Practice Exam - Qats PDF

NAME: ____________________________
VCE® BIOLOGY
UNITS 3 & 4 Practice Written Examination
Reading time: 15 minutes Writing time: 2 hours 30 minutes
Structure of book
Section Number of Questions Number of Questions Number of Marks

to be answered
A 40 40 40
B 13 13 70
Total 110
• Students are permitted to bring into the examination room: pens, pencils, highlighters, erasers,
sharpeners and rulers.
• Students are NOT permitted to bring into the examination room: blank sheets of paper and/or
white out liquid/tape.
• No calculator is allowed in this examination.
Materials supplied
• Question and answer book of 42 pages.
• Answer sheet for multiple-choice questions.
Instructions
• Write your name in the space provided above on this page.
• Detach the answer sheet for multiple-choice questions during reading time.
• Write your name on your answer sheet for multiple-choice questions.
• All written responses must be in English.
At the end of the examination
• Place the answer sheet for multiple-choice questions inside the front cover of this book.
Students are NOT permitted to bring into the examination room mobile phones and/or
any other unauthorised electronic devices.
©2017 Ser4BIOU34EA
Published by QATs. Permission for copying in purchasing school only.

QATs VCE®BIOLOGY Practice Written Examination Units 3 and 4
SECTION A - Multiple Choice Questions
Instructions for Section A

Answer all questions in pencil on the answer sheet provided for multiple-choice questions.
Choose the response that is correct for the question.
A correct answer scores 1, an incorrect answer scores 0.
Marks will not be deducted for incorrect answers.
No marks will be given if more than one answer is completed for any question.
Question 1
Which of the following statements is true for movement across a plasma membrane?
A. Lipophobic gases such as carbon dioxide can cross by facilitated diffusion.
B. Amino acids always require ATP to cross the membrane.
C. Water will move via osmosis from a region of low water concentration to a region of high
water concentration.
D. Uncharged polar molecules can diffuse across the plasma membrane.
Question 2
Observe the diagram of the cell:
A
Source:http://content.jacplus.com.au/
C
D
An accurate description of the structures in the cell is
A. D is the endoplasmic reticulum and protein synthesis occurs in C.

B. A is the site of protein synthesis and proteins are packaged for export in D.
C. C is the golgi apparatus and modification of proteins occurs in B.
D. B is organelle that packages proteins for export from the cell.
©2017 Ser4BIOU34EA
Published by QATs. Permission for copying in purchasing school only. 2

Question 3
Endocytosis
A. is a passive process.
B. is demonstrated by phagocytosis.
C. involves formation of vesicles by the golgi body .
D. occurs with the concentration gradient.
Question 4
A condensation reaction between two amino acids will produce
A. monomers.
B. water.
C. energy.
D. DNA.
Question 5
The tertiary structure of a protein can include
A. two polypeptide chains.
B. three polypeptide chains.
C. alpha helices.
D. only peptide bonds.
Question 6
The proteome can best be described as
A. all of the proteins that a cell can produce.
B. all of the genes in a cell.
C. only the proteins that are needed by the organism.
D. the complete array of the gene pool.
©2017 Ser4BIOU34EA

Question 7
A codon can be described as degenerate because
A. the same codon can code for multiple amino acids.
B. the same amino acid can be coded for by more than one codon.
C. nonsense mutations lead to stop codons.
D. a single stop codon can terminate the sequence.
Question 8
The molecule shown below is extracted from the cytosol of a cell
Source: http://userscontent2.emaze.com
If a chemical analysis was done on this molecule, you would expect to see
A. phosphate groups and thymine.
B. phospholipid groups and guanine.
C. phosphate groups and uracil.
D. phospholipid groups and adenine.
Question 9
Structural and regulatory genes both contain
A. DNA polymerase.
B. RNA polymerase.
C. exons.
D. transcriptional factors.
©2017 Ser4BIOU34EA

Questions 10 and 11 refer to the following information.

A repressed lac operon is represented by the following diagram.
Source: https://qph.ec.quoracdn.net
Question 10
The promotor region is represented by
A. 1
B. 2
C. 3
D. 4
Question 11
Transcription would begin in the presence of which of the following molecules
A. B.
C. D.
©2017 Ser4BIOU34EA

Questions 12 and 13 refer to the following.

Cholinesterase is an enzyme that breaks down acetylcholine to prevent its accumulation in the
cell. It catalyses the breakdown of acetylcholine into acetic acid and choline.
Question 12
Below shows a graph of acetylcholinesterase action
Graph A
Concentration of
Acetic Acid Graph B
(arbitrary units)
Time
A reasonable explanation for the difference in lines is an increase in the amount of
A. acetic acid in Graph A.

B. cholinesterase in Graph B.
C. acetylcholine in Graph A.
D. cholinesterase in Graph A.
Question 13
Anti-cholinesterase is a molecule that prevent cholinesterase from breaking down acetylcholine
by binding to the active site. This could be considered to be a
A. competitive inhibitor that is reversible.
B. competitive inhibitor that is irreversible.
C. non-competitive inhibitor that is reversible.
D. non-competitive inhibitor that is irreversible.
©2017 Ser4BIOU34EA

Question 14
Which of the following could be referred to as a ‘loaded’ coenzyme?
A. NAD
B. FAD
C. ATP
D. NADP
Question 15
A test tube contains a solution containing mitochondria that had been extracted from cytoplasm,
as shown below.
In the absence of cytosol the addition of
A. glucose would result in an increased concentration of pyruvate.

B. pyruvate would result in an increased concentration of carbon dioxide.
C. water and oxygen would result in an increased concentration of glucose.
D. oxygen would result in increased glucose breakdown.
Question 16
A plant hormone capable of cell elongation is
A. gibberellins.
B. ethylene.
C. abscisic acid.
D. cytokinins.
©2017 Ser4BIOU34EA

Question 17
An example of a condition most likely caused by a pathogen is
A. hypersensitivity.
B. skin cancer.
C. food poisoning.
D. rheumatoid arthritis.
Question 18
Prions
A. are larger than viruses.
B. contain nucleic acids.
C. replicate by binary fission.
D. may have different secondary structures compared to normal protein.
Question 19
Fire blight is a plant disease caused by the bacteria Erwinia amylovora. It affects pome fruits,
including apples and pears.
Source: http://www.omafra.gov.on.ca/english/crops/facts/fireblight.htm
A likely defence the plant would have in response to the bacteria is
A. production of specific antibodies.

B. development of a gall.
C. production of interferon.
D. engulfment by phagocytes.
©2017 Ser4BIOU34EA

Question 20
The lymphatic system
A. contains fluid that is pumped by the heart.
B. is the site of the cell mediated immune response only.
C. is able to trap cancerous cells.
D. is the site of innate immune responses.
Question 21
Cells that act as phagocytes include
A. monocytes and neutrophils.

B. basophils and mast cells.
C. lymphocytes.
D. natural killer cells.
Question 22
A list of events that occur in the allergic reaction, in no particular order include
1. Immunoglobulin E binds to mast cells

2. B plasma cells produce specific antibodies
3. Inflammation occurs
4. Degranulation occurs
5. Allergens react with IgE
The correct sequence of events is
A. 5, 1, 2, 3, 4
B. 4, 5, 2, 1, 3
C. 2, 3, 5, 1, 4
D. 2, 1, 5, 4, 3
©2017 Ser4BIOU34EA

Question 23
Multiple sclerosis is an example of an
A. autoimmune disease.
B. allergy.
C. immunodeficiency.
D. infectious disease.
Question 24
Monoclonal antibodies are a relatively new type of drug that is being used to treat cancer.
Which of the following is not a mode of action of monoclonal antibodies?
A. Inhibiting the growth of new blood vessels to cancerous tissue.
B. Binding to antigens on cancerous cells to attract immune cells.
C. Binding to receptors to block the reception of growth factors.
D. Inducing necrosis of cancerous cells.
Question 25
The following scenario that is matched with the correct type of immunity is
Scenario Type of immunity
A. A person has an immune response against Active, natural

antigens on the varicella zoster virus
which causes chicken pox.
B. Injection of diphtheria antitoxin to a Active, passive

person living with a family member
infected with the bacteria
Corynebacterium diphtheria.
C. A child is breastfed by their mother who Induced, Passive

was vaccinated against whooping cough
during her pregnancy.
D. A person receives an injection of influenza Induced, Active

antibodies.
©2017 Ser4BIOU34EA

Question 26
Different farmers who have cultivated crops of the common wild mustard (Brassica oleracae)
have produced a number of different plants available to consumers today including: Brussel
sprouts, cabbage, cauliflower, broccoli and kale. The farmers only allowed plants with particular
traits to reproduce.
source: https://feralbigten.files.wordpress.com
Crops of the new plants were cultivated through a process of
A. natural selection.
B. manipulating the gene pool.
C. genetic technologies.
D. environmental selection pressures.
Question 27
Allopatric speciation requires a physical barrier like a river or mountain range to divide a
population in order to
A. temporarily isolate the populations.
B. create environmental selection pressures.
C. allow mutations to accumulate.
D. prevent gene flow.
©2017 Ser4BIOU34EA

Question 28
A region of a genetic code of a gene is shown below.
….TACCTCTGACAGTTCTGCTAGCTAGTCGTAGCTAGCTGATCGATCGTAGC….
The type of mutation which will cause the greatest chance of creating a non-functional gene is a
A. point mutation where the first A is substituted for a T.
B. block mutation where the following sequence TGACAGT is inverted.
C. cytosine being inserted at the start of the sequence.
D. sequence CTA being deleted from the sequence.
Question 29
Which of the following is not able to reduce the variation in a population?
A. Mutation
B. Genetic drift
C. Bottleneck effect
D. A natural disaster
©2017 Ser4BIOU34EA

Question 30
An extinct species of the baleen whale Aetiocetus weltoni is an early species of whale that
showed origins similar to that of the modern whale species. Fossilised fragments of partial skulls
and cranial remains show that it had incisor, canine and molar teeth like many other mammals
and lacked the baleen (keratin based filter feeding plates) found in modern mammals.
Aetiocetus weltoni fossilised skull
Source: https://www.researchgate.net/
From the information given, it is likely that
A. the Aetiocetus weltoni individual shown above had a frameshift mutation.

B. Aetiocetus weltoni is a reliable index fossil.
C. Aetiocetus weltoni is an example of a transitional fossil.
D. Aetiocetus weltoni must have lived during the Jurassic period.
Question 31
Methods of determining the relative age of fossils include
A. radiometric dating.
B. stratigraphy.
C. biogeography.
D. electron spin resonance.
©2017 Ser4BIOU34EA

Question 32
Species relatedness determined by changes to nucleotide sequences at a particular rate can be
inferred by using
A. molecular clock concept.
B. comparative genomics.
C. phylogenetic analysis.
D. comparative embryology.
Question 33
Which of the following provides accurate evidence for Homo sapiens and Homo
neanderthalensis having interbred?
A. Evidence of Neanderthal DNA in all modern humans.
B. Identical positions of the foramen magnum.
C. Recently discovered cave paintings of Neanderthals.
D. Evidence of Neanderthal DNA in non-African descended populations.
Question 34
A characteristic of hominins not shared by other hominoids is
A. a bowl-shaped pelvis.
B. comparatively longer arms compared to the legs.
C. larger teeth.
D. the ability to communicate.
©2017 Ser4BIOU34EA

Question 35
A characteristic feature of skulls of early species of the genus Homo is that they had relatively
A. smaller brain cases.
B. smaller brow ridges.
C. less pronounced muzzle.
D. more vertical forehead.
Questions 36 to 39 refer to the following diagram.
Electrophoresis Gel of Deer Species
Direction of
DNA movement
Source: http://mdk12.msde.maryland.gov
Question 36
The species of deer most recently diverged from the common ancestor is
A. 1
B. 2
C. 3
D. 4
©2017 Ser4BIOU34EA

Question 37
Which species contains the smallest fragments of DNA being analysed?
A. 1
B. 2
C. 3
D. 4
Question 38
The enzyme needed to produce the DNA fragments is
A. restriction enzyme.
B. DNA ligase.
C. DNA polymerase.
D. acetyl Co-Enzyme A.
Question 39
Which of the following is not an example of a transgenic technology?
A. ‘Golden’ rice crops expressing a bacterial gene to produce more Vitamin A.
B. Humans having a working copy of the gene inserted that can potentially cure cystic
fibrosis.
C. Tomato plants having genes from fish inserted into them for frost resistance.
D. Mice that have had a jellyfish gene inserted allowed them to glow under UV light.
Question 40
A vector is an organism that carries a pathogen from one host to another. In gene technology a
vector such as a plasmid can be used to transfer DNA to the target organism. The property that
is not necessary for a vector is that it
A. can replicate in the target organism.
B. has at least one recognition site for a restriction enzyme.
C. contains a genetic marker that can identify successfully transferred DNA.
D. already contains a number of regulatory genes.
©2017 Ser4BIOU34EA

SECTION B – Short Answer Questions
Instructions for Section B

Answer this section in pen.
Answer all questions in the spaces provided.
Question 1 (5 marks)
Membrane fusion is integral to many cell functions including the secretion of molecules such as
antibodies and neurotransmitters from cells. Membrane fusion is the process by which two
separate membranes join to form one continuous membrane. Recent studies have lead
researchers to believe that membrane fusion is currently more complex than was previously
known. This research can lead to advancements in the ways that drugs are developed.
a. Label the component of the neural cell membrane in the diagram below:
1 mark
http://www.grootfeest.info
b. What is the role of structure labelled i)? 1 mark
______________________________________________________________________________
______________________________________________________________________________
©2017 Ser4BIOU34EA

c. Name and explain the process by which a neuron releases neurotransmitters. 1 mark
_____________________________________________________________________________
______________________________________________________________________________
d. i) Explain how the structure of a neurotransmitter can cause a response in the target cell.
1 mark
______________________________________________________________________________
______________________________________________________________________________
ii) What does this suggest about the solubility of neurotransmitters? 1 mark
______________________________________________________________________________
______________________________________________________________________________
©2017 Ser4BIOU34EA

Fang blennies (Meiacanthus grammistes) are little fish that have large fangs capable of
delivering venom to their victims. The venom is made up of a number of substances, including
an opioid peptide. It is thought that when the fang blennies bite the ‘would be’ predator the
opioid causes a drop in blood pressure. This would then disorientate and slow the predator down,
giving the fang blennies a chance to escape. It could also relax the jaws and allow them to
escape.
Source: https://s-media-cache-ak0.pinimg.com
Nucleic acids found in the cells of the fang blennies are needed for the synthesis of the opioid
proteins found in the cells of the blennies.
a. Explain how the roles of the 3 different types of RNA within the cells of the blennies that are
needed to produce the venom. 3 marks
rRNA
mRNA
©2017 Ser4BIOU34EA

tRNA
b. When studying the venom of the fang blennies, why would scientists be interested in the
proteome in this species, rather than just the study of a single gene? 1 mark
______________________________________________________________________________
______________________________________________________________________________
The following image shows a close view of a receptor for the opioid protein (found in fish). It is
known that a single gene codes for this receptor.
Source: https://www.mitchmedical.us
c. What hierarchal level of protein structure is pictured? Give a reason for your choice. 2 marks
______________________________________________________________________________
______________________________________________________________________________
Reference: https://www.sciencedaily.com/releases/2017/03/170330142149.htm
©2017 Ser4BIOU34EA

A number of genes called E2F genes are regulatory genes controlling the development of the
placenta during embryonic development. Two of the genes from this family of genes have been
identified: E2F7 and E2F8. The absence of these genes results in a placenta that is composed of
overly crowded cells that are not able to function properly. These genes are believed to have a
role in supressing other genes that control cell division.
a. Explain how the E2F genes could interact in utero to control the cells and lead to a healthy
baby. 2 marks
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
b. Explain the role that the identification of the E2f7 and E2f8 genes could have in applications
of better understanding cancer. 1 mark
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
c. Are the E2F genes structural or regulatory? Circle the correct response below.
Structural Regulatory
Describe a structural gene. 1 mark
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
Source: https://www.sciencedaily.com/releases/2012/04/120416125318.htm
©2017 Ser4BIOU34EA


A leaf shaped sea slug, Elysia chlorotica, pictured below, has the ability to take chloroplasts
from the algae that it eats and is able to preserve them in working order to use them for its own
metabolic purpose for the entire duration of the sea slug’s life. The sea slug not only takes these
organelles but is able to incorporate chlorophyll producing genes into its own genetic make-up.
Source: https://www.wired.com/2010/01/green-sea-slug/
a.
i) Draw a labelled diagram of a chloroplast and include the locations of each stage of
photosynthesis. 2 marks
©2017 Ser4BIOU34EA

ii) Complete the table below for the first stage of photosynthesis. 2 marks
Name of stage:
Name one Input:
Name one Output:
Role of output
(above)
b. Elysia chlorotica must produce approximately 16 different enzymes to allow it to produce

chlorophyll a. Chlorophyllase is an enzyme that has a role in regulating chlorophyll
metabolism.
i) Minerals such as magnesium and potassium are cofactors to these reactions. Define
cofactor. 1 mark
______________________________________________________________________________
______________________________________________________________________________
ii) Chlorophyllase has optimal conditions of pH 8.5 and 50°C. Complete the table below to
show what would happen to the rate of reaction of chlorophyllase at 10°C and at 70°C.
Give reasons for the changes you have suggested. 2 marks
Temperature Change Explanation for change
Increase/
stay the same/
decrease
10°C
70°C
©2017 Ser4BIOU34EA

c. By photosynthesising, Elysia chlorotica is able to produce a high energy containing molecule

that can undergo a different process to release this energy to the cell. Consider the second
stage of this process.
i) In the boxes on the diagram below, label the missing input and output. 1 mark
Source: https://s3.amazonaws.com/
ii) Name this stage and briefly outline what happens during this stage. 1 mark
______________________________________________________________________________
______________________________________________________________________________
©2017 Ser4BIOU34EA

d. Much like the Elysia chlorotica takes in chloroplasts and preserves them as a functional
organelle it is believed that chloroplasts were once their own free living photosynthetic
prokaryotic cell. State one piece of evidence that supports this theory. 1 mark
______________________________________________________________________________
______________________________________________________________________________

Chikungunya is a retrovirus that causes sufferers to experience fever, muscle and joint pain,
headaches, nausea and fatigue. Deaths from this virus are very rare. It most commonly occurs in
Africa and Asia. The word ‘chikungunya’ comes from an African word meaning ‘to become
contorted.’ The virus is transmitted from human to human by the bites of infected female
mosquitos.
a. Describe the general structure of the chikungunya virus. 1 mark
______________________________________________________________________________
______________________________________________________________________________
b. Name the vector for this virus and identify one preventative measure that an individual could
take to reduce the risk of vector transmission. 1 mark
______________________________________________________________________________
______________________________________________________________________________
c. Explain how an infected individual could develop long term immunity against the
chikungunya virus. 2 marks
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
©2017 Ser4BIOU34EA

d. Outline the role of a chemical in the innate immune response against the chikungunya virus.
1 mark
______________________________________________________________________________
______________________________________________________________________________
e. Late 2016, researches from the University of Texas developed the first vaccine against
chikungunya virus. Define ‘vaccine.’ 1 mark
______________________________________________________________________________
______________________________________________________________________________
f. It is hypothesised that the vaccine that has been developed completely protects mice infected
with the chikungunya virus. Design an experiment to test the effectiveness of the vaccine. In
your experiment outline the following:
 Need for controls
 Dependent and independent variables
 Expected results.
3 marks
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
©2017 Ser4BIOU34EA

g. If the mother of a new born baby had previously been infected with chikungunya, would her
child have long term immunity? Explain. 1 mark
______________________________________________________________________________
______________________________________________________________________________
The brown anole lizards (Anolis sagrei) inhabit a range of islands in the Caribbean. In 2004
Hurricane Frances completely submerged seven low-lying islands, wiping out several small
towns and all of the lizards that had inhabited the islands. The seven islands were searched and
no brown anoles could be found. Scientists, in the years following 2005, transported some
colonising lizards from the two larger islands (that were not submerged) onto each of the seven
islands. The lizards were selected randomly. The length of limbs was recorded over a 10 year
period in data Table 1.
Source: https://upload.wikimedia.org
©2017 Ser4BIOU34EA

Data Table 1
Island Colonising lizards Average limb length after 5 Average limb length after
average limb length years 10 years.
1 Long Medium Medium
2 Medium Medium Short
3 Medium Short Short
4 Short Short Very Short
5 Long Long Medium
6 Medium Medium Short
7 Short Very short Very Short
a. What effect did Hurricane Frances have on the genetic diversity of the brown anole
populations in 2004? 1 mark
______________________________________________________________________________
______________________________________________________________________________
©2017 Ser4BIOU34EA

b. What evolutionary mechanism were the scientists replicating by placing a small colony of
lizards on each of the 7 islands? Use Data Table 1 to provide evidence for the persistence of
this mechanism after 10 years of the study. 2 marks
Surviving Lizards
No
Lizards
Surviving Lizards
Mechanism:
_______________________________________________________________________
Evidence:
_________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
c. Scientists who observed the different populations on the 7 islands observed natural selection
as the lizards adapted to their new environments. Each island differs slightly in terms of the
food sources available to the lizards. Scientist also noted significant differences in limb
length of the lizards. Explain how natural selection would have caused these changes in the
different lizard populations to cause short-limbed lizards. 3 marks
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
©2017 Ser4BIOU34EA

The thylacine, Thylacinus cynocephalus, is an iconic Australian carnivorous marsupial that is

believed to have disappeared from mainland Australia several hundred years ago. The last known
thylacine died in captivity in 1936 in a zoo in Hobart.
Source: https://australianmuseum.net.au/image/thylacine-at-hobart-zoo-1930s
The thylacine is a marsupial, possessing a pouch to rear its young. Although often called a
‘Tasmanian tiger’ or ‘Tasmanian wolf’ this is inaccurate as the thylacine is only very distantly
related to the canidae family, including the grey wolf.
a. Explain how the definition of convergent evolution can be used to explain the similar
appearance of the thylacine and grey wolf. 1 mark
______________________________________________________________________________
______________________________________________________________________________
©2017 Ser4BIOU34EA

b. Unlike all other marsupials, the teeth of the thylacine appear to be similar to the milk teeth of
placental mammals such as the wolf which, when born, have a set of teeth referred to as
‘milk teeth’ which are eventually replaced by permanent, adult teeth. The thylacine is the
only marsupial to possess a tooth that is replaced during its life.
Thylacine jaw fossil showing milk teeth
Source: https://www.dreamstime.com/
Are the teeth of the thylacine and wolf examples of homologous or analogous structures?
Explain your choice. 2 marks
Structure: _________________________________________
Explanation:
________________________________________________________________________
______________________________________________________________________________
c. The image above shows a fossil of a thylacine which is approximately fifteen million years
old.
i) What method would be used to determine the absolute age of this fossil? Explain the
reason for your choice. 1 mark
______________________________________________________________________________
______________________________________________________________________________
©2017 Ser4BIOU34EA

ii) In order to be preserved, remains must be subject to certain conditions to favour

fossilisation. State one factor and explain its importance in fossilisation. 1 mark
______________________________________________________________________________
______________________________________________________________________________
d. The thylacine is believed to be extinct. What evidence would support this claim? 1 mark
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
©2017 Ser4BIOU34EA

Cichlids are a large family of brightly coloured fish that are predominantly found in Africa and
America and are popular pets. There are over 1600 species of cichlid found in Africa mostly
spread throughout Lake Victoria, Lake Malawi and Lake Tanganyika. The region has been
subject to flooding and droughts which has caused populations of cichlids to become isolated,
resulting in adaptive radiation.
There is variation within the molecular genetic basis of the opening and closing mechanisms of
the lower jaw of African cichlids. Their jaws are either adapted to suction feeding to consume
plankton or other fish or adapted to biting, useful for picking algae from rocks or scales from
other fish.
Cichlid jaws
Source: http://dev.biologists.org/content/132/5/851
Post-transcriptional modification of the BMP4 (bone morphogenic protein 4) gene is believed to

account for some of the variation in the jaw structure of these fish. BMP4 is considered to be a
master regulatory gene.
©2017 Ser4BIOU34EA

a. Explain how master regulatory genes are able to influence jaw development in African
Cichlids. 2 marks
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
b. A phylogenetic tree can be arranged by studying the mtDNA gene ND2 of a range of African
cichlids. Consider the following information about four species of cichlid. Use the
information in the table to complete the phylogenetic tree:
Species Feeding style Egg spots Body colour
Labeotropheus fuelleborni biting present solid

(Lf)
Metriaclina zebra (Mz) sucking present Banded
Melanochromis auratus biting present Banded

(Ma)
Melanchromis vermivorus sucking present banded

(Mv)
i. Write the species initials (in brackets after the species name) in the boxes below. 2 marks
©2017 Ser4BIOU34EA

ii. Describe a technique that could be used to compare the sequence of the mitochondrial
DNA to confirm the arrangement of the phylogenetic tree? 1 mark
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
©2017 Ser4BIOU34EA

In 2008 scientists unearthed a bone from the little finger of a Denisovan
girl around 6 years old. After constructing the genome, scientists found
traces of the genetic origins in some modern (Homo sapien) Asian and
Papua New Guinean populations. Denisovans are part of the hominin
group.
Reconstruction of the Denisovan girl
Source: https://s-media-cache-ak0.pinimg.com
a. Define hominin. 1 mark

______________________________________________________________________________
______________________________________________________________________________
b. Provide a likely explanation for these genes appearing in the Homo sapien genome of Asian
and Papua New Guinean humans but not populations of Africans and Europeans. 2 marks
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
Comparisons of Denisovans and Humans can help scientists to better understand why we are the
only species alive today.
c. Give an example of one type of cultural evolution present in early humans; explain the
advantage that Homo sapiens would have had over the other species of hominins also present
at the same time as us. 2 marks
Cultural evolution example:
____________________________________________________________
Advantage:
______________________________________________________________________________
______________________________________________________________________________
©2017 Ser4BIOU34EA

d. Explain why denisovans could not have arisen before H. erectus had evolved? 1 mark
___________________________________________________________________________
___________________________________________________________________________
Non-invasive pre-natal testing (NIPT) is a test conducted on pregnant women at around 7- 10
weeks of pregnancy. It uses a sample of the mothers blood (taken from the arm) and is able to
estimate the chance of Down’s and other syndromes. A small sample of DNA called ‘cell free
DNA’ (cfDNA) from the placenta circulates in the mother’s blood while she is pregnant. These
small DNA fragments are usually only around 150bp long.
In 1997 the discovery of foetal Y chromosomes fragments found in the blood plasma of pregnant
women who were pregnant with a male foetus has helped to propel the investigation into the
NIPT technology.
a. What is the name of the process that could enable the laboratory to sort the cfDNA fragments
by size? 1 mark
___________________________________________________________________________
b. What is aneuploidy, and why would pregnant mothers be concerned about its presence in
their unborn foetus? 1 mark
___________________________________________________________________________
___________________________________________________________________________
c. Why is using the cell free DNA a better option that taking a sample from the placenta
directly? 1 mark
___________________________________________________________________________
___________________________________________________________________________
d. Explain the process of Polymerase Chain Reaction which would allow the small amounts of
free fcDNA to be made into a large DNA sample ready for analysis. 3 marks
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
©2017 Ser4BIOU34EA

Zanamivir (also known as Relenza) is a competitive neuraminidase inhibitor. It is taken through
an oral inhaler for the treatment of influenza (the flu). It was produced through the process
known as rational drug design. Neuraminidase is an enzyme found on the outside of influenza
viruses and is needed for the detachment of the virus from the host cell. Neuraminidase cleaves
the sialic acid from the glycoproteins found on the host cells. When the sialic acid is cleaved the
virus can detach from the host cell receptor to which it was bound.
a. Describe rational drug design. 1 mark
______________________________________________________________________________
______________________________________________________________________________
b. Explain which substance the Relenza is likely to mimic? 1 mark

______________________________________________________________________________
©2017 Ser4BIOU34EA

A region of a surface of the host cell is shown in the diagram below. The enlarged section is
shown below.
c. Draw a labelled diagram of Relenza bound to the neuraminidase of a virus in the space
provided. 2 marks
Host Cell Surface
Space for diagram
Plasma Membrane
Glycoprotein
Sialic acid
Enlarged Region
Plasma Membrane
Glycoprotein
Sialic acid
d. If an extremely virulent strain of Influenza virus was to be found in Asian countries, list a
strategy that would be used to manage the new disease in Australia. 1 mark
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
©2017 Ser4BIOU34EA

e. Explain the difference between an epidemic and a pandemic if there were to be an influenza
outbreak. 1 mark
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
END OF QUESTION AND ANSWER BOOK
©2017 Ser4BIOU34EA

MULTIPLE CHOICE ANSWER SHEET Name:…………………………………………
Instructions: Shade the letter corresponding to the correct response for each question
Question 1 A B C D
Question 2 A B C D
Question 3 A B C D
Question 4 A B C D
Question 5 A B C D
Question 6 A B C D
Question 7 A B C D
Question 8 A B C D
Question 9 A B C D
Question 10 A B C D
Question 11 A B C D
Question 12 A B C D
Question 13 A B C D
Question 14 A B C D
Question 15 A B C D
Question 16 A B C D
Question 17 A B C D
Question 18 A B C D
Question 19 A B C D
Question 20 A B C D
Question 21 A B C D
©2017 Ser4BIOU34EA

Question 22 A B C D
Question 23 A B C D
Question 24 A B C D
Question 25 A B C D
Question 26 A B C D
Question 27 A B C D
Question 28 A B C D
Question 29 A B C D
Question 30 A B C D
Question 31 A B C D
Question 32 A B C D
Question 33 A B C D
Question 34 A B C D
Question 35 A B C D
Question 36 A B C D
Question 37 A B C D
Question 38 A B C D
Question 39 A B C D
Question 40 A B C D
©2017 Ser4BIOU34EA

SOLUTION PATHWAY
Answers to Section A: Multiple choice
Correct Explanation
Question Answer
1 D Ethanol is able to diffuse through the plasma membrane. CO2 is able

to diffuse so therefore must not be lipophobic. Amino acids cross by
facilitated diffusion and water moves from high to low concentration
so C in incorrect.
2 B ‘A’ is the ribosome and therefore site of protein synthesis, D is the

golgi apparatus for modification, packaging and export.
3 B Phagocytosis is a type of endocytosis. Endocytosis is an active

transport process hence A and C are incorrect. Vesicles are not
formed internally via the Golgi apparuts therefore C is incorrect.
4 B Condensation reactions release a water molecule as the new bonds

form. Hydrolysis reactions release energy. DNA is a polymer of
nucleic acids, not amino acids.
5 C Secondary structures, like an alpha helix can form part of the tertiary
structures. More than one polypeptide chain would be a quaternary
structure.
6 A D is incorrect because it is referring to multiple organisms. The

proteome refers to all of the proteins that are produced by a cell or
organism.
7 B Some amino acids have more than one codon that can code for it. This
is because there are 64 codons, while there are only 20 different
amino acids.
8 C The molecule is RNA, as DNA is not found in the cytosol. Each

monomer of RNA contains a phosphate group and one of the bases A,
U, G, C.
9 C Exons are present in both the DNA and the mRNA transcript that they
code for.
©2017 Ser4BIOU34EA

10 C 1.RNA polymerase, 2.Repressor Protein, 3.Promotor Region,

4.Operator.
11 A The shape that binds with the repressor protein (2) to remove it is only
matched by A.
12 C As the concentration of product (acetic acid increases) there must be a

greater amount of substrate (acetylcholine).
13 A Competitive inhibitors bind to the active site (stem of question –

therefore cannot be a non-competitive inhibitors) and are reversible.
14 C ATP has formed from lower energy state ADP. NAD, FAD and
NADP are not ‘loaded’ as they have not bound to a H+.
15 B In the absence of cytosol, glycolysis will not occur therefore A and C

are incorrect. Kreb’s cycle and electron transport chain can still occur,
resulting in production of CO2, therefore B is correct. Water and
oxygen are not inputs for cellular respiration.
16 A Gibberellins have a role in cell elongation.
17 C Food poisoning is caused by bacterial infections.
18 D Prions have the same amino acid sequence but changes to secondary
structure.
19 B Plants produce galls as a defence mechanism to bacterial infections.
20 C Lymphatic system is the site of B and T cell activity in response to

foreign antigens. The lymphatic system contains lymph nodes, that
trap antigens including cancer cells.
21 A Monocytes and neutrophils are two types of white blood cell that act
as phagocytes.
22 D The correct order of events is: B plasma cells produce specific

antibodies, Immunoglobulin E binds to mast cells, Allergens react
with IgE, Degranulation occurs, Inflammation occurs.
23 A MS is an autoimmune disorder that occurs due to the mis-
identification of self cells of the myelin.
©2017 Ser4BIOU34EA

24 D A, B and C are all correct roles of monoclonal antibodies in cancer

treatment. They do not induce necrosis hence D is the correct answer.
25 A The answer is A, as this person is having an immune response to

antigens and will make antibodies and memory cells.
26 B This is an example of selective breeding/artificial selection – where

the farmers are shown to have manipulated the gene pool of their
crops over the generations.
27 D A is not correct as the populations must be isolated for a large amount

of time. The role of the physical barrier is to prevent immigration and
emigration (gene flow).
28 C This causes a frameshift mutation and therefore will affect the largest
number of codons.
29 A Mutations increase the variation, while the other options all reduce the
variation.
30 C It is a transitional form as it shows characteristics of modern whales

and earlier mammal species.
31 B Stratigraphy determines relative age, the other 3 techniques determine

absolute age.
32 A The molecular clock concept measures the rate of changes to a

nucleotide sequence.
33 D Neanderthals could not have bred with African populations (there is

no evidence of them having ever been in Africa). The accurate
evidence is that as humans left Africa, they encountered Neanderthals
and bred then.
34 A Hominins are upright walking while the apes are not. This would be
evidenced by a bowl shaped pelvis. Hominins have smaller teeth, both
can communicate and hominins have shorter arms.
35 A Early species of the genus Homo had smaller brain cases than their
modern counterparts.
36 C Species 3 has the most bands in common with the common ancestor.
©2017 Ser4BIOU34EA

A is not correct as it has not ‘diverged’ from the common ancestor.
37 D DNA moves towards the positive electrode and smaller fragments

move the fastest. The band closest to the bottom of the gel contains
the smallest fragments.
38 A Restriction enzymes cut the DNA at a specific sequence, cutting the

DNA into fragments. DNA polymerase is needed for DNA replication
and DNA ligase joins DNA fragments together.
39 B Transgenic has the DNA from a different species inserted into the
organism. The cystic fibrosis gene is a human gene inserted into a
another human.
40 D Regulatory genes can be inserted (if needed) for transcription of the

new gene to occur. They are not needed in the vector.
©2017 Ser4BIOU34EA

Answers to Section B: Short Answer
Question 1
a. i. Cholesterol
ii. Glycolipid
iii. Protein channel
(1 mark for 3 correct labels)
b. To maintain fluidity of the plasma membrane (1 mark).
c. Exocytosis AND neurotransmitters are packaged into vesicles that fuse with the plasma
membrane and are released (1 mark).
d. i. Neurotransmitters must have a complementary shape to the receptors on the receiving

neuron (1 mark).
ii. As receptors are outside the cell, neurotransmitters must be hydrophilic/lipophobic (1 mark).
Question 2
a.
rRNA Produce ribosomes that are the sight of protein synthesis.
mRNA Are the temporary copy of the DNA that are needed to transfer the code to
outside of the nucleus.
tRNA Bring in a specific amino acid (as the anti-codon joins to the codon) to add to
the polypeptide.
(3 marks)
b. As proteins rarely act in isolation OR The venom is comprised of a number of substances,
therefore many proteins need to be studied (1 mark).
c. This is a tertiary structure,(1) it is a 3 dimensional structure, made of a single polypeptide that

includes secondary structures (1). (2 marks)
Question 3
a. They could produce a protein at certain times in the development of the placenta to stop the
over-replication of other cells (1). This would allow for a normal functioning placenta to deliver
the oxygen and nutrients to the baby (1). (2 marks)
b. Genes that supress rapidly dividing cells, like those that produce tumours in cancer, could
have applications in reducing the cancer (1 mark).
©2017 Ser4BIOU34EA

c.
Structural Regulatory
AND
Structural genes code for the proteins associated with the organisms phenotype (and do not
directly regulate the expression of other genes) (1 mark).
Question 4
a. i.
(1 mark for 2 correct labels)

ii.
Name of stage: Light dependent stage
Give one Input: ADP + Pi OR H2O OR NADP
Give one Output: ATP OR O2 OR NADPH
Role of output ATP: to provide energy for the light independent reactions
(above) O2: released as a product of photosynthesis
NADPH: supplies energy and hydrogen ions for the light independent
reactions.
(1 mark for 2-3 correct boxes, 2 marks for 4 correct boxes)
©2017 Ser4BIOU34EA

b. i. A non-protein substance that is essential for the activity of some enzymes (1 mark).
ii.
Temperature Change Explanation
Increase/
stay the same/
decrease
Decrease Slower movement of enzymes and substrate particles

reduces the amount of collisions.
10°C
Decrease The enzyme may become denatured, changing the

shape of the active site so the enzyme cannot bind to
70°C the substrate.
(1 mark for each correct line)

c. i.
(1 mark)
ii. Kreb’s cycle AND second biochemical pathway of cellular respiration where pyruvate is
broken down and carbon dioxide is produced (1 mark).
©2017 Ser4BIOU34EA

e. Chloroplasts have ribosomes OR chloroplasts have circular molecules of DNA OR

chloroplasts have a double membrane OR chloroplasts divide by a fission like process OR
chloroplasts are similar in size compared to prokaryotic cells (1 mark).
Question 5
a. RNA surrounded by a protein coat (1 mark).
b. Mosquito AND remove water sources from around the home OR use insect repellent OR
mosquito nets for beds OR install flyscreens on windows and doors (1 mark).
c. After exposure to chikungunya antigens, specific antibodies are produced (1 mark) and (B)
memory cells are formed for a rapid response to future infection (1 mark).
d. Interferon AND increases the resistance to viral infection of surrounding cells (1 mark)
OR cytokines AND communication molecules for coordination of immune response (1 mark)
OR Interleukin-1 AND stimulates hypothalamus to increase body temperature (1 mark).
e. An attenuated version of a pathogen (i.e. chikungunya virus) that stimulates and immune
response (1 mark).
f. Arrange two groups with 50 mice of same the species/age/health in each group. Vaccinate
(independent variable) one group and leave the other untreated (control) (1 mark).
Infect both groups with the chikungunya virus. Keep all mice in the same conditions i.e.
temperature and diet (1 mark).
After a period of time, examine both groups for symptoms of chikungunya virus (dependent
variable). If less mice in the vaccinated group show symptoms, the vaccine can be considered
effective (1 mark).
g. The child would NOT have long term immunity as it has not produced its own memory cells (1
mark).
Question 6
a. The genetic diversity/variation was lowered/reduced (1 mark).
b. Mechanism: Founder effect (1). The differences from the founding populations have persisted
even after 10 years eg the founding lizards with longer legs still had longer legs compared to the
other islands after 10 years. (1)
c. Variation exists in a population of lizards with regards to limb length, and a struggle for
survival occurs (1). Selection pressures such as food availability mean that those that have
shorter limbs have a selective advantage (1). Over time, the shorter limbed lizards reproduce
more and there is an accumulation of their genes in the population (1). (3 marks)
©2017 Ser4BIOU34EA

Question 7
a. The thylacine and grey wolf do not share a recent common ancestor but have evolved to show
similarities due to similar selection pressures in their environments (1 mark).
b. Structure: Analogous (1 mark).
Explanation: structure have developed similar functions but have evolved independently as a
result of the same selection pressures (1 mark).
c. i. Potassium-Argon dating, because the fossil is older than 50,000-60,000 years old, therefore
carbon dating in ineffective (1 mark).
ii. Presence of hard parts – more likely to be preserved (1 mark).
OR rapid burial – reduce chance of scavengers (1 mark).
OR low oxygen environment – less microbial decomposition (1 mark).
d. No sightings of living individuals AND no evidence of their existence (1 mark).
Question 8
a.
- By controlling other structural genes that produce proteins that influence gene
expression (1 mark).
- By controlling regulatory genes that code for transcription factors that bind to
promoter regions to induce or repress gene expression (1 mark).
©2017 Ser4BIOU34EA

b.
1 mark for 2 – 3 correct positions, 2 marks for 4 correct.
c. DNA-DNA hybridisation. DNA strands from the species could be heated to dissociate strands,
allowed to cool, and the amount of pairing between species can be used to determine degree of
relatedness (1 mark).
Question 9
a. Modern Homo sapiens and their extinct upright walking ancestors (1 mark).
b. Interbreeding occurred as the human population moved through Asia and encountered the
denisovans. (1) Denisovans did not ever live in Africa or Europe (Only in Asia) (1) (2 marks).
c. Cultural evolution: Writing / Articulate Speech Advantage Humans could have more
sophisticated ways to pass on/record knowledge to successive generations (2 marks).
d. H.erectus was the first species to have left Africa. As Denisovans were found in Russia they
must be a later species (1 mark).
Question 10
a. Gel electrophoresis. (1 mark)
b. Aneuploidy is when the cells (of the baby) have the wrong number of chromosomes AND The
mother would be concerned as it would lead to disorders such as Down syndrome (1 mark).
c. It is less of risk to the baby OR it is less invasive OR less risk of miscarriage (1 mark).
d. Denaturation: Double stranded DNA is heated to 94°C to separate the strands (1).
©2017 Ser4BIOU34EA

Annealing: Cooled to 55°C the primers that are added bind to the separated DNA strands (1).
Extension: The primers are extended as free nucleotides are joined in to complete the
complementary strands (1).
The process is repeated in many cycles to make many copies of the DNA.
NOTE : Mentioning the process being repeated is needed for the awarding of the full 3 marks.
Question 11
a. Is the analysis of the structure of the disease or agent and developing a drug with a specific
shape to treat the disease (1 mark).
b. Sialic Acid (1 mark)
c.
Virus Virus with Relenza
Relenza
Neuraminidase
Virus
(2 marks)
d. Stop flights to Asia OR develop a quarantine for people who have visited that country (1
mark).
e. Epidemics are a rapid spread of influenza over a wide geographic area/across a country,
where as a pandemic is considered a global threat (1 mark).
©2017 Ser4BIOU34EA

Practice Exam - Qats PDF

Diunggah oleh

Informasi Dokumen

Judul Asli

Hak Cipta

Format Tersedia

Bagikan dokumen Ini

Bagikan atau Tanam Dokumen

Opsi Berbagi

Apakah menurut Anda dokumen ini bermanfaat?

Apakah konten ini tidak pantas?

Hak Cipta:

Format Tersedia

Practice Exam - Qats PDF

Diunggah oleh

Hak Cipta:

Format Tersedia

NAME: ____________________________

Reading time: 15 minutes Writing time: 2 hours 30 minutes

Section Number of Questions Number of Questions Number of Marks

Published by QATs. Permission for copying in purchasing school only.

SECTION A - Multiple Choice Questions

Instructions for Section A

An accurate description of the structures in the cell is

A. D is the endoplasmic reticulum and protein synthesis occurs in C.

Published by QATs. Permission for copying in purchasing school only. 2

Published by QATs. Permission for copying in purchasing school only. 3

Published by QATs. Permission for copying in purchasing school only. 4

Questions 10 and 11 refer to the following information.

Published by QATs. Permission for copying in purchasing school only. 5

Questions 12 and 13 refer to the following.

A reasonable explanation for the difference in lines is an increase in the amount of

A. acetic acid in Graph A.

Published by QATs. Permission for copying in purchasing school only. 6

In the absence of cytosol the addition of

A. glucose would result in an increased concentration of pyruvate.

Published by QATs. Permission for copying in purchasing school only. 7

A likely defence the plant would have in response to the bacteria is

A. production of specific antibodies.

Published by QATs. Permission for copying in purchasing school only. 8

A. monocytes and neutrophils.

1. Immunoglobulin E binds to mast cells

Published by QATs. Permission for copying in purchasing school only. 9

Scenario Type of immunity

A. A person has an immune response against Active, natural

B. Injection of diphtheria antitoxin to a Active, passive

C. A child is breastfed by their mother who Induced, Passive

D. A person receives an injection of influenza Induced, Active

Published by QATs. Permission for copying in purchasing school only. 10

Published by QATs. Permission for copying in purchasing school only. 11

Published by QATs. Permission for copying in purchasing school only. 12

Aetiocetus weltoni fossilised skull

From the information given, it is likely that

A. the Aetiocetus weltoni individual shown above had a frameshift mutation.

Published by QATs. Permission for copying in purchasing school only. 13

Published by QATs. Permission for copying in purchasing school only. 14

B. smaller brow ridges.

C. less pronounced muzzle.

D. more vertical forehead.

Questions 36 to 39 refer to the following diagram.

Electrophoresis Gel of Deer Species

Published by QATs. Permission for copying in purchasing school only. 15

Published by QATs. Permission for copying in purchasing school only. 16

SECTION B – Short Answer Questions

Instructions for Section B

b. What is the role of structure labelled i)? 1 mark

Published by QATs. Permission for copying in purchasing school only. 17

Published by QATs. Permission for copying in purchasing school only. 18

Published by QATs. Permission for copying in purchasing school only. 19

Published by QATs. Permission for copying in purchasing school only. 20

Published by QATs. Permission for copying in purchasing school only. 21

Question 4 (10 marks)

Published by QATs. Permission for copying in purchasing school only. 22

Name one Input:

Name one Output:

b. Elysia chlorotica must produce approximately 16 different enzymes to allow it to produce

Published by QATs. Permission for copying in purchasing school only. 23

c. By photosynthesising, Elysia chlorotica is able to produce a high energy containing molecule

Published by QATs. Permission for copying in purchasing school only. 24

Question 5 (10 marks)