J Oral Pathol Med (2009) 38: 63–71
doi: 10.1111/j.1600-0714.2008.00702.x
Polymorphic drug metabolizing CYP-enzymes –
a pathogenic factor in oral lichen planus?
C. Kragelund1, C. Hansen2, J. Reibel1, B. Nauntofte1, K. Broesen3, A. M. L. Pedersen1, D. Smidt1,
H. Eiberg4, L. A. Torpet1
1
Section of Oral Medicine, Clinical Oral Physiology, Oral Pathology & Anatomy, Department of Odontology, Faculty of Health
Sciences, University of Copenhagen, Copenhagen, Denmark; 2Wilhelm Johannsen Center for Functional Genome Research,
Department of Medical Genetics, University of Copenhagen, Copenhagen, Denmark; 3Centre of Clinical Pharmacology, University of
Southern Denmark, Odense, Denmark; 4Department of Medical Biochemistry and Genetics, University of Copenhagen, Copenhagen,
Denmark
BACKGROUND: Oral lichen planus (OLP) is a chronic
mucosal disease with a characteristic clinical phenotype.
Environmental exposures, e.g. drugs have been associ-
ated with the pathogenesis.
OBJECTIVES: To test the hypothesis that some OLP
lesions have a pharmacological pathogenesis related to
polymorphisms of the cytochrome P450 enzymes (CYPs)
resulting in poor or intermediate CYP metabolism.
METHODS: One hundred and twenty patients with OLP
and 180 gender-matched controls without OLP were
genotyped for CYP2C9, CYP2C19, and CYP2D6 alleles with
absent or reduced function.
RESULTS: The prevalence of poor or intermediate
metabolizers was not higher among the OLPs as compared
with the controls; however, there were higher numbers of
variant CYP2D6 genotypes among the OLP females
(P < 0.05). There were no differences between the groups
with regard to intake of drugs metabolized by polymorphic
CYPs or drug or herbal products inhibiting CYPs. The
prevalence of CYP2D6*4 alleles among the OLPs was
higher [28%; 95% confidence interval (CI) 20–36%] than
previously reported among Danes (19%; 95% CI 17–22%).
Fifty per cent of the OLPs had a CYP2D6*4 genotype as
compared with 30% in the background population (P =
0.0001). The CYP2D6*4 protein has sequence homology
with human herpes simplex virus type 1 (HSV1) and
Candida albicans, which may result in molecular mimicry.
CONCLUSION: It was not possible to substantiate a
pharmacological pathogenesis of OLP based on poor or
intermediate CYP metabolism. However, molecular
mimicry between CYP2D6, in particular CYP2D6*4, and
common oral pathogens may be involved in the patho-
genesis of OLP.
J Oral Pathol Med (2009) 38: 63–71
Correspondence: Camilla Kragelund, Section of Oral Medicine,
Clinical Oral Physiology, Oral Pathology & Anatomy, Faculty of
Health Sciences, University of Copenhagen, 20, Norre Allé, DK-2200
Copenhagen N, Denmark. Tel: +45 35 32 67 23, Fax: +45 35 32 67 22,
E-mail: ckr@odont.ku.dk
Accepted for publication June 8, 2008
ª 2008 The Authors. Journal compilation ª 2008 Blackwell Munksgaard Æ All rights reserved
www.blackwellmunksgaard.com/jopm
Keywords: CYP; CYP2D6*4; cytochrome P450; molecular
mimicry; oral lichen planus; polymorphisms
Introduction
Lichen planus (LP) is defined as a chronic mucocuta-
neous disease with unknown aetiology. Usually, LP is
subdivided into cutaneous lichen planus (CLP) and oral
lichen planus (OLP) referring to the area affected, but all
external and some internal epithelial surfaces can show
lichenoid manifestations, why a multidisciplinary eval-
uation and treatment may be wanted (1). The prevalence
of OLP varies from 0.1% to 2.8% in different studies
and in different ethnic populations (2–4). In Scandina-
via, a higher prevalence of OLP among females has been
found (4). If an aetiological factor is suspected, the
lesions are designated lichenoid. The oral lichenoid
phenotype includes OLP, lichenoid contact lesions
(dental materials causing a mucosal reaction), lichenoid
drug eruptions (LDE) and the lichenoid reactions seen
in graft vs. host disease (5) reflecting heterogeneous
aetiology patterns. Clinical and histopathologic assess-
ment of OLP is to some extent subjective (6, 7), and
attempts to differentiate between lichenoid lesions and
LP clinically and histopathologically have not been
successful (8). Thus, the lichenoid diagnosis is based on
case history.
Drugs from almost all drug classes have been impli-
cated in LDE (9). A few LDE case series have been
reported (10, 11) but the majority of today’s knowledge
is based on spontaneously reported cases where the
introduction of drugs is related to mucosal changes.
Familial cases of LP have been reported. Most reports
are anecdotal cases (12), although a noticeable retro-
spective study from Denmark found a prevalence of
10% of familial LP (13). Familial LP suggests that a
variety of genetic factors may be implicated in the
pathogenesis of lichenoid eruptions.
The most important drug metabolizing cytochrome
P450 enzymes (CYP) are the CYP3A4, CYP2E1,
 Oral lichen planus and drug metabolizing CYP-enzymes
Kragelund et al.
64
CYP1A2, CYP2D6, CYP2C19 and CYP2C9, of which
the latter three have frequent, clinically relevant
polymorphisms due to single nucleotide polymor-
phisms, gene deletion and multiple gene copies. This
results in alleles with no (PM), reduced (IM), exten-
sive (WT) or increased (UM) function. Subsequently,
individuals are categorized as poor (PM⁄PM), inter-
mediate (IM⁄IM, WT⁄PM, WT⁄IM, PM⁄IM), extensive
(WT⁄WT) and ultrarapid metabolizers (WT · N active
genes) according to the enzyme activity of the different
CYPs. Both PMs and IMs may have a clinically
significant increased plasma concentration when
treated with drugs metabolized by the enzyme in
question (14, 15). The prevalence of PMs and IMs
varies in different ethnic groups (16) but there are no
reports of age or gender selection. Furthermore, the
activity of the CYPs vary due to modulations by
environmental factors that may induce or inhibit the
enzyme activity. Of utmost importance is the fact that
altered CYP activity may result in adverse drug
reactions, interactions and therapy failure as some
drugs, in particular those with a low therapeutic index
or drugs principally metabolized by one polymorphic
CYP, may reach non-favourable therapeutic levels
(15, 17).
The CYPs have been associated with autoimmune
diseases, e.g. autoimmune hepatitis type 2, the mono-
genic childhood variant (type 1) of autoimmune
polyglandular syndrome and drug-induced hepatitis
(16, 18). CYP2D6 WT proteins of the hepatocytes have
been identified as the major target antigen for liver
kidney microsomal type 1 antibodies (LKM1) in
autoimmune hepatitis type 2 (19, 20). Molecular
mimicry is a phenomenon where molecules from
different genes, e.g. self-genes and non-self-genes, share
similar structures or amino acid sequences. Molecular
mimicry is suspected in the pathogenesis of auto-
immune diseases as environmental molecules, e.g.
related to infections, pollutants or drugs, may trigger
the immune response to mistake host structures with
similar molecular shapes as foreign and attack them
(21). Amino acid sequence homology has been found
among CYP2D6 WT protein, cytomegalovirus, human
herpes simplex type 1 (HSV1) and hepatitis C virus
(HCV) with evidence of cross-reactivity with the
LKM1 (19, 22).
In a previous study on the relationship between OLP
and drugs metabolized by polymorphic CYPs, we found
that the OLP group consumed significantly more drugs
metabolized by polymorphic CYPs and drugs with an
inhibitory effect on one or more CYPs than an age,
gender and ethnically matched control group (23).
Subsequently, it is possible that some OLP lesions have
a pharmacological pathogenesis related to absent or
reduced CYP metabolism. Thus, we hypothesize that
there is an association between non-functional CYP2D6,
CYP2C19 and CYP2C9 alleles, CYP-inhibition and
lichenoid manifestations, possibly provoked by expo-
sure to drugs principally metabolized by a polymorphic
CYP. Furthermore, we speculate if the CYP enzymes
may be the target for the immune reaction in OLP.
J Oral Pathol Med
Materials and methods
Study groups
The OLP group comprised 120 patients with OLP where
the majority was living in the Copenhagen County. All
OLP patients were randomly selected among 348 OLPs
monitored regularly at the Clinic of Oral Medicine at the
School of Dentistry in Copenhagen. The average period
of control was 4.5 years (range 6 months to 26 years).
Two hundred and seventeen OLP patients were invited
to participate in the study, but 97 refrained because of
old age or disabilities (n = 35), lack of time (n = 4),
resistance against phenotype probe drugs (n = 9, see
perspectives) or no specific reason (n = 49). The clinical
diagnosis of OLP was established by at least two
specialists in oral medicine on clinical manifestations
of classic bilateral reticular lesions during the recall
period. History of extra-oral LP manifestations was
reported by 21% of the males and 26% of the females
where CLP was reported by 19% of both genders. One
male (2%) and nine females (12%) reported history of
more than one extra-oral LP sites. Patients with
lichenoid lesions restricted to the mucosa in direct
contact with dental restorations and in that way
suspected to be contact lesions were not included (24).
Thus, in this paper the OLP diagnosis was used for all
patients with the oral lichenoid phenotype, as the
distinction between OLP and LDE is mostly based on
case histories and inconclusive clinical and histopatho-
logical criteria. Thirty-seven patients had the clini-
cal diagnosis supported by histopathological features
of LP (25).
The control group comprised 180 gender-matched
randomly selected among 191 elderly (>64 years) with
normal-appearing oral mucosa. Normal-appearing
mucosa included normal anatomical variations, e.g.
leucoedema, Fordyce’s spots and lingual varicosities.
The 191 elderly were part of a cohort of 668 participants
of the ODONT II from the fourth follow-up examination
of the Copenhagen City Heart Study, a prospective
populations study started in 1976 (26). The inclusion
criterion was normal-appearing oral mucosa at the
clinical examination. A clinical oral examination of each
participant was performed by trained investigators
(OLPs by CK, controls by DS, AMLP, LAT) recording
the status of the oral mucosa. The inclusion criterion was
OLP lesions in the OLP group and normal-appearing oral
mucosa in the control group. The two groups were
selected without concern to the participant’s medication
profile why both medicated and non-medicated were
included in this study. All the controls were native Danish
Caucasians. Likewise, all the OLP patients were Cauca-
sians and the vast majority was native Danes, but one
female originated from Sweden and two males from the
United States and Finland, respectively. In order to
investigate if age was a confounder a subgroup of elderly
(>64 years) OLPs (the OLP > 64 subgroup) was anal-
ysed (n = 38) and compared with the controls.
All participants received verbal and written informa-
tion and the study was approved by the local ethical
committee (KF) 03-005⁄02, and written informed con-
sent was obtained from all patients.
 Oral lichen planus and drug metabolizing CYP-enzymes
Kragelund et al.

Drug and dietary supplement evaluation
The patient’s health and drug history, and the current
intake of drugs and dietary supplements, i.e. vitamins,
minerals, fish oil and herbal products (herbal medicine
and supplements) at the examination, were based on
self-reported data and recorded by use of a standardized
questionnaire, which was scrutinized by the examiners.
The CYP-metabolism for each drug (CYP-substrate
or CYP-inhibitor) was evaluated according to Flock-
hart’s CYP drug interaction table (http://medicine.
iupui.edu/flockhart/table.htm) (27), Lægemiddelkatalo-
get (28) and Unger and Kaschina (29). The diversity of
dietary supplements with potential to interact with
conventional drugs due to CYP inhibition, i.e. herbal
products, was evaluated (30).
Genotyping
Genomic DNA was extracted from bloodspots from
finger blood obtained from each subject and purified
using Macherey-Nagel NucleoSpin 8 Trace. Extracted
DNA was stored at )20C. The patients were tested for
CYP2C19*2,*3, CYP2C9*2,*3 and CYP2D6*3,*4,
*6,*9,*10. The CYP2C19*2,*3, CYP2C9*2,*3 and
CYP2D6*3,*4,*6 alleles are PM alleles, whereas the
CYP2D6*9 and *10 alleles are IM alleles. Other alleles
than those investigated were defined as WT.
The genotyping for CYP2D6*3, *4 and *6 was
performed using primers as reported by Sachse et al.
(31), and allele-specific primers were designed for
CYP2D6*4, *9 and *10. The genotyping for CYP2C19*3
and CYP2C9*3 were performed using primers as
reported by Goldstein and Blaisdell (32) and by Sulli-
van-Klose et al. (33), while allele-specific primers were
65
designed for CYP2C19*2 and CYP2C9*2. All target
sequences were amplified using polymerase chain reac-
tions (PCR). All PCRs were performed by 5 min of pre-
denaturation at 96C followed by 43 cycles at 96C,
20 s, 52–67C (annealing temperature was dependent on
the primer set), 20 s, 72C, 30 s, followed by a post-
extension step of 5 min at 72C (for details, see Table 1).
Following amplification, an aliquot of products was
analysed by agarose gel electrophoresis, and the remain-
der was digested by specific restriction enzymes accord-
ing to the manufacturer’s instructions (New England
Biolabs, Beverly, MA, USA). Digested fragments were
analysed by gel electrophoresis. The lengths of PCR
fragments, restriction fragments and the restriction
enzymes used for the tests are all listed in Table 2. In
some cases, where the genotype was ambiguous, new
PCR products were prepared and automatically
sequenced on an AB3120xl Genetic analyzer using
BigDye terminator v 1.1 (Applied Biosystems, Foster
City, CA, USA).
Statistics
The chi-square test was used to asses the differences in
the distribution of alleles, genotypes and medication
between the groups. The age distributions of the
groups were analysed by a unpaired t-test. To test
for Hardy–Weinberg proportions and equality of
genotype frequencies within the groups standard chi-
square tests with degrees of freedom (n – 1) according
to the number of genotypic classes observed of each
enzyme were performed. The analyses were per-
formed using the SAS software package (Version 9.1).
A value of P < 0.05 was considered to be statistically

Table 1 Allele-specific primer sequences, and PCR conditions

CYP alleles Primer sequence Annealing temperature (ºC⁄20 s) Polymerase and buffer
CYP2D6
CYP2D6*3(31) 5¢ GCTGGGGCCTGAGACTT 54 PT
5¢ GGCTGGGTCCCAGGTCATAC
CYP2D6*4 5¢ CCTTTGTGCCGCCTTCGCCAACCACT 67 AB
5¢ AGCTCGCCCTGCAGAGACTCCTCGGTCTC
CYP2D6*4 and *6 (31) 5¢ CCTGGGCAAGAAGTCGCTGGACCAG 60 PT
5¢ GAGACTCCTCGGTCTCTCG
CYP2D6*9 5¢ AATGCTGTCCCCGTCCTCCTGCAT 65 AB
5¢ TCCCCTCATTCCTCCTGGGACGC
CYP2D6*10 5¢ AGCACTGGTGCCCCTGGCCG 65 PT
5¢ TGGCTTCTGGTCCAGCCTGTGTTTC
CYP2C19
CYP2C19*2 5¢ GCATATTGTATCTATACCTTTATTAAATG 52 SB
5¢ CTAGTCAATGAATCACAAATACG
CYP2C19*3 (32) 5¢ CAGAGCTTGGCATATTGTATC 49.5 PT
5¢ GTAAACACACAACTAGTCAATG
CYP2C9
CYP2C9*2 5¢ AGTTTCGTTTCTCTTCCTGTTAGGAATTG 65 SB
5¢ TCACATGAGCTAACAACCAGGACTCAT
CYP2C9*3 (33) 5¢ AATAATAATATGCACGAGGTCCAGAGATGC 57 AB
5¢ AATAATAATATGCACGAGGTCCAGAGGTAC 59
5¢ GATACTATGAATTTGGGACTTC

Forced mismatches are marked with underlining and bold type.

SB, Taq DNA polymerase, 10· standard buffer, triton free (100 mM Tris–HCl pH 8.3, 500 mM KCl, 15 mM MgCl2) (Amplicon); AB, Taq DNA
polymerase, 10· ammonium buffer, Tween free [Tris–HCl, pH 8.5, (NH4)2SO4, 15 mM MgCl2] (Amplicon); PT, Platinium Taq DNA polymerase,
10· PCR buffer, minus Mg [200 mM Tris–HCl (pH 8.4), 500 mM KCl], addition of 50 mM MgSO4 (Invitrogen).

J Oral Pathol Med

 Oral lichen planus and drug metabolizing CYP-enzymes
Kragelund et al.

66
Table 2 CYP alleles: restrictions enzymes, fragment size, mutation position and enzyme function

Restriction enzyme
(units per restriction Wild type Variant type Enzyme
CYP alleles analysis) (fragment size) (fragment size) Variant position Allele function
CYP2D6
CYP2D6*3 (31) BsaA1 (3 U) 201 180⁄20 2549 A > del *3 None
CYP2D6*4 BstN1 (3 U) 115, 203 318 1846 G>A *4 None
CYP2D6*4 (31) BstN1 (6 U) 190, 163 353 1846 G>A *4 None
CYP2D6*6 (31) BstN1 (6 U) 190, 163 190, 139, 23 1707 T > del *6 None
*4 None
CYP2D6*9 Mnl1 (3 U) 10, 25, 90, 109 10, 25, 35, 55, 109 2615–2617 delAAG *9 Decreased
CYP2D6*10 Hph1 (3 U) 181, 71, 16 96, 85, 71, 16 100 C > T *4, *10, *14, *36, *37, Decreased
*47, *49, *52, *54,
*56B, *57, *63, *64
CYP2C19
CYP2C19*2 Sma1 (6 U) 100, 200 300 681 G > A *2, *16 None
CYP2C19*3 (32) BamH1 (20 U) 175, 96 271 636 G > A *3 None
CYP2C9
CYP2C9*2 AVA 2 (3 U) 3, 122, 178 3, 300 430 C > T *2, *24 Decreased
CYP2C9*3 Nsi1, WT (3 U) 112, 29 141 1075 A > C *3, *18 Decreased
CYP2C9*3 (33) Knp1, VT (3 U) 141 30, 111 1075 A > C *3, *18 Decreased

WT, wild type; VT, variant type.

Underlining mark the most common allele, however, the 100 C > T mutation is not essential for CYP2D6*10 but together with the reactions for
CYP2D6*4 the genotype was established on the current knowledge of the genotype frequency in Caucasians.

significant. When considered relevant the P-value and
the odds ratio (OR) with the 95% confidence limits are
given in the text. Due to the explorative nature of the
study no corrections for multiplicity were performed
instead the resulting P-value shall be evaluated with
this issue in mind.
Results
Demography
Two-thirds of the OLP and control groups were females.
The age distribution among the OLP males and females
was quite similar as 12% of both genders were young
(<45 years), 59% of the males and 55% of the females
were middle-aged (45–64 years) and 29% of the males
and 33% of the females were elderly (>64 years). The
control group was on average 16.8 years older than the
OLP group (P < 0.0001), the control males 16.3 years
(P < 0.0001) and females 17 years (P < 0.0001) older
than the respective OLPs. There was no significant age
difference between the genders within the OLP and
control group.
OLP females vs. control females (P = 0.0525). There
was statistically significant difference for all the inves-
tigated CYP2D6 PM and -IM alleles OR 1.58 (1.02;
2.45) (P = 0.0413) among the OLP females as com-
pared with the control females [OLPs 55⁄101 and
controls 60⁄174 (six missing alleles)]. Likewise, there
was statistically significant difference between the con-
trol females and females in the OLP > 64 subgroup in
the number of investigated CYP2D6 PM and -IM alleles
OR 1.96 (1.05; 3.68) (P = 0.0328) [OLPs 21⁄31 and
controls (six missing alleles)]. There were no statistical
differences between the control males, OLP males and
males in the OLP > 64 subgroup but in particular, the
high prevalence of CYP2D6*4 alleles in all three groups
was noteworthy.
For eight control persons, it was not possible to give
the full genotype for CYP2C9, CYP2C19 and CYP2D6,
although DNA extraction and PCR were replicated five
times. Incomplete genotype led to exclusion from the
frequency analysis of the involved alleles and from
the genotype frequencies where they are listed as missing
(Table 3).

CYP2C9, CYP2C19 and CYP2D6 allele frequencies
The allele frequencies for the investigated alleles of
CYP2C9 and CYP2C19 did not vary between the
controls, the OLPs and the OLP > 64 subgroup or
between genders. However, there was a higher number
of the investigated CYP2D6 PM allele (P = 0.0360)
among the OLP females as compared with the control
females OR 1.64 (1.03; 2.60) [OLPs 48⁄108 and controls
50⁄184 (six missing alleles)]. The CYP2D6*4 allele
accounted for all the CYP2D6 PM alleles among the
females in the OLP > 64 subgroup but the CYP2D6*4
allele was not statistically more prevalent when com-
pared with the control females (P = 0.1022). Nor was
the CYP2D6*4 allele statistically more prevalent among
CYP2C9, CYP2C19 and CYP2D6 genotypes
The prevalence of CYP2C9 PM and IM genotypes in the
control group, the OLP group and the OLP > 64
subgroup was quite similar. Likewise, there was no
statistically significant difference between the groups in
the prevalence of CYP2C19 PM and IMs. For details
see Table 3a.
Forty-nine per cent of the controls and 59% of the
OLP had a genotype with at least one variant CYP2D6
allele (P = 0.0993) nor was there statistical difference
between the OLP > 64 subgroup (58%) and the con-
trols having a variant CYP2D6 genotype (P = 0.3440).
The prevalence of CYP2D6 PMs, IM and PM⁄IMs in
the control group, the OLP group and in the OLP > 64

J Oral Pathol Med

 Oral lichen planus and drug metabolizing CYP-enzymes
Kragelund et al.

67
Table 3a The frequencies of CYP2C9 and CYP2C19 genotypes in the OLP group, the OLP > 64 subgroup, and control group

OLP males Control males OLP females Control females Frequency

OLP group Control group
n () Frequency n Frequency n () Frequency n Frequency (predicted)a (predicted)a
CYP2C9
CYP2C9 wt⁄wt 29 (7) 0.691 37 0.649 57 (19) 0.730 80 0.672 0.717 (0.701) 0.665 (0.656)
CYP2C9*1*⁄*2 8 (3) 0.191 13 0.228 8 (3) 0.103 26 0.218 0.133 (0.161) 0.222 (0.235)
CYP2C9*1⁄*3 4 (2) 0.095 4 0.070 9 (2) 0.115 7 0.059 0.108 (0.112) 0.063 (0.074)
CYP2C9 IM 12 (5) 0.286 17 0.298 17 (5) 0.218 33 0.277 0.241 (0.273) 0.285 (0.309)
CYP2C9*2⁄*2 1 (0) 0.024 1 0.018 1 (1) 0.013 3 0.025 0.017 (0.009) 0.023 (0.021)
CYP2C9*2⁄*3 0 (0) 0.000 1 0.018 3 (1) 0.039 2 0.017 0.025 (0.013) 0.017 (0.013)
CYP2C9*3⁄*3 0 (0) 0.000 1 0.018 0 (0) 0.000 0 0.000 0.000 (0.004) 0.006 (0.002)
CYP2C9 PM 1 (0) 0.024 3 0.053 4 (2) 0.051 5 0.042 0.025 (0.017) 0.023 (0.015)
Total number 42 (12) 57b 78 (26) 118b
of persons
CYP2C19
CYP2C19 wt⁄wt 33 (10) 0.786 48 0.842 60 (20) 0.769 90 0.750 0.775 (0.773) 0.767 (0.746)
CYP2C19*1⁄*2 9 (2) 0.214 9 0.158 16 (6) 0.205 26 0.217 0.208 (0.212) 0.194 (0.235)
CYP2C19*1⁄*3 0 (0) 0.000 0 0.000 0 (0) 0.000 0 0.000 0.000 (0.000) 0.000 (0.000)
CYP2C19 IM 9 (2) 0.214 9 0.158 16 (6) 0.205 26 0.217 0.208 (0.212) 0.194 (0.235)
CYP2C19*2⁄*2 0 (0) 0.000 3 0.053 2 (0) 0.026 4 0.033 0.017 (0.015) 0.039 (0.019)
CYP2C19 PM 0 (0) 0.000 3 0.053 2 (0) 0.026 4 0.033 0.017 (0.015) 0.039 (0.019)
Total number 42 (12) 60 78 (26) 120
of persons
a
Predicted frequencies calculated according to the Hardy–Weinberg equation.
(), number of persons in the OLP > 64 subgroup; bthree control males and two control females did not have a complete genotype analysis for
CYP2C9, see text for details.

Table 3b The frequencies of CYP2D6 genotypes in the OLP group, the OLP > 64 subgroup, and control group

OLP males Control males OLP females Control females Frequency

OLP group Control group
n () Frequency n Frequency n () Frequency n Frequency (predicted)a (predicted)a
CYP2D6
CYP2D6 wt⁄wt 17 (5) 0.405 22 0.373 32 (11) 0.410 67 0.573 0.408 (0.396) 0.506 (0.488)
CYP2D6*1⁄*3 2 (1) 0.048 5 0.085 3 (0) 0.039 5 0.043 0.042 (0.037) 0.057 (0.048)
CYP2D6*1⁄*4 12 (2) 0.286 20 0.339 31 (8) 0.397 29 0.248 0.358 (0.351) 0.278 (0.306)
CYP2D6*1⁄*6 2 (1) 0.048 1 0.017 1 (0) 0.013 0 0.000 0.025 (0.021) 0.006 (0.004)
CYP2D6*1⁄*9 0 (0) 0.000 0 0.000 2 (1) 0.026 4 0.034 0.017 (0.021) 0.023 (0.028)
CYP2D6*1⁄*10 0 (0) 0.000 1 0.017 0 (0) 0.000 3 0.026 0.000 (0.037) 0.023 (0.040)
CYP2D6*9⁄*9 0 (0) 0.000 1 0.017 0 (0) 0.000 0 0.000 0.000 (0.000) 0.006 (0.000)
CYP2D6 IM 16 (4) 0.381 28 0.475 37 (9) 0.474 41 0.350 0.442 (0.467) 0.393 (0.426)
CYP2D6*3⁄*3 0 (0) 0.000 0 0.000 1 (0) 0.013 0 0.000 0.008 (0.001) 0.000 (0.001)
CYP2D6*3⁄*4 0 (0) 0.000 1 0.017 0 (0) 0.000 1 0.009 0.000 (0.016) 0.011 (0.015)
CYP2D6*4⁄*4 5 (2) 0.119 4 0.068 3 (1) 0.038 5 0.043 0.067 (0.080) 0.051 (0.048)
CYP2D6*4⁄*6 1 (1) 0.024 0 0.000 0 (0) 0.000 0 0.000 0.008 (0.009) 0.000 (0.001)
CYP2D6 PM 6 (3) 0.143 5 0.085 4 (1) 0.051 6 0.051 0.083 (0.106) 0.062 (0.065)
CYP2D6*4⁄*9 2 (0) 0.048 1 0.017 0 (0) 0.000 0 0.000 0.017 (0.009) 0.006 (0.009)
CYP2D6*4⁄*10 1 (0) 0.024 3 0.051 5 (5) 0.064 3 0.026 0.050 (0.014) 0.034 (0.012)
CYP2D6 PM⁄IM 3 (0) 0.072 4 0.068 5 (5) 0.064 3 0.026 0.067 (0.023) 0.040 (0.021)
CYP2D6*4 genotype 21 (5) 0.500 29 0.492 39* (14)* 0.500 38 0.325 0.499 (0.454) 0.380 (0.391)
CYP2D6 other than wt⁄wt 25 (7) 0.595 37 0.644 46* (15) 0.590 50 0.427 0.584 (0.596) 0.495 (0.514)
Total number of persons 42 (12) 59b 78 (26) 117b

*P < 0.05.
a
Predicted frequencies calculated according to the Hardy–Weinberg equation; (), number of persons in the OLP > 64 subgroup; bone control male
and three control females did not have a complete genotype analysis for CYP2D6, see text for details.

subgroup did not vary considerably. For detail see
Table 3b. However, the OLP females had a higher
prevalence of genotypes with at least one variant
CYP2D6 allele as compared with control females OR
1.93 (1.08; 3.44) (P = 0.0263) but that was not the case
when they were compared with the females in the
OLP > 64 subgroup (P = 0.1659) (Table 3b). Fifty per
cent of the OLP males and OLP females had a genotype
with at least one CYP2D6*4 allele. However, a genotype
with at least one CYP2D6*4 allele was only statistically
more prevalent among OLP females compared with
control females (33%) OR 2.08 (1.15; 3.75) (P =
0.0142). In the OLP > 64 subgroup 42% (n = 5) of
the males and 54% (n = 14) of the OLP females had a

J Oral Pathol Med

 Oral lichen planus and drug metabolizing CYP-enzymes
Kragelund et al.

68
Table 4 The distribution of combinations of variant CYPs genotypesa in the OLP group, the OLP > 64 subgroup, and control group

CYP2C9⁄
Status of genotype CYP2C9⁄CYP2C19 CYP2C9⁄CYP2D6 CYP2C19⁄CYP2D6 CYP2C19⁄CYP2D6
combination OLP Control OLP Control OLP Control OLP Control
IM⁄IM 1 (1) 1 13 (5) 22 9 (3) 12 2 (1) 5
PM⁄IM 10 (2) 7 7 (3) 5
PM⁄PM 1
Sum 1 (1) 1 23 (7) 29 16 (6) 18 2 (1) 5
a
In the table the genotypes are defined as PM when (PM⁄PM or PM⁄IM) and intermediate when (IM⁄IM, WT⁄PM, or WT⁄IM) (see text and
Tables 3a and 3b for further details).
(), number of persons in the OLP > 64 subgroup.

genotype with at least one CYP2D6*4 allele. This was medicated. Seventy-six per cent of the controls with a
statistically significant for the females as compared with CYP2C19 variant genotype were medicated vs. 59% of
the control females OR 2.43 (1.02; 5.75) (P = 0.0405) the all OLPs and 75% in the OLP > 64 subgroup. Of
but not for the males (P = 0.6361). the controls with a CYP2D6 variant genotype 80% were
The distribution of all the CYP2C9 and CYP2C19 medicated where only 62% of the corresponding OLPs
alleles occurred in the Hardy–Weinberg proportions in were medicated. However, 82% in the OLP > 64
the control group, OLP group and in the OLP > 64 subgroup with a CYP2D6 variant genotype were
subgroup. However, the distribution of the CYP2D6 medicated.
alleles was not in the Hardy–Weinberg proportions in
neither the control (0.05 > P > 0.02) nor in the OLP CYP2C9, CYP2C19, or CYP2D6 substrates or inhibitors
group (0.02 > P > 0.01). Interestingly, the dispropor- Forty-six percent of the medicated controls and 36% of
tion was due to the control males (0.01 > P > 0.001) the medicated OLPs had a daily intake of drugs
and OLP females (0.01 > P > 0.001). In the OLP metabolized by CYP2C9, CYP2C19, or CYP2D6 but
group >64 years the CYP2D6 alleles were distributed in the vast majority with a WT genotype for the enzyme in
the Hardy–Weinberg proportions. The Hardy–Wein- question. For details see Fig. 1.
berg disproportions were caused by few expected num- Only 7 in the OLP group and 13 in the control group
bers of the CYP2D6*9⁄*9 (control males) and the took medication inhibiting one of the polymorphic
CYP2D6*3⁄*3 (OLP females) as compared with the CYPs but only one OLP male in the OLP > 64
actual observed numbers and by a higher number of subgroup and one control female had a variant CYP-
actual observed CYP2D6*4⁄*10 genotypes as compared genotype.
with the expected number among both the control males Nineteen controls and 9 OLPs reported taking a
and OLP females (Table 3b). herbal product with a potential of CYP inhibition and
The combination of more than one variant genotype 17 and 8, respectively, took daily medication.
of the three CYPs in the groups are given in details in
Table 4. Thirty-one per cent of the controls, 35% of the
OLPs and 39% of the OLP > 64 subgroup had a
OLP Control
combination of at least two variant genotypes. The 100
1 1 PM 4 2
combination of all three variant genotypes was found in 90
1
IM 7
five controls and two OLPs (one in the OLP > 64 2
WT
subgroup), and all of them were IMs for all the enzymes 80 2 9
6
(Table 4). 70
12

60
Medication, genotypes and allele frequencies
Significantly more controls (79%) than OLPs (64%) did
%

50

take daily medication (P = 0.0136) However, no dif- 40 12 23

ference was seen between the controls and the 7 30
30 10
OLP > 64 subgroup as 76% of those did take daily 15
medication (P = 0.7260). 20
Because both PMs and IMs may experience clinically 10
relevant increased plasma levels of drugs metabolized by
0
the enzyme in question and because of the low number CYP2C9 CYP2C19 CYP2D6 CYP2C9 CYP2C19 CYP2D6
of PMs; the PMs, PM⁄IMs and IMs were pooled with drugs drugs drugs drugs drugs drugs
regard to analysis of CYP variant genotypes in relation
Figure 1 Percentage of drugs metabolized by CYP2C9, CYP2C19,
to daily medication. Seventy-six per cent of both the or CYP2D6 in relation to the genotype of the corresponding enzyme in
controls and the OLPs, and 75% of the OLP > 64 the OLP group and the control group (actual numbers of persons in
subgroup with a CYP2C9 variant genotype were bars).

J Oral Pathol Med


Discussion
It was hypothesized that CYP polymorphisms are
associated to OLP; however, we did not find a higher
prevalence of PM or IM genotypes for any of the
CYPs investigated in the OLP group as compared with
the control group. However, there were higher
numbers of variant CYP2D6 genotypes and of the
CYP2D6 genotype with at least one CYP2D6*4 allele
among the OLP females. The distribution of the
CYP2D6 alleles was not in the Hardy–Weinberg
proportions among the OLP females, which also imply
that polymorphisms of CYP2D6 may be in play
among OLP females.
However, the prevalence of CYP2D6*4 alleles among
the OLPs was higher (28%) than previously estimated
among Danes (19%) (34). Likewise, 50% of the OLPs
had a CYP2D6 genotype with at least one CYP2D6*4
allele as compared with about 30% (71⁄169) (108⁄252)
among Caucasians in population studies (P = 0.0001)
(35, 36) suggesting that CYP2D6*4 may be associated
with OLP among both genders. The prevalence of
variant CYP2C9 and CYP2C19 alleles in the OLP
group did not differ from that in the background
population (35, 37). There was no significant difference
between the groups regarding the daily intake of
medication metabolized by polymorphic CYPs and the
genotype of the corresponding enzyme. Nor was
there any difference between the groups with regard to
intake of CYP inhibiting drugs or herbal products with
the potential of CYP inhibition.
CYP2D6 and molecular mimicry
The CYP2D6*4 mutation results in a splicing defect of
the CYP2D6 protein, and the CYP2D6*4 protein has a
unique 13 amino acids sequence, DAPFAPTVSWTKP.
This sequence has a five-amino acid sequence homology
with HSV1-UL41 protein, VSWTK (accession num-
ber AY240501.1). The sequence homology between
CYP2D6*4 protein and HSV1 gives rise to speculation
of molecular mimicry in the OLP pathogenesis, as 85%
of the adult Danish population are estimated to be
seropositive (38). Furthermore, the CYP2D6*4 protein
has an amino acid homology with Candida albicans,
SWTKP, which is part of the oral microflora in about
50% of the population (39).
Molecular mimicry is already suspected with
CYP2D6 WT protein in autoimmune hepatitis type 2,
where CYP2D6 WT proteins on the hepatocytes are the
major target antigen for the LKM1 (19). OLP has been
associated with HCV in some geographic areas (40) and
it is possible that molecular mimicry may be involved in
the pathogenesis as sequence homology has been found
between CYP2D6 WT protein and HCV (19, 22).
CYP2D6 transcript has been found in oral epithelial
cell lines (41), and it is of major interest whether oral
epithelial cells in vivo express the CYP2D6 proteins as
epitopes, or whether they do so when induced, as the
cross-reactivity between C. albicans, HSV1, CYP2D6
WT and CYP2D6*4 proteins may be of special interest
from an oral perspective.
Oral lichen planus and drug metabolizing CYP-enzymes
Kragelund et al.
69
Confounders
In our study it was not possible to subgroup the OLP
group according to present daily medication and CYP
genotype. As the control group was significantly older
than the OLP group age could be a confounder. In the
selection of the control participants among the available
cohort it was considered more important to randomize
the selection and that the participants did not have OLP
or other oral mucosal diseases than that they were
matched with regard to age as there are no reports on
age related differences of CYP-genotypes. This assump-
tion was supported by the fact that no marked differ-
ences were detected between the OLP group and the
OLP > 64 subgroup in respect to genotypes.
Incidence–prevalence bias may influence our results as
the drug(s) that may have initiated a LDE may not be
reflected by the current medication, i.e. 22 persons in the
OLP group reported on changing drug regimen during
the past year. Such data were not available for the
control group. Fourteen (33%) OLP males and 42
(54%) OLP females reported daily intake of medication
when their OLP was diagnosed. Of these, 11 (79%)
males and 22 (52%) females had a genotype with one or
more variant CYP2D6 allele where the vast majority
presented with at least one CYP2D6*4 allele (25⁄33).
Our hypothesis was tested towards a control popula-
tion with more chronic diseases and higher exposure to
polypharmacy (data not published) than our OLP
group. Thus, we expected that control persons with
susceptible genotypes (variant CYP genotypes) were less
exposed to drug and herbal products with a potential to
inhibit CYPs, and drug metabolized by polymorphic
CYPs than the corresponding in the OLP group. That
was not the case. On the other hand, the control group
appears to be too small to reflect the CYP genotypes in
the Danish population (34) but due to the explorative
nature of this study no sample size calculations could be
performed. Thus, to substantiate the relation of
CYP2D6*4 and the OLP pathogenesis larger study
most be initiated.
The prevalence of CYP2D6*5 is between 2% and 4%
in the European population (31, 34, 35). The allele is a
deletion of the CYP2D6 gene and can be identified using
long PCR (42). Using DNA purified from whole blood,
it was possible to get a PCR product using the primers
and protocol published by Dorado et al. (42). Unfor-
tunately, using the bloodspots, it was not possible
to achieve a PCR product. Thus, the absence of
CYP2D6*5 may be a confounder affecting our results.
Unknown confounders like non-recognized gender
differences, differences in hormone status, environ-
mental factors or genetic heterogeneity may jeopardize
the OLPs or protecting the controls. There are a number
of studies on the decline in the CYP functions due to
infection and inflammation (43). Considering that the
OLPs experience a chronic inflammation, their drug
metabolizing capacity may be influenced profoundly.
Perspectives
This study suggests that CYP2D6 may play a role in the
pathogenesis of OLP not solely due to susceptibility to
J Oral Pathol Med
 Oral lichen planus and drug metabolizing CYP-enzymes
Kragelund et al.
70
drugs but also to possible molecular mimicry. This
finding provides an indication towards further studies
of the prevalence of multiple copies of CYP2D6 alleles
(*1, *2 and *4) in an OLP population and to a search
for auto-antibodies to CYP2D6 WT and CYP2D6*4
proteins and mimetic structures.
Data on the phenotype of CYP2D6, CYP2C19, and
CYP1A2 among OLPs as compared with the genotype
have been collected, and in future studies, the function
of the polymorphic CYPs is also to be evaluated in
relation to the clinical distribution of the intra- and
extra-oral lichenoid lesions, drug exposure and the
lifestyle factors that may influence the function of the
CYPs.
References
1. Eisen D. The evaluation of cutaneous, genital, scalp, nail,
esophageal, and ocular involvement in patients with oral
lichen planus. Oral Surg Oral Med Oral Pathol Oral Radiol
Endod 1999; 88: 431–6.
2. Zain RB, Ikeda N, Razak IA, et al. A national epidemi-
ological survey of oral mucosal lesions in Malaysia.
Community Dent Oral Epidemiol 1997; 25: 377–83.
3. Bouquot JE, Gorlin RJ. Leukoplakia, lichen planus, and
other oral keratoses in 23,616 White Americans over the
age of 35 years. Oral Surg Oral Med Oral Pathol 1986; 61:
373–81.
4. Axell T. A prevalence study of oral mucosal lesions in an
adult Swedish population. Odontol Revy 1976; 27: 1–103.
5. Eisen D, Carrozzo M, Bagan Sebastian JV, Thongprasom
K. Number V Oral lichen planus: clinical features and
management. Oral Dis 2005; 11: 338–49.
6. van der Meij EH, Reibel J, Slootweg PJ, van der Wal JE,
de Jong WF, van der Waal I. Interobserver and intra-
observer variability in the histologic assessment of oral
lichen planus. J Oral Pathol Med 1999; 28: 274–7.
7. van der Meij EH, Schepman KP, Plonait DR, Axell T, van
der Waal I. Interobserver and intraobserver variability in
the clinical assessment of oral lichen planus. J Oral Pathol
Med 2002; 31: 95–8.
8. Thornhill MH, Sankar V, Xu XJ, et al. The role of
histopathological characteristics in distinguishing amal-
gam-associated oral lichenoid reactions and oral lichen
planus. J Oral Pathol Med 2006; 35: 233–40.
9. McCartan BE, McCreary CE. Oral lichenoid drug erup-
tions. Oral Dis 1997; 3: 58–63.
10. Potts AJ, Hamburger J, Scully C. The medication of
patients with oral lichen planus and the association
of nonsteroidal anti-inflammatory drugs with erosive
lesions. Oral Surg Oral Med Oral Pathol 1987; 64: 541–3.
11. Hay KD, Reade PC. Methyldopa as a cause of oral
mucous membrane reactions. Br Dent J 1978; 145: 195–
203.
12. Singal A. Familial mucosal lichen planus in three succes-
sive generations. Int J Dermatol 2005; 44: 81–2.
13. Kofoed ML, Wantzin GL. Familial lichen planus. More
frequent than previously suggested? J Am Acad Dermatol
1985; 13: 50–4.
14. Grasmader K, Verwohlt PL, Rietschel M, et al. Impact of
polymorphisms of cytochrome-P450 isoenzymes 2C9,
2C19 and 2D6 on plasma concentrations and clinical
effects of antidepressants in a naturalistic clinical setting.
Eur J Clin Pharmacol 2004; 60: 329–36.
J Oral Pathol Med
15. Kirchheiner J, Nickchen K, Bauer M, et al. Pharmaco-
genetics of antidepressants and antipsychotics: the contri-
bution of allelic variations to the phenotype of drug
response. Mol Psychiatry 2004; 9: 442–73.
16. Hasler JA, Estabrook R, Murray M, et al. Human
cytochromes P450. Mol Aspects Med 1999; 20: 1–137.
17. Wuttke H, Rau T, Heide R, et al. Increased frequency of
cytochrome P450 2D6 poor metabolizers among patients
with metoprolol-associated adverse effects. Clin Pharmacol
Ther 2002; 72: 429–37.
18. Boitier E, Beaune P. Xenobiotic-metabolizing enzymes as
autoantigens in human autoimmune disorders. An update.
Clin Rev Allergy Immunol 2000; 18: 215–39.
19. Kerkar N, Choudhuri K, Ma Y, et al. Cytochrome
P4502D6(193–212): a new immunodominant epitope and
target of virus⁄self cross-reactivity in liver kidney micro-
somal autoantibody type 1-positive liver disease. J Immu-
nol 2003; 170: 1481–9.
20. Ma Y, Bogdanos DP, Hussain MJ, et al. Polyclonal T-cell
responses to cytochrome P450IID6 are associated with
disease activity in autoimmune hepatitis type 2. Gastro-
enterology 2006; 130: 868–82.
21. Oldstone MB. Molecular mimicry, microbial infection,
and autoimmune disease: evolution of the concept. Curr
Top Microbiol Immunol 2005; 296: 1–17.
22. Manns MP, Griffin KJ, Sullivan KF, Johnson EF. LKM-1
autoantibodies recognize a short linear sequence in
P450IID6, a cytochrome P-450 monooxygenase. J Clin
Invest 1991; 88: 1370–8.
23. Kragelund C, Thomsen CE, Bardow A, et al. Oral lichen
planus and intake of drugs metabolized by polymorphic
cytochrome P450 enzymes. Oral Dis 2003; 9: 177–87.
24. Thornhill MH, Pemberton MN, Simmons RK, Theaker
ED. Amalgam-contact hypersensitivity lesions and oral
lichen planus. Oral Surg Oral Med Oral Pathol Oral Radiol
Endod 2003; 95: 291–9.
25. Pindborg JJ, Reichart PA, Smith CJ, van der Waal I.
WHO. Histological typing of cancer and precancer of the
oral mucosa. Berlin: Springer, 1997.
26. Schnohr P, Jensen JS, Scharling H, Nordestgaard BG.
Individual and population based risk factors of ischemic
heart diseases. A 21-year follow-up of 12,000 men and
women from the osterbro study. Ugeskr Laeger 2003; 165:
1353–8.
27. Flockhart DA Cytochrome P450 drug-interaction table.
http://medicine.iupvi.edu/flockhart/table.htm. Version 4.0
[AUG 2007].
28. http://www.medicin.dk. Lægemiddelkataloget.
29. Unger T, Kaschina E. Drug interactions with angiotensin
receptor blockers: a comparison with other antihyperten-
sives. Drug Saf 2003; 26: 707–20.
30. Zhou S, Gao Y, Jiang W, Huang M, Xu A, Paxton JW.
Interactions of herbs with cytochrome P450. Drug Metab
Rev 2003; 35: 35–98.
31. Sachse C, Brockmoller J, Bauer S, Roots I. Cytochrome
P450 2D6 variants in a Caucasian population: allele
frequencies and phenotypic consequences. Am J Hum
Genet 1997; 60: 284–95.
32. Goldstein JA, Blaisdell J. Genetic tests which identify the
principal defects in CYP2C19 responsible for the poly-
morphism in mephenytoin metabolism. Methods Enzymol
1996; 272: 210–8.
33. Sullivan-Klose TH, Ghanayem BI, Bell DA, et al. The role
of the CYP2C9-Leu359 allelic variant in the tolbutamide
polymorphism. Pharmacogenetics 1996; 6: 341–9.

34. Brosen K, Nielsen PN, Brusgaard K, Gram LF, Skjodt K.
CYP2D6 genotype determination in the Danish popula-
tion. Eur J Clin Pharmacol 1994; 47: 221–5.
35. Scordo MG, Caputi AP, D’Arrigo C, Fava G, Spina E.
Allele and genotype frequencies of CYP2C9, CYP2C19
and CYP2D6 in an Italian population. Pharmacol Res
2004; 50: 195–200.
36. Bathum L, Andersen-Ranberg K, Boldsen J, Brosen K,
Jeune B. Genotypes for the cytochrome P450 enzymes
CYP2D6 and CYP2C19 in human longevity. Role of
CYP2D6 and CYP2C19 in longevity. Eur J Clin Pharmacol
1998; 54: 427–30.
37. Pedersen RS, Verstuyft C, Becquemont L, Jaillon P,
Brosen K. Cytochrome P4502C9 (CYP2C9) genotypes in a
nordic population in Denmark. Basic Clin Pharmacol
Toxicol 2004; 94: 151–2.
38. Kjaer SK, de Villiers EM, Haugaard BJ, et al. Human
papillomavirus, herpes simplex virus and cervical cancer
incidence in Greenland and Denmark. A population-based
cross-sectional study. Int J Cancer 1988; 414: 518–24.
39. Arendorf TM, Walker DM. The prevalence and intra-oral
distribution of Candida albicans in man. Arch Oral Biol
1980; 25: 1–10.
40. Lodi G, Giuliani M, Majorana A, et al. Lichen planus and
hepatitis C virus: a multicentre study of patients with oral
lesions and a systematic review. Br J Dermatol 2004; 151:
1172–81.
41. Farin FM, Bigler LG, Oda D, McDougall JK, Omiecinski
CJ. Expression of cytochrome P450 and microsomal
Oral lichen planus and drug metabolizing CYP-enzymes
Kragelund et al.
71
epoxide hydrolase in cervical and oral epithelial cells
immortalized by human papillomavirus type 16 E6⁄E7
genes. Carcinogenesis 1995; 16: 1391–401.
42. Dorado P, Caceres MC, Pozo-Guisado E, Wong ML,
Licinio J, LLerena A. Development of a PCR-based
strategy for CYP2D6 genotyping including gene multi-
plication of worldwide potential use. Biotechniques 2005;
39: 571–4.
43. Prandota J. Important role of proinflammatory cyto-
kines⁄other endogenous substances in drug-induced hepa-
totoxicity: depression of drug metabolism during
infections⁄inflammation states, and genetic polymorphisms
of drug-metabolizing enzymes⁄cytokines may markedly
contribute to this pathology. Am J Ther 2005; 12: 254–61.
Acknowledgements
We would like to thank Jeanette Andreasen for competent and meticulous
assistance with genotyping procedures. Thanks to Professor Niels Tomm-
erup and the Wilhelm Johannsen Centre for Functional Genome Research
established by The Danish National Research Foundation for providing
facilities and expertise. Biostatistical expertise was provided by Judith L.
Jacobsen MSc, PhD, Statcon Aps. This study was supported by Novo
Nordisk Foundation, Apotekerfonden af 1991’, The Danish Medical
Research Council, The Danish Dental Association’s F.U.T.⁄Calcin Fond’,
and Forskningsfond’.
J Oral Pathol Med