APSnet > Publications > Plant Disease > 2010 > May

Molecular Detection of 16SrXI Group Phytoplasma Associated

with Root (Wilt) Disease of Coconut (Cocos nucifera) in India
May 2010, Volume 94, Number 5
Pages 636.2 - 636.2

R. Manimekalai, V. P. Soumya, and R. Sathish Kumar, Central Plantation Crops Research

Institute, Kasaragod, Kerala, India; R. Selvarajan, National Research Centre for Banana,
Tiruchirapalli, Tamil Nadu, India; K. Reddy, Indian Institute of Horticultural Research, IIHR,
Bengaluru, India; G. V. Thomas, M. Sasikala, and G. Rajeev, Central Plantation Crops Research
Institute, Kasaragod, Kerala, India; and V. K. Baranwal, Plant Virology Unit, Division of Plant
Pathology, Indian Agricultural Research Institute (IARI), New Delhi, India

Go to article:
http://dx.doi.org/10.1094/PDIS-94-5-0636B

Accepted for publication 10 February 2010.

Coconut palm (Cocos nucifera L.), a versatile tree crop with multifarious uses, is important for the
livelihood security of millions of people in India. Root (wilt) disease (RWD) is a major production
constraint causing an estimated yield loss of 968 million nuts in southern India. Affected palms show
bending of leaflets (flaccidity), foliar yellowing, and marginal necrosis. Phytoplasmas have been
observed to be associated with this disease by electron microscopy (EM) and transmission (3) but not
characterized. Attempts made in the past decade to detect a phytoplasma associated with RWD
through PCR using universal primers had inconsistent results so we designed two primer sets (1F7
[AGTGCTTAACACTGTCCTGCTA]/7R3 [TTGTAGCCCAGATCATAAGGGGCA], 3Fwd
[ACCTGCCTTTAAGACGAGGA]/3Rev [AAAGGAGGTGATCCATCCCCACCT]) and seminested
primer pair 1F7/7R2 (GACAAGGGTTGCGCTCGTTTT), 3Fwd/5Rev
(ACCCCGAGAACGTATTCACCGCGA) from sequencing of a 1.8-kb fragment (GenBank No.
FJ794816) amplified by primers P1/P7 from a diseased sample. These new primer pairs were used for
the detection of phytoplasma from five symptomatic and five asymptomatic palms from Kasaragod
(where disease is not endemic), 14 symptomatic palms from Kayamkulam (endemic area), and 10
palms from disease-free areas (Kidu, Karnataka) using PCR. DNA was extracted from 3 g of spindle
leaf (two to three leaflets) midrib tissues using a modified phytoplasma enrichment protocol in which an
addition of 5% polyvinylpolypyrrolidone (MW of 40,000) during tissue grinding was essential. PCR was
performed for 35 cycles with an annealing temperature of 63°C to avoid nonspecific amplification. A
1.3-kb amplicon was seen in two of the five samples and the positive control sample (sugarcane
grassy shoot DNA) using the seminested primer pair 3Fwd/3Rev--3Fwd/5Rev. The amplicons were
cloned and sequenced and a representative sequence was deposited in GenBank (GQ850122). With
the 1F7/7R3-1F7/7R2 seminested primers, a 493-bp product was obtained from 13 of 14 palms from
Kayamkulam and all five diseased palms from Kasaragod. No amplification was seen from healthy
palms. A BLAST search showed that the RWD phytoplasma 16S rRNA gene sequence has >96% nt
identity with 16SrXI and 16SrXIV group phytoplasmas and 99% identity with sugarcane white leaf
phytoplasma (AB052874), On the basis of the identity of the 16Sr RNA gene 3Fwd/5Rev region, RWD
phytoplasma belongs to the 16SrXI group. A phylogenetic tree (neighbor-joining method) also revealed
clustering of the coconut phytoplasma with the 16SrXI group phytoplasmas and virtual restriction
fragment length polymorphism analysis (4) also placed it into group 16SrXI. Other phytoplasmas
infecting coconut are found in groups 16SrIV (1) and 16SrXIV (2). Our RWD phytoplasma sequence
does not match an earlier reported Kerala (wilt) coconut phytoplasma sequence (AY158660) and the
latter sequence does not have similarity with any known phytoplasma sequences in the database. To
our knowledge, this is first report of the association of 16SrXI group phytoplasma with the root wilt
disease of coconut in India. These findings could be used for the early detection of root wilt disease
phytoplasma in breeding materials and to develop a DNA-based diagnostic kit.

References: (1) N. A. Harrison et al. Ann. Appl. Biol. 153:85, 2008. (2) N. Nejat et al. Am. J. Appl. Sci.
6:1331, 2009. (3) M. Sasikala et al. Eur. J. Plant Pathol. 94:191, 2005. (4) Y. Zhao et al. Int. J. Syst.
Evol. Microbiol. 59:2582, 2007.
New Disease Reports (2005) 13, 10.
First report of molecular detection of an Aster yellows phytoplasma
(Candidatus Phytoplasma asteris) isolate infecting chilli (Capsicum
annuum) in India
M.S. Khan and S.K. Raj*

Molecular Virology, National Botanical Research Institute, Lucknow-2260 01, India

*skraj2@ rediffmail.com

Accepted: 28 May 2005

Chilli (Capsicum annuum; family Solanaceae) is an important spice crop, being cultivated over large
areas in Asia, Africa, South and Central America, parts of USA and Southern Europe. India is the
largest chilli producer in the world, producing 1.2 million tonnes of dry chilli, from an area of about
880,000 hectares. During the winter of 2004, a severe phytoplasma-like disease of chilli was
noticed in the Bahraich district of Uttar Pradesh with a low incidence (ca. 5% of plots showed some
infection). The symptom of the disease consisted of shortening of leaves, petioles & internodes and
crowding of leaves and stunting of whole plant (Fig. 1).

For molecular detection of the causal pathogen, the total DNA of plant samples with or without
symptoms was isolated using the protocol of Ahrens & Seemüller, 1992. Direct PCR was carried out
using the universal 16S rDNA-specific primers P1/P6 (Deng & Hiruki, 1991), which resulted in the
production of a ~1.5 kb product from diseased samples but not symptomless ones. Nested-PCR was
further performed with primers R16F2n/R16R2 (Gundersen & Lee, 1996) which gave an amplicon of
the expected size ~1.2 kb DNA. This product was cloned, sequenced and the data deposited in
Genbank (Accession DQ343288). A blast search revealed the highest level of sequence identities
(98%) with 16SrI Aster yellows group members, such as Barley deformation phytoplasma
(AY734453), Aster yellows phytoplasma (AY665676), Valeriana yellows phytoplasma (AY102274),
Onion yellows phytoplasma (AP006628) and Silene virescence phytoplasma (AY744070).

Previously a phytoplasma associated with chilli little leaf disease has been detected in India by graft
transmission and electron microscopy (Singh & Singh 2000), but the causal pathogen was not
characterised at the molecular level. To our knowledge, this is the first report of molecular detection
of an isolate of Aster yellows phytoplasma (Candidatus Phytoplasma asteris) infecting chilli in India.