See

discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/269397458

The State of Knowledge in Designing Primer of

interest for successful Polymerase Chain
Reaction: A review

Article · November 2014

CITATIONS READS

0 147

1 author:

Dereje Beyene Degefie

Addis Ababa University
7 PUBLICATIONS 8 CITATIONS

SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Molecular biology of cervical cancer: genetic predisposition, HPV subtyping and genome interaction View
project

All content following this page was uploaded by Dereje Beyene Degefie on 31 December 2014.

The user has requested enhancement of the downloaded file.

 Advanced Journal of Biological Sciences Research
Vol. 2(001), pp. 001-012, November, 2014
©2014 Advanced Journals
http://www.advancedjournals.org/AJBSR

Review Paper

The State of Knowledge in Designing Primer of interest for successful

Polymerase Chain Reaction: A review
Dereje Beyene

Department of Microbial, Cellular and Molecular Biology, Addis Ababa University, P O Box 1176, Addis Ababa, Ethiopia.

E-mail: dereje.beyene@aau.edu.et; b.dereje@hotmail.com.

Submitted 16th October, 2014; Accepted 13th November, 2014

Primers design is the bases for most of the molecular biology experiments. It may require fetching similar sequence
from biological databases, multiple align and identifying conserved regions. These needs prior knowledge of the
most common bioinformatics tools as well as the basic features of ‘good’ primers that amplify the target region
which is instrumental for developing diagnostic markers for disease diagnosis (molecular medicine), crop
improvement, GMO’s quarantine; Genetic diversity and any PCR based studies. To know how to design primers is of
paramount advantage to develop and test research ideas that centers molecular biology. The review is intended to
give technical guidelines to design basic and degenerate primers for successful amplification of the region of interest
in complex genome of organisms of interest.

Key words: Allele specific primers, PCR, degenerate primers, oligo-calculators, SNPs.

INTRODUCTION

Polymerase chain reaction (PCR), the revolutionary
technique for DNA research, depends on Taq
polymerase, an enzyme from Themnus aquaticus,
organism that was first isolated from a hot spring in
Yellowstone National Park (Chien et al., 1976) and has
since been found in similar thermal habitats around the
world. PCR is become the state of the art of preferred
approach in advent of molecular biology. The reaction
mix constitutes precursor molecules (deoxyribose
nucleotides; dNTPs), PCR buffer, template DNA, primers
(forward and reverse), DNA polymerase and DNAase free
distilled water. From the components of the reaction
mix, primers play a paramount role in determining
amplicon size and in picking the region of interest in
complex genome. Primers are short piece of DNA or RNA
complementary to a given DNA sequence that acts as a
point at which replication can proceed, as in a
polymerase chain reaction. Some of the techniques that
make use of oligonucleotides as their prime component
are polymerase chain reaction (PCR), hybridization,
Southern blotting, sequencing, etc. Perhaps the most
universal method in use today is PCR, with applications
including amplification, cloning, mutation detection and
mutagenesis. Thus, primers dictate the field of molecular
biology research objectives; they can be used in
identification/isolation of a gene from the complex
genome of an organism (Beyene et al., 2010), DNA figure
print for diversity studies (Simple Sequence Repeats;
SSR, Random Amplified Polymorphic DNA; RAPD,
Amplified Fragment Length Polymorphisms; AFLP and
002 Adv. J. Biol. Sci. Res.
Single Nucleotide Polymorphisms; SNPs). Moreover, they
can be used in disease diagnosis (Reid et al., 2000) and
quarantine of Genetically Modified Organism’s
(Randhawa et al., 2013).
Oligonuclotides are one of the constituent of PCR mix,
the rest components (PCR buffer, DNA polymerase and
precursor molecules; dNTPs) can be bought from
company based on user interest. However, user’s order
primers from companies based on what the researcher
intends to achieve. This suggests that researcher have to
go through the primer design procedure that requires
bioinformatics knowledge and skills. The most critical
step in PCR experiment is designing/choosing competent
oligo-nucleotide primers, poor primers could result in
little or even no PCR product. Alternatively, it could
result in the amplification of many unwanted DNA
fragments. Either way, it would interfere in subsequence
downstream applications such as gene cloning,
sequencing and biomarker. Therefore, it is important
that user have to design their primers of interest
carefully. Primer design requires extensive computer-
based sequence analysis. The basic principles explained
in this review are important to design user’s primer of
interest mainly manually; so far no online support
resources helps users to design primer of interest
manually.
Moreover, there is no review that compiled in
structured, information that will enable user generates
knowledge on how to design and evaluate primers.
Online primer design tools usually have user guides,
publications, and they are also user friendly but lack
detail knowledge on how to design and evaluate
primers. However, this review creates the opportunity
for users’ to integrate their biological thoughts to
optimize the success of their PCR amplification, which is
lacking in primer online tools. The review takes readers
to the landscapes of how a ‘good’ primer is designed and
analyzed interactively. Thus, the objective of this review
is to take early stage researchers through the
bioinformatics skills and knowledge required to design
their own ‘good’ primers.
Criteria Considered in ‘Good’ Primer Design
There is no good primer by definition; the primers you
intend to design have to go through a minimum
examination to attain your research objectives. Good
primer is the primers that amplify the region of interest
in the complex genome specifically. When researchers
design a primer, they examined their primers by the
following basic criteria:
i). Specificity: it infers that the PCR is capable of
amplifying a single target DNA fragment out of a
complex mixture of DNA. This ability depends on the
specificity of the primers. Primers are short single-
stranded oligonucleotides which anneal to template DNA
and serve as a “primer” for DNA synthesis. In order to
achieve the geometric amplification of a DNA fragment,
there must be two primers, one flanking each end of the
target DNA, define the amplicon size. It is essential that
the primers have a sequence that is complementary to
the target DNA. There are two critical issues considered
for specificity a) Primers must be complementary to
flanking sequences of target region and b) primers
should not be complementary to many non-target
regions of genome. This could be checked by similarity
search using Basic Local Alignment Search tools (BLAST)
using primers sequences as query. During this time your
primer should hit the template DNA sequence with 100%
similarity to where the primers was designed; form the
ocean of sequences found in the biological databases.
The in silco analysis mimic the real situation primers
faces during amplification in complex genome, the
outcome is the reflection of the primers specificity. The
researcher may use Primer-BLAST tool to design new
and/or evaluate the specificity of designed primers (Ye
et al., 2012). Primer-BLAST tool is less robust than the
similarity search using BLAST tools direct to databases.
The combination of both methods is strongly
recommended for comprehensive analysis of primers
specificity.
ii) Primer Length: For standard PCR, an oligonucleotide
range of 18-24 nucleotides is ideal. This size is long
enough to be specific to the target region and also short
enough to anneal efficiently (most often the annealing
temperature is between 52 - 65℃). The primer length
determines the annealing temperature, preferably
excluded if it is less than 50℃ (Chen et al., 2003). If you
make the primers too short for instance 10 nucleotide
long (RAPD, primers are often decamer long), their
annealing temperature most often is between 36 - 40℃
which compromise the reproducibility and the specificity
PCR product (Liu and Cordes, 2004); this is one of the
paramount problem in using too short primer. Thus,

users have to avoid designing too short primers to
amplify region of interest where the annealing
temperature is dictated by GC content and primer
length.
iii) Melting temperature: The melting temperature Tm is
the temperature at which one-half of a particular DNA
duplex will dissociate and become single strand DNA.
The stability of a primer-template DNA duplex can be
measured by its Tm. Primers with melting temperatures
in the range of 52-60°C generally produce better results
than primers with lower melting temperatures, that is,
annealing temperature. Primers with Tm lower than 50℃
are excluded; the acceptable Tm difference between
primer pairs is within 5℃ (Chen et al., 2003). The melting
temperature of a nucleic acid duplex is directly
proportional to the length and GC content. Primer Tm is
calculated using the following equation (Freier et al.,
1986):
675
Tm(℃) = 59.9 + (0.41 X GC content) –
Primer length
The actual (Tm) is influenced by the concentration of
Mg2+, K+, and co-solvents; the predicted value is an
approximation and bases to start with PCR optimization.
There are numerous computer programs which assist in
primer design. The formula given above for (Tm) can be
used to calculate Tm of primers of interest. However,
there are many primer design programs which use more
complex nearest-neighbor thermodynamics values for
prediction (Kibbe, 2007).
iv) Product Size: The choice of primers determines the
size of the PCR product. If two primers are complemen-
tary to the nearby regions on the template DNA, then a
small fragment of DNA will be amplified, whereas
complementary to regions farther apart, a larger
fragment of DNA will be amplified.
Taq polymerase can easily amplify fragment length
ranging from 1000 bp to 2000 bp, adds 1000 bp per
minute. For standard PCR, the primers should be
complementary to regions on the target DNA within
1000 bp far apart from each other otherwise larger
regions could be precisely amplified by primer walking.
The predetermined amplicon size creates the oppor-
tunity to isolate your region of interest using gel-
electrophoresis (Figure 1).
Dereje 003
1000
500
400
300
About 300 bp
PCR product
200
100
Primer Dimer (PD)
Figure 1 The PCR amplicon determination in reference
to 100 bp DNA ladder and lane 1 has both the
expected PCR product and Primer Dimer.
v) Primer Dimer (PD): Primers can also participate in
intermolecular and/or intramolecular base pairings
instead of target region; could be amplified by DNA
polymerase and become PCR by-product called a Primer
Dimer (PD) (Figure 2). As its name implies, a PD consists
of primer molecules that have attached (hybridized) to
each other because of strings of complementary bases in
the primers (Figure 2). Consequently, the DNA
polymerase amplifies the PD, leading to competition for
PCR reagents, this potentially inhibits amplification of
the DNA sequence targeted for PCR amplification or
limits the amplicon amount. If the experiment was
designed to conduct a gene expression study, the PD
should be avoided by troubleshooting otherwise there is
no way to interpret the outcome scientifically. In Real
Time PCR, it is detected by the melting curve analysis, if
it gives two peaks. The base pairing is between the
forward and the reverse primer; it is called hetero-dimer
formation. If the base pairing is between just one of the
two primers it is called self-dimer/homo-dimer
formation. Primers that has palindromic region could
form hairpin structure and result in PD formation where,
the 3’ end initiate DNA polymerization and the 5-
overhang used as template (Figure 2, panel B).
vi) G/C Content: Good primer GC content ranges
between 40-60% that ensures stable binding between
the primer and the template DNA. It is calculated as
percentage ratio of number of G and C nucleotides and
the entire nucleotides. The equation for %GC is:
G+ C
%GC = X 100
A+T+G+C
004 Adv. J. Biol. Sci. Res.

Step I A): the primers are attached in their 3’ end Step I-B) : The primer froms
secondary (hairpin) structure
5’ 3’
5’ ATTAGCC ATCGT
3’ 5’
Step II-A) : the primers are elongated by DNA pol 3’TAGCT

5’ 3’
3’ 5’ Step II-B) : the primer is longated

Step III- A) : in the following cycle the elongated

3’ TAATCGG TAGCT
5’ ATTAGCC ATCGT
primere binds its complementary primer with
high affinity

5’ 3’
3’ 5’
5’ 3’
3’ 5’

A) Intra and/or inter molecular base pairing B) Hairpin structure inter

molecular base pairing

Figure 2. Primer Dimer formation panel A) homo-dimer (the base pairing of the forward or reverse primers) or
hetero dimer (the base pairing of the forward and reverse primers), panel B) it is self PD, PD formed from
palindromic region that can initiate the formation of hair pin structure.
Key:
: Primers, the arrow indicates the elongation side
: DNA elongated from the 3’ end of the primer
////: Hydrogen bond between the complementary bases

vii) G/C clamp: it refers to having G or C in row utmost
three nucleotide long at the 3’ terminal of primers. The
GC base pairs are more stable than AT base pairs. Thus,
it results in a stable base pairing between the 3’ end of a
primer and the target DNA; it is a base for kickoff
amplification irrespective of the 5’ ends either matching
or an overhang does not affect the PCR outcome. This
ensures the stable interaction between the 3’end of
primer and the annealing region of the template;
primers are often designed ending in either a G and/or C
at their 3’ end. The stable 3’ end in primer template
duplex will improve the polymerization efficiency (Buck
et al., 1999).
Most good primer criteria could be summarized and
specificity checked in by inbuilt BLAST search using
online tools such as Oligo calculator, available at
http://www.basic.northwestern.edu/biotools/oligocalc.h
tml. It is a reliable bioinformatics tool (Kibbe, 2007), the
screen shoot of the tool is as shown in Figure 3.
WHERE DO I GET QUERY DNA SEQUENCE OF GENE OF
INTEREST?
One challenge for earlier stage researcher is, where can I
get gene sequence of interest. This is not a simple
question but it needs bioinformatics knowledge and
skills. It is also a primary information required to design
a primer; the sequence will be retrieved by searching
biological databases such as National Center for
Biotechnology Information; NCBI
(http://www.ncbi.nlm.nih.gov/genbank/), European
Nucleotide Archive; ENA (http://www.ebi.ac.uk/ena/)
and DNA Databank of Japan; DDBJ
(http://www.ddbj.nig.ac.jp/). They are interlinked by
International Nucleotide Sequence Data Base
Collaboration; INDSC (http://www.insdc.org/). The
deposited sequences can be accessed in any of the three
databases while working in one of them. Information will
be sourced from literatures for instance gene ID then the

Pest the primer sequence (3’->5’) here
Reverese complementary region is automatically generated
Click
Figure 3. Online oligo-nucleotide calculator entry and main calculator screen shoot of ligoCalc.
sequence of interest would be retrieved from biological
databases. After the collection of sequence of interest;
user may be interested to retrieve other most similar
sequences to the gene of interest using Basic Local
Alignment Search Tool; BLAST (Table 1).
ANALYZING THE SEQUENCE OF GENE OF INTEREST
The analysis of gene of interest is the primary activity
before starting a primer design. The analysis frame work
proposed (Figure 4) is useful to retrieve sequence and
analyze before design and also useful for annotating
genes. The frame work enable you to answer most of the
questions such as: where do I get my sequence of
interest?, How do I identify conserved regions?, what to
do after gettng the sequence of my interest (annotation
pipe line)?, and what are the possible implications of the
different bioinformatics tools during sequence analysis?;
these are some of the questions raised which could be
Dereje 005
output
answered by the analysis frame work.
The Sequence Analysis frame work includes Multiple
alignment tools, this provides the best matches for the
selected BLAST most similarity outputs, so that the
conserved and mismatches (mutations) regions can be
identified. Conserved regions across species may be
implicates the region is conserved across species due to
evolutionary significance. Thus, targeting these regions
for designing primers will increase the primer specificity.
BoxShade (multiple alignment designers program;
http://au.expasy.org/tools/sim-prot.html) input is an
output of either T-coffee or Clustal W and then
differentially shade the conserved and mismatch
regions; this could assist in identification of conserved
regions and pin point the possible primer design sites.
Other programs for sequence alignment include Clustal
W, MAP, MAFFT for DNA or proteins, and PIMA and SIM
for protein only (Thompson et al., 1998; Katoh et al.,
2002). Moreover, these tools are important to infer
functional and evolutionary information from well
006 Adv. J. Biol. Sci. Res.

Table 1. List of few bioinformatics tools and their uses during primer design.

Some Bioinformatics tools and their websites Their uses

Nucleotide/gene sequence search engine
http://www.ncbi.nlm.nih.gov/nuccore/
Search Nucleotide database which is a collection of sequences
from several sources, including GenBank, Reference sequence
(RefSeq), and Protein Database (PDB). Genome, gene and
transcript sequence data provide the foundation for biomedical
research and discovery.
The objective is to retrieve the sequence of your gene of interest

BLASTn Search a nucleotide database using a nucleotide query or Gene ID

http://www.ncbi.nlm.nih.gov/ or accession number.
The objective is to identify and retrieve the most similar DNA
sequences to gene of interest.

BLASTp Search protein database using a protein query.

http://www.ncbi.nlm.nih.gov/ The objective is to identify and retrieve the most similar protein
sequences for gene of interest

Multiple alignment tools
i. T-Coffee http://www.ebi.ac.uk/Tools/msa/tcoffee/
ii. Muscle
http://www.bioinformatics.nl/tools/muscle.html
To align DNA/Protein sequences of the most similar genes (often
retrieved by BLASTn/BLASTp search outputs).
The objective is to identify the most conserved regions across
different species or similar gene sequences. This gives hint about
the conserved regions across different taxonomic groups and
where to anchor primers and also to know the amplicon size.

Browsing sequence of interest

Where do users search? Biological databases such as Genebank, ENA and DDBJ using
keywords such as Sequence query or Gene ID, Accession number or gene name

Nucleotide Sequence project

Nucelotide Sequence Managment
Analysis Schem Protein Sequence
Analysis Schem
Nucelotide Sequence File

Search databses for Search for Protein coding

similar sequences regions; Opend Reading Coding
(BLASTN) Frmae (ORF) prediction
Protein
Translate into
Protein Sequence File
Design fursther experiments:
•Restriction Mapping
•PCR planning Non-Coding
Search databses for
similar sequences Search for Predicte
Search for Known (BLASTp) Known motifs secondary
motifs and tertiary
Sequence comparisons
structure
Sequence comparisons

Sequence Multiple alignment Format the alignment or Feed the

out put for Multiple alignmnet
Degenerate/Basic designer (BoxShade)
Primer design Multiple Align using Programes

Molecular Phyolgent Protein Family Analysis

Figure 4. Conceptual Sequence Analysis frame work using biological databases as source of DNA and protein sequences
and bioinformatics tools.
 Dereje 007

ATGAGAGCCCTGGGAGCTGTTGTTGCCCTCCTGTTCTGGGGGCAGCTTTTCGCAGTGGAGACTGGCAATG
>>>>>>>>>
AGGCCACGGATAACACAGAGGTCAGCCTTCCAAAGCCCCCAGAGATTGAGAATGGCTATGCGGAGCACTT
>>>>>>>>>>>
TGTTCGCTACCAGTGTAATCCCCTCTATAAACTGCGCACCGAAGGAGACGGAGAGTATACATTAAACAGT
GAGAAGCACTGGACAAACAAGGCCATTGGAGAGAAACTTCCCGAATGTGAAGCAGTGTGCGGAAAGCCCA
AGAACCCGGTGGACCAGGTGCAGCGGATCATGGGTGGATCAGTGGATGCCAAAGGCAGCTTTCCCTGGCA
GGCTAAGATGGTCTCCCACCATAATCTCACCTCGGGGGCCACACTGATCAGTGAACAGTGGCTGTTGACC
ACGGCTAAAAATCTCTTCCTGGGCCATAAAGATGATGCAAAAGCAAAAGACATTGCCCCAACTTTGAAAC
TCTATGTGGGGAAAAATCAGCCTGTGGAGATTGAGAAGGTGGTTCTCCACCCTAACTACTCCAACGTAGA
CATCGGACTCATCAAACTCAAACAGAAGGTGCCCATTGATGAGAGAGTAATGCCCATCTGTCTACCTTCA
AAAGATTATGCAGAAGTGGGGCGTGTGGGCTATGTGTCTGGATGGGGGCGAAATACCAACTTTAATTTCA
<<<<<<<<<<<<<<<<<<<<
CTGAGCTACTGAAGTACGTCATGCTGCCTGTGGCTGATCAAGAGAATTGTGTGAAGCACTACGAAGGCAG

Figure 5 The Felies Cattus hepaltglobin (HP) mRNA with accession number NM_001198928.1
used to design a primer manually; …>>> indicate the forward primer and <<<…the reveres primer
anchoring sites, respectively. The amplicon is 600bp long.

designed quires and alignments. The programs are
openly accessible for academic use.
MANUAL DESIGN OF BASIC AND DEGENERATE PRIMERS
Basic Primer Design
Basic primer refers to primer that does not count to
accommodate point mutations; it is only consist of one
type forward and reverse primers in the PCR reaction
mix. These primers are usually used to amplify a known
gene sequence from genomes or total RNAs extracts. It
can be designed manually without using primer
designing bioinformatics tools such as primer3
(biotools.umassmed.-edu/bioapps/primer3_www.cgi).
At the moment of manual design the properties of a
good primers has to be calculated either using oligo
nucleotide calculators software’s or manually. For
instance; retrieve your gene sequence of interest from
biological databases, identify your region of interest
where the forward/sense primer and the reverse/anti-
sense primer (it is the exact copy of the anti-sense
strand) anchors within the distance range of amplicon
size of interest. Determination of the amplicon size is
very important because isolation of the amplicon of
interest depends on gel electrophoresis. The primers
should have comparable size; and G-C% difference
should not exceeds 5% and also satisfy the good
properties of primers (Figure 5).
The properties of both primers are summarized in
Table 2. If user calculates the properties of the forward
primer using Oligo Cal., will get default output track
(Figure 6). The second click on the self-complemen-
tarities checking confirmed that there is no hairpin
formation. Thus, it is less likely that the PCR product
forms primer dimer. There are other cases that could
contribute to PD formation such as less template or high
primers concentrations, this can be overcome through
troubleshooting. The specificity of primers would be
checked by clicking on BLAST button of the Oligo cal. It is
linked with Genebank database or user may go to NCBI
and do BLASTN. This implicates the forward primer hit
user gene of interest (accession number
NM_001198928.1) with 100% similarity. The in silco
analysis mimics the real situation which happens in the
organism complex genome, the genome constitute of
thousands of genic and non-genic regions, where the
primer of interest should amplify the region of interest.
The positive outcome of the BLAST 100% similarity hit to
the query sequence; confirms the designed primer is too
specific to the target region. The same evaluation should
be done for reverse primer as well.
Basic Primers spans Exons
The estimation of PCR amplicon size is fundamental for
fragment isolation using gel-electrophoresis, when it
comes to genomic DNA (gDNA) cloning of eukaryotic
genes; it poses an actual problem if primers design was
based on query cDNA sequences. This is because
eukaryotic genes are split where exons are interspersed
by introns. The actual amplicon size estimation is based
008 Adv. J. Biol. Sci. Res.

Table 2. Summary of the manual primers properties.

Oligo Length Tm GC% Sequence (5’->3’)

Forward 20 59.8 55 GGAGCACTTTGTTCGCTACC
Reverse 20 59.9 55 CACAGGCAGCATGACGTACT

1 Click

output

2
Figure 6. The screen shot of Oligo Calc. forward primer outputs.

on cDNA sequence whereas in the work involving
genome cloning, the size is far larger than the expected
size. At this time users have to align gDNA and cDNA
sequences together and identify the exons and introns
boarders and predict the gene model; to conduct the
prediction manually or using alignment tools (Table 1)
are not useful, this is because the multiple alignment
tools were not developed to predict the exon and intron
junction and align them accordingly.
Therefore, bioinformatics tools developed to predict
the intron-exon splicing junction and propose a gene
model are useful. Splign tool
(http://www.ncbi.nlm.nih.gov/sutils/splign/splign.cgi) is
one of the tools that predict the gene model by
computing cDNA to gDNA alignment of the gene of
interest (Kapstin et al., 2008). The coding regions (exons)
are highly conserved than non-coding regions (Introns)
(Schork et al., 2000). This suggests that it is good to
design primers anchored onto exons than introns while
gDNA cloning. Single Nucleotide Polymorphisms (SNPs)
are the third generation DNA based marker of choice
which has wider application. SNPs study involves the
cloning of genomic DNA by designing primers. There is a
general scenario that SNPs occurs much less frequently
in coding regions of the genome than noncoding regions,
with most SNPs being located at noncoding regions
(Schork et al., 2000; Beyene et al., 2013). This gives you
the confidence that if you target your primer design onto
exons; it is less likely that mutation at 3’end of your
primer of interest will result in no amplification or
irreproducible PCR amplification (it will amplify in some
groups and null in others). In addition, designing primers
spanning exons is also important to overcome gDNA
contamination during gene expression studies using Real
 Dereje 009

A) Primers straddles an intron B) Primers flank an intron

Intron

RT-PCR
A1) reaction RT-PCR reaction
With genomic DNA
contamination
No amplicon is formed
Large amplicon is Small amplicon is
formed formed

RT-PCR
A2)
reaction

Amplicon is formed

Figure 7. Primers spanning and exons or straddled an introns, the boxes indicate exons, lines for introns and arrows for primers
annealing sites and direction of amplification. Panel A) primers were designed A1: the 3’end is from intron, it doesn’t amplify
the target region during RT-PCR but it could amplify during gDNA cloning; A2: the 3’end is on the exon, it amplify during RT-PCR
and gDNA cloning and Panel B) Primers designed flanking introns and only cDNA syntheiszed from a spliced mRNA would
efficiently produces a PCR product of expected size whereas if there is genomic DNA contamination two amplicons one large
(genomic) and smaller expected produced (cDNA).

Time PCR (Fraga et al., 2008). If there is genomic DNA
contamination the RT-PCR product would have two
fragments, one large (with intron) and small sizes (exons
only) (Figure 7).
Degenerate Primer Design
The basic primer design does not often intend to use
conserved regions across similar gene sequences. This
could questions the reproducibility of the PCR reaction
because primers selected may have mismatch at 3’ends
in some genotypes/populations. It is also sometimes rare
to design a basic primer that can universally amplify the
region of interest. The limitations of using basic primers
are: i) does not accommodate point mutations, ii) may
not be designed from multiple aligned most conserved
regions of protein/nucleotide sequences and iii) does not
provide a clue if the primer designed region is conserved
across species or within species. The other alternative is
to capture all; it is advised that when designing a
degenerate primer, it addresses the aforementioned
issues. A degenerate primer is defined as “a mix of
primers in which some positions contain a number of
possible bases, giving a population of oligo-nucleotide
sequences with different sequences that cover all
possible nucleotide combinations for a given nucleotide/
protein sequence”. It is in fact a mixture of unique
primers. For example, AACK{G,T}GV{A,C,G}G is a 7 base
pair long degenerate primer, in which the fourth (K) and
sixth (V) positions are degenerate; six species of primer
mix exist. These primers can be used in PCR reactions to
amplify many related sequences from genomic DNA
and/or total RNA extracts. They can be used when the
gene of interest sequence is unknown or known only in a
related species (Beyene et al., 2010) or when interested
to develop a universal primer from conserved regions for
phylogenetics (White et al., 1990), identification of genes
(Beyene et al., 2010) and disease diagnosis (Brown and
Wyatt, 1996). Thus, degenerate bases are very useful
tool when the DNA sequence of gene of interest is not
available but known in other related species or
populations of the same species. Thus sequence from
one species is the basis for amplification of a
homologous region or gene in another species. For
situations likes these, degenerate provide more
flexibility than basic primers in their specificity in order
to amplify a genomic region of interest. The guideline
010 Adv. J. Biol. Sci. Res.

Table 3. International Union of Pure and Applied Chemistry (IUPAC) system nomenclatures
degenerate nucleotide bases.

Code Nucleotide/s Explanation for denomination*

R A or G PuRine
Y C or T PYrimidine
M A or C AMino
K G or T Keto
S C or G Strong interaction
W A or T Weak interaction
H A or C or T Not G, H follows G in alphabet
B C or G or T Not A, B follows A in alphabet
V A or C or G Not T/U, V follows U in alphabet
D A or G or T Not C, D follows C in alphabet
N A or T or G or C ANy
* Abbreviations (the first column; ‘Code’) capitalized and bolded

on how to start designing degenerate primers either = 2, N (A or T or C, or G) = 4), S (G or C) = 2, and Y (C or T)

from DNA or protein query sequences is:
i) Retrieve the sequence of your gene of interest either
protein or nucleotide sequences from biological
databases
ii) Fetch the most similar sequence to the query of gene
interest using BLASTN (similar nucleotide
sequences)/BLASTP (similar protein sequences) from
biological databases
iii) Multiple align the most similar sequences collected
from the biological databases using multiple alignment
bioinformatics tools (Table 1)
iv)Identify the most conserved region within the range of
user expected amplicon size
v) Positioned forward and reverse primers at strongly
conserved regions that is, anchor the primers on sites
less degenerate and the further apart
vi) May encounter few mismatches that could pose a
challenge, which nucleotides user will prefer. At this
moment user may consult the standard ambiguous
IUPAC nucleotide nomenclature (Table 3).
vii) To avoid degeneracy at the 3’ terminus primer, the
specificity of the primer of interest is dependant mainly
at the 3’ end. This has a paramount advantage for primer
specificity.
viii) If there is a high degeneracy at primers of interest, it
can be dichotomized to reduce the level of degeneracy.
For instance degenerate primer ATG CKN KST CCG NCA
ATG Y (level of degeneracy depends on the product of
each ambiguous codons stands for nucleotides K (G or T)
= 2. The level of degeneracy is the product of the
number of nucleotides represented by the ambiguous
codons that is, 2 X 4 X 2 X 2 X 4 X 2 = 256. This indicates
that there are 256 species of primer mixes exist in the
designed degenerate primer. The level of the
degeneracy can be reduced into half by breaking one of
the ambiguous codon for instance N into R (A or G) and
Y (C or T). Then the above degenerate primer
dichotomized into ATG CKN KST CCG RCA ATG Y and ATG
CKN KST CCG YCA ATG Y where the observed mismatch
is now captured by two primers.
WEB BASED BASIC AND DEGENERATE PRIMERS
DESIGN/ ONLINE TOOLS FOR PRIMER DESIGNS
There are several web-based services or stand-alone
software provided to the public for designing basic
primer (Abd-Elsalam, 2003). Users can redefine or work
on the default track parameters designed pairs of
primers from the query sequence. However, most of
them only take a single sequence query in Fasta format
or gene ID/accession number. Like in basic primer
design, there are a number of online and/or
downloadable programs available to aid degenerate
primer designing. Based on user input sequence, the
software will generate the minimum number of
degenerate primers while maintaining optimal PCR
requirements. Some commonly used programs to try
out are presented in Table 4.

Table 4. Some Bioinformatics tools available online for academic uses.
Designing Tools
Basic primer
I. PRIDE PRIMER
II. Primer3
III. Primer Design Assistant (PDA)
Degenerate Primers
I. Consensus-Degenerate Hybrid
Oligonucleotide Primers (iCODEHOP)
II. Highly Degenerate primers (HYDEN)
III. DePict (V2.0) web interface
CONCLUSIONS
Primers are the bases for any PCR based reaction; they
are useful for gene cloning, sequencing, genetic testing,
diversity and phylogenetic studies, crop improvement,
disease diagnosis, pharmacogenomics etc. The design
requires prior knowledge of the template DNA
sequence; this demands basic bioinformatics knowledge
such as the biological databases, how to retrieve DNA
and/or protein sequences and how to use bioinformatics
tools.
Identifying conserved regions among similar genes
sequences (outputs of BLAST similarity search) collected
across species using multiple alignment tools gives clue
that the regions are conserved in the species of interest.
Moreover, these tools are important to infer functional
and evolutionary information from well designed quires
and alignments. So that, primers designed from
conserved regions have higher chance to amplify the
region of interest specifically. The user has to keep in
mind that primers are the cheapest component of PCR
mixes.
Users have to design and order multiple of primer sets
at once; this will increase the success chance and also
save time and resources. This is because if the first set
doesn’t work, the user should try another set of primers.
In addition, user can combine the forward and reverse
primers of different sets, if they do have compatible
annealing temperature. Primers are the principal
components of the any PCR reaction which is highly
dependent on the user need. Thus, knowing how to
design primers by scientifically analyzing DNA/protein
sequences will increase the competence of the
researchers in the field of molecular biology.
Dereje 011
Available at
http://pride.molgen.mpg.de/pride.html
http://biotools.umassmed.edu/bioapps/primer3_www.cgi
http://dbb.nhri.org.tw/primer/index.html
http://blocks.fhcrc.org/codehop.html
http://acgt.cs.tau.ac.il/hyden/
http://users.cis.fiu.edu/~giri/bioinf/DePiCt1.0/WebVersion/2depict.htm
ACKNOWLEDGMENTS
I am grateful for the Addis Ababa University, Department
of Microbial, Cellular and Molecular Biology for initiation
and support for the reviewing article. I am grateful also
to Dr. Mesfin Tafess (Addis Ababa Science and
Technology University) for his critical review and
suggestion during the preparation.
REFERENCES
Abd-Elsalam KA (2003). Bioinformatics tools and
guideline for PCR primer design. Afr. J. Biotechnol.,
2:91-95.
Beyene D, Mukasa, SB, Jansson C, Villiers EP, Ferguson
M, Rabbi IY, Kyamanywa S, Sebuliba J, Baguma Y
(2013). Patterns of nucleotide diversity in Meisa1 and
G3pdh in wild and cultivated cassava. SINET: Ethiop. J.
Sci., 36(2):65–72.
Brown KJ, Wyatt SD (1996). Detection of sub group III
Geminivirus isolates in leaf extracts by degenerate
primers and polymerase reaction. Phytopathology,
86:1288-1293.
Buck GA, Fox JW, Gunthorpe M, Hager KM, Naeve CW,
Pon RT, Adams PS, Rush J (1999). Design strategies and
performance of custom DNA sequencing primers.
Biotechniques, 27:528-536.
Chen SH, Lin CY, Cho CS, Lo CZ, Hsiung CA (2003). Primer
Design Assistant (PDA): a web-based primer design
tool. Nucleic Acids Res., 31: 3751–3754.
Chien L, Edgar DB, Trela JM (1976). Deoxyribonucleic
012 Adv. J. Biol. Sci. Res.

Acid Polymerase from the Extreme Thermophile Schork NJ, Fallin D, Lanchbury JS (2000). Single
Thermus aquaticus. J. Bacteriol., 127: 1550-1557. nucleotide polymorphisms and the future of genetic
Freier SM, Kierzek R, Jaeger JA, Sugimoto N, Catuthers epidemiology. Clin. Gene.,, 58: 259-264.
MH, Neilson T, Turner DH (1986). Improved free- Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F,
energy parameters for predictions for RNA duplex Higgins DG (1998). The ClustalX window interface:
stability. Proc. Natl. Acad. Sci. USA, 83:9373-9377. flexible strategies for multiple sequence alignment
Fraga D, Meulia T, Fenster S (2008). Real-Time PCR. aided by quality analysis tools. Nucleic Acids Res.,
Current Protocols Essential Techniques, 10.3.1-10.3.34. 27:4876-4882.
Kapstin Y, Souvorov A, Tatusova T, Lipman D (2008). Ye J, Coulouris G, Zaretskaya I, Ioana Cutcutache I, Rozen
Splign: algorithms for computing spliced alignments S, Madden TL (2012). Primer-BLAST: A tool to design
with identification of paralogs. Biology Direct, 3:20 target-specific primers for polymerase chain reaction.
doi:10.1186/1745-6150-3-20. BMC Bioinformatics, 2012, 13:134.
Katoh K, Misawa K, Kuma K, Mityata T. (2002). MAFFT: a
novel method for rapid multiple sequence alignment
based on fast Fourier transform. Nucleic Acids Res.,
30: 3059-3066.
Kibbe WA (2007). OligoCalc: an online oligonucleotide
properties calculator. Nucleic Acids Research 35:
webserver issue, W43–W46.
Liu ZJ, Cordes JF (2004). DNA marker technologies and
their applications in aquaculture genetics.
Aquaculture, 238: 1–37.
Reid SM, Ferris NP, Hutchings GH, Samuel AR, Knowles
NJ (2000). Primary diagnosis of foot-and-mouth
disease by reveres transcription polymerase chain
reaction. J. Virol. Methods, 89:167-176.
Randhawa GJ, Singh M, Morisset D, Sood P, Zel J (2013).
Loop-mediated isothermal amplification: rapid visula
and real time method for detection of genetically
modified crops. J. Agric. Food Chem., 61: 11338-11346.

View publication stats