Anda di halaman 1dari 59

SKRIPSI

IDENTIFIKASI Trypanosoma evansi PADA SAPI BALI


(Bossondaicus) BERDASARKAN MORFOMETRI
DAN Polymerase Chain Reaction

Disusun oleh :
HAYYU MAHARANI
061211131064

FAKULTAS KEDOKTERAN HEWAN


UNIVERSITAS AIRLANGGA
SURABAYA
2016

i
IDENTIFIKASI Trypanosoma evansi PADA SAPI BALI
( Bossondaicus) BERDASARKAN MORFOMETRI
DAN Polymerase Chain Reaction ( PCR )

Skripsi
Sebagai salah satu syarat untuk memperoleh gelar
Sarjana Kedokteran Hewan
Pada
Fakultas Kedokteran Hewan, Universitas Airlangga

oleh
HAYYU MAHARANI
061211131064

Menyetujui
Komisi Pembimbing,

(Dr. Mufasirin, drh., M.Si.) (RetnoBijanti, drh., M.S.)


Pembimbing Utama Pembimbing Serta

ii
PERNYATAAN

Dengan ini saya menyatakan bahwa dalam skripsi yang berjudul :

IDENTIFIKASI Trypanosoma evansi PADA SAPI BALI


(Bos sondaicus) BERDASARKAN MORFOMETRI
DAN Polymerase Chain Reaction

Tidak terdapat karya yang pernah diajukan untuk memperoleh gelar kesarjanaan
di suatu perguruan tinggi dan sepanjang pengetahuan saya juga tidak terdapat
karya atau pendapat yang pernah ditulis atau diterbitkan oleh orang lain, kecuali
yang secara tertulis diacu dalam naskah ini dan disebutkan dalam daftar pustaka.

Surabaya, Februari 2016

Hayyu Maharani
NIM. 061211131064

iii
Telah diuji pada Seminar Hasil Penelitian
Tanggal : 22 Januari 2016

KOMISI PENILAI SEMINAR HASIL PENELITIAN

Ketua : Dr. Poedji Hastutiek, drh., M.Si


Sekretaris : M. Yunus, drh., M. Kes., Ph.D
Anggota : Dr. Jola Rahmahani, drh., M.Kes
Pembimbing I : Dr. Mufasirin, drh., M.Si
Pembimbing II : Retno Bijanti, drh., M.S

iv
Telah diuji pada
Tanggal: 09 Februari 2016

KOMISI PENGUJI SKRIPSI


Ketua : Dr. Poedji Hastutiek, drh., M.Si
Anggota : M. Yunus, drh., M. Kes., Ph.D
Dr. Jola Rahmahani, drh., M.Kes
Dr. Mufasirin, drh., M.Si
Retno Bijanti, drh., M.S

Surabaya, 11 Februari 2016


Fakultas Kedokteran Hewan
Universitas Airlangga
Dekan,

Prof. Dr. Pudji Srianto,drh., M.Kes.


NIP. 195601051986011001

v
UCAPAN TERIMA KASIH

Puji syukur Kehadirat Allah SWT atas karunia yang telah dilimpahkan
sehingga penulis dapat melaksanakan penelitian dan menyelesaikan penulisan
skipsi dengan judulIdentifikasi Trypanosoma evansipada Sapi Bali (Bos
sondaicus) berdasarkan morfometri dan Polymerase Chain Reaction.Pada
kesempatan ini penulis ingin menyampaikan terima kasih kepada:
Dekan Fakultas Kedokteran Hewan Universitas Airlangga Prof. Dr. Pudji
Srianto, drh., M.Kes.dan staf pimpinan serta Prof. Hj. Romziah Sidik, PhD., drh.
atas kesempatan mengikuti pendidikan di Fakultas Kedokteran Hewan Universitas
Airlangga Surabaya.
Dr. Mufasirin, drh., M.Si. selaku dosen pembimbing pertama yang
bersedia memberikan bimbingan, sarandan nasehat yang berguna selama
penelitian serta dalam penyusunan naskah skripsi ini.
Retno Bijanti, drh., M.S.selaku pembimbing serta sekaligus sebagai dosen
pembimbing penelitian yang tiada henti membimbing penulis dengan ikhlas
dalam pelaksanaan penelitian dari awal hingga akhir dan memberi saya dorongan
untuk segera menyelesaikan penulisan skripsi.
Dr. Poedji Hastutiek, drh., M.Si. selaku ketua penguji, Muchammad
Yunus, drh., M.Kes., Ph.D. selaku sekretaris penguji, dan Dr. Jola Rahmahani,
drh, M.Kes.selaku anggota, atas saran yang membangun dalam penyusunan
skripsi.
Dr. I Komang Wiarsa Sardjana, drh., DEA.selaku dosen wali, atas segala
nasehat, kritik, saran dan bimbingan yang diberikan selama mengikuti pendidikan
di Fakultas Kedokteran Hewan Universitas Airlangga.
Ketua Departemen Parasitologi Veteriner dan staf Laboratorium Biologi
Molekuler Veteriner Fakultas Kedokteran Hewan Universitas Airlangga yang
telah memberikan ijin dan bantuan pada penelitian ini.
Seluruh staf pengajar Fakultas Kedokteran Hewan Universitas Airlangga
atas wawasan keilmuan selama mengikuti pendidikan di Fakultas Kedokteran
Hewan Universitas Airlangga.

vi
Terima kasih kepada drh. Dilasdita Kartika Pradana selaku staf di Balai
Besar Veteriner Bali yang telah berkenan memberikan banyak bantuan selama
penelitian ini berlangsung.
Ayahanda Slamet Adi Wibowo dan Ibunda Siti Solekah serta kakak Taju
Mahadhikara yang telah memberikan dukungan, semangat, terutama doa yang
sangat memotivasi penulis dalam menyelesaikan penelitian dan penyusunan
skripsi. Radiaprima Kartika Wijaya, terima kasih atas bantuan, dukungan,
semangat dan doanya.
Terima kasih kepada teman seperjuangan yang telah banyak membantu
dan mendukung penelitian ini Lusiana Fitriyanti, Amira Nadia dan Anggun
Rahmawati, serta teman-teman yang namanya tidak mungkin disebutkan satu
persatu yang telah membantu terselesaikanya skripsi ini.
Semua pihak yang tidak bisa saya sebutkan satupersatu yang telah
mendukung baik secara langsung maupun tidak langsung demi
terselesaikannyapenelitian ini.
Penulis menyadari bahwa skripsi ini masih jauh dari kesempurnaan,oleh
karena itu, penulis mengharapkan kritik dan saran yang membangun. Semoga
penulisan skripsi ini dapat memberikan manfaatbagi pembaca dan bagi
perkembangan ilmu pengetahuan.

Surabaya, 22 Januari 2016

Penulis

vii
DAFTAR ISI

Halaman
HALAMAN JUDUL......................................................................................... i
HALAMAN PENGESAHAN ......................................................................... ii
HALAMAN IDENTITAS .............................................................................. iii
ABSTRACT .................................................................................................... vi
UCAPAN TERIMAKASIH ........................................................................... vii
DAFTAR ISI ................................................................................................... ix
DAFTAR TABEL ........................................................................................... xi
DAFTAR GAMBAR ..................................................................................... xii
DAFTAR LAMPIRAN ................................................................................. xiii
SINGKATAN DAN ARTI LAMBANG ...................................................... xiv
BAB 1 PENDAHULUAN ................................................................................1
1.1 Latar Belakang Penelitian ...............................................................1
1.2 Rumusan Masalah ...........................................................................5
1.3 Landasan Teori ................................................................................5
1.4 Tujuan Penelitian .............................................................................7
1.5 Manfaat Penelitian ...........................................................................7
BAB 2 TINJAUAN PUSTAKA .......................................................................8
2.1 Surra ................................................................................................8
2.1.1 Penyebab ...............................................................................8
2.1.2 Morfologi Trypanosoma evansi ............................................8
2.1.3 Hewan yang rentan ..............................................................10
2.1.4 Penularan .............................................................................10
2.1.5 Gejala klinis.........................................................................11
2.1.6 Patogenesis ..........................................................................12
2.1.7 Diagnosis .............................................................................13
2.2 Sapi Bali ........................................................................................14
2.3 Morfometri ....................................................................................17

viii
2.4 Polymerase Chain Reaction ..........................................................17
BAB 3 METODE PENELITIAN....................................................................19
3.1 Jenis Penelitian ..............................................................................19
3.2 Tempat dan Waktu Penelitian .......................................................19
3.3 Materi Penelitian ...........................................................................19
3.3.1.1 Sampel ..............................................................................19
3.3.1.2 Bahan ulas darah ..............................................................19
3.3.1.3 Bahan isolasi DNA ...........................................................20
3.3.1.4 Alat penelitian ..................................................................20
3.4 Metode Penelitian .........................................................................21
3.4.1 Pembuatan ulas darah ..........................................................21
3.4.2 Pemeriksaan morfometri .....................................................21
3.4.3 Isolasi DNA .........................................................................22
3.4.3.1 Persiapan reagen isolasi ...............................................22
3.4.3.2 Ekstraksi DNA.............................................................22
3.4.4 Teknik Polymerase Chain Reaction (PCR) .........................23
3.4.5 Analisis hasil PCR...............................................................24
3.5 Analisis Data .................................................................................24
3.6 Bagan Kerangka Operasional ........................................................25
BAB 4 HASIL PENELITIAN ........................................................................26
4.1 Hasil Pemeriksaan Ulas Darah dan Morfometri ...........................26
4.2 Hasil Pemeriksaan Menggunakan Metode PCR ...........................27
BAB 5 PEMBAHASAN .................................................................................29
BAB 6 KESIMPULAN DAN SARAN ..........................................................34
RINGKASAN .................................................................................................35
DAFTAR PUSTAKA .....................................................................................38
LAMPIRAN ....................................................................................................44

ix
DAFTAR TABEL

Tabel Halaman

3.3 Susunan dan Posisi Nucleotida untuk Primer ITS1 CF/BR ...............20
4.1 Hasil Pemeriksaan Morfometri Trypanosoma sp. ..............................27

x
DAFTAR GAMBAR

Gambar Halaman
2.1 Morfologi Trypanosoma evansi ............................................................9
2.2 Sapi Bali betina ...................................................................................14
2.3 Sapi Bali jantan ...................................................................................15
3.1 Bagan kerangka operasional penelitian ...............................................25
4.1 Hasil pemeriksaan ulas darah Sapi Bali ..............................................26
4.2 Hasil elektroforesis PCR pada darah Sapi Bali ...................................28

xi
DAFTAR LAMPIRAN

Lampiran Halaman
1. Gen Trypanosoma evansi ................................................................... 44
2. Letak penempelan primer foward ITS1 CF/BR pada sequence gen
Trypanosoma evansi ...........................................................................46
3. Letak penempelan primer reverse ITS1 CF/BR pada sequence
gen Trypanosoma evansi .....................................................................46

xii
SINGKATAN DAN ARTI LAMBANG

% = Persen
C = Derajat Celcius
l = microliter
bp = base pairs
dATP = Deoxyadenine Triphospate
dCTP = Deoxycitosine Triphospate
ddH2O =Double Distilled Water
dGTP = Deoxyguanine Triphospate
DNA = Deoxyribonucleic Acid
dNTP = Deoxynucleatide Triphospate
dTTP = Deoxytimine Triphospate
EDTA = Ethylen Diamine Tetra Acid
ELISA = Enzyme Linked Immunosorbent Assay
EtBr = Ethidium Bromida
GPI = Glikosilphosphatidilinositol
mA = mili Ampere
mg = miligram
mm = milimeter
ng = nanogram
nm = nanometer
nt = nukleotida
PCR = Polymerase Chain Reaction
pH = power of Hydrogen
Primer F = Primer Forward
Primer R = Primer Reverse
Rpm = Revolutions per minute
rpm = Rotation per minute
TBE = Tris Borat EDTA
UV = Ultra Violet
V = Volt

xiii
1

BAB 1 PENDAHULUAN

1.1. Latar Belakang

Penyakit surra merupakan salah satu penyakit strategis yang menyerang

hewan ternak yang disebabkan oleh Trypanosoma evansi (Luckins et al., 1992;

Dargantes et al., 2005). Trypanosomaevansi banyak ditemukan dalam

darahdanataujaringan hewan vertebrata(FAO, 1994).Parasitini ditularkan secara

mekanis oleh vektor lalat penghisap darah seperti Tabanus sp dan Stomoxys

sp(Payne et al., 1991, Luckins et al., 1992).

Trypanosoma evansi mempunyai induk semang yang beragam dari hewan

liar sampai hewan domestik termasuk ternak.Hewan domestik yang rentan adalah

kuda, sapi, kerbau, kambing, domba, babi, anjing dan kucing, sedangkan hewan

liar yang rentan diantaranya adalah badak (Vellayan et al., 2004), rusa (Adrian et

al., 2010), wallaby (Reid et al., 2001) dan bisa berpotensi sebagai sumber infeksi

untuk hewan domestik (Dargantes et al., 2005). Khusus pada sapi dan kerbau di

Indonesia, infeksi T. evansi dapat menyebabkan kerugian ekonomi yang sangat

besar dikarenakan ternak tersebut merupakan sumber produksi daging dan susu

(Manuel, 1998).

Trypanosoma evansi pada beberapa ternak mempunyai ukuran yang

bermacam-macam tergantung dari induk semang dan daerah geografisnya. Secara

umum T. evansi mempunyai panjang berkisar antara 15-34 m dengan ratarata

24 m. Bentuk tubuh silinder tetapi kadangkadang terjadi bentuk stumpy/gemuk.

Ukuran T. evansihampir sama dengan genus Trypanosoma lain, seperti T.

1
2

bruceiyang memiliki panjang berkisar antara 12-26 m, T. gambiense dengan

panjang berkisar antara 15-30 m dan T. cruzi dengan panjang berkisar antara 15-

20 m (Levine, 1985).

Kasus penyakit surra pertama kali dilaporkan di Indonesia pada tahun

1897 pada populasi kuda di Pulau Jawa.Semenjak itu, secara sporadik menyebar

ke seluruh wilayah Indonesia (Partoutomo, 1996). Menurut Sukanto (1994),paling

tidak ada 11 provinsi di Indonesia (Aceh, Sumatra Utara, Lampung, Jawa Barat,

Jawa Tengah, Jawa Timur, Kalimantan Selatan, Sulawesi Utara, Nusa Tenggara

Barat, Bali dan Nusa Tenggara Timur) merupakan daerah endemik penyakit surra.

Penyakit surra pada sapi dan kerbau umumnya berlangsung lebih lambat,

bersifat kronis dan bahkan tanpa menunjukkan gejala klinis atau

subklinis.Respons imun terhadap infeksi T. evansi pada kerbau dan sapi relatif

lebih baik dari pada kuda sehingga ternak ruminansia besar tersebut lebih

tahan terhadap serangan penyakit surra. Penyakit dapat bersifat akut dan

mewabah pada ternak ruminansia ketika hewan mengalami stres, karena

dipekerjakan atau difungsikan terlampau berat, akibat kekurangan pakan atau air

dan faktor kondisi lingkungan kritis dan cuaca yang ekstrim (Soulsby,1982).

Di antara berbagai bangsa sapi yang terdapat di Indonesia, Sapi Bali

merupakan salah satu jenis sapi yang terdapat dalam jumlah yang cukup banyak

dan tersebar hampir ke seluruh Indonesia. Menurut Guntoro (2002), pada tahun

1990 jumlah populasi Sapi Bali di seluruh Indonesia mencapai sekitar 3 juta ekor

yang tersebar di berbagai provinsi, mulai dari Aceh hingga Irian Jaya. Dari

populasi tersebut sekitar 82% terdapat di 4 provinsi utama, dengan urutan


3

populasi yaitu Sulawesi Selatan sekitar 1.200.000 ekor, Nusa Tenggara Timur

600.000 ekor, Bali 450.000 ekordan Nusa Tenggara Barat 350.000

ekor.Sementara pada tahun 2002 seluruh populasi Sapi Bali di Indonesia

diperkirakan mencapai hampir 3,5 juta ekor (Guntoro 2002).

Sapi Bali (Bos sondaicus) merupakan jenis sapi yang unggul.Sapi Bali

didomestikasi pertama kali di Pulau Bali.Perkembangan Sapi Bali sangat cepat

dibandingkan dengan breed sapi potong lain di Indonesia, sehingga apabila Sapi

Bali terkena suatu penyakit seperti penyakit surra akan mudah menular

(Handiwirawan dan Subandriyo 2004). Penyakit surra pada Sapi Bali pernah

terjadi di Flores, Provinsi Nusa Tenggara Timur pada tahun 1971.Sebanyak 516

ekor Sapi Bali terserang penyakit surra (Mastra, 2011).Pada tahun 2009, kasus

penyakit surra pada Sapi Bali juga terjadi di Kecamatan Batu Engau, Kabupaten

Paser, Provinsi Kalimantan Timur.Dari 19 sampel yang diuji di laboratorium

BPPV Regional V Banjarbaru terdapat 8 sampel yang positif penyakit surra

(BPPV Regional V Banjarbaru, 2009).

Diagnosispenyakit surra di Indonesia umumnya masih berdasarkan laporan

kasus diagnosa klinis, pemeriksaan laboratoris secara mikroskopis terhadap

sampel preparat ulas darah dan atau teknik sentrifugasi mikrohematokrit. Akurasi

data diagnosis klinis dan sensitivitas metoda uji laboratoris tersebut relatif belum

optimal terutama pada manifestasi penyakit sub klinis sehingga cenderung tidak

mencerminkan kejadian penyakit yang sesungguhnya (Mastra, 2011). Pada

faseakut, tanda klinisyang biasa terlihat dilapanganadalah

demamintermitendisertai denganakumulasiparasitdalam darah(parasitemia), gejala


4

ini biasa terjadi pada kuda (Luckins, 1998; Thumbi, 2008).Sebagian penyakit

berlangsungkronis yang biasa terjadi pada sapi dan kerbau dan hasil pemeriksaan

ulas darah jumlahparasitdalam darah sedikit sekali bahkan tidak terdeteksi.

Tingkatparasitemia yang rendah akan menyebabkan diagnosis parasitologi

terhadap Trypanosomafalse negatif. DeteksiT. evansitidak

berhasilketikajumlahparasitterlalu rendah, seperti pada infeksikronis(Nantulya,

1994; Masakeetal., 2002; Desquesnes, 2002).Perlu ada alternatif teknik diagnosis

yang lebih sensitif terhadap infeksi Trypanosoma pada sapi yaitu penanda

molekuler dengan metode Polymerase Chain Reaction (PCR).

Pengembangan dan penerapan teknik PCR telah banyak digunakan untuk

diagnosis infeksi Trypanosomapada hewan.Untuk mengoptimalkandiagnosis

dengan PCR perlu mempertimbangkan beberapa faktor yang mempengaruhi

sensitivitas PCR, seperti kuantitas dan kualitas DNA yang ada di dalam sampel

(Gonzlez et al., 2006).Pemeriksaan morfometri dan teknik PCR penting untuk

memperkuat diagnosis penyakit surra secara parasitologis

karenaketerbatasandiagnosis T.evansiyang ada dan disarankan untuk

menggunakan kombinasidaridua atau lebihteknik untukmeningkatkan

akurasidiagnosis(Monzonet al., 1990).


5

1.2. Rumusan Masalah

Berdasarkan latar belakang yang telah diuraikan di atas, maka dapat

dirumuskan masalah yaitu : Bagaimana identifikasi dan morfologi Trypanosoma

evansiyang terdapat pada Sapi Bali (Bos sondaicus) berdasarkan morfometri dan

Polymerase Chain Reaction?

1.3. Landasan Teori

Pada tahun 1968-1969 wabah surra pada Sapi Bali terjadi di beberapa

daerah di Indonesia, termasuk terjadi di Flores, Provinsi Nusa Tenggara Timur

pada tahun 1971 terserang sebanyak 516 ekor Sapi Bali. Sementara dalam tahun

1974-1976 terjadi peningkatan kasus penyakit Surra di Provinsi Nusa Tenggara

Barat (Sukanto et al., 1994). Prevalensi Trypanosomiasis pada Sapi Bali di

Kabupaten/Kota Bima dan Sumbawa Besarrata-rata sebesar 15,3%. Hasil ini

mengindikasikan bahwa kejadian infeksi secara alami oleh parasit darah

patogen T. evansi pada Sapi Bali di Kabupaten/Kota Bima dan Sumbawa Besar

tersebar luas dan cendrung bersifat endemis (Mastra, 2011).Menurut data

pengujian dan diagnosa laboratorium BPPV Regional V Banjarbaru, pada tahun

2009 terjadi kasus penyakit surra di Kecamatan Batu Engau, Kabupaten Paser

Provinsi Kalimantan Timur pada Sapi Bali.Dari 19 sampel yang diuji terdapat 8

sampel positif penyakit surra (BPPV Regional V Banjarbaru, 2009).

Periode antara inokulasi pada hewan sehat dan waktu Trypanosoma dapat

dideteksi dalam plasma darah dengan observasi langsung disebut masa/periode

prepaten. Dengan mengetahui periode prepaten, penyakit ini kemudian dibedakan


6

menjadi dua kategori yaitu : kategori akut apabila jumlah parasit dalam darah

sangat tinggi dan terlihat gejala klinis. Dikategorikan kronis apabila jumlah parasit

dalam darah sedikit dan tidak tampak gejala klinis.Trypanosomiasis adalah

penyakit yang serius di banyak negara, seperti Afrika, Asia dan Amerika Latin

(Duvallet et al., 1999)

Trypanosoma evansi memiliki morfologi yang mirip dengan Trypanosoma

lain seperti T. equiperdum, T. brucei, T. gambiense dan T. rhodesiense.

Permukaan tubuhT.evansi diselubungi oleh lapisan protein tunggal yaitu

glikoprotein yang dapat berubah-ubah bentuk (variable surface glycoprotein).

Kemampuan glikoprotein yangdapat berubah bentuk, maka T. evansi dapat

memperdaya sistem kekebalan tubuh induk semang. Konsekuensinya akan

terjadi variasi antigenik (antigenic variation) tubuh akan selalu berusaha

membentuk antibodi yang berbeda-beda sesuai denganprotein permukaan yang

ditampilkan oleh T. evansi (Davilaet al., 2003).

Banyak cara yang dapat dilakukan untuk mengidentifikasi Trypanosoma,

baik dengan cara yang sederhana seperti pemeriksaan ulas darah dengan

pewarnaan, sampai dengan pemeriksaan dengan metode Polymerase Chain

Reaction (PCR). Metode PCR dapat mendeteksi asam nukleat parasit.Polymerase

Chain Reaction merupakan metode yang sangat sensitif yang dapat mendeteksi

satu Trypanosoma/ml darah (Davila etal.,2003) atau bahkan satu pikogram dari

DNA Trypanosoma yang ada pada DNA inang (Clausen etal.,1998).

Polymerase Chain Reaction adalah suatu metode memperbanyak fragmen

DNA spesifik secara in vitro.Prinsip metode PCR adalah perbanyakan rantai


7

DNA.Polymerase Chain Reaction juga dapat digunakan untuk mendeteksi

fragmen DNA tertentu dalam sampel.Proses PCR melibatkan serangkaian siklus

temperatur yang berulang masingmasing siklus terdiri atas tiga

tahapan.Polymerase Chain Reaction memanfaatkan enzim DNA polymerase yang

secara alami memang berperan dalam perbanyakan DNA pada proses replikasi.

Siklus PCR terdiri dari tiga tahap yaitu denaturasi, annealing dan polimerasi

(Gumilar et al., 2008).

1.4. Tujuan Penelitian

Penelitian ini bertujuan untuk mengidentifikasi dan mengetahui morfologi

Trypanosoma evansiyang terdapat pada Sapi Bali (Bos sondaicus) berdasarkan

morfometri dan Polymerase Chain Reaction.

1.5. Manfaat Penelitian

Hasil penelitian ini dapat memberikan informasi tentang identifikasi dan

morfologi Trypanosoma evansiyang terdapat pada Sapi Bali (Bos sondaicus)

berdasarkan morfometri dan Polymerase Chain Reaction, sehingga dapat

menambah pengetahuan dan sebagai referensi untuk penelitian selanjutnya.


8

BAB 2 TINJAUAN PUSTAKA

2.1. Penyakit Surra

2.1.1. Penyebab

Penyakit surra adalah nama penyakit yang diberikan pada hewan yang

terserang protozoa darah Trypanosoma evansi. Taksonomi Trypanosoma menurut

Levine (1985) adalah :

Kingdom : Animal

Filum : Sarcomastigophora

Sub Filum : Mastigophora

Kelas : Zoomastighoporasida

Ordo : Kinetoplastorida

Sub Ordo : Trypanosomarina

Family : Trypanosomatidae

Genus : Trypanosoma

Spesies : Trypanosoma evansi

2.1.2. Mofologi Trypanosoma evansi

Trypanosoma evansi berbentuk seperti daun, aktif membelah dengan

binary fission.Di bagian tengah tubuh terdapat inti yang mengandung kariosoma

(trofonukleus) yangbesar dan terletak hampir sentral (Ausvetplan, 2006).Gambar

morfologi T. evansi dapat dilihat pada Gambar 2.1.

8
9

Gambar 2.1 Morfologi Trypanosoma evansi


Sumber : Levine (1985).

Trypanosoma evansimempunyai karakteristik ramping, ukuran kecil,

dibandingkan dengan Trypanosoma theileri, tetapi lebih besar dibandingkan

dengan T. congolense, mempunyai flagela bebas dan bergerak aktif (Desquesnes

et al., 2002).Pada Gambar 2.1 terlihat bahwa flagela timbul pada ujung posterior

dari bagian parabasal dan membentang sampai bagian anterior.Flagela di luar

ujung anterior tubuh sebagai flagela bebas berbentuk seperti cambuk.Flagela di

sepanjang tubuh membentuk membran bergelombang yang disebut undulating

membran.Trypanosoma evansi mempunyai panjang 15-34 m dengan rata rata

24 m. Tubuh berbentuk silinder, tetapi kadangberbentuk stumpy/gemuk (Levine,

1985).
10

2.1.3. Hewan yang rentan

Hampir semua hewan berdarah panas rentan terhadap penyakit surra,

kecuali bangsa burung.Kuda paling tinggi kerentanannya diikuti unta, anjing, sapi

dan kerbau.Hewan percobaan seperti tikus, marmut dan kelinci juga termasuk

hewan yang rentan. Pada sapi dan kerbau, penyakit ini bersifat kronis, tetapi

dalam kondisi tertentu seperti kurang makan dan kerja terlalu keras, keganasan

penyakit akan meningkat dengan mortalitas sampai 80 % (Levine, 1985).

Trypanosoma evansi mempunyai inang yang beragam dari hewan liar

sampai hewan domestik. Diantara hewan domestik yang rentan adalah kuda,

sapi, kerbau, kambing, domba, babi, anjing dan kucing, sedangkan hewan liar

yang rentan diantaranya adalah badak (Vellayan et al., 2004), rusa (Adrianet

al., 2010), wallaby (Reid et al., 2001), dan bisa berpotensi sebagai sumber

infeksi untuk hewan domestik (Dargantes et al., 2005). Hewan coba seperti tikus

dan mencit juga sangat peka terhadap infeksi T. evansi (OIE, 2009).

2.1.4. Penularan

Penyakit surra di Indonesia ditularkan oleh lalat penghisap darah Tabanus

sp, Haematopota sp, Chrysop sp, Stomoxys spdan Haematobiasp. (Jones et al.,

1996). Insekta merupakan vektor mekanik, karena tidak terjadi perkembangan

siklus di dalam vektor dan Trypanosoma tertinggal di dalam probosis (Levine,

1985). Penularan infeksi Trypanosoma evansi sangat cepat pada beberapa hewan

karena sifat lalat, khususnya Tabanus sp yang menghisap darah terputusputus

(dari satu hewan berpindah ke hewan lain) (Soulsby, 1982). Lalat Tabanus
11

yangpaling menonjol populasinya sebagai penyebar infeksi Trypanosoma evansi

di Indonesia adalah Tabanus rubidus dan Tabanus megalops (Sasmita dkk.,

2013).

Sebaran penyakit yang luas sangat dipengaruhi oleh topografi daerah dan

manajemen atau cara pemeliharaan ternak terutama yang dipelihara secara

tradisional dengan cara menggembalakan ternak secara bersama-sama di areal

padang pengembalaan. Batas tanah pertanian tidak jelas, ladang terbuka yang

hanya dibatasi oleh semak, sungai dan hutan masih banyak dijumpai didaerah ini

sebagai tempat berkumpul hewan ternak untuk merumput dan mencariair minum.

Kondisi lingkungan seperti ini juga sangat digemari oleh lalat pengisap darah

seperti Tabanus sp.,Stomoxyssp. Lalat Tabanus sp., merupakan salah satu vektor

penularan secara mekanik Trypanosomiasis yang sangat potensial pada hewan

ternak (Soulsby, 1982).

2.1.5. Gejala klinis

Gejala klinis yang khas penyakit surra adalah adanya oedema atau

pembengkakan pada daerah ventral atau bagian bawah tubuh seperti leher, legok

lapar dan kaki.Gejala klinis lain adalah terjadi perdarahan di bawah kulit, hidung,

mata dan anus. Gejala lain adalah anemia, demam selang seling (intermittent

fever) dan pada akhirnya terjadi kematian.Gejala klinis rambut rontok dapat

terjadi karena kondisi tubuh hewan yang menurun dan nafsu makan berkurang

(Ismudiono dkk., 2006). Gejala klinis khas yang lain apabila parasit menuju cairan

cerebrospinal akan menimbulkan gejala inkoordinasi gerak (Levine, 1985).


12

Bentuk akut penyakit dapat berlangsung sampai tiga bulan dan ditandai

dengan demam tidak teratur, penurunan berat badan yang progresif,

keratokonjungtivitis berulang dan plak urtikaria pada leher.Tanda klinis pada

kasus kronis kurang terlihat jelas.Pada hewan yang terinfeksi T. evansi,

produksiakan turun, hewan tampak lesu,rambut kasar, anemia dan demam

berulang (Hoare, 1972).

2.1.6. Patogenesis

Patogenesis penyaki surra bermula dari kelenjar saliva vektor lalat dan

ditularkan pada inang melalui gigitan (Wiser, 1999).Infeksi ditularkan dengan

penetrasi T. evansi ke dalam jaringan subkutan atau submukosa (Losos, 1986).

Parasit tersebut kemudian memasuki sistem peredaran darah, berkembang dan

akan bertambah secara logaritmik di dalam darah dalam waktu satu sampai tiga

hari setelah parasit ditemukan di dalam aliran darah (Noble and Noble., 1982;

Jefrey et al., 1983). Kerusakan endotel pembuluh darah menyebabkan oedema dan

perdarahan (Ressang, 1984).

Trypanosoma evansi menyebabkan reaksi inflamasi pada jaringan darah

dengan diikuti multifikasi parasit (Losos, 1986).Trypanosoma evansi bertambah

dalam darah secara berkala dan hal ini disertai demam pada hewan.Serangan

demam yang berulang disebabkan oleh invasi masal T. evansi ke dalam darah atau

perkembangbiakan yang cepat dalam darah (Ressang, 1984).

Trypanosoma evansi mengeluarkan toksin yang dikenal dengan nama

trypanotoksin yang dapat mempengaruhi sistem kerja tubuh hewan yang terinfeksi
13

(Levine, 1985). Trypanotoksin dapat merusak membran eritrosit yang dimulai

dengan ikatan antara kompleks antigenantibodi atau komplemen, proses tersebut

menyebabkan anemia hemolitik (Morrison et al., 1981).Gangguan

imunopatologik yang paling penting pada trypanosomiasis adalah imunosupresi

yang ditandai anemia. Ikatan kompleks antigen antibodi atau komplemen yang

beredar dalam darah pada permukaan eritrosit, bertanggung jawab terhadap

destruksi eritrosit dan proses ini menyebabkan terjadi hemolisis (Noble and

Noble., 1982).

Anemia hemolitik menyebabkan peningkatan destruksi eritrosit dengan

cara fagositosis pada limpa, hati, sumsum tulang dan di sirkulasi darah (Morrison

et al., 1981). Peningkatan destruksi eritrosit ditandai dengan adanya splenomegali

(Losos, 1986).

2.1.7. Diagnosis

Diagnosis penyakit surra berdasarkan gejala klinis yang muncul dan

dilakukan uji parasit, uji serologis dan uji molekuler untuk diagnosis konfirmatif

di laboratorium.Uji parasit diantaranya dilakukan dengan pemeriksaan

haematologi (mikroskopik), Microhematocrite Centrifugation Technique (MHCT)

dan Mouse Inoculation Test (MIT). Uji serologi dapat dilakukan dengan metode

Card Agglutination Test For Trypanosomes (CATT) dan Enzyme-Linked

Immunosorbent Assay (ELISA), sedangkan uji molekuler menggunakan

Polymerase Chain Reaction (PCR) (Solihat, 2002).


14

2.2. Sapi Bali

Sapi Bali merupakan sapi potong asli Indonesia dan merupakan hasil

domestikasi dari Banteng (Bos bibos) (Hardjosubroto, 1994), dan merupakan sapi

asli Pulau Bali (Sutan, 1988).Sapi Bali menjadi primadona sapi potong di

Indonesia karena mempunyai kemampuan reproduksi tinggi, serta dapat

digunakan sebagai ternak kerja di sawah dan ladang (Moran, 1990; Putu et al.,

1998), persentase karkas tinggi, daging tanpa lemak (Pane, 1990), daya adaptasi

yang tinggi terhadap lingkungan dan persentase kelahiran dapat mencapai 80

persen (Tanari, 2001).Beberapa kekurangan Sapi Bali yaitu pertumbuhan lambat,

peka terhadap penyakit jembrana, penyakit Malignant Catarrhal Fever (MCF)

dan penyakit surra (Hardjosubroto, 1994).Gambar Sapi Bali dapat dilihat pada

Gambar 2.2 dan 2.3.

Gambar 2.2 Sapi Bali Betina


Sumber :Wibisono (2009).
15

Gambar 2.3 Sapi Bali Jantan


Sumber :Wibisono (2009).

Menurut Hardjosubroto (1994), Sapi Bali mempunyai klasifikasi

taksonomi sebagai berikut :

Phylum : Chordata

Subphylum : Vertebrata

Class : Mamalia

Sub class : Theria

Infra class : Eutheria

Ordo : Artiodactyla

Sub ordo : Ruminantia

Infra ordo : Pecora

Famili : Bovidae

Genus : Bos (cattle)

Sub-Genus : Bovine

Group : Taurinae

Spesies : Bos sondaicus (Banteng/Sapi Bali)


16

Sapi Bali (Bos sondaicus) berasal dari domestikasi Banteng dan dapat

beradaptasi dengan baik pada lingkungan setempat, dan sekarang sudah menyebar

di luar wilayah Indonesia (tropis dan sub tropis) (McCool, 1992; Sivarajasingham,

1992; Talib et al., 1998).Sapi Bali juga dapat ditemukan di kebun binatang dan

Taman Safari di luar negeri, secara liar dan terpelihara juga dapat dilihat pada

hutan-hutan tropis dan negara Asia Tenggara dan Australia Utara (Talib et al.,

1998).

Sapi Bali mempunyai ciri khusus antara lain, warna bulu merah bata, tetapi

yang jantan dewasa berubah menjadi hitam. Satu karakter lain yakni perubahan

warna sapi jantan kebirian dari warna hitam kembali pada warna semula yakni

coklat muda keemasan yang diduga karena hormon testosteron sebagai hasil

produk testes. Karakteristik lain yang harus dipenuhi dari ternak Sapi Bali murni

yaitu warna putih pada bagian belakang paha, pinggiran bibir atas, dan pada paha

kaki bawah mulai tarsus dan carpus sampai batas pinggir atas kuku, bulu pada

ujung ekor hitam, bulu pada bagian dalam telinga putih dan terdapat garis hitam

yang jelas pada bagian atas punggung. Bentuk tanduk pada jantan yang paling

ideal disebut bentuk tanduk silak congklok, yaitu jalannya pertumbuhan tanduk

dimulai dari dasar sedikit keluar lalu membengkok ke atas, kemudian pada ujung

membengkok sedikit keluar.Pada sapibetina bentuk tanduk yang ideal yang

disebut manggul gangsa yaitu pertumbuhan tanduk satu garis dengan dahi arah ke

belakang sedikit melengkung ke bawah dan pada ujung sedikit mengarah ke

bawah dan ke dalam.Tanduk ini berwarna hitam (Hardjosubroto, 1994).


17

2.3. Morfometri

Morfometri adalah suatu metode yang digunakan untuk menganalisis

organisme secara kuantitatif yang mencakup ukuran dan bentuk.Morfometri

digunakan sebagai alat untuk identifikasi parasit sejak zaman dahulu.Morfometri

dapat digunakan untuk mengukur dan mendeteksi perubahan bentuk.Tujuan utama

dari morfometri adalah untuk statistik uji hipotesis tentang faktor yang

mempengaruhi bentuk.Ukuran dan bentukdariparasitdapat

membuatkesalahan tentangidentifikasi spesies parasit karena pada beberapa

spesies parasit ditemukan memiliki ukuran dan bentuk yang hampir sama,oleh

karena itupengukuran morfometridapat membantu untuk mengidentifikasiparasit

(Javidet al., 2013).

2.4. Polymerase Chain Reaction

Polymerase Chain Reaction adalah metode amplifikasi suatu sekuen DNA

tertentu.Polymerase Chain Reaction merupakan cara yang sensitif, selektif dan

sangat cepat untuk memperbanyak sekuen DNA yang diinginkan (Murray et al.,

2006). Empat komponen utama pada proses PCR adalah (1) DNA cetakan, yaitu

fragmen DNA yang akan dilipatgandagakan, (2) oligonukleotida (primer), yaitu

suatu sekuen oligonukleotida pendek (15-25 basa nukleotida) yang digunakan

untuk mengawali sinstesis rantai DNA. Primer yang digunakan dalam PCR ada

dua, yaitu oligonukleotida yang mempunyai sekuen yang identik dengan salah

satu rantai DNA cetakan pada ujung 5 fosfat dan oligonukleotida dengan

sekuen pada ujung 3 OH rantai DNA cetakan yang lain, (3)


18

deoksiribonukleotida trifosfat (dNTP), yang terdiri atas dATP, dCTP, dGTP,

dTTP dan (4) enzim DNA polimerase yaitu enzim yang berfungsi sebagai katalis

dalam reaksi sintesis rantai DNA. Komponen lain yang juga berperan penting

adalah buffer PCR (Yuwono, 2006).

Reaksi pelipatgandaan fragmen DNA dimulai dengan melakukan

denaturasi DNA tamplate (cetakan) sehingga rantai DNA yang berantai ganda

(double stranded) akan terpisah menjadi rantai tunggal (single stranded).

Denaturasi DNA dilakukan dengan menggunakan panas (95C) selama 1-2 menit,

kemudian suhu diturunkan menjadi 55C sehingga primer akan menempel

(annealing) pada cetakan yang telah terpisah menjadi rantai tunggal. Proses

annealing bisa dilakukan selama 1-2 menit. Setelah dilakukan annealing,

oligonukleotida (primer) menempel pada DNA cetakan, suhu inkubasi dinaikkan

menjadi 72C selama 1,5 menit. Pada suhu ini, DNA polimerase akan melakukan

proses polimerasi rantai DNA yang baru berdasarkan informasi yang ada pada

DNA cetakan. Setelah terjadi polimerasi, rantai DNA yang baru akan membentuk

jembatan hidrogen dengan DNA cetakan. DNA rantai ganda yang terbentuk,

dengan ikatan hidrogen antara rantai DNA cetakan dengan rantai DNA baru hasil

polimerasi, selanjutnya akan didenaturasi lagi dengan menaikkan suhu inkubasi

menjadi 95C. Rantai DNA yang baru tersebut, selanjutnya akan berfungsi

sebagai cetakan bagi reaksi polimerase selanjutnya (Yuwono, 2006).


19

BAB 3 MATERI DAN METODE

3.1. Jenis Penelitian

Penelitian ini merupakan penelitian eksploratif laboratoris yang hasilnya

disajikan secara deskriptif.

3.2. Tempat dan Waktu penelitian

Penelitian dilakukan di Laboratorium Departemen Parasitologi Veteriner

dan Laboratorium Biologi Molekuler Veteriner Fakultas Kedokteran Hewan

Universitas Airlangga Surabaya. Waktu pelaksanaan penelitian pada bulan

Agustus 2015 September 2015.

3.3. Materi penelitian

3.3.1. Bahan penelitian

3.3.1.1. Sampel

Sebanyak dua sampel diperoleh dari darah Sapi Baliyang diduga terinfeksi

Trypanosoma evansi berasal dari Kabupaten Jembrana yang didapatkan dari Balai

Besar Veteriner Bali. Sampel darah sebanyak 3 ml diambil melalui vena

jugularis, menggunakan 5 ml tabung venoject yang berisi larutan Ethylen Diamine

Tetra Acid (EDTA).

3.3.1.2. Bahanulas darah

Bahan untuk pemeriksaan ulas darah adalah darah, larutan pewarna

Giemsa 10%, minyak emersi dan methanol absolut.

19
20

3.3.1.3. Bahanisolasi DNA

Bahan untuk isolasi DNA adalah gSYNCT M DNA Extraction Kit

(Geneaid), yang meliputi (larutan GSTBuffer, GSB Buffer, W1 Buffer, Wash

Buffer,Proteinase K, Elution Buffer), Ethanol Absolut dan ddH2 O.Bahan untuk

PCR adalah 2x KAPA Taq Extra Hotstart Ready Mix PCR Kit (KAPA

Biosystems).Sepasang primer ITS1 CF/BR dan distilled water. Bahan untuk

elektroforesis gel adalah agarosa, Tris Borat EDTA(TBE), Ethidium Bromida

(EtBr), Marker DNA dan loading dye.Susunan untuk primerITS1 CF/BR dapat

dilihat pada Tabel 3.3, dan posisi primer pada genom Trypanosoma evansi untuk

primer forward pada nomor 2117-2097 dan primer reverse pada nomor 2597-

2578 dapat dilihat pada Lampiran 1.

Tabel 3.3. Susunan untuk Primer ITS1 CF/BR


Panjang
Primer Sekuens Posisi
Pita
Forward 5-CCGGAAGTTCACCGATATTG-3 2117-2097
480 bp
Reverse 5-TGCTGCGTTCTTCAACGAA- 3 2597-2578

Sumber : Njiruet al.(2005)

3.3.2 Alat penelitian

Alat penelitian yang digunakan adalah glove disposable, masker,

Erlemeyer 1000 ml, disposablespuit 1 cc, disposable spuit 3 cc, sentrifus, tabung

Eppendorf, mikro pipet, jarum sonde, aluminium foil, gabus, gelas obyek, gelas

penutup, mikroskop, tissue, spidol marker dan frezer.


21

Alat untuk isolasi DNA dan PCR yang digunakan dalam penelitian yaitu

mesin PCR (Mastercycler Personal), Microcentrifuge (Hermle Z 400 K), water

bath (Gemmyco Water Bath YCW-010), vortex, mikropipet, tip, tabung

Eppendorf, microtube, timbangan digital, alat elektrophoresis, lampu UV, botol

reagen, cool box, optilab, mikroskop dan laptop

3.4.Metode Penelitian

3.4.1. Pembuatan ulas darah

Darah diteteskan pada object glass,dibuat ulasan darah dan dikeringkan.

Kemudian difiksasi dengan methanol absolut selama 3 menit dan

dikeringkan.Proses selanjutnya adalah preparat diwarnai dengan Giemsa 10%

selama 45 menit. Setelah itu, dicuci dengan air mengalir dan dikeringkan,

diperiksa dengan mikroskop dengan perbesaran 1000x dengan bantuan minyak

emersi.

3.4.2. Pemeriksaan morfometri

Pemeriksaan morfometri dilakukan dengan cara hasil ulas darah yang

positif terdapat T. evansi diperiksa di bawah mikroskop dengan perbesaran 1000x

dan difoto dengan menggunakan OptiLab . Kemudian hasil foto Trypanosoma

tersebut diukur yang meliputi panjang dan lebar tubuh, panjang dan lebar inti,

panjang dan lebar kinetoplas, panjang undulating membran dan jarak inti ke

kinetoplas. Morfologi yang terlihat sesuai dengan deskripsi Soulsby (1982) untuk

spesies T. evansi.
22

3.4.3.Isolasi DNA

3.4.3.1. Persiapan reagen isolasi DNA

Larutan Wash buffer ditambahkan ethanol absolut sebanyak 100 ml dan

kemudian dicampur. Proteinase K dilarutkan dengan pelarut dengan cara

ditambahkan ddH2 O sebanyak 1,10 ml dan disimpan dalam suhu 4o C (Geneaid,

2014).

3.4.3.2. Ekstraksi DNA menggunakan prosedur menurut Geneaid (2014)

Sampel darah ditambahkan PBS sampai volume akhir 200 l dan

dicampur, kemudian dipindahkan pada 1,5 ml microsentrifus tube. 20 l

proteinase K ditambahkan pada larutan dan divortex, kemudian diinkubasi pada

suhu 60o C selama 5 menit.Selama inkubasi tube dibalik setiap 2 menit.

Larutan yang sudah diberi PBS dan proteinase K kemudian ditambahkan

200 l GSB bufferdandivortex selama 5 detik. Larutan diinkubasi pada suhu 60o C

selama 5 menit untuk memastikan lisat hancur.Selama inkubasi, tube dibolak

balik setiap 2 menit.

Larutan ditambahkan 200 l alkohol absolut kemudian divortex selama 10

detik.GD column diletakkan pada tabung koleksi ukuran 2 ml, kemudian semua

campuran pada GD columndipindahkan dan disentrifugasi pada 14-16.000 x g

selama 1 menit. Selama dilakukan sentrifugasi, jika campuran tidak mengalir ke

GD columnmembrane waktu sentrifugasi diperlama sampai campuran mengalir ke


23

GD columnmembrane.2 ml tabung koleksi yang terisi dibuka kemudian GD

column dipindahkan pada 2 ml tabung koleksi yang baru.

Sebanyak 400 l W1 buffer ditambahkan pada GD column, disentrifugasi

pada 14-16.000 x g selama 30 detik kemudian dibuang.GD columndiletakkan

kembali pada tabung koleksi ukuran 2 ml. Pada GD culumnditambahkan 600 l

Wash buffer kemudian disentifugasi pada 14-16.000 x g selama 3 menit dan

dibuang. GD columndiletakkan kembali pada tabung koleksi ukuran 2 ml.

Standar volume elusi adalah 100 l. Jika sampel yang digunakan sedikit,

volume elusi dikurangi menjadi 30-50 l untuk meningkatkan konsentrasi

DNA.Konsentrasi DNA diukur dengan spektrofotometer dengan panjang

gelombang 260 nm.

3.4.4.Teknik Polymerase Chain Reaction (PCR)

Campuran reaksi PCR dimasukkan dalam tabung Eppendorf, yang terdiri

atas 25 l 2x KAPA Taq Extra HotStart Ready Mix with dye, 4-7 l

templateDNA, primer (F: 1l), primer (R: 1 l) dan distilled water16-19 l

sehingga total volume 50 l.Campuran reaksi PCR dicampur sampai homogen

menggunakan vortex. Tabung Eppendorf selanjutnya dimasukkan kedalam mesin

PCR dengan menggunakan program persiapan dengan suhu 94 C selama 5 menit,

denaturasi 94 C selama 40 detik, anneling dengan suhu 58 C selama 40 detik,

extension rantai 72 C selama 90 detik, dan terminasi 72 C selama 5 menit.

Proses PCR menggunakan reaksi 35 kali (Njiru et al., 2005).


24

3.4.5. Analisis hasil PCR dengan elektroforesis gel agarosa

Hasil amplifikasi dari proses PCR yang telah dilakukan sebelumnya

kemudian dianalisis dengan elektroforesis gel agarosa 1% (b/v) menggunakan alat

elektroforesis. Komposisi gel agarosa dibuat dengan melarutkan 0,3 gram agarosa

dalam 30 ml buffer TBE 1x dan ditambahkan larutan Ethidium Bromida (EtBr) 0,3

l. Larutan tersebut kemudian dipanaskan hingga semua agarosa larut sempurna,

kemudian didinginkan hingga suhu larutan mencapai 60 o C. Setelah larutan dingin

dituangkan ke dalam cetakan gel yang memiliki sisir sebagai pembentuk sumur

gel. Pada tiap sumuran gel dimasukkan 5 l marker DNA yang telah dicampurkan

dengan 1 l loading dye dan 7 l sampel hasil PCR yang telah dicampurkan

dengan 1 lloading dye.

Proses elektroforesis dilakukan dalam buffer TBE 1x sebagai media

penghantar arus pada tegangan 100 volt selama 45 menit. Hasil elektroforesis

kemudian divisualisasi dengan lampu UV dan difoto dengan kamera

digital.Sampel dinyatakan positif apabila didapatkan pita DNA 480 base pair

(bp).

3.5.Analisis data

Data penelitian berupa hasil pengukuran Trypanosoma evansi dan

amplifikasi DNA sampel. Pada metode PCR, sampel dinyatakan positif apabila

didapatkan pita DNA 480 base pair (bp). Data disajikan secara deskriptif (Njiru

et al,. 2005).
25

3.6.BaganKerangkaOperasionalPenelitian

Sampel darah Sapi Bali

Pemeriksaan Ulas Darah Ekstraksi DNA

Pemeriksaan Morfometri PCR

Identifikasi hasil
pemeriksaan terhadap
Trypanosama evansi

Gambar 3.1. Bagan kerangka operasional penelitian


26

BAB 4 HASIL PENELITIAN

4.1 Hasil Pemeriksaan Ulas Darah dan Morfometri

Hasil pemeriksaan ulas darah dari dua sampel darah Sapi Bali (Bos

sondaicus) yang berasal dari Kabupaten Jembrana Provinsi Bali menunjukkan

satu sampel positif (sampel B), Trypanosoma sp. berbentuk ramping, mempunyai

inti, kinetoplas, flagela bebas dan undulating membran.Hasil pemeriksaan ulas

darah pada Sapi Bali (Bos sondaicus) dapat dilihat pada Gambar 4.1.

Gambar 4.1 Hasil pemeriksaan ulas darah Sapi Bali (Bos sondaicus) pada
perbesaran 1000x terlihat adanya Trypanosoma sp.pada plasma
darah.

26
27

Setelah diketahui adanya Trypanosoma sp.pada plasma darah Sapi Bali

(Bos sondaicus), maka dilakukan pemeriksaan morfometri dengan cara hasil foto

pemeriksaan ulas darah yang positif Trypanosoma sp. dengan menggunakan

mikroskop dengan perbesaran 1000x dan optilab , kemudian dilakukan

pengukuran dengan menggunakan aplikasi yang berasal dari optilab pada PC.

Hasil pemeriksaan morfometri dapat dilihat dari Tabel 4.1.

Tabel 4.1 Hasil pemeriksaan morfometri Trypanosoma sp. pada darah Sapi Bali
(Bos sondaicus) yang berasal dari Kabupaten Jembrana Provinsi Bali.

Parameter Kisaran Rata-rata


Panjang 23,09 39,94 m 32,47 m
Lebar 1,82 4,34 m 3,15 m
Panjang Inti 5,21 11,41 m 8,21 m
Lebar Inti 1,56 4,19 m 3,10 m
Panjang Kinetoplas 2,34 9,05 m 5,16 m
Lebar Kinetoplas 1,78 4,58 m 2,69 m
Panjang Undulating 8,95 17,45 m 12,77 m
Membran
Jarak Inti ke Kinetoplas 10,57 19,36 m 14,80 m

4.2 Hasil Pemeriksaan Menggunakan Metode Polymerase Chain Reaction


(PCR)

Untuk memperkuat diagnosis dari hasil pemeriksaan ulas darah yang

positif merupakan Trypanosoma evansi, maka dilakukan pemeriksaan dengan

menggunakan metode Polymerase Chain Reaction (PCR). Hasil amplifikasi DNA

dari darah Sapi Bali (Bos sondaicus) yang berasal dari Kabupaten Jembrana

Provinsi Bali menggunakan Primer ITS1 CF/BR menghasilkan pita dengan


28

panjang 480 bp (positif). Hasil elektroforesis pada proses PCR sampel darah Sapi

Bali (Bos sondaicus) dapat dilihat pada Gambar 4.2.

Gambar 4.2 Hasil Elektroforesis PCR pada darahSapi Bali (Bos sondaicus).
A. Darah Sapi Bali (Bos sondaicus) negatif;
B.Darah Sapi Bali (Bos sondaicus) positif Trypanosoma evansi
M. Marker DNA.
29

BAB 5 PEMBAHASAN

Hasil pemeriksaan ulas darah dari dua sampel darah Sapi Bali (Bos

sondaicus) yang berasal dari Kabupaten Jembrana Provinsi Bali, diketahui satu

sampel positif.Pemeriksaan mikroskopik hapusan darah menunjukkan adanya

spesies Trypanosoma sp. dengan karakteristik morfologi yang khas seperti

T. evansi.

Bentuk terlihat seperti daun dengan panjang sekitar 23,09 39,94 m dan

rata-rata panjang adalah 32,47 m. Lebar tubuh sekitar 1,82 4,34 m dengan

rata-rata 3,15 m. Inti yang terlihat berukuran panjang 5,21 11,41 m rata-rata

8,21 m dan lebar inti sekitar 1,56 4,19 m, rata-ratanya 3,10 m. Dalam

gambar juga terlihat adanya kinetoplas yang memiliki panjang sekitar 2,34 9,05

m dan rata-ratanya 5,16 m, lebar kinetoplas berkisar antara 1,78 4,58 m

dengan rata-rata 2,69 m, serta undulating membran dengan panjang sekitar 8,95

17,45 m, rata-rata 12,77 m. Jarak antara inti ke kinetoplas sekitar 10,57

19,36 m, rata-rata 14,80 m. Morfologi yang terlihat sama dengan deskripsi

Soulsby (1982)untuk spesies T. evansi.

Ketika diamati dalam sampel darah segar, T. evansi berbentuk ramping,

berukuran lebih kecil dibandingkan dengan T. theileri, tetapi lebih besar

dibandingkan dengan T. congolens. T. evansi memiliki extremitas posterior yang

tipis dan juga flagela bebas, aktif bergerak tetapi memiliki perpindahan yang

terbatas jika dilihat dari mikroskop.Apabila diamati pada preparat ulas darah tipis

dengan pewarnaan Giemsa, terlihat bentuk monomorfik tipis Trypanomastigot

(Hoare, 1972).
29
30

Trypanosoma evansi dapat ditemukan di dalam sirkulasi darah pada fase

infeksi akut. Trypanosoma evansi memiliki ukuran panjang 15 sampai 34 m

dengan rata-rata 24 m dan dapat membelah (binary fission) untuk

memperbanyak diri. Bentuk yang khas seperti daun atau kumparan adalah ciri

khusus dan ditemukan flagella yang panjang sebagai alat gerak. Di bagian tengah

tubuh terdapat inti. Salah satu ujung tubuh berbentuk lancip, sedangkan ujung

tubuh yang lain agak tumpul dan terdapat bentukan yang disebut kinetoplas

(Naiposposet al., 2014). Dalam penelitian ini, ukuran T. evansi pada Sapi Bali

terlihat lebih panjang dengan rata-rata 32,47 m. Hal ini berbeda dengan ukuran

T. evansi yang ada pada kuda yaitu rata-rata 27,94 m (Elshafie et al., 2013).

Peningkatan panjang rata-rata T. evansi berhubungan dengan virulensi (Gill,

1977). Ukuran dan bentuk T.evansi dalam darah tidak berkaitan dengan

karakteristik genetik, tetapi pertumbuhan parasit berhubungan dengan respons

imun inang (Tejeroet al., 2008).

Salah satu aspek penting dari T. evansi adalah kemampuannya secara

periodik untuk mengubah varian glikoprotein permukaan (VSG) (Herrera et al.,

2001). Trypanosoma ditutupi oleh varian glikoprotein permukaan (VSG) yang

merupakan penentu antigenik utama sistem kekebalan tubuh inang (Maudlin and

Miles., 2004). Variabilitas terletak pada kemampuan parasit yang dapat

melepaskan lapisan dan membuat lapisan yang baru dengan glikoprotein

permukaan lain (Bacchi, 2009). Variasi antigen dalam T. evansi menjadi

mekanisme primer penolakan respon imun induk semang (Maudlin and Miles.,

2004).
31

Sebuah studi di India melaporkan besar variasi yang signifikan dalam total

panjang isolat T. evansi antara kerbau dan anjing (John et al., 1992). Variasi yang

berbeda dapat diamati dalam morfologi T. evansi ditemukan pada spesies hewan

yang sama, oleh karena itu pengamatan biometrikal dapat memberikan hanya

perkiraan diagnosis (Stephen, 1986; Tamarit et al., 2011). Dengan demikian,

konfirmasi infeksi dengan teknik molekuler diperlukan untuk mengatasi

keragaman yang terlihat pada diagnosis berdasarkan morfologi.

Pada penelitian ini, terdapat satu sampel darah Sapi Bali yang diperiksa

dengan ulas darah maupun dikuatkan dengan pemeriksaan PCR menunjukkan

hasil yang negatif. Hali ini disebabkanrespons imun terhadap infeksi T. evansi

pada kerbau dan sapi relatif lebih baik dari pada kuda sehingga ternak

ruminansia besar tersebut lebih tahan terhadap serang penyakit surra. Menurut

Soulsby (1982), penyakit surra dapat bersifat akut dan mewabah pada ternak

ruminansia ketika hewan mengalami stres, karena dipekerjakan atau difungsikan

terlampau berat, akibat kekurangan pakan atau air dan faktor kondisi lingkungan

kritis dan cuaca yang ekstrim.

Dalam penelitian terdahulu juga tidak didapatkan penyakit surra akut atau

kematian pada sapi dan kerbau yang diamati selama lebih dari 2 tahun di lapangan

(Partoutomo et al., 1996). Faktor lain yang ikut berperan sebagai penentu

terjadinya sakit atau kematian hewan dengan penyakit surra di lapangan adalah

pemeliharaan, makanan dan ada atau tidaknya infeksi campuran. Infeksi yang

kronis juga ditandai dengan kenaikan suhu badan antara hari ke-1-5 pascainfeksi

yang selanjutnya suhu badan berfluktuasi pada nilai normal. Walaupun jumlah
32

parasit di dalam darah meningkat sampai jumlah yang sangat tinggi, tetapi suhu

badan tidak menunjukkan kenaikan, atau dapat dikatakan bahwa tidak ada korelasi

antara jumlah parasit di dalam darah dan kenaikan suhu badan (Partoutomo,

1996).

Metode yang digunakan dalam penelitian ini adalah Polymerease Chains

Reaction(PCR), yang merupakan metode deteksi antigen yang mempunyai

spesifisitas dan sensitivitas yang tinggi. Hasil deteksi Trypanosoma evansi dengan

menggunakan metode PCR menunjukkan hasil positif dengan panjang pita 480

bp. Untuk indentifikasi T.evansi dengan metode PCR, persentase deteksi dan

sensitivitas PCR tergantung dari primer yang digunakan yang ditentukan oleh

jumlah salinan dan homologi primer urutan target. Ketika parasitemia kurang dari

103 parasit/ml darah, pada periode prepaten, perlu untuk menggunakan setidaknya

100 ng DNA dalam sampel (Gonzlezet al., 2006). Pada penelitian ini

menggunakan primer ITS1 CF/BR yang dapat mendeteksi sampai 0,01 pg DNA

T.evansi (Njiru et al., 2005).

Meskipun memiliki sensivitas rendah, teknik ulas darah untuk mendeteksi

adanya T.evansi banyak digunakan di lapangan karena cepat untuk mendiagnosis

dan lebih murah. Sampel harus diperiksa maksimal dalam waktu 3 jam setelah

pengambilan sampel karena kelangsungan hidup T. evansi yang terbatas (Holland

et al., 2001). Berbeda dengan pemeriksaan ulas darah, salah satu keuntungan dari

PCR adalah bahwa sampel DNA dapat di proses dalam waktu lebih dari 3 jam

setelah pengambilan sampel (Gonzles et al., 2003;Singh et al.,2004).


33

Polymerase Chain Reaction (PCR) diketahui memiliki sensitivitas yang

tinggi dalam hal deteksi parasit (Masake et al., 2002).Pada awal infeksi, teknik

PCR menunjukkan sensitivitas 80%, sedangkan pada fase infeksi kronis, teknik

PCR 2-3 kali lebih sensitif (Desquesnes and Davila, 2002).Dalam penelitian ini,

ada kemungkinan bahwa Sapi Bali (Bos sondaicus) yang terdeteksi positif

T.evansi berada pada fase aktif infeksi yang dibuktikan dengan ditemukan parasit

yang beredar di dalam darah cukup banyak dan dapat dideteksi dengan

pemeriksaan ulas darah dan PCR.

Metode PCR sudah banyak dilakukan untuk mendeteksi antigen termasuk

T.evansi. Polymerase Chain Reaction dapat mendeteksi infeksi T.evansi baik

infeksi awal atau kronis dibandingkan dengan teknik parasitologi tradisional dan

teknik serologi (Wuytset al., 1995). Salah satu faktor keberhasilan uji PCR adalah

kemurnian sampel dan kadar DNA yang digunakan sebagai template. Metode

PCR memiliki ambang sensitivitas yang biasanya berkisar 1 sampai 20 parasit/ml

darah. Jika parasitemia lebih rendah dari tingkat ini, PCR tidak dapat mendeteksi

adanya infeksi (negatif)(Desquesnes and Davila, 2002).


34

BAB 6 KESIMPULAN DAN SARAN

6.1. Kesimpulan

Hasil penelitian ini dapat disimpulkan bahwa morfologi Trypanosoma

evansiyang terdapat pada Sapi Bali (Bos sondaicus) berdasarkan morfometri

berukuran panjang berkisar antara 23,09 39,94 m dengan rata-rata 32,47 m

dan lebar 1,82 4,34 m dengan rata-rata 3,15 m, yang dikuatkan dengan hasil

PCR dengan ditemukan pita dengan panjang 480 bp.

6.2. Saran

Berdasarkan hasil penelitian, maka saran yang dapat diajukan adalah

diperlukan penelitian lebih lanjut pada daerah lain di wilayah Indonesia terutama

pada daerah sekitar Provinsi Bali untuk mengetahui tingkat kejadian penyakit

surra pada Sapi Bali (Bos sondaicus) dan variasi morfologi dengan berdasarkan

pengukuran morfometri yang dikuatkan dengan pemeriksaan PCR.

34
35

RINGKASAN

Hayyu Maharani.Identifikasi Trypanosoma evansipada Sapi Bali (Bos

sondaicus) berdasarkan morfometri dan Polymerase Chain Reaction. Penelitian

ini di bawah bimbingan Dr. Mufasirin,drh., M.Si selaku pembimbing utama dan

Retno Bijanti, drh., M.S. selaku pembimbing serta.

Penyakit surra merupakan salah satu penyakit strategis yang menyerang

hewan ternak yang disebabkan oleh Trypanosoma evansi.Penyakit surra pada Sapi

Bali pernah terjadi di Flores, Provinsi Nusa Tenggara Timur pada tahun

1971.Sebanyak 516 ekor Sapi Bali terserang penyakit surra.Pada tahun 2009,

kasus penyakit surra pada Sapi Bali juga terjadi di Kecamatan Batu Engau,

Kabupaten Paser, Provinsi Kalimantan Timur.Dari 19 sampel yang diuji di

laboratorium BPPV Regional V Banjarbaru terdapat 8 sampel yang positif

penyakit surra.

Pemeriksaan morfometri dan teknik PCR adalah metode yang penting

untuk memperkuat diagnosis penyakit surra karenaketerbatasandiagnosis

T.evansiyang ada pada teknikparasitologidan disarankan untuk menggunakan

kombinasidaridua atau lebihteknik untukmeningkatkan akurasidiagnosis.

Penelitian ini bertujuan untuk mengidentifikasi dan mengetahui morfologi

Trypanosoma evansiyang terdapat pada Sapi Bali (Bos sondaicus) berdasarkan

morfometri dan Polymerase Chain Reaction.Penelitian ini dilakukan pada bulan

Agustus 2015 sampai September 2015.

35
36

Penelitian ini menggunakan dua sampel darah Sapi Bali yang berasal dari

Kabupaten Jembrana yang didapatkan dari Balai Besar Veteriner Bali.Darah Sapi

Bali kemudian diperiksa dengan metode ulas darah. Pemeriksaan morfometri

dilakukan dengan cara hasil ulas darah yang positif terdapat Trypanosoma sp.

diperiksa di bawah mikroskop dengan perbesaran 1000x dan difoto dengan

menggunakan OptiLab. Kemudian hasil foto tersebut diukur morfometri

Trypanosoma sp. yang meliputi panjang dan lebar tubuh, panjang dan lebar inti,

panjang dan lebar kinetoplas, panjang undulating membran dan jarak inti ke

kinetoplas. Selanjutnya darah Sapi Bali diekstraksi untuk memperoleh DNA.

Deoxyribonucleic Acid (DNA) hasil ekstraksi kemudian diamplifikasi melalui

proses PCR dengan menggunakan primer ITS1 CF/BR. Proses PCR menggunakan

program persiapan dengan suhu 94 C selama 5 menit, denaturasi 94C selama 40

detik, anneling dengan suhu 58 C selama 40 detik, extension rantai 72 C selama

90 detik dan terminasi 72 C selama 5 menit. Proses PCR menggunakan reaksi 35

siklus.

Hasil pemeriksaan morfometri Trypanosoma sp. pada Sapi Bali adalah

panjang sekitar 23,09 39,94 m dan rata-rata panjang adalah 32,47 m. Lebar

tubuh sekitar 1,82 4,34 m dengan rata-rata 3,15 m. Inti yang terlihat

berukuran panjang 5,21 11,41 m rata-rata 8,21 m dan lebar inti sekitar 1,56

4,19 m dengan rata-rata 3,10 m. Kinetoplas yang memiliki panjang sekitar 2,34

9,05 m dan rata-rata 5,16 m, lebar antara 1,78 4,58 m dengan rata-rata

2,69 m, serta undulating membran dengan panjang sekitar 8,95 17,45 m, rata-

rata 12,77 m. Jarak antara inti ke kinetoplas sekitar 10,57 19,36 m, rata-rata
37

14,80 m.Hasil deteksi Trypanosoma sp.dengan menggunakan metode PCR

menunjukkan hasil positif T. evansi dengan panjang pita 480 bp.

Berdasarkan hasil penelitian dapat disimpulkan bahwa morfologi T.

evansiyang terdapat pada Sapi Bali (Bos sondaicus) berdasarkan morfometri

berukuran panjang berkisar antara 23,09 39,94 m dengan rata-rata 32,47 m

dan lebar 1,82 4,34 m dengan rata-rata 3,15 m, yang dikuatkan dengan hasil

PCR dengan ditemukanpita dengan panjang 480 bpdan disarankan perlu penelitian

lebih lanjut di daerah lain terutama daerah yang berada di sekitar Kabupaten

Jembrana dan Kabupaten di Provinsi Bali serta daerah lain di Indonesia.


38

DAFTAR PUSTAKA

Adrian, S.M., A.S. Rehana, L. Hassan and M.T. Wong, 2010. Outbreaks of
trypanosomiasis and the seroprevalence of Trypanosoma evansi in a deer
breeding centre in Perak, Malaysia. Trop. Anim. Health. Product.42
(2):145-150.

Ausvetplan. 2006. Disease Strategy Surra. Australia: Primary Industries


Ministerial Council OIE. 2008. Trypanosoma Evansi Infection (including
surra). Belgium.

Bacchi, C.J., 2009. Chemotherapy of human African


Trypanosomiasis.Interdisciplinary Perspective Infectious Disease.15.

Balai Penyidikan dan Pengujian Veteriner Regional V Banjarbaru.2009. Peta


Hasil Pengujian Hewan Kalimantan.

Clausen, P.H., A. Wiemann, R. Patzelt, D. Kakaire, C. Poetzsch, A. Peregrine and


D. Mehlitz, 1998. Use of a PCR assay for the specific and sensitive
detection of Trypanosoma sp. in naturally infected dairy cattle in peri-urban
Kampala, Uganda. Ann. N.Y. Acad. Sci. 849:2131.

Dargantes, A.P., R.S.F. Campbell, D.B. Copeman and S.A. Reid. 2005.
Experimental Trypanosoma evansi infection in the goat. II. Pathology. J.
Comp. Pathol. 133(2):267-276.

Dvila, A.M., H.M. Herrera, T. Schlebinger, S.S. Souza andY.M. Traub-Cseko,


2003.Using PCR for unraveling the cryptic epizootiology of livestock
Trypanosomosis in the Pantanal, Brazil. Vet. Parasitol. 117:113.

Desquesnes, M., and A.M.R. Dvila. 2002. Applications of PCR-based tools for
detection and identification of animal Trypanosomes: a review and
perspectives. Vet.Parasitol. 109:213231.

Duvallet, G., S. de La Rocque, J.M. Reifenberg, P. Solano, T. Lefranois, J.F.


Michel, Z. Bengaly, I. Sidibe, D. Cuisance and G. Cuny. 1999. Review on
the molecular tools for the understanding of the epidemiology of animal
Trypanosomosis in West Africa. Mem.Inst. Oswaldo Cruz. 94: 245248.

Elshafie, E.I., R.A. Sani, L. Hassan,R. Sharma, A. Bashir,and I.A. Abubakar.


2013. Seroprevalence and risk factors of Trypanosoma evansiinfection in
horses in Peninsular Malaysia. Res.Vet. Sci. 94: 285-289.

FAO. 1994. In "A systematic approach to tsetseand Trypanosomiasis Control,


Proceedingsof the FAO Panels of Experts, Rome Dec.

38
39

Geneaid. 2014. gSYNC T M DNA Extraction Kit. 1-10.

Gill, B.S., 1977.Trypanosomes and Trypanosomiasis of Indian Livestock. ICAR,


New Delhi.

Gonzlez, E., B. Gonzlez-Baradat, R. Gonzlez, N. Linares, A. Mijares, T.


Perrone and M. Mendoza. 2006. Development oftechniquepolymerasechain
reactionfor diagnosisof animalTrypanosomosiscaused byTrypanosoma
evansi.Agro. Trop. 56:496500.

Gumilar, G., F. M. T. Supriyanti dan H.H. Siti., 2008.Bioteknologi. Jurusan


Pendidikan Kimia FMIPA UPI. Bandung.

Guntoro S., 2002. Membudidayakan Sapi Bali.Kanisius.Yogyakarta.

Handiwirawan, E. dan Subandriyo. 2004. Potensi dan keragaman sumberdaya


genetik sapi bali. Lokakarya Nasional Sapi Potong. Pusat
Penelitiandan Pengembangan Peternakan. Hlm. 50-60.

Hardjosubroto, W., 1994. Aplikasi Pemuliabiakan Ternak di Lapangan. PT.


Gramedia Widiasarana Indonesia. Jakarta.

Herrera, H.M., L.P.C.T. Aquino, R.F. Menezes, L.C. Marques, M.A.V. Moraes,
K. Werther and R.Z. Machado.2001.Trypanosoma evansiexperimental
infection in South American coati (Nasua nasua): clinical, parasitological
and humoral immune response. Vet. Parasitol. 102: 209216.

Herrera, H.M., A.M.R. Davila, A. Norek, U.G. Abreu, S.S. Souza, P.S. DAndrea
andA.M. Jansen. 2004. Enzootiology of Trypanosoma evansi in Pantanal,
Brazil.Vet.Parasitol. 125:263275.

Hoare CA., 1972. The Trypanosomes of Mammals: a zoological monograph.


Blackwell Scientific Publications, Oxford, U.K, 749.

Holland, W.G., F. Claes, N.G. Thanh, P.T. Tam and D. Verloo et al., 2001.A
comparative evaluation of parasitological tests and a PCR for Trypanosoma
evansi diagnosis in experimentally infected water buffaloes. Vet.
Parasitol.97: 23-33.

Ismudiono, N. D. Retno, H. Anwar, R. Sidik, K. Soepranianondo, Y. Dhamayanti,


R.S. Wahyuni, P. Srianto, D.S. Nazar, B. Sektiari, M. Yunus, F.A. Ratam,
T. Nurhayati, dan S. Prawestirini. 2006. Laporan studi Kelayakan Pendirian
Pusat pembibitan dan Pengembangan Ternak Kerbau Rawa di Kabupaten
Kutai Kartanegara Kalimantan Timur. Fakultas Kedokteran Hewan
Universitas Airlangga Surabaya.
40

Javid, A.K., A. Fayaz, Z.C. Mohammad, A.D. Javid, and T. Hidayatullah. 2013.
On Morphology and Morphometry of Trichuris ovis Abildgaard, 1795
Recovered from Ruminants of Ladakh, India. J. Buffalo Sci. Res. 2:49-52.

Jefrey, H.C and Leach., 1983. Atlas Helminthologi dan Protozoologi Kedokteran.
Edisi II. Penerbit E.G.C. Jakarta.Hlm : 61 63.

John, M.C., S. Nedunchelliyan, and K.S. Venkataraman. 1992. Biometrical


observations on different strains of Trypanosoma evansi. Vet. Parasitol.
43: 143-145.

Jones T. W., R.C. Payne,I.P. Sukanto, dan S. Partoutomo. 1996. Trypanosoma


evansi in the republic of Indonesia. Proceedings of the first Internet
Conference on Salivarian Trypanosomes. FAO anim. prod. 136.
Levine, N. D. 1985. Veterinary Protozoology.1 st Edition.Iowa Statet University
Press. Ames.

Losos, G.J. 1986. Infectious Tropical Disease of Domestic Animal.IDRC. Canada.


Hlm : 183 263.

Luckins, A. G., 1998. Epidemiology of Surra: unanswered questions. J. Protozool.


Res. 8:106-119.

Luckins, A.G., N. Mclntyre, and P. Rae. 1992. Multiplication of Trypanosoma


evansi at the site of infection in skin of rabbits and cattle. Acta Tropica.
50:19-27.

Manuel, M. F., 1998. Sporadic outbreaks of Surra in the Philippines and its
economic impact.J. Protozool. Res. 8:131-138.

Masake, R.A., J.T. Njuguna, C.C. Brown, and P.A.O.Majiwa. 2002. The
application of PCR ELISA to the detection of Trypanosoma brucei and
T. vivax infections in livestock. Vet.Parasitol. 105:179-189.

Mastra, I.K., 2011. Seroprevalensi Trypanosomiasis Di Pulau Sumbawa, Propinsi


Nusa Tenggara Barat. Buletin Veteriner, BBVet Denpasar.23:79

Maudlin, I., P.H. Holmes, and M.A. Miles. 2004. The Trypanosomiasis. CABI
PublishingCAB International, Oxfordshire, U.K. 2530, 283331.

McCool, C. 1992. Buffalo and Bali cattle: Exploiting their reproductive behaviour
and physiology. Trop. An. Health and Product.24: 165.

Monzon C.M., O.A. Mancebo,and J.P. Roux. 1990. Comparison between 6


parasitological methods for diagnosis of Trypanosoma evansi in the
subtropical area of Argentina. Vet. Parasitol. 36:141146.
41

Moran.J.B., 1990.Performans dari sapi-sapi Pedaging di Indonesia dalam Kondisi


Pengelolaan Tradisional dan Diperbaiki. Laporan Seminar Ruminansia II.
Pusat Penelitian dan Pengembangan Ternak. Bogor.

Morrison. W.I., M. Murray and W.I. McIntrye. 1981. Bovine Trypanosomiasis.


Desease of Cattle In The Tropic. Martinus Nijhoff Publisher. London. Hlm:
469 496.

Murray, R.K., D.K. Granner dan V.W. Rodwell.2006. Biokimia Harper. Penerbit
Buku Kedokteran EGC. Jakarta.

Naipospos, T. S. P., P.P. Suseno, C. Basri, M.Z. Hasan, D. Sudiana., dan H. Latif.
2014. CIVAS. Trypanosomiasis (Surra).

Nantulya, V. M., 1994. Suratex: a simple latexagglutination antigen test for


diagnosis ofTrypansoma evansi suratex infections(surra). Trop. Med.
Parasitol. 45(1):9-1.

Njiru, Z.K., C.C. Constantine, S. Guya, J. Crowther, J.M. Kiragu, R.C.


Thompson, and A.M. Davila. 2005. The use of ITS1 rDNA PCR in
detecting pathogenic African Trypanosomes. Parasitol. Res. 95:186192.

Noble, E.R and G.A. Noble., 1982. Parasitologi ( Biologi Parasit Hewan ). Gadjah
Mada University Press. Hlm:67 69.

Office International des Epizootics (OIE). 2009. Manual ofDiagnostic Tests


and Vaccine for Terrestrial Animals. New York, USA.

Pane, I., 1990.Upaya peningkatan mutu genetik sapi Bali di P3 Bali.Prosiding


Seminar Nasional Sapi Bali.Bali.

Partoutomo, S., 1996.Trypanosomiasis Caused by Trypanosoma evansi (Surra) in


Indonesia. Proceeding of A Seminar on Diagnostic Techniques for
Trypanosoma evansi in Indonesia. Balitvet, Bogor: 1-9.

Payne, R. C., I. P. Sukanto, D. Djauhari, D. Partoutomo, S. Wilson, A. J. Jones,R.


Boid, and A. G. Luckins., 1991.Trypanosoma evansi infection in cattle,
buffaloes andhorses in Indonesia. Vet. Parasitol. 38:109-119.

Pereira, D. E., P. J. L. Almeda, M. Ndao, B. Goosens, and S. Osaer.1998. PCR


primer evaluation for the detection of Trypanosome DNA in naturally
infected goats. Vet. Parasitol.80:111-116.
42

Putu, I.G., P. Situmorang, A. Lubis, T.D. Chaniago, E. Triwulaningsih, T.


Sugiarti, I.W. Mathius dan B. Sudaryanto. 1998. Pengaruh pemberian
pakan konsentrat tambahan selama dua bulan sebelum dan sesudah
kelahiran terhadap performan produksi dan reproduksi sapi potong.
Prosiding Seminar Nasional Peternakan dan Veteriner. Bogor.

Reid S.A., A.Husein,andD.B. Copeman. 2001. Evaluation and improvement of


parasitological tests for Trypanosoma evansi infection. Vet. Parasitol. 102:
291297.

Ressang, A.A., 1984. Trypanosomiasis. Patologi Khusus Veteriner. Edisi II.


Airlangga University Press.Hlm : 347 359.

Sasmita, R., P. Hastutiek, A. Sunarso, dan M. Yunus. 2013. Buku Ajar


Arthropoda Veteriner. Airlangga University Press. Surabaya.

Singh, N., K.M.L. Pathak, and R. Kumar. 2004. A comparative evaluation of


parasitological, serological and DNA amplification methods for diagnosis
of natural Trypanosoma evansi infection in camels. Vet.
Parasitol.126:365-373.

Sivarajasingham, S., 1992. Improvement of indigenous cattle and buffalo breeds


in South East Asia. Proceeding of the 6th AAAP Animal Science Congress.
Bangkok. 151.

Solihat, L. 2002. Proses Pemeriksaan Sampel Penyakit-Penyakit Parasit Darah di


Laboratorium Parasitologi Balivet. Temu Teknis Fungsional Non Peneliti.

Soulsby, E. J. L., 1982.Helminths, Arthropods, and Protozoa of Domesticated


Animals.7th ed.Lea and Febriger. London. 514:532-536.

Stephen, L.E.,1986. Trypanosomiasis: a veterinary perspective. Pergamon Press,


Oxford.

Sukanto, I.P., 1994. Petunjuk diagnosa parasit darah Trypanosoma, Babesia dan
Anaplasma dan Prosiding Seminar Penelitian Parasit Besar di Indonesia.
Bogor. Hlm: 23-28.

Sutan, S.M., 1988. Perbandingan Performans Reproduksi dan Produksi antara


Sapi Brahman, Peranakan Ongole dan Bali di Daerah Transmigrasi
Batumarta, Sumatra Selatan.Institut Pertanian Bogor. Bogor.

Talib, C., A. Bamualim, dan A.Pohan., 1998. Problematika pengembangan sapi


bali dalam pemeliharaan di padang penggembalaan. Prosiding Seminar
Nasional Peternakan dan Veteriner. Bogor.
43

Tamarit, A., M.T. Tejedor-Junco, M. Gonzlez, J. Alberola And C. Gutierrez.


2011. Morphological and biometrical features of Trypanosoma evansi
isolates from an outbreak in mainland Spain. Vet. Parasitol. 177: 152-156.

Tanari, M., 2001. Usaha Pengembangan Sapi bali sebagai Ternak Lokal dalam
Menunjang Pemenuhan Kebutuhan Protein asal Hewani di Indonesia.

Tejero F., A. Roschman-Gonzlez, T.M. Perrone-Carmona, and P.M. Aso. 2008.


Trypanosoma evansi: A quantitative approach to the understanding of the
morphometry-hematology relationship throughout experimental murine
infections. J. Protozool. Res. 18: 34-47.

Thumbi, S. M., F. A. McOdimba, R. O. Mosi, and J. O. Junga.,


2008.Comparative evaluationof three PCR base diagnostic assays for the
detection of pathogenic Trypanosomes in cattleblood.Parasitol.Vec. 1:1-7.

Vellayan, S., M. Aidi,R.W. Radcliffe,L.J. Lowenstine,J. Epstein,S.A. Reid,D.E.


Paglia, R.M. Radcliffe, T.L. Roth, T.J. Foose, M. Khan, V. Jayam, S. Reza,
and M. Abraham.2004. Trypanosomiasis (Surra) in The Captive Sumatran
Rhinoceros (Dicerorhinus Sumatrensis Sumatrensis) in Peninsular
Malaysia. Int Congr Entomol Proc Trop Vet. Med. 11:187-189.

Wibisono A., 2009. Silsilah sapi Bali.

Wiser, M.F., 1999.Kinetoplastids.www.fao.org.

Wuyts N., N. Chokesajjawatee, N. SarataphanAnd S. Panyim. 1995. PCR


amplification of crude blood on microscope slides in the diagnosis of
Trypanosoma evansiin dairy cattle. Ann. Soc. Belge Med. Trop. 75:229
237.

Yuwono, T., 2006.Teori dan Aplikasi Polymerase Chain Reaction. Penerbit Andi.
Yogyakarta.
44

LAMPIRAN
1.Gen Trypanosoma evansi
ORIGIN
1. ttagccatgc atgcctcaga atcactgcat tgcaggaatc tgcgcatggc
tcattacatc
61. gacgtaatc tgccgccaaa attttgcggt ctccgcatta ctggataact
tggcgaaacg
121. ccaagctaat acatgaacca atcggacgct ctctttttct atgtcgcggc
ttgtgtttac
181. gcacttgtcg tggcgatggg acgtccagcg aatgaatgaa attagaacca
acgcctccac
241. ccgggggcag taacactcag acgtgttgac tcaattcatt ccgtgcgaaa
gccgagcctt
301. gttgctcggc gtctactgac gaacaactgc cctatcagcc agtgatggcc
gtgtagtgga
361. ctgccatggc gttgacggga gcgggggatt agggttcgat tccggagagg
gagcctgaga
421. aatagctacc acttctacgg agggcagcag gcgcgcaaat tgcccaatgt
cgaaaaaata
481. cgatgaggca gcgaaaagaa atagagccga ccgtgcccta gtgcatggtt
gttttcaatg
541. ggggatactc aaacccatcc aatatcgagt aacaattgga ggacaagtct
ggtgccagca
601. cccgcggtaa ttccagctcc aaaagcgtat attaatgctg ttgctgttaa
agggttcgta
661. gttgaactgt gggccacgta gttttgtgcc gtgccagtcc cgtccacctc
ggacgtgttt
721. tgacccacgc cctcgtggcc cgtgaacaca ctcagataca agaaacacgg
gagcggttcc
781. tcctcacttt cacgcatgtc atgcatgcga gggggcgtcc gtgaatttta
ctgtgaccaa
841. aaaagtgcga ccaaagcagt ctgccgactt gaattacaaa gcatgggata
acgaagcatc
901. agccctgggg ccaccgtttc ggcttttgtt ggttttagaa gtccttggga
gattatgggg
961. ccgcgtgcct tgggtcggtg tttcgtgtct catttttgtg gcgcgcacat
tcggctcttc
1021. gtgatgtttt tttacattca ttgcgacgcg cggcttccag gaatgaagga
gggtagttcg
1081. ggggagaacg tactggtgcg tcagaggtga aattcttaga ccgcaccaag
acgaactaca
1141. gcgaaggcat tcttcaagga taccttcctc aatcaagaac caaagtgtgg
ggatcaaaga
1201. tgattagaga ccattgtagt ccacactgca aaccatgaca cccatgaatt
ggggaacatc
1261. attgggtgcc cgtgtggcgg ccttttgtgc cgaccctcgg ccccaattta
tttatcaatt
1321. tacgtgccta ttctatcacc cccggttccc tcttttgagg ttcttccggg
gttttttacg
1381. ggaatatcct cagcacgttt cttacttctt cacgcgaaag cttggaggtt
acagtctcag
1441. gggggagtac gttcgcaaga gtgaaactta aagaaattga cggaatggca
ccacaagacg
1501. tggagcgtgc ggtttaattt gactcaacac ggggaacttt accagatccg
gacagggtga
45

1561. ggattgacag atggagtgtt ctttctcgat cccctgaatg gtggtgcatg


gccgcttttg
1621. gtcggtggag tgatttgttt ggttgattcc gtcaacggac gagatccaag
ctgcccagta
1681. ggtgccggga ttgtccacac aggacagcag tccctccggc ggggattttt
tccccaacgg
1741. tggtcgtcat ccttcttttt acaggcccct tctctgcggg attccttgct
tttcgcgcaa
1801. ggtgagattt tgggcaacag caggtctgtg atgctcctca atgttctggg
cgacacgcgc
1861. actacaatgt cagtgagaac aagagtccga gcggcacttc acaatgtcgc
tcccgcttga
1921. tcaaaagagc ggggaaacca cggaatcacg tagacccact tgggaccgag
tattgcaatt
1981. attggtcgcg caacgaggaa tgtctcgtag gcgcagctca tcaaactgtg
ccgattacgt
2041. ccctgccatt tgtacacacc gcccgtcgtt gtttccgatg atggtgcaat
acaggtccgg
2101. aagttcaccgatattggatc ggaccgtcgctccgggcgaccgacttcaat
agaggaagca
2161. aaagtcgtaa caaggtagct gtaggtgaac ctgcagctgg atcattttct
gatatccatt
2221. atacaaaaaa gagcatattt atgtgcatgt ataaattgca cagtatgcaa
ccaaaaatat
2281. acatatatgt tttacatgta tgtgtttcta tatgccgttt gacatgggag
atgagggatg
2341. ctatacatag ttctgttatt ttctatcatg tatgtgtgtt agagtgtctg
tgttaatata
2401. ctttttaatg catgctctac ataatataca gtagtaataa cacagagaat
acgtatggaa
2461. tgcgtatctc tctatatata tttatgtata tatgctatgt gtatatcaac
ctcgcatatt
2521. ttctccctgt tgaccacggc tcccacaacg tgtcgcgatg
gatgacttttcttcctagtt
2581. cgttgaagaacgcagcacgc gcaagatgcgatcaattgta gcagaatcat
ttcattgccc
2641. aatctttgaa cgcaaacggc gcatgggaga agctctctcg agccatcccc
gtgcatgcca
2701. catttctcag tgtcgaatat aaaaacaaaa cacacaccta ttttgtgttg
ttcaacgcac
2761. gcaaaaaatc ccgccacctc tttctcctcg tgtggtgcat attcatgttt
gtgagtgtgc
2821. acatatacga tatctttcaa ctctttctac tcgcacgatg gtgtatgtca
cgcatatacg
2881. tgtgtgtagt gagtgatatg gaagagaaat gggaaaggca tatatatata
tgtatataca
2941. taatatatat gtgtgtggat ttgtgtgttg agcacatata aggaaaaagg
ttgtgtgtat
3001. atacagagag tctgtggcgg ttgggacatg tgtataaata tatatatgta
tatgtgtgtg
3061. ttccgctgtg gagattttat atcttacgga gagtgttcat atatatatgt
ttgtacgcat
3121. gtattttggc gccccgtata gagattaaaa aagaagagaa aaagtatgca
aaagaggcgg
3181. cggatagtgt gtatgtgtgt attcacagca agcaactata ttttgctgct
tgtgagtata
46

3241. tgcatatatg tacattatgt gcttgtgctt ctttcgtgta cgcttcactt


ttttatattg
3301. catttttcag acctgagtgt ggcaggacca cccgctaaac ttaagcatat
tactcagcgg
3361. aggaaaagaa aacaa

2. Letak penempelan primer foward ITS1 CF/BR pada sequenze gen


Trypanosoma evansi

A lignment s tatis tic s for matc h #1

Score Expect Identities Gaps Strand

3 2 .2 bits(1 6) 9 e- 0 6 1 6 /1 6(100%) 0 /1 6 (0%) P lus /Plus

Query 5 AAGTTCACCGATATTG 20
||||||||||||||||
Sbjct 2117 AAGTTCACCGATATTG 2097

3. Letak penempelan primer reverse ITS1 CF/BR pada sequenze gen


Trypanosoma evansi

Al i gnment st at i st i cs f or mat ch # 1

Score Expect Identities Gaps Strand

38.2 bits(19) 1e-07 19/19(100%) 0/19(0%) Plus/Minus

Query 1 TGCTGCGTTCTTCAACGAA 19
|||||||||||||||||||
Sbjct 2597 TGCTGCGTTCTTCAACGAA 2578

Sumber : National Center of Biotechnology Information


(www.ncbi.nlm.nih.gov)