (33,3) dentes na bipsia muscular, eletromiografia e aumento das
IVIG 1 (5,0) 1 (12,5) 0 0 enzimas musculares. Nossos pacientes apresentaram au-
Recidivas 6 (30,0) 2 (25,0) 1 (16,7) 3 (50,0)
mento significativo do nvel srico das enzimas musculares,
Neoplasias 1 (5,0%) 0 0 1 (16,7)
no incio da doena, alm de fraqueza muscular objetiva dos
bitos 2 (10,0) 1 (12,5) 1 (16,7) 0
membros superiores e/ou inferiores. Os pacientes com SAS
IVIG, imunoglobulina intravenosa humana.
anti-PL-7 apresentaram, em nossa casustica, maior fraqueza
Resultados expressos em mdia desvio padro, mediana
global, apesar dos valores do nvel srico das enzimas mus-
[interquatil] ou percentagens (%)
culares serem mais altos no subgrupo anti-EJ. Sugere-se, por-
tanto, que na populao estudada no necessariamente haja
A recidiva da doena (clnica e/ou laboratorial) ocorreu relao linear entre as alteraes laboratoriais e maior gravi-
aproximadamente em um tero dos casos, principalmente no dade de acometimento muscular no momento do diagnstico.
grupo de anti-EJ. O comprometimento pulmonar, mesmo na ausncia de
Neoplasia (mamria) ocorreu em um caso (5,0%), no grupo alteraes musculares, encontrado em mais de 60% e a
anti-EJ, na ocasio do diagnstico da miopatia inflamatria. O principal causa de morbidade.19,20 Em alguns casos, a doena
paciente foi submetido mastectomia radical com resoluo intersticial pulmonar predominante na SAS, podendo ser
da neoplasia. de incio rpido, levando insuficincia respiratria aguda,
Durante o seguimento, dois pacientes evoluram para bito sendo, por vezes, altamente refratria aos tratamentos insti-
(um paciente do grupo anti-PL-12, cujo bito foi decorrente de tudos.21,22 As manifestaes pulmonares descritas incluem
abscesso glteo e sepse; e outro paciente do grupo anti-PL-7, dispneia, tosse, dor torcica, intolerncia a exerccios fsicos e
cujo bito foi decorrente de pneumonia aspirativa associada insuficincia respiratria.21 Anticorpos antissintetases, parti-
disfagia alta). cularmente anti-PL-7 e anti-PL-12, esto fortemente associa-
dos com doena pulmonar intersticial, cuja associao chega
a 90-100% dos casos.10,19,22,23 Na anlise de grande nmero de
Discusso pneumonias intersticiais idiopticas, o encontro de SAS no
foi rara, sendo a maior parte dos casos associada ao anti-EJ.23
Apresentamos as caractersticas clnicas, laboratoriais e evo- Em nossa casustica, dispneia e alteraes pulmonares acon-
lutivas de uma srie de 20 pacientes com SAS anti-PL-7, anti- teceram em taxas semelhantes nos trs subgrupos estuda-
-PL-12 e anti-EJ. Devido a raros trabalhos epidemiolgicos na dos, e com frequncia menor que a descrita na literatura.10,19,23
literatura,8-11,13 o presente trabalho fornece uma viso geral As imagens radiolgicas podem revelar um padro intersti-
deste subgrupo de pacientes. cial, leso em vidro-fosco, opacidades lineares, consolidaes
A SAS afeta principalmente indivduos adultos na propor- parenquimatosas e/ou microndulos, com prova de funo
o de 2,3:1 (mulher:homem).1-14 No presente estudo, a SAS pulmonar de padro restritivo.20,24 No presente estudo, quase
acometeu apenas o sexo feminino, com a exceo do grupo metade dos pacientes apresentava evidncia de pneumopatia
com anti-PL-12, em que a doena acometeu igualmente am- incipiente, leses em vidro-fosco e/ou fibrose pulmonar basal
bos os sexos. tomografia computadorizada de trax de alta resoluo.
A SAS apresenta anticorpos contra diferentes aminoacil- Envolvimento articular afeta 50% dos casos, como artral-
-tRNA sintetases que, por sua vez, so protenas citoplas- gia e/ou artrite, com ou sem eroses sseas.25 Os dados do
mticas pertencentes famlia de enzimas, cuja funo presente estudo reforam essa prevalncia. O fenmeno de
catalisar a unio de aminocidos especficos tRNA.2-15 A Raynaud, mos de mecnico, fotossensibilidade, rash malar,
presena desses anticorpos encontrada em aproximada- vasculite cutnea podem tambm estar presentes.25 Envolvi-
mente 20-40% dos adultos polimiosite e 5% com dermato- mento cardaco tambm tem sido observado, mas sua pre-
miosite,1-3,13 sendo o mais frequente o anticorpo anti-Jo-1.16-18 valncia no parece diferir da dermatomiosite/polimiosite.26
Recentemente, apresentamos o perfil clnico e laboratorial No presente estudo, metade dos pacientes (maioria anti-EJ)
de pacientes com SAS anti-Jo-1.7 No presente estudo foram apresentou alteraes cutneas, e no houve casos de aco-
analisados apenas os pacientes com anti-PL-7, anti-PL-12 metimento cardaco.
ou anti-EJ. A presena de autoanticorpos contra aminoacil- A corticoterapia o tratamento de primeira linha para
-tRNA sintetases fundamental para a definio de SAS, miosite e tambm para a pneumopatia intersticial em SAS.27
embora, at o presente momento, no haja ensaios laborato- No presente estudo, todos os pacientes usaram corticosteroi-
riais padronizados e validados para a caracterizao desses des. Alm disso, um tero dos pacientes precisou de pulsote-
autoanticorpos.13 Apesar dessa limitao, utilizamos um kit rapia com metilprednisolona devido gravidade da doena

RBR 53(4) - Arquivo livro (Impressa).indb 355 21/10/2013 18:21:27


356 R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 5 2 3 5 7

(disfagia alta, acamado e/ou progresso do quadro de disp- REFERNCIAS


neia objetiva).
Quanto ao uso de imunossupressores, nenhum consenso
foi alcanado. A evidncia disponvel na literatura fraca, 1. Medsger TA, Oddis CV. Inflammatory muscle disease. Clinical
baseando-se em relatos de caso e revises.28-30 Alm da falta features. In: Rheumatology. Eds JH Klippel, PA Dieppe.
de consenso, o manejo de imunossupressores pode variar de London, UK: Mosby; 1994.
2. Hengstman GJ, van Engelen BG, van Venrooij WJ. Myositis
acordo com a experincia regional e com a especialidade na
specific autoantibodies: changing insights in pathophysiology
qual os pacientes esto em seguimento, como neurologia, and clinical associations. Curr Opin Rheumatol.
pneumologia e/ou reumatologia. No presente estudo, como a 2004;16(6):692-9.
experincia do nosso servio de reumatologia, os imunossu- 3. Imbert-Masseau A, Hamidou M, Agard C, Grolleau JY,
pressores mais rotineiramente utilizados nos pacientes com Chrin P. Antisynthetase syndrome. Joint Bone Spine.
SAS foram azatioprina, ciclofosfamida e metotrexato. 2003;70(3):161-8.
Aps a administrao de corticosteroides, todos os pa- 4. Spth M, Schrder M, Schlotter-Weigel B, Walter MC,
Hautmann H, Leinsinger G, et al. The long-term outcome
cientes apresentaram remisso inicial da doena, em con-
of anti-Jo-1-positive inflammatory myopathies. J Neurol.
traste com relatos da literatura que descrevem a taxa de re- 2004;251(7):859-4.
misso de 21 a 68%.31,32 Essa discrepncia pode ser explicada 5. Gran JT. Anti-synthetase syndrome. Tidsskr Nor Laegeforen.
pelo uso mais frequente de pulsoterapia no estudo. Em um 2009;129(16):1631.
tero dos nossos pacientes, principalmente naqueles com 6. Vncsa A, Cspo I, Nmeth J, Dvnyi K, Gergely L, Dank K.
anti-PL-7, houve frequncia de recidivas da doena. J os da- Characteristics of interstitial lung disease in SS-A positive/
dos da literatura mostram que as recidivas acontecem em Jo-1 positive inflammatory myopathy patients. Rheumatol.
Int 2009;29(9):989-94.
6-43% dos casos.26,31
7. Shinjo SK, Levy-Neto M. Anti-Jo-1 antisynthetase syndrome.
A taxa de mortalidade nos pacientes com SAS varia de
Rev Bras Reumatol. 2010;50(5):492-500.
12-40%.33-35 Em nossos pacientes, apenas dois evoluram para 8. Kalluri M, Sahn SA, Oddis CV, Gharib SL, Christopher-Stine L,
bito (um decorrente de abscesso glteo e sepse, e o outro Danoff SK, et al. Clinical profile of anti-PL-12 autoantibody.
decorrente de pneumonia aspirativa secundria a disfagia Cohort study and review of the literature. Chest.
alta) portanto, uma baixa taxa de mortalidade. 2009;135(6):1550-6.
Alm disso, houve um caso de neoplasia (mamria), 9. Targoff IN, Arnett FC. Clinical manifestations in patients with
antibody to PL-12 antigen (alanyl-tRNA synthetase). Am J
identificado na ocasio do diagnstico da SAS anti-EJ,
Med. 1990;88(3):241-51.
quando foi realizada mastectomia radical, com a resoluo
10. Labirua A, Lundberg IE. Interstitial lung disease and
da neoplasia. idiopathic inflammatory myopathies: progress and pitfalls.
Como limitao de nosso presente estudo, analisamos Curr Opin Rheumatol. 2010;22(6):633-8.
apenas os pacientes com SAS em acompanhamento em um 11. Labirua-Iturburu A, Selva-OCallaghan A, Vincze M, Dank
servio tercirio, o que pode no refletir a real distribuio K, Vencovsky J, Fisher B, et al. Anti-PL-7 (anti-threonyl-
de pacientes com SAS em nosso meio. Alm disso, no fo- tRNA synthetase) antisynthetase syndrome: clinical
manifestations in a series of patients from a European
ram includos pacientes em acompanhamento em outras
multicenter study (EUMYONET) and review of the literature.
especialidades, como a pneumologia que pode estar acom-
Medicine (Baltimore) 2012. [In press].
panhando pacientes com pneumopatia intersticial definida, 12. Bohan A, Peter JB. Polymyositis and dermatomyositis (first of
independente de acometimento muscular, e fazendo parte two parts). N Engl J Med. 1975;292(7):344-7.
do grupo de SAS. 13. Ghirardello A, Rampudda M, Ekholm L, Bassi N, Tarricone E,
Em concluso, SAS anti-PL-7, anti-PL-12 e anti-EJ, em et al. Diagnostic performance and validation of autoantibody
nossa populao, afetou predominantemente mulheres de testing in myositis by a commercial line blot assay.
Rheumatology (Oxford). 2010;49(12):2370-4.
cor branca. Embora os autoanticorpos descritos no presen-
14. Hengstman GJD, van Venrooij WJ, Vencovsky J, Moutsopoulos
te estudo estejam mais relacionados com o acometimento
HM, van Engelen BGM. The relative prevalence of
pulmonar comparativamente ao articular, nossos pacientes dermatomyositis and polymyositis in Europe exhibits a
apresentaram uma porcentagem significativa de ambos, latitudinal gradient. Ann Rheum Dis. 2000;59(2):141-2.
alm de alta frequncia de acometimento muscular. Houve 15. Plotz PH, Targoff I. Myositis associated antigens. Aminoacyl-
tambm baixa taxa de mortalidade. Estudos de maior casu- tRNA synthetases. In: Manual of Biological Markers of
stica so necessrios para verificar a realidade destas as- Disease. Eds, WJ Van Venrooij, R Maini. The Netherlands:
Kluwer Academic Publications. 1994;1(6):1-18.
sociaes.
16. Nishikai M, Reichlin M. Heterogeneity of precipitating
antibodies in polymyositis and dermatomyositis.
Characterization of the Jo-1 antibody system. Arthritis
Suporte financeiro Rheum. 1980;23(8):881-8.
17. Brouwer R, Hengstman GJD, Vree Egberts W, Ehrfeld H,
SK Shinjo (Federico Foundation), MAP Cruellas (FAPESP Bozic B, Ghirardello A, et al. Autoantibody profiles in the
#2012/03399-9), Presente estudo (FAPESP #2011/12700-1). sera of European patients with myositis. Ann Rheum Dis.
2001;60(2):116-23.
18. Love LA, Leff RL, Fraser DD, Targoff IN, Dalakas M, Plotz PH,
et al. A new approach to the classification of idiopathic
Conflitos de interesse
inflammatory myopathy: myositis-specific autoantibodies
define useful homogeneous patient groups. Medicine.
Os autores declaram no haver conflitos de interesse. (Baltimore) 1991;70(6):360-74.

RBR 53(4) - Arquivo livro (Impressa).indb 356 21/10/2013 18:21:28


R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 5 2 3 5 7 357

19. Gugliemi S, Merz M, Gugger M, Suter C, Nicod LP. Acute pneumonia and severe pulmonary hypertension. Intern Med.
respiratory distress syndrome secondary to antisynthetase 2005;44(4):319-25.
syndrome is reversible with tacrolimus. Eur Respir J. 28. Douglas WW, Tazelaar HD, Hartman TE, Hartman RP, Decker
2008;31(1):213-7. PA, Schroeder DR, et al. Polymyositis-dermatomyositis-
20. Clawson K, Oddis CV. Adult respiratory distress syndrome in associated interstitial lung disease. Am J Respir Crit Care
polymyositis patients with the anti-Jo-1 antibody. Arthritis Med. 2001;164(7):1182-5.
Rheum. 1995;38(10):1519-23. 29. Wilkes MR, Sereika SM, Fertig N, Lucas MR, Oddis CV.
21. Marie I, Hatron PY, Hachulla E, Wallaert B, Michon-Pasturel Treatment of antisynthetase-associated interstitial lung
U, Devulder B. Pulmonary involvement in polymyositis and disease with tacrolimus. Arthritis Rheum. 2005;52(8):2439-46.
in dermatomyositis. J Rheumatol. 1998;25(7):1336-13. 30. Kenji N, Masayoshi H, Masako H, Yasuyuki Y, Takao
22. Ikezoe J, Johkoh T, Kohno N, Takeuchi N, Ichikado K, K, Nobuyuki M. Efficacy of cyclosporine treatment to
Nakamura H. High-resolution CT findings of lung disease in interstitial pneumonitis associated with polymyositis and
patients with polymyositis and dermatomyositis. J Thorac dermatomyositis. Arthritis Rheum. 2001;44:S353.
Imaging. 1999;11(4):250-9. 31. Frost NA, Morand EF, Hall CL, Maddison PJ, Bhalla AK.
23. Watanabe K, Handa T, Tanizawa K, Hosono Y, Taguchi Y, Idiopathic polymyositis complicated by arthritis and
et al. Detection of antisynthetase syndrome in patients mesangial proliferative glomerulonephritis: case report and
with idiopathic interstitial pneumonias. Respir Med. review of the literature. Br J Rheumatol. 1993;32(10):929-31.
2011;105(8):1238-47. 32. Selva-OCallaghan A, Labrador-Horrilllo M, Solans-Laque R,
24. Akira M, Hara H, Sakatani M. Interstitial lung disease in Pilar Simeon-Aznar C, Martinez-Gomez X, Viardell-Tarres
association with polymyositis-dermatomyositis: long- M. Myositis specific and myositis-associated antibodies in a
term follow-up CT evaluation in seven patients. Radiology. series of eighty-eight Mediterranean patients with idiopathic
1999;210(2):333-8. inflammatory myopathy. Arthritis Rheum. 2006;55(5):791-8.
25. Targoff IN, Arnett FC. Clinical manifestations in patients 33. Lee W, Zimmermann B 3rd, Lally EV. Relapse of polymyositis
with antibody to PL-12 antigen (alanyl-tRNA synthetase). after prolonged remission. J Rheumatol. 1997;24(8):1641-4.
Am J Med. 1990;88(3):241-51. 34. Tillie-Leblond I, Wislez M, Valeyre D, Crestani B, Rabbat A,
26. Poveda Gomez F, Merino JL, Mate I, Sobrino JA, Camacho J, Israel-Biet D, et al. Interstitial lung disease and anti-Jo-1
Gamallo C. Polymyositis associated with anti-Jo1 antibodies: antibodies: difference between acute and gradual onset.
severe cardiac involvement as initial manifestation. Am J Thorax. 2008;63(1):53-9.
Med. 1993;94(1):110-1. 35. Bronner IM, van der Meulen MFG, de Visser M, Kalmijn
27. Handa T, Nagai S, Kawabata D, Nagao T, Takemura M, S, van Venrooij WJ, Voskuyl AE, et al. Long-term outcome
Kitaichi M et al. Long-term clinical course of a patient in polymyositis and dermatomyositis. Ann Rheum Dis.
with anti PL-12 antibody accompanied by interstitial 2006;65(11):1465-61.

RBR 53(4) - Arquivo livro (Impressa).indb 357 21/10/2013 18:21:28


R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 5 8 3 6 4

REVISTA BRASILEIRA DE
REUMATOLOGIA
www.reumatologia.com.br

Artigo de reviso

Reviso sistemtica da induo de autoanticorpos e lpus


eritematoso pelo infliximabe

Joo Luiz Pereira Vaz a,b,*, Carlos Augusto Ferreira Andrade c, Alessandra Cardoso Pereira a,d,
Maria de Ftima M. Martins e, Roger Abramino Levy a
a
Universidade do Estado do Rio de Janeiro, Rio de Janeiro, RJ, Brasil
b
Universidade Federal do Estado do Rio de Janeiro, Rio de Janeiro, RJ, Brasil
c
Insituto de Pesquisa Clnica Evandro Chagas, Fundao Oswaldo Cruz, Rio de Janeiro, RJ, Brasil
d
Universidade do Grande Rio Professor Jos de Souza Herdy, Rio de Janeiro, RJ, Brasil
e
Instituto de Comunicao e Informao Cientfica e Tecnolgica em Sade, Fundao Oswaldo Cruz, Rio de Janeiro, RJ, Brasil

informaes resumo

Histrico do artigo: Nesta reviso sistemtica abordamos a induo de autoanticorpos e lpus eritematoso
Recebido em 20 de abril de 2012 pelo infliximabe, analisando estudos que dosaram vrios autoanticorpos antes e aps o uso
Aceito em 14 de agosto de 2012 do infliximabe em diversas doenas (artrite reumatoide, espondilite anquilosante, artrite
psorisica e doena de Crohn). Nossa busca foi realizada em nove bases de dados (Pub-
Palavras-chave: Med, ScienceDirect, Scopus, Web of Knowledge, Scirus, Cochrane, EMBASE, Scielo e LILACS).
Infliximabe Foram encontradas 998 referncias; 24 artigos foram separados na ntegra, dos quais 10
Terapia biolgica foram excludos por no entrarem em nossos critrios de seleo. A escolha dos artigos
Autoanticorpos foi realizada por dois revisores, e as divergncias foram resolvidas por um terceiro revi-
sor. Inclumos estudos de fase IV, com no mnimo trs meses de durao. No total foram
estudados 760 pacientes; o fator antinuclear, o anticorpo anti-DNA de dupla hlice e os
antgenos extrados pela salina foram os mais verificados. De todos os pacientes, apenas 10
(1,3%) apresentaram manifestaes clnico-laboratoriais de lpus induzido por infliximabe.
2013 Elsevier Editora Ltda. Todos os direitos reservados.

Systematic review of infliximab-induced autoantibodies and systemic


lupus erythematosus

abstract

Keywords: The present systematic review aims to discuss infliximab-induced autoantibodies and sub-
Infliximab sequent onset of systemic lupus erythematosus (SLE) through the analyses of primary re-
Biologic therapy ports measuring autoantibodies both before and after the administration of infliximab for
Autoantibodies the treatment of several diseases e.g., rheumatoid arthritis, ankylosing spondylitis, pso-
riatic arthritis, and Crohns disease. Our literature search was performed in nine databases
PubMed, Science Direct, Scopus, Web of Knowledge, Scirus, Cochrane, EMBASE, Scielo and
LILACS, and the search query retrieved 998 primary reports, from which 24 articles were
selected and further narrowed down to 14, based on our inclusion criteria. Two indepen-


Trabalho realizado na Universidade do Estado do Rio de Janeiro, Rio de Janeiro, RJ, Brasil.
* Autor para correspondncia.
E-mail: drjoaovaz@gmail.com (J.L.P. Vaz).
0482-5004/$ - see front matter. 2013 Elsevier Editora Ltda. Todos os direitos reservados.

RBR 53(4) - Arquivo livro (Impressa).indb 358 21/10/2013 18:21:28


R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 5 8 3 6 4 359

dent reviewers performed the article selection and a third reviewer solved discrepancies.
Our inclusion criteria comprised primary reports of phase IV clinical trials with duration of
at least three months. In total, 760 patients were evaluated and the most prevalent assays
performed in the studies were anti-nuclear antibodies (ANA), anti-double stranded DNA
antibodies (anti-dsDNA), and antibodies to saline-extracted antigens (ENA panel). Of all
patients evaluated, 10 (1.3%) showed clinical signs and laboratorial evidence of infliximab-
induced SLE.
2013 Elsevier Editora Ltda. All rights reserved.

podem demorar alguns meses aps a suspenso da medica-


Introduo o para desaparecer.8
Apesar de a terapia anti-TNF favorecer o aparecimento de
O advento da terapia biolgica mudou o perfil do tratamento autoanticorpos, as complicaes autoimunes clnicas so ex-
das doenas autoimunes. No entanto, apesar de mais de uma cepcionais.9 Em relao produo de autoanticorpos pelos
dcada de utilizao dos agentes antifator de necrose tumo- agentes anti-TNF, alguns mecanismos so propostos: a) como
ral (anti-TNF), ainda restam muitas dvidas, e uma das mais o anti-TNF reduz as protenas de fase aguda e a fagocitose dos
importantes recai sobre a relao entre a induo de autoan- restos celulares apoptticos, a persistncia dos restos nucle-
ticorpos e determinadas enfermidades como o lpus induzi- ares seria imunognica e levaria induo da sntese de au-
do por drogas (LID). Neste trabalho, realizamos uma reviso toanticorpos;10 e b) os anti-TNF poderiam induzir a apoptose
sistemtica sobre o papel do infliximabe como indutor de au- das clulas produtoras de TNF e inibir o clearence desses restos
toanticorpos, mostrando o que j se publicou a este respeito. celulares apoptticos que, por sua vez, seriam imunognicos
Com relao resposta imune, aps a estimulao anti- e levariam induo da sntese de autoanticorpos.11 Neste
gnica, conforme o ambiente local de citocinas, os linfcitos trabalho optamos por utilizar apenas o infliximabe, que um
T CD4+ nave proliferam-se e diferenciam-se em diferentes agente anti-TNF quimrico, contendo, portanto, uma poro
subtipos efetores com caractersticas prprias (Th1, Th2, Th3, murina imunognica os outros agentes biolgicos dessa
Treg, Th17), determinadas pelo perfil de citocinas produzidas classe so humanos, apresentando menor chance de induzir
e pelas propriedades funcionais. Dessa forma, as citocinas fenmenos de origem autoimune.
do perfil Th1 ou Th2 direcionam o desenvolvimento de sua
respectiva via, inibindo a expresso do padro oposto. Assim,
uma vez polarizada a resposta imune para o padro Th1, a Mtodos
via Th2 ser inibida, e vice-versa.1 Como os agentes anti-TNF
inibem a resposta Th1, poderia ocorrer um aumento no apare- Esta reviso sistemtica foi realizada de acordo com a dire-
cimento de fenmenos de autoimunidade de perfil Th2, como triz PRISMA (Preferred Reporting Itens for Systematic Reviews and
no lpus eritematoso sistmico (LES). Entretanto, a ocorrncia Meta-Analyses).12
de LES tem sido relatada de forma espordica, apesar de a
produo de fatores antinucleares e autoanticorpos ser bem Bancos de dados e estratgias de pesquisa
mais frequente.2-4 Cabe ressaltar a dificuldade de comprova-
o de LID por uma determinada medicao, pois para isso A busca foi realizada em nove bases de dados (PubMed,
os sintomas devem melhorar com a interrupo do uso da ScienceDirect, Scopus, Web of Knowledge, Scirus, Cochrane,
mesma (dias a semanas aps suspenso) e reaparecer ou rea- EMBASE, SciELO e LILACS), incluindo a chamada literatura
gravar a doena ao reinici-la. No entanto, na prtica clnica cinza (Scirus). No foram feitas restries de idiomas. Fo-
difcil procedermos dessa forma. Alm disso, o medicamento ram avaliados todos os artigos encontrados at janeiro de
deve estar sendo empregado pelo menos por um ms, mas 2012. Elaborou-se com o auxlio de uma bibliotecria com
talvez esses dados no se apliquem a agentes biolgicos.5 experincia em revises sistemticas a seguinte estrat-
Quando falamos em LID, devemos lembrar que os sinto- gia de pesquisa na base PubMed : #2 Search infliximab; #4
mas so um pouco diferentes daqueles apresentados no LES, Search (autoantibodies[MeSH Terms]) OR autoimmu-
sendo mais comuns as artralgias, as mialgias, a febre, o mal- ne diseases[MeSH Terms]) OR autoimmunity[MeSH Ter-
-estar e as serosites, e raras as leses renais e alteraes neu- ms]08:21:05359160; #7 Search (arthritis, psoriatic/drug
rolgicas. As manifestaes cutneas clssicas do LES como therapy[MeSH Terms]) OR psoriasis/drug therapy[MeSH
rash malar e leses discoides so incomuns no LID, sendo as Terms]) OR spondylitis, ankylosing/drug therapy[MeSH
leses inespecficas (eritema nodoso e prpura) mais frequen- Terms]) OR crohn disease/drug therapy[MeSH Terms]) OR
tes neste caso. No entanto, no lpus induzido pelos anti-TNF, proctocolitis/drug therapy[MeSH Terms]) AND arthritis,
sobretudo pelo infliximabe, podem ser observadas leses rheumatoid/drug therapy[MeSH Terms]08:24:33805. Nas ou-
clssicas como o rash malar e o lpus discoide.6 Do ponto de tras bases de dados foram utilizadas estratgias equivalentes.
vista laboratorial, encontramos comumente fator antinuclear O banco de dados da busca eletrnica foi criado com o au-
(FAN) reator, leucopenia, trombocitopenia, anemia e anticor- xlio do programa Webendnote. Citaes duplicadas foram
po anti-histona. Esse ltimo, na realidade, inespecfico, pois excludas. Ttulos e resumos relevantes foram selecionados
pode tambm ser observado no LES.7 Os achados laboratoriais por dois revisores (Vaz JLP, Pereira AC), e as divergncias fo-

RBR 53(4) - Arquivo livro (Impressa).indb 359 21/10/2013 18:21:28


360 R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 5 8 3 6 4

ram resolvidas por um consenso ou por um terceiro revisor A excluso dos 919 resumos se deu porque, apesar de terem
(Andrade CAF), quando necessrio. sido recuperados pela busca eletrnica, no preenchiam os
critrio de incluso (fig. 1). Em que pese as meticulosas buscas
Critrios de seleo e extrao de dados de referncias cruzadas nos artigos selecionados, no foi ob-
tido nenhum artigo adicional. Foram estudados 760 pacientes
Foram selecionados apenas artigos referentes a ensaios clni- no total, sendo avaliados artigos dos seguintes pases: Blgica,
cos e estudos de coortes com dosagem de autoanticorpos antes Canad, Frana, Israel, Itlia e Sucia (tabela 1).
e depois do uso do infliximabe, sendo excludos os relatos de Em quase todos os estudos escolhidos nesta reviso sis-
caso e artigos de reviso. Foram aceitos somente estudos com temtica foi avaliado o FAN (tabela 1). O total de pacientes
durao mnima de trs meses, tendo sido o infliximabe o pri- com avaliao do FAN foi de 695, dos quais 199 (28,6%) apre-
meiro agente biolgico usado e os pacientes deveriam ser adul- sentavam FAN reator antes do uso de infliximabe. Aps o uso
tos maiores de 18 anos. Exclumos artigos nos quais houvesse da medicao (em mdia aps seis meses, pois somente um
pacientes com diagnstico de mais de uma doena autoimune. estudo teve durao mxima de trs meses), o total de pa-
Dentre as doenas, selecionamos a artrite reumatoide (AR), a cientes com FAN reator era de 469 (67,5%), isto , houve uma
espondilite anquilosante (EA), a artrite psorisica (AP), a psor- variao de 38,9% de pacientes reatores antes e aps o infli-
ase, a doena de Crohn e a retocolite ulcerativa. Essas doenas ximabe (tabela 2).
foram escolhidas porqueo infliximabe, em adultos, pode ser Quanto ao anti-DNAds, dois estudos no o avaliaram sepa-
usado em qualquer uma dessas enfermidades. radamente (tabela 1). Dessa forma, o total de casos avaliados
Optamos por comparar somente a variabilidade dos auto- foi de 669. No incio, antes do infliximabe, somente oito (1,2%)
anticorpos (antes e aps uso do infliximabe), independente- pacientes eram reatores. Aps o tratamento, 117 (17,5%) casos
mente das titulaes. Foram aceitos estudos com os seguintes foram reatores, com uma variao de 16,2% (tabela 2).
autoanticorpos/mtodos: FAN por imunofluorescncia indire- Quanto ao anti-DNAss, apenas dois estudos pesquisaram
ta em clulas HEp-2 (independente do corte); anticardiolipina este anticorpo. Vermeire et al.,26 encontraram o anti-DNAss
(aCL) pelo mtodo ELISA; anti-DNA de dupla hlice ou nativo em cerca de 14% (17 em um total de 125) dos doentes aps uso
(anti-DNAn) por imunofluorescncia indireta utilizando como do infliximabe por 12 meses. Comby et al.16 mostraram que
substrato Crithidia lucilae e outros autoanticorpos [antgenos aps seis meses de uso de infliximabe houve um aumento de
extrados pela salina (anti-ENA total), anti-histona, anti- 12% no nmero de pacientes com altos ttulos de anti-DNAss.
-DNA de hlice simples (anti-DNAss), anti-Ro, anti-La, anti- Os estudos que avaliaram o anti-ENA total (tabela 1) no
-Sm, antirribonucleoprotena (anti-RNP), antitopoisomerase apresentaram nenhum caso antes ou aps o tratamento
(anti-SCL70), antimitocndria, antitireoide, anticitoplasma (tabela 2). Nos quatro estudos (tabela 1) que analisaram os
dos neutrfilos (ANCA), antinucleossomo, antifilagrina, anti- anti-ENA separadamente, encontraram o total de 208 casos,
microssomal fgado-rim (anti-LKM) e antiadrenal]. Foram ex- tendo o anti-Ro variado de quatro (1,9%) para cinco (2,4%)
cludos desta avaliao os artigos que verificaram somente o casos, antes e aps o infliximabe, respectivamente. Quanto
fator reumatoide e o antipeptdio citrulinado cclico (ACPA). ao anti-RNP havia somente um (0,6%) caso antes do inflixi-
mabe e 12 (7,3%) casos aps a medicao, variando em 6,7%
(n = 165). Antes da medicao havia dois (1,2%) casos com
Resultados anti-La reator, e aps a medicao esse nmero aumentou
somente para trs casos (1,8%), variando em 0,6% (n = 165).
Foram encontrados 998 artigos, sendo selecionados inicial- Apenas um (0,7%) caso era reator contra o anti-Sm (n = 139),
mente 79 resumos e, posteriormente, 24 artigos na ntegra. permanecendo assim aps o tratamento.

998 referncias identificadas em 9 bases de dados

919 resumos excludos (no preencheram os critrios de incluso)

79 resumos selecionados pelo ttulo

24 artigos selecionados para avaliao dos autores

10 artigos excludos:
2 artigos de reviso
2 artigos usaram outros biolgicos previamente
2 artigos avaliaram mtodos diagnsticos para o anti-DNAds
2 artigos incluram vrios biolgicos na mesma amostra
1 artigo no avaliou pacientes separadamente
1 artigo avaliou autoanticorpos somente antes do infliximabe

14 artigos nos critrios de incluso desta reviso sistemtica

Figura 1 Fluxograma do processo de seleo dos estudos.

RBR 53(4) - Arquivo livro (Impressa).indb 360 21/10/2013 18:21:28


R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 5 8 3 6 4 361

Tabela 1 Dados epidemiolgicos e das doenas e autoanticorpos dos estudos avaliados


Autor/ ano Pas N M/H Idade mdia Doenas Tempo de Durao do Autoanticorpos
(anos) doena estudo (meses)
(anos)
Allanore13 Frana 59 54/05 54 (41-68) AR 14 (05-23) 7,5 FAN, anti-DNAds, anti-histona,
2004 anti-ENA total
Bobbio- Itlia 30 24/06 57 (48-66) AR 9 (1-17) 18 FAN, anti-DNAds, aCL
Palavicini14
2004
Caramaschi15 Itlia 43 37/06 52 (40-64) AR 14 (5-23) 12 FAN, anti-DNAds, ANCA,
2006 antimitocndria, antitireoide,
anti-Ro
Comby16 2006 Frana 58 44/14 54 (42-66) AR 13 (04-22) 3 FAN, anti-DNAds, anti-DNAss
DeRycke17 Blgica AR 62 38/24 54 (32-76) AR, EA AR 7,5 FAN, anti-DNAds, anti-histona,
2003 EA 35 12/23 47 (29-66) EA 8,5 antinucleossomo, anti-Sm, anti-
RNP, anti-Ro, anti-La
Elkayam18 Israel 26 17/09 51 (27-71) AR 3 FAN, anti-DNAds aCL, ANCA, anti-
2005 RNP, anti-Sm, anti-Ro, anti-La,
anti-SCL70, antiperoxidase, anti-
histona, anti-ENA total
Erikson19 2005 Sucia 53 43/10 55 (26-79) AR 14 (2-37) 7,5 (3,5-13,5) FAN, anti-DNAds aCL, anti-ENA
total, antinucleossomo,
antimitocndria, antimsculo
liso, anti-histona, antiproteinase
3, antimieloperoxidase
Ferraro-Peyret20 Frana AR 24 16/08 56 (26-77) AR, EA 12 (3-32) 17 18 FAN, anti-DNAds aCL, anti-
2004 EA 15 04/11 41 (26-57) (6-30) B2GPI, ANCA, anti-LKM,
antimitocndria, antimsculo
liso, antiperoxidase,
antitireoglobulina, antiadrenal
Hoxha21 2006 Itlia AR 30 AR 24/06 AR 52 (39-65) AR, EA AR 12 (05-18) AR 29-53 FAN, anti-DNAds anti-ENA total
EA 30 EA 05/25 EA 35 (23-47) EA 10 (02-18) EA 06-26
Jondosttir22 Sucia 65 AR 12 aCL
2004
Louis23 2003 Canad 42 05/37 53 (40-66) AR, EA, AP 6 FAN,anti-DNAds, anti-Sm, anti-Ro,
anti-La, anti-RNP
Nancey24 2005 Frana 35 24/11 36 (19-71) Doena de 10 (03-24) 12 FAN, anti-DNAds aCL, anti-B2GPI,
Crohn anti-mitocondria, anti-musculo
liso, anti-filagrina, anti-LKM,
anti-tireoide
Sellam25 2005 Frana 28 18/10 42 (28-56) EA 10 (5-15) 8 FAN, anti-DNAds, anti-histona,
anti-ENA total
Vermeire26 Blgica 125 82/43 34 (28-43) Doena de 12 FAN, anti-DNAds, anti-DNAss, anti-
2003 Crohn histona, anti-ENA total
Total 760

AR, artrite reumatoide; EA, espondilite anquilosante; AP, artrite psorisica; FAN, fator antinuclear; anti-DNAds, anti-DNA nativo ou dupla hlice;
anti-DNAss, anti-DNA hlice simples; aCL, anticardiolipina; ANCA, anticorpos contra citoplasma de neutrofilos; anti-2GP1, anticorpo anti-
2 glicoprotena 1; anti-ENA, antgenos extraveis pela salina; anti-SCL70, antitopoisomerase; anti-RNP, antirribonucleoprotena; anti-LKM,
antimicrossomal fgado-rim.

Tabela 2 Variao dos autoanticorpos antes e aps o uso de infliximabe


Autoanticorpo n Antes do tratamento Aps o tratamento Variao (%)
FAN 695 199 (28,6%) 469 (67,5%) 38,9
Anti-DNAds 669 8 (1,2%) 117 (17,5%) 16,3
Anti-ENA total 351 0 0 0
aCL 222 21 (9,5%) 49 (22%) 12,5
Anti-2GP1 74 0 6 (8,1%) 8,1
Anti-histona 388 48 (12%) 116 (30%) 18
Antinucleossomo 147 9 (6,1%) 22 (15%) 8,9
M ANCA 108 0 7 (6,5%) 6,5

FAN, fator antinuclear; anti-DNAds, anti-DNA nativo ou dupla hlice; anti-ENA, antgenos extraveis pela salina; aCL, anticardiolipina; anti-
2GP1, anticorpo anti- 2 glicoprotena 1; ANCA, anticorpos contra citoplasma de neutrfilos.

RBR 53(4) - Arquivo livro (Impressa).indb 361 21/10/2013 18:21:28


362 R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 5 8 3 6 4

Seis estudos (tabela 1) avaliaram o aCL em um total de 222 Quatro estudos avaliaram ainda outros autoanticorpos, a
pacientes. Antes do tratamento, 21 (9,5%) casos eram reatores, saber: antimitocndria, antimsculo liso, antifilagrina, anti-
porm ao final do tratamento 49 (22%) dos casos reagiram, -LKM, antiperoxidade tireoidiana, antitireoglobulina e antia-
tendo uma variao de 12,5% (tabela 2). No houve nenhum drenal. Em nenhum dos estudos houve variao significativa
caso de anti-2GP1 antes do uso do infliximabe (n = 74, em desses anticorpos.
dois estudos), mas aps o uso da medicao a variao foi de Dos 760 casos avaliados em todos os estudos, somente
6,5% (sete casos) (tabela 2). houve relato de 10 (1,3%) pacientes com provvel LII (tabela 3).
Quanto ao anti-histona, foi avaliado por seis estudos (tabela
1), num total de 388 casos. Antes do biolgico, 48 (12%) casos
eram reatores, mas aps a medicao 116 (30%) casos foram re- Discusso
atores, numa variao de 18% (tabela 2). No estudo de Vermeire
et al.,26 nenhum paciente apresentava o anticorpo anti-histona Esta reviso sistemtica mostra informaes sobre a indu-
antes. Aps o uso de infliximabe por 24 meses, 1,6% dos casos o de autoanticorpos e lpus eritematoso pelo infliximabe.
(dois em um total de 125) aumentaram seus ttulos e desenvol- A maior dificuldade encontrada em correlacionar os autoan-
veram lpus induzido pelo infliximabe (LII) (alm da presena ticorpos a falta de uma padronizao, uma vez que cada
do anticorpo anti-histona, tambm houve elevao dos ttulos estudo usou mtodos diferentes. Quando o mtodo usado era
do FAN e do anti-DNAds). Em 2004, Alanore et al.13 avaliaram o mesmo, os kits dos autoanticorpos ou o corte do FAN eram
separadamente os isotipos IgM e IgG, mostrando que, aps o diferentes, impedindo uma comparao fidedigna.
uso da medicao, o isotipo IgM aumentou significativamente Em nossa busca, inclumos somente estudos de fase IV, de
aps 6 semanas, mas sem significado clnico. 2003 a 2006 (estudos de anos anteriores foram excludos por
O anticorpo antinucleossomo foi avaliado por dois estudos no preencherem os parmetros usados nesta reviso siste-
(tabela 1), com um total de 147 casos, nos quais 9 (6,1%) eram mtica) (fig. 1). Viana et al.,27 em 2010, realizaram um estudo
reatores antes da medicao e 22 (26%) foram reatores aps em pacientes com artrite psorisica mostrando que a terapia
o uso do infliximabe (tabela 2), mas sem significado clnico. anti-TNF induziu alteraes no FAN em 1/3 dos doentes (n =
O anticorpo anticitoplasma de neutrfilos (ANCA) foi ava- 23), e a maioria dos autoanticorpos avaliados (anti-DNAn, an-
liado em trs estudos (n = 108) (tabela 1). Antes do inflixima- ti-Ro, anti-La, aCL, anti-histona e fator reumatoide) no reagiu
be, no houve casos de ANCA reator, tendo uma variao de aps a terapia biolgica. O estudo foi muito bem-conduzido,
6,5% (sete casos) aps o biolgico (tabela 2). Em nenhum caso mas no pudemos inclu-lo nesta reviso pois os biolgicos
houve correlao com vasculite. Eriksson et al. 19 avaliaram foram avaliados em conjunto (infliximabe, adalimumabe e
separadamente o anti-proteinase 3 e o antimieloperoxidase, etanercepte), no sendo relatados os resultados somente dos
mas no houve reatividade em nenhum caso antes ou aps o pacientes que usaram infliximabe (fig. 1), apesar de serem a
uso do infliximabe. maioria (19 dos 23 pacientes). O estudo mais recente visto

Tabela 3 Dados dos pacientes com lpus induzido pelo infliximabe


Estudo Tempo aps Clnica Autoanticorpos Evoluo
infliximabe
Bobbio-Palavicinni14 30 semanas Artrite moderada e rash malar Anti-DNAds Resoluo algumas semanas aps retirada
Pleuropericardite Anti-DNAds
Comby16 18 meses Artralgia migratria, astenia FAN > 1:1280; Durao dos sintomas por um ms aps
anti-DNAds IgG a suspenso do infliximabe, controle
aps corticoide; manteve FAN alto
persistentemente
Elkayam18 3 infuses Mialgia, artralgia, febre > 38 C, FAN, anti-histona Resoluo com retirada do infliximabe e
rash nas pernas e nos braos prednisona
5 infuses Febre, mialgia, poliartralgia FAN, anti-histona Suspenso do infliximabe e corticoide por
uma semana
Eriksson19 Mialgia, artrite Anti-histona, anti-DNAds Melhora aps poucas semanas da suspenso
IgG, consumo de do infliximabe, sem uso de prednisona
complemento C3 e C4,
leucopenia
Eriksson19 54 semanas Rash malar, leucopenia, Anti-DNAds,
artralgia e vasculite das antinucleossoma
extremidades distais dos
membros superiores
Nancey24 3 infuses Rash malar, poliartralgia FAN e anti-DNAds Recuperao espontnea aps algumas
semanas sem infliximabe ou corticoide
Vermeire26 1 infuso Poliartralgia, mialgia e rash FAN, anti-DNAds e Sintomas desapareceram com a retirada do
malar anti-histona infliximabe; aps um ano FAN ainda reator,
mas com ttulos mais baixos
1 infuso Artralgia e rash malar FAN 1:640

FAN, fator antinuclear; anti-DNAds, anti-DNA nativo ou dupla hlice.

RBR 53(4) - Arquivo livro (Impressa).indb 362 21/10/2013 18:21:29


R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 5 8 3 6 4 363

em nossa busca foi o de Hoffmann et al.,28 de 2011, a respeito REFERNCIAS


do uso de infliximabe em psorase. No entanto, ele tambm
no pode ser includo nesta reviso, pois alguns doentes j
haviam utilizado outros medicamentos biolgicos antes do 1. Souza AWS, Junior DM, Arajo JAP, Catelan TTT, Cruvinel WM,
infliximabe (fig. 1), mas no foram separados do grupo total, Andrade LEC, et al. Sistema Imunitrio- Parte III: o delicado
assim no pudemos usar os dados em nossos clculos. equilbrio do sistema imunolgico entre os polos de tolerncia
e autoimunidade. Rev Bras Reumatol. 2010;50(6):665-78.
A fim de calcularmos o percentual de autoanticorpos en-
2. De Rycke L, Baeten D, Kruithof E, Van den Bosch F, Veys EM, De
contrados, para os estudos que dosaram diversas vezes os Keyser F. The effect of TNF alpha blockade on the antinuclear
anticorpos ao longo de cada visita, utilizamos, por exemplo, antibody profile in patients with chronic arthritis: biological
como resultado final o perodo no qual os anticorpos foram and clinical implications. Lupus. 2005;14:931-7.
mais reatores, ou ento, no caso de perda de pacientes, utili- 3. De Bant M, Sibilia J, Le Let X, Prouzeau S, Fautrel B, Marcelli
zamos o perodo em que havia mais pacientes. C, et al. Club Rhumatismes et Inflammation. Systemic
Escolhemos estudos de ao menos trs meses de durao, lupus erythematosus induced by anti-tumor necrosis factor
alpha therapy: a French national survey. Arthritis Res Ther.
pois h relatos de este ser o tempo mnimo para a induo
2005;7:R54551.
de autoanticorpos pelo infliximabe.18,22 No entanto, Nancey et 4. Gonnet-Gracia C, Barnetche T, Richez C, Blanco P, Dehais J,
al.24 mostraram que j houve induo persistente de FAN e Schaeverbeke T. Anti-nuclear antibodies, anti-DNA and C4
anti-DNAds mesmo aps a segunda infuso do medicamento. complement evolution in rheumatoid arthritis and ankylosing
Nesta reviso sistemtica verificamos que os autoanticor- spondylitis treated with TNF blockers. Clin Exp Rheum.
pos mais comumente avaliados nos estudos foram o FAN, o 2008;26:401-7.
anti-DNAds, o anti-ENA total e o anti-histona. Na realidade, v- 5. Mathian A, Arnaud L, Amoura Z. Lupus mdicamenteux. Rev
Prat. 2011;61(9):1268.
rios estudos preferiram avaliar o anti-ENA total e, caso fosse re-
6. Marzano AV, Vezzoli P, Crosti C. Drug-induced lupus: an update
ator em algum doente, os autoanticorpos seriam avaliados se- on its dermatologic aspects. Lupus. 2009;18:935-40.
paradamente. Porm, como observamos em nosso estudo que 7. Shabana AA, El-Ghawet AE, Machaly SA, Hashim EMA, El-Kady
nenhum paciente reagiu com o anti-ENA (n = 351) (tabela 2), BA, Shaat R. Anti-chromatin and anti-histone antibodies in
o nmero de pacientes que dosaram esses autoanticorpos ex- Egyptian patients with systemic lupus erythematosus. Clin
traveis pela salina foi menor do que os outros autoanticorpos. Rheumatol. 2009;28(6):673-8.
O autoanticorpo relacionado com a sndrome do anticorpo 8. Pallotta P, Cianchini G, Ruffelli M, Puddu P. Infliximab-induced
lupus-like reaction in a patient with psoriatic arthritis.
antifosfolipideo (aCL) foi descrito em 222 pacientes, mas no
Rheumatology (Oxford). 2006;45(1):116-7.
houve significado clnico (nenhum doente apresentou epis- 9. Lee SJ, Kavanaugh A. Biologic agents in Rheumatology: safety
dio trombtico). No houve nenhum caso de anti-2GP1 antes considerations. Rheum Dis Clin N Am. 2006;32(Suppl.1):3-10.
do uso do infliximabe (n = 74, em dois estudos), mas aps o 10. Mountz JD, Wu J, Cheng J, Zhou T. Autoimmune disease.
uso da medicao a variao foi de 6,5% (sete casos) (tabela A problem of defective apoptosis. Arth Rheum.
2), tambm sem eventos trombticos. No estudo de Bobbio- 1994;37(10):1415-20.
-Palaviccini et al.,29 foi demonstrado um aumento significa- 11. Sibilia J. Les Lupus induits par les medicaments. Rev Rheum.
2002;(69):355-69.
tivo do anti-2GP1 aps o uso do infliximabe por 1-2 anos, o
12. Liberati A, Altman DG, Tetzlaff J, Mulrow C, Gzsche PC,
que no aconteceu com os outros agentes anti-TNF testados Ioannidis JP, et al. The PRISMA statement for reporting
(etanercepte e adalimumabe). No entanto, tambm no houve systematic reviews and meta-analyses of studies that evaluate
relao com manifestaes clnicas. health care interventions: explanation and elaboration. Ann
Quanto ao desenvolvimento de doenas autoimunes, mes- Intern Med. 2009;151:W65-W94.
mo para os estudos que tiveram aumento significativo de FAN 13. Allanore Y, Sellam J, Batteux F, Deslandre CJ, Weil B, Kahan A.
e outros autoanticorpos comparando-se antes e aps o infli- Induction of autoantibodies in refractory rheumatoid arthritis
treated by infliximab. Clin Exp Rheum. 2004;22:756-8.
ximabe, no houve induo de nenhuma enfermidade, ex-
14. Bobbio-Pallavicini F, Alpini C, Caporali R, Avalle S, Bugatti S,
ceto aqueles 10 casos de LII. Nesses pacientes, os anticorpos
Montecucco C. Autoantibody profile in rheumatoid artritis
mais comumente encontrados foram o FAN, o anti-DNAds e o during long-term infliximab treatment. Arthritis Res Ther.
anti-histona, conforme tem sido demonstrado pelos diversos 2004;6(3):R264-72.
relatos da literatura.30-32 Os achados clnicos mais comuns fo- 15. Caramaschi P, Biasi D, Colombatti M, Pieropan S, Martinelli N,
ram artralgia e mialgia, de acordo com vrios relatos de caso Carletto A, et al. Anti-TNF therapy in rheumatoid arthritis
desse tema. Somente um doente apresentou serosite. and autoimmunity. Rheumatol Int. 2006;26:209-14.
16. Comby E, Tanaff P, Mariotte D, Costetin-Pignol V, Marcelli
No houve relao da induo de autoanticorpos com a
C, Ballet JJ. Evolution of antinuclear antibodies and clinical
doena de base, pois nesta reviso os estudos avaliaram pa-
patterns in patients with active rheumatoid arthritis with
cientes com diversas doenas autoimunes e inflamatrias longterm infliximab therapy. J Rheumatol. 2006;33(1):24-30.
(AR, EA, AP, Chron), gerando vrios autoanticorpos, indepen- 17. De Rycke L, Kruithof E, Van Dame N, Hoffman IEA, Kruithof
dente da doena em questo. Porm, o no desenvolvimento E, Van den Bossche N, et al. Antinuclear antibodies following
de outras doenas sugere que se trata somente de um epife- infliximab treatment in patients with Rheumatoid Arthritis or
nmeno e, na maioria das vezes, esses autoanticorpos no de- Spondyloarthropathy. Arth Rheum. 2003;48(4):1015-23.
18. Elkayam O, Burke M, Vardinon N, Zakut V, Bem Yitzhak R,
vem ser patognicos. Talvez se usssemos metodologias que
Paran D, et al. Autoantibodies profile of rheumatoid arthritis
avaliam anticorpos mais patognicos, como o caso do uso de
patients during treatment with infliximab. Autoimmunity.
aparelhos multiplex, o resultado poderia ser bem diferente. 2005;38(2):155-60.
Isto , acreditamos que somente encontraramos autoanticor- 19. Eriksson C, Engstrand S, Sundqvist K-G, Rantap-Dahlqvist
pos em poucos casos. S. Autoantibody formation in patients with rheumatoid

RBR 53(4) - Arquivo livro (Impressa).indb 363 21/10/2013 18:21:29


364 R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 5 8 3 6 4

arthritis treated with anti-TNF. Ann Rheum Dis. spondyloarthropathy treated with infliximab and
2005;64:403-7. methotrexate. JBS. 2005;72:48-52.
20. Ferraro-Peyret C, Coury F, Tebib JG, Bienvenu J, Fabien 26. Vermeire S, Noman M, Van Assche G, Baert F, Van Steen K,
N. Infliximabe therapy in rheumatoid arthritis and Esters N, et al. Autoimmunity associated with anti-tumor
ankylosing spondylitis-induced specific antinuclear and necrosis factor treatment in Crohns disease: a prospective
antiphospholipid autoantibodies without autoimmune cohort study. Gastroenterology. 2003;125:32-9.
clinical manifestations: a two-year prospective study. 27. Viana VST, Carvalho JF, Moraes JCB, Saad CGS, Ribeiro
Arthritis Res Ther. 2004;6:R535-43. ACM, Gonalves C, et al. Autoantibodies in patients with
21. Hoxha A, Ruffatti A, Grypiotis P, Podswiadek M, Botsios C, psoriatic arthritis on anti-TNF therapy. Rev Bras Reumatol.
Fiocco U, et al. Gli autoanticorpi antinucleo, anti-dsDNA, 2010;50(3):225-34.
anti-ENA nei pazienti con artrite reumatoide o spondilite 28. Hoffmann JHO, Hartmann M, Enk AH, Hadaschik EN.
anchilosante in trattamento con infliximab. Reumatismo. Autoantibodies in psoriasis as predictors for loss of
2006;58(2):121-6. response and anti-infliximab antibody induction. BJD.
22. Jondosttir T, Forslid J, Van Vollenhoven A, Harju A, 2011;165:1355-8.
Brannemark S, Klareskog L, et al. Treatment with tumor 29. Bobbio-Palavicini F, Atzeni F, Caporali R, Alpini C, Avalle
necrosis factor antagonists in patients with rheumatoid S, Klersy C, et al. Anti-phospholipid antibodies induction
arthritis induces anticardiolipin antibodies. Ann Rheum Dis. by different TNF-alpha blocking agents in Rheumatoid
2004;63:1075-8. Arthritis. Ann Rheum Dis. 2009;68(Suppl.3):238.
23. Louis M, Rauch J, Armstrong M, Fitzcharles MA. Induction of 30. Mounach A, Ghazi M, Nouijai A, Ghozlani I, Achemlal L,
autoantibodies during prolonged treatment with infliximab. J Bezza A, El Maghraoui A. Drug-induced lupus-like syndrome
Rheumatol. 2003;30:2557-62. in ankylosing spondylitis treated with infliximab. Clin Exp
24. Nancey S, Blanvillain E, Parmentier B, Flouri B, Bayet C, Rheumatol. 2008;26(6):1116-8.
Bienvenu J, et al. Infliximab treatment does not induce organ- 31. Bodur H, Eser F, Konca S, Arikan S. Infliximab-induced
specific or nonorgan-specific autoantibodies other than lupus-like syndrome in a patient with ankylosing
antinuclear and anti-double-stranded DNA autoantibodies in spondylitis. Rheumatol Int. 2009;29(4):451-4.
Crohns disease. Inflamm Bowel Dis. 2005;11(11):986-91. 32. Benucci M, Li Gobbi F, Fossi F, Manfredi M, Del Rosso A.
25. Sellam J, Allanore Y, Batteux F, Deslandre CJ, Weil B, Kahan Drug-induced lupus after treatment with infliximab in
A. Autoantibody induction in patients with refractory rheumatoid arthritis. J Clin Rheumatol. 2005;11(1):47-9.

RBR 53(4) - Arquivo livro (Impressa).indb 364 21/10/2013 18:21:29


R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 6 5 3 6 7

REVISTA BRASILEIRA DE
REUMATOLOGIA
www.reumatologia.com.br

Relato de caso

Vasculite testicular uma manifestao rara de artrite


reumatoide

Alexandre Wagner S. de Souza*, Daniela Pereira Rosa, Ana Letcia Pirozzi Buosi,
Ana Ceclia Diniz Oliveira, Jamil Natour
Disciplina de Reumatologia, Escola Paulista de Medicina, Universidade Federal de So Paulo, So Paulo, SP, Brasil

informaes resumo

Histrico do artigo: A vasculite testicular uma manifestao extra-articular muito rara da artrite reumatoide
Recebido em 20 de novembro de 2011 (AR). Descrevemos o caso de um homem de 53 anos com diagnstico de AR por oito anos,
Aceito em 14 de maio de 2013 sem controle adequado da doena. O paciente desenvolveu vasculite reumatoide, manifesta-
da por lceras de membros inferiores e neuropatia perifrica. Apresentou ainda meningite
Palavras-chave: neutroflica aguda, tendo sido tratado com antibiticos e posterior pulsoterapia endoveno-
Artrite reumatoide sa com metilprednisolona (500 mg/dia) por trs dias, seguida de ciclofosfamida (2 mg/kg/
Vasculite reumatoide dia) e prednisona orais. O paciente apresentou melhora do quadro, mas 15 dias aps a alta
Doenas testiculares hospitalar, houve reativao da meningite bacteriana. O paciente foi reinternado e tratado
Sepse novamente com antibiticos. Trs dias depois da segunda admisso hospitalar, o paciente
apresentou dor, aumento de volume do testculo esquerdo e posteriormente gangrena. Foi
realizada orquiectomia unilateral e o exame anatomopatolgico revelou vasculite linfoctica.
O paciente faleceu dois dias aps a cirurgia devido a pneumonia aspirativa. Esse caso ilustra
a vasculite testicular como uma manifestao rara e grave da vasculite reumatoide.
2013 Elsevier Editora Ltda. Todos os direitos reservados.

Mesenteric vasculitis in a juvenile systemic lupus erythematosus patient

abstract

Keywords: Testicular vasculitis is a very rare extra-articular manifestation of rheumatoid arthritis


Arthritis, rheumatoid (RA). We describe the case of a 53-year-old man diagnosed with RA for eight years, who was
Rheumatoid vasculitis poorly controlled and developed rheumatoid vasculitis, which manifested as leg ulcers and
Testicular diseases peripheral polyneuropathy. The patient also had acute neutrophilic meningitis and was
Sepsis treated with antibiotics and intravenous pulse therapy with methylprednisolone (500 mg
daily) for three days, followed by oral cyclophosphamide (2 mg/kg daily) and prednisone.
Overall improvement was observed, and the patient was discharged. But 15 days later, the
meningitis recurred, and the patient was readmitted and treated again with antibiotics.
Three days later, he developed pain and enlargement of his left testicle with gangrene. Uni-
lateral orchiectomy was performed, revealing lymphocytic vasculitis. The patient died two
days later due to aspiration pneumonia. This case illustrates a rare and severe manifesta-
tion of rheumatoid vasculitis.
2013 Elsevier Editora Ltda. All rights reserved.

* Autor para correspondncia.


E-mail: alexandre_wagner@uol.com.br (A.W.S. Souza).
0482-5004/$ - see front matter. 2013 Elsevier Editora Ltda. Todos os direitos reservados.

RBR 53(4) - Arquivo livro (Impressa).indb 365 21/10/2013 18:21:29


366 R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 6 5 3 6 7

trias aerbicas, fungos e micobactrias foram negativas. A


Introduo sorologia do LCE para toxoplasmose, sfilis, citomegalia, her-
pes simplex e criptococose foi tambm negativa. A biopsia in-
A vasculite reumatoide (VR) considerada uma complicao cisional de pele revelou lcera inespecfica com vasculite neu-
associada com artrite reumatoide (AR) de longa durao, em troflica em uma pequena artria. A eletromiografia mostrou
geral mais de 10 anos.1 A VR est relacionada a pior progns- polineuropatia sensitiva e motora axonal. O FR permaneceu
tico devido ao aumento de morbimortalidade.2,3 Costuma se positivo (1.280 UI/mL), sendo tambm positivos os anticorpos
apresentar como infartos digitais, lceras de membros infe- antiprofilagrina (ttulo: 1/320). Os seguintes anticorpos foram
riores, manifestaes sistmicas e mononeurite multiplex, negativos: fator antinuclear (FAN), anticitoplasma de neutr-
mas pode envolver qualquer leito vascular, em especial as filo (ANCA) e crioglobulinas. Os testes sorolgicos para HIV,
artrias mesentrica, coronrias e cerebrais. A VR mais co- hepatite B e hepatite C foram negativos.
mum em homens, e alguns fatores preditivos, tais como taba- O paciente foi tratado com ceftriaxona (4 g/dia) por dez
gismo, ndulos reumatoide e fatores genticos, foram identi- dias, tendo recebido pulsoterapia intravenosa com metilpred-
ficados.1,4 A incidncia de VR ao longo de 30 anos foi estimada nisolona (500 mg/dia) por trs dias, seguida por prednisona
em 3,6% entre pacientes com AR.5 Uma possvel abordagem oral (60 mg/dia) e ciclofosfamida oral (2 mg/kg/dia). Houve
para o diagnstico de VR o uso dos critrios diagnsticos uma melhora geral das lceras de perna, meningite, queixas
propostos; embora til, esses critrios no foram ainda vali- articulares e neuropatia perifrica.
dados.4,6,7 Quinze dias aps a alta, o paciente apresentou recorrncia
Sabe-se que a inflamao testicular uma manifestao da febre, cefaleia e vmitos. Retornou ao hospital, foi subme-
de vasculites sistmicas graves, como prpura de Henoch- tido a outra puno lombar, tendo a anlise do LCE mostrado:
-Schnlein e poliarterite nodosa, ou pode ocorrer como uma 4.640 clulas/mm3 (84% de neutrfilos); protena, 276,5 mg/dL;
forma isolada de vasculite testicular.8-10 Na VR, o envolvimen- e glicose, 116 mg/dL. Tais resultados confirmaram a recidiva
to testicular extremamente raro e, at onde sabemos, existe da meningite. Suspeitou-se de infeco causada por Listeria
um relato de caso descrevendo tal complicao em um pa- monocytogenes, sendo o paciente tratado com meropenem e
ciente com AR e um outro em um paciente com artrite crnica ampicilina, e a combinao de prednisona e ciclofosfami-
juvenil.11,12 Descrevemos um caso de VR em um paciente com da temporariamente suspensa. Trs dias aps a admisso, o
AR mal controlada e altos ttulos de fator reumatoide (FR). paciente queixou-se de dor escrotal e aumento do testculo
esquerdo, e sinais de gangrena surgiram poucas horas mais
tarde. O parecer da urologia recomendou cirurgia, sendo re-
Relato de caso alizada orquiectomia radical unilateral. A avaliao histopa-
tolgica do espcime revelou vasculite linfoctica transmural
Paciente masculino, branco, de 53 anos de idade, admitido nos ramos arteriais justa-funiculares com proliferao mioin-
no hospital universitrio, queixando-se de lceras, formiga- timal (fig. 1). O paciente desenvolveu pneumonia aspirativa e
mento, adormecimento e fraqueza nos membros inferiores e sepse aps a cirurgia, a despeito do tratamento com antibi-
piora da dor e edema de pequenas e grandes articulaes nas ticos, drogas vasoativas e ventilao mecnica. Morte ocorreu
ltimas trs semanas. O paciente informou ainda que, cinco dois dias mais tarde, devido a choque sptico.
dias antes da admisso, comeou a apresentar febre, cefaleia
intensa e vmitos. J tinha o diagnstico de AR h oito anos,
com poliartrite simtrica e positividade para o FR (640 UI/mL). Discusso
Alm disso, tinha histria anterior de hipertenso sistmica,
diabetes mellitus tipo 2 e tabagismo. Aps o diagnstico de AR, Este relato de caso ilustra o incio de uma VR comprovada
foi tratado com glicocorticoides (GC) e metotrexato, e depois por biopsia com envolvimento de pele, nervos perifricos e
com metotrexato e leflunomida (20 mg/dia), obtendo alguma artrias testiculares em um paciente com AR mal controlada
melhora das queixas articulares por quatro anos. O paciente e altos ttulos de FR. Embora tenha apresentado melhora ge-
no fez acompanhamento ambulatorial pelos trs anos se- ral aps o incio de terapia imunossupressora com ciclofos-
guintes, tendo usado apenas 20 mg de prednisona, uma vez famida e GC, o paciente desenvolveu infeco grave, que foi
ao dia, sem qualquer imunossupressor associado. considerada a principal causa de morte. At onde sabemos,
Ao exame fsico, o paciente mostrava-se febril, com leves este o segundo relato de caso de VR com envolvimento
caractersticas cushingoides e duas lceras profundas, com testicular em um paciente adulto com AR. Este caso se-
margens elevadas e deposio de fibrina, na perna esquerda. melhante ao previamente relatado quanto ao incio da VR
Apresentava edema e aumento da sensibilidade nas articu- em paciente masculino de meia-idade com AR soropositi-
laes interfalangeanas proximais e metacarpofalangeanas, va de longa durao e pouca adeso ao tratamento. Houve
punhos, cotovelos e joelhos. Seu escore DAS-28 era de 5,0. O acometimento de pele e nervos perifricos nos dois casos,
exame neurolgico revelou status mental normal, rigidez de tendo o envolvimento testicular ficado aparente aps uma
nuca, reduo dos reflexos profundos dos tendes em mem- melhora inicial com GC e ciclofosfamida. Nosso paciente, no
bros inferiores, comprometimento da sensibilidade abaixo entanto, apresentou vasculite linfoctica nos ramos arteriais
dos joelhos e p esquerdo cado. A anlise do lquido cerebro- justa-funiculares dos testculos em lugar da vasculite leuco-
espinhal (LCE) foi sugestiva de meningite bacteriana: 2.832 c- citoclstica testicular observada no caso previamente rela-
lulas/mm3 (98% de neutrfilos); protena, 376,5 mg/dL; glicose, tado.11 A demonstrao histopatolgica de vasculite consi-
69 mg/dL. A colorao de Gram e as culturas do LCE para bac- derada o padro-ouro para o diagnstico de VR e na maioria

RBR 53(4) - Arquivo livro (Impressa).indb 366 21/10/2013 18:21:29


R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 6 5 3 6 7 367

Concluindo, o envolvimento testicular uma manifesta-


o rara de VR, e os reumatologistas devem estar cientes des-
sa potencial complicao, em especial quando o paciente se
queixa de dor e aumento de volume testicular no contexto de
VR. Embora a maioria dos pacientes com VR apresente vascu-
lite cutnea e neuropatia perifrica, os rgos internos podem
ser afetados, sendo a pronta investigao e o tratamento ade-
quado importantes para a obteno de melhores resultados.

Conflitos de interesse

Os autores declaram no haver conflitos de interesse.

REFERNCIAS

Figura 1 Microfotografia (aumento original x20; 1. Turesson C, Matteson EL. Vasculitis in rheumatoid arthritis.
hematoxilina-eosina) de corte de testculo esquerdo Curr Opin Rheumatol. 2009;21(1):35-40.
2. Erhardt CC, Mumford PA, Venables PJ, Maini RN. Factors
mostrando vasculite linfoctica transmural nos ramos
predicting a poor life prognosis in rheumatoid arthritis: an
arteriais justa-funiculares e intimite com proliferao eight year prospective study. Ann Rheum Dis. 1989;48(1):7-13.
miointimal. Os tbulos seminferos so atrficos. 3. Puechal X, Said G, Hilliquin P, Coste J, Job-Daslandre C,
Lacroix C, et al. Peripheral neuropathy with necrotizing
vasculitis in rheumatoid arthritis: a clinicopathologic and
prognostic study of thirty-two patients. Arthritis Rheum.
dos casos os espcimes patolgicos apresentavam vasculite 1995;38(11):1618-29.
leucocitoclstica.4 O achado histopatolgico mais tpico de 4. Genta MS, Genta RM, Gabay C. Systemic rheumatoid
VR a necrose medial circundada por proliferao de clulas vasculitis: a review. Semin Arthritis Rheum. 2006;36(2):88-98.
intimais e adventcias em um arranjo radial semelhante ao 5. Turesson C, OFallon WM, Crowson CS, Gabriel SE, Matteson
ndulo reumatoide. Infiltrados em torno de vasos normais e EL. Extra-articular disease manifestations in rheumatoid
arthritis: incidence trends and risk factors over 46 years. Ann
necrosados so tambm vistos com frequncia em pacientes
Rheum Dis. 2003;62(8):722-7.
com VR.4,13
6. Scott DG, Bacon PA, Tribe CR. Systemic rheumatoid vasculitis:
importante ainda notar a dificuldade para tratar a VR a clinical and laboratory study of 50 cases. Medicine
do nosso paciente, devido s vrias complicaes infecciosas (Baltimore). 1981;60(4):288-97.
observadas, tais como a meningite bacteriana antes da tera- 7. Scott DG, Bacon PA. Intravenous cyclophosphamide plus
pia imunossupressora, sua recorrncia aps o incio do tra- methylprednisolone in treatment of systemic rheumatoid
tamento para VR com suspeita de listeriose e a pneumonia vasculitis. Am J Med. 1984;76(3):377-84.
8. Ben-Sira L, Laor T. Severe scrotal pain in boys with Henoch-
por aspirao, que evoluiu para sepse e morte. Infelizmente,
Schnlein purpura: incidence and sonography. Pediatr Radiol.
tais fatos dificultaram o tratamento adequado da VR em nos- 2000;30(2):125-8.
so paciente, e os efeitos da combinao de GC e ciclofosfa- 9. Stroup SP, Herrera SR, Crain DS. Bilateral testicular infarction
mida podem ter determinado a recorrncia da meningite. O and orchiectomy as a complication of polyarthritis nodosa.
tratamento da VR emprico, sendo a combinao de altas Rev Urol. 2007;9(4):235-8.
doses de GC e ciclofosfamida uma terapia reconhecida. Em 10. Hernndez-Rodrguez J, Molloy ES, Hoffman GS. Single-organ
um estudo aberto,7 21 pacientes em uso endovenoso de me- vasculitis. Curr Opin Rheumatol. 2008;20(1):40-6.
11. Mayer DF, Matteson EL. Testicular involvement in rheumatoid
tilprednisolona e ciclofosfamida foram comparados com 24
vasculitis. Clin Exp Rheumatol. 2004;22(Suppl.36):S62-4.
pacientes usando outras terapias que incluam azatioprina, 12. Tangney NJ. Testicular complications in connective tissue
D-penicilamina, clorambucil e altas doses de prednisolona. disease. Arch Dis Child. 1981;56:651-2.
A resposta clnica foi significativamente melhor, sendo a 13. Sokoloff L, Bunim JJ. Vascular lesions in rheumatoid arthritis.
taxa de recidiva mais baixa no grupo da ciclofosfamida.7 Te- J Chron Dis. 1957;5(6):668-87.
rapias biolgicas com agentes anti-TNF e rituximabe foram 14. Puchal X, Miceli-Richard C, Mejjad O, Lafforgue P, Marcelli C,
Solau-Gervais E, et al. Antitumor necrosis factor treatment
usadas para tratar VR em relatos de casos e sries de casos
in patients with refractory systemic vasculitis associated
com algum sucesso.14,15 Podem ser uma alternativa para pa-
rheumatoid arthritis. Ann Rheum Dis. 2008;67(6):880-4.
cientes com VR grave quando os agentes citotxicos esto 15. Assmann G, Pfreundschuh M, Voswinkel J. Rituximab in
contraindicados ou no conseguem controlar as manifesta- patients with rheumatoid arthritis and vasculitis-associated
es de vasculite.1 cutaneous ulcers. Clin Exp Rheumatol. 2010;28(1Suppl 57):81-3.

RBR 53(4) - Arquivo livro (Impressa).indb 367 21/10/2013 18:21:29


R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 6 8 3 7 0

REVISTA BRASILEIRA DE
REUMATOLOGIA
www.reumatologia.com.br

Relato de caso

Camptocormia secundria polimiosite

Melina Andrade Mattar, Joara Martins da Silva Gordo, Ari Stiel Radu Halpern,
Samuel Katsuyuki Shinjo*
Servio de Reumatologia, Hospital das Clnicas, Faculdade de Medicina da Universidade de So Paulo, So Paulo, SP, Brasil

informaes resumo

Histrico do artigo: A camptocormia uma doena postural caracterizada por flexo anormal da coluna to-
Recebido em 6 de dezembro de 2011 racolombar que surge na posio ereta, aumenta durante a caminhada e desaparece na
Aceito em 14 de maio de 2013 posio supina. Na literatura, h descrio de apenas cinco casos de camptocormia secun-
dria a miopatias inflamatrias idiopticas. No presente relato de caso, descrevemos um
Palavras-chave: paciente do sexo masculino, de 67 anos, com polimiosite h 18 anos, cursando com quadro
Polimiosite compatvel com camptocormia (estvel e sem progresso do quadro clnico). A polimiosite
Miosite uma miopatia inflamatria idioptica caracterizada clinicamente por fraqueza muscu-
Doenas musculoesquelticas lar simtrica predominantemente proximal dos membros. Entretanto, sendo uma doena
Postura autoimune sistmica, plausvel que ocorra acometimento de musculatura esqueltica de
forma difusa, incluindo a paravertebral, podendo manifestar-se com camptocormia.
2013 Elsevier Editora Ltda. Todos os direitos reservados.

Camptocormia secondary to polymyositis

abstract

Keywords: Camptocormia is a postural affliction characterised by abnormal flexion of the thoraco-


Polymyositis lumbar spine, which appears upon standing, increases with walking, and disappears in the
Myositis supine position. Only five cases of camptocormia secondary to idiopathic inflammatory
Musculoskeletal diseases myopathies have been described in the literature. In this case report, we describe the case
Posture of a male patient 67 years of age who suffered from polymyositis for 18 years, which was
associated with manifestations compatible with camptocormia. The clinical manifesta-
tions were stable and did not progress. Polymyositis is an idiopathic inflammatory myopa-
thy clinically characterised by symmetric weakness that predominantly affects the proxi-
mal muscles. Nevertheless, polymyositis is a systemic autoimmune disease; therefore, the
skeletal muscles may be diffusely affected, including the paravertebral muscles, which may
manifest as camptocormia.
2013 Elsevier Editora Ltda. All rights reserved.


Trabalho realizado no Hospital das Clnicas da Faculdade de Medicina da Universidade de So Paulo, So Paulo, SP, Brasil.
* Autor para correspondncia.
E-mail: samuel.shinjo@gmail.com (S.K. Shinjo).
0482-5004/$ - see front matter. 2013 Elsevier Editora Ltda. Todos os direitos reservados.

RBR 53(4) - Arquivo livro (Impressa).indb 368 21/10/2013 18:21:29


R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 6 8 3 7 0 369

Atualmente, aps oito anos de seguimento ambulatorial,


Introduo o paciente apresenta estabilidade do quadro clnico-labora-
torial, sem progresso, porm com sequela do quadro clnico
A camptocormia [(grego: kamptos (curvar-se) e kormos (tron- fraqueza dos membros inferiores e postura de cifose tora-
co)] uma doena postural caracterizada por flexo anormal colombar significativa com anteriorizao do quadril ,, alm
da coluna toracolombar que surge na posio ereta, aumen- de creatinoquinase ao redor de 200 U/L e aldolase de 6,0 U/L,
ta durante a caminhada e desaparece na posio supina.1 A fazendo uso de metotrexato 20 mg/semana e azatioprina 100
condio foi descrita pela primeira vez em 1818,2 e por muito mg/dia. Realizou-se ressonncia magntica da regio tora-
tempo foi considerada uma desordem psicognica, visto que colombar, que evidenciou lipossubstituio significativa da
os primeiros casos foram descritos como uma reao con- musculatura paravertebral da regio lombar (fig. 1).
versiva em soldados da Primeira Guerra Mundial.1 Posterior-
mente, com a descrio de novos casos, tornou-se evidente
que, alm de transtornos psiquitricos, vrias afeces mus- Discusso
culoesquelticas e neurolgicas tambm estariam envolvi-
das como causas dessa entidade.3-11 Embora incomum at o Apresentamos um caso de paciente com polimiosite cursan-
presente momento, h ainda a descrio de cinco casos de do com camptocormia. A polimiosite uma miopatia inflama-
camptocormia secundria s miopatias inflamatrias idio- tria idioptica que caracterizada clinicamente por fraqueza
pticas.10,11 muscular simtrica predominantemente proximal dos mem-
Assim, relatamos um caso de camptocormia em um pa- bros. Entretanto, como uma doena autoimune sistmica,
ciente com polimiosite, fornecendo mais uma evidncia da esperado que ocorra acometimento de musculatura esquel-
associao entre as duas condies raras. tica de forma difusa, incluindo a paravertebral. Clinicamente,
levaria a uma instabilidade do tnus postural, caracterizan-
do-se por flexo dorsal da regio cervical e/ou toracolombar.
Relato de caso Essa posio anormal acentuada com a deambulao e de-
saparece na posio supina, definindo a camptocormia. Na
Paciente do sexo masculino, amarelo, 67 anos, procedente de ressonncia magntica, pode-se evidenciar presena de atro-
So Paulo, com histria insidiosa e crnica de fraqueza mus- fia e substituio gordurosa da musculatura paravertebral,12,13
cular proximal e progressiva dos quatro membros princi- como no caso do nosso paciente. Os achados eletroneuromio-
palmente dos membros inferiores e da regio toracolom- grficos no so uniformes, podendo encontrar caractersti-
bar, sem sintomas constitucionais e sem causa aparente. O cas tanto miognicas quanto neurognicas.14
paciente vinha sendo acompanhado em outro Servio e no Apenas cinco casos de camptocormia e miopatias infla-
soube referir exatamente as medicaes que utilizou. matrias foram documentados. Kuo et al.10 descreveram o
Aps 10 anos de histria, passou a ser acompanhado no primeiro caso de camptocormia associada miopatia infla-
nosso Servio. No exame fsico, apresentava fraqueza mus- matria em que a alterao postural j estava presente ao
cular proximal e objetiva dos membros inferiores (fora grau diagnstico da doena muscular autoimune. A paciente foi
IV), enquanto os membros superiores apresentavam pratica- tratada com pulsos de metilprednisolona parenteral, com
mente fora grau V. Em posio supina, o paciente apresenta-
va posio de cifose toracolombar significativa, alm de ante-
riorizao do quadril para compensar o centro gravitacional.
Essas alteraes acentuavam com a deambulao, porm de-
sapareciam na posio de decbito dorsal. Notava-se ainda
hipotrofia da musculatura paravertebral. Radiograficamente,
no se evidenciavam fraturas vertebrais nem sinais de cifo-
se ou lordose vertebral. Laboratorialmente, apresentava nvel
srico de creatinoquinase de 1103 IU/L (valor de referncia:
24-173 IU/L) e aldolase de 6,0 IU/L (valor de referncia: 1,0-7,5
IU/L). Foi realizada bipsia do msculo bceps braquial, que
evidenciou infiltrado inflamatrio linfomononuclear perimi-
sial, alm de fibras esparsas degeneradas e em necrose com
macrofagia, sugerindo miopatia inflamatria. A eletroneuro-
miografia mostrava sinais de miopatia inflamatria proximal
dos quatro membros. Figura 1 Ressonncia magntica da regio toracolombar,
Com o diagnstico firmado de polimiosite e camptocormia com lipossubstituio significativa da musculatura
associada, a dose de corticosteroide oral foi otimizada (pred- paravertebral da regio lombar. (A) corte sagital na
nisona 1 mg/kg/dia) e associada com azatioprina (dose mxi- sequncia T1 e (B) corte axial na sequncia T2, mostrando
ma de 150 mg/dia); posteriormente, com metotrexato (dose acentuado aumento do tecido adiposo na constituio da
mxima 25 mg/semana) e ciclosporina (dose mxima 100 mg/ musculatura paravertebral, caracterizado por aumento de
dia), com o intuito de poupar o uso crnico de corticosteroide. sinal nas sequncias T1 e T2, com raras fibras musculares
Alm disso, foram indicados exerccios fisioterpicos para for- remanescentes, as quais esto representadas por finas
talecimento principalmente da regio toracolombar. imagens lineares de isossinal.

RBR 53(4) - Arquivo livro (Impressa).indb 369 21/10/2013 18:21:30


370 R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 6 8 3 7 0

melhora discreta da fora muscular e da postura. Delcey et 3. Djaldetti R, Mosberg-Galili R, Sroka H, Merims D, Melamed
al.11 relataram uma srie de sete casos de camptocormia; qua- E. Camptocormia (bent spine) in patients with Parkinsons
disease characterization and possible pathogenesis of an
tro dos pacientes cursavam com dermatomiosite/polimiosite
unusual phenomenon. Mov Disord. 1999;14(3):443-7.
e foram tratados base de corticosteroide, imunoglobulina
4. Reichel G, Kirchhofer U, Stenner A. Camptocormia
intravenosa humana ou ciclosporina, com melhora da camp- segmental dystonia. Proposal of a new definition for an old
tocormia em trs casos. Em nosso caso, o paciente apresenta disease. Nervenarzt. 2000;72(4):1011-6.
histria crnica de polimiosite cursando com camptocormia, 5. Laroche M, Delisle MB, Aziza R, Lagarrigue J, Mazieres
comprometendo sua qualidade de vida. B. Is camptocormia a primary muscular disease? Spine.
As opes teraputicas para a camptocormia so limitadas 1995;20(9):1011-16.
6. Loh LM, Hum AY, Teoh HL, Lim EC. Graves disease associated
e frequentemente pouco eficazes. O tratamento de escolha in-
with spasmodic truncal flexion. Parkinsonism Relat Disord.
clui controle da doena de base, uso de rteses e fisioterapia. 2005;11(2):117-9.
Nos casos secundrios miopatia inflamatria, h relatos de 7. Hund E, Keckl R, Goebel H, Meinck HM. Inclusion body
melhora com corticosteroides e imunoglobulina humana.15 myositis presenting with isolated erector spine paresis.
Em nosso paciente, o tratamento institudo no levou me- Neurology. 1995;45(5):993-4.
lhora do quadro de camptocormia, apesar da estabilizao da 8. Shinjo SK, Torres SCR, Radu AS. Camptocormia: a rare axial
miopatia. A camptocormia, portanto, pode ser considerada myopathy disease. Clinics. 2008;63(3):416-7.
9. Gmez-Puerta JA, Peris P, Grau JM, Martinez MA,
uma sequela da miopatia inicial que talvez fosse evitada com
Guaabens N. Camptocormia as a clinical manifestation of
tratamento agressivo precoce. mitochondrial myopathy. Clin Rheumatol. 2007;26(6):1017-9.
Em sntese, sendo as miopatias inflamatrias doenas sis- 10. Kuo SH, Vullaganti M, Jimenez-Shaled J, Kwan JY.
tmicas, devemos lembrar que pode ocorrer o envolvimento Camptocormia as a presentation of generalized
sistmico da musculatura esqueltica, incluindo a muscula- inflammatory myopathy. Muscle Nerve. 2009;40(6):1059-63.
tura paravertebral dos segmentos lombossacro da coluna ver- 11. Delcey V, Hachulla E, Michon-Pasturel U, Queyrel V, Hatron
PY, Boutry N, et al. Camptocormia: a sign of axial myopathy.
tebral, com repercusses biomecnicas desse acometimento.
Report of 7 cases. Rev Med Interne. 2002;23(2):144-54.
No presente caso, a camptocormia pode ser consequncia
12. Laroche M, Cintas P. Bent spine syndrome (camptocormia):
biomecnica da fraqueza da musculatura paravertebral. a retrospective study of 63 patients. Joint Bone Spine.
2010;77(6):593-6.
13. Umapathi T, Chaudhry V, Comblath, Drachman D, Griffin J,
REFERNCIAS
Kuncl R. Head drop and camptocormia. J Neurol Neurosurg
Psychiatry. 2002;73(1):1-7.
14. Haig AJ, Tong HC, Kendall R. The bent spine syndrome:
1. Azher SN, Jankovic J. Camptocormia. Pathogenesis, myopathy biomechanics symptoms. Spine J. 2006;6(2):190-4.
classification, and response to therapy. Neurology. 15. Dominick J, Sheean G, Schleimer J, Wixom C. Response
2005;65(3):355-9. of the dropped head/bent spine syndrome to treatment
2. Brodie BC. Pathological and surgical observations on the with intravenous immunoglobulin. Muscle Nerve.
diseases of the joints. London: Longman; 1818, p. 276. 2006;33(1):824-6.

RBR 53(4) - Arquivo livro (Impressa).indb 370 21/10/2013 18:21:30


R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 7 1 3 7 4

REVISTA BRASILEIRA DE
REUMATOLOGIA
www.reumatologia.com.br

Comunicao breve

Perfil lipdico em pacientes adultos com artrite idioptica


juvenil

Thelma Larocca Skare*, Marilia Barreto Silva, Paulo Negreiros


Servio de Reumatologia, Hospital Universitrio Evanglico de Curitiba, Faculdade Evanglica do Paran, Curitiba, PR, Brasil

informaes resumo

Histrico do artigo: O processo inflamatrio articular de uma criana com artrite idioptica juvenil (AIJ) pode
Recebido em 22 de dezembro de 2011 persistir na vida adulta. A inflamao tem sido ligada a distores do perfil lipdico e ate-
Aceito em 14 de maio de 2013 rognese acelerada. Neste trabalho, estudou-se o perfil lipdico de indivduos adultos com
AIJ, comparando-o ao de pessoas saudveis. Foram recrutados 54 adultos com AIJ (57,3%
Palavras-chave: poliarticular, 37% oligoarticular, 1,9% do subtipo entestica e 3,7% do subtipo sistmica) e 54
Dislipidemias indivduos saudveis para comparao de perfil lipdico. Nos adultos AIJ, coletaram-se da-
HDL-colesterol dos sobre sexo, idade e idade de incio da doena, presena de fator reumatoide (FR) e fator
LDL-colesterol antinuclear (FAN), HAQ (Health Assessment Questionnaire) e tempo de doena. Observou-se
Artrite reumatoide juvenil que hipercolesterolemia, aumento de LDL e diminuio de HDL foram mais comuns em
Triglicerdeos pacientes com AIJ do que nos controles (com P = 0,016; P < 0,0001 e P = 0,0008, respecti-
vamente). Alteraes no colesterol total (CT) e no LDL foram mais comuns em indivduos
com incio de doena mais tardio (P = 0,0017 para CT e P = 0,023 para LDL). Em todo o gru-
po de pacientes com AIJ nenhuma outra varivel pode ser ligada dislipidemia tal como
presena de FR, FAN, durao de doena e HAQ (P = ns). Concluiu-se que pacientes adultos
com AIJ apresentam um perfil lipdico com aumento de CT e de LDL, e diminuio de HDL
em relao aos controles. Nenhuma caracterstica clnica pode ser ligada a essa alterao,
exceto idade de incio da doena.
2013 Elsevier Editora Ltda. Todos os direitos reservados.

Lipid profile in adult patients with idiopathic juvenile arthritis

abstract

Keywords: The inflammatory processes in the joints of a child with juvenile idiopathic arthritis (JIA)
Dyslipidemias can persist into adulthood. Inflammation has been linked to distortions of the lipid pro-
Cholesterol, HDL file and accelerated atherogenesis. In the present study, we examined the lipid profiles
Cholesterol, LDL of adults with JIA compared with those of healthy people. A lipid profile of a sample of
Triglycerides 54 adults with JIA (57.3% with polyarticular JIA, 37.0% with oligoarticular JIA, 1.9% with
Arthritis, juvenile rheumatoid enthesitis-related JIA and 3.7% with systemic onset JIA) and 54 healthy subjects were com-
pared. In the adults with JIA, data on gender, age, age at disease onset, the presence of
rheumatoid factor (RF) and antinuclear antibodies (ANA), a Health Assessment Question-
naire (HAQ) and the disease duration were collected. We found that hypercholesterolaemia,


Trabalho realizado no Servio de Reumatologia, Hospital Universitrio Evanglico de Curitiba, Faculdade Evanglica do Paran, Curitiba, PR, Brasil.
* Autor para correspondncia.
E-mail: tskare@onda.com.br (T.L. Skare).
0482-5004/$ - see front matter. 2013 Elsevier Editora Ltda. Todos os direitos reservados.

RBR 53(4) - Arquivo livro (Impressa).indb 371 21/10/2013 18:21:30


372 R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 7 1 3 7 4

increased low-density lipoprotein (LDL) and decreased high-density lipoprotein (HDL) were
more common in patients with JIA than the controls (P = 0.016, P < 0.0001 and P = 0.0008,
respectively). Changes in the levels of total cholesterol (TC) and LDL were more common in
the individuals who had a later onset of disease (P = 0.0017 for TC and P = 0.023 for LDL). In
the entire JIA group, no other variable, such as RF, ANA, disease duration or responses to the
HAQ, could be linked to dyslipidaemia (P = non-significant). We concluded that the adult
patients with JIA have a lipid profile with increased TC and LDL levels and decreased levels
of HDL compared to the controls. No clinical feature could be correlated with this change
except for the age at disease onset.
2013 Elsevier Editora Ltda. All rights reserved.

constitui a totalidade de pacientes adultos com AIJ vistos


Introduo pelo ambulatrio de reumatologia de um centro universitrio
nos ltimos cinco anos e que concordaram em participar da
A AIJ (artrite idioptica juvenil) a artropatia crnica da in- pesquisa. Os participantes foram classificados nos diferentes
fncia mais comum e engloba vrios subtipos de artrite que subtipos de AIJ pelos critrios da International League of Asso-
aparecem antes dos 16 anos.1 Embora esta seja uma doena ciations for Rheumatology (ILAR),1 sendo coletados dados demo-
que, ao afetar crianas, tem o potencial de gerar graves reper- grficos, perfil de autoanticorpos [fator antinuclear (FAN) e
cusses para o desempenho na vida adulta, existem poucos fator reumatoide IgM (FR)], valores de HAQ (Health assessment
estudos voltados para o adulto que desenvolveu AIJ. questionnaire)12 e medicamentos em uso. Excluram-se mulhe-
sabido que a sobrevida de indivduos sujeitos a pro- res grvidas e em aleitamento, bem como indivduos com hi-
cessos inflamatrios de longa durao alterada pelo risco potireoidismo no corrigido (n = 3).
de aterognese acelerada.2,3 Muitos estudos foram feitos na Para comparao, foram estudados indivduos sem proces-
artrite reumatoide (AR) do adulto e mostraram claramente so inflamatrio, pareados para sexo e idade, que procuraram
essa repercusso, que gera aumento de risco de morte pelas ambulatrio de ginecologia para consultas preventivas e o
complicaes cardiovasculares.4-7 Entre as causas associa- servio de oftalmologia para correo de refrao.
das ao risco de aumento de aterognese encontram-se as A populao de adultos com AIJ e de controles foi submeti-
alteraes no perfil lipdico oriundas da exposio s citoci- da a dosagens de CT, TG, LDL e HDL colesterol pelos mtodos
nas pr-inflamatrias, como interleucina (IL) 1, IL-6 e TNF enzimtico/colorimtrico. Foram considerados normais os va-
(fator de necrose tumoral)-.7 O uso crnico de glicocorticoi- lores de CT at 200 mg/dL, de HDL colesterol acima de 40 mg/
des para tratamento dessa entidade tem sido ligado ocor- dL, de LDL colesterol at 110 mg/dL e de TG at 150 mg/dL.13
rncia de hipercolesterolemia.8 Em pacientes com AR, tem- Os dados obtidos foram estudados por tabelas de frequn-
-se notado uma diminuio do HDL colesterol e alteraes cia e de contingncia. Para a anlise comparativa de dados
menos precisas do colesterol total (CT) e de nveis de LDL, nominais, utilizaram-se os testes de Fisher e de qui-quadra-
bem como das relaes entre os diferentes componentes do do. Para o estudo dos valores numricos, usaram-se os testes
perfil lipdico.9 t de Student e de Mann-Whitney conforme a distribuio da
A AIJ uma doena de perfil clnico bem mais hetero- amostra. Para os estudos de correlao, utilizou-se o teste de
gneo do que a AR, sendo esperado tambm um espectro Spearman. A significncia adotada foi de 5%.
de manifestaes com diferentes graus de intensidade do
processo inflamatrio.1 Um estudo com 25 crianas com AIJ
comparadas a 15 crianas saudveis mostrou que existe au- Resultados
mento de colesterol total e de LDL, alm de diminuio de
HDL.10 Outro estudo mostrou que triglicerdeos (TG) estavam Caracterizao da amostra estudada
aumentados e que existia diminuio do HDL, sendo essas
alteraes proporcionais ao tempo de doena e nveis de ati- Os 54 indivduos do grupo controle eram formados por 40
vidade inflamatria.11 (74,1%) mulheres e 14 (25,9%) homens com idade mdia de 20,6
No presente estudo, avaliou-se o perfil lipdico de pacien- 1,8 anos; o IMC mdio era de 22,6 3,5. Nenhum deles era
tes adultos com AIJ, comparando-os ao da populao saudvel fumante; no existiam casos com diabetes mellitus ou hiper-
e estabelecendo sua relao com as variveis clnicas da AIJ. tenso arterial. No grupo de adultos com AIJ havia 54 pacientes,
sendo 39 (72,2%) mulheres e 15 (27,8%) homens (P = 0,8), com
idade mdia de 22,0 5,2 anos (P = 0,1), tempo mdio de doen-
Mtodo a de 15,0 7,8 anos, idade mdia ao diagnstico de 9,4 4,1
anos. O IMC mdio era de 23,4 4 (P = 0,3). Desses, trs eram fu-
Este um estudo transversal analtico do perfil lipdico de mantes (P = 0,2). Um paciente com AIJ apresentava hipertenso
pacientes adultos com AIJ, devidamente aprovado pelo comi- arterial e outro, diabetes mellitus (P = 1,0 para as duas variveis).
t de tica em pesquisa local. Todos os participantes assina- Nos pacientes com AIJ, o subgrupo sistmico estava pre-
ram termo de consentimento livre esclarecido. Esta amostra sente em 2 (3,7%) indivduos; 1 (1,8%) apresentava o subtipo

RBR 53(4) - Arquivo livro (Impressa).indb 372 21/10/2013 18:21:30


R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 7 1 3 7 4 373

entestico, 20 (37%) apresentavam subtipo oligoarticular, e 31


Tabela 1 Perfil lipdico de pacientes adultos com artrite
(57,4%), subtipo poliarticular. Em 28% existia FAN positivo e idioptica juvenil comparado com o do grupo controle
18% eram positivos para FR. Em 13% deles foi relatada histria
Adultos com AIJ Controles P
de uvete. Cerca de 6% usavam sulfassalazina, 10% usavam
N = 54 N = 54
leflunomide, 31,3% usavam cloroquina, 33,3% usavam anti-
Colesterol 102,0-288,0 109,0-213,0 0,0004
TNF, 33,3% usavam prednisona (dose mdia de 9,5 mg/dia)
(mg/dL) Mediana de 170,0 Mediana de 143,5
e 50,9% usavam metotrexato. O HAQ tinha um valor mediano
HDL (mg/dL) 20,1-79,0 39,0-69,0 < 0,0001
de 0,3. Mediana de 45,0 Mediana de 55,0
LDL (mg/dL) 40,6-192,4 31,0-114,0 < 0,0001
Estudo do perfil lipdico Mediana de 100,6 Mediana de 54,5
Triglicerdeos 44,0-311,0 104,0-230,0 < 0,0001
Na populao de adultos com AIJ foram encontrados valores (mg/dL) Mediana de 96,5 Mediana de 131,5

alterados para CT em 16,6%, para HDL colesterol em 23%, para AIJ, artrite idioptica juvenil.
LDL colesterol em 20,3% e para TG em 16,6%. Na amostra con-
trole houve valores alterados em 3,7% para o CT, 1,8% para o
HDL, 1,8% para LDL e 18,5% para TG. A comparao entre as
Tabela 2 Comparao do perfil lipdico de pacientes
duas populaes pode ser visualizada na figura 1.
adultos com artrite idioptica juvenil dos subtipos
Os valores medianos encontrados de CT, HDL e LDL coles- oligoarticular e poliarticular
terol e de TG nos dois grupos podem ser analisados na tabela
Poliarticular Oligoarticular P
1, na qual se observam nveis de LDL e CT mais altos no grupo N = 31 N = 20
adulto de AIJ e de HDL, bem como de TG no grupo controle.
Colesterol 105,0-282,0 117,5-288,0 0,3
Ao estudar o perfil lipdico dos pacientes adultos com AIJ
(mg/dL) Mediana de 166,0 Mediana de 171,5
de acordo com o subtipo de incio, no se observaram diferen- HDL (mg/dL) 29,0-69,0 20,1-79,0 0,3
as entre subtipos oligo e poliarticular (tabela 2). Mediana de 47,0 Mediana de 42,5
A anlise de associao entre perfil lipdico e presena do LDL (mg/dL) 40,6-166,0 58,5-192,4 0,06
FR (FR e CT com P = 0,7; FR e HDL com P = 0,3; FR e LDL com Mediana de 95,2 Mediana de 111,8
P = 0,5 e FR com TG com P = 0,3) e com o FAN (FAN e CT com Triglicerdeos 45,0-311,0 44,0-179,0 0,5
(mg/dL) Mediana de 97,0 Mediana de 91,0
P = 0,8, HDL com P = 0,8; com LDL com P = 0,6 e TG com P =
0,7) no foi significante. O mesmo aconteceu com a correlao
entre perfil lipdico e tempo de doena (CT com P = 0,1; R de verificando associao com HDL (P = 0,3; R de Spearman de
Spearman = 0,19; HDL com P = 0,1 e R de Spearman = 0,19; 0,1) e TG (com P = 0,2; R de Spearman de 0,1).
LDL com P = 0,2 e R de Spearman = 0,15 e TG com P = 0,6 e R Por ltimo, estudando-se o perfil lipdico nos pacientes
de Spearman = 0,06). que estavam usando corticoide no momento do estudo (n =
A anlise de correlao entre HAQ e perfil lipdico no for- 18) em relao aos que no o faziam, encontrou-se que os va-
neceu nenhuma correlao positiva (HAQ e CT com P = 0,1 e lores medianos de colesterol para usurios de corticoide era
R de Spearman de 0,20; HAQ e HDL com P = 0,1 e R de Spear- de 173 mg/dL e para os no usurios era de 169,0 mg/dL (P
man 0,20; HAQ e LDL com P = 0,6 e R de Spearman de 0,05 e = 0,2); para LDL colesterol era de 102,8 mg/dL nos usurios
HAQ e TG com P = 0,9 e R de Spearman de 0,01). Todavia, a contra 100,6 mg/dL nos no usurios (P = 0,2); para o HDL co-
correlao entre idade de incio da doena e CT foi positiva (P lesterol era de 52,1 mg/dL nos usurios de corticoide e de 44,5
= 0,001; R de Spearman de 0,4; IC 95% de 0,1 a 0,6) e com LDL mg/dL naqueles que no usavam (P = 0,03); e de TG era 95
(P = 0,02; R de Spearman de 0,3; IC 95% de 0,03 a 0,54), no se mg/dL nos usurios de prednisona contra 96,5 mg/dL nos no
usurios (P = 0,3).
50
45
40 Discusso
35
30
Quando os dados do presente estudo so analisados, existem
25
alguns resultados relevantes. O primeiro , sem dvida, as al-
20
15 teraes encontradas no perfil lipdico dos indivduos adultos
10 com AIJ, o qual passa a assumir caractersticas pr-aterogni-
5 cas. Observa-se aumento de CT e LDL, assim como diminuio
0 de HDL colesterol em relao ao controle. Nenhuma das ca-
CT HDL-C LDL-C TG ractersticas da AIJ (como subtipos da doena, presena de au-
Adultos com AIJ Controles toanticorpos) pode identificar um grupo com maior risco para
CT = colestereol total; AIJ X CT controle p=0,016 esse aumento, embora fosse observado que pacientes com ida-
HDL-C = HDL colesterol; AIJ X controle p=0,0008 de de incio mais tardio tinham valores mais altos de CT e LDL.
LDL-C = LDL colesterol; AIJ X controle p<0,0001
Um estudo feito com 51 crianas com AIJ (idade mdia de 11
TG = HDL colesterol; AIJ X controle p=0,80
anos) por Gonalves et al.14 tambm encontrou diminuio de
Figura 1 Frequncia (em %) de valores anormais do perfil HDL, mas, ao contrrio do presente estudo, esses autores veri-
lipdico em indivduos adultos com AIJ e controles. ficaram tambm um aumento de TG. Em nosso estudo, a pre-

RBR 53(4) - Arquivo livro (Impressa).indb 373 21/10/2013 18:21:30


374 R E V B R A S R E U M AT O L . 2 0 1 3 ; 5 3 ( 4 ) : 3 7 1 3 7 4

valncia de hipertrigliceridemia foi igual nos dois grupos, mas 2. Kitas GD, Erb N. Tackling ischaemic heart disease in
existiam nveis medianos mais altos nos controles. Bakkaloglu rheumatoid arthritis. Rheumatology. 2003;42:607-13.
3. Brenol CV, Monticielo OA, Xavier RM, Brenol JCT. Artrite
et al.,15 estudando 19 crianas turcas com AIJ, no constataram
reumatoide e aterosclerose. Rev Assoc Med Bras.
aumento de TG.
2007;53:465-70.
Na presente anlise, observou-se tambm uma tendncia 4. Van Doomum S, Mc Coll G, Wicks IP. Accelerated
para pacientes com o subtipo oligoarticular demonstrarem au- atherosclerosis: an extra articular feature of rheumatoid
mento do LDL. Este ltimo aspecto interessante, uma vez que arthritis? Arthritis Rheum. 2002;46:862-73.
seria esperado que os pacientes com subtipo poliarticular, ou 5. Assous N, Touze E, Meune C, Kahan A, Allanore Y.
seja, aqueles com maior intensidade de processo inflamatrio, Cardiovascular disease in rheumatoid arthritis: single
center hospital based cohort study in France. Joint Bone
estivessem mais afetados. Todavia, todos os pacientes estavam
Spine. 2007;74:66-72.
sendo tratados de maneira que a intensidade do processo in-
6. Turesson C, Jarenros A, Jacobsson L. Increased incidence
flamatrio possa ter sido nivelada pelo uso de medicamentos of cardiovascular disease in patients with rheumatoid
modificadores de doena. arthritis: result from a community based study. Ann Rheum
Um aspecto interessante o encontrado em relao ao uso Dis. 2004;63:952-5.
dos corticoides. Os nveis de HDL colesterol, nesta amostra, 7. Avelar AB, de Melo AKG, Souza BD, Avaliao prospectiva
estavam mais altos nos usurios do medicamento. A atuao do perfil lipdico na artrite reumatoide. Rev Bras Reumatol.
2008;48:213-7.
dos glicocorticoides no perfil lipdico de pacientes reumticos
8. Maxwell SR, Moot RJ, Kendall MJ. Corticosteroids: do
pode ser considerada, no mnimo, ambgua. Se por um lado a they damage the cardiovascular system? Postgrad Med J.
atuao direta desses agentes no metabolismo dos lipdeos faz 1994;70:863-70.
com que eles sejam considerados pr-aterognicos,8 por ou- 9. Steiner G, Urowitz MB. Lipid profile in patients with
tro devem ser considerados seus efeitos anti-inflamatrios.16 rheumatoid arthritis: mechanisms and the impact of
A atuao anti-inflamatria dos corticoides pode neutralizar treatment. Sem Arthitis Rheum. 2009;38:372-81.
10. Urban M, Pietrewicz E, Gorska A, Glowinska B. Lipid and
as alteraes lipdicas causadas pela inflamao, direcionando
homocysteine levels in juvenile idiopathic arthritis. Pol
o perfil lipdico para um aspecto mais benigno. Boers et al.16
Merkur Lekarski. 2004;17:235-8.
demonstraram que, em indivduos com AR, a dislipidemia cau- 11. Ilowite NT, Samuel P, Beseler L, Jacobson MS.
sada pela atividade da doena era revertida pelo tratamento, Dyslipoproteinemia in juvenile rheumatoid arthritis. J
no qual se incluam os glicocorticoides. Infelizmente, no pre- Pediatr. 1989;114:823-6.
sente estudo, no existiam dados acerca de uso anterior dos 12. Ferraz MB, Oliveira LM, Araujo PM, Atra E, Tugwell P.
corticoides para que se pudessem estudar os efeitos de doses Crosscultural reliability of the physical ability dimension
of the health assessment questionnaire. J Rheumatol.
cumulativas do medicamento. Muitos dos pacientes aqui ana-
1990;17:813-7.
lisados eram oriundos de diferentes clnicas peditricas, o que
13. Santos RD, Giannini SD, Fonseca FH, Moriguchi EH,
dificultou a obteno de dados acerca de tratamentos prvios. Maranho RC, da Luz PL, et al. Sociedade Brasileira de
Outro fator que chama a ateno a existncia de anorma- Cardiologia. III Diretrizes Brasileiras Sobre Dislipidemias
lidades lipdicas em populao bastante jovem (idade mdia e Diretriz de Preveno da Aterosclerose. Arq Bras Cardiol.
de 25 anos). Essa ltima observao fundamental quando 2001;77(supl 3):1-48.
so lembrados os riscos de doena cardiovascular e de sua alta 14. Gonalves M, DAlmeida V, Guerra-Shinohara EM, Galdieri
L, Len CA, Hilrio MOE. Homocysteine and lipid profile
morbimortalidade. A expectativa de vida em pacientes com AIJ
in children with juvenile idiopathic arthritis. Pediatr
est diminuda. French et al.17 encontraram uma mortalidade Rheumatol Online J. 2007;5:2. [Available from: http://www.
quatro vezes maior nessa populao quando comparada po- ped-rheum.com/content/5/1/2]
pulao geral. Thomas et al.,18 ao estudarem a razo de morta- 15. Bakkaloglu A, Kirel B, Ozen S, Saati U, Topaloglu Besbas N.
lidade padronizada (Standardized Mortality Ratio ou SMR) em AIJ, Plasma lipid and lipoproteins in juvenile chronic arthritis.
encontraram aumento de trs vezes para homens e de cinco Clin Rheumatol. 1996;15:341-5.
16. Boers M, Nurmohamed MT, Doelman CJA, Lard LR,
vezes para mulheres valores considerados mais altos do que
Verhoeven AC, Vaskuyl AE, et al. Influence of glucocorticoids
os encontrados para a AR de incio no adulto. Todavia, as razes
and disease activity on total and high density lipoprotein
para essa mortalidade no esto bem-esclarecidas.18,19 cholesterol in patients with rheumatoid arthritis. Ann
Resumindo, pacientes adultos com AIJ apresentam risco au- Rheum Dis. 2003;62:842-5.
mentado de dislipidemia, e todos os esforos no sentido de seu 17. French AR, Mason T, Nelson AM, OFallon WM, Gabriel SE.
controle devem ser empreendidos. Increased mortality in adults with a history of juvenile
rheumatoid arthritis: a population-based study. Arthritis
Rheum. 2001;44:523-7.
18. Thomas E, Symmons DP, Brewster DH, Black RJ, Macfarlane
REFERNCIAS
GJ. National study of cause-specific mortality in rheumatoid
arthritis, juvenile chronic arthritis, and other rheumatic
conditions: a 20 year follow up study. J Rheumatol.
1. Lowell DJ. Juvenile Idiopathic arthritis: clinical features. In 2003;30:958-65.
Klippel JH, Stone JH, Crofford LJ, White PH. (eds) Primer on 19. Minden K. Adult Outcomes of Patients with Juvenile
the Rheumatic diseases. New York: Springer, 2008; p.142-53. Idiopathic Arthritis. Horm Res 2009;72(S1):20-5.

RBR 53(4) - Arquivo livro (Impressa).indb 374 21/10/2013 18:21:30