MECHANISMS OF DEVELOPMENT 1 3 0 ( 2 0 1 3 ) 5 4 –6 0

Available at www.sciencedirect.com

journal homepage: www.elsevier.com/locate/modo

Overexpression of AtHsfB4 induces specific effects on root

development of Arabidopsis

Tahmina Begum a, Rolf Reuter b, Friedrich Schöffl a,*

a
Universität Tübingen, Zentrum für Molekularbiologie der Pflanzen (ZMBP) – Allgemeine Genetik, Auf der Morgenstelle 28,
D-72076 Tübingen, Germany
b
Interfakultäres Institut für Zellbiologie, Genetik der Tiere, Auf der Morgenstelle 28, D-72076 Tübingen, Germany

A R T I C L E I N F O A B S T R A C T

Article history: The functions of plant class B-heat shock factors (Hsfs) are not well understood. Hsfs
Available online 5 June 2012 belonging to this group differ from class A-Hsfs in structural features of the oligomeriza-
tion domain and by the absence of a typical AHA motif for transcriptional activation. AtHs-
fB4 is expressed in different parts of the plants with highest levels in root tissue. Transgenic
Keywords:
Arabidopsis plants overexpressing (OE) HsfB4 by CaMV-35S-promoter showed massively
Heat shock
enhanced levels of Hsf mRNAs. The root surface of OE-plants was rough and cells became
Transcription factor
detached. Crossings with cell type specific root marker lines and confocal laser scanning
Root development
microscopy provided clear evidence for a duplication of cells in the ground tissue and ecto-
Endodermis
pic layers of lateral root cap (LRC) cells in HsfB4-OE plants. A duplication of endodermis
Lateral root cap
cells occurs already during embryonic development, while the ectopic LRC cells are only
Stem cells
detected during postembryonic growth. The mutant phenotypes of Hsf-OE plants are with-
out precedence and indicate that class B-Hsfs may play an important role in root
development.
! 2012 Elsevier Ireland Ltd. Open access under CC BY-NC-ND license

1. Introduction binding and subsequently for transcriptional activation of

Heat shock factors (Hsfs) play important roles in stress
sensing and signaling of different environmental stresses.
Based on structural characteristics and phylogenetic compari-
son plant Hsfs are subdivided into three classes and several
subgroups. Hsfs display a modular structure with a highly con-
served N-terminal DNA-binding domain (DBD), which is char-
acterized by a central helix-turn-helix motif, and an adjacent
bipartite oligomerization domain (HR-A/B) composed of
hydrophobic heptade repeats. Hsfs recognize consensus
binding motifs, so-called heat stress elements (HSE:
5 0 -nGAAnnTTCnnGAAn-3 0 or 5 0 nTTCnnGAAnnTTCn3 0 )
conserved in promoters of heat-inducible genes of all eukary-
otes. Hsf trimerization via the formation of a triple stranded al-
pha-helical coiled coil is a prerequisite for high-affinity DNA
heat shock genes. Other functional domains of Hsf include nu-
clear localization and nuclear export sequences and, a typical
feature of class A Hsfs, transcriptional activator regions lo-
cated in the C-terminal part (Nover et al., 1996).
Most research on Hsfs was focussed on the functional
characterization of class A-Hsfs of Arabidopsis with 15 differ-
ent genes/proteins, some of which are known to function as
transcriptional activators of heat stress target genes. Much
less is known about the function of class B-Hsfs, which differ
from class A by a structural variation within the oligomeriza-
tion domain and the lack of an AHA-motif that is required for
transcriptional activation function of class A-Hsfs (Von
Koskull-Döring et al., 2007). There are only five different class
B-Hsf genes present in the Arabidopsis genome, two of which,
B3 and B4, are low level constitutively expressed in leaves

* Corresponding author. Tel.: +49 7071 2978831; fax: +49 7071 295042.
E-mail address: friedrich.schoeffl@zmbp.uni-tuebingen.de (F. Schöffl).
0925-4773 ! 2012 Elsevier Ireland Ltd. Open access under CC BY-NC-ND license
http://dx.doi.org/10.1016/j.mod.2012.05.008
 MECHANISMS OF DEVELOPMENT
while the expression of HsfB1, HsfB2a, HsfB2b is significantly
increased upon heat stress (Lohmann et al., 2004; Busch et al.,
2005).
In contrast to Hsfs of class A, classes B- and C-Hsfs have no
evident function as transcription activators on their own (Ko-
tak et al., 2004; Czarnecka-Verner et al., 2000, 2004; Kumar
et al., 2009). Since class B-Hsfs have the capacity to bind to
similar or the same sites in the heat shock gene promoters
as class A-Hsfs, it was proposed that they may act as repres-
sors of target gene expression (Czarnecka-Verner et al., 2000,
2004). This is consistent with the identification of an R/KLEGV
motif, which is important for a repressive activity in factors
including plant class B-HSFs, (Ikeda and Ohme-Takagi,
2009). Functional analysis of HsfB1 and HsfB2b knock out mu-
tants provided evidence for a repressing effect on the expres-
sion of a small set of non-heat shock target genes including
the pathogen resistance genes Pdf1.2a/b (Kumar et al., 2009).
Recently, it was shown that schizoriza is allelic with HsfB4
(ten Hove et al., 2010; Pernas et al., 2010). HsfB4/Scz acts
mainly in the stem cell niche, exerting autonomous and
non-autonomous effects to specify cell identity and control
of cell fates in surrounding layers.
In order to identify further biological functions of HsfB4 we
determined its expression patterns in Arabidopsis and ana-
lyzed the phenotype of Hsf overexpressing transgenic plants.
The preferential expression in specific root tissues and the
developmental effects (growth retardation, alteration of root
morphology) of Hsf-overexpressing transgenic plants suggest
a regulatory function of HsfB4 in plant development under
non-stress conditions.
2. Results
2.1. Expression pattern of HsfB4
In order to identify possible functions it was important to
determine the expression profile of HsfB4 in Arabidopsis. The
mRNA levels, determined by qRT-PCR, were much higher in
the root than in any other tissue (Fig. 1A) lower levels were de-
tected in shoot apex and leaves. Transgenic plants carrying
the HsfB4::GUS promoter-driven gene showed staining of
GUS activity in shoot apex, roots, pistils, seeds and at the base
of siliques (Fig. 1B). The strong histochemical staining of the
root is consistent with the strong expression of HsfB4 mRNA
(Fig. 1A). The major root staining is in the stele and ground tis-
sue (endodermis and cortex) and also in the meristematic re-
gion including the quiescent center. Columella and lateral
root cap cells are completely devoid of GUS staining.
(Fig. 1B-a).
2.2. Transgenic overexpression of HsfB4 in Arabidopsis
The effects of transgenic overexpression (OE) of a CaMV-
35S promoter-driven HsfB4 (Fig. 2) was analyzed in more detail
in three (OE5, -7, -8) out of several independent OE-lines. In
these lines the HsfB4 mRNA levels were massively increased
from 75–434-fold (Fig. 2A) compared to WT plants. The
HsfB4-OE lines showed no obvious phenotype in the aerial
parts of the plant, however, there was a clear retardation of
1 3 0 ( 2 0 1 3 ) 5 4 –6 0 55
root growth: the roots were significantly shorter as in WT
(Fig. 2B). Microscopic inspection revealed morphological dif-
ferences at the root surface (Fig. 2C), which was, compared
to WT, a thickening in the meristematic region with a rough
surface and a detachment of cells in the elongation and mat-
uration zone of the roots of HsfB4-OE plants (Fig. 2C). This
phenotype was also observed on lateral roots (Fig. 2C, inset).
There was no significant phenotypic difference between dif-
ferent OE-lines, therefore, further analyzes concentrated on
HsfB4-OE8.
2.3. HsfB4 overexpression affects early root development
Microscopy of the roots by CLSM showed major differences
in the structure of root cell types in HsfB4-OE-lines. A very dis-
tinctive alteration, an extra cell layer in the ground tissue
(Fig. 3c and d), was observed in all (n > 20) HsfB4-OE roots. Ec-
topic double cell files can be observed already in the embry-
onic root (Supplementary Fig. S1).
In order to verify the identity of cells we crossed the HsfB4-
OE8 line with the endodermis-specific marker-line SCR2.0
(Brady et al., 2007). The marker-line expresses GFP driven by
the SCARECROW promoter, which exhibits GFP fluorescence
only in one cell layer, the endodermis (Fig. 3e). The F1 progeny
of the cross between the marker line and HsfB4-OE8 shows
clearly two fluorescent cell layers (Fig. 3f), indicating endoder-
mis identity. At later stages in development (>3 dpg) the
duplicated cell file is extended by cell division in the meriste-
matic zone (Fig 3d).
The microscopic inspection of the root showed also prolif-
eration of another cell type surrounding the meristematic re-
gion in roots of HsfB4-OE plants (Fig. 4a and b). These cells
seem to originate from LRC daughter cells. In order to identify
the specification of ectopic cell layers in LRC, an HsfB4-OE8
plant was crossed with GFP marker lines (Brady et al., 2007).
F1 progeny of crossings with the WER marker line for epider-
mis and LRC (Fig 4c) shows GFP fluorescence in the single epi-
dermal cell layer, same as the marker line (Fig. 4d), but
additional fluorescence in ectopic layers of lateral root cap
cells (Fig. 4d). These data suggest that the extra cell layers de-
cent from LRC. The fluorescence in ectopic LRC cells is re-
stricted to only the lower part of the root, there was no
fluorescence observed in the upper part of the root, although,
there is often an extra cell layer extending the outermost
layer of LRC cells covering the epidermis (Fig. 4d). It seems
that an extension of lateral root cap cells to more distal re-
gions of the root tip has occurred. The proliferation and the
detachment of these cells after prolonged root growth may
be responsible for the observed root phenotype (Fig. 2C).
In WT the periclinal division of the presumptive cortex/
endodermis initial daughter cell takes place in the late heart
or torpedo stage. In HsfB4-OE8 the second periclinal division
of the inner daughter cell seems to occurs at the end of the
torpedo stage and results in the formation of an initial cell
for a second layer eventually forming three layers of ground
tissue in the embryo (Figure S1). However, ectopic layers of
LRC cells were not found in the mature embryonic root
(Fig. S1), which indicated that the ectopic division in HsfB4-
OE8 root cap cells occurred post-embryonically.
56 MECHANISMS OF DEVELOPMENT 1 3 0 ( 2 0 1 3 ) 5 4 –6 0

Fig. 1 – Tissue specificity of HsfB4 expression. (A) Messenger RNAs were isolated from different parts of the two week old
plants (leaf, root, whole seedling, shoot apex) and HsfB4 transcripts were quantified by real time RT-PCR. Relative amounts
were normalized to Actin 2 mRNA (=100%), N = 3. (B) Histochemical localization of GUS activity in different organs of 7dpg
HsfB4::GUS plants (T3 generation): (a–d) root tip, different staining intensities, (e) lateral root staining, (f) shoot apical
meristem, (g) inflorescence shoot, (h) flower, (i) seeds.

3. Discussion structural changes in the organization of certain cell layers

The expression profiles of HsfB4 determined by qRT-PCR
and promoter::GUS fusions in transgenic plants indicated
that this Hsf is important to the development of main and lat-
eral roots. The GUS-staining is most prominent in the stele,
ground tissue, and quiescent center cells (Fig 1B, a–d). All
HsfB4-OE lines showed a very similar mutant phenotype of
the root. The GUS staining in shoot apical meristem and other
parts of the plant (Fig. 1B) could not be correlated with a
HsfB4-OE phenotype in the respective structures of the plant.
The macroscopic effects on root morphology including thick-
ening of the root in the meristematic region and a rough sur-
face with cells becoming detached, are paralleled by
during root development. Cell division patterns and cellular
organization of WT and HsfB4-OE roots show two major differ-
ences: ectopic layers of ground tissue and lateral root cap
cells. This gain of function root phenotype indicates an inter-
ference of HsfB4 with specific developmental processes.
It was reported that the SHORT-ROOT (SHR) gene, a grass
family transcription factor, controls the asymmetric division
and specification of endodermis in the ground tissue (Hel-
ariutta et al., 2000; Benfey et al., 1993); the shr mutant allele
resulted in only a single layer of ground tissue with cortex
identity. However, ectopic expression of SHR under 35S
promoter caused supernumerary layers (three to seven) of
endodermis. Overexpression of HsfB4 results in only one extra
 MECHANISMS OF DEVELOPMENT
Fig. 2 – Ectopic overexpression of HsfB4 and phenotypic
variation in transgenic plants. (A) Quantification of HsfB4
mRNA expression in whole seedlings of three independent
HsfB4 overexpressor lines (OE5, OE7, OE8) compared to WT
by real time RT-PCR. Relative amounts were normalized to
Actin 2 mRNA (=100%), N = 3. (B) Measurement of primary
root length of HsfB4-OE5, -7, -8 plants by Image pro express
program on scanned pictures (N = 40–50). (C) Root
phenotype and morphology in WT (upper panels) and
HsfB4-OE8 (lower panels) plants determined by binocular
light microscopy (left panels, 10·), the insets show lateral
roots, Nomarski image (middle panels), CLSM after PI
staining (right panels).
layer of cells marked by the SCR promoter-driven GFP (Fig. 3).
These cells appear to have the same identity as the ground
tissue endodermis or respectively stem cells. The phenotype
generated by HsfB4-OE may be transmitted through SHR and
activation of SCR expression.
Schizoriza is allelic with HsfB4 and the analysis of loss-of-
function mutants indicated that HsfB4/Scz acts mainly in
the stem cell niche, exerting autonomous and non-autono-
mous effects to specify cell identity and control of cell fates
1 3 0 ( 2 0 1 3 ) 5 4 –6 0 57
in surrounding layers (ten Hove et al., 2010; Pernas et al.,
2010).
In HsfB4-OE plants additional periclinal divisions must
have occurred in root cap daughter cells that led to the pro-
duction of extra LRC cells (Fig. 4b and d). The proliferation
of extra LRC cells was observed after germination from 1–
2 dpg on (Fig. 4b and d) in the meristematic region. The prolif-
eration of LRC cells in HsfB4-OE plants is consistent with a re-
ciprocal phenotype (fewer cells in LRC) in the scz-2 mutant
(ten Hove et al., 2010). In HsfB4-OE plants ectopic cell layers
were also located outside the ground tissue and from dpg 5–
7 onwards cells became detached from the root surface of
the elongation/maturation and from the meristematic zone
of the root tip. Normally, in Arabidopsis the LRC stops growth
after a few anticlinal divisions and cells die before approach-
ing to the elongation zone of the root tip (Benfey and Scheres,
2000; Dolan et al., 1993; Truernit and Haseloff, 2008). It ap-
pears that this arrest in LRC cell division is much delayed in
HsfB4-OE roots and the LRC expands into the maturation/
elongation regions and become eventually detached during
further growth. Starting at 5 dpg the epidermis/LRC specific
GFP-marker expression was not consistently strong in the
upper part of a new LRC layer. This may indicate that the cells
have lost the LRC identity, reflecting processes preceding the
detachment from the root surface.
The developmental timing of the two effects of HsfB4-OE
on the cellular structure of root is different. The initiation of
a supernumerary layer of ground tissue is observed as early
as torpedo/walking stick stage, which is consistent with the
activity of the CaMV-35S (Völker et al., 2001; Odell et al.,
1994). This is also in accordance with the developmental stage
of Scz expression in embryo development (Pernas et al., 2010;
ten Hove et al., 2010). LRC cell proliferation in HsfB4-OE roots
was not observed in the embryo. A post-embryonic prolifera-
tion could be a consequence of ectopic HsfB4 expression epi-
dermal/lateral root cap development, which is initiated in
cells that are normally not expressing HsfB4. It has been sug-
gested that SCZ/HsfB4 promotes stem cell identity (Pernas
et al., 2010) and thus supernumerary layers of cells may have
adopted the identity of endodermis or LRC cells.
4. Experimental procedures
4.1. Plant growth
Arabidopsis thaliana ecotype Columbia 0 (Col-0) was used as
experimental material.
For screening, phenotypic analysis, sampling of plant or-
gans (leaves, flower, seed) for RNA-isolation and for crossing
with marker lines seeds were spread on soil and 10–12 days
after germination seedlings were singled out in individual pots
and grown with a light/dark cycle of 16/8 h at 22 "C, 60% rela-
tive humidity and a light intensity of 5000 lumen m!2.
For phenotypic analysis of roots seeds were sterilized by
incubation for 10 min in 70% ethanol, 10 min treatment in
4% NaOCl, 0.2% Tritron-X 100 under vigorous agitation fol-
lowed by 5· washing in sterilized water. The seeds were
maintained at 4 "C for 48 h to stimulate synchronized germi-
nation. For in vitro culture seeds were grown on MS medium
58 MECHANISMS OF DEVELOPMENT 1 3 0 ( 2 0 1 3 ) 5 4 –6 0

Fig. 3 – Analysis of the cellular structure of HsfB4-OE8 roots at different developmental stages after germination. Roots were
grown on MS agar medium in a vertical position, stained with PI (b–f) and subjected to CLSM. Optical sections were made at 1–
1.5 lm thickness. (a) Scheme of the Arabidopsis root tip. Tissues are depicted in a median longitudinal section with
corresponding initials in lighter color at the base of each cell file (adopted from Nawy et al., 2005). Epidermis (orange), cortex
(yellow), endodermis (green), and stele (red) make up most of the root, and lateral (turquoise) and columella (blue) root caps
surround the apex. Epidermis and lateral root cap share a common initial, as do endodermis and cortex. Initial cells surround
the QC (white). (b) 3.5 day old WT root tip shows two layers of ground tissue marked by rectangular box. (c) 3.5 day old OE root
tip shows the ectopic cell layer in the ground tissue. (d) 4.5d old OE root tip shows additional cell layer in between ground
tissue and lateral root cap cells. Scale bar 50 lm. (e) Identification of endodermis cells in marker line SCR 2.0 (Brady et al.,
2007). Overlay of GFP (green) and PI (red) channels of 3 day old root shows GFP expression in single endodermis layer. (f)
Identification of ectopic cell layer in the ground tissue of HsfB4-OE roots. In the F1 progeny of a cross of HsfB4-OE8 line with
the endodermis specific GFP marker line SCR 2.0. Overlay of GFP (green) and PI (red) channels of 3 day old F1 root shows
expression of GFP in regular endodermis cell files and ectopic endodermis cell layer.

(Murashige and Skoog, 1962) with 0.68 to 1.2% phyto agar
(Duchefa) supplemented with 1% sucrose under short day
condition (light/dark cycle of 14/10 h) at 21 "C. For examining
root phenotype germinated seedlings were transferred to ½
MS medium on square plates and incubated in a vertical posi-
tion for 2 weeks under short day conditions. When necessary
roots were cut from the whole seedlings and used for
experimentation.
4.2. Heat Stress treatment
Heat stress (HS) was administered by incubating one week
old seedlings grown in vitro or cut plant tissue from soil grown
plants for 1 h at 37 "C in section incubation buffer (SIB: 1 mM
potassium sulfate, pH 6.0 and 1% sucrose) in the dark.
Heat stress treatment in the dark is routinely used in our
laboratory to minimize photooxidative stress (Busch et al.,
2005). Non-heat stressed seedlings, used as control, were
incubated in SIB at 25 "C.
4.3. Plant crosses with marker lines
Several GFP marker lines and enhancer trap lines (Hasel-
hoff collection kindly provided by Dr. Phillip Benfey, Duke
University, USA) were crossed with the HsfB4-OE lines. In
the SCR-2.0 marker line, SCR::GFP is expressed in the QC (qui-
escent centre), in cortex/endodermal initials and the decend-
ing endodermis cell layer, the SHR::GFP marker line is specific
for the stele. The WER::GFP marker line shows expression in
LRC (lateral root cap) and epidermis cells. The tissue specific
expression of the GFP was examined by confocal laser scan-
ning microscopy.
 MECHANISMS OF DEVELOPMENT
Fig. 4 – Abnormal cellular outgrowth of LRC in the
meristematic region of HsfB4-OE root tip. Root cell
morphology determined by confocal microscopy after
staining with Propidium Iodide of 4 dpg WT (a) and HsfB4-
OE8 (b) plants. Identification of epidermis and LRC cells in
WER::GFP marker line (c) showing GFP expression in single
epidermis and LRC layers (Brady et al., 2007). Identification
of ectopic cell layers of roots from progeny of HsfB4-OE8
crossed with WER::GFP marker line (d), which shows
expression of GFP in epidermis and in ectopic layers of LRC.
Overlay of GFP (green) and PI (red) channels. GT: ground
tissue, Ep, epidermis; C, cortex; E, endodermis; size marker,
50 lm; asterisks, collection of LRC cells.
4.4. Hsf promoter GUS reporter gene construction
Genomic DNA was isolated from two weeks old in vitro
grown seedlings of Arabidopsis (Col-0) according to Li and
Chory (1998). A DNA fragment spanning 1,77 kb of the pro-
moter region (upstream of the ATG start codon) of HsfB4
was amplified by PCR from whole genomic DNA template
using the primers B4-promo-F-Xba1 (5 0 CTCTAGAGCGAAGGA
AGTGGTGGGTGAG) and B4-promo-R-BamHI (5 0 CGGGATCCCG
TAGAGAGTTCGAGAAAGAGAGAGACA) with a PCR program:
95 "C, 1 min; 30 cycles of 94 "C, 1 min, 63 "C, 40 s, 72 "C,
3 min and final elongation at 72 "C for 10 min with Pfu poly-
merase (Fermentas). The PCR products were digested with
BamHI and EcoRI, ligated into the pCB308 (Xiang et al., 1999)
in front of the GUS reporter (uid A) gene.
1 3 0 ( 2 0 1 3 ) 5 4 –6 0 59
The resulting promoter::GUS constructs were transformed
into E. coli DH5a and the constructions were verified by DNA
sequencing. The vector pHsfB4::GUS was transformed into
Agrobacterium strain GV3101 followed by transformation of
Arabidopsis through floral dip method (Bechtold and Pelletier,
1998). Primary transformants were selected by spraying
plants with 0.1% BASTA solution.
4.5. Histochemical staining and microscopical analyzes
For histochemical localization of GUS activity embryos or
seedlings were infiltrated with X-Gluc (5-bromo-4-chloro-3-
indolyl-glucuronide) in sodium phosphate buffer (pH-7.4)
and incubated for 3 h at 37 "C, the reaction was stopped in
70% (v/v) ethanol. GUS staining was recorded microscopically
using Leica MZFL III supplied with an Axiocam (Zeiss) digital
camera and AxioVision 3.0 software.
Embryos were collected from developing siliques or ma-
ture seeds and mounted in chloral hydrate solution (8 vol
chloral hydrate: 2 vol H2O:1 vol glycerol) overnight (Berleth
and Jürgens, 1993) and documented under Nomarski optics.
4.6. Construction of CaMV-35S::Hsf vectors
The HsfB4 coding region with 5 0 - and 3 0 -UTRs was amplified
from an HsfB4 cDNA clone GSLTFB79ZF11 (Castelli et al., 2004)
using the primer B4-utr5 0 -EcoRI-F (5 0 CCGGAATTCCGGACAAA
CACAAATCTCTTCTCTTTT) and B4-utr3 0 -EcoRI-R (5 0 CCGGAAT
TCCGGAGTAAAGATTTAACCAGAATATTCATC). The amplified
sequence was digested with the restriction enzyme, purified
from agarose gel and inserted into EcoRI site located down-
stream of CaMV-35S promoter in vector pCB308. The final con-
struct in pCB308 (p35S::HsfB4) was transformed into
Agrobacterium tumefaciens strain GV3101, which was used for
transformation of Arabidopsis thaliana (Col-0) by floral dip
method with vacuum infiltration (Bechtold, 1993). T1 trans-
genic lines were selected by spraying with 0.1% BASTA and
subsequent generations were screened by leaf painting assay
(Dennehey et al., 1994).
4.7. RNA quantification by real-time RT-PCR
Poly (A)+ RNA was isolated from 100 mg frozen tissue of
either two weeks old whole seedlings or separately from dif-
ferent parts of the seedlings using the chemagic mRNA direct
kit (Chemagen). Copy-DNA was synthesized using the iS-
criptTM cDNA synthesis kit (Biorad) and used as template
for PCR amplification. Quantitative RT-PCR was performed
in triplicates in the iCycler (Biorad) using undiluted, 1/8 and
1/64 diluted cDNA as template. The values were normalized
to an internal standard (Actin2 mRNA). Tissue specificity and
quantification of HsfB4 mRNAs in OE lines were determined
using the primers B4–116-F (5 0 AAGCCTGTTGCTCCAAGT), B4–
70-R (5 0 TTACATATTACTCTGATCATGATGATTAGT). Actin2
mRNA expression using the primers Actin-F3 (5 0 AAGCTGGG
GTTTTATGAATGG) and Actin-R3 (5 0 TTGTCACACACAAGTG-
CATCAT) was taken as an internal standard. Routinely three
independent biological replicates were measured, each as
duplicate samples.
60 MECHANISMS OF DEVELOPMENT
4.8. Microscopy
The cellular structure of roots was analyzed by light
microscopy with or without Nomarski optics and confocal la-
ser scanning microscopy using seedlings at days 1–5 after ger-
mination. Plant material was analyzed either after chloral
hydrate treatment over night or after staining with 0.1 mg/
ml propidium iodide (PI) for 10–15 min respectively. PI-stained
roots were imaged with a Leica SP2 confocal microscope using
the 568 nm excitation and 498–551 nm emission lines. The
488 nm excitation and 580–700 nm emission lines were used
to image GFP expression in the enhancer trap and GFP marker
lines. Images were processed using Adobe Photoshop CS2 and
assembled using Adobe Illustrator program.
Acknowledgements
We thank Drs., Philip N. Benfey and Wolfgang Busch, Duke
University, USA, for kindly providing root GFP marker lines
and W.B. for critical reading of the manuscript and helpful
suggestions. We are also grateful to Alice Ott, Genetik der
Tiere, Universität Tübingen, for her kind help in the introduc-
tion to CLSM. Sponsoring: Part of the research was funded by
a Grant of the Deutsche Forschungsgemeinschaft (SFB446) to
FS.
Appendix A. Supplementary data
Supplementary data associated with this article can be
found, in the online version, at http://dx.doi.org/10.1016/
j.mod.2012.05.008.
R E F E R E N C E S
Bechtold, N., Pelletier, G., 1998. In planta Agrobacterium-mediated
transformation of adult Arabidopsis thaliana plants by vacuum
infiltration. Methods Mol. Biol. 82, 259–266.
Benfey, P.N., Linstead, P.J., Roberts, K., Schiefelbein, J.W., Hauser,
M.T., Aeschbacher, R.A., 1993. Root development in
Arabidopsis: four mutants with dramatically altered root
morphogenesis. Development 119, 57–70.
Benfey, P.N., Scheres, B., 2000. Root development. Curr. Biol. 10,
R813–815.
Berleth, T., Jürgens, G., 1993. The role of the monopteros gene in
organising basal development in the Arabidopsis embryo.
Development 118 (2), 575–587.
Brady, S.M., Orlando, D.A., Lee, J.Y., Wang, J.Y., Koch, J., Dinneny,
J.R., Mace, D., Ohler, U., Benfey, P.N., 2007. A high-resolution
root spatiotemporal map reveals dominant expression
patterns. Science 318, 801–806.
Busch, W., Wunderlich, M., Schöffl, F., 2005. Identification of novel
heat shock factor-dependent genes and biochemical pathways
in Arabidopsis thaliana. Plant J. 41, 1–14.
Czarnecka-Verner, E., Pan, S., Salem, T., Gurley, W.B., 2004. Plant
class B HSFs inhibit transcription and exhibit affinity for TFIIB
and TBP. Plant Mol. Biol. 56, 57–75.
Czarnecka-Verner, E., Yuan, C.X., Scharf, K.D., Englich, G., Gurley,
W.B., 2000. Plants contain a novel multi-member class of heat
1 3 0 ( 2 0 1 3 ) 5 4 –6 0
shock factors without transcriptional activator potential. Plant
Mol. Biol. 43, 459–471.
Dennehey, B.K., Petersen, W.L., Fordsantino, C., Pajeau, M.,
Armstrong, C.L., 1994. Comparison of selective agents for use
with the selectable marker gene BAR in maize transformation.
Plant Cell, Tissue Organ Cult. 36, 1–7.
Dolan, L., Janmaat, K., Willemsen, V., Linstead, P., Poethig, S.,
Roberts, K., Scheres, B., 1993. Cellular organisation of the
Arabidopsis thaliana root. Development 119, 71–84.
Helariutta, Y., Fukaki, H., Wysocka-Diller, J., Nakajima, K., Jung, J.,
Sena, G., Hauser, M.T., Benfey, P.N., 2000. The SHORT-ROOT
gene controls radial patterning of the Arabidopsis root
through radial signaling. Cell 101, 555–567.
Ikeda, M., Ohme-Takagi, M., 2009. A novel group of transcriptional
repressors in Arabidopsis. Plant Cell Physiol. 50, 970–975.
Truernit, E., Haseloff, J., 2008. A simple way to identify non-viable
cells within living plant tissue using confocal microscopy.
Plant Methods 4, 15. http://dx.doi.org/10.1186/1746-4811-4-15.
von Koskull-Döring, P., Scharf, K.D., Nover, L., 2007. The diversity
of plant heat stress transcription factors. Trends Plant Sci. 12,
452–457.
Kotak, S., Port, M., Ganguli, A., Bicker, F., von Koskull-Döring, P.,
2004. Characterization of C-terminal domains of Arabidopsis
heat stress transcription factors (Hsfs) and identification of a
new signature combination of plant class A Hsfs with AHA
and NES motifs essential for activator function and
intracellular localization. Plant J. 39, 98–112.
Kumar, M., Busch, W., Birke, H., Kemmerling, B., Nürnberger, T.,
Schöffl, F., 2009. Heat shock factors HsfB1 and HsfB2b are
involved in the regulation of Pdf1.2 expression and pathogen
resistance in Arabidopsis. Mol. Plant. 2, 152–165.
Li, J., Chory, J., 1998. Methods in Molecular Biology. In: Martinez-
Zapater, J.M., Salinas, J. (Eds.), Arabidopsis Protocols. Humana
Press, Toronto, pp. 55–60.
Lohmann, C., Eggers-Schumacher, G., Wunderlich, M., Schöffl, F.,
2004. Two different heat shock transcription factors regulate
immediate early expression of stress genes in Arabidopsis.
Mol. Genet. Genomics 271, 11–21.
Murashige, T., Skoog, F., 1962. A revised medium for rapid growth
and bioassays with tobacco tissue cultures. Plant Physiol. 15,
473–497.
Nawy, T., Lee, J.Y., Colinas, J., Wang, J.Y., Thongrod, S.C., Malamy,
J.E., Birnbaum, K., Benfey, P.N., 2005. Transcriptional profile of
the Arabidopsis root quiescent center. Plant Cell 17, 1908–1925.
Nover, L., Scharf, K.D., Gagliardi, D., Vergne, P., Czarnecka-Verner,
E., Gurley, W.B., 1996. The Hsf world: classification and
properties of plant heat stress transcription factors. Cell Stress
Chaperones 1, 215–223.
Odell, J.T., Hoopes, J.L., Vermerris, W., 1994. Seed-specific gene
activation mediated by the Cre/lox site-specific recombination
system. Plant Physiol. 106, 447–458.
Pernas, M., Ryan, E., Dolan, L., 2010. SCHIZORIZA controls tissue
system complexity in plants. Curr. Biol. 20, 818–823.
ten Hove, C.A., Willemsen, V., de Vries, W.J., van Dijken, A.,
Scheres, B., Heidstra, R., 2010. Schizoriza encodes a nuclear
factor regulating asymmetry of stem cell divisions in the
Arabidopsis root. Curr. Biol. 20, 452–457.
Völker, A., Stierhof, Y.-D., Jürgens, G., 2001. Cell cycle-independent
expression of the Arabidopsis cytokinesis-specific syntaxin
KNOLLE results in mistargeting to the plasma membrane and
is not sufficient for cytokinesis. J. Cell Sci. 114, 3001–3011.
Xiang, C.B., Han, P., Lutziger, I., Wang, K., Oliver, D.J., 1999. A mini
binary vector series for plant transformation. Plant Mol. Biol.
40, 711–717.