Advanced Oxidation Processes For Waste Water Treatment

International Journal of Photoenergy
Advanced Oxidation
Processes for Wastewater
Treatment 2013
Guest Editors: Meenakshisundaram Swaminathan,
Muruganandham Manickavachagam, and Mika Sillanpaa
Advanced Oxidation Processes for
Wastewater Treatment 2013
Advanced Oxidation Processes for

Wastewater Treatment 2013
Guest Editors: Meenakshisundaram Swaminathan,

Copyright © 2014 Hindawi Publishing Corporation. All rights reserved.
This is a special issue published in “International Journal of Photoenergy.” All articles are open access articles distributed under the
Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the
original work is properly cited.
Editorial Board
M. Abdel-Mottaleb, Egypt Shahed Khan, USA L. Schmidt-Mende, Germany
Nihal Ahmad, USA Cooper H. Langford, Canada P. Smirniotis, USA
N. Alonso-Vante, France Yuexiang Li, China Zofia Stasicka, Poland
Wayne A. Anderson, USA Stefan Lis, Poland Juliusz Sworakowski, Poland
Vincenzo Augugliaro, Italy Niyaz M. Mahmoodi, Iran Nobuyuki Tamaoki, Japan
D. W. Bahnemann, Germany D. Mantzavinos, Greece Gopal N. Tiwari, India
M. A. Behnajady, Iran Ugo Mazzucato, Italy N. V. Tkachenko, Finland
Ignazio R. Bellobono, Italy Jacek Miller, Poland Veronica Vaida, USA
Raghu N. Bhattacharya, USA Jarugu N. Moorthy, India Roel van De Krol, Germany
Pramod H. Borse, India Franca Morazzoni, Italy M. van Der Auweraer, Belgium
G. Calzaferri, Switzerland F. Morlet-Savary, France Ezequiel Wolcan, Argentina
Adriana G. Casas, Argentina E. B. Namdas, Australia Man Shing Wong, Hong Kong
Wonyong Choi, Korea M. da Graça Neves, Portugal David Worrall, UK
Vra Cimrova, Czech Republic Leonidas Palilis, Greece F. Yakuphanoglu, Turkey
Vikram Dalal, USA Leonardo Palmisano, Italy Minjoong Yoon, Korea
D. (Dion) D. Dionysiou, USA Ravindra K. Pandey, USA Hongtao Yu, USA
Mahmoud M. El-Nahass, Egypt D. Lee Phillips, Hong Kong Jimmy C. Yu, Hong Kong
Ahmed Ennaoui, Germany Pierre Pichat, France Jun-Ho Yum, Switzerland
Chris Ferekides, USA Gianluca Li Puma, UK K. Zachariasse, Germany
Beverley Glass, Australia Xie Quan, China Lizhi Zhang, China
Shinya Higashimoto, Japan Tijana Rajh, USA Jincai Zhao, China
Yadong Jiang, China Peter Robertson, UK
Chun-Sheng Jiang, USA Avigdor Scherz, Israel
Contents
Advanced Oxidation Processes for Wastewater Treatment 2013, Meenakshisundaram Swaminathan,
Volume 2014, Article ID 682767, 2 pages
Synthesis and Characterization of Cerium Doped Titanium Catalyst for the Degradation of
Nitrobenzene Using Visible Light, Padmini Ellappan and Lima Rose Miranda
Function of TiO2 Lattice Defects toward Photocatalytic Processes: View of Electronic Driven Force,
Huanan Cui, Hong Liu, Jianying Shi, and Chuan Wang
Adsorption and Photocatalytic Decomposition of the 𝛽-Blocker Metoprolol in Aqueous Titanium

Dioxide Suspensions: Kinetics, Intermediates, and Degradation Pathways, Violette Romero, Pilar Marco,
Jaime Giménez, and Santiago Esplugas
Solar Photo-Fenton Degradation of Electro-Optical Industry Wastewater by a Pilot-Scale Fresnel Lens

Assisted IPCC Reactor, Wen-Shiuh Kuo, Dong-Yun Liu, and Chin-Fang Juang
Renovation and Reuse of Reactive Dyeing Effluent by a Novel Heterogeneous Fenton System Based on
Metal Modified PTFE Fibrous Catalyst/H2 O2 , Bing Li,
Yongchun Dong, Zhizhong Ding, Yiming Xu, and Chi Zou
Application of Ozone Related Processes to Mineralize Tetramethyl Ammonium Hydroxide in Aqueous

Solution, Chyow-San Chiou, Kai-Jen Chuang, Ya-Fen Lin, Hua-Wei Chen, and Chih-Ming Ma
Removal of Textile Dyes from Aqueous Solution by Heterogeneous Photo-Fenton Reaction Using
Modified PAN Nanofiber Fe Complex as Catalyst, Xueting Zhao, Yongchun Dong, Bowen Cheng,
and Weimin Kang
Ozonation of Indigo Carmine Catalyzed with Fe-Pillared Clay, Miriam Bernal, Rubı́ Romero,
Gabriela Roa, Carlos Barrera-Dı́az, Teresa Torres-Blancas, and Reyna Natividad
Ultrasonic Degradation of Fuchsin Basic in Aqueous Solution: Effects of Operating Parameters and
Additives, Rui-Jia Lan, Ji-Tai Li, and Bao-Hua Chen
Treatment of Effluent from a Factory of Paints Using Solar Photo-Fenton Process, Alam Gustavo Trovó,
Oswaldo Gomes Jr., and Antonio Eduardo da Hora Machado
Power Generation Enhancement by Utilizing Plant Photosynthate in Microbial Fuel Cell Coupled
Constructed Wetland System, Shentan Liu, Hailiang Song, Xianning Li, and Fei Yang
Kinetics and Photodegradation Study of Aqueous Methyl tert-Butyl Ether Using Zinc Oxide: The Effect
of Particle Size, Zaki S. Seddigi, Saleh A. Ahmed, Shahid P. Ansari, Ekram Danish, Abdullah Abu Alkibash,
and Shakeel Ahmed
A Novel Solar Driven Photocatalyst: Well-Aligned Anodic WO3 Nanotubes, Chin Wei Lai,
Sharifah Bee Abd Hamid, and Srimala Sreekantan
Synthesis of Nitrogen-Doped ZnS with Camellia Brushfield Yellow Nanostructures for Enhanced
Photocatalytic Activity under Visible Light Irradiation, Gang-Juan Lee, Chi-Lun Hong,
Valentina Batalova, Gennady Mokrousov, and Jerry Wu
Multifunctional Chitosan-Copper Oxide Hybrid Material: Photocatalytic and Antibacterial Activities,

Yuvaraj Haldorai and Jae-Jin Shim
Photocatalytic Decolourization of Direct Yellow 9 on Titanium and Zinc Oxides, Elżbieta Regulska,
Diana Małgorzata Bruś, and Joanna Karpińska
Removal of Polyvinyl Alcohol Using Photoelectrochemical Oxidation Processes Based on Hydrogen

Peroxide Electrogeneration, Kai-Yu Huang, Chih-Ta Wang, Wei-Lung Chou, and Chi-Min Shu
Catalytic Activity of Porous Phosphate Heterostructures-Fe towards Reactive Black 5 Degradation,

Marco S. Lucas, Manuel Algarra, José Jiménez-Jiménez, Enrique Rodrı́guez-Castellón, and José A. Peres
Hindawi Publishing Corporation
http://dx.doi.org/10.1155/2014/682767
Editorial
Advanced Oxidation Processes for Wastewater Treatment 2013
Meenakshisundaram Swaminathan,1 Muruganandham Manickavachagam,2

and Mika Sillanpaa3
1
Department of Chemistry, Annamalai University, Annamalainagar 608002, India
2
Water and Environmental Technology (WET) Center, College of Engineering, Temple University, Philadelphia, PA 19122, USA
3
Laboratory of Green Chemistry, Faculty of Technology, Lappeenranta University of Technology, 50130 Mikkeli, Finland
Correspondence should be addressed to Meenakshisundaram Swaminathan; chemsam50@gmail.com
Received 15 January 2014; Accepted 15 January 2014; Published 2 March 2014
Copyright © 2014 Meenakshisundaram Swaminathan et al. This is an open access article distributed under the Creative Commons
Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is
properly cited.
1. Introduction by R.-J. Lan et al. X. Zhao et al. prepared the modified PAN
nanofiber Fe complex by the amidoximation and Fe coor-
Environmental remediation, particularly, in the field of dination of PAN nanofiber and used for the heterogeneous
wastewater treatment, has gained utmost importance in Fenton degradation of textile dyes as a novel catalyst.
recent years. There is no alternative except to make use of C. W. Lai synthesized well-aligned anodic tungsten tri-
Advanced Oxidation Processes (AOPs) for the treatment of oxide (WO3 ) nanotubes and investigated their photocatalytic
wastewater with high degree of pollution. Hence, the recent ability by the degradation of methyl blue (MB) dye.
research is mainly focused on the efficient, cost-effective, “Solar photo-Fenton degradation of electro-optical industry
and ecofriendly AOPs in the degradation of any kind of wastewater by a pilot-scale Fresnel lens assisted IPCC reactor”
pollutants. This is reflected by the publication of this second was studied by W.-S. Kuo et al. Z. S. Seddig et al. investigated
special issue in this journal. This special issue contains 18 the effect of particle size on the photodegradation of aqueous
original research articles and a review article entitled “Recent methyl tert-butyl ether using zinc oxide. Zinc oxide of
developments in homogeneous advanced oxidation processes particle size of 421 nm was found to be the most effective in
(AOPs) for water and wastewater treatment.” degrading MTBE in an aqueous solution.
The review article by M. Muruganandham et al. reports G. Trovó et al. studied the treatment of pint industry efflu-
on recent development of AOPs, such as O3 , UV/O3 , ent using solar light assisted photo-Fenton process. The effect
UV/O3 /H2 O2 , UV/H2 O2 , Fe2+ /H2 O2 , and UV/Fe2+ /H2 O2 , of H2 O2 , iron dosages, and light intensity was investigated.
on the degradation of pollutants. The influence of various Reactive Black 5 dye degradation using porous phosphate
experimental processes such as solution pH, temperature, heterostructures-Fe (Fe-PPH) catalysts was analyzed by M.
concentration of the oxidants, and dosage of the light source S. Lucas et al. Removal of polyvinyl alcohol using photoelec-
on the process efficiency is also discussed. trochemical oxidation processes based on hydrogen peroxide
electrogeneration has been reported by K.-Y. Huang et al.
2. A Brief Outline of All the Accepted Papers Is Renovation and reuse of reactive dyeing effluent by a novel
Provided Below heterogeneous Fenton system based on metal-modified PTFE
fibrous catalyst/H2 O2 was investigated by B. Li et al. Hu et
Y. Haldorai and J.-J. Shim reported that the chitosan- al. studied the application of response surface methodology
encapsulated CuO hybrid material exhibited significant pho- on COD removal by simultaneous anodic oxidation and
tocatalytic activity on methylene blue degradation and excel- cathodic electro-Fenton oxidation.
lent antibacterial activity against E. coli. Ultrasonic degra- V. Romero et al. studied the adsorption and photocat-
dation of fuchsin basic in aqueous solution and effects of alytic degradation of the 𝛽-blocker metoprolol in aqueous
operating parameters and additives have been investigated titanium dioxide as photocatalyst. They have studied effect
2 International Journal of Photoenergy
of various experimental parameters, kinetics, intermediates,

and degradation pathways. P. Ellappan and L. R. Miranda
synthesized cerium-doped titanium dioxide photocatalyst
and used the catalyst for nitrobenzene degradation under
visible light irradiation. The synthesized photocatalyst was
characterized by using the suitable analytical methods. They
have optimized the experimental parameters. The TiO2 lattice
defects on the photocatalytic processes was investigated by V.
Romero et al. They have concluded that the oxygen vacancies
and Ti-related defects are the main lattice defects in TiO2
and that electronic driven forces are vitally necessary for pho-
tocatalysis. G.-J. Lee et al. synthesized nitrogen-doped ZnS
with camellia brush field yellow nanostructures and studied
its photocatalytic activity under visible light irradiation. They
have prepared photocatalysts with different amount of dopant
and studied the influence of the amount of dopant on the
photocatalytic activity. S. Liu et al. investigated microbial
fuel cell (MFC) (CW-MFC) to convert solar energy into
electricity based on the principles of photosynthetic MFC by
utilizing root exudates of Ipomoea aquatica as part of fuel.
The mineralization of tetramethyl ammonium hydroxide in
aqueous solution was studied using ozone-related processes
by C.-S. Chiou et al. The degradation efficiencies of various
processes were compared and it was concluded that the cat-
alyst combined with ozone and peroxide was more efficient
than other processes tested for mineralization. “Ozonation of
indigo carmine catalyzed with Fe-pillared clay” was reported
by M. Bernal et al. The synthesized clay was characterized
by suitable analytical methods. The process conditions for
efficient removal of dye were reported.
Acknowledgments
We are much grateful to the scientific colleagues, who
reviewed the papers by sparing their valuable time. We are
thankful to the Editorial Board for giving us an opportunity to
edit this special issue and for their suggestions and guidance.
Meenakshisundaram Swaminathan
Muruganandham Manickavachagam
Mika Sillanpaa
http://dx.doi.org/10.1155/2014/756408
Research Article
Synthesis and Characterization of Cerium
Doped Titanium Catalyst for the Degradation of
Nitrobenzene Using Visible Light
Padmini Ellappan and Lima Rose Miranda

Department of Chemical Engineering, A. C. Tech, Anna University, Chennai 600 025, India
Correspondence should be addressed to Lima Rose Miranda; limamiranda2007@gmail.com
Received 22 May 2013; Accepted 3 October 2013; Published 6 January 2014
Academic Editor: Manickavachagam Muruganandham
Copyright © 2014 P. Ellappan and L. R. Miranda. This is an open access article distributed under the Creative Commons
Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is
properly cited.
Cerium doped catalyst was synthesized using Titanium isopropoxide as the Titanium source. The metal doped nanoparticles
semiconductor catalyst was prepared by sol-sol method with the sol of Cerium. The synthesized catalyst samples were characterized
by powder X-ray diffraction, BET surface area, thermogravimetric analysis (TGA), scanning electron microscopy (SEM), and
UV-vis diffuse reflectance measurements (DRS) and compared with undoped TiO2 catalyst. The photocatalytic activity of the
sample was investigated for the decomposition of nitrobenzene (NB) using visible light as the artificial light source. Cerium doped
catalyst was found to have better degradation of nitrobenzene owing to its shift in the band gap from UV to visible region as
compared to undoped TiO2 catalyst. The operational parameters were optimized with catalyst dosage of 0.1 g L−1 , pH of 9, and
light intensity of 500 W. The degradation mechanism followed the Langmuir Hinshelwood kinetic model with the rate constant
depending nonlinearly on the operational parameters as given by the relationship 𝐾app (theoretical) = 2.29 ∗ 10−4 ∗ Intensity0.584 ∗
Concentration−0.230 ∗ Dosage0.425 ∗ pH0.336 .
1. Introduction composition, particle size distribution, and porosity which

have an influential effect on the degradation of the com-
The mechanism of photocatalysis using a semiconductor is pound. Band gap reduction could be done by dye sensiti-
by charge carrier generation resulting in the formation of zation, doping, bimetallic semiconductor, and surface modi-
holes, charge carrier trapping to form hydroxyl radicals, and fication. By reducing the band gap, use of visible light could
recombination of electrons and holes where heat is generated. be employed as an alternative to UV light which may result in
Heterogeneous photocatalytic systems based on TiO2 cat- better economics. Various nonmetal elements, such as B [1], C
alysts show some limitations that reduce their impact in the [2], N [3], V [4], and S [5], have been successfully doped into
domain of environmental protection. Important limitations TiO2 nanomaterials. Surface area, crystal composition, and
are low photonic yield and little efficiency under visible light. particle size distribution can be varied by varying the prepa-
These limitations have recently been the source of great devel- ration methods like preparation using solgel method wherein
opment in the area of the production and characterization of uniform crystal structure with better properties could be
TiO2 -based photocatalysts, capable of being efficiently used achieved. Several researchers have modified TiO2 with
under visible irradiation or showing a higher photochemical transition metals. Deposition of noble metals Ag, Au, Pt, and
yield in the near UV region. Pd [6, 7] on the surface of TiO2 enhances the photocatalytic
Any semiconductor material could be activated using a efficiency by acting as an electron trap, promoting interfacial
light whose wavelength greatly depends on the band gap of charge transfer and therefore delaying recombination of the
the semiconductor catalyst. Apart from the band gap, electron-hole pair. Another technique involves TiO2 doping
there have been other properties like surface area, crystal with transition metals such as Fe, Cu, Co, Ni, Cr, V, Mn,
Mo, Nb, W, Ru, Pt, and Au [8, 9]. The incorporation of isopropoxide, Titanium dioxide, Cerium oxide, ethanol, and
transition metals in the titania crystal lattice may result in glacial acetic acid are supplied by SRL chemicals, Mumbai,
the formation of new energy levels between valence band and India. In all the experiments double distilled water was used.
conduction band, inducing a shift of light absorption towards
the visible light region. Photocatalytic activity depends on the
2.2. Catalyst Characterization. X-ray diffraction (XRD)
nature and the amount of doping agent. Possible limitations
(Siemens D5000) was performed on fresh synthesized
are photocorrosion and promoted charge recombination at
catalyst. The X-ray powder diffraction pattern of the powder
metal sites. Choi et al. [10] has made an extensive study by
sample was measured employing CuK𝛼 radiation. The data
doping with Fe3+ , Mo5+ , Ru3+ , Os3+ , Re5+ , V4+ , and Rh3+ and
were collected over diffraction angle of 5∘ to 80∘ in 2𝜃 with
concluded that there was an increase in the photoreactivity
a step scanning. The accelerating voltage and the applied
for both oxidation and reduction of the organic compound.
Cerium, among the lanthanides, has a band gap of ∼3 eV. current were 40 kV and 40 mA, respectively.
Hence, it has strong absorption and shows better optical The surface chemical analysis of the samples was made
properties. Ce (III) and Ce (IV) have the high oxygen by X-ray Photoelectron Spectroscopy (AXIS His; Kratos
storage capacity which enhances the catalytic potential, also Analytical) using MgK𝛼 X-ray source (ℎ𝜐 = 1253.6 eV)
its oxidation ability of Ce3+ to Ce4+ states leads to high oxygen and an analyzer pass energy of 40 eV. The physical adsorp-
mobility resulting in better catalytic performance [11, 12]. It tion of nitrogen was performed on a NOVA 1000 system
has also been demonstrated by many researchers that there (Quantachrome) at 77 K. Surface areas of the samples were
are many advantages because of Cerium doping [13]. Chen et calculated based on the BET model.
al. [14] and Liu et al. [15] have also established that there was The DRS spectra of all the samples were recorded to
a shift towards visible region due to doping of titania with determine the sample’s UV-VIS light absorption capacity,
Cerium. on a Jasco-V650 diode array, computer controlled (with
Nitrobenzene, an aromatic compound used in the manu- SpectraManager software) spectrophotometer equipped with
facture of aniline, has moderate to low water solubility. This an ILV-724 integration sphere. The recorded spectral data
nitroaromatic compound has been listed as a carcinogen by was acquired in the 220–800 nm range, with 0.5 nm data
the National Institute of Environmental Health Sciences. The pitch and 100 nm/min scan speed. When higher resolution
maximum permissible limit for Nitrobenzene in drinking of the spectra was needed (usually in the 400–525 nm) the
water is 17 ppm as recommended by the U.S. EPA. Nitroben- data pitch was changed to 0.05 nm and the scan speed to
zene has been widely used as solvent and in manufacture 50 nm/min.
of dye intermediates and pesticides. Due to its carcinogenic SEM-EDX analysis was performed to evaluate the mor-
and mutagenic properties, it has to be eliminated from the phology of the amorphous starting material and the obtained
water streams. Prolonged exposure causes damage to lung by well crystallized catalysts on a Hitachi S-4700 Type II cold
irritation, anaemia, and liver damage. A number of workers field emission scanning electron microscope equipped with
illustrate the removal or degradation of this compound by a Röntec QX2-EDS spectrometer.
different biological methods like bioaugmentation and oxida-
tive reduction by bioremediation. Works has been carried out 2.3. Photoreactor. The experiments were performed in an
on the degradation of nitrobenzene using white root fungus annular photoreactor with a separate immersion well for the
and glow discharge plasma. Owing to the disadvantages of visible lamp. The lamps were cooled using circulating water.
these procedures due to noneconomical degradation time The reactor was of 500 mL capacity. The samples were taken at
and complicated equipment designs leading to increased cost, known intervals of time and absorbance was measured using
there has been extensive research in identifying techniques UV-spectrophotometer.
which would show better performance. One such technique
found to be effective over the years is the use of advanced
oxidation process, photocatalysis. Authors like Tayade et 2.4. Preparation of Catalyst. Titanium dioxide was prepared
al. [6], Priya and Madras [7], and Bhatkhande et al. [16] by solgel method using Titanium isopropoxide as precursor.
have worked on the degradation of Nitrobenzene using Titanium dioxide sol was prepared using Titanium iso-
semiconductor catalysts and an artificial light source. propoxide as precursor. 8 mL of Titanium isopropoxide was
The main objectives of the present research work are (i) mixed with 42 mL of ethanol and stirred well. To this 100 mL
synthesis and characterization of TiO2 doped with Cerium of 50% ethanol was added slowly and continuously stirred for
photocatalysts, (ii) photocatalytic degradation of Nitroben- 30 min at a temperature of 80∘ C for the hydrolysis reaction
zene pollutant in aqueous suspensions using the doped to take place, a method modified and adopted from Saif and
catalyst and undoped catalyst under visible light, (iii) opti- Abdel-Mottaleb [17]. A modified method was adopted for
mization of operational parameters, and (iv) detailed kinetic Cerium sol preparation from Alouche [18]. 65 g of Cerium
study using Langmuir Hinshelwood model. nitrate was dissolved in 1 L of glacial acetic acid. This solution
was added to 1 L of 10% ammonia. This is the sol of Cerium.
2. Experimental Procedures This sol was then added to TiO2 sol and stirred uniformly and
continuously. It was then left for ageing for 24 hours and then
2.1. Chemical Reagents and Apparatus. All chemicals used calcined at 400∘ C for 4 hours. This catalyst is referred to as
in this experiment were of analytical grade. Titanium TiO2 -Ce.
International Journal of Photoenergy 3
140 Table 1: Physical characterization of the catalysts.

120 Ti
TiO2 (solgel) 𝑆BET , Paricle diameter, nm
Intensity (CPS)
100 Catalyst Pore volume,

80 m2 g−1 cm3 g−1 Scherer’s Using 𝑆
BET
60
formula
40 TiO2 (solgel) 102 0.34 13.21 14.01
20 TiO2 -Ce 92 0.20 19.14 20.04
0
160
140 Ti
Intensity (CPS)
120 TiO2 -Ce

100 anatase peaks at 25.06∘ , 47.54∘ , 54.46∘ , and 61.72∘ . The rutile
80 phase of solgel-TiO2 was indicated by the peaks 37.4∘ and
60 Ce 53.63∘ . Titanium dioxide in the anatase form is generally
40
20 Ce accepted to be the most active polymorph [19]. This better
0 efficiency is attributed to a higher degree of hydroxylation
10 20 30 40 50 60 70 of anatase when compared with that of the rutile phase. The
2𝜃 (deg) XRD patterns of Ce doped TiO2 samples almost coincide with
Figure 1: XRD analysis of TiO2 and TiO2 -Ce.
those of pure solgel-TiO2 but show diffraction peaks due to
cerium doping. The average particle sizes of solgel-TiO2 and
TiO2 -Ce were calculated and tabulated in Table 1.
2.5. Degradation Experiment. The batch degradation exper- The particle size was also calculated using surface area
iment was performed in an annular photoreactor by taking calculated from BET isotherms determined using BET Quan-
a known quantity of catalyst to aqueous solution of concen- tachrome instruments as given in (3). The surface area,
trations ranging between 25 and 200 mg L−1 . Visible light of average pore area, and particle size calculated are shown in
150 W, 300 W, and 500 W was used for degradation and the Table 1. Consider the following:
solution was irradiated for 7 hours. Samples were collected
6000
at different intervals of time and the solution was analysed Particle Diameter 𝐷 = , (3)
for concentration of nitrobenzene by reading the absorbance 𝑆BET
at 264.5 nm in an UV spectrophotometer. The percentage
degradation was the reduction in concentration compared to where 𝑆BET is the surface area (cm2 g−1 ) and 𝜌 is the density
the original concentration as given in of the catalyst which is approximately 4.2 gc m−3 for titania
based particles. The ionic radii of Ce3+ and Ti2+ are 0.101 nm
𝐶 −𝐶 and 0.068 nm, respectively. Ce3+ could not be incorporated
Percentage degradation = 0 ∗ 100, (1)
𝐶0 into the lattice of TiO2 and hence there was an increase in
particle size. As the particle size increases, the surface area
where 𝐶0 is the initial concentration of the aqueous solution decreases as seen from Table 1.
and 𝐶 is the concentration at any time 𝑡. The unknown The valence state of Cerium in the TiO2 -Ce sample was
concentration of the solution at any time can be predicted examined by XPS. The XP spectrum in Figure 2 shows
from the standard plot of absorbance and concentration of the characteristic Ce 3d peak that has a binding energy of
the solution.
887.3 eV; XPS peaks corresponding to Ce4+ ion were not
found. This result confirms the presence of Cerium deposits
3. Results and Discussion on the TiO2 surface of the TiO2 -Ce sample. The binding
energies for Ti 2p were 458.3 eV and 464.1 eV as shown
3.1. Catalyst Characterization. XRD patterns were recorded in Figure 2. Combined with the XRD analysis, it could be
for the prepared and calcined samples on a graphite crystal understood that the doping cerium atoms presented in the
monochromator, operating with a Cu anode and a sealed forms of Ce2 O3 and were distributed on the surface of titania.
X-ray tube as shown in Figure 1. For the range of 20–80∘ Figure 3 shows SEM photograph of the typical samples
with 0.05∘ step size, the 2𝜃 scans were recorded at several of TiO2 (a) and TiO2 -Ce (b). From the image, the sample
resolutions using CuK𝛼 radiation of wavelength 1.54 Å. Aver- TiO2 -Ce existed approximately in the form of spherical
age particle size was determined by using full width at half particle and presented porous structures similar to those of
maximum (FWHM) data. Scherer’s formula (2) was used to TiO2 . According to the statistical estimation, the average
determine average particle size as follows: size was about 14.5 nm, which was in accordance with the
𝑘𝜆 value determined by XRD (19.14 nm). The morphological
𝐷= , (2) study shows that for both TiO2 and TiO2 -Ce catalyst, the
𝛽 Cos 𝜃
surface looked almost the same with slightly whitish portion
where 𝐷 is the diameter of the particle, 𝑘 is a constant equal indicating the deposition of Ce. On the basis of the SEM
to 0.89, 𝜆 is the X-ray wavelength equal to 0.154 nm, 𝛽 is results, the Ti Ka-fluorescence signals for the pure TiO2 and
the full width at half maximum, and 𝜃 is the half diffraction TiO2 -Ce samples were also obtained by EDX analysis and the
angle [4]. The XRD pattern of solgel-TiO2 showed primary spectra are shown in Figure 4, which gave both qualitative
Ce 3d Ti 2p
887.3 eV 458.5 eV
Intensity (a.u.)
Intensity (a.u.)
464.5 eV
875 880 885 890 895 454 458 462 466 470 474
Binding energy (eV) Binding energy (eV)
(a) (b)
Figure 2: XPS analysis of TiO2 -Ce doped catalyst.
(a) (b)
Figure 3: SEM analysis of TiO2 (a) and TiO2 -Ce (b) doped catalyst.
Full scale counts: 3320 TiO2 -Ce TiO2

2500 Ti
3000
2000
2000 1500
O
1000 Ti
1000 O
Ti
Ti 500 Ti
Ce
0 0
0 1 2 3 4 5 0 1 2 3 4 5
(keV) klm-80-Hg (keV)
(a) (b)
Figure 4: EDX analysis of TiO2 -Ce doped and TiO2 catalyst.

Table 2: Catalyst composition using EDX analysis of TiO2 and

TiO2 -Ce catalyst.
Compound %
Element
Absorbance (a.u.)
TiO2 TiO2 -Ce
O 11.83 19.65
Ti 88.17 76.56
Ce — 3.79
and quantitative information about the elemental and atomic 300 350 400 450 500 550 600 650 700
percentages in the TiO2 and TiO2 -Ce samples, as presented Wavelength (nm)
in Table 2.
TiO2 (solgel)
In order to estimate the band gap distance, UV-vis Ti-Ce
spectroscopy was employed. An Oriel Instruments spec-
trometer with an integrating sphere was used for UV-Vis Figure 5: UV-DRIFT analysis of TiO2 and TiO2 -Ce catalyst.
spectrometry measurements to analyze the red-shifts in the
absorption regions. The UV-Vis transmittance measurements
79.14
90
were taken and converted into absorption readings as given in
72.89
71.16
68.98
80
65.14
66.32
65.19
Figure 5. For pure TiO2 , the band gap energy correpsonding
62.01
59.15
60.13
70
57.36
to 388.8 nm indicates 3.18 eV which was found to be in
54.41
accordance with that of other researchers [20–22], while for 60
TiO2 -Ce, the band gap energy reduced due to the shift of 50
absorbance further away from UV region. The band gap
28.94
40
25.18
26.05
23.16
energy corresponding to the wavelength of 551.4 nm was 22.66

20.84
30
determined to be 2.25 eV. The results show that cerium does 20
improve visible light absorbance of TiO2 due to cerium
10
plasmon absorption.
0
Photolysis (150 W)
Photolysis (300 W)
Photolysis (500 W)
TiO2 (solgel)(150 W)
TiO2 -Ce (150 W)
TiO2 -Ce (300 W)
TiO2 -Ce (500 W)

3.2. Control Experiment. Photocatalytic degradation studies
were performed using TiO2 -Ce and compared with undoped
TiO2 . The catalyst dosage was uniformly taken to be 0.1 g L−1
for all the experiments with solution concentration to be
50 mg L−1 , pH of 6.8, and different light intensities (150, 300,
and 500 W). From Figure 6, it could be seen that using TiO2 - Degradation (%)
TOC removal (%)
Ce and 500 W light, the degradation achieved was 79.09%
which was higher than the other catalysts studied. Addition of Figure 6: Degradation % of NB for different catalysts at different
Cerium to TiO2 has increased the percentage of degradation intensities (Conc.: 50 mg L−1 , pH: 6.8, and catalyst dosage: 0.1 g L−1 ).
by 14% when compared to TiO2 . The photolytic degradation
of nitrobenzene was performed in the absence of the catalyst
varying the intensity of the visible light for comparing the 2.25 eV also contributed to this increase in degradation.
performance of cerium doped catalyst as shown in Figure 6. Consider
The degradation using 150, 300, and 500 W was found to be
23, 25, and 29%, respectively. This was much lower than the Ce3+ + O2 󳨀→ ∙ O−2 + Ce4+ (4)
degradation using Cerium doped catalyst.
Ce4+ + e− 󳨀→ Ce3+ (5)
Though the particle size of TiO2 -Ce was higher than
TiO2 (solgel), it showed better degradation because, in photo-
Ce3+ + TiO2 + ℎ] 󳨀→ e− + h+ (6)
catalysis, doping a semiconductor changed the photocatalytic
process by suppressing electron-hole recombination and Ce2 O3 + ℎ] 󳨀→ e− + h+ (7)
when the electron formed due to excitation migrates to the
metal, it gets trapped within. The organic compound diffuses The present study revealed that the cerium doped TiO2 in
to the free hole on the semiconductor surface and oxidation sol-sol method could be effectively used as compared to other
of nitrobenzene occurs. The presence of cerium species on catalysts as discussed in Table 3. Better shift of the catalyst
TiO2 influences the photoreactivity by altering the electron- towards visible region has resulted in 100% degradation at
hole pair recombination rate through the following equations a pH of 9 and catalyst dosage of 0.1 gL−1 (as summarized in
(4)–(7). The reduction in band gap energy from 3.2 eV to Section 3.3.5).
Table 3: Comparison of the performance of the present work with other published works.
Catalyst Properties Light source % degradation Reference

Particle size: 10.8 nm
5% for 50 mgL−1 of Alouche (2008)
Ce doped TiO2 Surface area: 89.6 m2 g−1 Visible
NB solution [18]
Band gap: 368 nm
Visible 94.1% of 20 mgL−1 of Tayade et al.
H3 PW12 O40 -TiO2
NB solution in 6.5 hrs (2007) [19]
Surface area: 191 m2 g−1 UV 43% of 50 mgL−1 of Shen et al.
Fe-ETS-10
Band gap: 3.13 eV NB solution in 4 hrs (2009) [20]
Nanocrystalline Particle size: 12 nm

Visible 96% of 50 mgL−1 of Tayade et al.
TiO2 Surface area: 166 m2 g−1 NB solution in 8 hrs (2006) [6]
Band gap: 3.28 eV
Silver metal
Surface area: 205 m2 g−1 UV light (267 nm) 57% 50 mgL−1 of NB Shen et al.
exchanged ETS-10
Band gap: 3.16 eV solution in 4 hrs (2009) [20]
Zeolite
Particle size: 10.8 nm
53% 50 mgL−1 of NB Alouche (2008)
N-Ce doped TiO2 Surface area: 152 m2 g−1 Visible (300 W xenon lamp)
solution in 4 hrs [18]
Band gap: 2.19 eV
The TOC removal % was studied for different intervals 90

of time. The photomineralization of the compounds were 80
measured using Total Organic Carbon analyzer (Shimadzu
TOC 5000 A). The extent of TOC removal % was compared 70
with the undoped and Cerium doped TiO2 catalyst. The TOC 60
Degradation (%)
removal % was maximum using Cerium doped catalyst at an

intensity of 500 W. 50
40
3.3. Optimization of Operational Parameters 30
20
3.3.1. Effect of Solution Concentration. The most important
operational parameter to be studied is the influence of initial 10
concentration of the solution. NB photocatalytic degradation
0
studies were carried out using 25–200 mg L−1 initial concen- 0 50 100 150 200 250 300 350 400
tration of NB and 0.1 g L−1 of catalyst loading. The plot of Time (min)
degradation % for different solution concentration was made
25 mgL−1 50 mgL−1
and from Figure 7 it could be inferred that as concentration
75 mgL−1 100 mgL−1
increased, percentage degradation decreased. This may be 150 mgL−1 200 mgL−1
due to the fact that with the increase in initial concentration
of NB, while the irradiation period and catalyst dose are Figure 7: Effect of solution concentration on degradation % (light
kept constant, more NB molecules are present on the surface intensity: 500 W, pH: 6.8, and catalyst dosage: 0.1 g L−1 ).
of TiO2 . Thus, an increase in the number of substrate ions
accommodating in interlayer spacing inhibits the action of
the catalyst, which thereby decreases the number of reactive
∙
OH and O∙− 2 free radicals attacking the NB molecules, and,
the catalyst surface and hence more hydroxyl radicals are
hence, lowers the photodegradation efficiency [23]. produced [24].
3.3.2. Effect of Light Intensity. The influence of light intensity 3.3.3. Effect of Catalyst Dosage. Photocatalyst dosage added
on the degradation efficiency has been examined at constant to the reaction vessel is a major parameter affecting the
Nitrobenzene concentration (50 mg L−1 ), at pH (6.5) and photocatalytic degradation efficiency. The aqueous solution
catalyst loading (0.1 g L−1 ). It is evident that the degradation of 50 mg L−1 of solution was degraded using different catalyst
rate increases with increase in the light intensity as shown dosages (0.025, 0.05, 0.1, 0.15, and 0.2 g L−1 ). From Figure 8
in Figure 6. The photons required for the electron transfer it can be seen that maximum degradation was achieved for
were generated by UV irradiation which results in electron the catalyst dosage of 0.1 g L−1 . It could also be inferred that
transfer from valence band to conduction band of the catalyst. further increase in catalyst dosage did not yield an increase
The degradation % increases when more radiations fall on in degradation percentage.
80 86
78 84
82
76
Degradation (%)
Degradation (%)
80
74
78
72
76
70 74
68 72
0 0.05 0.1 0.15 0.2 0.25 0 2 4 6 8 10 12
Catalyst dosage (gL−1 ) Solution pH
Figure 8: Effect of catalyst dosage on degradation % (Conc.: Figure 9: Effect of solution pH on degradation % (Conc.: 50 mg L−1 ,
50 mg L−1 , pH: 6.8, and intensity: 500 W). catalyst dosage: 0.1 g L−1 , and intensity: 500 W).
2
1.8
The increase in degradation percentage for 0.025 to 1.6
0.1 g L−1 may be due to an increase in the amount of active 1.4
sites on the surface of the photocatalyst particles. The number 1.2
ln(C0 /C)
of NB molecules adsorbed as well as the number of photons

1
absorbed increase with the increase in catalyst concentration
thereby enhancing the rate of degradation. Addition of 0.8
catalyst beyond 0.1 g L−1 leads to decrease in the degradation. 0.6
Aggregation of TiO2 particles occurs at higher dosage causing 0.4
decrease in the number of surface active sites and also there is 0.2
an increase in the opacity of the solution and light scattering
0
of TiO2 particles at high dosage through the solution [25]. 0 50 100 150 200 250 300 350 400
Time (min)
3.3.4. Effect of pH of the Solution. pH of the solution greatly 25 mgL−1 100 mgL−1
influences the degradation rate. It tends to change the surface 50 mgL−1 150 mgL−1
property of the catalyst. The effect of change in initial pH 75 mgL−1 200 mgL−1
(2, 4, 6.5, 8, 9, 10, and 11) of 50 mg L−1 of the nitrobenzene
Figure 10: Langmuir Hinshelwood plot (pH: 6.8, catalyst dosage:
solution was studied by adding 0.1 g L−1 of catalyst. The plot 0.1 g L−1 , and light intensity: 500 W).
of % degradation against pH (Figure 9) showed that as pH
increased the degradation increased. A maximum of 100%
degradation was achieved at pH 9. The degradation was lower
in lower acidic and higher alkaline pH. terms of reaction rate constant (𝑘𝑟 ) and Langmuir Hinshel-
pH of the catalyst dispersions majorly affects the surface wood adsorption constant (𝐾LH ) which is as given in
properties on the particles, agglomerate size formed, and
𝑘𝑟 𝐾LH 𝐶
the conductance and valence bands positions [26]. The 𝑟= = 𝑘app 𝐶, (8)
nitrobenzene solution was degraded by hydroxyl attack and 1 + 𝐾LH 𝐶0
direct oxidation at the holes and reduction at the conduction
where is rate of disappearance of organic substrate,
band. In alkaline pH, the surface of TiO2 -Ce acquires a
negative charge leading to greater adsorption and hence mg L−1 min−1 , and 𝐶 is concentration of organic substrate,
increasing the degradation rate in the alkaline media. mg L−1 ,
𝑘𝑟 𝐾LH
𝑘app = . (9)
3.3.5. Kinetic Modelling Using Langmuir Hinshelwood Model. 1 + 𝐾LH 𝐶0
The degradation percentage was calculated and for hetero-
geneous catalyst, the Langmuir Hinshelwood model was Linearization of (8) yields an equation from which a plot
used to calculate the apparent rate constant. The Langmuir of ln (𝐶0 /𝐶) against time will result in a linear relation-
Hinshelwood model, derived based on the monolayer activity ship resulting in zero intercept and apparent rate constant
assumption, was used to estimate the kinetic parameters in (𝑘app ) derived from the slope of the line. Figure 10 is the
×10−2 The average crystal size and the surface area were deter-
0.6 mined and compared between two types of catalysts. The
operational parameters were optimized and the following
0.5 condition was suggested to obtain maximum degradation:
pH: 9, dosage: 0.1 g L−1 , solution concentration: 25 mg L−1 ,
kapp (min−1 ) (theo)
0.4 and light intensity: 500 W. The kinetic study revealed that
the degradation followed Langmuir Hinshelwood model.
0.3 The apparent rate constant was determined and evaluated
theoretically using the nonlinear fit which depends on the
0.2 operational parameters. Based on the previously mentioned
experiments and characterization it could be concluded that
0.1 Cerium doped TiO2 catalyst prepared by solgel method could
be efficiently used for degradation of Nitrobenzene using
0 visible light.
0 0.001 0.002 0.003 0.004 0.005 0.006
kapp (min−1 ), (exp)
Conflict of Interests
Figure 11: Comparison between the experimental and theoretical
The authors declare that there is no conflict of interests
values of apparent rate constant.
regarding the publication of this paper.
representation of the plot from which the apparent rate References

constant was determined using slope of the line. Similarly
[1] S. C. Moon, H. Mametsuka, S. Tabata, and E. Suzuki, “Photo-
for all the conditions of pH (2–11), concentration (25–
catalytic production of hydrogen from water using TiO2 and
200 mg L−1 ), catalyst dosage (0.025–0.2 g L−1 ), and intensity B/TiO2 ,” Catalysis Today, vol. 58, no. 2, pp. 125–132, 2000.
of visible light (150–500 W), the plot of ln (𝐶0 /𝐶) against
time was evaluated. The apparent rate constant was found [2] C. Lettmann, K. Hildenbrand, H. Kisch, W. Macyk, and W.
F. Maier, “Visible light photodegradation of 4-chlorophenol
to increase with light intensity and decrease with solution
with a coke-containing titanium dioxide photocatalyst,” Applied
concentration. The maximum degradation could be achieved Catalysis B, vol. 32, no. 4, pp. 215–227, 2001.
at the following parameter condition: pH: 9, dosage: 0.1 g L−1 ,
[3] R. Asahi, T. Morikawa, T. Ohwaki, K. Aoki, and Y. Taga,
solution concentration: 25 mg L−1 , and light intensity: 500 W. “Visible-light photocatalysis in nitrogen-doped titanium
The nonlinear fit between the apparent rate constant and the oxides,” Science, vol. 293, no. 5528, pp. 269–271, 2001.
operational parameters was determined and were found that [4] C.-S. Wu and C. Chen, “A visible-light response vanadium-
the experimental values when compared with the theoretical doped titania nanocatalyst by sol-gel method,” Journal of Photo-
values as in Figure 11, the theoretical values had less than 3% chemistry and Photobiology A, vol. 163, no. 3, pp. 509–515, 2004.
error and hence the following equation (10) could be chosen [5] T. Umebayashi, T. Yamaki, S. Tanaka, and K. Asai, “Visible
for approximating the experimental conditions. Equation light-induced degradation of methylene blue on S-doped TiO2 ,”
(10) could be used for a condition of pH 2 to 9, dosage Chemistry Letters, vol. 32, no. 4, pp. 330–331, 2003.
of 0.05 to 0.1 g L−1 , light intensity of 150, 300, or 500 W, [6] R. J. Tayade, R. G. Kulkarni, and R. V. Jasra, “Photocatalytic
and concentration of solution from 25 to 200 mg L−1 . The degradation of aqueous nitrobenzene by nanocrystalline TiO2 ,”
nonlinear equation was Industrial and Engineering Chemistry Research, vol. 45, no. 3, pp.
922–927, 2006.
𝑘app (theoretical)
[7] M. H. Priya and G. Madras, “Photocatalytic degradation of
nitrobenzenes with combustion synthesized nano-TiO2 ,” Jour-
= 0.000229 ∗ Intensity0.584 ∗ Concentration−0.230 nal of Photochemistry and Photobiology A, vol. 178, no. 1, pp. 1–7,
2006.
∗ Dosage0.425 ∗ pH0.336 .
[8] S. Ikeda, N. Sugiyama, B. Pal et al., “Photocatalytic activity
(10)
of transition-metal-loaded titanium(IV) oxide powders sus-
pended in aqueous solutions: correlation with electron-hole
4. Conclusion recombination kinetics,” Physical Chemistry Chemical Physics,
vol. 3, no. 2, pp. 267–273, 2001.
The undoped and cerium doped titania photocatalyst was [9] A. Fuerte, M. D. Hernández-Alonso, A. J. Maira et al., “Visible
prepared through the sol-gel route. The cerium doped pho- light-activated nanosized doped-TiO2 photocatalysts,” Chemi-
tocatalyst could absorb the visible light and showed high cal Communications, no. 24, pp. 2718–2719, 2001.
photoactivity in the visible region because of the band gap [10] W. Choi, A. Termin, and M. R. Hoffmann, “The role of
narrowing. Cerium atoms existed in the state of Ce2 O3 metal ion dopants in quantum-sized TiO2 : correlation between
and were dispersed on the surface of titania, suppressing photoreactivity and charge carrier recombination dynamics,”
the recombination of electron-hole pairs and increasing the Journal of Physical Chemistry, vol. 98, no. 51, pp. 13669–13679,
photoactivity as confirmed using XPS and DRIFT analysis. 1994.
[11] B. M. Reddy, P. M. Sreekanth, Y. Yamada, Q. Xu, and T. [26] Y. Ku and C. B. Hsieh, “Photocatalytic decomposition of 2,4-
Kobayashi, “Surface characterization of sulfate, molybdate, and dichlorophenol in aqueous TiO2 suspensions,” Water Research,
tungstate promoted TiO2 -ZrO2 solid acid catalysts by XPS and vol. 26, no. 11, pp. 1451–1456, 1992.
other techniques,” Applied Catalysis A, vol. 228, no. 1-2, pp. 269–
278, 2002.
[12] V. M. Orera, R. I. Merino, and F. Peña, “Ce3+↔Ce4+ conversion
in ceria-doped zirconia single crystals induced by oxido-
reduction treatments,” Solid State Ionics, vol. 72, no. 2, pp. 224–
231, 1994.
[13] W. M. Yen, M. Raukas, S. A. Basun, W. Van Schaik, and U.
Happek, “Optical and photoconductive properties of cerium-
doped crystalline solids,” Journal of Luminescence, vol. 69, no.
5-6, pp. 287–294, 1996.
[14] S. W. Chen, J. M. Lee, K. T. Lu et al., “Band-gap narrowing
of TiO2 doped with Ce probed with x-ray absorption spec-
troscopy,” Applied Physics Letters, vol. 97, no. 1, Article ID
012104, 2010.
[15] H. Liu, X. Z. Li, Y. J. Leng, and W. Z. Li, “An alternative approach
to ascertain the rate-determining steps of TiO2 photoelectro-
catalytic reaction by electrochemical impedance spectroscopy,”
Journal of Physical Chemistry B, vol. 107, no. 34, pp. 8988–8996,
2003.
[16] D. S. Bhatkhande, V. G. Pangarkar, and A. A. C. M. Beenackers,
“Photocatalytic degradation of nitrobenzene using titanium
dioxide and concentrated solar radiation: chemical effects and
scaleup,” Water Research, vol. 37, no. 6, pp. 1223–1230, 2003.
[17] M. Saif and M. S. A. Abdel-Mottaleb, “Titanium dioxide
nanomaterial doped with trivalent lanthanide ions of Tb, Eu and
Sm: preparation, characterization and potential applications,”
Inorganica Chimica Acta, vol. 360, no. 9, pp. 2863–2874, 2007.
[18] A. Alouche, “Preparation and characterization of Copper and/
or Cerium catalysts supported on Alumina or Ceria,” Jordan
Journal of Mechanical and Industrial Engineering, vol. 2, pp. 111–
116, 2008.
[19] R. J. Tayade, P. K. Surolia, R. G. Kulkarni, and R. V. Jasra,
“Photocatalytic degradation of dyes and organic contaminants
in water using nanocrystalline anatase and rutile TiO2 ,” Science
and Technology of Advanced Materials, vol. 8, no. 6, pp. 455–462,
2007.
[20] X.-Z. Shen, Z.-C. Liu, S.-M. Xie, and J. Guo, “Degradation
of nitrobenzene using titania photocatalyst co-doped with
nitrogen and cerium under visible light illumination,” Journal
of Hazardous Materials, vol. 162, no. 2-3, pp. 1193–1198, 2009.
[21] W. Wang, Y. Huang, and S. Yang, “Photocatalytic degradation of
nitrobenzene wastewater with H3 PW12 O40 /TiO2 ,” in Proceed-
ings of the International Conference on Mechanic Automation
and Control Engineering (MACE ’10), pp. 1303–1305, June 2010.
[22] P. K. Surolia, R. J. Tayade, and R. V. Jasra, “Photocatalytic degra-
dation of nitrobenzene in an aqueous system by transition-
metal-exchanged ETS-10 zeolites,” Industrial and Engineering
Chemistry Research, vol. 49, no. 8, pp. 3961–3966, 2010.
[23] W. Bahnemann, M. Muneer, and M. M. Haque, “Titanium
dioxide-mediated photocatalysed degradation of few selected
organic pollutants in aqueous suspensions,” Catalysis Today, vol.
124, no. 3-4, pp. 133–148, 2007.
[24] A. E. Cassano and O. M. Alfano, “Reaction engineering of sus-
pended solid heterogeneous photocatalytic reactors,” Catalysis
Today, vol. 58, no. 2, pp. 167–197, 2000.
[25] A. A. Adesina, “Industrial exploitation of photocatalysis: pro-
gress, perspectives and prospects,” Catalysis Surveys from Asia,
vol. 8, no. 4, pp. 265–273, 2004.
http://dx.doi.org/10.1155/2013/364802
Review Article
Function of TiO2 Lattice Defects toward Photocatalytic
Processes: View of Electronic Driven Force
Huanan Cui,1 Hong Liu,1 Jianying Shi,1 and Chuan Wang2

1
Key Laboratory of Environment and Energy Chemistry of Guangdong Higher Education Institutes, School of Chemistry and
Chemical Engineering, Sun Yat-Sen University, Guangzhou 510275, China
2
Chongqing Institute of Green and Intelligent Technology, Chinese Academy of Sciences, Chongqing 401122, China
Correspondence should be addressed to Hong Liu; liuhong@cigit.ac.cn and Jianying Shi; shijying@mail.sysu.edu.cn
Received 18 July 2013; Revised 6 October 2013; Accepted 14 October 2013
Academic Editor: M. Muruganandham
Copyright © 2013 Huanan Cui et al. This is an open access article distributed under the Creative Commons Attribution License,
which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Oxygen vacancies and Ti-related defects (OTDs) are the main lattice defects of TiO2 , which have great influence on its photocatalytic
activity. To understand the relationship between the defects and photocatalytic activities, detailed discussions based on the
electronic driven force provided by these defects are carried out during the three commonly accepted processes in photocatalytic
reactions. It is found that these defects inevitably (i) influence the energy structure of the pristine TiO2 as the isolate acceptor/donor
level or hybrid with the original orbital, (ii) provide a disordered short-range force that confuses the charge carriers transferring to
surface active sites, (iii) act not only as the surface active sites for trapping the charge carriers but also as the main chemisorption
sites for O2 , H2 O, and organic species. These effects of the defects make them one of the key factors that determine the efficiency
of heterogeneous photocatalysis. Clarifying the role of the defects will further facilitate the exploration and the construction of
high-performance photocatalysts for practical applications.
1. Introduction solid solution [18], heterostructure composites [17, 19], and

multilayer films [20]). During these systems, the enhanced
The construction of photocatalysis system provides a promis- photocatalytic activities are always attributed to the structure
ing strategy to solve energy and environmental issues by [21], composition, particle size [22], or surface area [23],
converting solar energy to hydrogen/electric energy and which do not seem to have direct relationship with defects.
oxidizing the organic compounds to reduce the chemical oxy- However, during the deep discussion of the intrinsic factor
gen demand (COD) in the environment. Titanium dioxide for photocatalysis, the importance of the defects in reactions
(TiO2 ) has been studied extensively due to its fundamental is gradually recognized and commonly accepted as the
properties and wide range applications [1–4]. As light can go dominant limitation of photocatalytic efficiency nowadays.
as deep as about 1 𝜇m down to the surface [5], photocatalytic It is the energy structure that makes TiO2 a semiconduc-
reaction automatically occurs on the surface/subsurface. tor photocatalyst. And OTDs have been widely concerned
Attentions were paid intensively to surface science of TiO2 to the so-called “self-doping” effect [24]. Pristine TiO2 is
and other oxide photocatalysts, and an expectation for the traditionally thought to be inert under visible light for its
surface properties insights into the molecular level is in broad band gap (𝐸𝑔 ≈ 3.2 eV). To narrow the band gap,
urgent need. The surface properties are largely influenced by foreign anion elements (e.g., N [12, 25], C [13], F [26], S
the defects, and the dominant defects in TiO2 surfaces are [27]) and cation elements (e.g., Fe3+ [28], Cr3+ [29], and Ce4+
oxygen vacancies and Ti-related defects (OTDs) [6–11]. [16]) are frequently introduced into TiO2 lattice, forming
OTDs can be created during the diverse workable syn- new energy state in solids. Defect state caused by OTDs was
thesis strategies (e.g., doping [12–14], loading [15, 16], and also found to influence the electronic structure of pristine
constructing Z-scheme photocatalytic system [17]) and can TiO2 , and visible light response was clearly observed in
also be found in many kinds of efficient photocatalysts (e.g., reduced TiO2−𝑥 specimens [11, 30]. OTDs were found to
be the active response sites from the scanning tunneling of OTDs were provided. The findings of this work would
microscopy (STM), which came out to be one of the powerful facilitating the design and exploration of high-performance
techniques in detecting surface configuration in materials green photocatalysts in the molecule level.
[31–33]. The formation of OTDs is called “self-doping.” The
effect of narrowing the band gap is proved to exist not
only in TiO2 but also in other metal oxides [34]. Avoiding
2. General Issues of Photocatalysis
introducing excess foreign elements, OTDs self-doping is The general mechanism of heterogenous photocatalysis is
recognized as a green and promising strategy for exploring always described as Figure 1. When the photon energy is
environmentally friendly photocatalysts. sufficient to promote the electrons in the valence band to
When an electron in the ground state absorbs a photon jump to the conduction band, three main steps can happen
which possesses sufficient energy larger than 𝐸𝑔 of the successively: (i) photon absorption and electron-hole pair
semiconductor, it can be excited from the valence band to the generation, (ii) charge separation and migration to surface
conduction band, leaving a hole behind. Once the electron- reaction sites or to recombination sites, and (iii) surface
hole (e-h) pair is generated, the charge carriers may imme- chemical reaction at active sites containing donor oxidation at
diately start the journey to the surface active sites, mainly valence-band hole and acceptor reduction at electron center.
to the OTDs. Reduced TiO2 OTDs surface is found to have Upon these three photocatalytic processes, several defects-
enhanced photocatalytic efficiency than defect-free surface. related photocatalytic issues should be clarified.
The efficiency may rise when increasing the concentration of
OTDs in a moderate range on surface [35, 36]. Density func-
tional theory (DFT) calculation, photoemission spectroscopy 2.1. Photoexcited Location. The process of heterogenous pho-
(PL), atomic force microscopy (AFM) [37, 38], and STM tocatalysis starts by irradiation. That is, photoexcitation of
reveal that lattice distortion induced electronic density varia- electron at ground state is the prerequisite. It should be
tion at OTDs accumulates the spontaneous charge migration noticed that the excitation step of electron under irradiation
to the surface, where the OTDs act as the trap center. They may not only occur in the semiconductor but also occasion-
serve to promote the separation of e-h pair and prolong the ally happen in the substance adsorbed on its surface, like
life time of charge carriers in TiO2 [39]. OTDs at subsurface the reaction happening in dye-sensitized solar cell [22]. The
are recognized more as the e-h recombination center, also charge carriers may experience different pathways in these
caused by the trapping effect. Kong et al. [40] found from two situations. Hence in this review, we focus on the cases
STM and positron annihilation lifetime spectroscopy (PALS) that initial excitation happens in the semiconductor itself.
[41, 42] that the larger the proportion of surface defects was
in the whole defects of TiO2 , the higher the photocatalytic 2.2. Point Defects and Standard Specimen. The concept of
activity was. This competitive relationship between surface defects initially lies in the solid state physics description of
OTDs and subsurface OTDs on trapping charge carriers lattice distortion. Such distortion can be in the form of point
should be attributed to their electronic properties. defect, liner defect, two-dimensional flaw or interface and
Owning to the feature electronic density, OTDs can three-dimensional valley or heteroimpurity. Among these,
not only gather charge carriers but also function as the point defect is the most investigated case and provides the
absorbing sites for external species (e.g., O2 , H2 O, CO2 , primary realization of properties of lattice defects, including
and plenty of organic substances) [43, 44]. The adsorption energetic, thermal, electrical, optical, and magnetic features
of these species toward OTDs may occur in the form of in solids [46–49]. OTDs are generally recognized as point
dissociative adsorption (chemical adsorption). This is of vital defects. The analysis of OTDs and OTDs-related clusters in
importance for mediating the transfer of charges, undergoing photocatalytic reactions is usually carried out by performing
from the surface → OTDs → dissociated species → the point trap model.
further redox reaction [45]. For instance, H2 O can dissoci- Lattice defects are inevitably generated during synthe-
ate at bridging oxygen vacancy, forming two neighbouring sis procedure and are thermal- and preparation-dependent
hydroxyls (−OH). This hydroxyl facilitates the photocatalytic products [50]. Intrinsic point defects exist automatically in
reactions by lowering the charge transfer barrier, assisting lattice as vacancies, interstitials, and atomic impurities which
the adsorption of organic substances, and further catalyzing are frequently observed in doping materials. It was observed
the decomposition of them. Besides, the −OH was deduced by STM images that these defects distributed scatteredly
to have an effect on the redistribution of subsurface OTDs. on the flat surface or centralized violently at the terrace
The dissociating mechanisms of species at OTDs active sites boundaries which are proved to be responsible for the
remain very rough, and the function of these dissociated increased photocatalytic efficiency. However, the existence of
species in photocatalysis still needs further investigation. the incoordinate and disordered defects in different samples
This review focuses on the understanding of the function makes it hardly possible to compare the photocatalytic
of OTDs in photocatalytic reactions, from the view of the properties precisely even in the same photocatalytic system.
electronic driven force toward neutralizing. The generation of The well-defined particles hardly exist at room tempera-
OTDs is always followed by the redistribution of electronic ture under ambient conditions. As a result, to simplify the
density. This variation has compact relationship with the analysis in molecule scale, a hypothesis about well-defined
photocatalytic efficiency. Upon the three basic photocatalytic samples is made in the vast majority of researches, and point
processes, further discussion was carried out and the effects defects are well-distributed ignoring the boundary defects.
Thus, preparation of comparable standard specimen is in direction and the relationship between them seems more to
urgent need for better understanding the nature of photocat- be the coworker than to be the competitor.
alytic reaction. The ability of intrinsic defects to influence the transfer
of charge carriers can be judged by electrical conductivity
[55], considering the cooperation of both the 𝑛-type and
2.3. Energy Structure. As is known, ground state energy
the 𝑝-type aspects. The resistance of TiO2 can be influenced
structure of a pure semiconductor is composed by valence
by the trapping of the charge carriers in ionic defects and
band (VB), conduction band (CB), and the band gap between
overcome the barriers in the distorted bond. An increase
them. Light absorption for photocatalytic reaction is deter-
of the electrical conductivity with the increase of oxygen
mined by the range of band gap (𝐸𝑔 ). When the photon
vacancies was observed by Nowotny et al. when changing the
energy is sufficient to excite an electron in valence band
oxygen partial pressure [48]. Accordingly, it is revealed by the
to overcome 𝐸𝑔 to the conduction band, photocatalytic
enhanced electrical conductivity that the surface investigated
reactions may occur.
is an 𝑛-type dominant surface and oxygen vacancies facilitate
The point defects as impurities are recognized to have a
the charge transfer.
“self-energy” in short range, creating a variation in the host
electronic structure. There are two general identified manners
on the influence of defect energy level to the host energy 2.5. Main Characterization Methods of Defects. Based on
structure: (i) to introduce an isolated mid gap as the accep- the first principles computation, the modified local density
tor/donor level, leaving the primary structures unchanged, approximation (LDA) and the related generalized method
and (ii) to hybrid with the host VB or CB, narrowing as well as some other computational modelings are used
or broadening the band gap. These two phenomena were to calculate the ground state energy structure of the host
proposed in N-doped TiO2 samples by Irie et al. [51] and semiconductor, despite of the error [56, 57]. As to the energy
Asahi et al. [52]. OTDs also have been found to undergo these level of the defects and the excited states, however, it becomes
two manners favorably in oxide semiconductors. It is crucial more complicated to choose the most suitable calculation
to study the energy structure of defects, for the long-range method/model and confirm the initial settings of the parame-
force of charge transfer is provided by the position of valence ters. Estimations are always handled by empirical adjustment
band/conduction band versus the redox potential of the without precise specifications. Among these modeling prin-
adsorbed substance on the external surface of photocatalyst, ciples, density functional theory (DFT) provides the relatively
which determines whether the photocatalytic reaction with acceptable data and is widely used in the calculation of
special substances would happen or not (see Figure 1). electronic structure of TiO2 [58–62].
Several experimental methods for OTDs are listed in
Table 1 and they are always used together to get the defects
2.4. 𝑛/𝑝-Type. TiO2 is one of the most extensively studied information.
photocatalysts. Pure TiO2 samples synthesized from con-
ventional preparation methods are mostly oxygen-deficient
nonstoichiometric compound or a solid solution of oxygen 2.6. Transient Local Heat. As has been reported, the kinetic
into TiO2−𝑥 lattice [5]. In consequence, oxygen vacancies as rate of photocatalytic reactions can be varied from different
well as Ti interstitials in TiO2 make it an 𝑛-type property of temperature and light intensity [63], and heat is one problem.
dominant materials, precisely written as TiO2−𝑥 [13]. How- For the sake of practical application of photocatalysts in ambi-
ever, the formation of metal-deficient TiO2 can be obtained ent environment, a set of coolers (mostly condensate water)
under strong oxidation at elevated temperatures [9, 53, 54] is usually equipped to provide moderate temperature for
and relatively a 𝑝-type behavior is found. laboratory-scale tests. However, ambient temperature could
It should be clear that, in the nonstoichiometric 𝑛-type not prevent the transient local heat that comes from (i) the
TiO2 , the charge carriers not only are the electrons but also released nonradiative thermal energy form recombination
may be the holes during the photocatalytic procedure. As and (ii) the slow diffusion of the adsorbed radiative infrared
the transfer rate of the holes is several orders of magnitudes light of the light source (solar or specially the Xe lamp with the
slower than electrons, the dominating charge carriers are power of 300 W or 500 W) in some lattice distortions. Here a
electrons and thus the TiO2 is called an 𝑛-type semiconduc- hypothesis is made that such heat do not or has little influence
tor. When the proportion of O atom in TiO2 rises, the TiO2 on the separation and migration of charge carriers.
may be identified as the 𝑝-type semiconductor taking holes
as the main charge carriers. The coexistence of 𝑛- and 𝑝-type 3. Generation of OTDs in TiO2
in TiO2 is shown in Figure 2 [8], as a result of distribution of
OTDs. 3.1. Removal of Oxygen in TiO2 . Ideal structure model of
To simplify the model of photocatalytic reactions in bridging oxygen vacancy in TiO2 (110) surface lattice is
particles, it is hypothesized that 𝑛-/𝑝-type can counteract shown in Figure 3(a). Figure 3(b) gives a direct picture for the
with each other during the long routes to the surface; thus a position of oxygen vacancies by STM, and it can be found
conception of “surplus 𝑛-type” or “surplus 𝑝-type” is usually that the bridging oxygen vacancies (Ob -vacs) are the main
introduced as there are only photoelectrons in 𝑛-type TiO2 surface defects. Figure 3(c) represents the electronic density
and vice versa. When TiO2 is used as an electrode, the scattering around a single oxygen vacancy [64] and it could
electrons and holes move efficiently toward the opposite be seen that the potential field of the neighbouring Ti is
Table 1: Common characterization techniques for defects.
Technique Characterization Evidence References

Colour of the materials Different from pristine TiO2 The defects maybe exist [123]
High-resolution transmission electron [72, 123]
The atomic lattice is blurred Maybe exists
microscopy (HR-TEM)
An optical absorption band above 400 [30]
Ultraviolet-visible spectroscopy (UV-vis) Maybe exists
nm
Type, relative concentration [124]
Photoemission spectroscopy (PL) The emission position and intensity
of defects
Variation in vibration of O and Ti-related [30, 38, 72]
Raman spectroscopy Type of defects
region
X-ray photoelectron spectroscopy (XPS) Valence state variation Type of defects mainly Ti3+ [30, 37, 72, 89]
𝑔 factor calculated from the position of Type of paramagnetic [35, 123, 125, 126]
Electron paramagnetic resonance (EPR)
the sharp signal defects
Positron annihilation lifetime spectroscopy Size, type, and relative [68]
The lifetime of the positrons
(PALS) concentration of defects
Scanning tunneling microscopy (STM) Light dot in pictures The type, position of defects [31, 113, 120]
Atomic force microscopy (AFM) Comparison of pictures The type, position of defects [38]
A narrow peak related to partial oxygen Rough concentration of [112, 123, 125]
Temperature programmed deoxidation (TPD)
loss according to temperature. oxygen defects
Electron energy loss spectroscopy (EELS) Energy loss Electronic change in defects [112]
Synchrotron radiation X-ray absorption fine Geometrical structure of [127]
Peak position
structure spectroscopy (XAFS) active sites
Acceptor∙− Potential/eV versus NHE

(iii) Reduction (pH= 7)
Acceptor −
TiO2 (ii) a
VB e− H2 /H2 O (−0.41 eV)
h O2 /O2 ∙− (−0.28 eV)
Eg (ii) b O2 /H2 O (+0.82 eV)
(i)
∙OH/OH− (+1.99 eV)
∙OH/H2 O (+2.77 eV)
CB h+
(ii) a Donor
(iii) Oxidation
Donor∙+ +
Figure 1: Main steps occurring in the photoelectrochemical mechanism. ((i) Photon absorption and electron-hole pair generation. (ii) Charge
separation and migration (a) to surface reaction sites or (b) to recombination sites. (iii) Surface chemical reactions at surface active sites, donor
oxidation at valence-band hole, or acceptor reduction at electron center.)
the most influenced site whereas the variations die largely in VO 󸀠󸀠 + 𝑒 ←→ VO 󸀠 (3)
distance. It reveals that OTDs can work as short-range traps in
capture charge carriers, which is crucial for charge migration [Ti4+ ] + VO 󸀠 ←→ [Ti3+ ] + VO 󸀠󸀠 (4)
in photocatalytic reactions. The formation processes of these
defects assist in the understanding of Figure 3(c). where Oa represents the oxygen atom that is taken away from
In an ideal defect-free lattice of TiO2 , the removal of the lattice, VO 󸀠󸀠 represents the corresponding empty position
an oxygen atom in lattice is usually accompanied with the (1), and VO 󸀠 also represents the empty position which origi-
exposure of the neighbouring metal atoms and the material nated from the removal of oxygen but with a localized single
would tend to maintain electrostatic balance according to the electron (3). [Ti4+ ] represents the exposed neighbouring Ti4+
following reactions: at oxygen vacancy (1) and [Ti3+ ] represents the exposed Ti
reduced by the excess electron (2) from O removal.
It can be seen from (1) that the removal of oxygen from
the lattice generates VO 󸀠󸀠 and further causes the formation of
2Ti4+ + O2− ←→ 2 [Ti4+ ] + 2𝑒/VO 󸀠󸀠 + Oa (1) VO 󸀠 (3) and the reduction of the neighbour metals (4) [6, 65].
Liu et al. [7] showed the relationship between the formation
[Ti4+ ] + 𝑒 ←→ [Ti3+ ] (2) of VO 󸀠 and the corresponding existence of Ti3+ during
reactions under light irradiation. Once photoinduced e-h pair

−2 −1/ is generated, the subsequent reactions could happen:
6
ℎV
TiO2 󳨀󳨀→ 𝑒− CB + ℎ+ VB (5)
−4 VO 󳰀󳰀 𝑒− CB + Ti4+ 󳨀→ Ti3+ trapped electron (6)

n
−1 ℎ+ VB + O2− 󳨀→ O− trapped hole (7)
/4
log[] [[] in molar ratio]
−6 Ti4+ Ti3+ 4ℎ+ VB + O2− 󳨀→ Oa + VO 󸀠󸀠 (8)

The photoinduced electrons and holes should also be
identified as defects [71]. Accordingly, the recombination
−8 of electrons and holes may be also called the reaction of
“electron defects” with “hole defects” in photocatalysts.
The excited electrons could react with lattice Ti4+ and
then Ti3+ is generated with a trapped electron (6). At the same
−10
p TiO2−x time, a hole could oxidize a nearby lattice O2− , leaving an O−
in lattice (7). Further, oxygen vacancy would be created under
1073 K strong oxidizing conditions, generating atom O (Oa ) in lattice
A = 1.0·10 −4 (8). Thus, the photoinduced defective surface/subsurface is
−12 performed under irradiation, and light energy can be stored
−15 −10 −5 0 5 as the form of electronic energy during this process.
log p(O2 ) [p(O2 ) (Pa)]
Figure 2: Oxygen vacancies and Ti-related defects (OTDs) related 3.3. Doping-Induced Defects in TiO2 . Foreign elements are
𝑛/𝑝-type TiO2 at 1073 K [8]. usually introduced to pristine TiO2 to make full use of
solar light. The formation of dopant defects is frequently
accompanied by the generation of OTDs [72].
H2 treatment up to 700∘ C (Figure 4). As the temperature Anion Doping. Di Valentin et al. [73] found from DFT
increased, more Oa were removed by H2 . Magnetic Ti3+ calculation that N doping was likely to be accompanied by the
defects generation followed the VO 󸀠 formation, indicating formation of oxygen vacancy, because the energy consumed
the reaction of the trapped localized single electron of VO 󸀠 by oxygen vacancy was substantially reduced by N doping.
with the near Ti4+ (4). This process was mainly controlled Chen et al. [74] obtained an N-doped TiO2 samples in NH3 ,
by temperature [66]. Besides, temperature has great influence and OTDs were found to be coexisted on the surface with
on the transition of the crystalline structures of TiO2 , and N impurities. Recent work of Di Valentin and the coworkers
the formation energy order of oxygen vacancies on surfaces [75] revealed that oxygen vacancies generated when doping F
is brookite (5.52 eV) > anatase (5.58 eV) > rutile (5.82 eV), in TiO2 . The formation of Ti3+ occurred when doping B due
which may result in the different concentration of OTDs [67]. to the charge compensation, while C and N did not donate
The control of ambient O2 concentration/pressure can excess electrons to lattice oxygen.
also adjust the concentration and the distribution of defects
in a feasible range [8]. The occurrence of VO 󸀠󸀠 may suffer the Cation Doping. It is found by Jing et al. [76] that doping of Zn
reverse reaction under a wide range of oxygen activities and increased the concentrations of oxygen vacancies and oxygen
Ti vacancies can be obtained from the prolonged oxidation of vacancies also served to assist the formation of Zn-doped
TiO2 at elevated temperatures [9]. Under ambient condition TiO2 samples. Following the static equilibrium, the Zn atoms
at room temperature, the VO 󸀠󸀠 in TiO2 dies out gradually, would
and this usually causes weakened photocatalytic efficiency in
ZnO ←→ ZnTi 󸀠󸀠 + Oa + VO 󸀠󸀠 (9)
TiO2 .
Considering the oxygen activity and temperature, surface where ZnTi 󸀠󸀠 represents Ti substituted by Zn in lattice, Oa is
treatment methods (e.g., annealing in vacuum condition also the O atom removed, and VO 󸀠󸀠 represents the Zn-doping-
[68], thermal treatment under reducing atmosphere (H2 , induced generation of oxygen vacancy, or according to the
CO, NO), and bombardment using electron beam [69, charge neutrality,
70], neutron, or 𝛾-ray) are introduced to obtain defective
surfaces. The bulk ODTs can be directly obtained from Ti4+ + O2− ←→ Zn2+ + VO 󸀠󸀠 (10)
sputtering method without further modifications on the TiO2
The introduction of Cr [77] and Fe [78] as the acceptor-
samples.
type defects in TiO2 practically undergoes the similar way in
generating oxygen vacancy:
3.2. Light-Induced Defects in TiO2 . Another way generating
OTDs came out of the application of TiO2 in photocatalytic Cr2 O3 ←→ 2CrTi 󸀠 + 3Oa + VO 󸀠󸀠 (11)
Ti5c Ob
Ob
Ob -vac Vac
Ti5c O Ti
Ti
Op
O
O
Ob -vac
[001] Ti
O
̄ Ti
[110] O
(a) (b) (c)
Figure 3: (a) Pseudospace-filling model of ideal bulk-terminated TiO2 (110) with a bridging oxygen vacancy. Blue (red) spheres are oxygen
(titanium) atoms. (b) STM image of (1 × 1) TiO2 (110) surface. The bright rows correspond to surface Ti5c sites (red ball in (a)). Black row
is bridging oxygen (Ob ) and Ob -vacs are marked as the bright protrusions in the black row [43]. (c) Redistribution of the surface electronic
density caused by single oxygen vacancy [64].
14 When it comes to the donor-type Nb-doped TiO2 , the

25
reactions are [79–81]
13
(b) 20 Nb2 O5 ←→ 2NbTi 󸀠 + 5Oa + 2𝑒󸀠 (13)
Intensity (a.u.)
Intensity (a.u.)
10
(a) 15 2Nb2 𝑂5 ←→ 4NbTi 󸀠 + 𝑉Ti + Oa (14)
8
10 𝑉Ti is Ti vacancy in (14). The occurrence of (13) and (14) is
6 also controlled by the doping condition, commonly the oxy-
5 gen activity. It can be seen in (13) that electron can be released
4
by Nb doping under the reduced conditions [81]. The excess
2 0 electrons result in the remarkably enhanced conductivity, and
this metallic-type property may be helpful to promote the
0 100 200 300 400 500 600 700 migration of the charge carriers in photocatalytic reactions.
H2 treatment temperature (∘ C) It could be found that chemical valence states of the
VO 󳰀
dopants play an important role on the formation of defects
Ti3+ under preparation conditions. Besides, it was also reported
that the doping of anions and cations in pristine TiO2 was
Figure 4: EPR intensity of oxygen vacancies and Ti3+ generation all accompanied by the formation of oxygen vacancies [82].
under thermal treatment with H2 [7]. At the same time, the formation of the corresponding color
centers (e.g., F, F+ , F++ [83], and Ti3+ ) revealed the probable
effects of defects in photocatalytic reactions [84].
or 4. The Function of Defects in Photocatalysis
3 The function of OTDs in photocatalysis can mainly be

Cr2 O3 + 6Tii 󸀠 ←→ 2CrTi 󸀠 + 6Tii 3+ + O2 (gas) (12)
2 (1) to modify the band energy structure of the pristine
TiO2 as the defect states,
(2) to trap charge carriers in the migration pathways as
The Tii 󸀠 in (12) presents the interstitial Ti. It could be
the electron pool or recombination center,
seen from (11) and (12) that Cr atoms would undergo different
reaction pathways. Besides the oxygen activity, the chromium (3) to influence the adsorption of reactants (e.g., H2 O,
concentration was found to be another factor to influence O2 , CO2 , and organic pollutants) as the active sites.
these two reactions [77]. When the chromium concentration
was lower than 3 atom %, it mainly underwent (12), producing 4.1. Function of OTDs on Energy Structure. The host energy
interstitial Ti3+ in lattice. When the chromium concentration structure of pristine TiO2 is constructed by valence band
was in the range of 4-5 atom%, oxygen vacancies were mainly (O 2p orbitals) and conduction band (Ti4+ 3d orbitals). The
created by (11), balancing the charge variation during Cr- energy level of TiO2 as well as other outstanding photocata-
doping as the acceptor defect center. lysts is shown in Figure 5 [85].
−2.0 and the highest occupied molecular orbital (HOMO), from
ZnS
SiC
ZrO2
GaP
SrTiO3
KTaO3
the crystal field theory point of view.
CdSe
CdS
−1.0
2
TiO2
More discussion of the relationship between OTDs states
V versus NHE (pH0)
1.75 eV MoS
Fe2 O3
1.1 eV Si
Wo3
2.4 eV
H+ /H2 and the crystal field arguments was carried out by Morgan
1.7 eV
0 3.2 eV
3.6 eV
3.0 eV
5.0 eV
3.4 eV
2.25 eV
3.0 eV
and Watson [65]. They used an on-site correction DFT
2.3 eV
1.0
O2 /H2 O calculation to study the oxygen vacancies in rutile (110),
2.8 eV
2.0 (100), (101), and (001) reduced surfaces, and it was found that
the oxygen vacancy of the reduced (110) surface introduced
3.0 an occupied defect state of 0.7 eV below the bottom of the
4.0 conduction band. The defect states were also shown in the
other three reduced surfaces and varied from each other.
Figure 5: Band structures of TiO2 and other popular semiconduc- However, the defect states seem more important than the
tors [85]. exposed surface or crystal form in photocatalytic reactions.
Liu et al. [92] compared the oxygen vacancies in anatase,
rutile, and brookite obtained from helium pretreatment in
The energy level of OTDs is recognized to aid band gap moderate temperature. The characterization results revealed
narrowing and the formation of the main active sites in favor that the oxygen vacancies were created in anatase and
of visible light adsorption [34, 46, 66, 86]. Figure 6 gives brookite, which led to a remarkable increase in photocatalytic
the STM images of defective TiO2 surface before and after CO2 reduction ability. On the contrary, the treated defect-
visible light irradiation. These images provide a clear evidence free rutile and the untreated TiO2 samples did not have
of oxygen vacancies function as the visible light response photocatalytic activity in this reaction. Liu et al. [92] also
sites [87], which can be attributed to the electronic structure examined the intermediates/radical and the corresponding
of OTDs. Accurate calculation of the defect state of OTDs final products and found that the reduction of CO2 may
in TiO2 energy structure is in urgent need, because energy undergo different pathways. It is deduced that OTDs are
structure of photocatalyst will influence light absorption and crucial to such difference, for the reactants (CO2 , H2 O, CO2 − ,
charge carriers migration. and CO) are all tend to adsorb on these surface active sites,
According to (1)–(4), once oxygen atom is removed, and which are about to discuss later in this review.
VO 󸀠󸀠 , VO 󸀠 , and Ti3+ are left behind. The defect states of these
defects are different in the band gap, as has been reported
by Janotti et al. [88] and Zou et al. [89]. Janotti and the 4.2. Function of OTDs on Charge Transfer. When irradi-
coworkers [88] found that oxygen vacancies were shallow ated with light, an excited single electron moves rapidly in
donor and VO 󸀠󸀠 defect state presented lower energy than VO 󸀠 response to an applied electric field (i.e., voltage supplied
for all Fermi-level positions in the band gap. Zou et al. [89] by power source or difference of potential between energy
introduced VO 󸀠 in TiO2 by calcining TiO2 precursor with structure of TiO2 and the redox potential of the adsorbed
imidazole and hydrochloric acid at the elevated temperature. species) by HOMO-LUMO promotion. Franck-Condon fac-
The paramagnetic oxygen vacancies VO 󸀠 were proven to form tors of this process are usually very small as a result of little
mid gap electronic state within the band gap of TiO2 , and lattice distortion when creating an electron.
thus visible light photocatalytic activity was performed by the The transfer of charge carriers follows the band model
electron transition from the VO 󸀠 mid gap to the conductor and the hopping model [93] and is limited by the vanishing
band of TiO2 . Here the VO 󸀠 acts as the donor. This conclusion reorganization of energy according to Marcus-Hush electron
is the same with the results that were previously reported by transfer theory. The energy initially provided by a photon to
Serpone [90] and Chen et al. [83]. As to oxygen vacancies an electron can be consumed by the lattice distortion, and
VO 󸀠󸀠 , Zou and the coworkers [89] believed that they could if the remaining energy is sufficient to overcome the surface
serve as an acceptor as well as Ti3+ , forming an unoccupied barrier, the charge could be utilized by the adsorbed species.
state below the bottom of the conduction band. The energy The annihilation at the recombination center is another quick
levels of OTDs in TiO2 were summarized by Nowotny and vanishing approach for the charge carriers. Yu et al. [94] pro-
his group as in Figure 7 [5]. posed three recombination mechanisms in semiconductors:
However, the isolate electronic band fails to explain the (i) band-to-band recombination, which happens between the
contradiction of the strongly localized small polarons versus excited electron and the hole lying in the empty VB, and this
the delocalized free polarons in experiments. Hence, hybrid reaction is limited by the production of available electrons
function is introduced appropriately and serves as a workable and holes and is a second order to the concentration of
theory. Janotti et al. [91] proposed that there exist two charge carrier (ii) trap-assisted recombination, which directly
kinds of hybrid functions in the electronic band: (i) between happens between the excited electrons and holes in the
the electrons and the conduction band in the presence of VB under the aid of “trap” state, and this reaction is also
delocalized free electrons and (ii) between the electrons limited by the concentration of charge carriers described
and the oxygen vacancies as the form of oxygen vacancies as Shockley-Read-Hall Model (SRH model); (iii) Auger
complexes and the ionized shallow-donor impurities. This recombination, which happens when the excited electron and
reveals the influence of the defect states on shifting the hole recombine, releasing the energy to enhance the energy
position of the lowest unoccupied molecular orbital (LUMO) of another electron or hole. It is discovered by Zhang et al.
(a) (b)
Figure 6: STM images of oxygen deficient TiO2 surface before (a) and after (b) visible light irradiation [87].
O2(gas)
Ec
O2(ads) + e󳰀 O−2 + e󳰀 2O− + 2e󳰀 (2O2− )(latt )
1.18 eV
4+ 2− 3+ 4+ 4+
VO 󳰀󳰀 1.47–1.56 eV Ti4+ O2− Ti3+ VO Ti O Ti O2− Ti O2− Ti
Energy
Ti3+ 3 eV O2− e󳰀 O2− O2− e󳰀 O2− O2− O2−

2− 2− 2− 2− 2−
VTi4+ Ti4+ O Ti4+ O Ti4+ O Ti4+ O Ti4+ O Ti4+
1.15 eV O2− O2− O2− O2− O2− O2−
E
Figure 8: The Ti vacancy functions as the active site [96].
Figure 7: The energy levels of OTDs in TiO2 [5].
the subsurface of an 𝑛-type TiO2 , it can be deduced that this

one excess electron in VO 󸀠 would subsequently
[95] that charge transfer follows the first order kinetic model (i) meet the h+ and recombine,
on surface under UV irradiation, because of the abundant (ii) reduce one Ti4+ to Ti3+ hindering the entrance of
OTDs serving as trap-assisted recombination centers. In the other electrons into this Ti-site,
subsurface, charge transfer mainly follows the second order
kinetic model for the OTDs. (iii) transfer along the surrounding Ti4+ to the surface
The exciting sites are widely distributed among the solid. active sites, maybe as the form of neutralized state,
Under light irradiation, the excitation mainly occurs around (iv) enter into another VO 󸀠󸀠 .
the OTDs as shown in Figure 6, and the recombination would
be in the form of SRH model. However, exact dynamic By this mean, the original VO 󸀠󸀠 is regenerated and
behavior of a single charge carrier remains unclear. The this process repeats until photocatalytic reaction ends. This
scope into the molecular level and the study on defect-related reiteration behavior not only prolongs the migration routes
characterization techniques are urgently needed. for the electron to the surface but also highly increases the
From the molecular point of view, short-range electronic recombination opportunity of e− with h+ . If the prime VO 󸀠󸀠 is
driven forces provided by bulk OTDs can work efficiently located on the surface, the entered electrons can be given to
only in the distance of several angstroms in bulk. This force is the dissociative adsorbed species here. Besides, if the arrival
weaker than that provided by surface OTDs as a result of the of electrons on the surface occurs along Ti atoms, the finally
broken symmetry in lattice. Despite working in short range, formed Ti3+ can also serve as the active sites toward adsorbing
the effect of OTDs cannot be ignored but taken into account O2 scavenger. The transfer of the charge carriers to the active
seriously. sites are shown in Figure 8.
As calculated by Janotti et al. [91], VO 󸀠󸀠 primly acts as Except for these defects, Ti vacancy reported by Nowotny
the acceptor but when it receives one electron, then VO 󸀠 was et al. [96] also assisted the transfer of electrons to the
formed and it acts more as a donor than an acceptor, in adsorbed species, as shown in Figure 9. OTDs on the surface
the photocatalytic reaction. If the prime VO 󸀠󸀠 is located in can enhance the separation of photogenerated electrons
4e󳰀 4.3.1. Adsorption of Oxygen. The introduction of O2 is of

2H2
significant importance in photocatalytic reactions, such as
Electrolyte O2 Cathode photoinduced refractory organics degradation systems and
Active water splitting. Experimental results have proven that the
complex
∗ +
2H2 O(ads) − 4e󳰀 2(H2 O2+ )∗ (ads) 2O (ads) + 4H (aq) existence of O2 can significantly enhance the degradation
− efficiency, and the addition of O2 with different dosages
O2− O2− O O2− O2− O2−
is widely investigated in water treatment processes. During
Ti4+ O2− Ti4+ O− VTi O− Ti4+ O2− Ti4+ O2− Ti4+
these processes, the adsorbed O2 at the active sites can
O2− O2− O− O2− O2− O2− serve as the electron scavenger [100]. These scavengers can
facilitate the charge separation, prevent the electron-hole
Ti4+ O2− Ti4+ O2− Ti4+ O2− Ti4+ O2− Ti4+ O2− Ti4+ recombination, and generate the ∙ O2 − for deep oxidation of
the organic specials. Figure 10 shows the subsequent reactions
Figure 9: The Ti vacancy functions as the active site [96].
of ∙ O2 − .
It can be seen that the intermediate products are hydroxyl
radical ( ∙ OH) and other oxidation species, which further
and holes by acting as the electron pools on surface and thus promote the mineralization of organic pollutants. The half
prolong the lifetime of both the electrons and holes. reaction led by photogenerated electrons is equally important
In a typical reaction procedure, the photogenerated to the reaction led by photogenerated holes, for these two
charge carriers experience different procedures between the pathways have a synergistic effect. However, during water
photocatalytic reactions and the photogeneration of elec- splitting, the existence of O2 in water tends to assist the
tricity when TiO2 is used as the electrode. Photocatalytic generation of O2 gas but not the H2 . By consequence,
excitation mainly happens in surface and subsurface, and the the experimental tests or comparisons of the H2 evolution
charge carriers must conquer these blockings as activity of photocatalysts are always performed in vacuum
or inert gases (i.e., N2 , Ar). Besides, the adsorption of
(i) localization or trapping in the recombination centers, oxygen by the active sites can also be capable of causing
(ii) consuming of migration energy in the distorted Ti–O upward band bending, which is of great importance in
bond caused by lattice defects in the subsurface, many of the applications of TiO2 (i.e., as the film elec-
trodes). Thus it is necessary to study the oxygen adsorp-
(iii) localization or trapping in the surface ionic defects, tion behavior and its distribution feature on the TiO2
(iv) consuming of migration energy in the distorted Ti–O surfaces.
bond caused by lattice defects on the surface, It is mostly accepted that adsorbed O2 species occur at
oxygen vacancies in an idealized model, and the bridge-
(v) surface barriers caused by the binding of the dissocia- bonded oxygen vacancies are believed to be the most pre-
tive adsorbed molecules with surface active sites such ferred sites for oxygen chemisorption on the surface [101].
as oxygen vacancies and Ti-related defects. Xu et al. [102] investigated the interaction between O2 and
reduced TiO2 (110) surface by DFT calculations, and the
Photocatalytic reaction (i.e., degradation of organic com- results showed oxygen interaction with oxygen vacancies as
pounds and water splitting) processes mainly suffer the the dissociative configuration form of O–O complex between
surface/subsurface OTDs, whereas the photovoltaic reaction in-plane oxygen and Ti atoms in room temperature. Other
must bear the OTDs in bulk. Here the movement of charge reports proposed that surface Ti-related defects (mainly
carriers can be delayed [97] by trapping or localizing in the interstitial Ti and Ti3+ ) were also the active adsorption sites
lattice of bulk OTDs and the migration energy can is reduced for oxygen [34].
by the bulk lattice distortion. Furthermore, in the interface The OTDs on the surface can act as the charge donor for
with large amount of lattice defects (e.g., the connected the transfer of charge carriers from TiO2 to oxygen atoms.
interface of the layered electrode/film be constructed by Except for the surface OTDs, bulk OTDs like Ti3+ ion can
multilayered materials), the bond distortion may cause a large also provide excess electrons to the adsorbed O2 at ∼410 K
problem [98, 99] because of the chemical tension. However, and the desorption of O2 occurs when the surface interstitial
the defects, which function as donor or acceptor in the Ti and Ti3+ act as the electron acceptor in the same condition.
interfaces, could promote the charge transfer by chemical These two models are shown in Figure 11. Aschauer and the
adsorption, which is of vital importance in the photovoltaic coworkers [103] further proposed that O2 was more favorable
cells. to adsorb at shallow subsurface interstitial Ti. The bulk
defects were also estimated to have more pronounced effect
4.3. Function of OTDs on Adsorption. Oxygen, water, or than lower-lying interstitials at providing excess electrons
organic compounds with electron-rich functional groups and contributing to O2 adsorption. Zhang and Yates [95]
can adsorb at OTDs by the electronic driven force toward proposed that desorption of oxygen could happen when
electrostatic equilibrium. The adsorption behavior of OTDs photoinduced holes reacted with adsorbed O2 − . However, the
promotes the charge transfer efficiency from solids to external molecular-scale mechanism of desorption of the oxygen and
reactants, and thus makes OTDs flexible active sites on the its subsequent reaction with other adsorbed substances is still
surface. unclear.
O2 + H2 O2 e−
H+ HO2 ∙OH + OH−
HO2 −
e− c.b.
O2 e H+
O2 − H2 O2 ∙OH + OH− + O2
O2 − H2 O O2 −
O2 + HO2 − + OH−
TiO2 + h
− − −
R , H2 O Oxidized
h+ v.b. (1) >TiOH R∙ O2 , HOO∙, HOOH, HOO , HO∙, OH
(2) R ∙ROH Activated oxygen species products
Thermal
oxidation
CO2
mineralization
Figure 10: The photocatalytic reactions with electrons and holes [121].
O2 O2 O2 O2 O2 O2 O2 O2 Ob
Ti5c
Model A
Ob -vac
O2 Oad O2 O2 O2 Oad O2 Adsorption

of water
Ti3+
Model B
Figure 11: The schematic diagram for the influences of OTDs on O2

adsorption. Model A: O2 adsorption on surface OTDs and Model Dissociation
B: surface oxygen distribution influenced by surface and bulk OTDs of water
[103].
4.3.2. Adsorption of Water. The efficiency of photocat-

alytic degradation of gas phase organic compounds can
be improved by moderating the dosage of water [104]. In
Figure 12: The dissociation of water in bridging oxygen vacancy.
aqueous solution, the hydrophilic surfaces tend to possess
Green spheres denote O atoms with two H pink spheres [122].
higher photocatalytic activity than hydrophobic surfaces. It
is proposed that water serves as a vital media to promote
the fast diffusion of OH radicals from TiO2 surface to the
near-surface region and thus remarkably improve the pho- happens at OTDs [105–108], mainly at the bridge-bonded
tocatalytic efficiency. Another reason for this improvement is oxygen vacancies, where H2 O dissociates leaving one pair of
attributed to the tendency of organic contaminant adsorption neighbouring –OH groups (Figure 12). The newly formed –
toward the OTDs (the adsorption of organic compounds OH can assist the redistribution of the defect electrons which
by surface defects is illustrated in the next section). The are originally trapped at subsurface sites to its neighboring
importance of the application of water in water splitting as the surface Ti4+ sites [109, 110], and thus the excess electrons (e.g.,
reactant and in photovoltaic cell as the electrolyte solution is the photogenerated electrons) can be forced onto exposed
very clear and needs no further illustration. surface and undergo further reactions. Further, Aschauer
The occurrence of H2 O adsorption on TiO2 surface et al. [111] proposed that subsurface defects could promote
can be in the forms of molecular absorption, dissociative the binding between water and surface defects by lowering
adsorption, and the transition state between them (Figure 12). the desorption energy of adsorbed water at OTDs. The
Molecular adsorption as physical absorption occurs mostly water adsorption energy to the defect-free stoichiometric
at surface radical groups as −OH and surface defects, and surface is higher than defective surfaces [111] (shown in
this kind of H2 O serves more as solution or media than Figure 13), implying a less effective photocatalytic activity on
as reactant. The vast majority of dissociative adsorption the stoichiometric TiO2 .
Reaction coordinate
0.0
Adsorption energy (eV)

(1) Molecular adsorption
Stoichiometric
2
3
(2) Transition state
O vacancy
1
(3) Dissociative adsorption −1.2 Ti interstitial
Figure 13: The water adsorption state on O vacancy, Ti interstitial and stoichiometric surface [111].
Table 2: Possible reaction pathways for defective TiO2 .
Phase CO2 photoreduction with H2 O vapor

H2 O + h+ → H+ + OH∙ (1) CO2 + Ti3+ → Ti4+ + CO2 − (2)
+ −
OH∙ + CO2 → HCO3 (3) CO2 − + H+ + 𝑒− → CO + OH− (4)
Defective TiO2 anatase and brookite − − 2−
CO2 + CO2 → CO + CO3 (5) CO2 + [Ti − Vo − Ti4+ ] ↔ CO + [Ti4+ − O2− − Ti4+ ] (6)
− 3+
𝑒− H∙ H∙
CO, HCO3 − , HCOOH 󳨀→ C(ads)⋅ 󳨀󳨀→ CH3 ⋅ 󳨀󳨀→ CH4 (7)
+ −
CO2 + 2H + 2𝑒 → HCOOH (8) CO2 − + 2H+ + 𝑒− → HCOOH (9)
Defective TiO2 brookite 𝑒− ,H+
HCOOH → CO + H2 O (10) CO, HCOOH 󳨀󳨀󳨀󳨀→ CH4 (11)
It is interesting that the electronic structure of surface different defects may cause different degradation pathways
oxygen vacancies can hardly be affected via water dissociation [45, 115, 116]. This variation would result in the change of the
at these sites [112], not influencing the subsequent physical reaction kinetic, adsorption-desorption completion toward
adsorption of O2 toward these oxygen vacancies [113] and the surface active sites with O2 and H2 O [117], mineralization
bridging hydroxyls [114]. Henderson and the coworkers [112] degree, photocatalytic quantum yield, and catalyst poisoning
also explained the negative effect of excess water in gas-phase degree as well [118]. Therefore, it is still necessary to discuss
photocatalysis. It is proposed that the second-layer H2 O is this problem in the view of microcoscopic view. Zhang et
sufficient to inhibit O2 adsorption towards the active sites. As al. [119] studied the adsorption behavior of methanol on
the effect of O2 scavenger was weakened, the photocatalytic TiO2 and found that the methanol molecules are mainly
efficiency would be lowered. distributed on bridging oxygen vacancies (Figure 14).
The adsorption of organic species to TiO2 surface defects
4.3.3. Adsorption of Organic Species. Degradation of organic is widely studied by modeling of the process and theoretical
compounds by heterogeneous photocatalysts starts by calculation. However, it is hard to build the adsorption model
adsorbing organic specials, the rate of which is commonly because of the complexity of the various organic compounds.
recognized to determine the overall photocatalytic efficiency. There exist no generally acceptable results even for a single
The adsorption behavior of the organic compounds follows alcohol molecule. Zhang et al. [120] introduced an in situ
the single molecule adsorption to the surface active sites STM to study the methanol adsorption on TiO2 surface.
and can be described by Langmuir adsorption isotherm. O−H bond scission on oxygen vacancies was found to be
The adsorption mass of the substrate by TiO2 particles is the dominant manner for methanol dissociation, prior to
usually very small due to the limitation of surface active C−O bond scission. This result is of great importance for the
sites. TiO2 nanostructures with high surface area have exploration of the mechanisms in the methanol reforming
been widely studied in the adsorption of organic species. and organic species degradation. Farfan-Arribas et al. [69]
However, the surface area can hardly essentially change the compared the adsorption behavior of ethanol, n-propanol,
adsorption behavior of the organic substrates, moving from and 2-propanol. It is found that the coverage of these com-
the near-surface region to the surface active sites. It can be pounds increased and they tended to undergo decomposition
supposed by the deduction from O2 and H2 O adsorption with the increased concentration of oxygen vacancies. Table 2
that surface defects as OTDs are the main sites for the also provides an evidence for altering the reaction pathways
dissociative adsorption/chemical adsorption whereas the by surface defects as OTDs in photocatalytic reactions. This
subsurface disordering defects tend to assist the physical reveals a surface defects-related change in reaction pathways
absorption on the surface. On the other hand, the chemical which is occurring, and it is important to understand the
adsorption of organic compounds and their by-products in mechanism of photocatalytic reactions.
(a) (b)
Figure 14: STM images of the methanol molecules and oxygen vacancies distribution on TiO2 surface. (a) Before methanol exposure, BBOv
represents the bonding bridging oxygen in the shallow bright color. (b) After methanol exposure, the strong bright dots reveal the methanol
adsorption sites [119].
5. Conclusion Remarks 2013J4100110), the Key Laboratory of Fuel Cell Technology

of Guangdong Province, and the Key Laboratory of Envi-
Oxygen vacancies and Ti-related defects are the main lattice ronmental Pollution Control and Remediation Technology of
defects in TiO2 . The formation of oxygen vacancies, VO 󸀠󸀠 and Guangdong Province (no. 2011K0011).
VO 󸀠 , and the related Ti3+ defects are described. It provides
an internal relationship between the defects, which is vital
for understanding the behavior of the charge carriers in References
photocatalysis. Once the defects are introduced, HOMO- [1] Z. Zou, J. Ye, K. Sayama, and H. Arakawa, “Direct splitting of
LUMO orbital can be reconstructed and the electronic cloud water under visible light irradiation with an oxide semiconduc-
density of pristine TiO2 can be redistributed. Such electric tor photocatalyst,” Nature, vol. 414, no. 6864, pp. 625–627, 2001.
properties directly result in the narrowing of band gap [2] J. Tang, J. R. Durrant, and D. R. Klug, “Mechanism of photo-
and the trapping of photoinduced charge carriers in sur- catalytic water splitting in TiO2 . Reaction of water with photo-
face/subsurface. OTDs in the subsurface mainly serve as the holes, importance of charge carrier dynamics, and evidence for
recombination center, and the concentrated lattice distortion four-hole chemistry,” Journal of the American Chemical Society,
would largely consume the motion energy of excited charge vol. 130, no. 42, pp. 13885–13891, 2008.
carriers. Both of them would deadly lower the life time of [3] J. Yu and J. Ran, “Facile preparation and enhanced photo-
the photogenerated charge carriers. OTDs in surface tend to catalytic H2 -production activity of Cu(OH)2 cluster modified
function as the electron pool favoring the e-h separation and TiO2 ,” Energy and Environmental Science, vol. 4, no. 4, pp. 1364–
serve to adsorb active species as a result of the electronic force 1371, 2011.
toward electrostatic neutralization. Surface OTDs would also [4] I. Chung, B. Lee, J. Q. He, R. P. H. Chang, and M. G. Kanatzidis,
mediate the charge transfer between the solid and the external “All-solid-state dye-sensitized solar cells with high efficiency,”
reactants. Moreover, the selective dissociated adsorption of Nature, vol. 485, no. 7399, pp. 486–489, 2012.
substance onto different kinds of OTDs is probably decisive [5] M. K. Nowotny, L. R. Sheppard, T. Bak, and J. Nowotny, “Defect
to the exploration of the reaction mechanism. To study the chemistry of titanium dioxide. Application of defect engineer-
ing in processing of TiO2 -based photocatalysts,” Journal of
behavior of defects caused by electronic driven forces is
Physical Chemistry C, vol. 112, no. 14, pp. 5275–5300, 2008.
vitally necessary for photocatalysis, and it will promote the
[6] J. Shi, J. Chen, Z. Feng et al., “Photoluminescence characteristics
construction of environmentally friendly high-performance
of TiO2 and their relationship to the photoassisted reaction of
photocatalysts for diverse specific applications. water/methanol mixture,” Journal of Physical Chemistry C, vol.
111, no. 2, pp. 693–699, 2007.
Acknowledgments [7] H. Liu, H. T. Ma, X. Z. Li, W. Z. Li, M. Wu, and X. H. Bao,
“The enhancement of TiO2 photocatalytic activity by hydrogen
The research was financially supported by the Natural Science thermal treatment,” Chemosphere, vol. 50, no. 1, pp. 39–46, 2003.
Foundations of China (nos. 21103235, 21067004, 51208539), [8] T. Bak, J. Nowotny, and M. K. Nowotny, “Defect disorder of
the Natural Scientific Foundation of Guangdong Province titanium dioxide,” Journal of Physical Chemistry B, vol. 110, no.
(no. S2012010010775), Science and Technology Plan Projects 43, pp. 21560–21567, 2006.
of Guangdong Province (no. 2010B010900033), the Sci- [9] M. K. Nowotny, T. Bak, and J. Nowotny, “Defect disorder and
ence and Technology Programme of Guangzhou City (no. semiconducting propertes of titanium dioxide single crystal,” in
Solar Hydrogen and Nanotechnology, vol. 6340 of Proceedings of [25] I.-C. Kang, Q. Zhang, S. Yin, T. Sato, and F. Saito, “Novel
SPIE, pp. 1–8, August 2006, 634016. method for preparation of high visible active N-doped TiO2
[10] M. V. Ganduglia-Pirovano, A. Hofmann, and J. Sauer, “Oxygen photocatalyst with its grinding in solvent,” Applied Catalysis B,
vacancies in transition metal and rare earth oxides: current state vol. 84, no. 3-4, pp. 570–576, 2008.
of understanding and remaining challenges,” Surface Science [26] D. Li, H. Haneda, N. K. Labhsetwar, S. Hishita, and N. Ohashi,
Reports, vol. 62, no. 6, pp. 219–270, 2007. “Visible-light-driven photocatalysis on fluorine-doped TiO2
[11] L.-B. Xiong, J.-L. Li, B. Yang, and Y. Yu, “Ti3+ in the surface powders by the creation of surface oxygen vacancies,” Chemical
of titanium dioxide: generation, properties and photocatalytic Physics Letters, vol. 401, no. 4–6, pp. 579–584, 2005.
application,” Journal of Nanomaterials, vol. 2012, Article ID [27] G. Yang, Z. Yan, and T. Xiao, “Low-temperature solvothermal
831524, 13 pages, 2012. synthesis of visible-light-responsive S-doped TiO2 nanocrystal,”
[12] S. Sato, R. Nakamura, and S. Abe, “Visible-light sensitization Applied Surface Science, vol. 258, no. 8, pp. 4016–4022, 2012.
of TiO2 photocatalysts by wet-method N doping,” Applied [28] Q. P. Wu and R. van de Krol, “Selective photoreduction of nitric
Catalysis A, vol. 284, no. 1-2, pp. 131–137, 2005. oxide to nitrogen by nanostructured TiO2 photocatalysts: role
[13] S. U. M. Khan, M. Al-Shahry, and W. B. Ingler Jr., “Efficient of oxygen vacancies and iron dopant,” Journal of the American
photochemical water splitting by a chemically modified n- Chemical Society, vol. 134, no. 22, pp. 9369–9375, 2012.
TiO2 ,” Science, vol. 297, no. 5590, pp. 2243–2245, 2002. [29] A. Nishimura, G. Mitsui, K. Nakamura, M. Hirota, and E. Hu,
[14] J. Wang, Q. Cai, H. Li, Y. Cui, and H. Wang, “A review on “CO2 reforming characteristics under visible light response of
TiO2 nanotube film photocatalysts prepared by liquid-phase Cr- or Ag-doped TiO2 prepared by sol-gel and dip-coating
deposition,” International Journal of Photoenergy, vol. 2012, process,” International Journal of Photoenergy, vol. 2012, Article
Article ID 702940, 11 pages, 2012. ID 184169, 12 pages, 2012.
[15] W. Zhou, P. Zhang, and W. Liu, “Anatase TiO2 nanospin- [30] M. S. Hamdy, R. Amrollahi, and G. Mul, “Surface Ti3+ -
dle/activated carbon (AC) composite photocatalysts with containing (blue) titania: a unique photocatalyst with high
enhanced activity in removal of organic contaminant,” Inter- activity and selectivity in visible light-stimulated selective oxi-
national Journal of Photoenergy, vol. 2012, Article ID 325902, 7 dation,” Acs Catalysis, vol. 2, no. 12, pp. 2641–2647, 2012.
pages, 2012. [31] Y. B. Xia, B. Zhang, J. Y. Ye, Q. F. Ge, and Z. R. Zhang, “Acetone-
[16] Y. Yao, N. Zhao, J. J. Feng, M. M. Yao, and F. Li, “Photocatalytic assisted oxygen vacancy diffusion on TiO2 (110),” Journal of
activities of Ce or Co doped nanocrystalline TiO2 -SiO2 com- Physical Chemistry Letters, vol. 3, no. 20, pp. 2970–2974, 2012.
posite films,” Ceramics International, vol. 39, no. 4, pp. 4735–
[32] E. Cavaliere, L. Artiglia, G. A. Rizzi, L. Gavioli, and G. Granozzi,
4738, 2013.
“Structure and thermal stability of fully oxidized TiO2 /Pt(111)
[17] Y. Miseki, S. Fujiyoshi, T. Gunji, and K. Sayama, “Photocatalytic polymorphs,” Surface Science, vol. 608, pp. 173–179, 2013.
water splitting under visible light utilizing I3− /I− and IO3− /I−
[33] X. Shao, Y. Cui, W. D. Schneider, N. Nilius, and H. J. Freund,
redox mediators by Z-scheme system using surface treated
“Growth of two-dimensional lithium islands on CaO(001) thin
PtO𝑥 /WO3 as O2 evolution photocatalyst,” Catalysis Science &
films,” Journal of Physical Chemistry C, vol. 116, no. 33, pp.
Technology, vol. 3, no. 7, pp. 1750–1756, 2013.
17980–17984, 2012.
[18] K. Maeda, D. L. Lu, and K. Domen, “Solar-driven Z-scheme
water splitting using modified BaZrO3 -BaTaO2 N solid solu- [34] S. Wendt, P. T. Sprunger, E. Lira et al., “The role of interstitial
tions as photocatalysts,” Acs Catalysis, vol. 3, no. 5, pp. 1026– sites in the Ti3d defect state in the band gap of titania,” Science,
1033, 2013. vol. 320, no. 5884, pp. 1755–1759, 2008.
[19] G. Liu, L. Wang, H. G. Yang, H.-M. Cheng, and G. Q. [35] I. Nakamura, N. Negishi, S. Kutsuna, T. Ihara, S. Sugihara, and
Lu, “Titania-based photocatalysts—crystal growth, doping and K. Takeuchi, “Role of oxygen vacancy in the plasma-treated
heterostructuring,” Journal of Materials Chemistry, vol. 20, no. TiO2 photocatalyst with visible light activity for NO removal,”
5, pp. 831–843, 2010. Journal of Molecular Catalysis A, vol. 161, no. 1-2, pp. 205–212,
2000.
[20] C. W. Zhao, X. L. Yao, Y. H. Ma, P. F. Yuan, and W. T. Yang,
“Preparation of flexible BOPP/SiO𝑥 /TiO2 multilayer film for [36] T. Ihara, M. Miyoshi, Y. Iriyama, O. Matsumoto, and S. Sugihara,
photodegradation of organic contamination,” Applied Surface “Visible-light-active titanium oxide photocatalyst realized by
Science, vol. 261, pp. 436–440, 2012. an oxygen-deficient structure and by nitrogen doping,” Applied
[21] A. Hu, R. Liang, X. Zhang et al., “Enhanced photocatalytic Catalysis B, vol. 42, no. 4, pp. 403–409, 2003.
degradation of dyes by TiO2 nanobelts with hierarchical struc- [37] F. Y. Pei, G. L. Liu, S. G. Xu, J. Lu, C. X. Wang, and S.
tures,” Journal of Photochemistry and Photobiology A, vol. 256, K. Cao, “Nanocomposite of graphene oxide with nitrogen-
pp. 7–15, 2013. doped TiO2 exhibiting enhanced photocatalytic efficiency for
[22] M. J. Jeng, Y. L. Wung, L. B. Chang, and L. Chow, “Particle size hydrogen evolution,” International Journal of Hydrogen Energy,
effects of TiO2 layers on the solar efficiency of dye-sensitized vol. 38, no. 6, pp. 2670–2677, 2013.
solar cells,” International Journal of Photoenergy, vol. 2013, [38] Y. von Lim, H. Fan, Z. Shen, C. H. Kang, Y. Feng, and S.
Article ID 563897, 9 pages, 2013. Wang, “Synthesis of silica supported titania nanocomposite in
[23] Y. T. Lin, C. H. Weng, H. J. Hsu, Y. H. Lin, and C. C. Shiesh, controllable phase content and morphology,” Applied Physics A,
“The synergistic effect of nitrogen dopant and calcination vol. 95, no. 2, pp. 555–562, 2009.
temperature on the visible-light-induced photoactivity of N- [39] T. Bak, J. Nowotny, M. Rekas, and C. C. Sorrell, “Defect
doped TiO2 ,” International Journal of Photoenergy, vol. 2013, chemistry and semiconducting properties of titanium dioxide:
Article ID 268723, 13 pages, 2013. III. Mobility of electronic charge carriers,” Journal of Physics and
[24] H.-H. Lo, N. O. Gopal, and S.-C. Ke, “Origin of photoactivity Chemistry of Solids, vol. 64, no. 7, pp. 1069–1087, 2003.
of oxygen-deficient TiO2 under visible light,” Applied Physics [40] M. Kong, Y. Li, X. Chen et al., “Tuning the relative concentration
Letters, vol. 95, no. 8, Article ID 083126, 2009. ratio of bulk defects to surface defects in TiO2 nanocrystals
leads to high photocatalytic efficiency,” Journal of the American [57] A. Alkauskas, P. Broqvist, and A. Pasquarello, “Defect energy
Chemical Society, vol. 133, no. 41, pp. 16414–16417, 2011. levels in density functional calculations: alignment and band
[41] W. Sun, Y. Li, W. Shi, X. Zhao, and P. Fang, “Formation of gap problem,” Physical Review Letters, vol. 101, no. 4, Article ID
AgI/TiO2 nanocomposite leads to excellent thermochromic 046405, 2008.
reversibility and photostability,” Journal of Materials Chemistry, [58] A. Iwaszuk, P. A. Mulheran, and M. Nolan, “TiO2 nanocluster
vol. 21, no. 25, pp. 9263–9270, 2011. modified-rutile TiO2 photocatalyst: a first principles investiga-
[42] A. K. Subramani, K. Byrappa, G. N. Kumaraswamy et al., tion,” Journal of Materials Chemistry A, vol. 1, no. 7, pp. 2515–
“Hydrothermal preparation and characterization of TiO2 :AC 2525, 2013.
composites,” Materials Letters, vol. 61, no. 26, pp. 4828–4831, [59] C. Y. Liu, Y. Z. Tan, S. S. Lin et al., “CO self-promoting oxidation
2007. on nanosized gold clusters: triangular Au-3 active site and
[43] C. L. Pang, R. Lindsay, and G. Thornton, “Structure of clean and CO induced O-O scission,” Journal of the American Chemical
adsorbate-covered single-crystal rutile TiO2 surfaces,” Chemical Society, vol. 135, no. 7, pp. 2583–2595, 2013.
Reviews, vol. 113, no. 6, pp. 3887–3948, 2013. [60] X. Pan, Q. X. Cai, W. L. Chen, G. L. Zhuang, X. N. Li, and J. G.
[44] H. Cui, Z. Zhao, Y. Liang et al., “Influence of carbon aerogel Wang, “A DFT study of gas molecules adsorption on the anatase
(CA) pore structure on photodegradation of methyl orange over (001) nanotube arrays,” Computational Materials Science, vol. 67,
TiO2 /CA,” Chinese Journal of Catalysis, vol. 32, no. 2, pp. 321– pp. 174–181, 2013.
324, 2011. [61] H. W. Wu, N. Zhang, H. M. Wang, and S. G. Hong, “Adsorption
[45] Z. T. Wang, N. A. Deskins, M. A. Henderson, and I. Lyubinetsky, of CO2 on Cu2 O(111) oxygen-vacancy surface: first-principles
“Inhibitive influence of oxygen vacancies for photoactivity on study,” Chemical Physics Letters, vol. 568, pp. 84–89, 2013.
TiO2 (110),” Physical Review Letters, vol. 109, no. 26, 2012. [62] Y. F. Zhukovskii, S. Piskunov, J. Begens, J. Kazerovskis, and
[46] K. Mitsuhara, H. Okumura, A. Visikovskiy, M. Takizawa, and O. Lisovski, “First-principles calculations of point defects in
Y. Kido, “The source of the Ti 3d defect state in the band gap inorganic nanotubes,” Physica Status Solidi (B), vol. 250, no. 4,
of rutile titania (110) surfaces,” Journal of Chemical Physics, vol. pp. 793–800, 2013.
136, no. 12, Article ID 124707, 2012.
[63] Z. D. Lin, C. L. Guo, Q. M. Fu, and W. L. Song, “Abnormal photo-
[47] D. L. Feng, Y. H. Feng, Y. Chen, W. Li, and X. X. Zhang, electrical properties and gas sensing of mesoporous Sn0.9 Ti0.1 O2
“Effects of doping, Stone-Wales and vacancy defects on thermal film under UV light,” Materials Letters, vol. 102, pp. 47–49, 2013.
conductivity of single-wall carbon nanotubes,” Chinese Physics
B, vol. 22, no. 1, 2013. [64] A. Vittadini and A. Selloni, “Small gold clusters on stoichiomet-
ric and defected TiO2 anatase (101) and their interaction with
[48] M. K. Nowotny, T. Bak, and J. Nowotny, “Electrical properties CO: a density functional study,” Journal of Chemical Physics, vol.
and defect chemistry of TiO2 single crystal. I. Electrical con- 117, no. 1, pp. 353–361, 2002.
ductivity,” Journal of Physical Chemistry B, vol. 110, no. 33, pp.
16270–16282, 2006. [65] B. J. Morgan and G. W. Watson, “A density functional theory +
u study of Oxygen vacancy formation at the (110), (100), (101),
[49] J. Chen, G.-J. Jin, and Y.-Q. Ma, “Effect of oxygen vacancy defect and (001) surfaces of rutile TiO2 ,” Journal of Physical Chemistry
on the magnetic properties of Co-doped ZnO diluted magnetic C, vol. 113, no. 17, pp. 7322–7328, 2009.
semiconductor,” Acta Physica Sinica, vol. 58, no. 4, pp. 2707–
2712, 2009. [66] W. Wang, C.-H. Lu, Y.-R. Ni, J.-B. Song, M.-X. Su, and Z.-Z. Xu,
“Enhanced visible-light photoactivity of {001} facets dominated
[50] D. Levis and L. F. Cugliandolo, “Defects dynamics following
TiO2 nanosheets with even distributed bulk oxygen vacancy
thermal quenches in square spin ice,” Physical Review B, vol. 87,
and Ti3+ ,” Catalysis Communications, vol. 22, pp. 19–23, 2012.
no. 21, 2013.
[51] H. Irie, Y. Watanabe, and K. Hashimoto, “Nitrogen-concen- [67] H. Pan, B. Gu, and Z. Zhang, “Phase-dependent photocatalytic
tration dependence on photocatalytic activity of TiO2−𝑥 N𝑥 ability of TiO2 : a first-principles study,” Journal of Chemical
powders,” Journal of Physical Chemistry B, vol. 107, no. 23, pp. Theory and Computation, vol. 5, no. 11, pp. 3074–3078, 2009.
5483–5486, 2003. [68] D. X. Li, X. B. Qin, L. R. Zheng et al., “Defect types and room-
[52] R. Asahi, T. Morikawa, T. Ohwaki, K. Aoki, and Y. Taga, temperature ferromagnetism in undoped rutile TiO2 single
“Visible-lightphotocatalysis in nitrogen-doped titanium crystals,” Chinese Physics B, vol. 22, no. 3, 2013.
oxides,” Science, vol. 293, no. 5528, pp. 269–271, 2001. [69] E. Farfan-Arribas and R. J. Madix, “Role of defects in the
[53] M. K. Nowotny, T. Bak, J. Nowotny, and C. C. Sorrell, “Titanium adsorption of aliphatic alcohols on the TiO2 (110) surface,”
vacancies in nonstoichiometric TiO2 single crystal,” Physica Journal of Physical Chemistry B, vol. 106, no. 41, pp. 10680–
Status Solidi (B), vol. 242, no. 11, pp. R88–R90, 2005. 10692, 2002.
[54] M. K. Nowotny, T. Bak, J. Nowotny, and L. R. Sheppard, “Semi- [70] M. Takeuchi, Y. Onozaki, Y. Matsumura, H. Uchida, and T. Kuji,
conducting properties of single crystal TiO2 in the n-p transi- “Photoinduced hydrophilicity of TiO2 thin film modified by
tion region,” Journal of the Australian Ceramic Society, vol. 46, Ar ion beam irradiation,” Nuclear Instruments and Methods in
no. 1, pp. 27–30, 2010. Physics Research B, vol. 206, pp. 259–263, 2003.
[55] M. Martin, “The influence of cation and vacancy distributions [71] N. A. Deskins and M. Dupuis, “Intrinsic hole migration rates
on the ionic conductivity of acceptor doped oxygen ion con- in TiO2 from density functional theory,” Journal of Physical
ductors,” Zeitschrift für Physikalische Chemie, vol. 219, no. 1, pp. Chemistry C, vol. 113, no. 1, pp. 346–358, 2009.
105–122, 2005. [72] M. Fittipaldi, D. Gatteschi, and P. Fornasiero, “The power of
[56] C. di Valentin, G. Pacchioni, and A. Selloni, “Reduced and n- EPR techniques in revealing active sites in heterogeneous pho-
type doped TiO2 : nature of Ti3+ species,” Journal of Physical tocatalysis: the case of anion doped TiO2 ,” Catalysis Today, vol.
Chemistry C, vol. 113, no. 48, pp. 20543–20552, 2009. 206, pp. 2–11, 2013.
[73] C. di Valentin, G. Pacchioni, A. Selloni, S. Livraghi, and E. [90] N. Serpone, “Is the band gap of pristine TiO2 narrowed
Giamello, “Characterization of paramagnetic species in N- by anion- and cation-doping of titanium dioxide in second-
doped TiO2 powders by EPR spectroscopy and DFT calcula- generation photocatalysts?” Journal of Physical Chemistry B, vol.
tions,” Journal of Physical Chemistry B, vol. 109, no. 23, pp. 11414– 110, no. 48, pp. 24287–24293, 2006.
11419, 2005. [91] A. Janotti, C. Franchini, J. B. Varley, G. Kresse, and C. G. van de
[74] Y. L. Chen, X. X. Cao, B. Z. Lin, and B. F. Gao, “Origin of Walle, “Dual behavior of excess electrons in rutile TiO2 ,” Physica
the visible-light photoactivity of NH3 -treated TiO2 : effect of Status Solidi (RRL), vol. 7, no. 3, pp. 199–203, 2013.
nitrogen doping and oxygen vacancies,” Applied Surface Science, [92] L. J. Liu, H. L. Zhao, J. M. Andino, and Y. Li, “Photocatalytic
vol. 264, pp. 845–852, 2013. CO2 reduction with H2 O on TiO2 nanocrystals: comparison
[75] C. di Valentin and G. Pacchioni, “Trends in non-metal doping of anatase, rutile, and brookite polymorphs and exploration of
of anatase TiO2 : B, C, N and F,” Catalysis Today, vol. 206, pp. surface chemistry,” Acs Catalysis, vol. 2, no. 8, pp. 1817–1828,
12–18, 2013. 2012.
[76] L. Jing, B. Xin, F. Yuan, L. Xue, B. Wang, and H. Fu, “Effects of [93] T. Bak, M. K. Nowotny, L. R. Sheppard, and J. Nowotny, “Mobil-
surface oxygen vacancies on photophysical and photochemical ity of electronic charge carriers in titanium dioxide,” Journal of
processes of Zn-doped TiO2 nanoparticles and their relation- Physical Chemistry C, vol. 112, no. 33, pp. 12981–12987, 2008.
ships,” Journal of Physical Chemistry B, vol. 110, no. 36, pp. [94] P. Y. Yu and M. Cardona, Fundamentals of Semiconductors:
17860–17865, 2006. Physics and Materials Properties, Springer, New York, NY, USA,
[77] T. Bak, M. K. Nowotny, L. R. Sheppard, and J. Nowotny, “Charge 2005.
transport in Cr-doped titanium dioxide,” Journal of Physical [95] Z. Zhang and J. T. Yates Jr., “Direct observation of surface-
Chemistry C, vol. 112, no. 18, pp. 7255–7262, 2008. mediated electron-hole pair recombination in TiO2 (110),” Jour-
[78] H. C. Wu, S. H. Li, and S. W. Lin, “Effect of Fe concentration nal of Physical Chemistry C, vol. 114, no. 7, pp. 3098–3101, 2010.
on Fe-doped anatase TiO2 from GGA + U calculations,” Inter- [96] J. Nowotny, T. Bak, M. K. Nowotny, and L. R. Sheppard,
national Journal of Photoenergy, vol. 2012, Article ID 823498, 6 “TiO2 surface active sites for water splitting,” Journal of Physical
pages, 2012. Chemistry B, vol. 110, no. 37, pp. 18492–18495, 2006.
[79] L. R. Sheppard, T. Bak, and J. Nowotny, “Metallic TiO2 ,” Physica [97] V. Duzhko, V. Y. Timoshenko, F. Koch, and T. Dittrich, “Photo-
Status Solidi (A), vol. 203, no. 11, pp. R85–R87, 2006. voltage in nanocrystalline porous TiO2 ,” Physical Review B, vol.
[80] L. R. Sheppard, T. Bak, and J. Nowotny, “Electrical properties of 64, no. 7, Article ID 075204, 2001.
niobium-doped titanium dioxide. 1. Defect disorder,” Journal of [98] T. Tachikawa and T. Majima, “Exploring the spatial distribution
Physical Chemistry B, vol. 110, no. 45, pp. 22447–22454, 2006. and transport behavior of charge carriers in a single titania
[81] L. R. Sheppard, T. Bak, and J. Nowotny, “Electrical properties nanowire,” Journal of the American Chemical Society, vol. 131,
of niobium-doped titanium dioxide. 3. Thermoelectric power,” no. 24, pp. 8485–8495, 2009.
Journal of Physical Chemistry C, vol. 112, no. 2, pp. 611–617, 2008. [99] J. D. Zhuang, S. X. Weng, W. X. Dai, P. Liu, and Q. Liu, “Effects
[82] V. N. Kuznetsov and N. Serpone, “Visible light absorption of interface defects on charge transfer and photoinduced prop-
by various titanium dioxide specimens,” Journal of Physical erties of TiO2 bilayer films,” Journal of Physical Chemistry C, vol.
Chemistry B, vol. 110, no. 50, pp. 25203–25209, 2006. 116, no. 48, pp. 25354–25361, 2012.
[83] J. Chen, L.-B. Lin, and F.-Q. Jing, “Theoretical study of F-type [100] M.-T. Chen, Y.-F. Lin, L.-F. Liao, C.-F. Lien, and J.-L. Lin,
color center in rutile TiO2 ,” Journal of Physics and Chemistry of “Adsorption and reactions of CH2 Br2 on TiO2 : effects of H2 O
Solids, vol. 62, no. 7, pp. 1257–1262, 2001. and O2 ,” International Journal of Photoenergy, vol. 6, no. 1, pp.
[84] K. N. Song, X. P. Han, and G. S. Shao, “Electronic properties 35–41, 2004.
of rutile TiO2 doped with 4d transition metals: first-principles [101] N. G. Petrik and G. A. Kimmel, “Electron- and hole-mediated
study,” Journal of Alloys and Compounds, vol. 551, pp. 118–124, reactions in UV-irradiated O2 adsorbed on reduced rutile
2013. TiO2 (110),” Journal of Physical Chemistry C, vol. 115, no. 1, pp.
[85] A. Kudo and Y. Miseki, “Heterogeneous photocatalyst materials 152–164, 2011.
for water splitting,” Chemical Society Reviews, vol. 38, no. 1, pp. [102] H. Xu and S. Y. Tong, “Interaction of O2 with reduced rutile
253–278, 2009. TiO2 (110) surface,” Surface Science, vol. 610, pp. 33–41, 2013.
[86] J. Stausholm-Møller, H. H. Kristoffersen, B. Hinnemann, G. K. [103] U. Aschauer and A. Selloni, “Influence of subsurface Ti inter-
H. Madsen, and B. Hammer, “DFT+U study of defects in bulk stitials on the reactivity of anatase (101),” in Physical Chemistry
rutile TiO2 ,” Journal of Chemical Physics, vol. 133, no. 14, Article of Interfaces and Nanomaterials IX, vol. 7758 of Proceedings of
ID 144708, 2010. SPIE, August 2010.
[87] M. Komiyama and Y.-J. Li, “Photoresponse of surface oxygen [104] C. A. Korologos, C. J. Philippopoulos, and S. G. Poulopoulos,
defects on TiO2 (1 1 0),” Applied Surface Science, vol. 244, no. 1– “The effect of water presence on the photocatalytic oxidation of
4, pp. 550–553, 2005. benzene, toluene, ethylbenzene and m-xylene in the gas-phase,”
[88] A. Janotti, J. B. Varley, P. Rinke, N. Umezawa, G. Kresse, and Atmospheric Environment, vol. 45, no. 39, pp. 7089–7095, 2011.
C. G. van de Walle, “Hybrid functional studies of the oxygen [105] M. A. Henderson, “A surface science perspective on TiO2
vacancy in TiO2 ,” Physical Review B, vol. 81, no. 8, Article ID photocatalysis,” Surface Science Reports, vol. 66, no. 6-7, pp. 185–
085212, 2010. 297, 2011.
[89] X. X. Zou, J. K. Liu, J. Su, F. Zuo, J. S. Chen, and P. Y. Feng, “Facile [106] S. Wendt, J. Matthiesen, R. Schaub et al., “Formation and
synthesis of thermal- and photostable titania with paramagnetic splitting of paired hydroxyl groups on reduced TiO2 (110),”
oxygen vacancies for visible-light photocatalysis,” Chemistry— Physical Review Letters, vol. 96, no. 6, Article ID 066107, 4 pages,
A European Journal, vol. 19, no. 8, pp. 2866–2873, 2013. 2006.
[107] O. Bikondoa, C. L. Pang, R. Ithnin, C. A. Muryn, H. Onishi, coated on foam nickel substrates,” Rare Metal Materials and
and G. Thornton, “Direct visualization of defect-mediated Engineering, vol. 37, pp. 143–147, 2008.
dissociation of water on TiO2 (110),” Nature Materials, vol. 5, no. [123] Y. H. Lv, C. S. Pan, X. G. Ma, R. L. Zong, X. J. Bai, and Y.
3, pp. 189–192, 2006. F. Zhu, “Production of visible activity and UV performance
[108] J. A. Rodriguez, S. Ma, P. Liu, J. Hrbek, J. Evans, and M. Pérez, enhancement of ZnO photocatalyst via vacuum deoxidation,”
“Activity of CeO𝑥 and TiO𝑥 nanoparticles grown on Au(111) in Applied Catalysis B, vol. 138, pp. 26–32, 2013.
the water-gas shift reaction,” Science, vol. 318, no. 5857, pp. 1757– [124] X. Wang, Z. Feng, J. Shi et al., “Trap states and carrier
1760, 2007. dynamics of TiO2 studied by photoluminescence spectroscopy
[109] P. Krüger, J. Jupille, S. Bourgeois et al., “Intrinsic nature of the under weak excitation condition,” Physical Chemistry Chemical
excess electron distribution at the TiO2 (110) surface,” Physical Physics, vol. 12, no. 26, pp. 7083–7090, 2010.
Review Letters, vol. 108, no. 12, Article ID 126803, 2012. [125] K. Suriye, P. Praserthdam, and B. Jongsomjit, “Control of Ti3+
[110] Z. Zhang, K. Cao, and J. T. Yates, “Defect-electron spreading surface defect on TiO2 nanocrystal using various calcination
on the TiO2 (110) semiconductor surface by water adsorption,” atmospheres as the first step for surface defect creation and its
Journal of Physical Chemistry Letters, vol. 4, no. 4, pp. 674–679, application in photocatalysis,” Applied Surface Science, vol. 253,
2013. no. 8, pp. 3849–3855, 2007.
[111] U. Aschauer, Y. He, H. Cheng, S.-C. Li, U. Diebold, and A. [126] S. Yang, A. T. Brant, N. C. Giles, and L. E. Halliburton, “Intrinsic
Selloni, “Influence of subsurface defects on the surface reactivity small polarons in rutile TiO2 ,” Physical Review B, vol. 87, no. 12,
of TiO2 : water on anatase (101),” Journal of Physical Chemistry C, 2013.
vol. 114, no. 2, pp. 1278–1284, 2010. [127] J. Long, Q. Gu, Z. Zhang, and X. Wang, “Molecular design and
[112] M. A. Henderson, W. S. Epling, C. H. F. Peden, and C. L. Perkins, XAFS characterization of active centers of solid-state catalysts,”
“Insights into photoexcited electron scavenging processes on Progress in Chemistry, vol. 23, no. 12, pp. 2417–2441, 2011.
TiO2 obtained from studies of the reaction of O2 with OH
groups adsorbed at electronic defects on TiO2 (110),” Journal of
Physical Chemistry B, vol. 107, no. 2, pp. 534–545, 2003.
[113] N. G. Petrik, Z. Zhang, Y. Du, Z. Dohnálek, I. Lyubinetsky,
and G. A. Kimmel, “Chemical reactivity of reduced TiO2 (110):
the dominant role of surface defects in oxygen chemisorption,”
Journal of Physical Chemistry C, vol. 113, no. 28, pp. 12407–12411,
2009.
[114] Z. Zhang, Y. Du, N. G. Petrik, G. A. Kimmel, I. Lyubinetsky, and
Z. Dohnálek, “Water as a catalyst: imaging reactions of O2 with
partially and fully hydroxylated TiO2 (110) surfaces,” Journal of
Physical Chemistry C, vol. 113, no. 5, pp. 1908–1916, 2009.
[115] X. Y. Pan, N. Zhang, X. Z. Fu, and Y. J. Xu, “Selective oxidation of
benzyl alcohol over TiO2 nanosheets with exposed {001} facets:
catalyst deactivation and regeneration,” Applied Catalysis A, vol.
453, pp. 181–187, 2013.
[116] O. Bondarchuk, Y. K. Kim, J. M. White, J. Kim, B. D. Kay, and Z.
Dohnalek, “Surface chemistry of 2-propanol on TiO2 (110): low-
and high-temperature dehydration, isotope effects, and influ-
ence of local surface structure,” Journal of Physical Chemistry C,
vol. 111, no. 29, pp. 11059–11067, 2007.
[117] Z. Zhang and J. T. Yates Jr., “Effect of adsorbed donor
and acceptor molecules on electron stimulated desorption:
O2/TiO2 (110),” Journal of Physical Chemistry Letters, vol. 1, no.
14, pp. 2185–2188, 2010.
[118] F. Parrino, A. Ramakrishnan, C. Damm, and H. Kisch, “Visible-
light-induced sulfoxidation of alkanes in the presence of tita-
nia,” ChemPlusChem, vol. 77, no. 8, pp. 713–720, 2012.
[119] Z. Zhang, O. Bondarchuk, J. M. White, B. D. Kay, and Z.
Dohnálek, “Imaging adsorbate O-H bond cleavage: methanol
on TiO2 (110),” Journal of the American Chemical Society, vol.
128, no. 13, pp. 4198–4199, 2006.
[120] Z. Zhang, O. Bondarchuk, J. M. White, B. D. Kay, and Z.
Dohnálek, “Imaging adsorbate O-H bond cleavage: methanol
on TiO2 (110),” Journal of the American Chemical Society, vol.
128, no. 13, pp. 4198–4199, 2006.
[121] M. R. Hoffmann, S. T. Martin, W. Choi, and D. W. Bahnemann,
“Environmental applications of semiconductor photocatalysis,”
Chemical Reviews, vol. 95, no. 1, pp. 69–96, 1995.
[122] H. Hu, W. J. Xiao, J. W. Shi, H. Yuan, and W. F. Shangguan,
“Photocatalytic activities of TiO2 and TiO2/3 Al2 O2 ⋅2SiO2 films
http://dx.doi.org/10.1155/2013/138918
Research Article
Adsorption and Photocatalytic Decomposition of the 𝛽-Blocker
Metoprolol in Aqueous Titanium Dioxide Suspensions: Kinetics,
Intermediates, and Degradation Pathways
Violette Romero, Pilar Marco, Jaime Giménez, and Santiago Esplugas

Department of Chemical Engineering, University of Barcelona, C/Martı́ i Franquès 1, 08028 Barcelona, Spain
Correspondence should be addressed to Pilar Marco; pmarco@ub.edu
Received 28 May 2013; Revised 25 September 2013; Accepted 3 October 2013
Copyright © 2013 Violette Romero et al. This is an open access article distributed under the Creative Commons Attribution License,
This study reports the photocatalytic degradation of the 𝛽-blocker metoprolol (MET) using TiO2 suspended as catalyst. A series of
photoexperiments were carried out by a UV lamp, emitting in the 250–400 nm range, providing information about the absorption
of radiation in the photoreactor wall. The influence of the radiation wavelength on the MET photooxidation rate was investigated
using a filter cutting out wavelengths shorter than 280 nm. Effects of photolysis and adsorption at different initial pH were studied
to evaluate noncatalytic degradation for this pharmaceutical. MET adsorption onto titania was fitted to two-parameter Langmuir
isotherm. From adsorption results it appears that the photocatalytic degradation can occur mainly on the surface of TiO2 . MET
removed by photocatalysis was 100% conditions within 300 min, while only 26% was achieved by photolysis at the same time. TiO2
photocatalysis degradation of MET in the first stage of the reaction followed approximately a pseudo-first-order model. The major
reaction intermediates were identified by LC/MS analysis such as 3-(propan-2-ylamino)propane-1,2-diol or 3-aminoprop-1-en-2-
ol. Based on the identified intermediates, a photocatalytic degradation pathway was proposed, including the cleavage of side chain
and the hydroxylation addition to the parent compounds.
1. Introduction shown that they can adversely affect aquatic organisms, even
at low concentration [2]. Due to its widespread occurrence
The presence of pharmaceutical drugs and endocrine disrup- and potential impact, MET must be removed from treated
tors in surface, ground, and drinking waters is a growing water before discharge or reuse.
environmental concern [1–9]. This pollution is caused by Several treatments for the removal of these compounds
emission from production sites, direct disposal of surplus have been reported in the literature, including membrane
drugs in households, excretion after drug administration to filtration [15], activated carbon adsorption [16], and reverse
humans and animals, wastewater from fish and other animal osmosis [17, 18]. However, the conventional water treat-
farms, and industry [3, 10, 11]. Some of these drugs, as 𝛽- ment processes are relatively inefficient in treating these
blockers, have been detected in the order of ng L−1 to 𝜇g L−1 compounds [4, 19]. These pharmaceuticals can undergo
in the water [3–9, 12]. As an example, metoprolol tartrate salt abiotic degradation (hydrolysis, photolysis) [13] and most of
(MET), which is usually prescribed as antihypertensive or them are photoactive because their structural compositions
antiarrhythmic, has been quantified up to 2 𝜇g L−1 in sewage consist of aromatic rings, heteroatoms, and other functional
treatment plant (STP) effluents and to 240 ng L−1 in rivers groups that can absorb solar radiation [20]. Thus, sunlight
[13]. Metoprolol and atenolol together account for more than induced photochemical treatments should be considered as
80% of total 𝛽-blockers consumption in Europe [6]. During an alternative to traditional treatment. Several researches
the last years, metoprolol usage increased by a factor of 4, have demonstrated that MET shows slow direct phototrans-
probably due to a change in human behavior [6]. Although formation and/or hydrolysis [13, 21, 22]. In this context,
full ecotoxicity data are not available [13, 14], it has been advanced oxidation processes (AOPs) appear as a good
25 10 and they were used without further purification. Titanium

9 dioxide (TiO2 ) Degussa P-25 (commercial catalyst ∼70%
f(𝜆) (mEinstein/total Einstein)

20 8 anatase, ∼30% rutile, surface area 50 ± 5.0 m2 g−1 , and 300 𝜇m
Absorbance ×10−2
7 particle size [25]) was used as received. This TiO2 is a

15 6 photochemical stable material [6, 26, 27].
5
10 4
3
2.2. Analytical Instruments. The target compounds con-
5 2
centrations were monitored by a high-performance liquid
1
chromatograph (HPLC) from Waters using a SEA18 5 𝜇m
0 0
200 250 300 350 400 450 500 15 × 0.46 Teknokroma column and Waters 996 photodiode
Wavelength (nm) array detector using Empower Pro software 2002 Water Co.
The mobile phase was composed by water and acetonitrile
Metoprolol (20 : 80), injected with a flow-rate of 0.85 mL min−1 , and
Lamp detected at maximum metoprolol (221.9 nm). Total organic
Figure 1: Absorbance spectrum of MET for aqueous concentration carbon (TOC) was measured in a Shimadzu TOC-V CNS.
of 10 mg L−1 (left axis) and lamp spectrum (right axis), where 𝑓(𝜆) pH was measured by a Crison GLP 22 instrument. UV-
represents the spectral distribution of the lamp. VIS spectra of MET (Figure 1) were obtained for 10 mg L−1
aqueous solution on a PerkinElmer UV/vis Lambda 20 (200–
400 nm range) spectrophotometer.
alternative for its degradation due to their versatility and

ability to increase biodegradability [23, 24]. Among the 2.3. Experimental Procedure. Photodegradation experiments
different advanced oxidation processes, heterogenous photo- were conducted in a Solarbox (CO.FO.MEGRA, Milan, Italy)
catalysis has been a potential alternative for the degradation and equipped with a Xenon lamp (Phillips XOP, 1000W)
of hazardous pollutants. Oxidation of organic compounds by and a tubular-horizontal photoreactor (0.084L illuminated
means of TiO2 was achieved by hydroxyl radical generation volume) located at the axis of a parabolic mirror in the bottom
through the 𝑒− /ℎ+ pair generated when the semiconductor is of the Solarbox. The photon flux inside the photoreactor
exposed to UV radiation [11, 14]. was evaluated by o-nitrobenzaldehyde actinometry [28, 29],
The main objective of this investigation is to undertake a being 2.68 𝜇Einstein s−1 . A stirred reservoir tank (1.0 L) was
study on the heterogeneous photocatalytic degradation and filled with the pharmaceutical-TiO2 (suspended) aqueous
mineralization of MET in aqueous suspensions with TiO2 . solution. The solution was continuously pumped (peristaltic
In addition, the contribution of the degradation of MET pump Ecoline VC-280 II, Ismatec) to the equipment and
by direct photolysis and the adsorption of the metoprolol recirculated to the reservoir tank with a flow of 0.65 L min−1 .
onto TiO2 were studied. In this way, the effect of different In order to keep the solution at 25∘ C, the jacket temperature of
initial pH values on the photodegradation rate and the the stirred tank was controlled with an ultrathermostat bath
adsorption isotherms of metoprolol in TiO2 suspensions (Haake K10). Samples were taken every 30 minutes during
were determined. The contribution of direct photolysis in 300 minutes and quickly analyzed. Before HPLC analysis,
photocatalysis was also examined in detail by using different samples were filtered through 0.20 𝜇m PVDF membrane to
wavelengths and glass type photoreactors. Additionally, an separate TiO2 . All the experiments were duplicated and the
attempt has been completed to estimate the kinetic param- results presented were the mean values.
eters and to identify the main intermediates formed during According to the literature [13], metoprolol stability
the photocatalytic degradation of MET. in aqueous solution was previously verified, by storing
50 mg L−1 during 3 days in the dark at room temperature, and
no degradation was observed.
2. Materials and Methods
MET adsorption of TiO2 was also measured. Thus, MET
2.1. Chemicals and Reagents. Metoprolol tartrate (MET) salt solution (0 to 50 mg L−1 ) was prepared with TiO2 in suspen-
was purchased from Sigma Aldrich Chemical Co. (Spain) and sion (0.4 g L−1 ) and placed into 25 mL hermetic closed flasks,
used as received (1-[4-(2 methoxyethyl)phenoxy]-3-(propan- adjusting the pH with NaOH solution (0.1 mol L−1 ). The
2-ylamino)propan-2-ol tartrate (2:1), CAS no 56392-17-7, conical flasks were shaken at a constant speed of 100 rpm and
(C15 H25 NO3 )2 C4 H6 O6 , MW 684.81). Solutions of 50 mg L−1 at room temperature (25 ± 0.5∘ C). Samples were taken every
of MET were prepared using deionized water to assure 24 h, assuming that adsorption equilibrium was reached.
accurate measurements of concentrations, to follow the For the identification of byproducts, the final sample
TOC, to secure identification of intermediates, and to make mixture, at 300 minutes, was analyzed by electrospray ion-
predictions about possible mechanisms of photocatalysis. ization/mass spectrometry using a PerSeptive, TOF Mariner
For pH adjustment, 0.1 mol L−1 sulphuric acid or 0.1 mol L−1 Jascoo AS-2050 plus IS mass spectrometer into the 𝑚/𝑧 range
sodium hydroxide was used. All chemicals were HPLC grade, of 50–1000. The experiments were carried out in replicate.
30 3.0 1.2E − 02
25 2.5 1.0E − 02
Removal MET (%)
20 2.0 8.0E − 03
TOC/TOCo
q (mg g−1 )
15 1.5 6.0E − 03
10 1.0
4.0E − 03
5 0.5
2.0E − 03
0 0.0
0 80 160 240 320 0.0E + 00
0 10 20 30 40 50 60
t (min)
C (mg L−1 )
Figure 2: MET photodegradation removal (I) and TOC/TOCo (∙)
Free pH
under simulated UV.
pH 9
Figure 3: Effect of pH on adsorption of MET over TiO2 at 25∘ C, pH

3. Results and Discussion 9 (∙), and free pH (I).
3.1. Effect of UV Radiation Photolysis on Metoprolol Degra-
dation. When studying photocatalysis, it is very important The efficiency of the photochemical transformation pro-
to be able to separate the influence of photolysis, since it is cess depends on many factors such as the irradiation setups,
expected to tackle the degradation of the substances mainly the characteristics of the light source, the water matrix
induced by the action of the catalyst. For this purpose, a used, the initial concentration, and the pH of the solutions
series of experiments was done with UV illumination, and [31]. Tests were carried out using different photoreactors,
without catalyst to highlight the metoprolol ability to absorb a borosilicate Duran, and quartz glass reactor, cutting out
the radiation reaching the system. wavelengths shorter than 290 and 320 nm, respectively. Other
Figure 2 shows the results obtained after applying sim- experiments have been done with and without glass filter for
ulated sunlight. As observed, MET is not fast enough to be restricting transmissions of light below 280 nm.
photodegraded in water by direct photolysis [30]; only 26% In this study, the effect of borosilicate Duran and quartz
of MET in 300 minutes was degraded under simulated UV. glass material reactor has been investigated under UV radi-
Moreover, it shows that direct photolysis was not able to ation. It was observed that MET removal was 25% and 28%
produce MET mineralization at the experimental conditions and the TOC reduction was 3.60% and 1.62%, for reactors
tested. This behavior can be explained because the MET made with borosilicate Duran and quartz, respectively. Thus,
absorption spectrum overlaps only slightly the spectrum of although the mineralization was not significant, there is a
the incoming radiation (Figure 1). small photodegradation of MET for the two tested reactors,
The UV-VIS absorbance was used to calculate the molar after 300 minutes of reaction. Moreover, the effect of a filter
absorption coefficient (𝜀) of the metoprolol at a wavelength glass cutting out wavelengths shorter than 280 nm has been
of 221.9 nm (Figure 1), assuming that Beer-Lambert’s law is investigated. As a result, only 19% of MET in 300 minutes has
followed: been removed with the glass filter; however, MET removal
of 25% can be achieved without filter glass. TOC conversion
𝐴 = − log (𝑇) = 𝜀 × 𝑙 × 𝐶, (1)
was 6.37% and 3.60% with and without filter, correspondingly
where 𝐴 is the absorbance (measured directly by the spec- after 300 minutes, thus confirming that the mineralization is
trophotometer), 𝑇 is the transmittance, 𝜀 is the molar absorp- very low in both cases.
tion coefficient, 𝑙 is the distance that the light travels through Summarizing, UV irradiation in the absence of TiO2
the material, and 𝐶 is the concentration of pollutant. The achieved an MET degradation lower than 30% after 300
molar absorption coefficient (𝜀) was 281 L mol−1 cm−1 ; this minutes of irradiation, confirming that the direct photolysis
value is very similar to other reported values [12, 13]. This low is not fast enough to be considered as an adequate technology.
value explains the MET stability in direct photolysis condi-
tions. Nevertheless, different studies [12, 13, 31] show a high 3.2. The Role of the Adsorption on the Photocatalytic Degrada-
photoability of some 𝛽-blockers, for example, propranolol, tion. Since the adsorption can play an important role in the
nadolol, and alprenolol. The rapid photodegradation of these evolution of the photodegradation, adsorption experiments
compounds was supported by a high molecular absorption at constant temperature (25 ± 0.5∘ C) were carried out. The
coefficient (𝜀 > 800 L mol−1 cm−1 ). This confirmed the adsorption capacity of MET, 𝑞𝑒 (mg g−1 ), was calculated
hypothesis that photoinitiated reactions contribute to the from the difference in MET concentration in the aqueous
degradation of naphthalene backbone (i.e., propranolol) [32], phase before and after adsorption at different initial MET
whereas the metoprolol, having a benzoic skeleton, is not concentrations (0, 6.2, 12.5, 25, 37.5, and 50 mg L−1 ). The
sensitive to direct photolysis when dissolved in deionized variation in adsorption of MET onto TiO2 was studied at two
water [33]. pHs: 9 and free pH (pH ≈ 5.8). Figure 3 presents the obtained
Table 1: Isotherm parameters for MET adsorption onto TiO2 obtained by linear method at 25∘ C.
pH
Two-parameter model Parameters
Free 9
Langmuir 𝑞𝑚 (mol g−1 ) 0.0014 0.0250
𝑞 𝐾𝐶 𝐾𝐿 (L mol−1 ) 0.0930 0.0817
𝑞𝑒 = 𝑚 𝑎 𝑒
1 + 𝐾𝑎 𝐶𝑒 𝑅2 0.987 0.998
1/𝑛 0.244 0.670
Freundlich
𝐾𝐹 (L mol−1 ) 0.00042 0.00129
𝑞𝑒 = 𝐾𝐹 𝐶𝑒 1/𝑛
𝑅2 0.105 0.147
Temkin 𝑅𝑇/𝑏 0.00024 0.00508
𝑅𝑇 𝐾𝑇 (L mol−1 ) 2.718 0.962
𝑞𝑒 = ln (𝐾𝑇 + 𝐶𝑒 )
𝑏 𝑅2 0.604 0.982
−1
Dubinin-Radushkevich 𝑞𝐷 (mol g ) 0.0013 0.0233
1 𝐵𝐷 × 10−3 (mol2 kJ−2 ) 1.533 1.532
𝑞𝑒 = 𝑞𝐷 exp (−𝐵𝑑 [𝑅𝑇 ln (1 + )])
𝐶𝑒 𝑅2 0.835 0.778
Three-parameter model
𝐾RP (L mol−1 ) 0.00011 0.10
Redlich-Peterson −1
𝐾RP 𝐶𝑒 𝑎𝑅 (L mol ) 0.051 18.040
𝑞𝑒 = 𝛽 0.999 0.679
1 + 𝑎𝑅 𝐶𝑒 𝛽
𝑅2 0.826 0.789
𝐾LF (L mol−1 ) 0.000205 0.00809
Langmuir-Freundlich
𝐾LF 𝐶𝑒𝑛LF 𝑎LF (L mol−1 ) 0.134 0.310
𝑞𝑒 = 𝑛 𝑛LF 0.779 0.92
1 + (𝑎LF 𝐶𝑒 ) LF
𝑅2 0.211 0.734
results and indicates that the amount adsorbed increases constants (L mol−1 ), respectively; 𝐶𝑒 and 𝑞𝑒 are the equilib-
when pH does it. rium concentration (mol L−1 ) and the adsorption capacity
The increase in the adsorption of metoprolol with increas- (mol g−1 ), respectively; 𝑞𝐷 is the Dubinin-Radushkevich
ing pH can be elucidated by considering the surface charge of saturation capacity (mol g−1 ). The parameter 𝑞𝑚 represents
the adsorbent material (pHpzc ∼ 6.5) [13, 34]. That is, titanium the maximum monolayer adsorption capacity (mol g−1 ) and
dioxide surface is positively charged in acid media pH (pH ≤ 1/𝑛 the adsorption intensity, which provides an indication of
7) whereas it is negatively charged under alkaline conditions favorability and capacity of the adsorbent/adsorbate system.
(pH ≥ 7) [29, 35]. Also, metoprolol can be transformed The parameter 𝑏 is related to the adsorption heat; 𝐵𝐷 gives the
to MET anion in the basic pH (pH ∼ 10) since the pKa
mean adsorption free energy 𝐸𝐷 (kJ mol−1 ). The parameters
value of metoprolol is 9.7 [36]. Under free pH conditions,
𝛽 and 𝑛LF are the Redlich-Peterson and Langmuir-Freundlich
close to the point zero charge of TiO2 (6.5) [30], MET is
exponents which lie between 0 and 1 [39]. And 𝑅2 is the
positively charged. A low adsorption was observed due to
corresponding sum of squares error obtained in the fitting
no electrostatic attraction between the surface charge and
experimental data of each model.
MET. A highest adsorption between MET and TiO2 would
be observed at pH 9, because the negative charges of the From Table 1, it was observed that the best fitting were
surface of the catalyst attract the protonated MET form. In obtained for Langmuir isotherm (𝑅2 = 0.987 and 0.998 for
addition the photocatalytic degradation would be expected free pH and pH 9, respectively). Thus, these models represent
on the surface of the catalysis. the equilibrium adsorption of MET on TiO2 particles in the
Two-parameter isotherm models (Langmuir, Freundlich, range of concentration studied. Accordingly, the adsorption
Temkin, and Dubinin-Radushkevich) and three-parameter mechanism may be interpreted as a monolayer coverage of
isotherm models (Redlich-Peterson and Langmuir- the catalyst surface.
Freundlich) were tested in the fitting of the adsorption For free pH MET adsorption (𝑞𝑚 ) was lower than for pH
data of MET onto titanium dioxide [37, 38]. 9, 0.0014 mol g−1 , and 0.0250 mol g−1 , respectively. In these
𝐾𝑎 , 𝐾𝐹 , 𝐾𝑇 , 𝐾RP , and 𝐾𝐿 are the Langmuir, Freundlich, cases, the adsorption does not play an important role in the
Temkin, Redlich-Peterson and Langmuir-Freundlich adsorp- photocatalytic process. The MET percentage removal in dark
tion equilibrium constants (L mol−1 ), respectively; 𝑎𝑅 and conditions was 0.1% and 11% for free pH and pH 9. These low
𝑎LF are also the Redlich-Peterson and Langmuir-Freundlcih adsorption values and MET percentage removals suggest that
Table 2: Kinetics of metoprolol UV-C photodegradation under different conditions.
Glass material reactor Glass filter 𝜆 ≥ 280 nm pH 𝑡1/2 (h)

with 5.8 ± 1 16.5 ± 0.5
Borosilicate
Photolysis without 5.8 ± 1 11.6 ± 0.6
Quartz without 5.8 ± 1 10.5 ± 0.5
without 5.8 ± 1 0.81 ± 0.4
Photocatalysis Borosilicate
without 9.0 ± 1 0.58 ± 0.3
the most possible way of degradation could be reached by 100 70

migration of ∙OH radicals to the bulk of the suspension. 90
60
80
Removal MET (%)
Removal TOC (%)

70 50
3.3. Degradation of MET by Photocatalytic Process. The pho-
60
tocatalytic degradation of MET solution (50 mg L−1 ) was 40
50
carried out during 300 minutes, in the presence of 0.4 g L−1 40 30
of TiO2 under UV-VIS light at room temperature. It is know 30 20
that, in heterogeneous photocatalysis, the rate of degradation 20
is not always proportional to the catalyst load [40]. An 10
10
optimal point exists where TiO2 loaded shows a maximum 0 0
degradation rate. Previous studies carried out in our research 0 50 100 150 200 250 300
group reported that the optimum catalyst concentration was t (min)
0.4 g L−1 [41]. Over this value, scattering can appear, and
Free pH (MET removal)
therefore increase in degradation rate does not occur. pH 9 (MET removal)
Firstly, the solution mixture was stirred for 24 hours Free pH (TOC removal)
without irradiation in order to get the equilibrium of MET pH 9 (TOC removal)
adsorption.
Figure 4 depicts the photocatalytic degradation of MET Figure 4: MET and TOC removal (%) versus time (min) at free pH
and pH 9 in photocatalytic experiments.
at free pH and pH 9. Maximum conversions are achieved
at 240 and 300 minutes for pH 9 and free pH, respectively.
An important remark is that the initial removal rate for free 16
pH and pH 9 experiments is different, being higher at pH 134
14
9. The effect of pH on the conversion is a complex issue
related to the ionization states of the catalyst surface and the 12
Intensity (cps) ×105
substrate, as well as the rate of formation of radicals and other 10

reactive species in the reaction mixture [42]. These effects can
8 118
be assessed since the action of the holes is favored at acidic
conditions, while hydroxyl radicals become the dominant 6 208
species at neutral and alkaline conditions [42]. 4 76
102 220
As known, photocatalysis occurs through the energy 74
92 116120
adsorption by the catalyst (light between 200 and 400 nm for 2 238 332
TiO2 ). Under excited condition, the valance band-electron is 161 193 226 240 268 300 316
0
transferred to the conduction band forming the hole-electron 65 80 100 116 134 155 175 197 217 238 260 280 305 325 345
pair (ℎ+ /𝑒− ) (2). The hydroxyl radicals are formed by cleavage m/z (Da)
of adsorbed molecules of water [43]:
Figure 5: MS spectrum of major oxidation products of metoprolol.
ℎ+
TiO2 + ℎ𝛾 󳨀→ TiO∗2 ( − ) (2)
𝑒
increases with time, indicating the increasing mineralization
ℎ+ + H2 O 󳨀→ ∙OH + H+ (3) of the initial organic structures.
If organic compounds are absorbed on the surface of the
catalyst, the ∙OH nonselective attack promotes the cleavage 3.4. Kinetics of MET Degradation. The Langmuir-Hinshel-
of compounds bounds. The higher MET degradation and the wood (L-H) model is usually used to describe the kinetics of
low MET adsorption on catalyst at a pH 9 suggest that the photocatalytic degradation of organic pollutants [12, 13, 30,
∙OH attack in the bulk of solution can be responsible for the 31, 41, 45], being the kinetic equation expressed as
MET degradation [40, 44].
The values of TOC during the photocatalytic degradation 𝑑𝐶 𝐾ads ⋅ 𝑘H-L ⋅ 𝐶
𝑟= − = , (4)
of MET, at two different pHs, are given in Figure 4. The TOC 𝑑𝑡 1 + 𝐾ads ⋅ 𝐶
Table 3: Intermediates proposed for the photocatalytic degradation of MET.
Detected Ret. time Molecular

𝑚/𝑧 (Da) Proposed structure
compound (DP) (min) formula
HO
O NH CH3
Metoprolol 3.24 268 C15 H25 NO3
H3 C CH3
O
OH
1 2.59 74 C4 H11 N
NH2
H2 C
HO
2 3.24 76 C3 H9 NO
NH2
H3 C
HO
3 2.59 92 C3 H9 NO2
HO NH2
O
NH
CH3
4 2.59 102 C5 H11 NO H
CH3
O
NH
5 2.59 116 C6 H13 NO CH3
H3 C
CH3
OH
NH CH3
6 3.24 118 C6 H15 NO H3 C
CH3
OH
NH
7 2.59 120 C5 H125 NO2 CH3
HO
CH3
OH
HO NH CH3
8 2.59 134 C6 H15 NO2
CH3
O
CH3
9 3.23 161 C11 H12 O
H2 C
O
CH3
10 3.23 193 C12 H16 O2 H3 C
O
Table 3: Continued.
Detected Ret. time Molecular
𝑚/𝑧 (Da) Proposed structure
compound (DP) (min) formula
O NH2
11 3.24 208 C12 H17 NO2 H3 C

O
O NH CH3
12 3.03 220 C13 H17 NO2 H CH3
O
OH
O NH2
13 3.03 226 C12 H19 NO3
H3 C
O
OH
O NH CH3
14 4.71 238 C13 H19 NO3
H CH3
O
OH
O NH CH3
15 3.23 240 C13 H21 NO3
HO CH3
HO
O NH CH3
16 3.98 300 C15 H25 NO5
H3 C CH3
O
(OH)2
HO
O NH CH3
17 3.98 316 C13 H25 NO6
H3 C CH3
O
(OH)3
HO
O NH CH3
18 3.23 332 C13 H19 NO7
H3 C CH3
O
(OH)4
where 𝑟 is the degradation rate, 𝐶 is the reactant concentra- surface of the photocatalysts is very low, 𝐾ads ⋅ 𝐶 can be
tion, 𝑡 is the time, 𝑘H-L is the rate constant, and 𝐾ad is the neglected in the denominator simplifying the equation to a
adsorption equilibrium constant. pseudo-first-order equation as given by [46]
This model assumes that adsorption is a rapid equilibrium
process and that the rate-determining step of the reaction
involves the species present in a monolayer at the solid–liquid 𝑑𝐶
𝑟= − = 𝐾ads ⋅ 𝑘H-L ⋅ 𝐶 = 𝑘 ⋅ 𝐶. (5)
interface. Furthermore if the adsorption of MET onto the 𝑑𝑡
OH
NH2 HO HO
H2 C O
DP 2 NH2 NH CH
H3 C H 3 HO NH2
DP 2
OH −C3 H8 DP 4 CH3 DP 3
NH CH3
H2 C −C3 H8
−CH3 OH −C3 H8
O CH3 OH
NH CH3 OH
NH CH H3 C
H3 C 3 HO NH CH3
CH3 CH3
DP 5 DP 6 CH3
DP 8
−C9 H10 O
OH OH
−C9 H12 O2 O NH CH3 O NH CH3
•OH
H3 C CH3 H3 C
O MET O DP 16 CH3
OH −CH3 OCH3 (OH)2
O NH2 −C3 H8
OH OH
H3 C DP 13 O NH O NH
CH3 CH3
O −H2 O
HO DP 15 H3 C
CH3 DP 17 CH3
O O
NH2 •OH ox (OH)3
H3 C DP 11 OH
O O NH CH3 OH
−NH3
O NH CH3
O H DP 14 CH3
CH3 H3 C DP 18 CH3
H3 C DP 10 O −NH3 O (OH)4
O
−CH3 OH O NH CH3
O DP 12
CH3 H CH3
H2 C DP 9
O
Figure 6: Proposed pathways for the degradation of MET.
The integrated form of the above equation is represented by were identified (Figure 5). The study was carried out using
HPLC/MS in positive electrospray model. The degradation
𝐶𝑜 intermediates for MET are shown in Table 3.
ln ( ) = 𝑘app ⋅ 𝑡, (6)
𝐶 The metoprolol has a molecular weight [M + H+] = 268.
where 𝐶0 is the initial pollutant concentration and 𝑘app is the Three intermediates corresponding to the binding of ∙OH
apparent pseudo-first-order reaction rate constant. radicals in the aromatic ring were detected at 𝑚/𝑧 300, 316,
The half-life was calculated with the following expression: and 332, di-(DP (Detected Compound) 16), tri-(DP 17), and
tetrahydroxy (DP 18) DPs, respectively. After breaking the C–
ln 2 C bond in the aliphatic part of the MET molecule, amino-diol
𝑡1/2 = . (7)
𝑘 (DP 8) was identified as one of the dominant intermediates
with 𝑚/𝑧 = 134. Different fragments of the ethanolamine side
The values of 𝑡1/2 in Table 2 verify that the direct photolysis were also identified (DP 1, DP 2, DP 3, DP 4, DP 5, DP 6, and
under simulated light was very low. The low photodegra- DP 7), probably due to the loss of the hydroxyl group and the
dation of MET was also supported by a low molar absorp- loss of isopropyl moiety.
tion coefficient (281 L mol−1 cm−1 ) measured at 221.9 nm PD 15 can be formed probably by reactions which involve
wavelength. However, an important increasing difference is attack on the ether side chain followed by elimination. On
observed in the MET degradation when TiO2 is present. the other hand, the oxidation of alcohols to aldehydes can
Also, when photocatalytic process is applied, results in be explained by the formation of DP 14 with 𝑚/𝑧 = 238
TOC conversion (63%) are notoriously improved, for initial [47]. The hydrogen abstraction and the water elimination
concentration of 50 mg L−1 of MET and 0.4 g L−1 of catalyst. of DP 14 probably generate a carbonyl, followed by an
If both processes are compared, photocatalytic process intermolecular electron transfer; it generates a double bond
is always much faster than the photolytic degradation of and the consequent formation of DP 12.
MET. Therefore, the interest of using photocatalysis in the Oxidative attack on the dimethylamine moiety results
treatment of this type of pollutant is obvious. in a DP 13 with 𝑚/𝑧 = 226. Following this, the hydrogen
abstraction and elimination of water of DP 13 generate a
3.5. Intermediates during Reaction. The major by-products carbonyl which followed by intermolecular electron transfer-
formed during 6 hours of photocatalytic treatment of MET ence, generates a double bond and forming DP 11. The DP
11 can generate DP 10 corresponding to a loss of ammonia [4] M. Huerta-Fontela, M. T. Galceran, and F. Ventura, “Occur-
after the hydrogen abstraction. The intermediate 9 could be rence and removal of pharmaceuticals and hormones through
formed by the loss of methanol combined with the attack of drinking water treatment,” Water Research, vol. 45, no. 3, pp.
∙OH on the C atom next to the ether oxygen in the aliphatic 1432–1442, 2011.
part of DP 10. [5] M. Pedrouzo, F. Borrull, E. Pocurull, and R. M. Marcé, “Pres-
A simplified fragmentation pathway of metoprolol degra- ence of pharmaceuticals and hormones in waters from sewage
dation is shown in Figure 6. treatment plants,” Water, Air, and Soil Pollution, vol. 217, no. 1–4,
pp. 267–281, 2011.
[6] A. C. Alder, C. Schaffner, M. Majewsky, J. Klasmeier, and K.
4. Conclusions Fenner, “Fate of 𝛽-blocker human pharmaceuticals in surface
water: comparison of measured and simulated concentrations
Langmuir isotherm fits very well the experimental data, in the Glatt Valley Watershed, Switzerland,” Water Research, vol.
which indicates that the adsorption of the MET onto TiO2 44, no. 3, pp. 936–948, 2010.
is by monolayer coverage of the catalyst surface. The results [7] M. Maurer, B. I. Escher, P. Richle, C. Schaffner, and A. C. Alder,
confirmed that the degradation of MET is not able to “Elimination of 𝛽-blockers in sewage treatment plants,” Water
undergo by direct photolysis due to its lower absorption Research, vol. 41, no. 7, pp. 1614–1622, 2007.
coefficient. In contrast, the addition of TiO2 photocatalyst [8] B. Abramović, S. Kler, D. Šojić, M. Laušević, T. Radović, and
significantly increases its degradation rate and, after 240 min D. Vione, “Photocatalytic degradation of metoprolol tartrate in
of irradiation, MET was totally eliminated for pH 9. The suspensions of two TiO2 -based photocatalysts with different
experimental data indicates that TiO2 photocatalysis allows surface area. Identification of intermediates and proposal of
a fast and efficient removal of metoprolol, transforming degradation pathways,” Journal of Hazardous Materials, vol. 198,
substrate into by-products that are more difficult to be pp. 123–132, 2011.
degraded by photocatalysis, as evidenced by the level of [9] M. Maurer, B. I. Escher, P. Richle, C. Schaffner, and A. C. Alder,
mineralization achieved (63%). Disappearance of MET by “Elimination of 𝛽-blockers in sewage treatment plants,” Water
photocatalysis follows Langmuir-Hinshelwood model that Research, vol. 41, no. 7, pp. 1614–1622, 2007.
can be simplified as a pseudo-first-order equation, as usually [10] E. Isarain-Chávez, J. A. Garrido, R. M. Rodrı́guez et al., “Min-
found in heterogenous photocatalysis at low concentration. eralization of metoprolol by electro-fenton and photoelectro-
Photocatalytic degradation rate of MET depends on pH, fenton processes,” Journal of Physical Chemistry A, vol. 115, no.
occurring the faster degradation at pH 9. At last, based on 7, pp. 1234–1242, 2011.
the identified degradation intermediates at 6-hour reaction [11] L. Prieto-Rodrı́guez, I. Oller, N. Klamerth, A. Agüera, E. M.
time, a photocatalytic degradation pathway of metoprolol was Rodrı́guez, and S. Malato, “Application of solar AOPs and
proposed. The main pathways involved in the photocatalytic ozonation for elimination of micropollutants in municipal
degradation process include hydroxilation of the aromatic wastewater treatment plant effluents,” Water Research, vol. 47,
ring, shortening of methoxyl contained in the lateral chain, pp. 1521–1528, 2013.
and cleavage of or addition of ∙OH to the amine lateral chain. [12] I. Kim and H. Tanaka, “Photodegradation characteristics of
PPCPs in water with UV treatment,” Environment International,
vol. 35, no. 5, pp. 793–802, 2009.
Acknowledgments [13] A. Piram, A. Salvador, C. Verne, B. Herbreteau, and R. Faure,
“Photolysis of 𝛽-blockers in environmental waters,” Chemo-
The authors are grateful to CICYT Project CTQ2011-26258, sphere, vol. 73, no. 8, pp. 1265–1271, 2008.
Consolider-Ingenio NOVEDAR 2010 CSD2007-00055, and
AGAUR, Generalitat de Catalunya (Project 200956R 1466) [14] H. Fang, Y. Gao, G. Li et al., “Advanced oxidation kinetics
and mechanism of preservative propylparaben degradation
for funds received to carry out this work.
in aqueous suspension of TiO2 and risk assessment of its
degradation products,” Environmental Science and Technology,
References vol. 47, pp. 2704–2712, 2013.
[15] L. D. Nghiem, A. I. Schäfer, and M. Elimelech, “Pharmaceutical
[1] A. Pal, K. Y.-H. Gin, A. Y.-C. Lin, and M. Reinhard, “Impacts of retention mechanisms by nanofiltration membranes,” Environ-
emerging organic contaminants on freshwater resources: review mental Science and Technology, vol. 39, no. 19, pp. 7698–7705,
of recent occurrences, sources, fate and effects,” Science of the 2005.
Total Environment, vol. 408, no. 24, pp. 6062–6069, 2010. [16] T. Heberer, “Occurrence, fate, and removal of pharmaceutical
[2] Y. Xu, T. V. Nguyen, M. Reinhard, and K. Y.-H. Gin, residues in the aquatic environment: a review of recent research
“Photodegradation kinetics of p-tert-octylphenol, 4-tert- data,” Toxicology Letters, vol. 131, no. 1-2, pp. 5–17, 2002.
octylphenoxy-acetic acid and ibuprofen under simulated solar [17] C. Hartig, M. Ernst, and M. Jekel, “Membrane filtration of two
conditions in surface water,” Chemosphere, vol. 85, no. 5, pp. sulphonamides in tertiary effluents and subsequent adsorption
790–796, 2011. on activated carbon,” Water Research, vol. 35, no. 16, pp. 3998–
[3] A. Jurado, E. Vàzquez-Suñé, J. Carrera, M. López de Alda, E. 4003, 2001.
Pujades, and D. Barceló, “Emerging organic contaminants in [18] J. Radjenović, M. Petrović, F. Ventura, and D. Barceló, “Rejec-
groundwater in Spain: a review of sources, recent occurrence tion of pharmaceuticals in nanofiltration and reverse osmosis
and fate in a European context,” Science of the Total Environ- membrane drinking water treatment,” Water Research, vol. 42,
ment, vol. 440, pp. 82–94, 2012. no. 14, pp. 3601–3610, 2008.
[19] P. Westerhoff, Y. Yoon, S. Snyder, and E. Wert, “Fate of [34] P. Fernández-Ibáñez, F. J. De Las Nieves, and S. Malato, “Tita-
endocrine-disruptor, pharmaceutical, and personal care prod- nium dioxide/electrolyte solution interface: electron transfer
uct chemicals during simulated drinking water treatment pro- phenomena,” Journal of Colloid and Interface Science, vol. 227,
cesses,” Environmental Science and Technology, vol. 39, no. 17, pp. no. 2, pp. 510–516, 2000.
6649–6663, 2005. [35] A. Mills and S. Le Hunte, “An overview of semiconductor
[20] J. Peuravuori and K. Pihlaja, “Phototransformations of selected photocatalysis,” Journal of Photochemistry and Photobiology A,
pharmaceuticals under low-energy UVA-vis and powerful vol. 108, no. 1, pp. 1–35, 1997.
UVB-UVA irradiations in aqueous solutions-the role of natural [36] F. J. Benitez, J. L. Acero, F. J. Real, G. Roldan, and F. Casas,
dissolved organic chromophoric material,” Analytical and Bio- “Bromination of selected pharmaceuticals in water matrices,”
analytical Chemistry, vol. 394, no. 6, pp. 1621–1636, 2009. Chemosphere, vol. 85, no. 9, pp. 1430–1437, 2011.
[21] Q.-T. Liu, R. I. Cumming, and A. D. Sharpe, “Photo-induced [37] K. Y. Foo and B. H. Hameed, “Insights into the modeling of
environmental depletion processes of 𝛽-blockers in river adsorption isotherm systems,” Chemical Engineering Journal,
waters,” Photochemical and Photobiological Sciences, vol. 8, no. vol. 156, no. 1, pp. 2–10, 2010.
6, pp. 768–777, 2009.
[38] K. V. Kumar and K. Porkodi, “Relation between some two- and
[22] Q.-T. Liu, R. I. Cumming, and A. D. Sharpe, “Photo-induced three-parameter isotherm models for the sorption of methylene
environmental depletion processes of 𝛽-blockers in river blue onto lemon peel,” Journal of Hazardous Materials, vol. 138,
waters,” Photochemical and Photobiological Sciences, vol. 8, no. no. 3, pp. 633–635, 2006.
6, pp. 768–777, 2009.
[39] J. S. Piccin, G. L. Dotto, and L. A. A. Pinto, “Adsorption
[23] R. Molinari, F. Pirillo, V. Loddo, and L. Palmisano, “Heteroge- isotherms and thermochemical data of FDandC RED N∘ 40
neous photocatalytic degradation of pharmaceuticals in water Binding by chitosan,” Brazilian Journal of Chemical Engineering,
by using polycrystalline TiO2 and a nanofiltration membrane vol. 28, no. 2, pp. 295–304, 2011.
reactor,” Catalysis Today, vol. 118, no. 1-2, pp. 205–213, 2006.
[40] F. Méndez-Arriaga, J. Gimenez, and S. Esplugas, “Photolysis
[24] W. Song, W. J. Cooper, S. P. Mezyk, J. Greaves, and B. M. Peake, and TiO2 photocatalytic treatment of naproxen: degradation,
“Free radical destruction of 𝛽-blockers in aqueous solution,” mineralization, intermediates and toxicity,” Journal of Advanced
Environmental Science and Technology, vol. 42, no. 4, pp. 1256– Oxidation Technologies, vol. 11, no. 3, pp. 435–444, 2008.
1261, 2008.
[41] V. Romero, N. de La Cruz, R. F. Dantas, P. Marco, J. Giménez,
[25] M. Janus, J. Choina, and A. W. Morawski, “Azo dyes decom-
and S. Esplugas, “Photocatalytic treatment of metoprolol and
position on new nitrogen-modified anatase TiO2 with high
propranolol,” Catalysis Today, vol. 161, no. 1, pp. 115–120, 2011.
adsorptivity,” Journal of Hazardous Materials, vol. 166, no. 1, pp.
1–5, 2009. [42] L. A. Ioannou, E. Hapeshi, M. I. Vasquez, D. Mantzavinos, and
D. Fatta-Kassinos, “Solar/TiO2 photocatalytic decomposition of
[26] T. E. Doll and F. H. Frimmel, “Fate of pharmaceuticals—
𝛽-blockers atenolol and propranolol in water and wastewater,”
photodegradation by simulated solar UV-light,” Chemosphere,
Solar Energy, vol. 85, no. 9, pp. 1915–1926, 2011.
vol. 52, no. 10, pp. 1757–1769, 2003.
[43] F. Méndez-Arriaga, S. Esplugas, and J. Giménez, “Photocatalytic
[27] M. Šcepanovic, B. Abramovic, A. Golubovic et al., “Photocat-
degradation of non-steroidal anti-inflammatory drugs with
alytic degradation of metoprolol in water suspension of TiO2
TiO2 and simulated solar irradiation,” Water Research, vol. 42,
nanopowders prepared using sol-gel route,” Journal of Sol-Gel
no. 3, pp. 585–594, 2008.
Science and Technology, vol. 61, pp. 390–402, 2012.
[28] K. L. Willett and R. A. Hites, “Chemical actinometry: using o- [44] H. Yang, T. An, G. Li et al., “Photocatalytic degradation kinetics
Nitrobenzaldehyde to measure light intensity in photochemical and mechanism of environmental pharmaceuticals in aqueous
experiments,” Journal of Chemical Education, vol. 77, no. 7, pp. suspension of TiO2 : a case of 𝛽-blockers,” Journal of Hazardous
900–902, 2000. Materials, vol. 179, no. 1–3, pp. 834–839, 2010.
[29] N. De la Cruz, V. Romero, R. F. Dantas et al., “o- [45] R. F. Dantas, O. Rossiter, A. K. R. Teixeira, A. S. M. Simões,
Nitrobenzaldehyde actinometry in the presence of suspended and V. L. da Silva, “Direct UV photolysis of propranolol
TiO2 for photocatalytic reactors,” Catalysis Today, vol. 209, pp. and metronidazole in aqueous solution,” Chemical Engineering
209–214, 2013. Journal, vol. 158, no. 2, pp. 143–147, 2010.
[30] F. J. Rivas, O. Gimeno, T. Borralho, and M. Carbajo, “UV-C [46] C. Sahoo, A. K. Gupta, and I. M. S. Pillai, “Heterogeneous
radiation based methods for aqueous metoprolol elimination,” photocatalysis of real textile wastewater: evaluation of reaction
Journal of Hazardous Materials, vol. 179, no. 1–3, pp. 357–362, kinetics and characterization,” Journal of environmental science
2010. and health A, vol. 47, pp. 2109–2119, 2012.
[31] D. Fatta-Kassinos, M. I. Vasquez, and K. Kümmerer, “Trans- [47] M. L. Wilde, W. M. M. Mahmoud, K. Kümmerer, and A. F.
formation products of pharmaceuticals in surface waters and Martins, “Oxidation-coagulation of 𝛽-blockers by K2FeVIO4
wastewater formed during photolysis and advanced oxidation in hospital wastewater: assessment of degradation products and
processes - Degradation, elucidation of byproducts and assess- biodegradability,” Science of the Total Environment, vol. 452-453,
ment of their biological potency,” Chemosphere, vol. 85, no. 5, pp. 137–147, 2013.
pp. 693–709, 2011.
[32] S. Sortino, S. Petralia, F. Boscà, and M. A. Miranda, “Irre-
versible photo-oxidation of propranolol triggered by self-
photogenerated singlet molecular oxygen,” Photochemical and
Photobiological Sciences, vol. 1, no. 2, pp. 136–140, 2002.
[33] Q.-T. Liu and H. E. Williams, “Kinetics and degradation prod-
ucts for direct photolysis of 𝛽-blockers in water,” Environmental
Science and Technology, vol. 41, no. 3, pp. 803–810, 2007.
http://dx.doi.org/10.1155/2013/759268
Research Article
Solar Photo-Fenton Degradation of Electro-Optical Industry
Wastewater by a Pilot-Scale Fresnel Lens Assisted IPCC Reactor
Wen-Shiuh Kuo, Dong-Yun Liu, and Chin-Fang Juang

Department of Safety, Health, and Environmental Engineering, National United University, Miao-Li 360, Taiwan
Correspondence should be addressed to Wen-Shiuh Kuo; wsk@nuu.edu.tw
Received 10 August 2013; Revised 23 October 2013; Accepted 14 November 2013
Academic Editor: M. Swaminathan
Copyright © 2013 Wen-Shiuh Kuo et al. This is an open access article distributed under the Creative Commons Attribution License,
In this study, a pilot-scale Fresnel lens mounted inclined plate curvature channel (IPCC) solar photo-Fenton reactor was well
designed, established, and evaluated for the treatment of the electro-optical industry wastewater. Under an initial pH of 3.0, a
[H2 O2 ]0 /COD0 ratio of 2, and a [H2 O2 ]0 /[Fe2+ ]0 ratio of 7.5 for a reaction time of 60 min, the COD of the wastewater could reach
a reduction of 85–90% which meets the effluent standard of EPA, Taiwan (COD < 100 mg/L). In addition, it was found that solar
light could be concentrated, which resulted in an increase in UVa+b intensity for 1.89 to 3.76 times and the temperature of the
wastewater could be raised for 8 to 16∘ C. Therefore, the residual COD of the electro-optical industry wastewater was also kept
under 100 mg/L after a 60 min of treatment even in winter season. Furthermore, the microtoxicity of the wastewater was essentially
removed. Accordingly, these results illustrated that the IPCC reactor showed a synergistic effect on the solar photo-Fenton process
not only in effectively dealing with a large amount of industrial organic wastewater, but also in the sector of energy conservation in
terms of effective utilization of solar energy.
1. Introduction hydroxyl radical possesses inherent properties that enable it

to attack refractory organic pollutants in water to achieve a
Organic wastewater from the electro-optical industry gener- complete mineralization. However, the production of pho-
ally contains so many residuals such as TMAH (C4 H13 NO), tons with artificial light sources requires significant electrical
PGMEA (C6 H12 O3 ), acrylic resin, and pigments and it is energy demand and UV lamp consumption, leading in a high
variable in composition and strength at different stages operation cost in AOPs [2].
of process. The effluent is usually characterized as a high Alternatively, solar energy is essentially unlimited and
chemical oxygen demand (COD) of wastewater. Therefore, its utilization is ecologically benign. In the wastewater treat-
biological treatment processes are susceptible for treatment of ment sector, solar technology has been extensively used as
electro-optical industry wastewater. Instead, activated carbon alternative to UV lamps to reduce the operation cost in
adsorption or coagulation is commonly used. However, new AOPs [3]. In particular, photo-Fenton process (1)–(3) using
environmental laws may consider the spent adsorbents or solar irradiation has been used as an economically viable
sludge as hazardous waste and require further treatment. process and has attracted great interest in recent years [4].
Consequently, intensive research for novel technologies with However, solar photo-Fenton process was usually carried
higher efficiency and less amount of waste generated has been out by using solar irradiation directly, resulting in a lower
stimulated. For that reason, advanced oxidation processes absorption and utilization of solar energy [5]. To improve the
(AOPs) have been previously described as a promising option efficiency and actual practice of solar photo-Fenton process,
to remove persistent pollutants from contaminated water it is necessary to maximize the absorption of solar energy for
[1] when conventional water treatment processes are not process reactor. Hence, a solar light concentrated compound
efficient enough. AOPs are able to produce a highly reactive, parabolic collector (CPC) was effectively used to treat landfill
nonspecific oxidant, mainly hydroxyl radicals ( ∙ OH). The leachate in the study of Vilar et al. [6]. Additionally, Fresnel
(a) With Fresnel lens (b) Without Fresnel lens
Figure 1: Photograph of pilot-scale solar inclined plate curvature channel (IPCC) reactor.
lens has been proven as an appropriate concentrating device Table 1: Characteristics of electro-optical industry wastewater.
for using in solar photo-Fenton process [7, 8]:
Item Range
2+ 3+ ∙ − pH 10.76∼11.24
Fe + H2 O2 󳨀→ Fe + OH +OH (1)
UV254 0.770∼0.801
Fe3+ + H2 O 󳨀→ Fe(OH)2+ + H+ (2) COD, mg/L 563∼593
TOC, mg/L 174.1∼180.3
Fe(OH)2+ + ℎ] 󳨀→ Fe2+ + ∙ OH (3) SS, mg/L 0.67∼2.17
Color (ADMI value) 507∼565
In this study, a pilot-scale Fresnel lens mounted inclined
plate curvature channel (IPCC) reactor was well designed,
established, and evaluated for treatment of the electro-optical Table 2: Average light intensity and temperature of different seasons
industry wastewater in different seasons. in Miao-Li, Taiwan.
Light range Summer—Sep. Winter—Feb. Spring—May
2. Material and Methods VIS, W/m2 749.8 711.2 817
UVa+b , W/m2 39.92 35.18 39.91
2.1. Materials. The industry wastewater used in this study UVa , W/m2 39.58 36.54 38.16
was obtained from an electro-optical industry plant located
UV365 , W/m2 8.41 7.5 8
in Miao-Li, Taiwan, during 2010–2012. The characteristics
of electro-optical industry wastewater are shown in Table 1. UV254 , W/m2 5.14 3.54 3.8
Basically, the wastewater has the properties of high pH Temp., ∘ C 33.9 26 34.66
(10.7−11.2), COD (563−593 mg/L), and TOC (174−180 mg/L).
Hydrogen peroxide (H2 O2 ) with a concentration of 35% was
supplied by Panreac Co., EU. FeSO4 ⋅ 7H2 O (Panreac Co., EU) An 8 L of the electro-optical industry wastewater was used for
with a purity of 99% was used as a source of ferrous ion. All each experiment with an initial pH of 3.0, a [H2 O2 ]0 /COD0
other chemicals used in this study were analytical grade and ratio of 2.0 g/g, and a [H2 O2 ]0 /[Fe2+ ]0 ratio of 7.5 (i.e.,
used as received. an initial H2 O2 dosage of 1173 mg/L (34.5 mM); an initial
Fe2+ dosage of 256 mg/L (4.6 mM)) for a reaction time of
2.2. Procedures. All experiments were carried out in a pilot- 60 min, which was on the basis of the results from a previous
scale Fresnel lens (5 Fresnel lens, which was made of PMMA study with 3∗3 RSM central composite design experiments
with a thickness of 2 mm, a pitch of 0.5 mm, a facet depth [9]. During the experiments, the pH of the solution was
of 0.2 mm, and Fresnel circles of 395 were used) mounted monitored using a pH meter (SP-701LI 120, Suntex Co.,
inclined plate curvature channel (IPCC) reactor (Figure 1). Taiwan) equipped with a glass electrode. Samples were with-
The distance between Fresnel lens and inclined plate is 16 cm. drawn from the reactor at preset time intervals, quenched
Table 3: Effect of Fresnel lens on the light amplification of IPCC in different seasons.
Amplification of light intensity

Light range
Summer—Sep. Winter—Feb. Spring—May
VIS >2 >2 >2
UVa+b 3.76 1.89 2.55
UVa 3.86 1.74 2.64
UV365 3.28 1.74 2.76
UV254 3.35 1.83 2.74
Table 4: Effect of Fresnel lens on IPCC for treatment of the electro-optical industry wastewater in different seasons.
Condition
a
𝑘COD , min−1 c 2
𝑟 Fresnel lens effect b
𝑘TOC , min−1 c 2
𝑟 Fresnel lens effect
With Fresnel lens 0.056 0.958 1.7 0.018 0.964 1.20
(Summer—Sep.)
Without Fresnel lens 0.033 0.906 — 0.015 0.969 —
(Summer—Sep.)
(Spring—May)
Without Fresnel lens 0.032 0.915 — 0.014 0.955 —
(Spring—May)
(Winter—Feb.)
With Fresnel lens 0.023 0.900 — 0.005 0.962 —
(Winter—Feb.)
∗
Operation condition: pH0 : 3.0, 2.0 g H2 O2 /g COD, [H2 O2 ]0 /[Fe2+ ]0 = 7.5.
a
𝑘COD : pseudo-first order rate constant based on the degradation of COD in solution.
b
𝑘TOC : pseudo-first order rate constant based on the degradation of TOC in solution.
c 2
𝑟 : coefficient of determination.
with sodium hydrogen sulfite to avoid further reactions, analyzer. Microtoxicity is expressed as EC50 (5 min, 15∘ C),
then tested for H2 O2 consumption according to the method which was defined as the effective concentration of solution
reported by Sellers [10] and iron as Fe2+ ion is determined for a 50% reduction of the luminescence of the bacterium
by Fe(II)/1,10-phenanthroline complex at 510 nm [11] using Photobacterium phosphoreum. A lower EC50 value indicates a
a Hitachi (Japan) U-2001 spectrophotometer instantly. The higher amount of toxic constituent presented in the pollutant
remaining samples were then stored at 4∘ C for the following solution. The EC50 values are expressed as percentage (%
COD, TOC, and microtoxicity analysis. v/v) of the sample [12, 13]. In addition, EC50 values could
The solar irradiation was measured with a LI-250 radia- be transformed to toxicity units (TU50 ), which was equal
tion indicator (LI-COR Co., USA) of pyranometer LI-200SA to 1/EC50 . The EC50 of electro-optical industry wastewater
and a UV280–400 nm detector of PMA 2100 (Solar Light Co., was measured and it was 300∼400%. Toxicity Unit (TU50 )
USA). was therefore in the range of 0.25∼0.33. In this study, the
TU50 value was used to trace the change in toxicity of
the electro-optical industry wastewater due to solar photo-
2.3. Analysis Fenton treatment.
2.3.1. Chemical Oxygen Demand (COD) Measurement. COD
of solution via a DR 4000 photometer (HACH Co., USA)
by using a K2 Cr2 O7 as the reacting reagent was measured in 3. Results and Discussion
order to understand the changes of degree of oxidation for Table 2 showed the average light intensity and temperature
color filter wastewater. of different seasons in Miao-Li, Taiwan. Basically, it was
found that the solar light concentrating effect of Fresnel lens
2.3.2. Total Organic Carbon (TOC) Measurement. TOC of for IPCC reactor could result in an increase of 1.89∼3.76
solution was measured by using a Shimadzu VCPH analyzer times of solar light irradiation (UVa+b ) (Table 3), which is
(Shimadzu Co., Japan) in order to know the amount of higher than that (1.2 times) of CPC reactor [15], and a raising
organics in color filter wastewater degraded to CO2 during heat irradiation in terms of 8∼16∘ C increase of wastewater
oxidation. temperature in this study. Figure 2 showed the effect of
Fresnel lens on the pH, H2 O2 consumption, and residual
2.3.3. Microtoxicity Measurement. The microtoxicity of each Fe2+ concentration in the electro-optical industry wastewater
sample was measured using an SDI M500 (SDI Co., USA) treated by solar IPCC reactor. The observed final pH of
3.1 100
3.0 80
H2 O2 consumption (%)
2.9
60
pH
2.8
40
2.7
20
2.6
2.5 0
0 10 20 30 40 50 60 0 10 20 30 40 50 60
Reaction time (min) Reaction time (min)
(a) (b)
4.8
4.4
Fe2+ (mM)
4.0
0.3
0.2
0.1
0.0
0 10 20 30 40 50 60
Reaction time (min)
Fenton
Solar photo-Fenton
Solar photo-Fenton + Fresnel lens
(c)
Figure 2: Effect of Fresnel lens on the pH, H2 O2 consumption, and residual Fe2+ concentration in the electro-optical industry wastewater
treated by solar IPCC reactor (initial pH: 3.0; [H2 O2 ]0 /COD0 = 2.0 g/g; [H2 O2 ]0 /[Fe2+ ]0 = 7.5).
Table 5: Comparisons of operation performance for compound parabolic collecting reactor (CPC), falling film reactor (FFR), and inclined
plate curvature channel (IPCC) reactor.
Accumulation
Waste-water Radiation area Reaction Initial COD Final COD Operation
Reactor type irradiated
type and vol. (L) on reactor (m2 ) time (h) (mg/L) (mg/L) dosage
energy (kJ/L∗h)
[H2 O2 ]0 =
Olive mill
CPC [14] 3.08 12 11.42 3400 1700 5000 mg/L
waste-water 30 L
[Fe2+ ]0 = 5 mM
[H2 O2 ]0 =
Olive mill
FFR [14] 1 14 5.64 3000 1700 5000 mg/L
waste-water 19 L
[Fe2+ ]0 = 5 mM
[H2 O2 ]0 =
Electro-optical
1173 mg/L
IPCC (this study) industry 0.12 1 7.45 588 44
[Fe2+ ]0 =
waste-water 8 L
4.6 mM
100 70
60
80
50
TOC degradation (%)

COD degradation (%)
60
40
30
40
20
20
10
0 0
0 10 20 30 40 50 60 70 0 10 20 30 40 50 60 70
W/O Fresnel lens (Summer—September) W/O Fresnel lens (Summer—September)
W/O Fresnel lens (Spring—May) W/O Fresnel lens (Spring—May)
W/O Fresnel lens (Winter—February) W/O Fresnel lens (Winter—February)
With Fresnel lens (Summer—September) With Fresnel lens (Summer—September)
With Fresnel lens (Spring—May) With Fresnel lens (Spring—May)
With Fresnel lens (Winter—February) With Fresnel lens (Winter—February)
(a) (b)
Figure 3: Effect of Fresnel lens on the degradation efficiency of (a) COD and (b) TOC of electro-optical industry wastewater treated by solar
IPCC reactor in different seasons (initial pH: 3.0; [H2 O2 ]0 /COD0 = 2.0 g/g; [H2 O2 ]0 /[Fe2+ ]0 = 7.5).
100 40
80 35
H2 O2 consumption (%)
Water temperature (∘ C)
60 30
40 25
20 20
0 15
0 10 20 30 40 50 60 70 0 10 20 30 40 50 60 70
W/O Fresnel lens (Summer—September) W/O Fresnel lens (Summer—September)
W/O Fresnel lens (Spring—May) W/O Fresnel lens (Spring—May)
W/O Fresnel lens (Winter—February) W/O Fresnel lens (Winter—February)
With Fresnel lens (Summer—September) With Fresnel lens (Summer—September)
With Fresnel lens (Spring—May) With Fresnel lens (Spring—May)
With Fresnel lens (Winter—February) With Fresnel lens (Winter—February)
(a) (b)
Figure 4: H2 O2 consumption (a) and water temperature (b) of the electro-optical industry wastewater treated by solar IPCC reactor in
different seasons (initial pH: 3.0; [H2 O2 ]0 /COD0 = 2.0 g/g; [H2 O2 ]0 /[Fe2+ ]0 = 7.5).
the treated wastewater was around 2.6–2.8. With the assis- as compared to CPC and FFR reactors even though the
tance of Fresnel lens, IPCC reactor had a higher H2 O2 accumulation irradiated energy per liter wastewater of IPCC
consumption efficiency due to a higher residual Fe2+ con- (7.45 kJ/L∗h) was lower than that (11.42 kJ/L∗h) of CPC.
centration to react with H2 O2 . Moreover, Figure 3 showed
the effect of Fresnel lens on the COD and TOC degradation 4. Conclusions
efficiency of the electro-optical industry wastewater by solar
IPCC reactor in different seasons. As shown in Figure 3, With the treatment of Fresnel lens assisted solar IPCC reactor,
the COD of the wastewater could have a reduction of 85– the COD of the wastewater could reach a reduction of
90% and reach the effluent standard of EPA, Taiwan (COD 85–90% and meet the effluent standard of EPA, Taiwan
< 100 mg/L), within a reaction of 60 min. An increase in (COD < 100 mg/L), after a 60 min treatment even in winter
COD degradation of 6–20% and a TOC degradation of 5– season. Moreover, the residual COD of the treated wastewater
20% of the electro-optical industry wastewater were reached was below 100 mg/L for a merely 45 min treatment, and a
with the assistance of Fresnel lens. Also, it was found that COD degradation efficiency of 93% and a mineralization
the degradation efficiency of the electro-optical industry efficiency of 65% in summer/autumn season (September)
wastewater with the use of Fresnel lens at a reaction time of could be reached. Accordingly, these results illustrated that
45 min was higher than that without the assistance of Fresnel the well designed Fresnel lens assisted IPCC reactor showed
lens at a reaction time of 60 min in summer season (Sep.). a synergistic effect on the solar photo-Fenton process not only
This could be due to a higher light irradiation and water in effectively dealing with a large amount of industrial organic
temperature increased the consumption of H2 O2 as shown wastewater, but also in the sector of energy conservation in
in Figure 4, that is, increasing the reaction rate between terms of effective utilization of solar energy.
hydrogen peroxide and any form of ferrous/ferric ion, thus
increased the rate of generation of oxidizing species such
Acknowledgment
as ∙ OH radical [16]. Furthermore, the microtoxicity (TU50 )
of electro-optical industry wastewater decreased almost to Many thanks to the kind sponsorship of National Science
0 as the reaction proceeded only 15 min for each season, Council, Taiwan (Project no.: NSC 99-2221-E-239-011), with-
indicating that the treated wastewater was essentially non- out which this work would not have been possible.
toxic. A similar phenomenon was also found in the study of
Will et al. [17]. Its result indicated that the TOC degradation
efficiency of phenol wastewater was 45% and 55% for a References
solar irradiation of 450 W/m2 and 750 W/m2 , respectively. [1] F. Al Momani, O. Gonzalez, C. Sans, and S. Esplugas, “Com-
In addition, Rodriguez et al. [18] also showed that the bining photo-Fenton process with biological sequencing batch
degradation efficiency of textile wastewater increased, while reactor for 2,4-dichlorophenol degradation,” Water Science and
the temperature of water was raised obviously from 30∘ C to Technology, vol. 49, no. 4, pp. 293–298, 2004.
60∘ C in photo-Fenton process. [2] L. A. Pérez-Estrada, S. Malato, A. Agüera, and A. R. Fernández-
To quantitatively analyze the effect of Fresnel lens on Alba, “Degradation of dipyrone and its main intermediates by
the degradation rate of electro-optical industry wastewater solar AOPs. Identification of intermediate products and toxicity
treated by solar IPCC reactor in different seasons, a pseudo- assessment,” Catalysis Today, vol. 129, no. 1-2, pp. 207–214, 2007.
first order model expressed by (4) was applied to obtain the [3] M. I. Maldonado, P. C. Passarinho, I. Oller et al., “Photocatalytic
rate constants: degradation of EU priority substances: a comparison between
TiO2 and Fenton plus photo-Fenton in a solar pilot plant,”
𝑑𝐶 Journal of Photochemistry and Photobiology A, vol. 185, no. 2-3,
− = 𝑘𝐶, (4)
𝑑𝑡 pp. 354–363, 2007.
in which 𝐶 is the concentration of COD or TOC in solu- [4] S. Malato, P. Fernández-Ibáñez, M. I. Maldonado, J. Blanco,
tion at time 𝑡 and 𝑘 is the pseudo-first order rate constant. and W. Gernjak, “Decontamination and disinfection of water
It was found that both COD and TOC degradation rate by solar photocatalysis: recent overview and trends,” Catalysis
Today, vol. 147, no. 1, pp. 1–59, 2009.
of the electro-optical industry wastewater with or without
[5] J. M. Monteagudo and A. Durán, “Fresnel lens to concentrate
Fresnel lens followed the pseudo-first order reaction kinetics
solar energy for the photocatalytic decoloration and mineral-
as indicated by a high determination coefficient (𝑟2 > ization of orange II in aqueous solution,” Chemosphere, vol. 65,
0.90) (Table 4). It was found that an enhancement for the no. 7, pp. 1242–1248, 2006.
degradation rate of electro-optical industry wastewater was [6] V. J. P. Vilar, S. M. S. Capelo, T. F. C. V. Silva, and R. A. R.
observed by the aid of Fresnel lens. In summer season, Boaventura, “Solar photo-Fenton as a pre-oxidation step for
the COD and TOC degradation rate of the electro-optical biological treatment of landfill leachate in a pilot plant with
industry wastewater was increased by a factor of 1.7 and 1.2, CPCs,” Catalysis Today, vol. 161, no. 1, pp. 228–234, 2011.
respectively. [7] J. M. Monteagudo, A. Durán, J. Guerra, F. Garcı́a-Peña, and P.
Furthermore, in order to evaluate precisely the operation Coca, “Solar TiO2 -assisted photocatalytic degradation of IGCC
performance of IPCC, a comparison among IPCC, com- power station effluents using a Fresnel lens,” Chemosphere, vol.
pound parabolic collecting reactor (CPC) [14], and falling 71, no. 1, pp. 161–167, 2008.
film reactor (FFR) [14] was made as shown in Table 5. It was [8] W. S. Kuo and C. L. Wu, “Treatment of color filter wastewater by
found that IPCC had a greater COD degradation efficiency fresnel lens enhanced solar photo-Fenton process,” Advances in
Materials Science and Engineering, vol. 2012, Article ID 679206,

6 pages, 2012.
[9] D. Y. Liu, Treatment of color filter wastewater by a pilot-scale
IPCC solar photo-Fenton reactor [M.S. thesis], National United
University, Taiwan, 2012.
[10] R. M. Sellers, “Spectrophotometric determination of hydrogen
peroxide using potassium titanium(IV) oxalate,” The Analyst,
vol. 105, no. 1255, pp. 950–954, 1980.
[11] APHA/AWWA/WEF, Standard Methods For the Examination
of Water and Wastewater, Washington DC, USA, 20th edition,
2000.
[12] O. González, C. Sans, and S. Esplugas, “Sulfamethoxazole abate-
ment by photo-Fenton. Toxicity, inhibition and biodegradabil-
ity assessment of intermediates,” Journal of Hazardous Materi-
als, vol. 146, no. 3, pp. 459–464, 2007.
[13] A. S. Koparal, Y. Yavuz, C. Gürel, and U. B. Öǧütveren,
“Electrochemical degradation and toxicity reduction of C.I.
Basic Red 29 solution and textile wastewater by using diamond
anode,” Journal of Hazardous Materials, vol. 145, no. 1-2, pp. 100–
108, 2007.
[14] W. Gernjak, M. L. Maldonado, S. Malato et al., “Pilot-plant
treatment of olive mill wastewater (OMW) by solar TiO2 photo-
catalysis and solar photo-Fenton,” Solar Energy, vol. 77, no. 5, pp.
567–572, 2004.
[15] O. M. Alfano, D. Bahnemann, A. E. Cassano, R. Dillert, and R.
Goslich, “Photocatalysis in water environments using artificial
and solar light,” Catalysis Today, vol. 58, no. 2, pp. 199–230, 2000.
[16] J.-H. Sun, S.-P. Sun, G.-L. Wang, and L.-P. Qiao, “Degradation
of azo dye Amido black 10B in aqueous solution by Fenton
oxidation process,” Dyes and Pigments, vol. 74, no. 3, pp. 647–
652, 2007.
[17] I. B. S. Will, J. E. F. Moraes, A. C. S. C. Teixeira, R. Guardani, and
C. A. O. Nascimento, “Photo-Fenton degradation of wastewater
containing organic compounds in solar reactors,” Separation
and Purification Technology, vol. 34, no. 1–3, pp. 51–57, 2004.
[18] M. Rodriguez, V. Sarria, S. Esplugas, and C. Pulgarin, “Photo-
enton treatment of a biorecalcitrant wastewater generated in
textile activities: biodegradability of the photo-treated solution,”
Journal of Photochemistry and Photobiology A, vol. 151, no. 1–3,
pp. 129–135, 2002.
http://dx.doi.org/10.1155/2013/169493
Research Article
Renovation and Reuse of Reactive Dyeing Effluent by a Novel
Heterogeneous Fenton System Based on Metal Modified PTFE
Fibrous Catalyst/H2O2
Bing Li,1 Yongchun Dong,1,2 Zhizhong Ding,2 Yiming Xu,1 and Chi Zou1
1
Textile Chemistry & Ecology, School of Textiles, Tianjin Polytechnic University, Tianjin 300387, China
2
Key Laboratory of Advanced Textile Composite of Ministry of Education, Tianjin Polytechnic University, Tianjin 300387, China
Correspondence should be addressed to Yongchun Dong; dye@tjpu.edu.cn
Received 10 July 2013; Revised 4 October 2013; Accepted 4 October 2013
Academic Editor: Mika Sillanpaa
Copyright © 2013 Bing Li et al. This is an open access article distributed under the Creative Commons Attribution License, which
permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Cu-Fe bimetallic grafted polytetrafluoroethylene (PTFE) fiber complexes were prepared and optimized as the novel heterogeneous
Fenton catalysts for the degradation of reactive dyes under UV irradiation. Cotton fabrics were dyed with three reactive dyes,
namely, Reactive Red 195, Reactive Yellow 145, and Reactive Blue 222, in tap fresh water using exhaustion process. The spent dyeing
effluents were then collected and degraded with the optimized Cu-Fe bimetallic grafted PTFE fiber complex/H2 O2 system. The
treated dyeing effluents were characterized and reused for the dyeing of cotton fabrics through the same process. The effect of
reuse process number on quality of the dyed cotton fabrics was examined. The results indicated that the Cu-Fe bimetallic modified
PTFE fiber complex with a Cu/Fe molar ratio of 2.87 was found to be the most effective fibrous catalyst, which enhanced complete
decolorization of the treated dyeing effluents with H2 O2 in 4 h. However, the TOC removal for the treated dyeing effluents was
below 80%. The dyeing quality was not affected for three successive cycles. The increase in residual TOC value influences fourth
dyeing cycle. Further TOC reduction of the treated effluents is needed for its repeated reuse in more than three dyeing cycles.
1. Introduction recalcitrant to microbial degradation. In recent years, the

increasing cost of water and wastewater treatment as well
Textile dyeing is a significant consumer of water and pro- as government’s tighter restrictions on wastewater discharges
ducer of contaminated aqueous waste streams because textile is forcing textile processors to reuse process water. A better
dyeing processes are generally conducted in water-based alternative is an attempt at renovating the dyeing wastewater
dyeing baths and the dyeing processes require the addition for reuse. Some works have been carried out to examine
of colorants and inorganic salts as dyeing promoter or the possibility of recycling dyeing effluents after decoloration
retardant. In a typical dyeing factory, about 0.2–0.5 m3 of using ozonation, electrochemistry, or Fenton process [2–13].
water is needed to produce 1 kg of finished textiles [1]. Dyeing Ozone has been often used as an effective oxidant for decol-
wastewaters are known to present strong color and high COD oration and reuse of the dyebath water, which can be recycled
values since more than 15% of the textile dyes are generally in reactive or acid dyeing process [2–5]. However, the dyeing
lost in wastewater stream during dyeing operation. It is a quality was sometimes affected by the reuse of decolorized
well-known fact that reactive dyes have become one of the dyebath water, possibly because the corresponding removal
major classes of colorants for dyeing of cellulose fiber because of chemical oxygen demand (COD) was not significant [2].
over 50% of cotton products are colored with reactive dyes. The electrochemical treatment was also used to decolorize the
Besides, a large amount of salt is usually required when exhausted reactive dyebath and washing effluents, the reuse of
the cellulose fiber is dyed with reactive dyes, which have which provided excellent red and yellow dyeing textiles [6, 7].
been one source of pollutant in dyeing wastewater. Moreover, The oxidation technologies based on ZnO [8] and K2 FeO4
the reactive dye-containing effluent is often persistent and [9] were applied for dyebath water treatment and recycle.
Cl
N
Reactive red 195 OH NH N
N
HO3 SOC2 H4 O2 S N N NH SO2 C2 H4 OSO3 H
HO3 S SO3 H
Reactive yellow 145
SO 3 Na
N
N N NH NH SO2 C2 H4 OSO3 Na
SO 3 Na N N
NaO 3 S
H3COCHN Cl
Reactive blue 222
NH2 OH SO 3 Na
N
KO3 SOH2 CH2 CO2 S HN NH N N N N
N N
NaO 3 S SO3 Na
F SO3 K NaO3S
Scheme 1: Chemical structures of the three dyes.
Fenton and photoassisted Fenton technologies as the impor- cotton fabrics by an exhaustion process, due mainly to its
tant advanced oxidation processes (AOPs) have been widely relatively high consumption rate in China for the dyeing of
applied in textile wastewater treatments. But drawbacks in cotton textiles.
the use of Fenton reactions are found to be the limitation
of pH value and the problem of separation and regeneration
at the end of the reaction [10, 11]. Moreover, Fenton and 2. Experimental
photoassisted Fenton technologies generally combined with
2.1. Materials and Reagents. Commercially scoured,
biological processes for textile wastewater treatment and
bleached, and mercerized cotton woven fabric was used in
reuse [12, 13] and thus, led to higher treating cost. In recent
this study. This fabric was further treated with a solution
years, the active heterogeneous Fenton catalysis is gradually
containing 2.0 gL−1 Na2 CO3 and 2.0 gL−1 soap at the boil for
replacing the homogeneous system by immobilized Fe ions
30 minutes, then thoroughly washed with cold water and
on the polymer substrates. Fe (III)-fiber complexes represent
dried at ambient temperature. The commercial PTFE fibers
a kind of promising heterogeneous catalysts with unique
were purchased from Fuxin Sengfuli Polymer Materials Co.,
properties, such as lower cost, easy separation, large surface
China. Acrylic acid, FeCl3 ⋅6H2 O, CuSO4 ⋅5H2 O, H2 O2 (30%,
area, suitable chemical and mechanical stability as well as
w/w), Na2 SO4 , and Na2 CO3 were of analytical grade and all
convenient utility [14–16]. However, very little research has
purchased from the Tianjin Nankai Chemicals Co., China.
been focused on the treatment and reuse of dyeing wastewater
Three commercial grade reactive dyes including Reactive Red
using a heterogeneous Fenton reaction system. The detailed
195 (RR 195), Reactive Yellow 145 (RY 145), and Reactive Blue
information about the impact of recycling on quality of the
222 (RB 222) were supplied by Tianjin Sanhuan Chemical
dyed fabric is rare for this treating process. In this approach,
Co., China. These dyes were not purified prior to use. Their
a series of Cu-Fe bimetallic grafted polytetrafluoroethylene
molecular structures are presented in Scheme 1.
(PTFE) fiber complexes was prepared and investigated as
the effective heterogeneous Fenton catalysts for renovating
and recycling reactive dye effluents for dyeing of cotton 2.2. Reactive Dyeing Procedure. A laboratory dyeing machine
fabric. This is because PTFE fiber as the support material with 12 stainless steel dyeing tubes of 500 mL capacity was
has advantages including large specific surface area, excel- used for dyeing. Known weight of pretreated cotton fabric
lent chemical and mechanical stability, easy handling, and was dyed at 3.0% shade on weight of fabric (owf) with the
convenient utility in various forms [17]. Three reactive dyes dyes selected using a fabric/liquor ratio of 1 : 50 at 60∘ C for
containing multireactive groups were used for coloration of 40 min. Dye bath consisted of necessary quantity of reactive
dye, 40.0 gL−1 Na2 SO4 , and tap fresh water. After dyeing, the Rinsing
Rinsing bath
fixation of the adsorbed dye on cotton fabric was conducted
at 60∘ C for 30 min by adding Na2 CO3 into the dyeing bath. Fresh water Wastewater
The dyed fabric was then removed from the dye bath and Dyeing Exhausted
squeezed to fall back in the bath itself. Afterwards, the dyed dyebath
fabrics were rinsed thoroughly using water at the boil for Filtration
15 min and air dried. Finally, the rinsing effluent was collected
and mixed with the exhausted dyebath water to form the or Treated Active carbon
Drain adsorption Decolorization
dyeing wastewater. wastewater
Figure 1: Schematic of degradation and reuse processes of reactive

2.3. Preparation of Metal Modified PTFE Fibrous Catalysts dyeing effluent.
2.3.1. Graft Polymerization of PTFE Fibers. According to the

literatures [18], 5.0 g of the dried PTFE fibers was immersed
mixing solution of dyeing effluent and H2 O2 in reaction ves-
into the monomer solution containing 50 mL acrylic acid
and 100 mL deionized water in a 250 mL flask. Ammonium sels. The pH of the solution was adjusted with 0.10 mmolL−1
ferrous sulphate (3.0 wt%) was also used in the monomer HNO3 and/or NaOH aqueous solution and measured using
solution to minimize the homopolymerization of acrylic DHS-25C digital pH meter (Shanghai Jingmi Instrumental
acid during the reaction. The flask containing the monomer Co., China). Afterwards, the treated dyeing effluent was
solution and fibers was bubbled with nitrogen to remove further purified by the active carbon fibers (BET specific
oxygen and was sealed. The mixture in the flask was directly surface area: 800–2000 m2 g−1 ) and then characterized for pH
subjected to gamma rays of irradiation from a 60 Co source at value, electric conductivity, color, and total organic carbon
(TOC) value according to standard methods. Color of the
a dose rate of 0.5 kGyh−1 for the given time. After irradiation,
dyeing effluent was determined by the absorbance measure-
the grafted PTFE fibers (denoted as PAA-g-PTFE) were taken
ments using UV-2401 Shimadzu spectrophotometer at the
out, washed with hot water and acetone repeatedly and dried
𝜆 max of each dye or 500 nm for the real dyeing effluent. The
in a vacuum oven at 50∘ C for 24 h, and weighed. The grafting
decoloration percentage of the dye was expressed using
degree of PTFE fibers was determined by the percentage
increase in weight to be 36.48%. 𝐶0 − 𝐶
𝐷% = × 100%, (1)
𝐶0
2.3.2. Metal PAA-g-PTFE Complexes. Five grams of PAA-g-
PTFE was placed into 150 mL of mixed metal salt aqueous where 𝐶0 and 𝐶 are the initial and residual concentrations
solutions of FeCl3 and CuSO4 . In all cases, the concentrations of the dye (mgL−1 ), respectively. Meanwhile, TOC value was
of the total metal ions were kept constant at 0.10 molL−1 . measured in the process using a Phoenix 8000 TOC analyzer
The mixture was then treated at 50∘ C and pH 2-3 for the (Tekmar-Dehrmann Inc., USA), and the TOC removal per-
given time under continuous agitation. The resulting fibrous centage of the dye was calculated by
metal complexes were filtered, washed with deionized water, TOC0 − TOC𝑡
and dried under vacuum at 60∘ C for 4.0 h to obtain Fe TOC removal (%) = × 100%, (2)
grafted PTFE fiber complex (denoted as Fe-PAA-g-PTFE), Cu TOC0
grafted PTFE fiber complex (denoted as Cu-PAA-g-PTFE),
where TOC0 and TOC𝑡 are the TOC values (mgL−1 ) at reac-
and Cu-Fe bimetal grafted PTFE fiber complex (Cu-Fe-PAA-
tion times 0 and 𝑡, respectively. When the treated effluents
g-PTFE). The residual concentrations of Fe (III) and Cu (II)
were reused, the same dyeing procedure given above was
ions in the solutions after coordination were determined
employed through adjusting the concentration of sodium
using a WXF120 atomic absorption spectrometry (Beijing
sulfate to 40.0 gL−1 in the dyeing bath, and the dyed samples
Rayleigh Analytical Instrument Corp., China) for calculating
were assessed for their quality. A schematic of the method-
the Fe content (𝑄Fe ) and Cu content (𝑄Cu ) of the complexes,
ology for degradation and reuse of reactive dyeing effluent is
respectively.
depicted in Figure 1.
2.4. Treatment and Recycle of Dyeing Effluent. The treating
2.5. Evaluation of Dyed Cotton Fabrics. Color strength (𝐾/𝑆)
system of dyeing effluent included filtration, degradation,
of the dyed fabric was established with the aid of Kubelka-
and active carbon fiber adsorption units. The dyeing effluent
Munk equation:
was firstly filtrated to remove the fiber tows for obtaining
a better degradation. The dyeing effluent was degraded at 𝐾 (1 − 𝑅)2
room temperature for the given time using a photoreaction = , (3)
𝑆 2𝑅
system consist mainly of chamber, UV lamp (400 W, 365 nm),
electromagnetic valve, relay, water bath, and reaction vessels. where 𝑅 = fraction of light reflected, 𝐾 = absorption coeffi-
The schematic diagram of the photoreaction system was pre- cient, and 𝑆 = scattering coefficient.
sented in our previous works [14, 16]. PAA-g-PTFE complex A Datacolor International SF-600 spectrophotometer in-
was firstly fixed on small glass rack and then placed into the terfaced to a personal computer under D65 illuminant, using
Table 1: Effect of Cu/Fe ratio on decoloration of three reactive dyes.
Metal content (mmol L−1 ) 𝐷180 %

Samples Cu/Fe
𝑄Fe 𝑄Cu Total RR195 RY145 RB222
Fe-PAA-g-PTFE 1.89 0.00 1.89 0 47.31 45.67 43.75
Cu-Fe-PAA-g-PTFE (i) 1.13 0.75 1.88 0.66 61.22 58.80 57.93
Cu-Fe-PAA-g-PTFE (ii) 0.54 1.55 2.09 2.87 84.65 79.18 78.55
Cu-Fe-PAA-g-PTFE (iii) 0.31 1.75 2.06 5.65 78.47 73.67 72.85
Cu-PAA-g-PTFE 0.00 1.98 1.98 / 51.90 45.79 44.86
[dye] = 0.05 mmol L−1 , [H2 O2 ] = 6.0 mmol L−1 , catalyst = 5.0 g L−1 , pH = 6.
a 10∘ standard observer, was used to measure 𝐾/𝑆 values. The

wavelength measured ranged from 400 to 700 nm with an 100
interval of 10 nm. The greater the 𝐾/𝑆 value, the greater the
coloration of the fabric sample. Then a 𝐾/𝑆 change percentage 80
(𝐾/𝑆max %) was calculated through
60
𝐾/𝑆max −2 − 𝐾/𝑆max −1
D180 (%)
𝐾/𝑆max % = × 100%, (4)
𝐾/𝑆max −1
40
where 𝐾/𝑆max −1 and 𝐾/𝑆max −2 are 𝐾/𝑆 values at the 𝜆 max
of the dyed fabric using tap fresh water and the treated 20
dyeing effluent, respectively. Moreover, the effect of recycling
of treated dyeing water on color reproduction and lightness
0
on cotton fabric was also analyzed using DE∗ and DL∗ 0 2 4 6 8 10
values, respectively, calculated with the help of CIE L∗ , a∗ ,
H2 O2 initial concentration (mmolL−1 )
and b∗ (CIELAB) equations. Level dyeing property of the
dyed cotton fabric was evaluated by relative unlevelness RR195
index (RUI) value calculated using the equation proposed by RY145
Senthilkumar and Muthukumar [2]. Color fastness to soaping RB222
and rubbing were examined in accordance with Textiles
Figure 2: Degradation of three dyes with varied initial concentra-
Test Specification for Color Fastness (GB3921.3-1997 and tion of H2 O2 .
GB3920-1997) based on ISO international standards, which
are included in the national standards of China.
3. Results and Discussion confirms that catalytic activity of metal PAA-g-PTFE com-
plexes depends highly upon their Cu/Fe molar ratio, and Cu-
3.1. Optimization of Metal Modified PTFE Fibrous Catalyst.
Fe-PAA-g-PTFE (ii) with a Cu/Fe molar ratio of 2.87 shows
Our previous work [19] revealed that Fe modified PTFE
the best catalytic activity at alkaline pH medium.
fiber complexes acted as an effective heterogeneous Fenton
catalyst for the dye degradation under UV or visible irradi-
ation. Moreover, the Cu-Fe bimetallic modified PTFE fiber 3.2. H2 O2 Initial Concentration. The degradation of each
complexes exhibited the excellent catalytic activity because
reactive dye (0.05 mmolL−1 ) was performed at pH 6 for
of the existence of synergetic effect between Fe (III) and Cu
180 min in the presence of 5.0 gL−1 Cu-Fe-PAA-g-PTFE
(II) ions. In order to meet the demands for rapid and stable
(ii) and varied H2 O2 initial concentration from 0 to
dye degradation in future commercial application, a series of
10.0 mmolL−1 . The 𝐷180 % values of three dyes were shown in
Cu-Fe bimetal PAA-g-PTFE complexes with different Cu/Fe
Figure 2.
molar ratios were prepared and used in the degradation of
the three simulated dyeing effluents containing 0.05 mmol/L Figure 2 shows that the 𝐷180 % values of three dyes grad-
reactive dye studied, respectively. The influence of Cu/Fe ually increase with increasing H2 O2 initial concentration,
molar ratio on decoloration percentage of each dye within and the increasing tendency levels at the concentration of
180 min (𝐷180 %) was presented in Table 1. 6.0 mmolL−1 . Moreover, their 𝐷180 % values are higher than
The data in Table 1 indicate that 𝐷180 % value of each 95% when H2 O2 initial concentration reached 6.0 mmolL−1 .
dyeing effluent in the presence of the bimetal PAA-g-PTFE These results indicate that almost all dye molecules have been
complexes is much higher than those in the presence of degraded under this condition. Accordingly, 6.0 mmolL−1
the monometal PAA-g-PTE complexes, and the maximum was considered to be the optimum H2 O2 initial concentration
𝐷180 % value is achieved for Cu-Fe-PAA-g-PTFE (ii). This for the degradation of 0.05 mmolL−1 dye in solution.
120 100
100 RR195
100
80
80
80
TOC removal (%)

60 60
D180 (%)
D (%)
60
40 40
40
20 20
20
0 0
0
pH = 3 pH = 6 pH = 9 0 40 80 120 160 200 240
t (min)
RR195 Without Na2 SO4 Without Na2 SO4
RY145 With Na2 SO4 With Na2 SO4
RB222
(a)
Figure 3: Relationship between pH and 𝐷180 % value.
100
100
RY145
80
3.3. The Solution pH. Some works [20–22] revealed that the 80
heterogeneous Fenton catalysts exhibited the high catalytic
TOC removal (%)

function for dye degradation over a wide pH range. In order 60 60
D (%)
to determine the dependence of photocatalytic performance

of Cu-Fe-PAA-g-PTFE (ii) on the solution pH, Cu-Fe-PAA- 40 40
g-PTFE (ii) and H2 O2 concentration were set at 5.0 gL−1
and 6.0 mmolL−1 ; respectively, the degradation of each dye 20 20
(0.05 mmolL−1 ) was then conducted for 180 min at different
pH levels, and the relationship between pH and 𝐷180 % value 0 0
were given in Figure 3. 0 40 80 120 160 200 240
Figure 3 shows that 𝐷180 % values at pH 3 and 6 are much t (min)
higher than those at pH 9 for all the dyes. These results Without Na2 SO4 Without Na2 SO4
demonstrated that Cu-Fe-PAA-g-PTFE (ii) showed excellent With Na2 SO4 With Na2 SO4
catalytic performance at acid medium. It should be noticed
that the decreased 𝐷200 % values were observed for all the (b)
dyes; however, their 𝐷180 % values were still over 75% at pH 9. 100
This proved that Cu-Fe-PAA-g-PTFE (ii) could significantly 100
RB222
accelerate the dye degradation in a broad pH range, which
80
is similar to the photocatalytic activity of the heterogeneous 80
photocatalysts such as Fe alginate gel bead [20] and bimetallic
TOC removal (%)
Cu/Fe clay [22]. 60 60

D (%)
3.4. Influence of Sodium Sulfate on Dye Degradation. In order 40 40

to accelerate absorption of reactive dyes onto cotton fibers in
water, Na2 SO4 are often used as the promoters in the dyeing of 20 20
cotton fabrics with reactive dyes [1]. However, the addition of
Na2 SO4 in the dyebath may have an effect on dyeing effluent
0 0
treatment processes. Hence, the degradation of the three 0 40 80 120 160 200 240
simulated dyeing effluents containing 0.05 mmolL−1 reactive t (min)
dye studied using Cu-Fe-PAA-g-PTFE (ii)/H2 O2 system was
Without Na2 SO4 Without Na2 SO4
carried out in the presence or absence of Na2 SO4 , and the With Na2 SO4 With Na2 SO4
results were shown in Figure 4.
Figure 4 shows that 𝐷% and TOC removal (%) values (c)
of each dye increase with the prolonging of reaction time.
It should be noticed that the addition of Na2 SO4 leads to Figure 4: Effect of Na2 SO4 on degradation of three reactive dyes
little reduction in 𝐷% and TOC removal (%) for all the ([dye] = 0.05 mmolL−1 , [H2 O2 ] = 6.0 mmolL−1 , catalyst = 5.0 gL−1 ,
dyes, suggesting that the degradation of the reactive dyes [Na2 SO4 ] = 10.05 gL−1 , pH = 6).
Table 2: Characteristics of raw and decolorized dyeing wastewater.
Numbers of Parameters Raw wastewater Treated wastewater Removal %

recycling processes
pH 8.48 6.22 /
Color (Abs) 0.502 0.008 98.41
First
Conductivity (mscm−1 ) 21.91 22.87 −4.38
TOC (mg L−1 ) 92.97 22.88 75.38
pH 8.61 6.09 /
Color (Abs) 0.522 0.009 98.27
Second
TOC (mg L−1 ) 104.2 38.02 63.51
pH 8.78 7.02 /
Color (Abs) 0.533 0.010 98.12
Third
TOC (mg L−1 ) 112.1 47.74 57.41
pH 8.52 7.34 /
Color (Abs) 0.538 0.011 97.95
Fourth
TOC (mg L−1 ) 126.1 69.09 45.22
The absorbance (Abs) at 500 nm is used to evaluate the color of real dyeing effluent. Color removal % equals 𝐷% value for real dyeing effluent.
is almost not affected by Na2 SO4 in aqueous solution. This It is evident from the data in Table 2 that the color
may be due to the two competing factors. On one hand, it is removals of more than 97% for the dyeing effluents from dif-
obvious that the presence of salt can increase the aggregation ferent recycling processes can be obtained after the treatment.
degree of ionic dyes in water, inhabiting the dye degradation However, the TOC removals of the treated dyeing effluents
[23].On the other hand, the reaction between sulfate ions gradually decrease as the number of recycling processes
and hydroxyl radical produced by photo-Fenton reaction increases. This suggests that although the dyeing effluents can
can generate the higher oxidative sulphate radicals, which be almost completely decolorized using Cu-Fe-PAA-g-PTFE
increase the dye degradation efficiency [24]. (ii)/H2 O2 system, the mineralization of the dye molecules in
the effluents is limited possibly due to the partial oxidation of
organic substrates. Similar results have been reported in the
3.5. Treatment of Real Reactive Dyeing Effluents. The raw
ozonation treatment of reactive and acid dyeing wastewaters
reactive dyeing effluents from coloration processes men-
[2, 4]. It is observed from Table 2 that their pH value and
tioned above were characterized with respect to pH, electric
electric conductivity increase with the increasing number
conductivity, color, and TOC values prior to any treat-
of recycling processes. This is attributed mainly to fact that
ment and then treated using successive filtration, degra-
addition of Na2 SO4 and Na2 CO3 during the recycling. It
dation, and active carbon adsorption units presented in
should be noted that pH values decline after the treatment for
Figure 1. The degradation process was conducted using a
all the wastewaters from the recycling processes. This may be
heterogeneous Fenton system consisting of Cu-Fe-PAA-g-
owing to the generation of acidic by-products during the oxi-
PTFE (ii) and H2 O2 . The optimal conditions were deter-
dation makes the effluent acidic in nature [26]. Additionally,
mined as follows: Cu-Fe-PAA-g-PTFE (ii), 5.0 gL−1 ; H2 O2
the treatment leads to higher conductivity, indicating that
concentration, 6.0 mmolL−1 ; degradation duration, 4.0 h, inorganic salt concentration increases in the treated effluent
based on the results of optimization experiments. More because of the partial mineralization of the dyes in water.
importantly, our previous work [25] reported that the
used Cu-Fe-PAA-g-PTFE (ii) could be reused five times
by thorough wash with mixed solution of 50/50 (v/v)% 3.6. Evaluation of Dyeing Quality. The quality of the cotton
water and ethanol under ultrasonication. The reason is that fabrics dyed with three reactive dyes using the treated
this photocatalyst was developed with the intention of (a) dyeing effluent was evaluated with respect to their color
withstanding the corrosion due to the oxidative radicals strength, color difference, fastness, and leveling proper-
produced in solution and (b) fixing the metal ions on a ties, respectively. The effect of recycling process on the
support in a stable way so as not to allow them to leach dyeing quality was then examined in order to assess the
out during the reaction. The treated effluent was reused color reproduction in the treated dyeing effluent. Con-
for the dyeing of cotton fabric after the characterization. sequently, the dyeing of cotton fabrics using tap fresh
The quality of the raw and treated effluents after different water was regarded as the control experiment, and the
recycling processes was summarized in Table 2. resulting dyed cotton fabric in the control experiment
25 20
20 16
430 nm
530 nm
15 12
K/S
K/S
10 8
5 4
RR195 RY145
0
0
350 400 450 500 550 600 650 700 350 400 450 500 550 600 650 700
Wavelength (nm)
Wavelength (nm)
3rd Control 3rd

Control
4th 1st 4th
1st
2nd 2nd
(b)
(a)
20
5
16
620 nm
4
12
K/Smax (%)
3
K/S
8
2
4
1
RB222
0 0
350 400 450 500 550 600 650 700 1st 2nd 3rd 4th
Wavelength (nm)
RR195
Control 3rd RY145
1st 4th RB222
2nd
(c) (d)
Figure 5: 𝐾/𝑆 curves and 𝐾/𝑆max % values of three dyed cotton fabrics compared to control samples.
was used as the control sample, by which dyeing reproducibil- 3.6.2. Color Differences. The DE∗ , DL∗ , Da∗ , Db∗ , DC∗ ,
ity was judged. and DH∗ values of three dyed cotton fabrics produced from
different recycling processes are given in Table 3.
It is clear, from Table 3, that, for three reactive dyes,
3.6.1. Color Strength. 𝐾/𝑆 curves and 𝐾/𝑆max % values of the the DE∗ values of the dyed fabrics became higher with the
dyed cotton fabrics obtained from various recycling processes increasing number of recycling processes, while their DL∗
and the control experiments were measured and calculated; values exhibit a reverse trend. This proposes that the dyed
the experimental results were presented in Figure 5. fabrics produced by recycling processes become gradually
It is found, from Figure 5, that 𝐾/𝑆 curves of the dyed darker in shade compared with the control samples because
cotton fabrics in the recycling processes, especially the first of their negative DL∗ values. This may be mainly attributed
and second recycling processes are similar to those of the to the insignificant variation in inorganic salt concentration
control samples. The 𝐾/𝑆max % values of the samples dyed and pH level of the treated dyeing effluents. The dyed fabrics
with three reactive dyes, particularly RY 145 and RB 222, are generally acceptable when the DE∗ values are between
significantly increase with the increasing number of recycling 0 and 1.5 and the DL∗ values are between −0.7 and 0.4. If
processes. In the case of RY 145, the 𝐾/𝑆max % value of the DL∗ values are less than −0.7, the samples are darker in
the dyed sample is slightly more than 5.0% in the fourth shade, and if they are greater than 0.4 the samples are lighter
recycling, implying that dyeing with RY 145 using the treated in shade compared to that of control sample [2]. Therefore,
effluent is limited in fourth recycling. as seen from Table 3, in the case of RR 195 and RY 145,
Table 3: Color differences of three dyed fabrics with respect to control samples.
Dyes Numbers of DE∗ DL∗ Da∗ Db∗ DC∗ DH∗

recycling processes
First 0.475 0.343 0.121 −0.306 0.078 −0.320
RR 195 Second 0.525 −0.182 −0.263 0.417 −0.205 0.448
Third 0.863 −0.584 −0.012 0.635 0.074 0.631
Fourth 1.301 −0.551 −0.265 1.148 −0.102 1.174
First 0.112 −0.039 0.103 0.018 0.062 −0.084
RY 145 Second 0.213 −0.034 −0.007 0.210 0.188 0.094
Third 0.681 −0.046 −0.101 −0.672 −0.653 −0.188
Fourth 0.680 −0.265 0.608 0.151 0.411 −0.473
First 0.241 −0.216 −0.108 −0.007 0.028 −0.105
RB 222 Second 0.583 −0.497 0.04 0.303 −0.305 −0.022
Third 0.963 −0.879 0.106 0.379 −0.393 0.033
Fourth 0.995 −0.954 0.002 0.285 −0.280 −0.053
The control samples were regarded as the references.
Table 4: Relative unlevelness index (RUI) values of dyed samples.
Dyed samples Reactive red 195 Reactive yellow 145 Reactive blue 222
Control 0.022 0.030 0.033
First recycle 0.046 0.055 0.052
Second recycle 0.067 0.081 0.070
Third recycle 0.091 0.099 0.102
Fourth recycle 0.137 0.158 0.149
RUI values: <0.2 (excellent levelness), 0.2–0.49 (good levelness), 0.5–1.0 (poor levelness ), and >1.0 (bad levelness) [2].
the DE∗ and DL∗ values fall in acceptable limits for all the recycling processes and the control experiments were tested
recycling process, suggesting that recycled effluents can be and summarized in Table 5.
used four times; whereas, for RB 222, the DE∗ values are The data in Table 5 indicate that the increase in number
accepted in all the recycles; however, the DL∗ values are lower of recycling processes is accompanied by an insignificant
than −0.7 in the last two recycling processes. This reveals reduction in the soaping fastness and rubbing fastness of the
that the recycled effluents can be used only two times for dyed cotton fabrics. This demonstrates that the formation of
RB 222, which may be attributed to increasing amount of by-products during Fenton reaction may interfere with the
the intermediates formed during Fenton-treatment in third fixation of the reactive dye on cellulose fiber during the dyeing
and fourth recycling processes. Also this mainly stems from procedure, thus, causing the insignificant reduction in color
the difference in the dyeing characteristics and molecular fastness. However, it is believed that the soaping fastness and
structure between these reactive dyes. rubbing fastness of the dyed cotton fabrics using the treated
dyeing effluent as the aqueous medium are still of practical
3.6.3. Level Dyeing Character. In order to accurately examine value in the future commercial application.
the levelness of the dyed cotton fabrics obtained from various
recycling processes and control experiments, their RUI index
were calculated and provided in Table 4. 4. Conclusions
It is seen from Table 4 that the RUI indexes of the dyed The Cu-Fe bimetallic modified PTFE fiber complex with a
cotton fabrics using the treated effluents are higher than those Cu/Fe molar ratio of 2.87 as a novel heterogeneous Fenton
of control samples, and it shows a gradual increasing trend photocatalyst was successfully applied in the treatment and
as the number of recycling processes increases. But these reuse of reactive dyeing effluents under UV irradiation. A
RUI indexes are still accepted according to the relationship complete decoloration and relatively high TOC removal can
between RUI and visual appearance of levelness suggested by be achieved within 4 h, when this catalyst was used. TOC
Senthilkumar and Muthukumar [2]. removal level is mainly dependent on the number of recycling
processes. Increasing the number of recycling processes
3.6.4. Fastness Properties. The soaping fastness and rubbing resulted in the dark shade, relatively big color differences,
fastness of the dyed cotton fabrics obtained from various and insignificant deteriorated fastness of the dyed cotton
Table 5: Soaping and rubbing fastness of dyed cotton fabrics in recycling processes.
Numbers of Soaping fastness Rubbing fastness

Dyes
recycling processes Staining Fading Dry Wet
Control 4-5 4-5 4-5 4-5
First 4-5 4-5 4-5 4-5
Reactive red 195 Second 4-5 4 4-5 4
Third 4-5 4 4 4
Fourth 4 4 4 4
Control 4-5 4-5 4-5 4-5
First 4-5 4-5 4-5 4-5
Reactive yellow 145 Second 4-5 4-5 4-5 4
Third 4-5 4 4-5 4
Fourth 4 4 4 4
Control 4-5 4-5 4-5 4
First 4-5 4-5 4-5 4
Reactive blue 222 Second 4-5 4-5 4-5 4
Third 4-5 4-5 4-5 4
Fourth 4 4 4 4
fabrics using the treated dyeing effluence compared to those [3] M. Sundrarajan, G. Vishnu, and K. Joseph, “Ozonation of light-
of control samples. Quality of the dyeing effluents treated shaded exhausted reactive dye bath for reuse,” Dyes and Pig-
by the resulting catalyst could comply with the criteria of ments, vol. 75, no. 2, pp. 273–278, 2007.
water quality for reuse in the reactive dyeing processes. The
number of recycled effluents is found to be highly determined [4] S. V. Srinivasan, T. Rema, K. Chitra et al., “Decolourisation of
leather dye by ozonation,” Desalination, vol. 235, no. 1–3, pp. 88–
by quality of the treated dyeing effluent and dyeing properties
92, 2009.
of the reactive dyes used. It should be pointed out that
the TOC removal for treated dyeing effluents was below [5] P. Colindres, H. Yee-Madeira, and E. Reguera, “Removal of
60% except first two recycling processes. The impact of the Reactive Black 5 from aqueous solution by ozone for water reuse
significant increase in residual TOC value on fourth dyeing in textile dyeing processes,” Desalination, vol. 258, no. 1–3, pp.
cycle suggests that this novel heterogeneous Fenton catalyst 154–158, 2010.
is feasible for decolorizing reactive dyebath waters for third
cycle of reuse. Further TOC reduction of the treated dyeing [6] N. Mohan, N. Balasubramanian, and C. A. Basha, “Electro-
effluent is needed for its repeated reuse in more than three chemical oxidation of textile wastewater and its reuse,” Journal
dyeing cycles. of Hazardous Materials, vol. 147, no. 1-2, pp. 644–651, 2007.
[7] V. López-Grimau, M. del Carmen Gutiérrez-Bouzán, J. Vallde-

peras, and M. Crespi, “Reuse of the water and salt of reactive
Acknowledgments dyeing effluent after electrochemical decolorisation,” Coloration
The authors thank the Tianjin Municipal Science and Tech-
nology Committee for a Research Program of Application [8] L. S. Roselin and R. Selvin, “Photocatalytic treatment and
Foundation and Advanced Technology (11JCZDJ24600). This reusability of textile dyeing effluents from cotton dyeing indus-
research was also supported in part by a Grant from the tries,” Science of Advanced Materials, vol. 3, no. 1, pp. 113–119,
Natural Science Foundation of China (20773093). 2011.
[9] I. Ciabatti, F. Tognotti, and L. Lombardi, “Treatment and reuse

References of dyeing effluents by potassium ferrate,” Desalination, vol. 250,
no. 1, pp. 222–228, 2010.
[1] S. Yi, Y. Dong, B. Li, Z. Ding, X. Huang, and L. Xue, “Adsorption
and fixation behaviour of CI Reactive Red 195 on cotton woven [10] Z. Wang, W. Ma, C. Chen, and J. Zhao, “Light-assisted decom-
fabric in a nonionic surfactant Triton X-100 reverse micelle,” position of dyes over iron-bearing soil clays in the presence of
Coloration Technology, vol. 128, no. 4, pp. 306–314, 2012. H2 O2 ,” Journal of Hazardous Materials, vol. 168, no. 2-3, pp.
1246–1252, 2009.
[2] M. Senthilkumar and M. Muthukumar, “Studies on the possi-
bility of recycling reactive dye bath effluent after decolouration [11] H. Jia, J. Zhao, X. Fan, K. Dilimulati, and C. Wang, “Photodegra-
using ozone,” Dyes and Pigments, vol. 72, no. 2, pp. 251– dation of phenanthrene on cation-modified clays under visible
255, 2007. light,” Applied Catalysis B, vol. 123, pp. 43–51, 2012.
[12] F. Feng, Z. Xu, X. Li, W. You, and Y. Zhen, “Advanced treatment [25] Z. Ding, Y. Dong, B. Li, and M. Li, “Preparation of grafted PTFE
of dyeing wastewater towards reuse by the combined Fenton fiber metallic complexes and their photocatalytic degradation
oxidation and membrane bioreactor process,” Journal of Envi- abilities,” Acta Physico-Chimica Sinica, vol. 29, no. 1, pp. 157–166,
ronmental Sciences, vol. 22, no. 11, pp. 1657–1665, 2010. 2013.
[26] J. Feng, X. Hu, P. L. Yue, H. Y. Zhu, and G. Q. Lu, “Degradation
[13] J. Blanco, F. Torrades, M. De la Varga, and J. Garcı́a-Montaño, of azo-dye orange II by a photoassisted Fenton reaction using
“Fenton and biological-Fenton coupled processes for textile a novel composite of iron oxide and silicate nanoparticles as a
wastewater treatment and reuse,” Desalination, vol. 286, pp. catalyst,” Industrial and Engineering Chemistry Research, vol. 42,
394–399, 2012. no. 10, pp. 2058–2066, 2003.
[14] X. Liu, R. Tang, Q. He, X. Liao, and B. Shi, “Fe(III)-loaded
collagen fiber as a heterogeneous catalyst for the photo-assisted
decomposition of Malachite Green,” Journal of Hazardous
Materials, vol. 174, no. 1–3, pp. 687–693, 2010.
[15] Y. Dong, Z. Han, C. Liu, and F. Du, “Preparation and pho-

tocatalytic performance of Fe (III)-amidoximated PAN fiber
complex for oxidative degradation of azo dye under visible light
irradiation,” Science of the Total Environment, vol. 408, no. 10,
pp. 2245–2253, 2010.
[16] Z. Han, Y. Dong, and S. Dong, “Copper-iron bimetal modified

PAN fiber complexes as novel heterogeneous Fenton catalysts
for degradation of organic dye under visible light irradiation,”
Journal of Hazardous Materials, vol. 189, no. 1-2, pp. 241–248,
2011.
[17] Q. Zhang, S. Zhang, S. Chen, P. Li, T. Qin, and S. Yuan,

“Preparation and characterization of a strong basic anion
exchanger by radiation-induced grafting of styrene onto
poly(tetrafluoroethylene) fiber,” Journal of Colloid and Interface
Science, vol. 322, no. 2, pp. 421–428, 2008.
[18] C. Xiong and C. Yao, “Preparation and application of acrylic

acid grafted polytetrafluoroethylene fiber as a weak acid cation
exchanger for adsorption of Er(III),” Journal of Hazardous
Materials, vol. 170, no. 2-3, pp. 1125–1132, 2009.
[19] Z. Ding, Y. Dong, and B. Li, “Preparation of a modified PTFE

fibrous photo-Fenton catalyst and its optimization towards the
degradation of organic dye,” International Journal of Photoen-
ergy, vol. 2012, Article ID 121239, 8 pages, 2012.
[20] Y. Dong, W. Dong, Y. Cao, Z. Han, and Z. Ding, “Preparation

and catalytic activity of Fe alginate gel beads for oxidative
degradation of azo dyes under visible light irradiation,” Catalysis
Today, vol. 175, no. 1, pp. 346–355, 2011.
[21] J. Feng, X. Hu, and P. L. Yue, “Effect of initial solution pH on the

degradation of Orange II using clay-based Fe nanocomposites
as heterogeneous photo-Fenton catalyst,” Water Research, vol.
40, no. 4, pp. 641–646, 2006.
[22] A. C.-K. Yip, F. Leung-Yuk Lam, and X. Hu, “Novel bimetallic

catalyst for the photo-assisted degradation of Acid Black 1 over
a broad range of pH,” Chemical Engineering Science, vol. 62, no.
18-20, pp. 5150–5153, 2007.
[23] W. S. Perkins, Textile Coloration and Finishing, Chinese notation

edition authorized by Carolina Academic Press, China Textile
Press, Beijing, China, 2004.
[24] Y. Dong, L. He, Q. Wang, M. Yang, R. Qi, and K. Li, “Effect of

inorganic salts on ferric oxalate-induced decomposition of CI
Acid Black 234 under different weather conditions,” Coloration
http://dx.doi.org/10.1155/2013/191742
Research Article
Application of Ozone Related Processes to Mineralize
Tetramethyl Ammonium Hydroxide in Aqueous Solution
Chyow-San Chiou,1 Kai-Jen Chuang,2,3 Ya-Fen Lin,1 Hua-Wei Chen,4 and Chih-Ming Ma4
1
Department of Environmental Engineering, National Ilan University, Ilan 260, Taiwan
2
Department of Public Health, School of Medicine, College of Medicine, Taipei Medical University, Taipei 110, Taiwan
3
School of Public Health, College of Public Health and Nutrition, Taipei Medical University, Taipei 110, Taiwan
4
Department of Cosmetic Application & Management, St. Mary’s Junior College of Medicine, Nursing and Management,
Yilan 266, Taiwan
Correspondence should be addressed to Hua-Wei Chen; superlemi@smc.edu.tw
Received 18 June 2013; Revised 21 September 2013; Accepted 3 October 2013
Copyright © 2013 Chyow-San Chiou et al. This is an open access article distributed under the Creative Commons Attribution
License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly
cited.
Tetramethyl ammonium hydroxide (TMAH) is an anisotropic etchant used in the wet etching process of the semiconductor industry
and is hard to degrade by biotreatments when it exists in wastewater. This study evaluated the performance of a system combined
with ultraviolet, magnetic catalyst (SiO2 /Fe3 O4 ) and O3 , denoted as UV/O3 , to TMAH in an aqueous solution. The mineralization
efficiency of TMAH under various conditions follows the sequence: UV/O3 > UV/H2 O2 /O3 > H2 O2 /SiO2 /Fe3 O4 /O3 > H2 O2 /O3 >
SiO2 /Fe3 O4 /O3 > O3 > UV/H2 O2 . The results suggest that UV/O3 process provides the best condition for the mineralization
of TMAH (40 mg/L), resulting in 87.6% mineralization, at 60 min reaction time. Furthermore, the mineralization efficiency of
SiO2 /Fe3 O4 /H2 O2 /O3 was significantly higher than that of O3 , H2 O2 /O3 , and UV/H2 O2 . More than 90% of the magnetic catalyst
was recovered and easily redispersed in a solution for reuse.
1. Introduction available information on the biodegradability of TMAH

is scarce. Chemical oxidation involving various forms of
The semiconductor industry is an important component advanced oxidation processes (AOPs) can be employed as
of the electronics industry, whose global market yield has preliminary treatment to convert the potentially biorefrac-
already exceeded that of the automobile industry. Anisotropic tory compounds into intermediate products that are more
chemical wet etching is widely used in the semiconductor amenable to biodegradation [6].
industry to fabricate microstructures on single crystal silicon Ozone (O3 ) is a chemical agent widely used for the miner-
wafers [1]. Of all the anisotropic etchants, the inorganic KOH alization (i.e., transformation into CO2 and inorganic ions) of
(potassium hydroxide) and organic TMAH (tetramethyl herbicides and related biorecalcitrant organic contaminants
ammonium hydroxide) solutions are the most commonly in water [7]. Disadvantages of ozonation alone (O3 system)
used [1, 2]. Moreover, TMAH solution has also attracted for water treatment are the high energy cost required for
attention because it is clean room compatible, nontoxic, its generation and very limited mineralization of refractory
and easy to handle. It also exhibits excellent selectivity to COD in industrial effluents. Indeed, hydroxyl radical is a less
silicon oxide and silicon nitride masks [3, 4]. It has been selective and more powerful oxidant than molecular ozone.
estimated that, for an 8 in wafer manufacturing facility with A common objective of AOPs is to produce a large amount
a monthly production of 20,000 wafer units, TMAH is by far of radicals (especially ∙ OH) to oxidize the organic matter.
the most concentrated chemical in wastewater [5]. Biological Alternative procedures involving ozonation catalyzed with
processes are the most widely accepted treatment for organic H2 O2 [5], UV light [6], catalysts [1], and Fe2+ [8, 9] allow a
wastewater of both domestic and industrial origins; however, quicker removal of organic pollutants, because such catalysts
Effluent
O3 outlet
O3 inlet
O3 generator
Triogen
UV lamp
Sampling port
Peristaltic pump
O2
H2 O2
Figure 1: Experimental sketch of UV/H2 O2 /O3 system.
improve the oxidizing power of O3 yielding a significant at 90∘ C; the pH was maintained at 9.5 with 0.1 N NaOH,
reduction of its economic cost. while being stirred by a mechanic stirrer. An appropriate
The present study assessed the function of UV light, amount of 20 g Na2 O ⋅ 𝑛SiO2 was dissolved in 100 mL of
magnetic catalyst (SiO2 /Fe3 O4 ), and H2 O2 on the enhancing deionized water; the aqueous solution was then mixed with
O3 to mineralize TMAH. A concentration of total organic the aqueous solution containing magnetite (Fe3 O4 ) with a
carbon (TOC) was chosen as a mineralization index of mechanic stirrer for 30 min. At last, the magnetic catalysts
decomposition of TMAH. The effects of pH value of aqueous (i.e., SiO2 /Fe3 O4 ) were dried at 105∘ C, after the pH value of
solution and ionic strength, Cl− , on the mineralization of the slurry solution was maintained at 8 with 5 N H2 SO4 .
TMAH were examined in this study.
2.2. Instrumental Analysis. Tetramethyl ammonium hydrox-
2. Material and Methods ide, TMAH (C4 H10 NO, MW = 98), supplied by Aldrich
(USA) was used as the target compound in this study.
The batch experiments of mineralization reaction were con- Hydrogen peroxide (H2 O2 ) of 35 wt.% supplied by Shimakyu
ducted in a 2.3 L glass flask reactor as illustrated in Figure 1. Co. (Japan) was injected into the reactor at a constant feed
The UV irradiation source was two 8 W lamps encased in a rate by syringe pump. All chemicals from several suppliers
quartz tube with wavelengths of 254 nm. A UVX Radiometer were reagent grade. The mineralization efficiency of TMAH
(UVP Inc., USA) was employed for the determination of by this advanced oxidation process was determined by the
UV light intensity. The UV intensity of one 8 W UV lamp analytical results of a TOC analyzer (Tekmar, Dohrmann
at 254 nm is 18.6 mW/cm2 . The ozone generator is from Phoenix 8000). Na2 SO3 solution (1.0 g/L) and Spectroquant
Triogen with the capacity of 10 g/hr. The flow rate of ozone Picco colorimeter test kit (Merck, Germany) was used to
air stream was 4 L/min directed into the photoreactor, and the quench and measure residual dissolved ozone in samples for
inlet ozone concentration was 26 mg/L. The concentration of TOC analysis, respectively. This instrument utilizes the UV-
ozone was analyzed online by an ozone analyzer (Anseros, persulfate technique to convert organic carbon into carbon
Ozamat GM-6000-PRO). H2 O2 was added into the reactor dioxide (CO2 ), analyzed by an infrared CO2 analyzer and
by a syringe pump at constant dosage rate. The pH value calibrated with potassium hydrogen phthalate. The magnetic
of the solution was controlled by the addition of 0.01 N properties and the isoelectric point (IEP) of the catalysts were
H2 SO4 /NaOH during the whole reaction time. The effects determined by a vibrating sample magnetometer (Lake Shore,
of pH values, ionic strength, and the initial concentration 7407) and a Zetasizer (Nano ZS ZEN 3600), respectively.
of Cl− on mineralization efficiency of the UV/O3 process
were examined by varying one factor while keeping the other
parameters fixed. 3. Results and Discussion
3.1. Surface Characteristics of Magnetic Photocatalyst. Fig-
2.1. Catalysts Preparation. Magnetite (Fe3 O4 ) was purchased ure 2 showed the surface zeta potential versus pH for the
from Sigma-Aldrich (St. Louis, MO, USA) and used without magnetic catalyst SiO2 /Fe3 O4 , and this same process was
any further purification. A total of 1.08 L of aqueous solution repeated two times. The pH of the isoelectric point (IEP) for
containing 20 g of Fe3 O4 particles was held in a 2 L beaker the magnetic catalyst SiO2 /Fe3 O4 was 2.8. The IEP for SiO2
20 namely, (i) direct attack and (ii) indirect attack through the
formation of hydroxyl radicals [12]. The observed 𝜂TOC,TMAH
10 is better than that for UV/H2 O2 . Under condition (c), using
H2 O2 and O3 (denoted here as H2 O2 /O3 ), a better 𝜂TOC,TMAH
0 (approximately 58.1% at 𝑡 = 90 min) was achieved as
Zeta potential (mV)
compared to the values under conditions (a) and (b), thereby

−10 confirming the strong oxidation ability of H2 O2 /O3 . The
oxidation potential of H2 O2 /O3 is based on the fact that
−20 the conjugate base of H2 O2 can catalyze ozone into the
formation of ∙ OH (Gottschalk et al., 2000). An optimum dose
−30 ratio of H2 O2 /O3 has often been shown to be in the molar
range of 0.5–1 depending on the presence of promoters and
−40
scavengers. H2 O2 itself can act as a scavenger as well as an
initiator, and therefore determining the optimum dose ratio
of H2 O2 /O3 is important [7]. With the stoichiometric molar
−50
1 2 3 4 5 6 7 8 ratio of H2 O2 /O3 being 0.5, the overall reaction of H2 O2
pH value catalyzes O3 to produce ∙ OH as shown in (2). In this study,
the dosage rates of O3 and H2 O2 are 5.0 × 10−4 mol/min and
Figure 2: Zeta potential of magnetic catalysts (SiO2 /Fe3 O4 ).
2.5 × 10−4 mol/min, respectively; consider the following
H2 O2 + 2O3 󳨀→ 2 ∙ OH +3O2 (2)

particles and Fe3 O4 particles was previously determined by
other procedures and ranged from 2 to 3 and from 6.5 to 6.8, Condition (d), in which UV and O3 (denoted as UV/O3 )
respectively [10]. Therefore, the results observed that Fe3 O4 were employed, yielded a value of approximately 87.6% for
(core) was almost covered by SiO2 (shell) because the IEP of 𝜂TOC,TMAH after 60 min of reaction time, which is far better
SiO2 /Fe3 O4 was close to SiO2 particles. than conditions (a), (b), and (c). Due to the strong photolysis
The magnetic properties of the SiO2 /Fe3 O4 and Fe3 O4 of ozone in combination with UV radiation (𝜀254 nm =
core were measured with a vibrating sample magnetometer 3300 M−1 cm−1 for O3 ), the decay rate of ozone for decay
(VSM), as shown in Figure 3. The M-H plots showed the resulting from the UV is higher than that resulting from
change in Ms of the particles, after the incorporation of a SiO2 H2 O2 by a factor of approximately 1000 [7]; this results in the
shell. The saturation magnetization (Ms) was 39.2 emu g−1 production of more hydroxyl radicals according to (3) and
and was observed in SiO2 /Fe3 O4 . The results indicated that (4), which in turn results in higher mineralization efficiency,
the prepared samples exhibited paramagnetic behaviors at as follows:
room temperature [11].
O3 + ℎ𝜐 󳨀→ O ( 1 D) + O∗2 (3)
3.2. Mineralization Efficiency of TMAH under Various Con-
ditions. To confirm the roles of O3 , UV, and H2 O2 in the O ( 1 D) + H2 O 󳨀→ 2 ∙ OH (4)
mineralization reaction of TMAH, five sets of experiments
were performed to compare the mineralization efficiency of Condition (e), involving UV, O3 , and H2 O2 (denoted as
TMAH under various conditions as a function of time, which UV/H2 O2 /O3 ), resulted in a poor efficiency (𝜂TOC,TMAH =
is given as 𝜂TOC,TMAH = (TOC0 −TOC)/TOC0 , and the results 72.3% at 𝑡 = 60 min) as compared to condition (d). In the
are shown in Figure 4. Condition (a) denotes a reaction UV/O3 process, the amount of residual O3 in the aqueous
system with UV 254 nm, power density of 37.2 mW/cm2 , and solution was small due to the high decay rate of O3 by UV
𝑑𝐶H2 O2 /𝑑𝑡 of 2.5 × 10−4 mol/min (called UV/H2 O2 ). The irradiation, and subsequently H2 O2 , when added, will react
obtained 𝜂TOC,TMAH was 38.5% after 60 min of reaction time. with ∙ OH instead of with O3 as indicated in (5). Under this
We also attempted to mineralize TMAH by H2 O2 alone, and condition, H2 O2 behaves as a scavenger of ∙ OH and a small
the result indicated that H2 O2 does not possess the ability value of 𝜂TOC,TMAH results. In this study, we also evaluated
to mineralize TMAH. As is the case with UV, with H2 O2 , the effect of the addition of H2 O2 on the mineralization
theoretically, the photolysis of one mole H2 O2 leads to two efficiency of UV/O3 , and the experimental results (data not
moles ∙ OH according to (1), and the resulting ∙ OH with shown) indicated that even the relatively low H2 O2 dosage
higher oxidation potential could mineralize TMAH (38.5%) of 𝑑𝐶H2 O2 /𝑑𝑡 = 5.0 × 10−5 mol/min causes the molar ratio
as follows: of H2 O2 /O3 to have a value considerably below 0.5. The
mineralization efficiency of UV/O3 with the addition of
H2 O2 + ℎ𝜐 󳨀→ 2 ∙ OH (1) H2 O2 is poorer than that without the addition of H2 O2 . This
result led to the conclusion that adding H2 O2 into the UV/O3
Condition (b) represents a reaction system with only O3 ,
process will result in a negative effect on 𝜂TOC,TMAH as follows:
and the resulting percentage of 𝜂TOC,TMAH was approximately
49.2% after 60 min of reaction time. There are two mech- ∙
anisms through which O3 can degrade organic pollutants, H2 O2 + OH 󳨀→ H2 O + ∙ O2 H (5)
60
1.0
Fe3 O4 /SiO2
40
0.8
Magnetization, M (emu/g)
20
TOC/TOC0
0.6
0
0.4
−20
0.2
−40
0.0
−60 0 10 20 30 40 50 60
−6000 −4000 −2000 0 2000 4000 6000
Reaction time (min)
Magnetic field, H (Oersted)
(a) H2 O2 /O3 (e) UV/O3
Figure 3: Magnetization versus applied magnetic field for magnetic (b) O3 (f) H2 O2 /SiO2 /Fe3 O4 /O3
catalysts (SiO2 /Fe3 O4 ). (c) UV/H2 O2 (h) SiO2 /Fe3 O4 /O3
(d) UV/H2 O2 /O3
Figure 4: Dependence of mineralization of TMAH on time

at various conditions. Experimental conditions: case (a): UV
Condition (f), involving SiO2 /Fe3 O4 , O3 , and H2 O2 (𝜆 254 ) = 37.2 mWcm−2 , dosing rate of H2 O2 (𝑑𝐶H2 O2 /𝑑𝑡) = 2.5×
(denoted as SiO2 /Fe3 O4 /H2 O2 /O3 ), resulted in a high effi-
10−4 mol/min; case (b): dosing rate of O3 (𝑑𝐶O3 /𝑑𝑡) = 5.0 ×
ciency (𝜂TOC,TMAH = 69.0% at 𝑡 = 60 min) as compared to
10−4 mol/min; case (c): 𝑑𝐶H2 O2 /𝑑𝑡 = 2.5×10−4 mol/min, 𝑑𝐶O3 /𝑑𝑡 =
condition (a). To evaluate the ability of catalyst adsorption,
the adsorption experiment at SiO2 /Fe3 O4 = 0.2 g and 5.0 × 10−4 mol/min; case (d): UV (𝜆 254 ) = 37.2 mWcm−2 , 𝑑𝐶O3 /𝑑𝑡 =
initial concentration of TMAH = 40 mg/L revealed that 5.0 × 10−4 mol/min; case (e): UV (𝜆 254 ) = 37.2 mWcm−2 , 𝑑𝐶O3 /𝑑𝑡 =
the adsorption of TMAH was less than 10% within 60 min- 5.0 × 10−4 mol/min, 𝑑𝐶H2 O2 /𝑑𝑡 = 2.5 × 10−4 mol/min. The initial
utes. The mineralization efficiency of SiO2 /Fe3 O4 /H2 O2 /O3 concentration of TMAH (CTMAH,0 ) for all cases was 40 mg/L;
was significantly higher than that of pure O3 , possibly case (f): SiO2 /Fe3 O4 = 0.2 g, 𝑑𝐶O3 /𝑑𝑡 = 5.0 × 10−4 mol/min,
because SiO2 /Fe3 O4 and H2 O2 could react with the dis- 𝑑𝐶H2 O2 /𝑑𝑡 = 2.5 × 10−4 mol/min. The initial concentration of
solved O3 molecules to generate reactive oxidative species TMAH (CTMAH,0 ) for all cases was 40 mg/L.
(O2 − , HO2 ∙ , ∙ OH, and O3 − ) via free-radical chain reactions.
The initiator (H2 O2 ) could induce the formation of super-
oxide ions (O2 − ) from O3 molecules, and ∙ OH formed in
variations of TOC and pH of the TMAH solution under
the chain reaction was used for the mineralization of organic
the UV/O3 process as a function of time. As shown in
compounds [13]. Furthermore, the paramagnetic behaviors of
Figure 4, the removal of TOC is close to 87.6% at 𝑡 = 60 min,
the prepared SiO2 /Fe3 O4 gave rise to the magnetic catalyst
indicating that the UV/O3 process could mineralize TMAH
SiO2 /Fe3 O4 , which could be separated more easily through
efficiently. Furthermore, the pH value of the reaction solution
the application of a magnetic field. According to the experi-
without a buffer system decreased considerably from 10 to 4.5
mental results, >90% of the magnetic catalyst was recovered
during the entire reaction time, thereby revealing that acid
and easily redispersed in a solution for reuse.
intermediates are formed before TMAH is converted into
Condition (h), involving SiO2 /Fe3 O4 and O3 (denoted as
CO2 .
SiO2 /Fe3 O4 /O3 ), resulted in a high efficiency (𝜂TOC,TMAH =
60.1% at 𝑡 = 60 min) as compared to condition (a). The
mineralization efficiency of SiO2 /Fe3 O4 /O3 was significantly 3.3. Effect of pH on the Mineralization Efficiency of UV/O3 .
higher than that of pure O3 possibly because of the enhance- The direct attack on organic pollutants by molecular ozone
ment of reactive oxidative species with the chain reaction of (commonly known as ozonolysis) occurs under acidic or
SiO2 /Fe3 O4 and the dissolved O3 . neutral conditions. At a high pH value, ozone decomposes
As a result, the mineralization efficiency of TMAH under to nonselective hydroxyl radicals according to (6), which in
various conditions follows the sequence: UV/O3 > UV/ turn oxidizes the organic pollutants. Many researches [6, 12]
H2 O2 /O3 > H2 O2 /SiO2 /Fe3 O4 /O3 > H2 O2 /O3 > SiO2 / found that an increasing pH accelerates ozone decomposi-
Fe3 O4 /O3 > O3 > UV/H2 O2 . Figure 4 presents the tion to generate hydroxyl radicals, which destroy organic
Table 1: The pseudo-first-order rate constant 𝑘obs , half-life t 1/2 , Table 2: The mineralization efficiency of TMAH by UV/O3 at
and correlation coefficients for degradation of TMAH by UV/O3 different chloride concentrations. (Experimental conditions are as
at different pH values. (Experimental conditions: pH values were shown in Figure 4(d).)
adjusted by H2 SO4 and NaOH and fixed at a constant value during
the whole reaction time; the other conditions were the same as in Cl− (mg/L) 𝜂TOC, TMAH (%)
Figure 4(d).) 0 87.56
100 80.08
pH 𝑘obs (1/min) 𝑅2
200 78.58
3.0 0.0315 0.942
300 76.05
5.0 0.0313 0.917
500 74.73
7.5 0.0312 0.973
10.0 0.0318 0.907
12
1.0
compounds more effectively than ozone. Therefore, the pH
10
of aqueous solution is an important factor that determines
the efficiency of ozonation since it can alter the degradation
0.8
pathways as well as kinetics. One has
8
O3 + OH− 󳨀→ ∙ OH + ( ∙ O2 ←→ ∙ O2 H) (6)
TOC/TOC0
0.6
For the combined oxidation process, UV/O3 , the effect
pH
6
of pH on the mineralization efficiency is more complex. The
study [14] found that neither low pH values nor high pH
0.4
values of the UV/O3 could provide a degradation rate better 4
than that obtained by the simultaneous application of UV/O3
with neutral pH values.
The pH values of the aqueous solution were controlled 0.2 2
to stay between 3 and 10 to evaluate the pH effect on the
mineralization efficiency of TMAH by the UV/O3 process,
as shown in Figure 5. As the pseudo-first-order kinetic 0.0 0
0 10 20 30 40 50 60
hypothesized, Table 1 reveals that the influence of the pH
Reaction time (min)
value on the reaction rate is negligible at pH values in the
range from 3 to 10. It is clear from (6) that more hydroxyl Figure 5: Time variation of TOC and pH using UV/O3 process to
radicals were produced at high pH values, thus enhancing mineralize TMAH. Experimental conditions were the same as those
the mineralization rate of TMAH. However, the production of case (d) in Figure 4.
of hydroxyl radicals by the UV/O3 process also proceeds
according to (3) and (4), and it was not influenced by the pH
value of the aqueous solution. Furthermore, the high OH− ion kinetic. So, the mineralization efficiency shown in Table 2
content of the system may trap the mineralization generated was illustrated by 𝜂TOC,TMAH at the reaction time of 60 min.
CO2 in the solution and, as a result, bicarbonates and carbon- The experimental results indicate that 𝜂TOC,TMAH decreased
ates are formed in the alkaline system. Both bicarbonates and with an increase in the chloride ion concentration. Chloride
carbonates are efficient scavengers of hydroxyl radicals due ions are likely to retard the efficiency of the mineralization of
to their very high reaction rate constants with the hydroxyl TMAH by competing for the oxidizing hydroxyl radicals and
radicals (𝑘 = 8.5 × 106 M−1 s−1 for bicarbonates and 𝑘 = ozone molecules. Chloride ions can be oxidized by ozone as
3.9 × 108 M−1 s−1 for carbonates). Thus, due to the influence per (7) and (8) [15], and they can be converted into ClO− and
of the increase in hydroxyl radicals and the formation of Cl2 . Thus, the effective concentration of ozone was decreased
scavengers, the comprised results causing the pH effect on by chloride ions, and the oxidation potential of the resulting
the mineralization of TMAH by UV/O3 are negligible for pH products, HOCl and Cl2 , was lower than that of ozone.
values of the solution in the range from 3 to 10. Note that a Furthermore, chloride ions may also act as scavenger with
buffer system was not introduced in the later experiments, regard to the hydroxyl radical as per (9) [15]. One has
except for the experiment relating to the pH effect.
O3 + Cl− + H+ 󳨀→ HOCl + O2 (7)
3.4. Effect of Chloride Ion and Ionic Strength on the Min- O3 + 2Cl− + 2H+ 󳨀→ Cl2 + H2 O + O2 (8)
eralization Efficiency of UV/O3 . The effect of chloride ions,
which are frequently present in industrial wastewater, on Cl− + ∙ OH 󳨀→ HOCl∙− (9)
the mineralization efficiency of TMAH with UV/O3 was
evaluated, as shown in Table 2. The mineralization rate of Ionic strength may affect the effective concentration of a
the TMAH solution containing chloride ion by the UV/O3 compound in a solution and this becomes more significant in
process could not be expressed by the pseudo-first-order the presence of polar compounds [16]. As noted, TMAH is a
The reuse experiments were carried out by evaluating

1.0 the stability of catalyst activity. In this experiment, 0.2 g L−1
of magnetic catalyst (SiO2 /Fe3 O4 ) was used at an initial
concentration of 40 mg/L of TMAH. After the ozonation
process, the magnetic catalyst (SiO2 /Fe3 O4 ) was collected by
0.8
magnetic force. The clear solution was used for analytical
determination, and the magnetic catalyst was used directly
in the subsequent catalytic ozonation process. This same
TOC/TOC0
0.6 process was repeated four times and the removal of TMAH
in the reuse experiment is shown in Figure 6. The catalytic
activity of SiO2 /Fe3 O4 remained constant and no obvious
0.4
deactivation (<15%) was observed after being used four times.
From the results of the reuse and recovery experiments,
the magnetic catalyst SiO2 /Fe3 O4 is considered to show
considerable promise in water treatment use.
0.2
4. Conclusions
0.0 The major results of applying the advanced oxidation process
0 10 20 30 40 50 60
to mineralize TMAH can be summarized as follows.
Reaction time (min)
(1) The rank of treatment conditions based on the min-
First use Third use eralization efficiency of TMAH has the sequence: UV/O3 >
Second use Fourth use UV/H2 O2 /O3 > H2 O2 /SiO2 /Fe3 O4 /O3 > H2 O2 /O3 >
SiO2 /Fe3 O4 /O3 > O3 > UV/H2 O2 .
Figure 6: Reuse performance of magnetic catalyst. (2) The experimental results of this study suggest that
UV irradiation 37.2 mWcm−2 UV (254 nm) and O3 flow rate
of 0.5 × 10−4 mol/min provide the best condition for the
Table 3: The pseudo-first-order rate constant 𝑘obs , half-life t 1/2 , mineralization of TMAH (20 mg/L), resulting in 95% min-
and correlation coefficients for degradation of TMAH by UV/O3 eralization, at 60 min reaction time. Adding H2 O2 into the
at different concentrations of K2 SO4 . (The other experimental UV/O3 process will suppress the mineralization efficiency.
conditions were the same as in Figure 4(d).) (3) The mineralization efficiency of SiO2 /Fe3 O4 /
K2 SO4 (mg/L) 𝑘obs (1/min) 𝑅2 H2 O2 /O3 was significantly higher than that of O3 , H2 O2 /
O3 UV/H2 O2 . More than 90% of the magnetic catalyst was
0 0.0320 0.977
recovered and easily redispersed in a solution for reuse.
100 0.0309 0.948
The addition of chloride ions in reaction solution will
300 0.0313 0.969 suppress the mineralization efficiency of the UV/O3 process.
500 0.0307 0.981 Ionic strength and variable pH values (from 3 to 10) in reac-
tion solution show no effect on the mineralization efficiency
of the UV/O3 process.
quaternary ammonium compound. Its ammonium ions are
surrounded by anions in solutions, resulting in shielding off Acknowledgment
oxidizing agents such as O3 and hydroxyl radicals. Presum-
ably, it decreases the mineralization efficiency of TMAH by This research was supported by the National Science Council,
the UV/O3 process. The experimental study [16] examined Taiwan, under Grant no. NSC 100-2221-E-562-001-MY3.
the effect of ionic strength on the solubility of O3 for various
types of inorganic solutions. These researchers concluded
References
that there is no significant effect on the solubility of O3
in sulfate solutions. Additionally, sulfates are not oxidized [1] H. W. Chen, Y. Ku, and Y. L. Kuo, “Photodegradation of o-
by ozone molecules and hydroxyl radicals. In the present Cresol with Ag deposited on TiO2 under visible and UV light
study, attempts have been made to evaluate the effect of irradiation,” Chemical Engineering and Technology, vol. 30, no.
ionic strength on the mineralization of TMAH in sulfate 9, pp. 1242–1247, 2007.
solutions by the UV/O3 process, and the results are shown in [2] M.-L. Wang and B.-L. Liu, “Kinetics of two-phase reaction
Table 3. As can be seen in the table, the variation of the ionic of o-phenylene diamine and carbon disulfide catalyzed by
strength neither facilitates nor suppresses the mineralization tetrabutylammonium hydroxide in the presence of potassium
of TMAH. This indicates that, in the UV/O3 process, the hydroxide,” Journal of the Chinese Institute of Engineers, vol. 30,
inhibition of the mineralization of polar organic compounds no. 3, pp. 423–430, 2007.
in an aqueous solution is not significant at high ionic [3] P. M. Sarro, D. Brida, W. V. D. Vlist, and S. Brida, “Effect of
strengths. surfactant on surface quality of silicon microstructures etched
in saturated TMAHW solutions,” Sensors and Actuators A, vol.

85, no. 1, pp. 340–345, 2000.
[4] I. Zubel and M. Kramkowska, “The effect of isopropyl alcohol
on etching rate and roughness of (100) Si surface etched in KOH
and TMAH solutions,” Sensors and Actuators A, vol. 93, no. 2,
pp. 138–147, 2001.
[5] W. Den, F.-H. Ko, and T.-Y. Huang, “Treatment of organic
wastewater discharged from semiconductor manufacturing
process by ultraviolet/hydrogen peroxide and biodegradation,”
IEEE Transactions on Semiconductor Manufacturing, vol. 15, no.
4, pp. 540–551, 2002.
[6] S.-P. Tong, D.-M. Xie, H. Wei, and W.-P. Liu, “Degradation of
sulfosalicylic acid by O3 /UV O3 /TiO2 /UV, and O3 /V-O/TiO2 : a
comparative study,” Ozone: Science and Engineering, vol. 27, no.
3, pp. 233–238, 2005.
[7] C. Gottschalk, J. A. Libra, and A. Saupe, Ozonation of Water and
Waste Water, Wiley-VCH, New York, NY, USA, 2000.
[8] T. K. Chen, C. H. Ni, and J. N. Chen, “Nitrification-
denitrification of opto-electronic industrial wastewater by
anoxic/aerobic process,” Journal of Environmental Science and
Health A, vol. 38, no. 10, pp. 2157–2167, 2003.
[9] P. Cañizares, R. Paz, C. Sáez, and M. A. Rodrigo, “Costs of
the electrochemical oxidation of wastewaters: a comparison
with ozonation and Fenton oxidation processes,” Journal of
Environmental Management, vol. 90, no. 1, pp. 410–420, 2009.
[10] D. E. Keller, D. C. Koningsberger, and B. M. Weckhuysen,
“Elucidation of the molecular structure of hydrated vanadium
oxide species by X-ray absorption spectroscopy: correlation
between the V. . .V coordination number and distance and the
point of zero charge of the support oxide,” Physical Chemistry
Chemical Physics, vol. 8, no. 41, pp. 4814–4824, 2006.
[11] J. Xu, Y. Ao, D. Fu, and C. Yuan, “Low-temperature preparation
of anatase titania-coated magnetite,” Journal of Physics and
Chemistry of Solids, vol. 69, no. 8, pp. 1980–1984, 2008.
[12] J. Hoigne and H. Bader, “The role of hydroxyl radical reactions
in ozonation processes in aqueous solutions,” Water Research,
vol. 10, no. 5, pp. 377–386, 1976.
[13] B. Kasprzyk-Hordern, M. Ziółek, and J. Nawrocki, “Catalytic
ozonation and methods of enhancing molecular ozone reac-
tions in water treatment,” Applied Catalysis B, vol. 46, no. 4, pp.
639–669, 2003.
[14] T. S. Müller, Z. Sun, M. P. Gireesh Kumar, K. Itoh, and M.
Murabayashi, “The combination of photocatalysis and ozonol-
ysis as a new approach for cleaning 2,4-dichlorophenoxyaceti-
cacid polluted water,” Chemosphere, vol. 36, no. 9, pp. 2043–
2055, 1998.
[15] J. de Laat and T. G. Le, “Effects of chloride ions on the
iron(III)-catalyzed decomposition of hydrogen peroxide and
on the efficiency of the Fenton-like oxidation process,” Applied
Catalysis B, vol. 66, no. 1-2, pp. 137–146, 2006.
[16] D. A. Skoog, D. M. West, F. J. Holler, and S. R. Crouch, Analytical
Chemistry, Thomson Learning, Singapore, 2000.
http://dx.doi.org/10.1155/2013/820165
Research Article
Removal of Textile Dyes from Aqueous Solution by
Heterogeneous Photo-Fenton Reaction Using Modified PAN
Nanofiber Fe Complex as Catalyst
Xueting Zhao,1,2 Yongchun Dong,1 Bowen Cheng,1,2 and Weimin Kang1,2

1
School of Textiles, Tianjin Polytechnic University, Tianjin 300387, China
2
State Key Laboratory of Hollow Fiber Membrane Materials and Processes, Tianjin Polytechnic University, Tianjin 300387, China
Correspondence should be addressed to Bowen Cheng; chengbowen@tjpu.edu.cn
Received 10 July 2013; Revised 20 September 2013; Accepted 6 October 2013
Academic Editor: Meenakshisundaram Swaminathan
Copyright © 2013 Xueting Zhao et al. This is an open access article distributed under the Creative Commons Attribution License,
The modified PAN nanofiber Fe complex was prepared by the amidoximation and Fe coordination of PAN nanofiber was obtained
using electrospinning technique and then used for the heterogeneous Fenton degradation of textile dyes as a novel catalyst. Some
main factors affecting dye degradation such as Fe content of catalyst, irradiation intensity, H2 O2 initial concentration, the solution
pH as well as dye structure, and initial concentration were investigated. UV-Vis spectrum analysis and TOC measurement were also
used to evaluate the dye degradation process. The results indicated that the modified PAN nanofiber Fe complex exhibited a much
better catalytic activity for the heterogeneous Fenton degradation of textile dyes than the Fe complex prepared with conventional
PAN yarns in the dark or under light irradiation. Increasing Fe content of catalyst or irradiation intensity would accelerate the dye
degradation. And the highest degradation efficiency was obtained with 3.0 mmol L−1 H2 O2 at pH 6. Moreover, this complex was
proved to be a universal and efficient catalyst for degradation of three classes of textile dyes including azo dye, anthraquinone dye,
and triphenylmethane dye. Additionally, the dye mineralization was also significantly enhanced in the presence of this complex.
1. Introduction recycling use [5]. The heterogeneous Fenton catalysts can be

obtained by immobilizing Fe ions on the polymer substrates
The dyeing wastewaters containing remarkable concentration such as Nafion membrane and fibrous materials. During
of organic dyes are often produced by the textile industry the past decade years, we have been devoted to exploring
around the world. It is well known that these dyes are toxic the polyacrylonitrile (PAN) fiber supported Fenton cata-
and nonbiodegradable to aquatic animals and plant [1–4]. lysts. And the resulting modified PAN fiber Fe complexes
Therefore, the treatment of dyeing wastewaters has become a have been considered as the effective heterogeneous Fenton
research focus in the field of environment research in recent catalysts with low cost [6]. But this catalyst suffers from
years. Various physically or mechanically based techniques some problems, such as low specific surface area and low
(e.g., activated carbon adsorption, coagulation/flocculation, utilization stability. Therefore, it is necessary to explore new
or membrane separation) have been extensively utilized. heterogeneous catalysts with higher performance for the
However, they only do a phase transfer of the pollutants. dye degradation using the polymer materials with larger
Compared with these techniques, Fenton and photo-Fenton surface area as the support substrates. On the other hand,
processes as the advanced oxidation technologies can poten- PAN nanofiber is regarded as one of the attractive fibrous
tially complete the mineralization of organic pollutants in materials owing to its excellent characteristics including large
water. Moreover, the heterogeneous Fenton technology is surface area, remarkably high porosity, and high permeability
replacing the homogeneous system because of its special compared with conventional fibers [7, 8]. It has been applied
advantages on a wide range of pH adaptability and easy widely in fine filtration [9, 10], enzyme immobilization
[11–14], and adsorptive membranes [15–18]. However, the a VISTA MPX inductively coupled plasma optical emission
detailed information regarding PAN nanofiber as the sup- spectrometer (ICP-OES, Varian Corp., USA) for calculating
ported material for heterogeneous Fenton catalyst is very the Fe content (𝑄Fe ) of Fe-AO-n-PAN.
limited. In the present work, PAN nanofibers were firstly
prepared by the electrospinning technique. PAN nanofiber Fe
2.4. Characterization of Modified PAN Nanofiber Fe Complex.
complex was then produced by its surface modification and
The surface morphology of Fe-AO-n-PAN was examined
metal coordination. Moreover, the activity of this complex
by a field emission scanning electron microscope (FE-SEM)
was investigated as a heterogeneous Fenton catalyst for the
(S-4800, Hitachi Co., Japan). The average diameter of PAN
oxidative degradation of the dye with H2 O2 . Finally, some
nanofibers was determined by analyzing the SEM images
factors affecting the dye degradation such as Fe content of
with an image analyzing software (Image-Pro Plus, Media
catalyst, light irradiation, H2 O2 initial concentration as well
Cybernetics Inc.) [21]. Composition of Fe-AO-n-PAN was
as structure and initial concentration of the dyes used were
verified by using a Nicolet Magana-560 Fourier transform
optimized and discussed.
spectrometer (Nicolet Instrument Co., USA).
2. Experimental 2.5. Photocatalytic Reaction Setup. The photoreaction system

was particularly designed in this experiment and consisted
2.1. Materials and Reagents. PAN knitting bulky yarn primarily of chamber, lamp, electromagnetic valve, relay,
(PAN yarn) that consisted of twisted PAN fibers was ob- and water bath [22]. Ten open Pyrex vessels of 150 mL
tained from Shanghai Shilin Spinning Company. N,N- capacity were served as reception receivers in water bath. A
dimethylformamide (DMF), hydroxylamine hydrochloride, 400 W high-pressure mercury lamp was used as illuminating
hydrogen peroxide (30%), and ferric chloride were of lab- source for the photocatalytic reaction. The intensity of light
oratory agent grade. Three kinds of textile dyes including irradiation over the surface of the test solution was mea-
Reactive Red 195 (RR 195), Reactive Blue 4 (RB 4), and Acid sured to be 8.42 mWcm−2 (400–1000 nm) and 0.62 mWcm−2
Blue 7 (AB 7) were commercially available and purified by (UV 365 nm) using FZ-A radiometer and UV-A radiometer
reprecipitation method in this experiment. Their molecular (Beijing BNU Light and Electronic Instrumental Co., China),
structures are presented in Figure 1. Double distilled and unless otherwise stated.
deionized water was used throughout the study.
2.6. Dye Degradation Procedure and Analysis. 0.20 g of Fe-
2.2. Electrospinning of PAN Nanofiber. According to [11, 19], AO-n-PAN was immersed into the 50 mL test solutions
the 14 wt% solution of PAN was prepared by dissolving PAN containing 0.05 mmol L−1 dye and the appropriate concen-
yarn in DMF under constant stirring at room temperature tration of H2 O2 in the vessel. The temperature in the vessel
for 24 h. The obtained PAN solution was added to a 10 mL was kept at 25 ± 1∘ C. The solution in vessel was exposed
glass syringe with a blunt needle. The PAN solution flow rate to the irradiation of lamp in photoreaction system. At the
was controlled by a microinfusion pump to be 0.30 mlh−1 . irradiation time intervals, 1-2 mL of the test solution was
The high-voltage supplier was used to connect the grounded taken off from the vessel and rapidly measured at the 𝜆 max of
collector and metal needles for forming electrostatic fields. the dye used (522 nm for RR 195, 596 nm for RB 4, and 630 nm
The used voltage was 20 kV and a piece of flat aluminum for AB 7) using a UV-2401 Shimadzu spectrophotometer. The
foil on the grounded collection roller was placed about 15 cm decoloration percentage of the dye was expressed as 𝐷% =
below the tip of the needle to collect the nanofiber. A jet of (1 − 𝐶/𝐶0 ) × 100%, where 𝐶0 is the initial concentration of
PAN solution came out from the needle tip at a critical voltage the dye (mmol L−1 ) and 𝐶 is the residual concentration of
and was collected on the aluminum foil. The PAN nanofibers the dye (mmol L−1 ). In addition, total organic carbon (TOC)
were obtained after DMF evaporation. of the test solution was measured by a Phoenix 8000 TOC
analyzer (Tekmar-Dohrmann Inc., USA), and TOC removal
2.3. Preparation of Modified PAN Nanofiber Fe Complex. On percentage of the test solution was calculated as follows: TOC
the basis of our previous work [20], PAN nanofibers were removal % = (1 − TOC𝑡 /TOC0 )× 100%, where TOC0 and
amidoximated using a mixed solution containing hydroxy- TOC𝑡 are the TOC values (mgL−1 ) at reaction times 0 and 𝑡,
lamine hydrochloride and sodium hydroxide in a 250 mL respectively.
flask with a thermometer and agitator for at 1-2 h at 68∘ C. And
then the resulting amidoximated PAN nanofiber (denoted as
AO-n-PAN) was washed several times with distilled water
3. Results and Discussion
and dried under vacuum at 50∘ C. The degree of the conver- 3.1. Morphological Properties and Structure. Figure 2 shows
sion from nitrile groups to amidoxime groups of the AO-n- the random orientation and smooth surface of PAN nanofi-
PAN was calculated to be 41.21% [19]. The obtained AO-n- ber, a and their average diameters are 319.8 nm. Moreover,
PAN nanofiber was immersed in an aqueous solution of ferric the surface of PAN nanofibers is rarely affected by the
chloride under continuous agitation at 50∘ C for 2 h in order modification and Fe coordination. However, the average
to produce the amidoximated PAN nanofiber Fe complex diameters of the resulting Fe-AO-n-PAN are 512.8 nm.
(denoted as Fe-AO-n-PAN). The residual concentration of Figure 3(a) exhibited the FTIR spectrum of PAN nanofi-
Fe3+ ions in solution after coordination was determined using ber. The typical characteristic bands due to the stretching
Reactive Red 195

Cl
N
OH NH N
N
HO3 SOC2 H4 O2 S N N NH SO2 C2 H4 OSO3 H
HO3 S SO3 H
Reactive Blue 4 Acid Blue 7

H3 CH2 C CH2 CH3
O NH2
N N+
SO3 Na CH2
H2 C
C
N
O NH NH Cl SO3 Na
N N
SO3 Na
Cl SO3 Na
Figure 1: Chemical structures of the three dyes.
(a) (b)
Figure 2: SEM images of (a) PAN nanofibers and (b) Fe-AO-n-PAN.
vibration of hydroxyl (3540 cm−1 ), nitrile (2248 cm−1 ), car- yarns using the same method described above, and the results
bonyl (1738 cm−1 ), and ether (1250 and 1150–1040 cm−1 ) were were given in Figure 4.
clearly observed [6, 16]. The intensity of CN group decreased Figure 4 shows that the 𝐷% value is less than 4.0%
after modification with hydroxylamine. The characteristic without Fe-AO-n-PAN or Fe-AO-PAN after 90 min of the
bands of the functional groups of PAN with additional reaction time under visible irradiation, demonstrating that
peaks appeared at 1662 cm−1 and 944 cm−1 which is due to the decomposition of RR 195 is rather slow in the absence of
the stretching vibration of N–O, N–H and C=N groups in the catalyst. It is clearly found that when Fe-AO-n-PAN or Fe-
amidoxime, respectively [16]. The intensity of these peaks AO-PAN was used, the 𝐷% value increased significantly with
further decreased and two peaks at 1662 and 944 cm−1 shifted the prolongation of the reaction time. These results suggest
to short position, separately after coordinating with Fe3+ ions that Fe-AO-n-PAN or Fe-AO-PAN exhibits strong catalytic
in the spectrum of Fe-AO-n-PAN. This demonstrated that the activity on the dye degradation. This is because the Fe-AO-n-
Fe3+ ions were chemically attached to the AO-n-PAN. PAN or Fe-AO-PAN can enhance the reduction of the loaded
Fe3+ to Fe2+ ions through the Fenton-like process, and the
3.2. Catalytic Activity of Fe-AO-n-PAN. To study the catalytic generated Fe2+ ions are then oxidized immediately by H2 O2
property of Fe-AO-n-PAN as a heterogeneous Fenton pho- to complete the Fe3+ /Fe2+ ions and generate ∙ OH radicals,
tocatalyst, the degradation of RR 195 was conducted under which is responsible for the dye degradation [23]. Addition-
the various conditions. For comparison, a control experiment ally, the photosensitization of the azo dyes can promote a
was also performed in the presence of the amidoximated PAN conversion of Fe3+ to Fe2+ ions during photoassisted Fenton
fiber Fe complex (denoted as Fe-AO-PAN) with the PAN reaction [5, 24]. In this work, it is believed that RR 195 could
2244 cm−1 944 cm−1

3500–3000 cm −1 1662 cm−1 100 (e)
(d)
(c)
798 cm−1 80
(c)
(b) 60
D (%)
40 (b)
(a)
20
(a)
0
4000 3500 3000 2500 2000 1500 1000
Wavelength (cm−1 ) 0 20 40 60 80 100
t (min)
Figure 3: The FTIR spectra of (a) PAN nanofiber, (b) AO-n-PAN,
and (c) Fe-AO-n-PAN. Figure 4: Variations in 𝐷% values of RR 195 in different systems:
(a) RR 195 and H2 O2 under visible irradiation, (b) RR 195, Fe-AO-
PAN and H2 O2 under dark, (c) RR 195, Fe-AO-PAN, and H2 O2
under visible irradiation, (d) RR 195, Fe-AO-n-PAN, and H2 O2
act as the sensitizer of the Fe-AO-n-PAN or Fe-AO-PAN to under dark, and (e) RR 195, Fe-AO-n-PAN, and H2 O2 under visible
lead to a charge transfer with the concomitant quenching of irradiation. The experiments were carried out under conditions:
the excited dye∗ and the formation of dye+ . These reaction [H2 O2 ] = 3.0 mmol L−1 , pH = 6, Fe-AO-PAN (𝑄Fe = 3.42 mmol g−1 ),
processes are described by or Fe-AO-n-PAN (𝑄Fe = 3.38 mmol g−1 ) = 0.20 g.
ℎ]/dark
Fe3+ /PAN + H2 O2 󳨀󳨀󳨀󳨀󳨀→ Fe2+ /PAN + HO2 ∙ + H⊕
It is seen from Figure 5 that the relatively high 𝐷% values
Fe2+ /PAN + H2 O2 󳨀→ Fe3+ /PAN + OH⊖ + ∙ OH (40.2% for 45 min and 58.4% for 90 min) were obtained when
AO-n-PAN (𝑄Fe = 0.00 mmol g−1 ) was used as a catalyst.
Fe3+ /PAN + HO2 ∙ 󳨀→ Fe2+ /PAN + O2 This is because AO-n-PAN has a big specific surface area,
leading to a strong adsorption of the dye molecules in
Dye + Fe3+ /PAN (1) solution. Moreover, increasing 𝑄Fe values of Fe-AO-n-PAN
ℎ] from 0.801 mmol g−1 to 2.25 mmol g−1 is accompanied with a
󳨀→ Dye∗ − −Fe3+ /PAN significant enhancement of 𝐷% levels, which are higher than
those in the case of AO-n-PAN. This suggests that higher
󳨀→ Dye+∙ + Fe2+ /PAN 𝑄Fe values can significantly accelerate the dye degradation.
∙ Similar result was observed for the decomposition of azo dye
OH +Dye+∙ or Dye 󳨀→ Products in the system of Fe-AO-PAN and H2 O2 in our previous work
[6]. The possible reason is that increasing 𝑄Fe values of the
More importantly, the 𝐷% values in the case of Fe-AO-n-
catalysts may cause more active sites on their surface, which
PAN are much higher than those in the case of Fe-AO-PAN,
can improve the H2 O2 decomposition and generate relatively
especially in the dark at the same conditions. Furthermore,
high concentration of ∙ OH radicals in the solution by the
most of RR 195 molecules were completely decolorized in the
heterogeneous photo-Fenton reaction, thus promoting the
presence of Fe-AO-n-PAN within 90 min. These results imply
dye degradation. It is worth noting that little enhancement
that the Fe-AO-n-PAN exhibits a more remarkable activity
for the dye degradation than Fe-AO-PAN. This is mainly was observed at 𝑄Fe being more than 2.25 mmol g−1 , espe-
cially for the 𝐷90 % value. This may be owing to the reaction
attributed to the great specific surface area (3.46 m2 g−1 ) of
of excess Fe3+ ion with H2 O2 producing less ∙ OH radicals
Fe-AO-n-PAN, which is much bigger than that (0.352 m2 g−1 )
of Fe-AO-PAN. Besides, the small diameter of the nanofibers [26]. Therefore, 2.25 mmol g−1 of 𝑄Fe value is believed to
could result in a reduced diffusion resistance of the dye and its be optimum Fe content of Fe-AO-n-PAN for the highest
degradation products due to the short diffusion path [11, 25], catalytic efficiency.
thus providing convenient diffusion channels for dye solution
and more reaction sites for dye adsorption and degradation. 3.4. Initial Concentration of H2 O2 . RR 195 was decomposed
using Fe-AO-n-PAN (𝑄Fe = 2.25 mmol g−1 ) and H2 O2 with
3.3. Fe Content of Catalyst. The degradation of RR 195 was the initial concentration (𝐶H2 O2 ) varied from 0 mmol L−1
carried out at pH 6 by the addition of Fe-AO-n-PAN with to 9.00 mmol L−1 at pH 6, and the results were shown in
various Fe content (𝑄Fe ) to the test solutions under light Figure 6.
irradiation. The influence of 𝑄Fe value on the 𝐷% values of Figure 6 shows that 𝐷% value increased with the pro-
RR 195 within 45 min and 90 min was presented in Figure 5. longation of reaction time in the absence or presence of
100 molecules could not generate enough ∙ OH radicals, resulting

in the limited decoloration of RR 195. When 𝐶H2 O2 was over
the optimum value, surplus H2 O2 molecules may act as ∙ OH
80
scavenger, thus reducing the ∙ OH concentration in solution
[27, 30].
60
D (%)
3.5. Irradiation Intensity. The degradation of RR 195 was

performed at pH 6 with Fe-AO-n-PAN (𝑄Fe = 2.71 mmol g−1 )
40
and 3.0 mmol L−1 H2 O2 under different light irradiations,
and 𝐷% values within 45 min and 90 min were presented in
20 Table 1.
It is noticed from Table 1 that RR 195 molecules were
partially removed from the test solution in the dark (no light
0
0 0.80 1.59 2.25 3.19 irradiation), which may be attributed to the better adsorption
QFe (mmol g−1 ) and catalytic capacity of Fe-AO-n-PAN. Moreover, 𝐷% value
gradually increased as the irradiation intensity becoming
45 min
higher. This suggests that stronger light irradiation can
90 min
significantly enhance catalytic activity of Fe-AO-n-PAN, thus
Figure 5: Degradation of RR 195 by Fe-AO-n-PAN with different resulting in an obvious improvement in the dye degradation.
𝑄Fe values. A main reason is that the amidoximated PAN fiber Fe
complex is activated throughout the UV and visible wave-
lengths where light absorption occurs [6]. Consequently, Fe-
100 AO-n-PAN is regarded as an efficient Fenton photocatalyst
for dyeing wastewater. Another explanation is that higher
irradiation may increase the photosensitization of the dye
80
molecules on the surface of catalyst, which promotes a
conversion of Fe3+ to Fe2+ ions during the degradation.
60 Besides, higher irradiation may be beneficial for photolysis of
H2 O2 and photoreduction of Fe3+ to Fe2+ ions in the solution
D (%)
since both processes are strongly dependent on wavelength

40
and intensity of light irradiation [31]. Finally, it is possible
that powerful light irradiation may change the aggregation
20 equilibrium of dye molecules in solution, and reduce the
formation of dye aggregation units due to their weak stability
in aqueous solution [32].
0
0 20 40 60 80 100
3.6. Dye Structure Characteristics and Initial Concentration.
t (min)
The comparative study was carried out for the degradation of
CH2 O2 (mmol L−1 ) three kinds of textile dyes: azo dye, RR 195; anthraquinone
0.0 1.0 dye, RB 4, and triphenylmethane dye, AB 7 from aque-
2.0 3.0
6.0 9.0
ous solution by Fe-AO-n-PAN (𝑄Fe = 2.71 mmol g−1 ) and
3.0 mmol L−1 H2 O2 at pH 6 under light irradiation. The
Figure 6: Effect of H2 O2 initial concentration on degradation of RR UV-Vis spectrum analysis was adopted to investigate their
195. degradation and intermediate transformation during treat-
ments. The comparisons of UV-Vis spectra of dye degradation
processes are given in Figure 7. Moreover, 𝐷% values of three
H2 O2 . And 𝐷% value reached 35.6% after 90 min without the dyes were also calculated and shown in Figure 7.
addition of H2 O2 , which is due to the adsorption effect of Fe- Figures 7(a)–7(c) show that three characteristic peaks
AO-n-PAN with large specific surface area. Moreover, 𝐷% at 522 nm for RR 195, 596 nm for RB 4, and 630 nm for
AB 7 decreased gradually with prolonging irradiation time.
values increased with 𝐶H2 O2 increasing from 0 mmol L−1 to
As shown in Figure 7(d), their 𝐷% values were above 90%
3.00 mmol L−1 , indicating that high 𝐶H2 O2 levels led to a grad- within 45 min. These results suggest that chromophores of
ual increasing 𝐷% values. However, 𝐷% value unremarkably three dyes have been almost completely destructed after the
increased when 𝐶H2 O2 is above 3.00 mmol L−1 . The optimal degradation. Not only characteristic peaks of three dyes, but
𝐶H2 O2 level was found to be 3.00 mmol L−1 in this experiment. also some peaks (296 nm for RR 195, 256 nm and 296 nm for
This is coincident with the results reported in [27]. According RB 4, and 307 nm for AB 7) in 200–400 nm also significantly
to [28, 29], the role of H2 O2 in Fenton reaction is different decreased during the degradation processes, which indicated
depending on its concentration. At the low 𝐶H2 O2 levels, H2 O2 that the aromatic rings of three dye molecules studied
3.0
RR 195 RB 4 0
0
3 3 0.15 596.0 nm
2.5 2.0
5 5
10 10 0.10
2.0 15
296 nm 15 1.5
20 0.05
20
(min)
256 nm
(min)
25
Abs
1.5
Abs
25 0.00
30 1.0 298 nm 30
400 500 600 700 800
522 nm 35 35
1.0 40
40
0.5 45 596 nm
45
0.5
0.0 0.0
200 300 400 500 600 700 800 200 300 400 500 600 700 800
Wavelength (nm) Wavelength (nm)
(a) (b)
3.5
AB 7 100
0 630 nm
3.0 3
5 80
2.5 10
15
60
(min)
2.0 20
D (%)
25
Abs
1.5 30 40
307 nm 35
1.0 405 nm 40
20
45
0.5
0
0.0
0 10 20 30 40 50
200 300 400 500 600 700 800
t (min)
Wavelength (nm)
RR 195
AB 7
RB 4
(c) (d)
Figure 7: Degradation of three dyes with different molecular structures.
Table 1: Degradation of RR 195 under increasing light irradiations.
Visible(400–1000 nm) (m W cm−2 ) 0 8.42 11.3 15.4

Irradiation intensity
UV(365 nm) (m W cm−2 ) 0 0.62 0.72 1.04
45 min 61.04 79.47 88.82 98.40
D%
90 min 82.35 91.25 97.02 99.89
were destroyed by the photocatalysis of Fe-AO-n-PAN/H2 O2 . the RR 195 initial concentration, the shorter the reaction
Consequently, Fe-AO-n-PAN was proved to be a universal period needed to degrade RR 195 completely. 𝐷% values,
and efficient catalyst for degradation of the three dyes with especially for low RR 195 initial concentration, increased
different molecular structures. quickly in the first 20 min and then obviously slowed down as
In order to investigate the effect of dye initial concentra- time goes on. This is because when the H2 O2 concentration
tion on its degradation, we performed the experiments with was kept constant for the solutions with different RR 195
four initial concentrations of RR 195 under light irradiation initial concentrations, more H2 O2 molecules were consumed
while the other variables were kept constant. It is apparent in the beginning stage [33]. On the other hand, it is well
from Figure 8 that higher initial concentrations can cause a known that the aggregation equilibrium of dye molecules
dramatic reduction in 𝐷% values, proposing that the lower in water is affected particularly by dye concentration
100 70
60
80
50
60 40
TOCR (%)
D (%)
30
40
20
20 10 TOCR % = 1.036t + 2.906

r = 0.9952
0
0
0 20 40 60 80 100 0 10 20 30 40 50 60
t (min) t (min)
0.03 mmol L−1 0.07 mmol L−1 Figure 10: TOCR % values of RR 195 solution as a function of the
0.12 mmol L−1 0.15 mmol L−1 reaction time.
Figure 8: The degradation of RR 195 with different initial con-
centrations, experimental conditions: 0.20 g Fe-AO-n-PAN (𝑄Fe =
2.15 mmolg−1 ), H2 O2 : 3.0 mmol L−1 , and pH = 6.
It was clearly observed from Figure 9 that 𝐷% values as
a function of the reaction time when initial solution pH is
varied. The dye degradation occurred over a wide range of
100 pH values from 3 to 9. 𝐷% value reached the maximum
value of 95.42% at pH 6 within 45 min. 𝐷% value at pH
3 was higher than that at pH 9 at the same reaction time.
80
These results demonstrated that Fe-AO-n-PAN exhibited a
higher catalytic activity at acidic medium than at alkaline
60 medium, and its highest catalytic efficiency could be obtained
D (%)
at pH 6. This optimum solution pH is higher than pH level

40 (about 3.0) at which homogeneous photoassisted Fenton
reaction was performed most easily [36]. On the other hand,
the change in the pH of the reaction system during the
20 degradation of RR 195 was obviously found. For instance,
the final pH value after 45 min of reaction was about 2.6 for
0 an initial pH of 6. This may be owing to the acidity of the
0 10 20 30 40 50
intermediates produced during the degradation [33]. Some
t (min)
similar phenomena were observed by Feng et al. [33] and
Dhananjeyan et al. [37].
pH = 6
pH = 3
pH = 9 3.8. Mineralization. Mineralization of the dye molecules in
solution should be examined since the degradation inter-
Figure 9: Degradation of RR 195 with Fe-AO-n-PAN in different pH mediates may be longer-lived and even more toxic than
levels. the parent dyes to aquatic animals and human beings. In
this work, mineralization of RR 195 was performed in the
presence of 3.0 mmol L−1 H2 O2 and Fe-AO-n-PAN (𝑄Fe =
[34, 35]. Higher dye concentration can generally enhance 2.71 mmol g−1 ) at pH 6 under light irradiation, and the result
the formation of dye aggregation units, which limits the dye is given in Figure 10.
adsorption and degradation. Figure 10 shows that TOCR % value increases propor-
tionally as the reaction time goes on. A linear equation
between TOCR % value and reaction time (𝑡) also is also
3.7. The Solution pH. The degradation of RR 195 with provided. Moreover, TOCR % value reaches 63.28% within
3.0 mmol L−1 H2 O2 catalyzed by Fe-AO-n-PAN (𝑄Fe = 60 min under light irradiation. These results illustrates that
3.71 mmol g−1 ) at different solution pH was investigated RR 195 molecules can be destructed and then converted into
under light irradiation in order to ensure the stability of Fe- H2 O, CO2 , and inorganic salts. This is in good agreement with
AO-n-PAN as a photocatalyst over a wide pH range, and the the decoloration and degradation of the RR 195 mentioned
experimental result was presented in Figure 9. above.
4. Conclusions [6] Y. Dong, Z. Han, C. Liu, and F. Du, “Preparation and pho-
tocatalytic performance of Fe (III)-amidoximated PAN fiber
The modified PAN nanofiber Fe complex was prepared complex for oxidative degradation of azo dye under visible light
through the amidoximation and consequent Fe coordination irradiation,” Science of the Total Environment, vol. 408, no. 10,
of PAN nanofiber obtained using electrospinning technique. pp. 2245–2253, 2010.
This complex not only significantly catalyzed the oxidative [7] L. Wan, Z. Xu, and H. Jiang, “Fibrous membranes electrospin-
degradation of the textile dye in water as a novel heteroge- ning from acrylonitrue-based polymers: specific absorption
neous Fenton photocatalyst, but also showed a better catalytic behaviors and states of water,” Macromolecular Bioscience, vol.
performance than the Fe complex prepared with conven- 6, no. 5, pp. 364–372, 2006.
tional PAN yarns in the dark or under light irradiation. It was [8] H. Zhang, H. Nie, D. Yu et al., “Surface modification of
found that Fe content of the complex, H2 O2 initial concen- electrospun polyacrylonitrile nanofiber towards developing an
tration, irradiation intensity, and the solution pH were the affinity membrane for bromelain adsorption,” Desalination, vol.
main factors that have strong impacts on the heterogeneous 256, no. 1–3, pp. 141–147, 2010.
Fenton degradation of the textile dye. Increasing Fe content [9] K. Yoon, B. S. Hsiao, and B. Chu, “High flux nanofiltration
of the complex or irradiation intensity would accelerate the membranes based on interfacially polymerized polyamide bar-
dye degradation. The optimal H2 O2 molar concentration rier layer on polyacrylonitrile nanofibrous scaffolds,” Journal of
Membrane Science, vol. 326, no. 2, pp. 484–492, 2009.
is 3.0 mmol L−1 in order to obtain the best decoloration
[10] A. Sato, R. Wang, H. Ma, B. S. Hsiao, and B. Chu, “Novel
efficiency. Although this complex has a relatively better
nanofibrous scaffolds for water filtration with bacteria and virus
catalytic activity over a wide pH range, the optimal pH removal capability,” Journal of Electron Microscopy, vol. 60, no.
of the reaction solution is 6 for the fastest degradation of 3, pp. 201–209, 2011.
the dye. Moreover, it was proved that the modified PAN [11] Q. Feng, Q. Wang, B. Tang et al., “Immobilization of catalases on
nanofiber Fe complex was a universal and efficient catalyst amidoxime polyacrylonitrile nanofibrous membranes,” Polymer
for degradation of the three classes of textile dyes including International, vol. 62, no. 2, pp. 251–256, 2013.
azo dye, anthraquinone dye, and triphenylmethane dye. [12] S. Li, J. Chen, and W. Wu, “Electrospun polyacrylonitrile
Besides, UV-Vis spectrum analysis and TOC measurement nanofibrous membranes for lipase immobilization,” Journal of
indicated that the chromophore and aromatic rings of the dye Molecular Catalysis B, vol. 47, no. 3-4, pp. 117–124, 2007.
molecules were decomposed and then converted into H2 O, [13] S. Li and W. Wu, “Lipase-immobilized electrospun PAN nanofi-
CO2 , and inorganic salts in the presence of the modified PAN brous membranes for soybean oil hydrolysis,” Biochemical
nanofiber Fe complex and H2 O2 under light irradiation. Engineering Journal, vol. 45, no. 1, pp. 48–53, 2009.
[14] N. Zhou, T. Yang, C. Jiang, M. Du, and K. Jiao, “Highly sensitive
Acknowledgments electrochemical impedance spectroscopic detection of DNA
hybridization based on Aunano-CNT/PANnano films,” Talanta,
The authors thank the Tianjin Municipal Science and Tech- vol. 77, no. 3, pp. 1021–1026, 2009.
nology Committee for the Research Programs of Applica- [15] P. Kampalanonwat and P. Supaphol, “Preparation and
tion Foundation and Advanced Technology (11JCZDJ24600, adsorption behavior of aminated electrospun polyacrylonitrile
11ZCKFGX03200). This research was also supported in part nanofiber mats for heavy metal ion removal,” ACS Applied
by the grants from the Natural Science Foundation of China Materials and Interfaces, vol. 2, no. 12, pp. 3619–3627, 2010.
(20773093, 51102178). [16] K. Saeed, S. Park, and T. Oh, “Preparation of hydrazine-
modified polyacrylonitrile nanofibers for the extraction of
metal ions from aqueous media,” Journal of Applied Polymer
References Science, vol. 121, no. 2, pp. 869–873, 2011.
[1] B. Lodha and S. Chaudhari, “Optimization of Fenton-biological [17] Q. Feng, X. Wang, A. Wei et al., “Surface modified ployacryloni-
treatment scheme for the treatment of aqueous dye solutions,” trile nanofibers and application for metal ions chelation,” Fibers
Journal of Hazardous Materials, vol. 148, no. 1-2, pp. 459–466, and Polymers, vol. 12, no. 8, pp. 1025–1029, 2011.
2007. [18] S. Li, X. Yue, Y. Jing, S. Bai, and Z. Dai, “Fabrication of zonal
[2] E. Abadulla, T. Tzanov, S. Costa, K.-H. Robra, A. Cavaco- thiol-functionalized silica nanofibers for removal of heavy
Paulo, and G. M. Gubitz, “Decolorization and detoxification of metal ions from wastewater,” Colloids and Surfaces A, vol. 380,
textile dyes with a laccase from Trametes hirsuta,” Applied and no. 1–3, pp. 229–233, 2011.
Environmental Microbiology, vol. 66, no. 8, pp. 3357–3362, 2000. [19] K. Saeed, S. Haider, T. Oh, and S. Park, “Preparation of amidox-
[3] A. Mittal, V. Gajbe, and J. Mittal, “Removal and recovery ime-modified polyacrylonitrile (PAN-oxime) nanofibers and
of hazardous triphenylmethane dye, Methyl Violet through their applications to metal ions adsorption,” Journal of Mem-
adsorption over granulated waste materials,” Journal of Haz- brane Science, vol. 322, no. 2, pp. 400–405, 2008.
ardous Materials, vol. 150, no. 2, pp. 364–375, 2008. [20] Z. Han, Y. Dong, and S. Dong, “Comparative study on the
[4] W. J. Epolito, Y. H. Lee, L. A. Bottomley, and S. G. Pavlostathis, mechanical and thermal properties of two different modified
“Characterization of the textile anthraquinone dye Reactive PAN fibers and their Fe complexes,” Materials and Design, vol.
Blue 4,” Dyes and Pigments, vol. 67, no. 1, pp. 35–46, 2005. 31, no. 6, pp. 2784–2789, 2010.
[5] Z. Ding, Y. Dong, and B. Li, “Preparation of a modified PTFE [21] Y. Kim, C. H. Ahn, M. B. Lee, and M. Choi, “Characteristics
fibrous photo-Fenton catalyst and its optimization towards the of electrospun PVDF/SiO2 composite nanofiber membranes as
degradation of organic dye,” International Journal of Photoen- polymer electrolyte,” Materials Chemistry and Physics, vol. 127,
ergy, vol. 2012, Article ID 121239, 8 pages, 2012. no. 1-2, pp. 137–142, 2011.
[22] Y. Dong, W. Dong, Y. Cao, Z. Han, and Z. Ding, “Preparation

and catalytic activity of Fe alginate gel beads for oxidative
degradation of azo dyes under visible light irradiation,” Catalysis
Today, vol. 175, no. 1, pp. 346–355, 2011.
[23] Y. Han, Y. Dong, Z. Ding, and C. Liu, “Influence of polypropy-
lene fibers on preparation and performance of Fe-modified
PAN/PP blended yarns and their knitted fabrics,” Textile
Research Journal, vol. 83, no. 3, pp. 219–228, 2013.
[24] J. F. Wei, Z. P. Wang, J. Zhang, Y. Y. Wu, Z. P. Zhang,
and C. H. Xiong, “The preparation and the application of
grafted polytetrafluoroethylene fiber as a cation exchanger for
adsorption of heavy metals,” Reactive and Functional Polymers,
vol. 65, no. 1-2, pp. 127–134, 2005.
[25] S. Sakai, K. Antoku, T. Yamaguchi, and K. Kawakami, “Devel-
opment of electrospun poly(vinyl alcohol) fibers immobilizing
lipase highly activated by alkyl-silicate for flow-through reac-
tors,” Journal of Membrane Science, vol. 325, no. 1, pp. 454–459,
2008.
[26] I. Muthuvel and M. Swaminathan, “Photoassisted Fenton min-
eralisation of Acid Violet 7 by heterogeneous Fe(III)-Al2O3
catalyst,” Catalysis Communications, vol. 8, no. 7, pp. 981–986,
2007.
[27] Y. Dong, L. He, and M. Yang, “Solar degradation of two azo dyes
by photocatalysis using Fe(III)-oxalate complexes/H2 O2 under
different weather conditions,” Dyes and Pigments, vol. 77, no. 2,
pp. 343–350, 2008.
[28] S. Kaur and V. Singh, “TiO2 mediated photocatalytic degrada-
tion studies of Reactive Red 198 by UV irradiation,” Journal of
Hazardous Materials, vol. 141, no. 1, pp. 230–236, 2007.
[29] C. M. So, M. Y. Cheng, J. C. Yu, and P. K. Wong, “Degradation
of azo dye Procion Red MX-5B by photocatalytic oxidation,”
Chemosphere, vol. 46, no. 6, pp. 905–912, 2002.
[30] M. Muruganandham and M. Swaminathan, “Photochemical
oxidation of reactive azo dye with UV-H2 O2 process,” Dyes and
Pigments, vol. 62, no. 3, pp. 269–275, 2004.
[31] B. Muthukumari, K. Selvam, I. Muthuvel, and M. Swaminathan,
“Photoassisted hetero-Fenton mineralisation of azo dyes by
Fe(II)-Al2O3 catalyst,” Chemical Engineering Journal, vol. 153,
no. 1–3, pp. 9–15, 2009.
[32] Y. Dong, W. Dong, C. Liu, Y. Chen, and J. Hua, “Photocatalytic
decoloration of water-soluble azo dyes by reduction based on
bisulfite-mediated borohydride,” Catalysis Today, vol. 126, no.
3-4, pp. 456–462, 2007.
[33] J. Feng, X. Hu, P. L. Yue, H. Y. Zhu, and G. Q. Lu, “Degradation
of azo-dye orange II by a photoassisted Fenton reaction using
a novel composite of iron oxide and silicate nanoparticles as a
catalyst,” Industrial and Engineering Chemistry Research, vol. 42,
no. 10, pp. 2058–2066, 2003.
[34] W. S. Perkins, Textile Coloration and Finishing, China Textile
Press, Beijing, China, 2004.
[35] M. M. El-Fass, N. A. Badawy, A. A. El-Bayaa, and N. S. Moursy,
“The influence of simple electrolyte on the behavior of some
acid dyes in aqueous media,” Bulletin of the Korean Chemical
Society, vol. 16, no. 5, pp. 458–461, 1995.
[36] M. Hartmann, S. Kullmann, and H. Keller, “Wastewater
treatment with heterogeneous Fenton-type catalysts based on
porous materials,” Journal of Materials Chemistry, vol. 20, no.
41, pp. 9002–9017, 2010.
[37] M. R. Dhananjeyan, J. Kiwi, P. Albers, and O. Enea, “Photo-
assisted immobilized Fenton degradation up to pH 8 of azo
dye Orange II mediated by Fe+ /Nafion/glass fibers,” Helvetica
Chimica Acta, vol. 84, no. 11, pp. 3433–3445, 2001.
http://dx.doi.org/10.1155/2013/918025
Research Article
Ozonation of Indigo Carmine Catalyzed with Fe-Pillared Clay
Miriam Bernal, Rubí Romero, Gabriela Roa, Carlos Barrera-Díaz,

Teresa Torres-Blancas, and Reyna Natividad
Centro Conjunto de Investigación en Quı́mica Sustentable UAEMex-UNAM, Carretera Toluca Atlacomulco Km 14.5,
50200 Toluca, MEX, Mexico
Correspondence should be addressed to Reyna Natividad; reynanr@gmail.com
Received 13 July 2013; Revised 28 September 2013; Accepted 3 October 2013
Academic Editor: M. Muruganandham
Copyright © 2013 Miriam Bernal et al. This is an open access article distributed under the Creative Commons Attribution License,
The ozonation catalyzed by iron-pillared clays was studied. The degradation of dye indigo carmine (IC) was elected as test reaction.
Fe-pillared clays were synthesized by employing hydrolyzed FeCl3 solutions and bentonite. The pillared structure was verified by
XRD and by XPS the oxidation state of iron in the synthesized material was established to be +2. By atomic absorption the weight
percentage of iron was determined to be 16. The reaction was conducted in a laboratory scale up-flow bubble column reactor.
From the studied variables the best results were obtained with a particle size of 60 microns, pH = 3, ozone flow of 0.045 L/min, and
catalyst concentration of 100 mg/L. IC was completely degraded and degradation rate was found to be double when using Fe-PILCS
than with ozone alone. DQO reduction was also significantly higher with catalyzed than with noncatalyzed ozonation.
1. Introduction and reacts rapidly with most of organic compounds [12]. It

oxidizes organic pollutants via two pathways: direct oxidation
A vast amount of water is employed by the textile industry. with ozone molecules and/or the generation of free-radical
Because of the dyeing process, the produced wastewater intermediates, such as the ∙ OH radical, which is a powerful,
contains strong color and this is reflected as well in a high effective, and nonselective oxidizing agent [13, 14]. However,
chemical oxygen demand (COD). It has been estimated the degree and rate of oxidation by ozonation is limited by
that 1–15% of the dye is lost during dyeing and finishing
the chemical structure; that is, amines, linear chain alcohols,
processes and is released into wastewater [1, 2]. Even small
and ketones are harder to be oxidized by ozone than some
quantities (<0.005 mg L−1 ) of dyes in water are unacceptable
aromatic compounds [15]. This has motivated the search for
since the discharge of effluents containing reactive dyes into
the environment can interfere with transmission of sunlight more efficient ozonation processes. In this context, metal-
into flowing liquid [3]. This causes perturbations in aquatic catalyzed ozonations have particularly drawn attention, but
life and the food web [4]. Thus, an effective and economical water contamination by metals turned out to be a major prob-
technique for removing dyes from textile wastewaters is lem [16, 17]. The aim of this work is to evaluate the efficiency of
needed [5]. In this sense, several conventional methods for ozonation of carmine indigo catalyzed by an Fe-pillared clay.
treating dye effluents have been studied, such as photodegra- The clay is expected to retain the iron within its structure so
dation [6], adsorption [7], filtration [8], coagulation [9], and that the solution is not contaminated with the metal.
biological treatments [10]. However, due to the stability of the Clays are natural abundant minerals that can be obtained
molecules of dyes some of these methods are not completely from some mines in high purity [18]. However, it is important
effective and/or viable. In recent years, water treatment to modify them to obtain homogeneous materials that can
based on the chemical oxidation of organic compounds by be used with reliable results. Furthermore, although clay
advanced oxidation processes (AOPs) like ozonation has possesses large surface area, this is not accessible due to the
drawn attention. Ozonation, which is effective, versatile, and strong electrostatic interaction between sheets and charge
environmentally sound, has been tested as a good method for balancing cations. Thus, to gain access to the interlami-
color removal [11]. Ozone is a strong oxidant (𝐸∘ = 2.07 V) nar area large cations (“pillars”) should be placed between
sheets; as a result an increase in the surface area is obtained.

Pillared clays are microporous materials that are obtained
3
by exchanging the interlayered cations of layered clays with 1
bulky inorganic polyoxocations, followed by calcinations [19–
22]. After pillaring, the presence of this new porous structure
and the incorporation of new active sites present several
possible applications of these materials [23]. As described 4
2
by Catrinescu et al. [24], there are few examples where iron
containing synthetic clays have been tested as solid catalyst 7 6
to promote the Fenton reaction [24]. Some reports indicate
that pillared clays can be used as Fenton catalyst; these reports
refer to the catalytic activity imparted by the pillars, which 5
8
become the actual catalytic sites [25–27]. However, in all the
previous research the addition of hydrogen peroxide has been Figure 1: Schematic apparatus for the ozonation reaction. (1) Up-
the common reactive added to promote the Fenton reaction. flow glass bubble column reactor, (2) porous glass (gas diffuser), (3)
To the authors knowledge there are no reports of the effi- KI solution trap, (4) ozone generator, (5) flow meter, (6) dry air inlet,
ciency of ozonation of dyes catalyzed with Fe-pillared clays. (7) ozone output, and (8) air dryer.

spectrophotometer. Before analysis, the samples were dis-
2.1. Reagents. Sulfuric acid, sodium hydroxide, and indigo solved in hydrofluoric acid and diluted to the interval of
carmine dye of analytical grade were purchased from Sigma- measurement.
Aldrich Chemicals. The acid and the base were used without Specific surface area and pore-size distribution were
further purification to adjust the solutions pH to 3. Purified- determined by N2 adsorption at 77 K in a static volumetric
grade bentonite was supplied by Fisher Scientific. apparatus (Micromeritics ASAP 2010 sorptometer). Pillared
Ozone was generated in situ from dry air by an ozone clays were outgassed prior use at 180∘ C for 16 h under vacuum
generator (Pacific Ozone Technology), with an average ozone of 6.6 × 10−9 bar. Specific total surface area was calculated
production of 0.005 g⋅dm−3 . using the Brunauer-Emmett-Teller (BET) equation, whereas
specific total pore volume was evaluated from nitrogen
2.2. Synthesis of Fe-PILCs. The Fe-pillared clay (Fe-PILC), uptake at N2 relative pressure of 𝑃/𝑃𝑜 = 0.99.
used as catalyst, was prepared by a purified-grade bentonite The chemical state of the Fe was analyzed by X-ray pho-
supplied by Fisher Scientific. Fe-PILCs were prepared using toelectron spectroscopy (XPS, Jeol JPS 9200) with a standard
FeCl3 ⋅6H2 O and NaOH solutions according to the method Mg K𝛼 excitation source (1253.6 eV). Binding energies were
of synthesis reported elsewhere [28]. The former was added calibrated with respect to the carbon signal (C1s) at 285 eV.
to the NaOH solution to obtain the required OH/Fe molar
ratio of 2.0. The initial concentration of the Fe salt was 2.4. Ozonation Experiments. The ozonation experiments
0.2 M and the suspension clay concentration was 0.10 wt.%. were conducted in an up-flow glass bubble column reactor
In order to avoid precipitation of iron species, the pH was (Figure 1). The gas mixture ozone/air was continuously fed
kept constant at 1.78–1.80. The mixture was aged for 4 h under with a flow rate varying from 0.02 to 0.06 L⋅min−1 through
stirring at room temperature. The pillaring solution was then a gas diffuser with a 2 mm pore size at the bottom of the
slowly added to a suspension of bentonite in deionized water. reactor. The excess of ozone in the outlet gas was decomposed
The mixture was kept under vigorous stirring for 12 h at and trapped in a KI solution. Samples were taken at specific
room temperature. Finally, the solid was washed by vacuum time intervals to be analyzed. Fe-pillared clays were crushed
filtration with deionized water until it was chloride-free and sieved to a particle size of 60 𝜇m. All the experiments
(conductivity < 10 𝜇S/cm). Finally, the solid was air-dried were carried out at room temperature (19∘ C ± 2). pH was
(70∘ C) and calcined for 2 h at 400∘ C. adjusted at 3.0 with analytical grade sulfuric acid and sodium
hydroxide. In addition to ozone flow rate, the effect of mass
2.3. Catalyst Characterization. X-ray diffraction (XRD) pat- of catalyst was also studied in the range of 0–0.1% w/w. At
terns were obtained on a Bruker Advance 8 diffractometer all experiments the initial concentration of IC was 1000 mg/L.
using CuK𝛼 radiation at 35 kV and 30 mA. Data were collect- As control experiments, IC concentration profiles were estab-
ed over 2𝜃 range of 3–12∘ with a step of 0.04∘ /min. X-ray dif- lished by adsorption, ozonation plus bentonite (clay without
fraction pattern suggests that the original bentonite was suc- pillaring) and particles of Fe∘ . For the adsorption experiment,
cessfully pillared since one peak corresponding to the (0 0 1) only clay without any ozone supplying was employed in
reflection appeared at small 2𝜃 angles (2𝜃 ≈ 4∘ ). According to order to discard the removal of IC by physical means. The
[28] this result clearly indicates an enlargement of the basal experiment with only bentonite was conducted with an ozone
spacing of the clay as consequence of the pillaring process. flow rate of 0.045 L⋅min−1 and a bentonite loading of 0.1%. It
The total iron content incorporated into the catalyst was is worth clarifying that in this case the employed bentonite
determined by using a SpectrAA 240FS atomic absorption was not pillared. For the experiment with Fe∘ particles,
d001 peak Table 1: Main characteristics of parent clay and Fe-PILC catalyst.
Micropore
Surface area
Sample 𝑑(0 0 1) (Å) volume Fe (wt.%)
(m2 /g)
(cm3 /g)
Intensity (a.u.)
Bentonite —, 9.6b 35 0.0028 2.7

Fe-PILC 24.22a , 11.6b 283 0.125 16
a
1st peak (2𝜃 ≈ 4∘ ).
b
2nd peak (2𝜃 ≈ 7–9∘ ).
Table 1 shows the main textural characteristics, the Fe

content of the samples prepared, and the basal spacing cor-
responding to both the parent clay and the Fe-PILC calcined
3 4 5 6 7 8 9 10 11 12 at 400∘ C. As can be seen, the pillared process increases the
basal spacing of the clay. The surface area analysis indicates
2𝜃
that the pillaring process produces a significant increase in
Figure 2: X-ray diffraction pattern of Fe-PILC. the surface area of parent clay. This can be ascribed to the
micropores formation [31].
XPS analysis was performed in order to corroborate the
presence of iron and to identify its chemical state. The XPS
a loading of 0.016% w/w was employed. This iron loading is
equivalent to that when using 0.1% w/w of Fe-pillared clay. spectrum corresponding to the Fe 2p3/2 narrow scan region
Fe∘ particles were synthesized in our laboratory by reducing of the Fe-PILC was observed (data not shown). According to
0.01 M Fe(II) sulfate solution with NaBH4 at pH 7 and room the National Institute of Standards and Technology (NIST),
temperature. pH was controlled by adding a 0.5 M NaOH this peak (≈710 eV) corresponds to FeO (Fe2+ ). This result
solution. This was carried out under nitrogen atmosphere and is coherent with TPR studies that indicated that Fe-pillared
with deaerated water to ensure the production of Fe∘ particles. clays present only one reduction peak that corresponds to the
Fe3+ → Fe2+ reduction process [28].
2.5. Chemical Analysis. Concentration of indigo carmine was
determined by UV-Vis spectrophotometry technique, using a 3.2. Ozonation Experiments
Perkin-Elmer Model Lambda 25 UV-Vis spectrophotometer
with a wavelength range of 190–1100 nm. Samples absorb- 3.2.1. Effect of Ozone Flow Rate. In an up-flow bubble column
ance was scanned from 200 to 900 nm, and a maximum the gas flow rate is expected to affect, among other aspects,
absorbance at 611 nm was observed. The scan rate was the rising bubble velocity and therefore the contact time
960 nm⋅s−1 . The samples were scanned in a quartz cell with of the gas with the solution. This is finally reflected in the
1 cm optical path. gas mass transferred to solution. Thus, gas flow rate is an
In order to establish the oxidation degree of indigo important variable in the study of any three-phase system. In
carmine, chemical oxygen demand of samples was deter- this case, to do so, this variable was studied only under the
mined by means of the American Public Health Association presence of ozone in the range of 0.020–0.060 L/min. Figure 3
(APHA) standard procedures [29]. shows the obtained averaged results of two repetitions per
flow rate. It can be observed that at all experiments 100%
degradation of indigo carmine (IC) was achieved. The veloc-
3. Results and Discussion ity at which this occurs, however, depends on ozone flow
rate. It can be observed that depletion of indigo carmine
3.1. Fe-PILCs Characterization. The XRD pattern of Fe-PILC
concentration along time increases when increasing of flow
after calcinations at 400∘ C is shown in Figure 2. This pillared
material exhibits a peak at 2𝜃 ≈ 4∘ which is commonly rate. Nevertheless, when flow rate is 0.06 L⋅min−1 the rate of
assigned to the basal (0 0 1) reflection (d(0 0 1)). The basal indigo carmine degradation becomes slower. This means that
spacing represents the distance between two clay layers, a maximum of ozone in solution is achieved before this flow
including the thickness of one of the layers. The reflection rate, and this is observed to happen when a 0.045 L⋅min−1
at low 2𝜃 values (2𝜃 ≈ 4∘ ) is a clear indication of the is employed. Therefore, the rest of the experiments were
enlargement of the basal spacing of the clay as consequence conducted at this flow rate.
of the pillaring process, as explained in a previous work [28].
In this pillared clay a broader peak in the range 2𝜃 ≈ 7–9∘ 3.2.2. Effect of Mass of Catalyst. In order to study the effect
was observed. This can be ascribed to two overlapped peaks, of this variable four experiments with their corresponding
the (0 0 2) reflection of the pillared clay and the (0 0 1) repetitions were conducted within the catalyst concentration
reflection corresponding to the intercalation of a proportion range of 0–0.1% w/w and with an initial concentration of
of monomeric species of small size, thus leading to smaller IC at all cases of 1000 mg/L and an ozone flow rate of
openings of the clay layers [30]. 0.045 L⋅min−1 . All the experiments were carried out at pH 3
1200 950
1000
900
800
[IC] (mg/L)
850
COD (mg/L)
600
400 800
200
750
0
0 10 20 30 40 50 60 70
Time (min) 700
0 10 20 30 40 50
0.02 L/min 0.05 L/min Time (min)
0.03 L/min 0.055 L/min
0% 0.01%
0.04 L/min 0.06 L/min
0.005% 0.10%
0.045 L/min
Figure 3: Influence of gas flow rate on the indigo carmine concen- Figure 5: Effect of catalyst concentration on chemical oxygen
tration. demand (COD).
1200
doubled. Moreover, Figure 5 shows that the use of catalyst not
only affects IC degradation rate but also its oxidation degree.
1000
Three other plots can be observed in Figure 4. The adsorption
experiment confirmed the role of Fe-PILC as catalyst rather
800 than as sorbent. It was found that only 2.9% of IC is removed
by this phenomenon during the time of reaction (60 min).
[IC] (mg/L)
600
Also, in Figure 4, the experiment labeled as bentonite further
highlights the effect of pillaring since it can be observed
that the bentonite alone does not have a significant effect on
400 ozonation rate, which came out to be practically the same
when using only ozone. It is worth clarifying that in this case
200 the employed bentonite was not pillared and that its iron
content (by nature) was determined by atomic absorption
to be 2.7%. Regarding the effect of Fe particles, it can be
0 observed that the initial IC degradation rate is noticeably
0 10 20 30 40
Time (min) improved by the presence of this solid. This improvement,
however, is not constant and the degradation rate becomes
0% Adsorption relatively slower after few minutes of reaction. This behavior
0.01% Bentonite can be ascribed to the ready availability of Fe for reactions (4)
0.01% Fe particles and (5) to occur. It seems, however, that in this case, reaction
0.10%
(4) occurs more rapidly than reaction (6), which implies that
Figure 4: Effect of Fe-PILC concentration (% w/w) and type of after few minutes of reaction Fe3+ species may prevail thus
catalyst (Fe-PILC, clay without pillaring, and Fe particles) on Indigo limiting degradation rate.
carmine concentration. Figure 5 indicates that the oxidation degree depends on
catalyst concentration. To elucidate the species that became
resistant to each treatment the UV-Vis spectra of the reacting
to avoid the precipitation of Fe [32]. From Figures 4 and 5, the solution as function of time were analyzed and these are
positive effect of the Fe-pillared clay is evident. The presence depicted in Figure 6. It can be observed in this figure that
of the catalyst enhances the ozonation process, and the mass the corresponding spectrum to IC presents two absorption
of catalyst has a strong influence over the dye degradation. bands with maxima at 600 and 340 nm. The former band
This increases when mass of Fe-pillared clays increases and is characteristic of indigo and the latter is ascribed to aux-
this is also an indication of the liquid-solid mass transfer ochromes (N, SO3 ) joined to the benzene ring. When ozone
resistance being negligible. It is observed in Figure 4 that by is applied to the IC solution, it can be observed in Figure 6(a)
only adding 0.1% w/w of catalyst the IC degradation rate is that the maximum absorbance at 600 nm decreases and this
3.5 3.5
3 3
2.5 2.5
2 2
(A)
(A)
1.5 1.5
1 1
0.5 0.5
0 0
320 370 420 470 520 570 620 670 720 320 370 420 470 520 570 620 670 720
Wavelength (nm) Wavelength (nm)
t = 0 min t = 60 min t= 0 min t = 90 min

t = 20 min t = 120 min t= 15 min t = 110 min
t = 30 min Isatin t= 30 min Isatin
t= 60 min
(a) (b)
Figure 6: Effect of degradation type and time on UV-Vis spectra. (a) Ozonation alone; (b) ozonation + Fe-pillared clay.
indicates that the characteristic blue color is diminishing also. The ferrous species involved in reaction (4) may be
This may be due to the loss of sulphonate group since this produced by the ferrous species in the pillared clay by means
works as auxochrome and therefore increases color intensity. of the following reactions:
After 40 minutes of reaction a new absorption band appears
at 403 nm and this can be ascribed to a degradation product of 6H+ + O3 + FeO 󳨀→ FeO2+ + 3H2 O (5)
IC. This product was identified as isatine by comparison with
the absorption spectra of the corresponding standard. After Fe3+ species may be going back to Fe2+ by means of the
120 minutes of ozonation treatment only isatine is identified following reaction:
in the solution and no further degradation with ozone only
was detected. Fe3+ + H2 O2 󳨀→ Fe2+ + HO∙2 + H+ (6)
Unlike with ozonation alone, it can be observed in
Figure 6(b) that when using ozonation + Fe-PILC not only Therefore, when adding the Fe-PILC to the ozonation
the loss of color is improved but also the degradation of process, the oxidation reactions are intensified and so the
isatine. Until minute 30, both treatments are very similar. degradation of IC to isatine and other products is plausible
When using Fe-PILC, the absorption band attributed to the to occur according to Scheme 1 [35].
IC completely disappears and then the band related to isatine Figure 7 shows the evolution of pH with time. It is
is observed. This diminished up to 72% of that at 60 minutes. observed that pH slightly rises at the beginning of the reaction
These results suggest that when only ozone is used the dye and this may be ascribed to the expected production of HO∙
is degraded mainly by the direct action of ozone molecules. radicals. After the initiation period, pH drops down to 2 and
This, however, does not rule out the production of ∙ OH radi- this may be due to the acid products shown in scheme of
cals by means of reaction (1). These radicals may be consumed reaction (1).
by reaction (2) rather than by oxidizing the IC. The product XPS analysis was made to determine the oxidation state
of this reaction may be reacting further to obtain H2 O2 [33]: of the Fe present in the clay at the end of reaction and it was
demonstrated to be 2+. It is worth noticing that iron leaching
O3 + H2 O 󳨀→ 2OH∙ + O2 (1) was not observed at any point of reaction.
∙
O3 + OH 󳨀→ O2 + HO∙2 ←→ O∙2 +H +
(2)
4. Conclusions
2OH∙2 󳨀→ O2 + H2 O2 (3)
The degradation of indigo carmine by ozonation and cat-
When the ozone is combined with Fe-PILC the intensifi- alyzed ozonation with Fe-pillared clay was studied. The
cation of OH production is expected according the following role of the Fe-pillared clay as catalyst was demonstrated. A
reaction [34]: small amount of the clay allows substantially enhancing the
degradation and mineralization of indigo carmine. In the
FeO2+ + H2 O2 󳨀→ Fe3+ + OH∙ + OH− (4) catalyzed ozonation process the reaction occurs faster than
H O
N SO3 − H O H
∙ N N
OH −2SO 2− ∙
4 OH O
SO3 − N
N
O H
O H O
Indigo carmine Isatine
Indigo
∙
OH
H O
CO2 + NH4 + + H2 O +
Carboxylic acids + H
N O H
O
Benzene Oxamic acid
Scheme 1: Plausible mechanism of degradation of indigo carmine by ozonation catalyzed with Fe-pillared clay.
3.3 continuous-flow photoreactor: influence of operational param-

eters and mineralization products,” Journal of Hazardous Mate-
3.1
rials, vol. 118, no. 1–3, pp. 155–160, 2005.
2.9 [2] N. Daneshvar, H. Ashassi-Sorkhabi, and A. Tizpar, “Decoloriza-
2.7 tion of orange II by electrocoagulation method,” Separation and
Purification Technology, vol. 31, no. 2, pp. 153–162, 2003.
2.5
[3] K. Santhy and P. Selvapathy, “Removal of reactive dyes from
pH
2.3 wastewater by adsorption on coir pith activated carbon,” Biore-

source Technology, vol. 97, no. 11, pp. 1329–1336, 2006.
2.1
[4] Z. Aksu, “Reactive dye bioaccumulation by Saccharomyces
1.9 cerevisiae,” Process Biochemistry, vol. 38, no. 10, pp. 1437–1444,
1.7 2003.
[5] B. Armagan, O. Ozdemir, M. Turan, and C. Elik, “Adsorption of
1.5 negatively charged azo dyes onto surfactant-modified sepiolite,”
0 10 20 30 40 50 60
Journal of Environmental Engineering, vol. 129, no. 8, pp. 709–
Time (min)
715, 2003.
Only ozone 100 mg/L Fe-PCl [6] P. Esparza, M. E. Borges, L. Dı́az, and M. C. Alvarez-Galván,
50 mg/L Fe-PCl 1000 mg/L Fe-PCl “Photodegradation of dye pollutants using new nanostructured
titania supported on volcanic ashes,” Applied Catalysis A, vol.
Figure 7: pH evolution with time. 388, no. 1-2, pp. 7–14, 2010.
[7] R. Gong, Y. Ding, M. Li, C. Yang, H. Liu, and Y. Sun, “Utilization
of powdered peanut hull as biosorbent for removal of anionic
dyes from aqueous solution,” Dyes and Pigments, vol. 64, no. 3,
in the noncatalyzed system doubling the reaction rate. The pp. 187–192, 2005.
reutilization of the catalyst is feasible since neither leaching [8] F. I. Hai, K. Yamamoto, F. Nakajima, and K. Fukushi,
or Fe oxidation state changes were detected. “Removal of structurally different dyes in submerged mem-
brane fungi reactor—Biosorption/PAC-adsorption, membrane
retention and biodegradation,” Journal of Membrane Science,
Conflict of Interests vol. 325, no. 1, pp. 395–403, 2008.
[9] J.-W. Lee, S.-W. Choi, R. Thiruvenkatachari, W.-G. Shim, and
The authors declare that there is no conflict of interests H. Moon, “Evaluation of the performance of adsorption and
regarding the publication of this paper. coagulation processes for the maximum removal of reactive
dyes,” Dyes and Pigments, vol. 69, no. 3, pp. 196–203, 2006.
[10] N. P. Tantak and S. Chaudhari, “Degradation of azo dyes by
Acknowledgment sequential Fenton’s oxidation and aerobic biological treatment,”
The authors are grateful to CONACYT for financial support Journal of Hazardous Materials, vol. 136, no. 3, pp. 698–705,
2006.
of Project 168305. Bernal is grateful to CONACYT for
scholarship. [11] S. Song, J. Yao, Z. He, J. Qiu, and J. Chen, “Effect of operational
parameters on the decolorization of C.I. Reactive Blue 19
in aqueous solution by ozone-enhanced electrocoagulation,”
References Journal of Hazardous Materials, vol. 152, no. 1, pp. 204–210,
2008.
[1] N. Daneshvar, M. Rabbani, N. Modirshahla, and M. A. Behna- [12] S. M. D. A. G. Ulson de Souza, K. A. Santos Bonilla, and A. A.
jady, “Photooxidative degradation of Acid Red 27 in a tubular Ulson de Souza, “Removal of COD and color from hydrolyzed
textile azo dye by combined ozonation and biological treat- [29] American Public Health Association American Water Works
ment,” Journal of Hazardous Materials, vol. 179, no. 1–3, pp. 35– Association/Water Environment Federation, Standard Methods
42, 2010. for the Examination of Water and Wastewater, American Public
[13] B. Merzouk, B. Gourich, K. Madani, C. Vial, and A. Sekki, Health Association American Water Works Association/Water
“Removal of a disperse red dye from synthetic wastewater Environment Federation, Washington, DC, USA, 20th edition,
by chemical coagulation and continuous electrocoagulation. A 1998.
comparative study,” Desalination, vol. 272, no. 1–3, pp. 246–253, [30] L. S. Cheng, R. T. Yang, and N. Chen, “Iron oxide and chromia
2011. supported on titania-pillared clay for selective catalytic reduc-
[14] E. Guinea, E. Brillas, F. Centellas, P. Cañizares, M. A. Rodrigo, tion of nitric oxide with ammonia,” Journal of Catalysis, vol. 164,
and C. Saez, “Oxidation of enrofloxacin with conductive- no. 1, pp. 70–81, 1996.
diamond electrochemical oxidation, ozonation and Fenton [31] C. Pesquera, F. Gonzalez, I. Benito, S. Mendioroz, and J. A.
oxidation. A comparison,” Water Research, vol. 43, no. 8, pp. Pajares, “Synthesis and characterization of pillared montmoril-
2131–2138, 2009. lonite catalysts,” Applied Catalysis, vol. 69, no. 1, pp. 97–104, 1991.
[15] L. A. Bernal-Martı́nez, C. Barrera-Dı́az, C. Solı́s-Morelos, and [32] D. Zhao, C. Ding, C. Wu, and X. Xu, “Kinetics of ultrasound-
R. Natividad, “Synergy of electrochemical and ozonation pro- enhanced oxidation of p-nitrophenol by fenton’s reagent,”
cesses in industrial wastewater treatment,” Chemical Engineer- Energy Procedia A, vol. 16, pp. 146–152, 2012.
ing Journal, vol. 165, no. 1, pp. 71–77, 2010. [33] M. Hernández-Ortega, T. Ponziak, C. Barrera-Dı́az, M. A.
[16] M. Koch, A. Yediler, D. Lienert, G. Insel, and A. Kettrup, Rodrigo, G. Roa-Morales, and B. Bilyeu, “Use of a combined
“Ozonation of hydrolyzed azo dye reactive yellow 84 (CI),” electrocoagulation-ozone process as a pre-treatment for indus-
Chemosphere, vol. 46, no. 1, pp. 109–113, 2002. trial wastewater,” Desalination, vol. 250, no. 1, pp. 144–149, 2010.
[17] K. Pachhade, S. Sandhya, and K. Swaminathan, “Ozonation of [34] T. Loegager, J. Holcman, K. Sehested, and T. Pedersen, “Oxi-
reactive dye, Procion red MX-5B catalyzed by metal ions,” dation of ferrous ions by ozone in acidic solutions,” Inorganic
Journal of Hazardous Materials, vol. 167, no. 1–3, pp. 313–318, Chemistry, vol. 31, no. 17, pp. 3523–3529, 1992.
2009. [35] C. Flox, S. Ammar, C. Arias, E. Brillas, A. V. Vargas-Zavala,
[18] S. Navalon, M. Alvaro, and H. Garcia, “Heterogeneous Fenton and R. Abdelhedi, “Electro-Fenton and photoelectro-Fenton
catalysts based on clays, silicas and zeolites,” Applied Catalysis degradation of indigo carmine in acidic aqueous medium,”
B, vol. 99, no. 1-2, pp. 1–26, 2010. Applied Catalysis B, vol. 67, no. 1-2, pp. 93–104, 2006.
[19] V. Rives and M. A. Ulibarri, “Layered double hydroxides
(LDH) intercalated with metal coordination compounds and
oxometalates,” Coordination Chemistry Reviews, vol. 181, no. 1,
pp. 61–120, 1999.
[20] A. Czı́merová, J. Bujdák, and R. Dohrmann, “Traditional and
novel methods for estimating the layer charge of smectites,”
Applied Clay Science, vol. 34, no. 1–4, pp. 2–13, 2006.
[21] E. M. Serwicka and K. Bahranowski, “Environmental catalysis
by tailored materials derived from layered minerals,” Catalysis
Today, vol. 90, no. 1-2, pp. 85–92, 2004.
[22] A. Vaccari, “Preparation and catalytic properties of cationic and
anionic clays,” Catalysis Today, vol. 41, no. 1–3, pp. 53–71, 1998.
[23] A. Gil, L. M. Gandı́a, and M. A. Vicente, “Recent advances in the
synthesis and catalytic applications of pillared clays,” Catalysis
Reviews, vol. 42, no. 1-2, pp. 145–212, 2000.
[24] C. Catrinescu, C. Teodosiu, M. Macoveanu, J. Miehe-Brendlé,
and R. le Dred, “Catalytic wet peroxide oxidation of phenol over
Fe-exchanged pillared beidellite,” Water Research, vol. 37, no. 5,
pp. 1154–1160, 2003.
[25] S. Perathoner and G. Centi, “Wet hydrogen peroxide catalytic
oxidation (WHPCO) of organic waste in agro-food and indus-
trial streams,” Topics in Catalysis, vol. 33, no. 1–4, pp. 207–224,
2005.
[26] L. F. Liotta, M. Gruttadauria, G. D. Carlo, G. Perrini, and
V. Librando, “Heterogeneous catalytic degradation of phenolic
substrates: catalysts activity,” Journal of Hazardous Materials,
vol. 162, no. 2-3, pp. 588–606, 2009.
[27] G. Centi and S. Perathoner, “Catalysis by layered materials: a
review,” Microporous and Mesoporous Materials, vol. 107, no. 1-
2, pp. 3–15, 2008.
[28] J. L. Valverde, A. Romero, R. Romero, P. B. Garcı́a, M. L.
Sánchez, and I. Asencio, “Preparation and characterization of
Fe-PILCS. Influence of the synthesis parameters,” Clays and
Clay Minerals, vol. 53, no. 6, pp. 613–621, 2005.
http://dx.doi.org/10.1155/2013/893131
Research Article
Ultrasonic Degradation of Fuchsin Basic in Aqueous Solution:
Effects of Operating Parameters and Additives
Rui-Jia Lan,1,2 Ji-Tai Li,1 and Bao-Hua Chen1

1
Key Laboratory of Analytical Science and Technology of Hebei Province, College of Chemistry and Environmental Science of
Hebei University, Baoding 071002, China
2
Faculty of Chemistry and Material Science, Langfang Teachers’ College, Langfang 065000, China
Correspondence should be addressed to Ji-Tai Li; lijitai@hbu.edu.cn
Received 19 June 2013; Revised 21 September 2013; Accepted 22 September 2013
Copyright © 2013 Rui-Jia Lan et al. This is an open access article distributed under the Creative Commons Attribution License,
Ultrasonic degradation is one of the recent advanced oxidation processes (AOPs) and proven to be effective for removing low-
concentration organic pollutants from aqueous solutions. In this study, removal of fuchsin basic from aqueous solutions by
ultrasound was investigated. The effects of operating parameters such as ultrasound power (200 W–500 W), initial pH (3–6.5),
and temperature (15, 22, 35, and 60∘ C) on the ultrasonic degradation were studied. The degradation of fuchsin under ultrasound
irradiation basic was found to obey pseudo first-order reaction kinetics. Addition of catalyst Fe(II) had a markedly positive effect on
degradation. 84.1% extent of degradation was achieved at initial dye concentration 10 𝜇mol L−1 , ultrasound power 400 W, ultrasound
frequency 25 kHz, dosage of Fe(II) 4 mg L−1 , initial pH 6.5, and temperature 22∘ C. But addition of heterogeneous catalyst TiO2
affected degradation slightly. Addition of radical scavenger suppressed fuchsin basic degradation significantly.
1. Introduction the degradation efficiency in sonochemical processes by

adding various kinds of catalysts [12–15].
Dyes are classified into various groups, such as azo, phthalo- Fuchsin basic, a cationic triphenylmethane dye, was
cyanine, xanthene, and arylmethane, on the basis of their chosen as a typical representative pollutant. Fuchsin basic
chemical structure. At present, approximately 10,000 differ- is traditionally used as colorant in dyeing textiles such as
ent dyes and pigments are utilized in industry, with total cotton, artificial fiber, leather, and paper [16]. When someone
estimated annual global consumption of 7 × 105 tonnes is exposed to fuchsin dye by the physical contact, ingestion, or
[1]. People are aware that cationic dye molecules are more inhalation, it may cause severe eye and skin irritation, nausea,
toxic than anionic dye molecules [2]. Furthermore, most of vomiting, diarrhea, irritation to the respiratory tract, and
these dyes are biorefractory and do not undergo effective damage to the organs such as blood, liver, and thyroid [17].
degradation using conventional biological techniques [3]. To the best of our knowledge, there is no report on
Advanced oxidation processes (AOPs) are very efficient the degradation of fuchsin basic using ultrasonic irradiation.
methods for degradation of recalcitrant organic compounds The aim of this work was to investigate the effects of some
in industrial and agricultural effluents [4, 5]. They act through sonochemical parameters such as ultrasonic power, pH,
the use of free radicals, especially reactive ∙ OH attack. and temperature on the degradation of fuchsin basic dye.
Sonolytic oxidation is one of the AOPs techniques and has Additionally, effects of additives such as ferrous iron, titanium
proven to be an effective method for degrading organic dioxide, and radical scavenging agents were also studied.
effluents into less toxic compounds [6–9]. Sonochemistry is a
complex process, which depends on physical parameters and 2. Experimental
also on the process conditions. All efforts have been devoted
to the optimization of physical parameters and the process 2.1. Materials and Apparatus. Fuchsin basic (biological pure,
conditions [10, 11]. Some efforts have been devoted to improve SCRC, CAS no. 632-99-5) was not purified before use.
NH2 Sampling Temperature sensor
Water bath
Ultrasonic probe
Cooling lines and

Cl− heating lines
Temperature sensor
+
H3 N NH
Stirring
Figure 1: Chemical formula of fuchsin basic. Figure 2: Schematic diagram of the experimental apparatus.
The chemical structure of fuchsin basic is shown in Figure 1. maximum absorbance of fuchsin basic. The percentage of dye
FeSO4 ⋅7H2 O, NaOH, and H2 SO4 were of analytical grade. degradation was calculated as follows:
Titanium dioxide (Degussa P25) was used as the heteroge- 𝐶𝑡
neous catalyst. Extent of degradation (%) = (1 − ) × 100%, (1)
An ultrasonic processor (XH-2008DE, Xianghu, China) 𝐶0
with a 18 mm diameter probe was used for sonication. The where 𝐶0 is the initial dye concentration and 𝐶𝑡 is the dye
energy output was controlled by setting the amplitude of the concentration at measurement time.
sonicator probe.
3. Results and Discussion
2.2. Procedure. Sixty milliliters of fuchsin basic solution was
put into a three-necked flask. The ultrasound probe was 3.1. Effect of Operating Parameters
submerged to a depth of 10 mm in the solution. A temperature
sensor was also immerged in the solution to measure the 3.1.1. Effect of Power. The effect of power on the degradation
temperature. Three-necked flask was placed in the water bath of fuchsin basic was studied by varying the ultrasonic power
whose temperature was controlled by refrigeration compres- at 200 W, 300 W, 400 W, and 500 W, which corresponds to
sor system or heating system (Figure 2). The initial concen- the actual acoustic power density injected into the sam-
tration of fuchsin basic was 10 𝜇mol L−1 for all experiments. ple solution at 0.042 W/mL, 0.084 W/mL, 0.14 W/mL, and
Ultrasonic power was adjusted at 400 W, excluding runs 0.224 W/mL, respectively, by calorimetry [20]. According
conducted to investigate the influence of power. Aqueous to Andaluri et al. [10] and Capocelli et al.’s [11] research,
samples were taken from the fuchsin basic solution, and power density is an essential factor for ultrasonic degra-
the concentrations of dye were determined using a UV-vis dation of organic pollutants. This agrees with our research
spectrophotometer (UV-2550, Shimadzu). Chemical oxygen result, as depicted in Figure 3; the extent of degradation
demand (COD) determinations were conducted according of fuchsin basic increased markedly with an increase in
to ISO 6060 [18]. Hydrogen peroxide concentrations were the ultrasonic power. For example, extent of degradation
determined using the iodometric method [19]. 75.4% was obtained at 500 W whereas only about 38.3% was
Experiments were performed at pH 6.5, which resulted observed at 200 W after 60 min irradiation. The increase
from dissolution of fuchsin basic in distilled water without in fuchsin basic degradation with an increase in ultrasonic
further adjustment. When the effect of pH was investigated, power may be explained by the increase in the number of
the solution pH was adjusted using dilute H2 SO4 aqueous active cavitation bubbles. In other words, at higher power
solutions. intensity the concentration of hydroxyl radicals and the mass
In the research of adding TiO2 , mixture of fuchsin basic transfer are higher which lead to the more degradation of
solution and TiO2 was stirred for one hour in the dark to fuchsin basic [21, 22]. However, the efficiency of energy
obtain adsorption equilibrium before ultrasonic irradiation. transfer to solution can also decrease with higher power
The concentration of fuchsin basic after adsorption equi- intensities which are mostly due to the coalescence of the
librium was taken as 𝐶0 for calculating degradation ratio. cavities at higher intensities [23]. Because 500 W is the upper
Each experiment was performed in triplicate. The standard limit of this ultrasonic equipment, it is not recommendable to
deviations of the values were calculated and used as error bars use this power during all the ultrasonic processes. And in the
in the figures. following experiments, ultrasonic power was fixed at 400 W.
The degradation of fuchsin basic in aqueous solution
under stirring condition (without sonication) was examined
2.3. Analyses. Absorbance values of the solutions were mea- as a control experiment. As shown in Figure 3, in the absence
sured at a wavelength of 542 nm, which corresponds to the of ultrasound irradiation the degradation did not take place
1.0
1.0 100
0.9
0.9 80
0.8
H2 O2 (𝜇 mol L−1 )
0.8 0.7 60
ct /c0
0.7 0.6
40
ct /c0
0.6 0.5
0.5 0.4 20
0.4 0.3
0
0.3 0 10 20 30 40 50 60
Time (min)
0.2
ct /c0 H2 O2 in presence of fuchsin basic
0 10 20 30 40 50 60
H2 O2 in absence of fuchsin basic
Time (min)
Stirring 400 W Figure 4: Formation of hydrogen peroxide during ultrasonic degra-
200 W 500 W dation of fuchsin basic (dye concentration = 10 𝜇mol L−1 , ultrasonic
300 W power = 400 W, ultrasonic frequency = 25 kHz, pH = 6.5, and
tempetature = 22∘ C).
Figure 3: Effect of ultrasonic power on the degradation of
fuchsin basic (initial dye concentration = 10 𝜇mol L−1 , ultrasonic
frequency = 25 kHz, tempetature = 22∘ C, pH = 6.5).
research was from pH 3 to pH 6.5. Because of keeping
increasing pH to about 9, the structure of fuchsin basic
changes and results in fading and red sediment.
at all. It is apparent that the ultrasound can accelerate the As shown in Figure 5, the extent of degradation follows
degradation of fuchsin basic from aqueous solution. The the order: pH 6.5 > pH 5 > pH 4 > pH 3. Fuchsin basic is a
effects of ultrasound during reactions are due to cavitation nonvolatile compound, and the region of degradation would
which can induce instantaneous high local temperatures and be at the exterior of the cavitation bubbles. Thus, the reaction
pressures. Under such extreme conditions, the solvent water between the radicals generated and fuchsin basic would be
and/or dye molecular suffers hemolytic bond breakage to enhanced if its hydrophobicity is enhanced. Fuchsin basic has
generate reactive species, for example, radicals, which then a superior hydrophobic character when its structure is in the
undergo a series of reactions resulting in the degradation of molecular state which occurs at higher pH value. Under this
fuchsin basic rapidly [24]. condition, fuchsin basic is accumulated in the interface of the
cavitation bubbles, and highest degradation rate is reached.
3.1.2. Formation of Hydrogen Peroxide during Ultrasonic Irra- However, at low pH values the amino group of fuchsin basic
diation. Under the sonic degradation of dye, water molecules reaches the ionized state and its hydrophilicity and solubility
suffer hemolytic bond breakage to generate H∙ and ∙ OH are enhanced, and thus, the degradation is carried out in the
radicals, which then undergo a series of reactions resulting bulk of the solutions, where there is a lower concentration of
∙
in the production of H2 O2 [24]. The rate of H2 O2 formed OH because only about 10% of the ∙ OH generated in the
reflects the active ∙ OH generation in the sonic process and bubble can diffuse into the bulk solutions [27] and thereby
also affects the extent of the sonic degradation of fuchsin results in lower decomposition of fuchsin basic in aqueous
basic. The iodometric method [19] was employed for detect- solutions.
ing H2 O2 in the absence and presence of fuchsin basic.
As shown in Figure 4, the formation of hydrogen per- 3.1.4. Effect of Temperature. The effect of temperature on
oxide was found to increase linearly with time of ultrasonic the sonolytic degradation of fuchsin basic was observed,
irradiation. It is noteworthy that in the presence of dye, and the results are shown in Figure 6. The raise in tem-
the hydrogen peroxide production was lower than that in perature from 15∘ C to 22∘ C resulted in a slight increase
the substrate free water. The reaction of hydroxyl radicals of extent of degradation from 62.7% to 66.5%. However,
with fuchsin basic competes with ∙ OH radical combination; as the temperature continued to increase to 35∘ C, extent
consequently, the presence of dye will decrease the hydrogen of degradation declined to 57.8%. With further increase to
peroxide formation. 60∘ C, the degradation was reduced obviously. Similar results
were found in Emery et al.’s research [28]: the liquid bulk
3.1.3. Effect of Initial pH. The effect of the initial pH on the temperature of 5 and 20∘ C almost led to the same extent of
degradation of fuchsin basic was investigated. The solution degradation of triphenylphosphine oxide. However, further
pH value could have important implications on the chemical increase up to 70∘ C led to severely reduced degradation.
structure of the substrate and therefore also affected the The effect of temperature on sonochemical degradation
performance of the sonochemical process [25, 26]. The typical rate is complicated [27]. Increasing the reaction temperature
range considered to study the effect of initial pH in this will raise the equilibrium vapour pressure and lead to easier
1.0 1.0
0.9 0.9
0.8 0.8
0.7 0.7
ct /c0
ct /c0
0.6 0.6
0.5 0.5
0.4 0.4
0.3 0.3
0 10 20 30 40 50 60 0 10 20 30 40 50 60
Time (min) Time (min)
pH 3 pH 5 15∘ C 35∘ C
pH 4 pH 6.5 22∘ C 60∘ C
Figure 5: Effect of pH on the degradation of fuchsin basic (initial Figure 6: Effect of temperature on ultrasonic degradation of fuchsin
dye concentration = 10 𝜇mol L−1 , ultrasonic power = 400 W, ultra- basic (initial dye concentration = 10 𝜇mol L−1 , ultrasonic power =
sonic frequency = 25 kHz, and tempetature = 22∘ C). 400 W, ultrasonic frequency = 25 kHz, and pH = 6.5).
Table 1: Pseudo first-order rate constants of fuchsin basic degra-

cavitation, which will afford an increase in sonochemical dations (initial dye concentration = 10 𝜇mol L−1 , ultrasonic power =
effects. But at higher temperature a large number of cavitation 400 W, ultrasonic frequency = 25 kHz, and pH = 6.5).
bubbles are generated and will act as a barrier to sound
transmission and dampen the effective ultrasonic energy Temperature (∘ C) 𝑘 (min−1 ) 𝑅
from the source to the solution [24], which will lead to a 15 0.0169 0.9921
decrease in sonochemical effects. Thus, there is no com- 22 0.0180 0.9972
pletely consistent report on the impact of temperature on 35 0.0141 0.9983
the decomposition of organic compounds in the literature. 60 0.0097 0.9967
Bhatnagar and Cheung [29] and Wu et al. [30] reported
that the degradation of trichloroethylene and carbon tetra-
chloride remained constant between −7–20∘ C and 20–60∘ C, Table 2: Degradation and mineralization percentages after ultra-
sonic irradiation (initial dye concentration = 10 𝜇mol L−1 , ultrasonic
respectively. Whereas Destaillats et al. [31] indicated that
power = 400 W, ultrasonic frequency = 25 kHz, temperature = 22∘ C,
the sonochemical degradation efficiency of trichloroethylene and pH = 6.5).
increased with increasing temperature.
Irradiation time Extent of degradation Mineralization (%)
3.1.5. Kinetics of Degradation and COD Removal by Ultra- (min) (%)
sound. In order to study the kinetics of the ultrasonic degra- 60 66.5 35.2
dation of fuchsin basic in aqueous solution, the degradation 120 94.1 40.3
rate constants were determined assuming pseudo first-order
reaction kinetics as follows:
𝑑𝐶 𝐶 decolorized within 120 min, but the mineralization was a
− = 𝑘𝑐 ⇐⇒ ln 0 = 𝑘𝑡, (2) relatively slow process with COD decrease. And the miner-
𝑑𝑡 𝐶𝑡
alization was found to be 35.2% and 40.3% after 60 min and
where 𝑘 is the pseudo first-order rate constant and 𝐶0 and 120 min radiation, respectively. These results underline that
𝐶𝑡 are the dye concentrations at time zero and 𝑡, respectively. degradation products of fuchsin basic are recalcitrant toward
If the results of Figure 6 are plotted in the form of (2), 𝑘 ultrasonic treatment [34]. This may be due to the fact that the
values can be computed from the slopes of the straight lines. intermediate products have very low probabilities of making
These values are shown in Table 1. The highest value of 𝑘 contact with ∙ OH radicals, which react mainly at the interface
at temperature 22∘ C was obtained. Similar results have been of the bubble [35].
reported in previous studies [11, 32, 33], where the ultrasonic
degradation was found to obey pseudo first-order reaction 3.2. Effect of Various Additives
kinetics.
Table 2 shows the degradation and the COD removal 3.2.1. Effect of Fe(II). Figure 7 depicts the influence of bivalent
percentages under ultrasonic irradiation. It can be observed iron on the sonolytic degradation of fuchsin basic. In these
from the table that the fuchsin basic aqueous solution was systems, the ultrasonic degradation of fuchsin basic was
1.0 1.0
0.9 0.9
0.8
0.8
0.7
0.7
ct /c0
0.6
ct /c0
0.5 0.6
0.4 0.5
0.3
0.4
0.2
0.3
0 10 20 30 40 50 60 0 10 20 30 40 50 60
Without ferrous iron 4 mg/L
Without TiO2 1.2 g/L
2 mg/L 6 mg/L
0.6 g/L 1.5 g/L
Figure 7: Effect of Fe(II) on ultrasonic degradation of fuchsin basic
(initial dye concentration = 10 𝜇mol L−1 , ultrasonic power = 400 W, Figure 8: Effect of TiO2 on ultrasonic degradation of fuchsin basic
ultrasonic frequency = 25 kHz, tempetature = 22∘ C, and pH = 6.5). (initial dye concentration = 10 𝜇mol L−1 , ultrasonic power = 400 W,
ultrasonic frequency = 25 kHz, tempetature = 22∘ C, and pH = 6.5).
enhanced by Fe(II) addition. In the presence of Fe(II), the

extent of degradation increased to 73.5%, 84.1%, and 83.1% of Madhavan et al. [14] and Wang et al. [38] showed that TiO2
for Fe(II) concentrations of 2, 4, and 6 mg/L, respectively. can accelerate the sonolytic degradation of dye pollutants
As discussed in this and other researches [36, 37], hydrogen markedly. TiO2 in sonocatalytic degradation may play the
peroxide can be formed from the combination of ∙ OH and role like photocatalyst on the surface of which ∙ OH radicals
∙ can form. However, it can also lead to screening effect, that is,
OOH radicals in the process of sonolysis. The enhance-
shielding fuchsin basic molecules from receiving sonic waves
ment of degradation by Fe(II) addition was due to the
to result in a drop of degradation. Furthermore, TiO2 can also
decomposition of H2 O2 and hydroxyl radical generation in
play as an adsorbent for dye molecules, so roles of adsorbent
the Fenton (Fe(II)/H2 O2 ) and Fenton-like (Fe(III)/H2 O2 )
and catalyst should be distinguished. Differences of the type
processes (reactions (3)–(7)):
(i.e., anatase or rutile) and diameter of TiO2 catalyst may also
Fe2+ + H2 O2 󳨀→ Fe3+ + ∙ O H + OH− (3) lead to these discrepant findings between this research and
others.
Fe2+ + ∙ O H 󳨀→ Fe3+ + OH− (4)
3.2.3. Effect of Radical Scavenging Agents. To study the role
Fe3+ + H2 O2 󳨀→ Fe − OOH2+ + H+ (5) of ∙ OH in ultrasound degradation of fuchsin basic, the effect
of ∙ OH scavenging agents (DMSO, methanol, and mannitol)
Fe − OOH2+ 󳨀→ Fe2+ + HOO∙ (6)
on the degradation of fuchsin basic under ultrasound irradi-
ation for 60 min was examined [39]. As shown in Figure 9,
Fe3+ + HOO∙ 󳨀→ Fe2+ + O2 + H+ (7)
the addition of the radical scavenging agents methanol
The slight decrease of degradation for 6 mg/L Fe(II) (1%), DMSO (1%), and mannitol (5 𝜇mol L−1 ) significantly
may be attributed to the addition of H2 SO4 in preparing suppressed the degradation of fuchsin basic, possibly by
FeSO4 solution, which prevented the hydrolysis of Fe(II). The quenching the ∙ OH. Among the scavengers, DMSO was the
addition of H2 SO4 caused the decline of solution pH and the most effective. The results demonstrate that ∙ OH plays an
lower degradation ratio, which was described in the research important role in the ultrasound degradation of fuchsin basic,
of pH effect. and the degradation process follows free radical mechanism.
3.2.2. Effect of TiO2 . The effect of TiO2 on the sonolytic 4. Conclusions

degradation of fuchsin basic was also investigated, and the
results are shown in Figure 8. When the dosage of TiO2 The conclusions drawn from this study are summarized as
was 1.2 g/L and 1.5 g/L, the extent of degradation reached follows. (1) Fuchsin basic can be readily eliminated by the
73.1% and 71.6%, respectively. Compared to that without TiO2 ultrasound process, but the complete mineralization of dye
(66.5%), the extent of degradation increased by 6.6% and did not occur. Ultrasonic degradation of fuchsin basic was
5.1%. While for the dosage of 0.6 g/L, the extent of degrada- found to obey pseudo first-order reaction kinetics. (2) The
tion even decreased slightly. These results show no obvious use of suitable catalysts (e.g., Fe(II)) that behave as radical
enhancement of degradation by adding TiO2 . The researches promoters can improve process efficiency. (3) The radical
1.0 [7] D. Kobayashi, C. Honma, A. Suzuki et al., “Comparison of

ultrasonic degradation rates constants of methylene blue at
0.9 22.8 kHz, 127 kHz, and 490 kHz,” Ultrasonics Sonochemistry,
vol. 19, no. 4, pp. 745–749, 2012.
0.8 [8] V. Naddeo, S. Meriç, D. Kassinos, V. Belgiorno, and M. Guida,
0.7
“Fate of pharmaceuticals in contaminated urban wastewater
effluent under ultrasonic irradiation,” Water Research, vol. 43,
ct /c0
0.6 no. 16, pp. 4019–4027, 2009.

[9] V. Naddeo, V. Belgiorno, D. Kassinos, D. Mantzavinos, and
0.5 S. Meric, “Ultrasonic degradation, mineralization and detox-
ification of diclofenac in water: optimization of operating
0.4
parameters,” Ultrasonics Sonochemistry, vol. 17, no. 1, pp. 179–
0.3 185, 2010.
[10] G. Andaluri, E. V. Rokhina, and R. P. S. Suri, “Evaluation of
0 10 20 30 40 50 60 relative importance of ultrasound reactor parameters for the
Time (min) removal of estrogen hormones in water,” Ultrasonics Sonochem-
istry, vol. 19, no. 4, pp. 953–958, 2012.
Without scavenger Methanol
DMSO Mannitol [11] M. Capocelli, E. Joyce, A. Lancia, T. J. Mason, D. Musmarra, and
M. Prisciandaro, “Sonochemical degradation of estradiols: inci-
Figure 9: Effect of radical scavenging agents on ultrasonic degrada- dence of ultrasonic frequency,” Chemical Engineering Journal,
tion of fuchsin basic (initial dye concentration = 10 𝜇mol L−1 , ultra- vol. 210, no. 1, pp. 9–17, 2012.
sonic power = 400 W, ultrasonic frequency = 25 kHz, temperature = [12] R. Sivakumar and K. Muthukumar, “Sonochemical degradation
22∘ C, and pH = 6.5). of pharmaceutical wastewater,” Clean—Soil, Air, Water, vol. 39,
no. 2, pp. 136–141, 2011.
[13] B. Soltani and A. Moheb, “Ultrasound irradiation facilitated
scavengers reduced the extent of degradation, which indicates adsorption of MTBE from aqueous solution using exfoliated
that ∙ OH plays an important role in the degradation of graphite,” Chemical Engineering and Technology, vol. 33, no. 7,
pp. 1107–1111, 2010.
fuchsin basic, and the degradation process follows free radical
mechanism. [14] J. Madhavan, P. S. Sathish Kumar, S. Anandan, F. Grieser, and M.
Ashokkumar, “Degradation of acid red 88 by the combination
of sonolysis and photocatalysis,” Separation and Purification
Acknowledgments Technology, vol. 74, no. 3, pp. 336–341, 2010.
[15] Y. Suzuki, W. Warsito, H. Arakawa, A. Maezawa, and S.
This work was supported by the Colleges and Universities Uchida, “Ultrasonic enhancement of photo-catalytic oxidation
Scientific Research Project Foundation of Hebei Education of surfactant,” International Journal of Photoenergy, vol. 1, no. 1,
Department (Project no. Z2013010) and Science and Technol- pp. 60–64, 1999.
ogy Bureau of Langfang, China (Project no. 2012011036). [16] G. Bayramoglu, B. Altintas, and M. Y. Arica, “Adsorption
kinetics and thermodynamic parameters of cationic dyes from
References aqueous solutions by using a new strong cation-exchange resin,”
Chemical Engineering Journal, vol. 152, no. 2-3, pp. 339–346,
[1] S. M. A. G. U. de Souza, E. Forgiarini, and A. A. Ulson de Souza, 2009.
“Toxicity of textile dyes and their degradation by the enzyme [17] V. K. Gupta, A. Mittal, V. Gajbe, and J. Mittal, “Adsorption of
horseradish peroxidase (HRP),” Journal of Hazardous Materials, basic fuchsin using waste materials—bottom ash and deoiled
vol. 147, no. 3, pp. 1073–1078, 2007. soya—as adsorbents,” Journal of Colloid and Interface Science,
[2] G. O. El-Sayed, “Removal of methylene blue and crystal violet vol. 319, no. 1, pp. 30–39, 2008.
from aqueous solutions by palm kernel fiber,” Desalination, vol. [18] ISO 6060, Water Quality-Determination of the Chemical Oxygen
272, no. 1–3, pp. 225–232, 2011. Demand, vol. 147, 6060/TC, ISO, Geneva, Switzerland, 2nd
[3] K. Z. Elwakeel and M. Rekaby, “Efficient removal of reactive edition, 1989.
black 5 from aqueous media using glycidyl methacrylate resin [19] C. Kormann, D. W. Bahnemann, and M. R. Hoffmann, “Photo-
modified with tetraethelenepentamine,” Journal of Hazardous catalytic production of H2 O2 and organic peroxides in aqueous
Materials, vol. 188, no. 1–3, pp. 10–18, 2011. suspensions of TiO2 , ZnO, and desert sand,” Environmental
[4] S. C. Kwon, J. Y. Kim, S. M. Yoon, W. Bae, K. S. Kang, and Science and Technology, vol. 22, no. 7, pp. 798–806, 1988.
Y. W. Rhee, “Treatment characteristic of 1,4-dioxane by ozone- [20] T. Kimura, T. Sakamoto, J.-M. Leveque et al., “Standardization
based advanced oxidation processes,” Journal of Industrial and of ultrasonic power for sonochemical reaction,” Ultrasonics
Engineering Chemistry, vol. 18, no. 6, pp. 1951–1955, 2012. Sonochemistry, vol. 3, no. 3, pp. S157–S161, 1996.
[5] G. L. Jing, M. M. Luan, W. T. Du, and C. J. Han, “Treatment [21] M. H. Entezari, A. Heshmati, and A. Sarafraz-Yazdi, “A com-
of oily sludge by advanced oxidation process,” Environmental bination of ultrasound and inorganic catalyst: removal of 2-
Earth Sciences, vol. 67, no. 8, pp. 2217–2221, 2012. chlorophenol from aqueous solution,” Ultrasonics Sonochem-
[6] R. Singla, F. Grieser, and M. Ashokkumar, “Sonochemical istry, vol. 12, no. 1-2, pp. 137–141, 2005.
degradation of martius yellow dye in aqueous solution,” Ultra- [22] R. J. Lan, J. T. Li, H. W. Sun, and W. B. Su, “Degradation of
sonics Sonochemistry, vol. 16, no. 1, pp. 28–34, 2009. naproxen by combination of fenton reagent and ultrasound
irradiation: optimization using response surface methodology,” anatase,” Ultrasonics Sonochemistry, vol. 12, no. 5, pp. 331–337,
Water Science and Technology, vol. 66, no. 12, pp. 2695–2701, 2005.
2012. [39] N. Shimizu, C. Ogino, M. F. Dadjour, and T. Murata, “Sonocat-
[23] M. H. Entezari and P. Kruus, “Effect of frequency on sonochem- alytic degradation of methylene blue with TiO2 pellets in water,”
ical reactions II. temperature and intensity effects,” Ultrasonics Ultrasonics Sonochemistry, vol. 14, no. 2, pp. 184–190, 2007.
Sonochemistry, vol. 3, no. 1, pp. 19–24, 1996.
[24] J. L. Luche, Synthetic Organic Sonochemistry, Plenum Press, New
York, NY, USA, 1998.
[25] A. Tauber, H.-P. Schuchmann, and C. Von Sonntag, “Sonolysis
of aqueous 4-nitrophenol at low and high pH,” Ultrasonics
Sonochemistry, vol. 7, no. 1, pp. 45–52, 2000.
[26] E. De Bel, J. Dewulf, B. D. Witte, H. Van Langenhove, and
C. Janssen, “Influence of pH on the sonolysis of ciprofloxacin:
biodegradability, ecotoxicity and antibiotic activity of its degra-
dation products,” Chemosphere, vol. 77, no. 2, pp. 291–295, 2009.
[27] M. Goel, H. Hongqiang, A. S. Mujumdar, and M. B. Ray, “Sono-
chemical decomposition of volatile andnon-volatile organic
compounds—a comparative study,” Water Research, vol. 38, no.
19, pp. 4247–4261, 2004.
[28] R. J. Emery, M. Papadaki, L. M. Freitas Dos Santos, and D.
Mantzavinos, “Extent of sonochemical degradation and change
of toxicity of a pharmaceutical precursor (triphenylphosphine
oxide) in water as a function of treatment conditions,” Environ-
ment International, vol. 31, no. 2, pp. 207–211, 2005.
[29] A. Bhatnagar and H. M. Cheung, “Sonochemical destruction
of chlorinated C1 and C2 volatile organic compounds in dilute
aqueous solution,” Environmental Science and Technology, vol.
28, no. 8, pp. 1481–1486, 1994.
[30] J. M. Wu, H. S. Huang, and C. D. Livengood, “Ultrasonic
destruction of chlorinated compounds in aqueous solution,”
Environmental Progress, vol. 11, no. 3, pp. 195–201, 1992.
[31] H. Destaillats, T. W. Alderson II, and M. R. Hoffmann, “Applica-
tions of ultrasound in NAPL remediation: sonochemical degra-
dation of TCE in aqueous surfactant solutions,” Environmental
Science and Technology, vol. 35, no. 14, pp. 3019–3024, 2001.
[32] X. Wang, Z. Yao, J. Wang, W. Guo, and G. Li, “Degradation
of reactive brilliant red in aqueous solution by ultrasonic
cavitation,” Ultrasonics Sonochemistry, vol. 15, no. 1, pp. 43–48,
2008.
[33] M. Inoue, F. Okada, A. Sakurai, and M. Sakakibara, “A new
development of dyestuffs degradation system using ultrasound,”
Ultrasonics Sonochemistry, vol. 13, no. 4, pp. 313–320, 2006.
[34] Q.-P. Isariebel, J.-L. Carine, J.-H. Ulises-Javier, W. Anne-Marie,
and D. Henri, “Sonolysis of levodopa and paracetamol in
aqueous solutions,” Ultrasonics Sonochemistry, vol. 16, no. 5, pp.
610–616, 2009.
[35] S. Merouani, O. Hamdaoui, F. Saoudi, and M. Chiha, “Sono-
chemical degradation of Rhodamine B in aqueous phase: effects
of additives,” Chemical Engineering Journal, vol. 158, no. 3, pp.
550–557, 2010.
[36] Y. Jiang, C. Petrier, and T. D. Waite, “Sonolysis of 4-
chlorophenol in aqueous solution: effects of substrate con-
centration, aqueous temperature and ultrasonic frequency,”
Ultrasonics Sonochemistry, vol. 13, no. 5, pp. 415–422, 2006.
[37] F. Méndez-Arriaga, R. A. Torres-Palma, C. Pétrier, S. Esplugas,
J. Gimenez, and C. Pulgarin, “Ultrasonic treatment of water
contaminated with ibuprofen,” Water Research, vol. 42, no. 16,
pp. 4243–4248, 2008.
[38] J. Wang, B. Guo, X. Zhang, Z. Zhang, J. Han, and J. Wu,
“Sonocatalytic degradation of methyl orange in the presence of
TiO2 catalysts and catalytic activity comparison of rutile and
http://dx.doi.org/10.1155/2013/340347
Research Article
Treatment of Effluent from a Factory of Paints Using
Solar Photo-Fenton Process
Alam Gustavo Trovó,1 Oswaldo Gomes Jr.,1 and Antonio Eduardo da Hora Machado1,2
1
Instituto de Quı́mica, Universidade Federal de Uberlândia, 38400-902 Uberlândia, MG, Brazil
2
Departamento de Quı́mica, Universidade Federal de Goiás, 75704-020 Catalão, GO, Brazil
Correspondence should be addressed to Alam Gustavo Trovó; alamtrovo@iqufu.ufu.br
Received 31 May 2013; Revised 31 August 2013; Accepted 31 August 2013
Copyright © 2013 Alam Gustavo Trovó et al. This is an open access article distributed under the Creative Commons Attribution
cited.
We evaluated the use of Fenton reactions induced by solar radiation in the treatment of effluent from a factory of paints for buildings,
after prior removal of the suspended solids. The increase of H2 O2 concentration from 100 to 2500 mg L−1 for a [Fe2+ ] = 105 mg L−1
contributed to the reduction of DOC, COD, and toxicity. Our best results were achieved using 1600 mg L−1 H2 O2 , with 90% of
DOC and COD removal and a complete removal of the toxicity with respect to Artemia salina. Additionally, through increasing Fe2+
concentration from 15 to 45 mg L−1 , the DOC removal rate increased 11 times, remaining almost constant in the range above 45 until
105 mg L−1 . Under our best experimental conditions, 80% of DOC removal was achieved after an accumulated dose of 130 kJ m−2 of
UVA radiation (82 ± 17 min of solar irradiation under an average UVA irradiance of 34.1 ± 7.3 W m−2 ), while 40% of DOC removal
was reached after 150 min under only thermal Fenton reactions. The results suggest the effectiveness of implementation of solar
photo-Fenton process in the decontamination and detoxification of effluents from factories of paints for buildings.
1. Introduction and also avoiding an additional step for removal of catalyst,

which is usual when dealing with heterogeneous processes.
Wastewaters containing toxic compounds may originate from Although the photo-Fenton process has been applied
household and personal care activities as well as from in the treatment of wastewaters of different compositions
industrial processes. Most of the compounds present in these (containing pesticides, pharmaceuticals, petroleum, dyes,
wastewaters are not treatable by conventional technologies and colorants, among other compounds), no attempts have
due to the high stability, toxicity, and/or low biodegradability been published concerning the use of the photo-Fenton
[1, 2]. process combined with solar radiation as an alternative to the
Having regard to the above information, many studies treatment of effluent from factories of paints for buildings,
aimed at the elimination of toxic and recalcitrant compounds searching its decontamination and detoxification. Most of the
are based on the application of advanced oxidation processes articles published concerning the treatment of wastewaters
(AOPs) [3–8], since the nonselective attack of the hydroxyl containing dyes and pigments involve the study of synthetic
radicals usually converts toxic compounds into carbon diox- effluents containing one or more target compounds in ultra-
ide, water, and inorganic ions [9]. However, the main disad- pure water and/or using artificial irradiation, a situation far
vantage of AOPs is high cost of maintenance of the artificial from the reality [14–18]. Few studies have been reported using
sources of radiation and equipment for ozone production. real effluents [10, 11, 19, 20].
On the other hand, solar radiation can be used as radiation Therefore, the aim of the present work is to evaluate
source in heterogeneous photocatalysis and photo-Fenton at lab scale the influence of H2 O2 concentration on the
process, reducing the energetic costs [10–13]. The photo- soluble fraction of the organic load (dissolved organic carbon
Fenton process has the advantage to be a homogeneous (DOC) and chemical oxygen demand (COD)), as well as
process, favouring a better contact between reagent species on the toxicity removal during the application of the solar
photo-Fenton process in the treatment of a real effluent, to the containers in small portions, in the order of a few
seeking to meet discharge standards and/or reuse in the mg L−1 . The consumption of H2 O2 was monitored during
manufacturing process or in other activities inherent to the solar exposure without control of the dose of the incident
industrial plant. Under the best concentration defined in this UVA radiation. After consuming all H2 O2 , an aliquot was
study for H2 O2 , the influence of Fe2+ on the kinetics of DOC taken for analyses. A new portion of H2 O2 was added, and
removal was evaluated, aiming to know the time of treatment another sample was taken after consumption of all the H2 O2 .
and estimate its potential of application. The evaluation of the This cycle was repeated until a cumulative concentration
concentration of Fe2+ and H2 O2 is determinant to establish of 2500 mg L−1 of H2 O2 has been added. The procedure
the process efficiency. This information is necessary for an described as “addition, total consumption, sample collection,
economic and operational evaluation before scaling up to a and new addition” is important as it prevents the occurrence
large scale. In addition, the knowledge about the behaviour of of reactions in the dark during storage after collection of
the effluent toxicity during application of the photocatalytic the sample and possible interference in toxicity tests and
process allows us to make the necessary adjustments so that the analysis of COD. In these experiments, aliquots (70 mL)
the process is feasible in large-scale applications. of the photolysed solution were collected immediately after
the confirmation of the total consumption of the added
2. Materials and Methods H2 O2 . Considering this procedure, it is recommended that
the experimental data must be expressed in terms of H2 O2
2.1. Reagents. All solutions, except the effluent, were prepared consumption and not on the basis of the accumulated
using ultrapure water. radiation dose or even the reaction time.
FeSO4 ⋅7H2 O (Vetec) was used to prepare aqueous In the second set of experiments (kinetic experiments),
0.25 mol L−1 Fe2+ stock solution; H2 O2 (30% w/w), H2 SO4 , containers of 13 cm diameter were used. Two sets of experi-
NaOH, and Na2 SO3 , all from Vetec, were used as received. A ments were performed: the first one involves the correlation
solution of ammonium metavanadate (Vetec) was prepared at between reaction time and accumulated dose of UVA, and
a concentration of 0.060 mol L−1 in 0.36 mol L−1 H2 SO4 and the other relates the reaction directly to the dose of UVA
used for H2 O2 quantification. radiation. In the first set of experiments, aliquots of 30 mL
The effluent was kindly provided by a factory of paints were collected at intervals of 20 min up to 60 min of reaction
for buildings, whose main activity is the production of acrylic and at very 30 min above 60 min of reaction up to 150 min.
paints. The composition of the effluent was not made available For the second, aliquots were collected after exposure to the
by the company. In general, this kind of effluent must contain same dose of UVA radiation. This procedure was done to
acrylic resin, organic and inorganic pigments (titanium facilitate the comparison of results, since for the same dose
dioxide, phthalocyanines, etc.), charges (carbonates, silicates, of UVA, the same amount of photons is obtained, providing
etc.), additives (dispersants, humectants, surfactants, etc.), the same level of degradation for a similar exposition [10,
and organic and inorganic salts, among others [21]. 11, 22]. The measurements of UVA irradiance and dose were
done using a solar light PMA2100 photometer/radiometer,
2.2. Photodegradation Procedure and Solar Irradiance Mea- equipped with a UVA detector (320–400 nm).
surements. All experiments were carried out between 10 am We used an initial concentration of H2 O2 equal to 1600
and 14 pm, in a range of temperatures varying between 27 mg L−1 , determined in previous experiments, which is able to
and 33∘ C, during autumn using a batch reactor located in induce an almost complete reduction in DOC and COD. Due
our lab, in Uberlândia, Brazil (18∘ 55󸀠 08󸀠󸀠 S; 48∘ 16󸀠 37󸀠󸀠 W). The to the fast consumption of H2 O2 , new additions were done
solutions containing reagents and effluent, after adjustment at each 78.3 kJ m−2 accumulated, in the experiments when
of pH and filtering, were exposed to sunlight under clear 45 mg L−1 Fe2+ were used, and at each 47.1 kJ m−2 of UVA,
sky conditions, in open vessels of dark glass (same deep, but when 75 or 105 mg L−1 Fe2+ were used.
with different surface area), and maintained under constant Before photo-Fenton experiments, the initial pH of the
magnetic stirring. Three types of glass containers were used: effluent was adjusted between 2.5 and 2.8, the optimum pH
the first one with 0.21 × 0.21 m (volume of 3.3 L and surface range for Fenton reactions [23, 24], using a solution of H2 SO4 ,
area of 0.044 m2 ), the second with 13 cm of diameter (volume which caused the precipitation of the suspended solids. The
of 0.98 L and surface area of 0.013 m2 ), and the third with suspended solids in the effluent were, then, removed by
diameter of 6 cm (volume of 0.21 L and surface area of filtration, using membranes with mean pore size of 0.45 𝜇m,
0.0028 m2 ), all with 7.2 cm of depth. Each glass container was after a previous decantation. An aqueous solution containing
filled with the effluent, resulting in a depth of 7 cm. Fe2+ , acidified with sulfuric acid, was added to the filtered
Two sets of experiments involving the photo-Fenton effluent. Acidification of this solution was to prevent the
treatment were performed. One is controlled dosing of H2 O2 oxidation of Fe2+ to Fe3+ . Shortly after the addition of Fe2+ ,
(ranging from 100 up to 2500 mg L−1 ), monitoring Fe2+ and a new adjustment of pH to the range between 2.5 and 2.8 was
Fe3+ concentrations, the removal of DOC and COD as well done. So, before exposing the solution to sunlight, the H2 O2
as the toxicity. The second set is evaluating the effect of was added.
different iron concentrations (15, 45, 75, and 105 mg L−1 ) on After sampling and before analysis, for the experi-
the kinetics of DOC removal and consumption of H2 O2 . ments involving the controlled dosage of H2 O2 , the pH of
The first one was done using containers of 0.21 × 0.21 m the aliquots was adjusted to the range between 6 and 8
and 105 mg L−1 Fe2+ . For these experiments, H2 O2 was added before filtration through membranes with mean pore size
Table 1: Composition of the studied effluent. content was determined directly, using a methodology based
on the reaction between Fe2+ and 1,10-phenantroline [25].
Parameter Value
The concentration of Fe3+ was estimated by the difference
Dissolved organic carbon (mg C L−1 )b 307 between the total iron, determined after reduction with
Dissolved organic carbon (mg C L−1 )c 237 hydroxylamine, and the content of Fe2+ . The toxicity tests
Dissolved inorganic carbon (mg C L−1 )b 83.5 were done evaluating the immobilization of A. salina [27].
Dissolved inorganic carbon (mg C L−1 )c 6.2
Chemical oxygen demand (mg O2 L−1 )b 1232 3. Results and Discussion
Chemical oxygen demand (mg O2 L−1 )c 672
Toxicity (A. salina) (%)c 100 3.1. Characterization of the Effluent. Paints for buildings can
pHa 7.6 be considered as a stable mixture, in basic medium, of solids
Solids in suspension (mg L−1 )a 2040 in a volatile component (water or organic solvent, in this
Total dissolved iron (mg L−1 )b 0.05 case, water). A third group of components is the additives.
Total chloride (mg L−1 )b 8.2 Although they represent a small fraction of the composition,
Total chloride (mg L−1 )c 4.1 they are responsible for important features for the paints, as
Total phosphorus (mg L−1 )c 3.2 wetting and dispersing action for pigments and charges and
Total N (mg L−1 )b 34.9
corrosion protection, among others.
A brief characterization of the effluent used in this study is
Total N (mg L−1 )c 28.1
presented in Table 1. The raw effluent, a mixture of different
N-NH4 + (mg L−1 )b 28.5
dyes, is opaque with a milky appearance and a slightly lilac
N-NH4 + (mg L−1 )c 26.9 color, possessing an expressive amount of suspended solids
Colora Lilac (2040 mg L−1 ) and a pH close to neutrality. The soluble
Colorb Lilac fraction has a moderate organic load (DOC = 307.0 mg C L−1
Colorc Colorless and COD = 1232 mg O2 L−1 ).
Odora Fetid Considering that the optimum pH range for Fenton
Odorb Fetid reactions occurs between 2.5 and 2.8 [23, 24], the pH of
Odorc Similar but less intense the effluent was adjusted to this range before performing
a
Raw effluent. the photo-Fenton experiments. However, after acidification,
b
Raw effluent, after filtration using 0.45 𝜇m mean pore size membranes. the equilibrium that kept the solids suspended due to the
c
After pH adjustment between 2.5 and 2.8, precipitation, and filtration using dispersant action of the additives, was compromised, leading
0.45 𝜇m mean pore size membranes.
to a rapid precipitation. Simultaneous to precipitation, a
complete color removal was observed, most likely due to
the adsorption of the pigments on the surface of the solids.
of 0.45 𝜇m, while for the kinetics experiments, an excess of
With the removal of the suspended solids, a partial but
a 2.0 mol L−1 solution of Na2 SO3 was added to the samples
expressive DOC and COD reduction, respectively, from
before pH adjustment and filtration, ensuring the removal of
307 to 237 mg L−1 and from 1232 to 672 mg L−1 (Table 1),
the remaining H2 O2 and stopping the Fenton reactions. For
was quantified. Similar behavior was also observed for the
the kinetics experiments, only DOC and H2 O2 analyses were
inorganic fraction (total chloride and nitrogen and nitrogen
done, since the presence of sulfite does not cause interference
as ammonium). In addition, the pH adjustment contributed
in these analyses.
to the elimination of carbonates and bicarbonates, reducing
Control experiments (direct photolysis, H2 O2 /solar,
the dissolved inorganic carbon from 83.5 to 6.2 mg C L−1
H2 O2 dark, Fe2+ /solar, and Fenton) were also performed in
(Table 1), which is extremely advantageous since these species
containers with 6 cm diameter using 1600 mg L−1 H2 O2 and
act as scavengers of hydroxyl radicals [28]. On the other
105 mg L−1 Fe2+ .
hand, although a complete color removal was reached after
pH adjustment and filtration of solids, much of the organic
2.3. Analytical Determinations and Toxicity Bioassays. The load remained in solution, which presented 100% of toxicity
efficiency of the photo-Fenton process was evaluated by mon- to A. salina (Table 1).
itoring the following experimental parameters: electronic From this point, the authors decided to apply the photo-
absorption, consumption of H2 O2 , amount of Fe2+ and Fe3+ , Fenton process as an alternative to degrade only the soluble
COD, DOC, and toxicity, evaluated using Artemia salina. fraction of the organic load to discharge standards and/or its
The DOC decay was followed using a TOC analyser (Shi- reuseain, and not the solid phase. So, before all photodegra-
madzu TOC-VCPH/CPN) equipped with an ASI-V autosam- dation experiments and after pH adjustment, the effluent was
pler. COD determinations were carried out according to submitted to decantation and filtration using 0.45 𝜇m mean
the 5220D Standard Methods [25]. The H2 O2 concentration pore size membranes.
was estimated using a photometric method proposed by The UV-Vis absorption spectrum of the effluent after
Nogueira et al. [26]. The absorbance values were obtained pretreatment reveals a high absorbance only in the UV region
from UV-Vis spectra in the range between 190 and 800 nm, (190–400 nm), probably due to the presence of aromatic
using a Shimadzu UV-1650 PC spectrophotometer. The Fe2+ compounds (Figure 1(b)).
700
2.5
600
500 2.0
400
C (mg L−1 )
1.5
Absorbance
300
1.0
200
0.5
100
0 0.0
0 600 1200 1800 2400 200 250 300 350 400
H2 O2 (mg L−1 ) Wavelength (nm)
DOC 0 1000
COD 100 mg L−1 H2 O2 1200
200 1600
300 2500
800
(a) (b)
Figure 1: Influence of the H2 O2 concentration on the soluble fraction of the (a) organic load DOC and COD, (b) UV absorbance removal
of the effluent, obtained during solar photo-Fenton reaction, using different H2 O2 concentrations. Experimental conditions: initial DOC =
237 mg CL−1 ; initial COD = 672 mg O2 L−1 ; Fe2+ = 105 mg L−1 ; and pH = 2.5–2.8.
3.2. Application of Photo-Fenton Process Mediated by HO∙ + ∙ OH 󳨀→ H2 O2 𝑘 = 5.2 × 109 M−1 s−1 (4)
Solar Radiation
For the experiments with controlled H2 O2 dosage, after
3.2.1. Influence of the H2 O2 Concentration. The H2 O2 con- addition of the first dose of 100 mg L−1 of this reagent, the
centration is an important operational parameter for Fenton color of the effluent changed from light orange to dark gray,
reactions, since an excess of this reagent, or its absence, tends suggesting the formation of dark colored intermediates. New
to reduce drastically the efficiency of the process. The excess additions of H2 O2 up to 2500 mg L−1 were done. Although
of H2 O2 favors self-decomposition reactions (1) and reactions there has not been a complete removal of color of the solution,
that consume hydroxyl radicals without however promoting there was a significant reduction in its intensity. This suggests
the degradation of organic matter (2)–(4), committing the the persistence of the colored intermediates. Despite that
efficiency of the process [27, 29–32]. In view of this, in the first the color of the effluent can limit the action of the incident
part of this study, a set of experiments was carried out aiming radiation, a fast COD decay from 672 to 250 mg O2 L−1
to find the best H2 O2 concentration in the range from 100 was achieved using 400 mg L−1 H2 O2 , and 105 mg L−1 Fe2+ ,
to 2500 mg L−1 , in the presence of 105 mg L−1 Fe2+ , capable under solar irradiation. Using 1600 mg L−1 H2 O2 a COD of
to maximize DOC and COD removal (Figure 1). In addition, 70 mg O2 L−1 was reached (Figure 1(a)).
the toxicity of the effluent was monitored throughout the Only a slight improvement in COD removal was observed
process in order to assess the viability and the potential use when increasing the H2 O2 concentration from 1600 up to
of photo-Fenton reactions in the treatment of this kind of 2500 mg L−1 , respectively, 70 to 57 mg O2 L−1 , probably due
effluent. In these experiments, the dose of UVA radiation was to the formation of acids of low molecular weight, refractory
not controlled the solutions were exposed to the sunlight until to oxidation [33, 34]. Similar behavior was observed for DOC
the total consumption of the H2 O2 was added: removal (Figure 1(a)) and for the absorption maxima at 224
and 272 nm (Figure 1(b)). Using 1600 mg L−1 H2 O2 , 90% of
H2 O2 + H2 O2 󳨀→ 2H2 O + O2 (1) DOC removal and 100% of removal of the absorbance peaks
at 224 and 272 nm were obtained (Figure 1), suggesting a
H2 O2 + HO∙ 󳨀→ H2 O + HO2 ∙ 𝑘 = 3.3 × 107 M−1 s−1 (2) high efficiency of the photo-Fenton process in removing the
organic load and decontamination of this class of effluent.
HO2 ∙ + ∙ OH 󳨀→ H2 O + O2 𝑘 = 0.71 × 1010 M−1 s−1 (3) Therefore, the use of H2 O2 concentrations higher than
120 As before mentioned, the presence of colored inter-

mediates was observed for concentrations of H2 O2 up to
2500 mg L−1 . This tends to affect the photochemical regen-
100 eration of ferrous ions since the absorption of photons by
Fe3+ complexes is more difficult in strongly colored solutions,
even under stirring (Figure 2) [36]. Considering this, we
80
can consider that at the beginning of the experiments, the
Dissolved iron (mg L−1 )
thermal Fenton process probably prevails over the photo-

60
Fenton. Therefore, the regeneration of ferrous ions probably
should occur, in this case, by the action of H2 O2 ((6)-(7)).
As presented in Figure 2, between 75 and 90% of the
40 initial concentration of Fe2+ was converted to Fe3+ , when
the H2 O2 added resulted in an initial concentration between
1000 and 1600 mg L−1 . As discussed before, the increase in
20 the initial concentration of H2 O2 from 1600 to 2500 mg L−1
contributed only to a minimal improvement in COD and
DOC removal. Besides the formation of carboxylic acids of
0 low molecular weight, the low COD and DOC removal may
0 600 1200 1800 2400
also be associated with the low concentration of Fe2+ and high
H2 O2 (mg L−1 )
concentration of Fe3+ in the reaction medium after adding
Fe2+ H2 O2 , giving an initial concentration between 1000 and
Fe3+
1600 mg L−1 (Figure 2), which helps to reduce the efficiency
Total iron
of generation of hydroxyl radicals ((5)–(7)). In other words,
Figure 2: Dependence on Fe2+ , Fe3+ , and total dissolved iron once the regeneration of ferrous ions is very slow ((6)-(7)),
concentrations and different concentrations of hydrogen peroxide, the degradation of the organic load will depend on the rate of
during photo-Fenton treatment of the soluble fraction of the regeneration of Fe2+ from Fe3+ , mediated by H2 O2 ((6)-(7)).
effluent. Experimental conditions: DOC = 237 mg C L−1 ; COD = A probable consumption of H2 O2 (Figure 1(a)) without
672 mg O2 L−1 ; Fe2+ = 105 mg L−1 ; and pH = 2.5–2.8. apparent contribution in the removal of COD and DOC
could have occurred due to the regeneration of Fe2+ ((6)-
(7)) [31, 32] as well as self-decomposition reactions and
1600 mg L−1 is not justifiable (Figure 1). The H2 O2 concen- scavenging of hydroxyl radicals ((1)–(4)).
tration defined as the best in this study (1600 mg L−1 ), is very The role of H2 O2 concentration in the toxicity during the
photo-Fenton process was also evaluated, once the soluble
near to the stoichiometric ratio of H2 O2 (1428 mg L−1 ), con-
fraction of the effluent presented 100% toxicity to A. salina
sidering that 1 g COD ≡ 0.03125 mol O2 ≡ 0.0625 mol H2 O2 =
(Figure 3). After the photo-Fenton process using H2 O2 in
2.125 g H2 O2 [35].
Parallel to DOC, COD, and absorbance analysis, the the range of 100 up to 1600 mg L−1 , the toxicity was reduced
to 0%. On the other hand, for an H2 O2 concentration of
concentrations of Fe2+ , Fe3+ and the total dissolved iron (Fe2+
2500 mg L−1 , the reduction of toxicity was from 100 to 23%
+ Fe3+ ) were also evaluated for different concentrations of
(Figure 3). It is probable that this effect is related to the
H2 O2 (Figure 2). These are also important parameters to
formation of carboxylic acids, that tend to be toxic to A. salina
determine the efficiency of the photo-Fenton process in the
[33], as also reported in studies involving Daphnia magna in
degradation of the organic load, since in most cases part of
the degradation of sulfamethoxazole and amoxicillin [37, 38].
the iron added tends to be complexed by degradation of by-
As presented and discussed above, the results demon-
products [19]. In view of this, new additions of iron ions
strate the feasibility and potential of photo-Fenton pro-
could be required to reach adequate degradation efficiency.
cess both in decontamination (Figure 1) and detoxification
In addition, it is important to know the changes in the
(Figure 3) of effluent from factories of acrylic paints for
concentration of Fe2+ and Fe3+ , since the amount of hydroxyl
buildings. Considering using concentrations of H2 O2 of
radicals generated by reactions mediated by Fe2+ (5) is higher
1600 mg L−1 , COD, DOC, and toxicity removal between
than that generated by Fe3+ , once the regeneration of ferrous 90 and 100% were obtained, an initial concentration of
ions from ferric ions ((6) and (7)) is the limiting step in the 1600 mg L−1 H2 O2 was used for the kinetics experiments,
catalytic cycle of iron: evaluating the iron ions concentration.
Fe2+ + H2 O2 󳨀→ Fe3+ + OH− + ∙ OH 𝑘 = 63.0 M−1 s−1 3.2.2. Influence of the Fe2+ Concentration. The initial Fe2+
(5) concentration is important in two aspects, one is related to
2+
the penetration of light through the solution, and the other
Fe3+ + H2 O2 󴀕󴀬 FeIII (HO2 ) + H+ 𝑘 = 3.1 × 10−3 (6) is related to the efficiency of the photo-Fenton process in
2+ generating hydroxyl radicals since Fe2+ catalyzes the decom-
FeIII (HO2 ) 󳨀→ Fe2+ + HO2 ∙ 𝑘 = 2.7 × 10−3 s−1 (7) position of H2 O2 , generating hydroxyl radicals (5). However,
100
general attributed to the formation of reaction intermediates
[8, 34, 37]. However, after a period between 5 and 50 minutes,
there was a complete removal of the dark color, which occurs
faster (5–10 min) when the larger concentrations of Fe2+ were
80 employed.
The curve of DOC removal can be divided into two parts
(up to 78.3 kJ m−2 and above 78.3 kJ m−2 ), Figure 4(a), with
60 exception of the experiment in the presence of 15 mg L−1 Fe2+ .
Toxicity (%)
In the first part, the curve of DOC removal presents appar-

ent pseudo first-order kinetics (𝑘 = 0.014, 0.16, 0.18, and
40 0.20 kJ−1 m2 , resp., for the initial dose of Fe2+ of 15, 45, 75, and
105 mg L−1 ). The second part of the curve is characterized by a
slow DOC removal rate, due to formation of carboxylic acids
of low molecular weight, refractory to oxidation, and because
20
they are able to form complexes with dissolved iron ions [39],
reducing the efficiency of the Fenton reactions.
An increase in the rate of DOC removal by a factor
0
0 600 1200 1800 2400 of 11 was achieved when the Fe2+ concentration increased
H2 O2 (mg L−1 ) from 15 to 45 mg L−1 , considering an accumulated dose of
78.3 kJ m−2 of UVA radiation (Figure 4(a)). On the other
A. salina
hand, in increasing the Fe2+ concentration from 45 to 75
Figure 3: Evaluation of the toxicity to A. salina during photo- and 105 mg L−1 no significant improvement was obtained in
Fenton treatment of the soluble fraction of the effluent, using DOC removal (Figure 4(a)). These results suggest that an
different concentrations of H2 O2 . Experimental conditions: DOC = iron concentration of 45 mg L−1 is enough to trigger the
237 mg C L−1 ; COD = 672 mg O2 L−1 ; Fe2+ = 105 mg L−1 ; and pH = photocatalytic process induced by solar irradiation. So, using
2.5–2.8.
45 mg L−1 Fe2+ , the photocatalytic regeneration of ferrous
ions from ferric was fast enough (Figure 4(b)), ensuring the
availability of ferrous ions to consume H2 O2 and produce
it is known that an excess of Fe2+ can act as scavenger of
more hydroxyl radicals.
hydroxyl radicals (8), compromising the efficiency of the
process [31]: After an accumulated dose of 130 kJ m−2 of UVA (82 ±
17 min of solar irradiation, equivalent to an average intensity
Fe2+ + HO∙ 󳨀→ Fe3+ + HO− 𝑘 = 3.2 × 108 M−1 s−1 (8) of UVA radiation of 34.1 ± 7.3 W m−2 ), in the presence
The effect of the iron concentration on Fenton and photo- of 45 mg L−1 of Fe2+ , 80% of DOC removal was reached
Fenton processes was evaluated in previous studies. It was for a consumption of 1650 mg L−1 H2 O2 (Figure 4(a)). This
observed that the rate of degradation increases with a given result reinforces the results obtained in experiments using
concentration of iron ions, regarded as the concentration that controlled dosing of H2 O2 , in which 90% of DOC removal
results in the best experimental conditions, which, on the was achieved using 1600 mg L−1 H2 O2 (Figure 1(a)). In addi-
other hand, is dependent on the composition of the effluent tion, an increase in the time of exposure to solar radiation
and type of reactor [10, 11, 19, 27, 39, 40]. did not result in significant improvement in DOC removal
In this study, four sets of experiments using different (Figure 4(a)), probably due to at least three factors: the forma-
iron concentrations (15, 45, 75, and 105 mg L−1 ) were done tion of carboxylic acids of low molecular weight, recombina-
using an initial H2 O2 concentration of 1600 mg L−1 . As the tion reactions ((2)–(4)), and scavenging of hydroxyl radicals
initial dose of H2 O2 was rapidly consumed, new additions by Fe2+ (8).
were done at each 78.3 kJ m−2 of accumulated dose of UVA Control experiments using the soluble fraction of the
radiation in the assays done with 45 mg L−1 Fe2+ and at each effluent were also carried out under the following conditions:
47.1 kJ m−2 of accumulated dose of UVA radiation in the (a) absence of Fe2+ and H2 O2 (direct photolysis at pH
assays done with 75 and 105 mg L−1 Fe2+ . Using the lower iron 2.5–2.8); (b) photolysis without adding Fe2+ , in presence
concentration (15 mg L−1 ), a low rate for DOC removal was of 1600 mg L−1 H2 O2 at pH 2.5; (c) photolysis involving a
verified when compared to the other iron concentrations (45, hydrated complex of iron, using 45 mg L−1 Fe2+ at pH 2.5–
75, and 105 mg L−1 ) (Figure 4(a)). 2.8, without H2 O2 ; and (d) Fenton process in the dark using
It can be observed in Figure 4(a), the occurrence of an 105 mg L−1 Fe2+ and 1600 mg L−1 H2 O2 . These experiments
induction period in the reactions is induced by the lowest were important to assure that the results found during the
iron concentration. For the largest concentrations of iron, photocatalytic assays were consistent and not due to direct
induction periods were not observed, suggesting that the photolysis and/or thermal Fenton reactions (Fenton reactions
limiting step of the reaction for the lower iron concentrations in the dark). No degradation was observed in the conditions
must be the regeneration of Fe2+ [39, 40], once these exper- from (a) to (c), while 40% of DOC removal was reached in
iments also showed an initial darkening of the effluent, in the thermal Fenton reaction in the presence of 105 mg L−1
120
250 3000
100
2500
200
H2 O2 consumed (mg L−1 )

80
2000
DOC (mg L−1 )
C (mg L−1 )
150
60
1500
100
40
1000
50 20
500
0 0 0
0 50 100 150 200 250 0 50 100 150 200 250
Energy dose (kJ m−2 ) Energy dose (kJ m−2 )
15 mg L−1 75 15 mg L−1 75
45 105 45 105
(a) (b)
Figure 4: Influence of Fe2+ concentration on (a) kinetics of DOC removal of the effluent (solid symbols) and consumption of H2 O2 (open
symbols); (b) dissolved iron species (solid symbols: Fe2+ concentration, open symbols: Fe3+ concentration) during the solar photo-Fenton
treatment of the soluble fraction of the effluent under study. Experimental conditions: DOC = 247 mg C L−1 ; H2 O2 = 1600 mg L−1 replaced
in 78.3 kJ m−2 to 45 mg L−1 Fe2+ and 47.1 kJ m−2 to 75 and 105 mg L−1 Fe2+ ; and pH = 2.5–2.8. Irradiation time: 128 ± 23 min (238 kJ m−2 ) and
solar light average intensity: 39.6 ± 5.6 W m−2 .
Fe2+ , after 150 min of reaction (data not shown), equivalent of H2 O2 of 1600 mg L−1 and [Fe2+ ] = 105 mg L−1 . Under these
to the period required to accumulate a dose of UVA radiation conditions, a removal of 90% of DOC and COD and of 100%
of 238 kJ m−2 in the experiments under solar irradiation. The of toxicity was obtained. Only a slight improvement in DOC
lower DOC removal obtained in the thermal Fenton reaction, and COD removal could be observed when increasing the
(d), when compared to the photo-Fenton process induced by H2 O2 concentration above 1600 up to 2500 mg L−1 (decay
solar radiation (90% of DOC removal), suggests a synergetic from 26 to 19 mg C L−1 and from 70 to 57 mg O2 L−1 , resp.)
effect caused by both Fenton processes. probably due to the formation of carboxylic acids, refractory
For thermal Fenton reactions, the concentrations of to oxidation.
Fe2+ and Fe3+ and total dissolved iron (Fe2+ + Fe3+ ) were The curve of DOC removal is consistent with appar-
also monitored. During the reaction interval (150 min), the ent pseudo first-order kinetics (𝑘 = 0.014, 0.16, 0.18, and
concentration of Fe2+ decreased from 102 to 20 mg L−1 after 0.20 kJ−1 m2 , resp., for the initial doses of iron of 15, 45, 75,
a consumption of 1260 mg L−1 H2 O2 . At the same time, no and 105 mg L−1 Fe2+ ), and an improvement of 11 times on the
increase in the concentration of Fe2+ has been observed DOC removal rate was reached when the iron concentration
(data not shown). This agrees with the results obtained using increased from 15 to 45 mg L−1 , keeping almost constant from
controlled dosing of H2 O2 (Figure 2). 45 up to 105 mg L−1 . Under our best experimental conditions
([Fe2+ ] = 45 mg L−1 and [H2 O2 ] = 1600 mg L−1 ), 80% of DOC
4. Conclusions removal was achieved after exposure to 130 kJ m−2 (82 ±
17 min of solar irradiation and average UVA irradiance of
Although, respectively, 62 and 75% of DOC and COD 34.1 ± 7.3 W m−2 ), while 40% of DOC removal was reached
removal were reached using 800 mg L−1 H2 O2 and [Fe2+ ] = under only thermal Fenton reaction ([Fe2+ ] = 105 mg L−1 and
105 mg L−1 , no reduction in the toxicity was observed. This [H2 O2 ] = 1600 mg L−1 ), after 150 min, suggesting a synergetic
suggests that the earliest intermediates of oxidized pretreated effect for the combination among the reactions of Fenton and
effluent obtained using a low dose of H2 O2 (up to 800 mg L−1 ) irradiation in the ultraviolet.
still present acute toxicity to A. salina. A photo-Fenton pro- These results demonstrate the viability of application of
cess involving a H2 O2 concentration over 1000 mg L−1 tends Fenton reactions to the decontamination and detoxification
to produce oxidized intermediates with low toxicity (below of effluent from factories of paints for buildings, using solar
20%). Our best results were obtained using a concentration radiation.
Acknowledgments [12] E. S. Elmolla and M. Chaudhuri, “Comparison of different

advanced oxidation processes for treatment of antibiotic aque-
The authors thank CNPq (Project no. 2011-EXA022) for the ous solution,” Desalination, vol. 256, no. 1–3, pp. 43–47, 2010.
scholarship to O. Gomes Jr. and FAPEMIG (CEX-APQ- [13] A. Durán, J. M. Monteagudo, and I. San Martı́n, “Photocatalytic
00915-11, CEX-APQ-01798-11, CEX-APQ-02425-10, and treatment of an industrial effluent using artificial and solar
CEX-APQ-01217-12), CAPES/PVNS, CNPq (304.576/2011-5) UV radiation: an operational cost study on a pilot plant scale,”
for the financial support of this work. The authors also thank Journal of Environmental Management, vol. 98, no. 1, pp. 1–4,
Mr. Paulo Souza Müller Jr. for technical support. A. E. H. 2012.
Machado is particularly indebted to CNPq and CAPES for [14] M. Kositzi, A. Antoniadis, I. Poulios, I. Kiridis, and S. Malato,
his research grants. This work is a collaborative research “Solar photocatalytic treatment of simulated dyestuff effluents,”
project between members of the Rede Mineira de Quı́mica Solar Energy, vol. 77, no. 5, pp. 591–600, 2004.
(RQ-MG), partially supported by FAPEMIG (Project no. [15] F. Ay, E. C. Catalkaya, and F. Kargi, “A statistical experiment
REDE-113/10). design approach for advanced oxidation of Direct Red azo-dye
by photo-Fenton treatment,” Journal of Hazardous Materials,
vol. 162, no. 1, pp. 230–236, 2009.
References [16] M. Jonstrup, M. Punzi, and B. Mattiasson, “Comparison of
anaerobic pre-treatment and aerobic post-treatment coupled to
[1] M. E. DeLorenzo, G. I. Scott, and P. E. Ross, “Toxicity of
photo-Fenton oxidation for degradation of azo dyes,” Journal of
pesticides to aquatic microorganisms: a review,” Environmental
Photochemistry and Photobiology A, vol. 224, no. 1, pp. 55–61,
Toxicology and Chemistry, vol. 20, no. 1, pp. 84–98, 2001.
2011.
[2] K. Kümmerer, “Antibiotics in the aquatic environment: a [17] M. Punzi, B. Mattiasson, and M. Jonstrup, “Treatment of
review—part I,” Chemosphere, vol. 75, no. 4, pp. 417–434, 2009. synthetic textile wastewater by homogeneous and heteroge-
[3] A. Goi, Y. Veressinina, and M. Trapido, “Fenton process for neous photo-Fenton oxidation,” Journal of Photochemistry and
landfill leachate treatment: evaluation of biodegradability and Photobiology A, vol. 248, pp. 30–35, 2012.
toxicity,” Journal of Environmental Engineering, vol. 136, no. 1, [18] E. R. Bandala, M. A. Peláez, A. J. Garcı́a-López, M. D. J. Salgado,
pp. 46–53, 2010. and G. Moeller, “Photocatalytic decolourisation of synthetic
[4] A. Zapata, T. Velegraki, J. A. Sánchez-Pérez, D. Mantzavinos, M. and real textile wastewater containing benzidine-based azo
I. Maldonado, and S. Malato, “Solar photo-Fenton treatment of dyes,” Chemical Engineering and Processing, vol. 47, no. 2, pp.
pesticides in water: effect of iron concentration on degradation 169–176, 2008.
and assessment of ecotoxicity and biodegradability,” Applied [19] V. J. P. Vilar, L. X. Pinho, A. M. A. Pintor, and R. A. R.
Catalysis B, vol. 88, no. 3-4, pp. 448–454, 2009. Boaventura, “Treatment of textile wastewaters by solar-driven
[5] A. Zapata, I. Oller, C. Sirtori et al., “Decontamination of indus- advanced oxidation processes,” Solar Energy, vol. 85, no. 9, pp.
trial wastewater containing pesticides by combining large-scale 1927–1934, 2011.
homogeneous solar photocatalysis and biological treatment,” [20] E. GilPavas, I. Dobrosz-Gomez, and M. A. Gomez-Garcia,
Chemical Engineering Journal, vol. 160, no. 2, pp. 447–456, 2010. “Decolorization and mineralization of Diarylide Yellow 12
(PY12) by photo-Fenton process: the response surface method-
[6] C. Sirtori, A. Zapata, I. Oller, W. Gernjak, A. Agüera, and S.
ology as the optimization tool,” Water Science and Technology,
Malato, “Decontamination industrial pharmaceutical wastewa-
vol. 65, no. 10, pp. 1795–1800, 2012.
ter by combining solar photo-Fenton and biological treatment,”
Water Research, vol. 43, no. 3, pp. 661–668, 2009. [21] “CETESB—Companhia de Tecnologia de Saneamento Ambi-
ental,” 2013, Guia Técnico Ambiental Tintas e Vernizes—
[7] L.-A. Lu, Y.-S. Ma, M. Kumar, and J.-G. Lin, “Photo-Fenton Sério P+L., http://www.cetesb.sp.gov.br/tecnologia/producao
pretreatment of carbofuran—analyses via experimental design, limpa/documentos/tintas.pdf.
detoxification and biodegradability enhancement,” Separation
and Purification Technology, vol. 81, no. 3, pp. 325–331, 2011. [22] R. F. P. Nogueira, A. G. Trovó, and W. C. Paterlini, “Evaluation
of the combined solar TiO2 /photo-Fenton process using mul-
[8] B. Lopez-Alvarez, R. A. Torres-Palma, F. Ferraro, and G. tivariate analysis,” Water Science and Technology, vol. 49, no. 4,
Penuela, “Solar photo-Fenton treatment of carbofuran: analysis pp. 195–200, 2004.
of mineralization, toxicity, and organic by-products,” Journal of
[23] R. F. Pupo Nogueira and J. R. Guimarães, “Photodegradation
Environmental Science and Health A, vol. 47, no. 13, pp. 2141–
of dichloroacetic acid and 2,4-dichlorophenol by ferrioxal-
2150, 2012.
ate/H2 O2 system,” Water Research, vol. 34, no. 3, pp. 895–901,
[9] A. Machulek Jr, F. H. Quina, F. Gozzi, V. O. Silva, L. C. 2000.
Friedrich, and J. E. F. Moraes, “Fundamental mechanistic [24] J. J. Pignatello, “Dark and photoassisted Fe3+ -catalyzed degra-
studies of the photo-Fenton reaction for the degradation of dation of chlorophenoxy herbicides by hydrogen peroxide,”
organic pollutants,” in Organic Pollutants Ten Years after the Environmental Science and Technology, vol. 26, no. 5, pp. 944–
Stockholm Convention—Environmental and Analytical Update, 951, 1992.
pp. 271–292, InTech, Rijeka, Croatia, 2012.
[25] APHA/AWWA/WEF, Standard Methods for the Examination of
[10] A. E. D. H. Machado, T. P. Xavier, D. R. De Souza et al., “Solar Water and wasteWater, American Public Health Association,
photo-fenton treatment of chip board production waste water,” New York, NY, USA, 12th edition, 1998.
Solar Energy, vol. 77, no. 5, pp. 583–589, 2004. [26] R. F. P. Nogueira, M. C. Oliveira, and W. C. Paterlini, “Simple
[11] C. Sattler, L. de Oliveira, M. Tzschirner, and A. E. H. Machado, and fast spectrophotometric determination of H2 O2 in photo-
“Solar photocatalytic water detoxification of paper mill efflu- Fenton reactions using metavanadate,” Talanta, vol. 66, no. 1, pp.
ents,” Energy, vol. 29, no. 5-6, pp. 835–843, 2004. 86–91, 2005.
[27] A. G. Trovó, T. F. S. Silva, O. Gomes Jr. et al., “Degradation

of caffeine by photo-Fenton process: optimization of treatment
conditions using experimental design,” Chemosphere, vol. 90,
no. 2, pp. 170–175, 2013.
[28] A. G. Trovó and R. F. P. Nogueira, “Diclofenac abatement using
modified solar photo-Fenton process with ammonium iron(III)
citrate,” Journal of the Brazilian Chemical Society, vol. 22, no. 6,
pp. 1033–1039, 2011.
[29] S. A. S. Melo, A. G. Trovó, I. R. Bautitz, and R. F. P. Nogueira,
“Degradation of residual pharmaceuticals by advanced oxida-
tion processes,” Quimica Nova, vol. 32, no. 1, pp. 188–197, 2009.
[30] C. Jiang, S. Pang, F. Ouyang, J. Ma, and J. Jiang, “A new insight
into Fenton and Fenton-like processes for water treatment,”
Journal of Hazardous Materials, vol. 174, no. 1–3, pp. 813–817,
2010.
[31] J. De Laat and H. Gallard, “Catalytic decomposition of hydro-
gen peroxide by Fe(III) in homogeneous aqueous solution:
mechanism and kinetic modeling,” Environmental Science and
[32] R. F. Pupo Nogueira, A. G. Trovó, M. R. A. Da Silva, R. D.
Villa, and M. C. De Oliveira, “Fundaments and environmental
applications of Fenton and photo-Fenton processes,” Quimica
Nova, vol. 30, no. 2, pp. 400–408, 2007.
[33] A. G. Trovó, O. Gomes Jr., A. E. H. Machado, W. Borges
Neto, and J. O. Silva, “Degradation of the herbicide paraquat
by photo-Fenton process: optimization by experimental design
and toxicity assessment,” Journal of the Brazilian Chemical
Society, vol. 24, no. 1, pp. 76–84, 2013.
[34] A. G. Trovó, R. F. P. Nogueira, A. Agüera, A. R. Fernandez-
Alba, and S. Malato, “Paracetamol degradation intermediates
and toxicity during photo-Fenton treatment using different iron
species,” Water Research, vol. 46, no. 16, pp. 5374–5380, 2012.
[35] W. Gernjak, T. Krutzler, A. Glaser et al., “Photo-fenton treat-
ment of water containing natural phenolic pollutants,” Chemo-
sphere, vol. 50, no. 1, pp. 71–78, 2003.
[36] S. Malato, P. Fernández-Ibáñez, M. I. Maldonado, J. Blanco,
and W. Gernjak, “Decontamination and disinfection of water
by solar photocatalysis: recent overview and trends,” Catalysis
Today, vol. 147, no. 1, pp. 1–59, 2009.
[37] A. G. Trovó, R. F. P. Nogueira, A. Agüera, A. R. Fernandez-Alba,
C. Sirtori, and S. Malato, “Degradation of sulfamethoxazole
in water by solar photo-Fenton. Chemical and toxicological
evaluation,” Water Research, vol. 43, no. 16, pp. 3922–3931, 2009.
[38] A. G. Trovó, R. F. Pupo Nogueira, A. Agüera, A. R. Fernandez-
Alba, and S. Malato, “Degradation of the antibiotic amoxicillin
by photo-Fenton process—chemical and toxicological assess-
ment,” Water Research, vol. 45, no. 3, pp. 1394–1402, 2011.
[39] E. M. R. Rocha, V. J. P. Vilar, A. Fonseca, I. Saraiva, and R. A. R.
Boaventura, “Landfill leachate treatment by solar-driven AOPs,”
Solar Energy, vol. 85, no. 1, pp. 46–56, 2011.
[40] S. M. Rodrı́guez, J. B. Gálvez, M. I. M. Rubio et al., “Engineering
of solar photocatalytic collectors,” Solar Energy, vol. 77, no. 5, pp.
513–524, 2004.
http://dx.doi.org/10.1155/2013/172010
Research Article
Power Generation Enhancement by Utilizing Plant
Photosynthate in Microbial Fuel Cell Coupled Constructed
Wetland System
Shentan Liu,1 Hailiang Song,1 Xianning Li,1 and Fei Yang2

1
School of Energy and Environment, Southeast University, Nanjing 210096, China
2
School of Public Health, Southeast University, Nanjing 210096, China
Correspondence should be addressed to Xianning Li; lxn@seu.edu.cn
Received 27 June 2013; Accepted 31 August 2013
Copyright © 2013 Shentan Liu et al. This is an open access article distributed under the Creative Commons Attribution License,
In the present study, a new technology that coupled constructed wetland (CW) with microbial fuel cell (MFC) (CW-MFC) was
developed to convert solar energy into electricity on the principles of photosynthetic MFC by utilizing root exudates of Ipomoea
aquatica as part of fuel. The maximum power density of 12.42 mW m−2 produced from the CW-MFC planted with Ipomoea aquatica
was 142% higher than that of 5.13 mW m−2 obtained from the unplanted CW-MFC. The maximum power output for the planted
CW-MFC could be divided into two parts: the maximum power yield from COD𝑅 in the water body was 66.05 KJ Kg−1 COD𝑅 , and
the maximum power transformation from plant photosynthesis was 2.31 GJ ha−1 year−1 . The average COD removal efficiencies were
92.1% and 94.8% in the unplanted CW-MFC and planted CW-MFC, respectively; the average TN removal efficiencies amounted to
54.4% and 90.8% in the unplanted CW-MFC and planted CW-MFC. This research demonstrates that planting Ipomoea aquatica in
the CW-MFC achieved a higher power density and nutrient removal of nitrogen simultaneously.
1. Introduction some photosynthetic bacteria. The photosynthetic MFC can

produce electricity without the external input of exogenous
A microbial fuel cell (MFC) is a bioelectrochemical system organics or nutrients, but it is often restricted by sunlight and
making use of biocatalyst for converting chemical energy into its power density is still too low for practical applications.
electricity, and it has been considered as one of the promis-
Wetland treatment of wastewater has been widely prac-
ing and sustainable technologies for power generation as
ticed in several countries for many years due to its easy
well as waste management [1–3]; especially, in the past
maintenance, low cost, and good self-purification capacity;
decade, there has been a remarkable promotion of MFC
moreover, it provides great quantities of biomass production
performance through a large variety of methods, including
advancement of fuel cell configuration [4, 5], selection and by photosynthesis [16]. A well-designed microbial fuel cell
modification of electrode material [6–8], and adoption of inside a constructed wetland system may combine the advan-
cheap proton exchange membrane with high conductivity tages of the photosynthesis of wetland plants and electricity
efficiency [9, 10]. Besides, novel technologies in generating generation of electroactive microorganisms to transform
power by integrating photosynthesis with microbial fuel cells solar energy into electricity. The first lab-scale CW-MFC was
(photosynthetic MFC) have been researched and significant designed and operated to evaluate the effect of configuration
progress has been made [11–14]. The photosynthetic MFC on power production [17], and it also showed good wastew-
operates to generate sufficient electric current from sunlight ater treatment effect with simultaneous power generation.
with either electrocatalysts or heterotrophic bacteria on the As the constructed wetland has the ability of degradation
anode to convert photosynthetic products indirectly [15], and of refractory organic matter, the CW-MFC system had great
the photosynthesis could be carried out by plants, algae, or advantages in treating dye containing wastewater [18].
The concept of CW-MFC is based on constructed wetland

and plant MFC (one form of photosynthetic MFC), of which
all contain plants. The role of plants is important in the
CW-MFC system, including their role in excreting oxygen
and organic matter into the rhizosphere [19], supporting
a wide range of microbes and providing a surface for
bacterial attachment [20]. These unique characteristics may
make the CW-MFC system an ideal approach to generate
electricity at sites and reduce globing warming as they can
decrease methane emissions. However, the effect of plant
photosynthesis and plant rhizosphere microorganisms on the Effluent
power enhancement for the CW-MFC has not been studied
fully yet. Load
GAC/cathode
In this study, we built a single-chamber, membrane-
free, continuously feeding upflow microbial fuel cell coupled
with constructed wetland, in which the cathode is located Gravel
in overlying water to use oxygen from air for reduction
reactions, and the anode is submerged in a support matrix
near the rhizosphere to obtain organic substrates in the GAC/anode
influent or deprived from wetland plants root as fuel. The aim
of this study was to evaluate whether or not the wetland plant
(Ipomoea aquatica) can improve power generation in a CW-
MFC system and to explore the bacterial population in the
electrode biofilm in response to MFC performance. Mean-
while, investigations of the removal efficiencies of chemical
oxygen demand (COD) and total nitrogen (TN) were carried Water distribution
out.
2. Experimental Influent
2.1. CW-MFC Construction. As schematically shown in

Figure 1, two CW-MFC reactors were constructed in the Figure 1: Schematic of the CW-MFCs used in the experiment.
same way using a polycarbonate plastic cylinder (30 cm in
diameter and 50 cm in height). The bottom 20 cm was support
matrix composed of gravel (gravel diameter 3–6 mm), and rate of 4.31 mL min−1 corresponding to a hydraulic reten-
then upwards it consisted of anode, support matrix (20 cm tion time (HRT) of 2 d. The feed solution consisted
gravel), and cathode. The anode was constructed from 10 cm of 50 mM phosphate buffer solution (PBS) with pH 7.4,
thick granular activated carbon (GAC, a diameter of 3–5 mm, glucose (0.20 g L−1 ), NH4 Cl (0.15 g L−1 ), KCl (0.13 g L−1 ),
the specific area of 500–900 m2 g−1 and the filling density NaHCO3 (3.13 g L−1 ), and 1 mL L−1 trace essential ele-
of 0.45–0.55 g cm−3 ). GAC was pretreated by soaking in 1 M ments solution (contained per liter: 5.6 g (NH4 )2 SO4 , 2 g
NaOH and 1 M HCl to eliminate possible oil stain and metal MgSO4 ⋅7H2 O, 200 mg MnSO4 ⋅H2 O, 3 mg H3 BO3 , 2.4 mg
ion contamination, respectively. The cathode was made from CoCl2 ⋅6H2 O, 1 mg CuCl2 ⋅2H2 O, 2 mg NiCl2 ⋅6H2 O, 5 mg
stainless steel mesh (a diameter of 25 cm, thickness of 0.3 cm, ZnCl2 , 10 mg FeCl3 ⋅6H2 O, and 0.4 mg Na2 MoO4 ⋅2H2 O). All
12 mesh) buried in 2 cm thick layer of activated carbon experiments were carried out in a 12:12-h light/dark cycle at
particle. The electrode spacing was 25 cm (center of the anode 26 ± 2∘ C under greenhouse conditions. The ambient light
to the face of the cathode). Electrodes were connected to a was provided by artificial illumination using (light-emitting
circuit using titanium wires across an external resistance of diode LED) Grow Lights (14 W, GC-ZW225S-P, Gechuang
1000 Ω, and epoxy was used to seal metals exposed to the Electronics Co., Ltd, Shenzhen, China), and the average light
solution. Nine adult plants of Ipomoea aquatica were planted intensity was 1000 lux during the light phase.
through the upper layer of one CW-MFC device (planting
density about 32 plants m−2 ), and the other CW-MFC was 2.3. Fluorescent In Situ Hybridization (FISH). FISH analysis
a control with no plants. The volume of the whole container was applied to investigate the quantity of microorganisms
was 35.3 L with a total liquid volume of 12.4 L. on the anode and cathode in our study. Granular activated
carbon with attached biofilm (wet weight of 0.5 g) was mul-
2.2. CW-MFC Operation. The CW-MFCs were inoculated tisampled (parallel samples) and suspended in 5 mL sterile
with the anaerobic sludge from a wastewater treatment deionized water, and microorganism cells were detached
plant located in Jiangning Development Zone (Nanjing, from the GAC and uniformly dispersed in the solution with
China) and operated by continuous feeding at a flow ultra-sonic oscillations treatment. About 0.5 mL supernatant
Table 1: Probe name and probe sequence used for FISH analysis.
Probe Target microflora Probe sequence References

EUB338 Bacteria GCTGCCTCCCGTAGGAGT [21, 22]
GEO2 Geobacter sulfurreducens GAAGACAGGAGGCCCGAAA [23]
HGEO2-1 Helper probes for GEO2 GTCCCCCCCTTTTCCCGCAAGA [23]
HGEO2-2 Helper probes for GEO2 CTAATGGTACGCGGACTCATCC [23]
BET42a Betaproteobacteria GCCTTCCCACTTCGTTT [24]
after ultrasonic oscillations was shifted and suspended in 𝐸𝑅 is a steep potential rise when the current is interrupted,
phosphate-buffered saline solution (PBS, pH 7.4) consisting and 𝐸OCV is the open circuit voltage:
of 8 g L−1 NaCl, 0.2 g L−1 KCl, 1.44 g L−1 Na2 HPO4 , and
𝐸
0.24 g L−1 K2 HPO4 in distilled water. Then the samples were 𝑖= , (2)
fixed with 4% paraformaldehyde (in PBS) at 4∘ C for 24 h. The 𝑅
fixed samples were washed twice with PBS, and suspended in 𝐸2
a solution of 50% PBS, and 50% ethanol and stored at −20∘ C. 𝑃= , (3)
𝑅𝐴
For FISH, 10 𝜇L of the fixed sample was applied on a glass
slide dried for 2 h at 37∘ C and subsequently dehydrated with 𝐸𝑅 (𝐸OCV − 𝐸) 𝑅
𝑅Ω = = . (4)
ethanol at 50, 80, and 96% (v/v, in 10 mM Tris-HCl, pH 7.5) 𝑖 𝐸
during 3 min at each concentration. To start hybridization,
Chemical oxygen demand (COD), ammonia nitrogen
24 𝜇L of hybridization buffer and 1 𝜇L of fluorescently labeled
(NH4 + -N), nitrite nitrogen (NO2 − -N), and nitrate nitrogen
probe (50 ng mL−1 ) were added. The hybridization was con- (NO3 − -N) were performed in accordance with the Standard
ducted for 5 h at 46∘ C in a humidified chamber. Slides were Methods of American Public Health Association (APHA,
then washed in a buffer solution (60 mM NaCl, 20 mM Tris- 1998), and all the samples for chemical analysis were filtered
HCl, pH 8.0, 0.1% SDS) at 45∘ C for 20 min. through a 0.45 𝜇m pore diameter syringe filter to remove
In the FISH procedure, target microflora and oligonu- particles. Total nitrogen (TN) concentration was calculated
cleotide probes used were shown in Table 1. Hereinto, Geo- as the sum of NH4 + -N, NO2 − -N, and NO3 − -N. Dissolved
bacter sulfurreducens and Betaproteobacteria have been evalu- oxygen (DO) concentration was measured in situ by the DO
ated for the potential for current production. Microscopy was probe (ORION 3 STAR, Thermo Co., USA). All measure-
performed on an Olympus BX50 microscope, equipped with ments were made at least three times and the average values
filters HQ-CY3 (Analysentechnik AG, Tübingen, Germany). with standard deviations are presented in the figures.
The bacterial number on each image was counted, and Specific power yield (SPY) was obtained by dividing
then the bacterial density (𝐷𝑏 ) of each biofilm cathode was power generated (𝑃𝑉, volume power density) with the sub-
calculated from the following equation: strate (COD) removed as shown in (5) [26], where 𝑉 is the
1000𝑁𝑆1 total liquid volume of the CW-MFC, CODin the influent COD
𝐷𝑏 = , (1) and CODout the effluent COD. The power yield (PY) was
𝑀𝑆2
calculated as shown in (6), and it implicates the power output
where 𝑆1 , 𝑆2 , and 𝑀 represent the coating area, the image per kilogram of organic substrate (COD𝑅 ) in the water body:
area, and the sample weight (g), respectively, and 𝑁 is the
average bacterial number on each image (cells). All cell 𝑃𝑉 𝐸2
SPY = = , (5)
density data shown in this paper were statistical average COD𝑅 (CODin − CODout ) 𝑅𝑉
values.
PY = SPY × HRT. (6)
2.4. Measurement and Analysis. The cell voltage was recorded
every 30 min by a data acquisition system (USB120816, 3. Results
Hytek Automation, Inc., Shanghai, China). The cell potentials
were measured against a saturated Ag/AgCl (S) electrode. 3.1. Power Output. The two CW-MFCs were operated for
Polarization curves were obtained in the daytime (high peak more than 1 month to obtain a stable performance before
voltage) by varying the external resistor over a range from 5 Ω the determination of cell voltage. Figure 2(a) shows voltage
to 105 Ω (105 , 4000, 3000, 2000, 1000, 800, 600, 400, 200, 100, outputs from the planted CW-MFC and unplanted CW-MFC
75, 50, 25, 10, and 5 Ω) to monitor the output voltage. The electricity-generating systems from May 3 to June 10. At the
current (𝑖) was calculated from Ohm’s law as shown in (2), initial stage (1–8 days), the trough voltages of the planted
and the power density (𝑃, area power density) was calculated CW-MFC (0.51–0.53 V) were close to the mean voltage of
as shown in (3), where 𝐸 is the voltage, 𝑅 is the external the unplanted CW-MFC (0.50 V). As Ipomoea aquatica was
resistance, and 𝐴 is the anode area. The ohmic resistance (𝑅Ω ) adapted to the experimental environment, the peak and
of each system was determined using the current interrupt trough voltages of the planted CW-MFC increased gradually
technique [25], and 𝑅Ω was calculated as shown in (4). (8–26 days) and remained stable (26–40 days).
0.8 0.8
0.7 0.7
Cell voltage (V)

Cell voltage (V)
0.6 0.6
0.5 0.5
0.4 0.4
0.3 0.3
0.2 0.2
0.1 0.1
0 0
0 4 8 12 16 20 24 28 32 36 40 0 12 24 36 48 60 72 84 96 108 120
Time (days) Time (hours)
Planted Planted
Unplanted Unplanted
(a) (b)
Figure 2: Continuous records of voltage with a fixed external load of 1000 Ω for the planted CW-MFC and unplanted CW-MFC. (a) A daily
record of voltages at 0:00 (night through time) and 12:00 (day peak time) from May 3 to June 10; (b) half-hourly records of voltages from June
12 to June 16.
As shown in Figure 2(b), the voltage for the planted CW- 0.9 18
MFC was characterized by diurnal oscillations with clear 0.8 16
fluctuations, but no such circadian oscillation was observed
for the unplanted CW-MFC. As temperatures were relatively 0.7 14
Power density (mW m−2 )

stable throughout the experiments, the observation implied 0.6 12
Cell voltage (V)
that the cyclical fluctuation of voltage for the planted CW-

0.5 10
MFC was closely related to the sunlight. From June 12 to June
16, the electric output was stable, and the average voltages 0.4 8
in the planted CW-MFC and unplanted CW-MFC were 0.64 6
0.3
and 0.49 V, respectively. Therefore, it was calculated that
the average power outputs for the planted CW-MFC and 0.2 4
unplanted CW-MFC were 0.129 and 0.076 GJ ha−1 year−1 , 0.1 2
respectively. Taking into account the consistency of the
0 0
influent condition and the culture environment in the two 0 1 2 3 4 5
CW-MFCs, the power output about 0.053 GJ ha−1 year−1 was Current (mA)
generated from plant photosynthetic products in the planted
CW-MFC. V planted P planted
V unplanted P unplanted
3.2. Fuel Cell Behavior. The performance of the planted CW-
Figure 3: Polarization curves of the planted CW-MFC and
MFC was depicted and compared with the unplanted CW-
unplanted CW-MFC (solid symbols for the cell voltage and open
MFC in terms of power density curves and polarization symbols for the power density).
curves. It can be seen from Figure 3 that planting Ipomoea
aquatica in CW-MFC effectively enhanced the electricity
generation. The open circuit voltages of the planted CW-MFC
and unplanted CW-MFC were 0.74 and 0.62 V, respectively,
and the maximum power density of the planted CW-MFC CW-MFC (202 mV) (Figure 4(a)), and the average anode
was 12.42 mW m−2 , 2-folds more than that of the unplanted potential (−341 mV) of the planted CW-MFC was lower than
CW-MFC (5.13 mW m−2 ). Maximum power outputs of the that of the unplanted CW-MFC (−288 mV) (Figure 4(b)).
planted CW-MFC and unplanted CW-MFC were 3.92 and As shown in Figure 4(a), the average bacteria density in
1.61 GJ ha−1 year−1 , respectively. According to (3), the internal cathodic biofilms of the planted CW-MFC (3.85 ± 0.61 × 107
resistances of the planted CW-MFC and unplanted CW-MFC cells g−1 ) was higher than that of the unplanted CW-MFC
were 156 and 256 Ω, respectively. (2.43 ± 0.40 × 107 cells g−1 ). From Figure 4(b), it was clearly
observed that cell densities of bacteria, G. sulfurreducens,
3.3. Relation of Electrode Potentials and Cell Density on the and Betaproteobacteria in anodic biofilms of the planted
Electrode. It was demonstrated that the catalytic activity of CW-MFC (8.66 ± 1.01 × 107 cells g−1 , 1.22 ± 0.18 × 107
the electrode positively correlates with biomass [27]. To cells g−1 , and 0.91 ± 0.13 × 107 cells g−1 ) were also higher
verify the hypothetical inference, electrode potentials and cell than that of the unplanted CW-MFC (5.13 ± 0.86 × 107
densities in various GAC electrodes zone were determined cells g−1 , 0.67 ± 0.11 × 107 cells g−1 , and 0.48 ± 0.09 × 107
(Figure 4). The average cathode potential (299 mV) of the cells g−1 ). The results indicated that the cathode potential
planted CW-MFC was higher than that of the unplanted showed a positive correlation with the microbial amount,
10 10 0
0.4
8 8 −0.1
Cell density (107 cell g−1 )

Cell density (107 cell g−1 )
0.3
Potential (V)
6
Potential (V)
6
−0.2
0.2
4 4
−0.3
2 0.1 2
−0.4
0 0 0
CW-MFC Unplanted CW-MFC CW-MFC Unplanted CW-MFC
Different reactors Different reactors
Bacteria Bacteria 𝛽-proteobacteria

Cathode potential G. sulfurreducens Anode potential
(a) (b)
Figure 4: Electrode potential and cell density in electrodes zone for the planted CW-MFC and unplanted CW-MFC: (a) cathode zone and
(b) anode zone.
but a negative correlation between the anode potential and 7

microbial amount was observed.
Anode Rhizosphere
6
3.4. Waste Treatment. Throughout the experimental stage, 5

the influent chemical oxygen demand (COD) and total
nitrogen (TN) reached to the ranges of 193–205 mg L−1 and
DO (mg L−1 )
4
31–39 mg L−1 , respectively. More or less, the same COD
removal efficiency (planted CW-MFC, 94.8%; unplanted 3
CW-MFC, 92.1%) was noticed with both the CW-
MFCs, but SPY (planted CW-MFC, 0.178 W Kg−1 COD𝑅 ; 2
unplanted CW-MFC, 0.107 W Kg−1 COD𝑅 ) and PY (planted
CW-MFC, 30.67 KJ Kg−1 COD𝑅 ; unplanted CW-MFC, 1
18.51 KJ Kg−1 COD𝑅 ) showed that the CW-MFC planted
with Ipomoea aquatica had higher power productivity 0
0 10 20 30 40 50
efficiency. Unlike the COD removal efficiency, a great Reactor height (cm)
difference in the TN removal efficiency (planted CW-MFC,
90.8%; unplanted CW-MFC, 54.4%) was observed. Planted
In order to ascertain the reason for the difference of TN Unplanted
removal efficiencies between the CW-MFCs, the concentra-
Figure 5: The change of DO in the planted CW-MFC and unplanted
tion of DO and various forms of nitrogen along the reactor
CW-MFC.
height were investigated in the day time. DO had a “V”
type change in both the planted CW-MFC and unplanted
CW-MFC (Figure 5). The concentration of DO decreased
gradually with the increasement of reactor height till it the highest DO of 4.56 mg L−1 and 3.79 mg L−1 , respectively,
reached 30 cm due to the consumption of O2 , and then it for the planted CW-MFC and unplanted CW-MFC. Further-
increased with the increasement of reactor height because more, diurnal variation of DO in cathode zone for the planted
of the reoxygenation. The lowest concentrations of DO were CW-MFC was higher (4.31 ± 0.18 mg L−1 ) in the day and
in the anode zone, and they were 0.15–0.38 mg L−1 and lower (3.85 ± 0.14 mg L−1 ) at night.
0.11–0.31 mg L−1 for the planted CW-MFC and unplanted Figures 6 and 7 present the change curves of different
CW-MFC, respectively. The maximum differentiation of DO forms of nitrogen in the planted CW-MFC and unplanted
occurred at height of 40 cm, and the concentrations of CW-MFC, respectively, over a period of 13 days. The con-
DO were 3.10 mg L−1 and 1.37 mg L−1 for the planted CW- centration of TN and NH4 + -N declined continuously with
MFC and unplanted CW-MFC, respectively. The effluent had water flows in both the two CW-MFCs. TN concentrations
40 respectively. In the planted CW-MFC, there were two sharp

descending regions for NH4 + -N removal: NH4 + -N decreased
35 Anode Rhizosphere
from 35.00 mg L−1 to 26.30 mg L−1 at the bottom of 0–10 cm
30 and from 19.80 mg L−1 to 4.30 mg L−1 at the top of 30–
40 cm. However, in the unplanted CW-MFC, NH4 + -N only
Concentration (mg L−1 )
25 decreased sharply from 35.00 mg L−1 to 25.60 mg L−1 at the

bottom of 0–10 cm, and then it began to descend smoothly.
20
In the planted CW-MFC, the accumulated NO2 − -N con-
15 centration gradually increased from 0 mg L−1 in the influent
to the maximal 6.30 mg L−1 at height of 10 cm, but it decreased
10 slowly to 0.70 mg L−1 in the effluent. The same change rules
of NO2 − -N were observed in the unplanted CW-MFC, but
5
the concentration of NO2 − -N in the effluent was slightly
0 higher about 1.56 mg L−1 . The change of NO3 − -N can be
0 10 20 30 40 50 divided into four stages in the planted CW-MFC, taking on
Reactor height (cm) the trend of rising first, dropping, then rising and dropping,
TN NO3 − -N namely, two inverse “V” type curves, and the maximal
NH3 -N NO2 − -N NO3 − -N concentrations were 3.5 mg L−1 and 5.7 mg L−1 at
the height of 20 cm and 40 cm, respectively. However, only a
Figure 6: The change of different forms of nitrogen in the planted flush of NO3 − -N concentration from 0 mg L−1 to 3.70 mg L−1
CW-MFC. was observed in the bottom region in the unplanted CW-
MFC, and then the concentration gradually decreased to
40 1.70 mg L−1 at the height of 30 cm, and it changed little in the
Anode top region.
35 Under aerobic conditions, NH4 + -N could be oxidated to
NO2 − -N and NO3 − -N by nitrococcus and nitrobacteria, and
30
the increase in NO𝑥 − -N concentration (sum of NO2 − -N and
Concentration (mg L−1 )
25 NO3 − -N) and the decrease in the NH4 + -N concentration

were significantly correlated with DO in the bottom region
20 both in the two CW-MFCs (𝑃 < 0.01). But the increase
in NO𝑥 − -N concentration and the decrease in the NH4 + -N
15 concentration at height of 30–40 cm in the planted CW-MFC
were generally correlated with DO (𝑃 < 0.05).
10
5 4. Discussion
0 4.1. Comparison of Power Output of the Planted CW-MFC and
0 10 20 30 40 50
Reactor height (cm)
Unplanted CW-MFC. When Ipomoea aquatica was planted
in CW-MFC, the bacteria density in anode and cathode
TN NO3 − -N both increased, cathode potential became larger, and anode
+
NH4 -N NO2 − -N potential become more negative (Figure 4), thus generating
more power. Here, the grown Ipomoea aquatica is generally
Figure 7: The change of different forms of nitrogen in the unplanted very important feature because it can improve the catalytic
CW-MFC. activity of anode and cathode mainly due to the enhancement
of the microbial density, activity, and diversity in the plant’s
rhizosphere [28]. Furthermore, root exudates that comprise
decreased drastically from 35.00 mg L−1 to 3.22 mg L−1 in carbohydrates, carboxylic acids, and amino acids are highly
the planted CW-MFC, but there was a less decrease from degradable to microorganisms and the most responsible for
35.00 mg L−1 to 15.96 mg L−1 in the unplanted CW-MFC. electron donation [29]. In addition, the internal resistance
Comparing the change curve of TN for the two CW-MFCs, of the planted CW-MFC accounted for only 61% of the
there were similarities that TN removal was less in the unplanted CW-MFC, and the cause of such difference may
bottom region (0–20 cm) and more in the central region (20– lie in the quantity of current-producing bacteria (such as
30 cm), but there was a great difference in the top region G. sulfurreducens and Betaproteobacteria), which are able to
(30–50 cm) that TN removal in the planted CW-MFC (from generate electrically conductive pili or nanowires that assist
22.50 mg L−1 to 3.22 mg L−1 ) was much higher than that in the microorganism in reaching more distant electrodes. The
the unplanted CW-MFC (from 21.70 mg L−1 to 15.96 mg L−1 ). power densities in the two CW-MFCs were consistent with
The removal efficiencies of NH4 + -N for the planted CW- the change of the internal resistances. It is generally known
MFC and unplanted CW-MFC were 96.51% and 64.86%, that the maximum power output occurs when the internal
H2 O O2
Cathode
NO3 − N2
Bacteria
O2
(CH2 O)n
CO 2
NH4 +
NO2 −
NO3 − Anode
CO2 C6 H12 O6
Figure 8: The principal reactions for the overall process of the CW-MFC. (1) Plant roots secrete O2 and (CH2 O)𝑛 . (2) Electrons are produced
at the anode from the anaerobic degradation of (CH2 O)𝑛 and C6 H12 O6 . (3) NH4 + was converted to NO3 − by Nitrifying bacterias in the
rhizosphere. (4) O2 and NO3 − were electron acceptors at the cathode.
resistance is equal to external resistance [25]; thus, the the ammonia oxidizing bacteria and nitrite oxidizing [38],
decrease in internal resistance is one reason for the improve- whereas the produced NO3 − (𝐸󸀠𝜃 NO3 /N2 = 0.74 V) could be
ment in power generation performance for the planted CW- used as the final electron acceptor in the cathode (Figure 8).
MFC. The improvement in power generation for the planted Although the electric production of MFC with nitrate as
CW-MFC resulted from three different factors: increased electron acceptor is inferior to other types of MFC (e.g., O2 as
biomass in anode and cathode, a decrease in the internal the electron acceptor), realizing the biological denitrification
resistance, and more available fuel secreted from plant in the cathode is crucial and significant for the total nitrogen
roots. removal in the CW-MFC system.
4.2. High Nitrogen Removal in the Planted CW-MFC. The 4.3. Comparison of the Planted CW-MFC with Similar Pub-
removal of nitrogen (including nitrate, nitrite, and ammonia) lished MFCs. Because of the alternating phases of light and
in MFC has been reported in recent years. In a MFC, nitrate dark, the electric output generated from plant photosynthetic
and nitrite can be removed as electron acceptors in the products may show diurnal oscillations with clear fluctu-
cathode through electrochemical reduction or autotrophic ations between the trough and the peak values [39, 40].
denitrification [30–32]. A high level of ammonia removal Similarly, in this study, the voltage outputs of the planted CW-
from 198 ± 1 to 34 ± 1 mg L−1 (83% removal) was obtained MFC were cyclically fluctuant depended on the day/night
from swine wastewater in a single-chamber air cathode MFC cycle. In the planted CW-MFC system, the fuel source
system [33]. However, subsequent research demonstrated consisted of glucose fed from waste water and a certain
that the removal of ammonia occurred primarily by physical- amount of organic compounds released by Ipomoea aquatica
chemical mechanisms due to ammonia volatilization with roots (Figure 8). Generally, the photosynthates produced
conversion of ammonium ion to the more volatile ammonia during the day may have led to increased exudates production
species as a result of an elevated pH near the cathode [34]. availability for the anode in the planted CW-MFC. When
In this study, effective TN removal efficiency obtained in the operated in the light, the CW-MFC could use photosynthates
planted CW-MFC might be attributed to Ipomoea aquatica and glucose as fuel generating more electricity. Moreover,
uptaking of NH4 + or NO3 − as their N source for growth and roots of Ipomoea aquatica (20 ± 2 cm length but most
yield [35]. In this experiment, the influent N was sufficient distributed in the upper part) released more oxygen in the day
and dominated by NH4 + . Many researches indicate that and created more suitable aerobic conditions in the cathode
aquatic plant roots can release oxygen (O2 ) in constructed zone, which induced the improvement of electric output. So
wetland [36, 37]; thus, the rhizosphere was aerated and the high peak voltages for the planted CW-MFC in the day
the nitrification process was promoted by microbial activity, were attributed to sufficient fuel available in the anode and
and the NH4 + was converted into NO3 − via NO2 − by favorable oxygen condition in the cathode.
The CW-MFC system can utilize the organic substrate The CW-MFC planted with Ipomoea aquatica produced a
in the influent and plant photosynthate as fuels, so its much higher power than that from unplanted CW-MFC,
power output could be divided into two parts: power yield because plant root can improve electrode activity and provide
from COD𝑅 in the water body and power transformation more organic compounds available for fuel. Moreover, the
from plant photosynthesis. In current study, the maximum root of aquatic plants could uptake ammonia nitrogen and
power output for the planted CW-MFC was 3.92 GJ ha−1 part of the pollutants to promote the degradation of con-
year−1 (12.42 mW m−2 ), the maximum power yield from taminants in the wastewater and reduce the greenhouse gas.
COD𝑅 in the water body was 66.05 KJ Kg−1 COD𝑅 , and the These results show that developing CW-MFC could provide
maximum power transformation from plant photosynthe- significant prospects for wastewater treatment and bioenergy
recovery. Further studies are necessary to investigate the
sis was 2.31 GJ ha−1 year−1 . A maximum power density of impact of CW-MFC on the rhizospheric environment and
15.73 mW m−2 for a CW-MFC system planted with canna aquatic plant physiology as well as the microbial community.
indica was achieved during the treatment of wastewater
containing 1000 mg L−1 methylene blue [18], and it was about
26% higher than that generated in this study. Our CW-MFC Acknowledgment
device is constructed with a large anodic geometric surface This work was financially supported by the National Natural
area about 706.50 cm2 , that is, 17 times higher than the CW- Science Foundation of China (Grant no. 21277024).
MFC planted with canna indica (40.93 cm2 ); moreover, the
substrate concentration (200 mg L−1 glucose) in the influ-
ent is relatively low in our CW-MFC, so these differences
References
may make the power density slightly less. Besides, many [1] B. E. Logan and J. M. Regan, “Electricity-producing bacterial
similar MFCs generated power from plant photosynthate communities in microbial fuel cells,” Trends in Microbiology,
have been reported, and the maximum power outputs vary vol. 14, no. 12, pp. 512–518, 2006.
in different systems, such as 1.89 GJ ha−1 year−1 of plant- [2] Z. Du, H. Li, and T. Gu, “A state of the art review on microbial
MFC in a rice paddy field [39], 4.55 GJ ha−1 year−1 of rice- fuel cells: a promising technology for wastewater treatment and
paddy MFC [41], 0.41 GJ ha−1 year−1 of sediment MFC with bioenergy,” Biotechnology Advances, vol. 25, no. 5, pp. 464–482,
2007.
a biocathode in the rice rhizosphere [19], 70.01 GJ ha−1 year−1
of plant MFC planted with Spartina anglica [42], 119.83 ± [3] D. R. Lovley, “The microbe electric: conversion of organic
matter to electricity,” Current Opinion in Biotechnology, vol. 19,
5.99 GJ ha−1 year−1 of Direct Photosynthetic Plant Fuel
no. 6, pp. 564–571, 2008.
Cell by using Lemna minuta duckweed [43], and 0.98 ±
[4] H. Liu, S. Cheng, L. Huang, and B. E. Logan, “Scale-up of
0.06 GJ ha−1 year−1 of vascular plant biophotovoltaics planted
membrane-free single-chamber microbial fuel cells,” Journal of
with Oryza sativa [40]. Through comparison and analysis Power Sources, vol. 179, no. 1, pp. 274–279, 2008.
for the previously reports, the power outputs were mainly
affected by plant species, plant area (anode surface area), and [5] J. R. Kim, G. C. Premier, F. R. Hawkes, R. M. Dinsdale, and A.
J. Guwy, “Development of a tubular microbial fuel cell (MFC)
internal resistance. As MFC tests have been demonstrated
employing a membrane electrode assembly cathode,” Journal of
that increasing the anode surface area resulted in a slight Power Sources, vol. 187, no. 2, pp. 393–399, 2009.
increase in volumetric power density [4], there would be a
[6] B. Logan, S. Cheng, V. Watson, and G. Estadt, “Graphite fiber
huge drop in area power density if the anode surface area
brush anodes for increased power production in air-cathode
were too large. Our device had relatively large anode surface microbial fuel cells,” Environmental Science and Technology, vol.
area (706.50 cm2 ) and high internal resistance (156 Ω), so the 41, no. 9, pp. 3341–3346, 2007.
power output was much lower than some of the plant MFCs [7] E. Martin, B. Tartakovsky, and O. Savadogo, “Cathode materials
(for instance, 119.83 ± 5.99 GJ ha−1 year−1 of Direct Photo- evaluation in microbial fuel cells: a comparison of carbon,
synthetic Plant Fuel Cell with anode area only 15.75 cm2 and Mn2 O3 , Fe2 O3 and platinum materials,” Electrochimica Acta,
interresistance 91 Ω). The current power generated by CW- vol. 58, no. 1, pp. 58–66, 2011.
MFC is not competitive; however, the CW-MFC technology [8] S. Ci, Z. Wen, J. Chen, and Z. He, “Decorating anode with
possesses potential advantages in removing contaminants in bamboo-like nitrogen-doped carbon nanotubes for microbial
wastewater and reducing greenhouse gas emission, which will fuel cells,” Electrochemistry Communications, vol. 14, no. 1, pp.
attract attention and may worth applying in the future. In this 71–74, 2012.
study, the CW-MFC system operating with cheap GAC anode [9] P. S. Jana, M. Behera, and M. M. Ghangrekar, “Performance
and cathode with no use of precious metals was low cos and comparison of up-flow microbial fuel cells fabricated using pro-
had large volume (35 L), so its application is more possible in ton exchange membrane and earthen cylinder,” International
the future. Journal of Hydrogen Energy, vol. 35, no. 11, pp. 5681–5686, 2010.
[10] M. Rahimnejad, M. Ghasemi, G. D. Najafpour et al., “Syn-
5. Conclusions thesis, characterization and application studies of self-made
Fe3 O4 /PES nanocomposite membranes in microbial fuel cell,”
Conversion of solar energy into electricity can be fulfilled Electrochimica Acta, vol. 85, pp. 700–706, 2012.
by coupling wetland plant photosynthesis with the microbial [11] Z. He, J. Kan, F. Mansfeld, L. T. Angenent, and K. H. Nealson,
conversion of organics to electricity in CW-MFC system. “Self-sustained phototrophic microbial fuel cells based on
the synergistic cooperation between photosynthetic microor- ferricyanide catholytes,” Electrochemistry Communications, vol.
ganisms and heterotrophic bacteria,” Environmental Science and 11, no. 2, pp. 371–375, 2009.
Technology, vol. 43, no. 5, pp. 1648–1654, 2009. [27] J. C. Wei, P. Liang, X. X. Cao, and X. Huang, “A new insight
[12] K. Nishio, K. Hashimoto, and K. Watanabe, “Light/electricity into potential regulation on growth and power generation of
conversion by a self-organized photosynthetic biofilm in a Geobacter sulfurreducens in microbial fuel cells based on energy
single-chamber reactor,” Applied Microbiology and Biotechnol- viewpoint,” Environmental Science and Technology, vol. 44, no.
ogy, vol. 86, no. 3, pp. 957–964, 2010. 8, pp. 3187–3191, 2010.
[13] R. A. Timmers, D. P. B. T. B. Strik, H. V. M. Hamelers, and C. J. N. [28] R. A. Timmers, M. Rothballer, D. P. B. T. B. Strik et al.,
Buisman, “Long-term performance of a plant microbial fuel cell “Microbial community structure elucidates performance of
with Spartina anglica,” Applied Microbiology and Biotechnology, Glyceria maxima plant microbial fuel cell,” Applied Microbiology
vol. 86, no. 3, pp. 973–981, 2010. and Biotechnology, vol. 94, no. 2, pp. 537–548, 2012.
[14] L. Xiao, E. B. Young, J. A. Berges, and Z. He, “Integrated [29] H. Deng, Z. Chen, and F. Zhao, “Energy from plants and
photo-bioelectrochemical system for contaminants removal microorganisms: progress in plant-microbial fuel cells,” Chem-
and bioenergy production,” Environmental Science and Technol- SusChem, vol. 5, no. 6, pp. 1006–1011, 2012.
ogy, vol. 46, no. 20, pp. 11459–11466, 2012. [30] C. Fang, B. Min, and I. Angelidaki, “Nitrate as an oxidant in
[15] M. Rosenbaum, Z. He, and L. T. Angenent, “Light energy the cathode chamber of a microbial fuel cell for both power
to bioelectricity: photosynthetic microbial fuel cells,” Current generation and nutrient removal purposes,” Applied Biochem-
Opinion in Biotechnology, vol. 21, no. 3, pp. 259–264, 2010. istry and Biotechnology, vol. 164, no. 4, pp. 464–474, 2011.
[16] M. P. Ciria, M. L. Solano, and P. Soriano, “Role of macro- [31] S. Puig, M. Serra, A. Vilar-Sanz et al., “Autotrophic nitrite
phyte Typha latifolia in a constructed wetland for wastewater removal in the cathode of microbial fuel cells,” Bioresource
treatment and assessment of its potential as a biomass fuel,” Technology, vol. 102, no. 6, pp. 4462–4467, 2011.
Biosystems Engineering, vol. 92, no. 4, pp. 535–544, 2005. [32] Y. Zhang and I. Angelidaki, “Bioelectrode-based approach for
[17] X. Li, H. Song, W. Xiang, and L. Wu, “Electricity generation enhancing nitrate and nitrite removal and electricity generation
during wastewater treatment by a microbial fuel cell coupled from eutrophic lakes,” Water Research, vol. 46, no. 19, pp. 6445–
with constructed wetland,” Journal of Southeast University, vol. 6453, 2012.
28, no. 2, pp. 175–178, 2012. [33] B. Min, J. Kim, S. Oh, J. M. Regan, and B. E. Logan, “Electricity
generation from swine wastewater using microbial fuel cells,”
[18] A. K. Yadav, P. Dash, A. Mohanty, R. Abbassi, and B. K. Mishra,
Water Research, vol. 39, no. 20, pp. 4961–4968, 2005.
“Performance assessment of innovative constructed wetland-
microbial fuel cell for electricity production and dye removal,” [34] J. R. Kim, Y. Zuo, J. M. Regan, and B. E. Logan, “Analysis
Ecological Engineering, vol. 47, no. 0, pp. 126–131, 2012. of ammonia loss mechanisms in microbial fuel cells treating
animal wastewater,” Biotechnology and Bioengineering, vol. 99,
[19] Z. Chen, Y. Huang, J. Liang, F. Zhao, and Y. Zhu, “A novel
no. 5, pp. 1120–1127, 2008.
sediment microbial fuel cell with a biocathode in the rice
rhizosphere,” Bioresource Technology, vol. 108, pp. 55–59, 2012. [35] X. Zhou, G. Wang, and F. Yang, “Characteristics of growth,
nutrient uptake, purification effect of Ipomoea aquatica, Lolium
[20] R. Wang, V. Baldy, C. Périssol, and N. Korboulewsky, “Influence multiflorum, and Sorghum sudanense grown under different
of plants on microbial activity in a vertical-downflow wetland nitrogen levels,” Desalination, vol. 273, no. 2-3, pp. 366–374,
system treating waste activated sludge with high organic matter 2011.
concentrations,” Journal of Environmental Management, vol. 95,
[36] F. Yao, G. Shen, X. Li, H. Li, H. Hu, and W. Ni, “A comparative
supplement, pp. S158–S164, 2012.
study on the potential of oxygen release by roots of selected
[21] G. Zhang, Q. Zhao, Y. Jiao et al., “Improved performance of wetland plants,” Physics and Chemistry of the Earth, vol. 36, no.
microbial fuel cell using combination biocathode of graphite 9–11, pp. 475–478, 2011.
fiber brush and graphite granules,” Journal of Power Sources, vol.
[37] C. Dong, W. Zhu, Y. Q. Zhao, and M. Gao, “Diurnal fluctuations
196, no. 15, pp. 6036–6041, 2011.
in root oxygen release rate and dissolved oxygen budget in
[22] G. Zhang, K. Wang, Q. Zhao, Y. Jiao, and D. Lee, “Effect of wetland mesocosm,” Desalination, vol. 272, no. 1–3, pp. 254–258,
cathode types on long-term performance and anode bacterial 2011.
communities in microbial fuel cells,” Bioresource Technology, [38] J. Wu, J. Zhang, W. Jia et al., “Impact of COD/N ratio on
vol. 118, pp. 249–256, 2012. nitrous oxide emission from microcosm wetlands and their per-
[23] H. Richter, M. Lanthier, K. P. Nevin, and D. R. Lovley, “Lack of formance in removing nitrogen from wastewater,” Bioresource
electricity production by Pelobacter carbinolicus indicates that Technology, vol. 100, no. 12, pp. 2910–2917, 2009.
the capacity for Fe(III) oxide reduction does not necessarily [39] N. Kaku, N. Yonezawa, Y. Kodama, and K. Watanabe,
confer electron transfer ability to fuel cell anodes,” Applied and “Plant/microbe cooperation for electricity generation in a rice
Environmental Microbiology, vol. 73, no. 16, pp. 5347–5353, 2007. paddy field,” Applied Microbiology and Biotechnology, vol. 79, no.
[24] W. Manz, R. Amann, W. Ludwig, M. Wagner, and K. Schleifer, 1, pp. 43–49, 2008.
“Phylogenetic oligodeoxynucleotide probes for the major sub- [40] P. Bombelli, D. Iyer, S. Covshoff et al., “Comparison of power
classes of proteobacteria: problems and solutions,” Systematic output by rice (Oryza sativa) and an associated weed (Echi-
and Applied Microbiology, vol. 15, no. 4, pp. 593–600, 1992. nochloa glabrescens) in vascular plant bio-photovoltaic (VP-
[25] B. E. Logan, B. Hamelers, R. Rozendal et al., “Microbial fuel BPV) systems,” Applied Microbiology and Biotechnology, vol. 97,
cells: methodology and technology,” Environmental Science and no. 1, pp. 429–438, 2013.
Technology, vol. 40, no. 17, pp. 5181–5192, 2006. [41] K. Takanezawa, K. Nishio, S. Kato, K. Hashimoto, and K.
[26] S. V. Raghavulu, S. V. Mohan, R. K. Goud, and P. N. Sarma, Watanabe, “Factors affecting electric output from rice-paddy
“Effect of anodic pH microenvironment on microbial fuel microbial fuel cells,” Bioscience, Biotechnology and Biochemistry,
cell (MFC) performance in concurrence with aerated and vol. 74, no. 6, pp. 1271–1273, 2010.
[42] M. Helder, D. P. B. T. B. Strik, H. V. M. Hamelers, A. J. Kuhn,

C. Blok, and C. J. N. Buisman, “Concurrent bio-electricity and
biomass production in three plant-microbial fuel cells using
Spartina anglica, Arundinella anomala and Arundo donax,”
Bioresource Technology, vol. 101, no. 10, pp. 3541–3547, 2010.
[43] Y. Hubenova and M. Mitov, “Conversion of solar energy into
electricity by using duckweed in direct photosynthetic plant fuel
cell,” Bioelectrochemistry, vol. 87, pp. 185–191, 2012.
http://dx.doi.org/10.1155/2013/206129
Research Article
Kinetics and Photodegradation Study of
Aqueous Methyl tert-Butyl Ether Using Zinc Oxide:
The Effect of Particle Size
Zaki S. Seddigi,1 Saleh A. Ahmed,1 Shahid P. Ansari,1 Ekram Danish,2

Abdullah Abu Alkibash,3 and Shakeel Ahmed4
1
Chemistry Department, College of Applied Sciences, Umm Al-Qura University, Makkah 21955, Saudi Arabia
2
Chemistry Department, College of Sciences, King Abdulaziz University, Jeddah 21589, Saudi Arabia
3
Chemistry Department, College of Sciences, King Fahd University of Petroleum & Minerals, Dhahran 31261, Saudi Arabia
4
Center for Refining & Petrochemicals, Research Institute, King Fahd University of Petroleum & Minerals, Dhahran 31261, Saudi Arabia
Correspondence should be addressed to Shahid P. Ansari; shahidzahir@gmail.com
Received 27 April 2013; Revised 24 July 2013; Accepted 25 August 2013
Copyright © 2013 Zaki S. Seddigi et al. This is an open access article distributed under the Creative Commons Attribution License,
Zinc oxide of different average particle sizes 25 nm, 59 nm, and 421 nm as applied in the photodegradation of MTBE. This study
was carried out in a batch photoreactor having a high pressure mercury lamp. Zinc oxide of particle size of 421 nm was found to
be the most effective in degrading MTBE in an aqueous solution. On using this type of ZnO in a solution of 100 ppm MTBE, the
concentration of MTBE has decreased to 5.1 ppm after a period of five hours. The kinetics of the photocatalytic degradation of
MTBE was found to be a first order reaction.
1. Introduction been found to be costly because carbon has to be changed

frequently [4]. Moreover, ethers are generally resistant to
Fuel oxygenates like methyl tert-butyl ether (MTBE) are usu- biodegradation because the presence of the bulky tertiary
ally added for the complete combustion of gasoline. MTBE methyl group renders MTBE nonbiodegradable by the tra-
has low vapor pressure, high octane rate, very good blending ditional methods [7–9].
compatibility with gasoline, and low production cost [1, 2]. Recently, advanced oxidation processes (AOPs) have
The speed of migration of MTBE resembles that of water been applied for the remediation of different contaminants
and it has high resistance to biodegradation [3, 4]. MTBE in water. Complete oxidation of organic pollutants into CO2
has been found to be a potential carcinogen; thus it poses and H2 O can be achieved by applying AOPs. The application
serious health threats. The presence of MTBE can be easily of AOPs in heterogeneous photocatalysis is highly promising
detected in water even at very low concentrations from its and good results have been obtained when this type of
characteristic smell which in turn lowers the quality of water. photocatalysis was applied to treat nonbiodegradable toxic
The serious hazardous effects of MTBE have attracted the organic molecules that exist in water [10, 11]. The heteroge-
attention of many researchers to develop efficient techniques neous photocatalytic reaction performed to degrade organic
that can be applied for the remediation/elimination of MTBE pollutants requires electromagnetic radiation of specific wave
from water [5, 6]. Those techniques include adsorption using length, a catalyst (i.e., semiconducting metal oxide), and
activated carbon, biodegradation, and air-stripping; however, oxygen. The photocatalyst usually plays a very important
the results obtained were not satisfactory. For instance, the role in carrying out the photochemical reaction. Being
removal of MTBE by adsorption on activated carbon has semiconductors in nature, photocatalysts have the tendency
been found to be ineffective because of the low adsorption of to promote their valence band electrons to conduction bands
MTBE on the activated carbon. The adsorption process has when they are subjected to an electromagnetic radiation of
appropriate energy. The photoexcited electrons create holes Teﬂon rod

when they jump to their corresponding conduction bands;
therefore, the electron-hole pairs are generated in the semi- Water supply
conducting metal oxide photocatalyst. These photogenerated
electrons/holes react with water/oxygen/hydroxyl ions to
produce OH∙ radicals. The resulting OH∙ radicals react with
the contaminant molecules adsorbed on the surface of the
photocatalyst and act through a series of possible reactions
to degrade those molecules to give CO2 and H2 O [12–14].
The selection of an appropriate catalyst that will efficiently
degrade the molecules of a certain pollutant is considered an
important step. TiO2 and ZnO have attracted the attention Hg lamp
of many researchers who have studied their applications as Reaction chamber
photocatalysts. This is due to the fact that these two catalysts Magnet
are nontoxic, friendly with the environment, relatively inex- Hot plate
pensive and their photogenerated holes are highly oxidizing
in nature. However, in certain cases, ZnO has been found Stirrer
to be more effective than TiO2. ZnO has more active sites
on its surface, as a result it will be more efficient in the Figure 1: Photocatalytic experimental setup.
photodegradation of dyes and more effective in generating
H2 O2 [14–17]. Recently, ZnO has been applied to treat water
contaminated with MTBE [18].
This work reports, for the first time, the effect of the reactor in its specified space using a special rod. Cold water
particle size of zinc oxide on the photodegradation of MTBE (16 ± 1∘ C) was continuously supplied through the cooling
in aqueous medium. Zinc oxide of three different particle jacket to cool the reaction mixture. A volume of 350 mL of
sizes having the averages of 420 nm, 59 nm, and 25 nm were 100 ppm MTBE solution and an amount of 100 mg of each of
applied in this work. the ZnO photocatalysts were added to the reactor and stirred
for 30 min. Stirring is essential in order to achieve uniform
dispersion of the ZnO particles at room temperature. The
2. Materials and Methods oxygen gas was passed at a moderate flow rate through the
reaction mixture for a period of 30 min. After this time, the
2.1. Materials. Methyl tert-butyl ether (MTBE) of 99.9% oxygen flow was stopped and the UV lamp was turned on.
purity was obtained from Sigma-Aldrich. The reaction setup was covered with an aluminum foil and the
A stock solution of 100 ppm of MTBE was prepared in samples were collected every hour for a period of five hours.
distilled water.
Zinc oxide of different average particle sizes as used in
this work. ZnO-1 of an average particle size of 421 nm was 3. Results and Discussion
supplied by J.T. Baker, USA. Zinc oxide (ZnO-2) of an average
particle size of 25 nm was prepared by mixing the aqueous 3.1. X-Ray Diffraction Studies. The XRD profiles of the three
solution of the zinc nitrate hexahydrate and ammonium types of the ZnO photocatalysts used are shown in Figure 2.
carbonate in a molar ratio of 1 : 1. This mixture was stirred The XRD peaks observed in each spectrum indicate that
at room temperature for a period of two hours. A precipitate the crystalline structures of the three types of the ZnO
was formed and separated by centrifugation. Zinc oxide of nanoparticles represent hexagonal wurtzite structure. X-ray
an average particle size of 59 nm was supplied by Nanoscale diffraction pattern of different ZnO nanoparticles as obtained
Materials Inc., USA. Samples of the three types of the zinc by X-ray diffractometer (X’pert PRO PANalytical) using
oxide were thoroughly washed with deionized water and then CuK𝛼 radiation (1.5406 Å)́ in the range 2𝜃 = 10–80∘ with
with ethanol and dried overnight at a temperature of 100∘ C. 0.02 as step size at 25∘ C. The existence of several peaks
The dried ZnO precursors were then calcined at 500∘ C for around 31.77525, 34.41348, 36.2, 47.5, 56.5, 62.8, 67.9, and
a period of six hours at a heating rate of 1∘ C/min to obtain 69.1 corresponding to (100), (002), (101), (102), (110), (103),
nano-ZnO particles. These particles were characterized by (112), and (201) planes can be observed. It is obvious from
XRD, SEM, and TEM. Figure 2 that the peaks are sharp and strong in nature, which
indicates that the effect of the impurities is negligible [19,
20]. The average calculated sizes of the nanoparticles are
2.2. Photocatalytic Reaction Procedure. Methyl tert-butyl
in good agreement with the data obtained from the TEM
ether (MTBE) (reagent grade) from Aldrich was used without
micrographs.
further purification in the photodegradation experiments. A
photoreactor made of quartz and equipped with a cooling
jacket and a specified tubular space for the UV lamp was used 3.2. Morphology of Photocatalysts. The morphology of each
to perform the photodegradation experiments (Figure 1). of the three types of the zinc oxide nanoparticles has been
A 125 W high pressure mercury UV lamp was placed in the examined by means of the Field Emission Scanning Electron
3000
6000 ZnO-1 ZnO-2
2500
5000
2000
4000
Counts
Counts
3000 1500
2000 1000
1000 500
0 0
10 15 20 25 30 35 40 45 50 55 60 65 70 75 10 15 20 25 30 35 40 45 50 55 60 65 70 75
2𝜃 (∘ ) 2𝜃 (∘ )
ZnO-1 ZnO-2
(a) (b)
1800
ZnO-3
1600
1400
1200
1000
Counts
800
600
400
200
0
10 15 20 25 30 35 40 45 50 55 60 65 70 75
2𝜃 (∘ )
ZnO-3
(c)
Figure 2: XRD spectrum of ZnO photocatalysts used.
Microscope (FESEM) and the Transmission Electron Micro- The activity of the photocatalyst increases with the
scope (TEM). The surface morphology and the crystallite number of the active sites available. The latter depends on
structure of each powder of the photocatalysts used were the size and the shape of the particles of the photocatalyst
analyzed using FESEM. Figure 3 shows that the three types employed [19]. The shapes and the sizes of the ZnO nanopar-
of the ZnO nanoparticles used have different morphologies. ticles photocatalysts used were examined by Transmission
Figure 3 also shows that the ranges of the sizes of the particles Electron Microscope (TEM). Figure 4 illustrates the TEM
of these photocatalysts are different. It can be seen that micrographs of the different types of the ZnO photocatalysts.
the ZnO-1 nanoparticles (Figure 3(a)) have cube or cuboid It can be seen that the particles of these photocatalysts are
shapes of size ranges that are higher than the size ranges generally round in shape with different sizes. The sizes of
of the other two types and the ZnO-3 (Figure 3(b)) has a these particles are in nanometer range and they are uniformly
spherical shape with the lowest size range and it is uniformly distributed; however, some aggregation can also be seen.
dispersed. The ZnO-2 nanoparticles prepared (Figure 3(c)) Regarding the sizes of the particles they have the order ZnO-1
have different morphologies and can be seen as clusters of > ZnO-2 > ZnO-3. The XRD data shows a similar trend of the
nanoparticles which have high size ranges compared to that sizes of the particles of these photocatalysts.
of the ZnO-3. This is supported by the XRD data. It is evident
that the properties of the ZnO nanoparticles depend on the
conditions applied during their preparations. Such conditions 3.3. Kinetic Studies of Photodegradation of MTBE. The three
will also affect the efficiency of the photocatalyst during the photocatalysts ZnO-1, ZnO-3, and ZnO-2 were used for the
degradation process. photocatalytic degradation of MTBE in water. ZnO-1 was
(a) (b)
(c)
Figure 3: FESEM of photocatalysts (a) ZnO-1, (b) ZnO-2, and (c) ZnO-3.
found to be more effective in the degradation of MTBE where 𝑘𝑟 is the rate constant, 𝐾 is the adsorption coefficient
as can be seen from Figure 5. The photocatalytic efficiency of the reactant on the surface of the catalyst, and 𝐶 is the
was found to be in the order ZnO-1 > ZnO-2 > ZnO-3. concentration of the reactant MTBE. When the concentration
From the TEM micrographs, the ZnO-3 having particles 𝐶 is very low, 𝐾𝐶 becomes negligible compared to 1. There-
of smaller sizes was expected to have better photocatalytic fore, the equation represents a first order kinetics [19, 22].
efficiency compared to the other two catalysts. However, By plotting − ln(𝐶0 /𝐶) versus irradiation time for the three
it was found that the photocatalytic efficiency of ZnO-1 is catalysts, straight lines were obtained as is shown in Figure 6.
higher than the efficiencies of the other two catalysts as can This indicates that the kinetics of the photodegradation of
be seen from Figure 4. This can be attributed to the higher MTBE is a first order type. The rate constants obtained from
number of oxygen vacancies available in the structure of the the slopes of the lines in Figure 6 in case of no catalyst,
ZnO-1 which depends on the conditions applied during its ZnO-1, ZnO-3, and ZnO-2 are 0.021, 0.544, 0.337, and 0.181,
preparation [20–22]. Thus, it may be assumed that in case respectively (Table 1).
of photocatalytic degradation of aqueous MTBE, the effect
of the oxygen vacancies available in the catalytic structure is
considered to be more important than the morphology and 3.4. Effect of pH on the Photocatalytic Degradation of MTBE
the surface area of the catalyst. Using ZnO-1. Photocatalysts like ZnO and TiO2 which are
Most of the photocatalytic reactions follow the kinetic commonly used in the photocatalytic degradation reactions
model proposed by Langmuir-Hinshelwood, which relates are mainly semiconducting metal oxides of amphoteric prop-
the rate of photochemical reactions which are proportional to erties. As a result, the properties of these metal oxides will
the surface coverage of the photocatalyst [22]. Accordingly, be affected by variations in the pH of the reaction medium.
The pH of the medium will also affect the size of the particle
𝑑𝐶 𝑘 𝐾𝐶 aggregates and the distribution of the charges on the surfaces
Rate = − ( ) = 𝑘𝑟 𝜃 = ( 𝑟 + 𝐾𝐶) . (1) of the particles. Moreover, the dispersion of the particles
𝑑𝑇 1
of the photocatalyst in the medium and the adsorption of
MTBE on the surface of the photocatalyst will also be affected
For a very low concentration when 𝐾𝐶 ≪ 1
by the pH [23]. The photocatalytic degradation reaction of
MTBE using ZnO-1 nanoparticles was performed at different
𝐶
− ln ( ) = 𝐾appt , (2) pH values. The effect of the pH on the efficiency of the
𝐶0 photocatalytic degradation of MTBE is illustrated in Figure 7.
(a) (b)
(c)
Figure 4: TEM micrographs of (a) ZnO-1, (b) ZnO-2, and (c) ZnO-3.
100 3.5
90
3
80
70
MTBE conc. (ppm)
2.5
60
ln(C0 /C)
50 2
40
1.5
30
20
1
10
0 0.5
0.5 1 2 3 4 5
Time (h)
0
No catalyst ZnO-2 0.5 1 2 3 4 5
ZnO-1 ZnO-3 Time (h)
Figure 5: Photodegradation of MTBE in water using various ZnO No catalyst ZnO-2

as photocatalysts. ZnO-1 ZnO-3
Figure 6: First order kinetics of MTBE degradation in presence of

ZnO nanoparticles of different origins photocatalysts.
It is obvious from this figure that the pH has insignificant
effect on the efficiency of the photocatalytic degradation of
MTBE. However, it has been noted by other researchers that
the pH of the reaction medium plays an important role in degradation of MTBE using ZnO or TiO2 , an optimum pH of
the photocatalytic process. For instance, an optimum pH of 7 was applied [18, 25]. Hu et al. [12] have reported an optimum
6 was applied during the photodegradation of vanillin using pH of 3 for the degradation of MTBE in UV/TiO2 system.
ZnO as a photocatalyst [24]. In case of the photocatalytic Fu et al. [26] found slightly better degradation efficiency
Table 1: Kinetic data of MTBE photodegradation on UV irradiation Acknowledgment

in presence of catalysts.
The authors wish to acknowledge the support by King Abdul
S. number Catalyst 𝑘 𝑅2 Aziz City for Science and Technology (KACST) through the
1 No catalyst 0.021 0.917 Science & Technology Unit at Umm Al-Qura University for
2 ZnO-1 0.544 0.973 funding through Project no. 10-wat1240-10 as part of the
3 ZnO-2 0.181 0.996 National Science, Technology and Innovation Plan.
4 ZnO-3 0.337 0.996
References
[1] M. J. Day, R. F. Reinke, and J. A. M. Thomson, “Fate and trans-
100 port of fuel components below slightly leaking underground
storage tanks technical note,” Environmental Forensic, vol. 2, pp.
21–28, 2001.
Photodegradation efficiency
[2] C. Guillard, N. Charton, and P. Pichat, “Degradation mecha-

99
nism of t-butyl methyl ether (MTBE) in atmospheric droplets,”
[3] Y. Zang and R. Farhood, “Effects of hydrogen peroxide concen-
98 tration and ultraviolet light intensity on methyl tert-butyl ether
degradation kinetics,” Chemical Engineering Science, vol. 60, no.
6, pp. 1641–1648, 2005.
97 [4] E. Selli, C. L. Bianchi, C. Pirola, and M. Bertelli, “Degradation
of methyl tert-butyl ether in water: effects of the combined use
of sonolysis and photocatalysis,” Ultrasonics Sonochemistry, vol.
96 12, no. 5, pp. 395–400, 2005.
4 5 6 8 9 10 [5] J. Araña, A. Peña Alonso, J. M. Doña Rodrı́guez, J. A. Herrera
pH Melián, O. González Dı́az, and J. Pérez Peña, “Comparative
study of MTBE photocatalytic degradation with TiO2 and Cu-
Figure 7: Effect of pH on photodegradation efficiency of ZnO-1.
TiO2 ,” Applied Catalysis B, vol. 78, no. 3-4, pp. 355–363, 2008.
[6] C. Baus, H. Hung, F. Sacher, M. Fleig, and H.-J. Brauch, “MTBE
in drinking water production—occurrence and efficiency of
treatment technologies,” Acta Hydrochimica et Hydrobiologica,
vol. 33, no. 2, pp. 118–132, 2005.
of methylene blue when the pH was changed from acidic [7] A. Asadi and M. Mehrvar, “Degradation of aqueous methyl tert-
to the neutral value. However, in the alkaline region the butyl ether by photochemical, biological, and their combined
efficiency of degradation has increased by many folds. In processes,” International Journal of Photoenergy, vol. 2006,
solutions of higher pH values, the recombination of the Article ID 19790, 7 pages, 2006.
photoexcited electron-hole pair is reduced, and as a result [8] F. Fayolle, A. François, L. Garnier et al., “Limitations in MTBE
the photodegradation efficiency increases. This efficiency also biodegradation,” Oil and Gas Science and Technology, vol. 58,
increases at higher pH values due to the fact that more no. 4, pp. 497–504, 2003.
OH− and ∙ OH will be available. However, in case of TiO2 , a [9] N. Y. Fortin, M. Morales, Y. Nakagawa, D. D. Focht, and M. A.
decrease in the photocatalytic efficiency has been observed at Deshusses, “Methyl tert-butyl ether (MTBE) degradation by a
higher pH values. This could be attributed to the repulsion microbial consortium,” Environmental Microbiology, vol. 3, no.
phenomenon between the hydroxyl ions and the negatively 6, pp. 407–416, 2001.
charged surface of TiO2 [27, 28]. It seems that the effect of pH [10] M. Bertelli and E. Selli, “Kinetic analysis on the combined
on the photocatalytic degradation of MTBE requires further use of photocatalysis, H2 O2 photolysis, and sonolysis in the
investigations to be undertaken. degradation of methyl tert-butyl ether,” Applied Catalysis B, vol.
52, no. 3, pp. 205–212, 2004.
[11] M. S. M. Chan and R. J. Lynch, “Photocatalytic degradation
of aqueous methyl tert-butyl ether (MTBE) in a supported-
4. Conclusions catalyst reactor,” Environmental Chemistry Letter, vol. 1, no. 3,
pp. 157–160, 2003.
The potentialities of the ZnO nanoparticles of different parti- [12] Q. Hu, C. Zhang, Z. Wang et al., “Photodegradation of methyl
cle sizes in the photocatalytic degradation of MTBE in water tert-butyl ether (MTBE) by UV/H2 O2 and UV/TiO2 ,” Journal
were investigated. ZnO-1 nanoparticles were found to be very of Hazardous Materials, vol. 154, no. 1–3, pp. 795–803, 2008.
effective in the photocatalytically degrading of MTBE even at [13] B. Dindar and S. Içli, “Unusual photoreactivity of zinc oxide
different pH values. Oxygen vacancies are expected to play a irradiated by concentrated sunlight,” Journal of Photochemistry
dominating role over the morphology and the surface area. and Photobiology A, vol. 140, no. 3, pp. 263–268, 2001.
The photocatalytic degradation of aqueous MTBE catalyzed [14] S. Devipriya and S. Yesodharan, “Photocatalytic degradation of
by ZnO nanoparticles was observed to follow Hinshelwood pesticide contaminants in water,” Solar Energy Materials and
first order kinetics. Solar Cells, vol. 86, no. 3, pp. 309–348, 2005.
[15] A. A. Aal, S. A. Mahmoud, and A. K. Aboul-Gheit, “Nanocrys-

talline ZnO thin film for photocatalytic purification of water,”
Materials Science and Engineering C, vol. 29, no. 3, pp. 831–835,
2009.
[16] B. Pal and M. Sharon, “Enhanced photocatalytic activity of
highly porous ZnO thin films prepared by sol-gel process,”
Materials Chemistry and Physics, vol. 76, no. 1, pp. 82–87, 2002.
[17] S. S. Shinde, P. S. Shinde, C. H. Bhosale, and K. Y. Rajpure, “Zinc
oxide mediated heterogeneous photocatalytic degradation of
organic species under solar radiation,” Journal of Photochem-
istry and Photobiology B, vol. 104, no. 3, pp. 425–433, 2011.
[18] A. Eslami, S. Nasseri, B. Yadollahi et al., “Photocatalytic degra-
dation of methyl tert-butyl ether (MTBE) in contaminated
water by ZnO nanoparticles,” Journal of Chemical Technology
and Biotechnology, vol. 83, no. 11, pp. 1447–1453, 2008.
[19] K. Hayat, M. A. Gondal, M. M. Khaled, S. Ahmed, and A.
M. Shemsi, “Nano ZnO synthesis by modified sol gel method
and its application in heterogeneous photocatalytic removal of
phenol from water,” Applied Catalysis A, vol. 393, no. 1-2, pp.
122–129, 2011.
[20] J. Liqiang, Q. Yichun, W. Baiqi et al., “Review of photolumi-
nescence performance of nano-sized semiconductor materials
and its relationships with photocatalytic activity,” Solar Energy
Materials and Solar Cells, vol. 90, no. 12, pp. 1773–1787, 2006.
[21] S.-Z. Kang, T. Wu, X. Li, and J. Mu, “A facile gelatin-
assisted preparation and photocatalytic activity of zinc oxide
nanosheets,” Colloids and Surfaces A, vol. 369, no. 1–3, pp. 268–
271, 2010.
[22] W.-J. Huang, G.-C. Fang, and C.-C. Wang, “A nanometer-ZnO
catalyst to enhance the ozonation of 2,4,6-trichlorophenol in
water,” Colloids and Surfaces A, vol. 260, no. 1–3, pp. 45–51, 2005.
[23] P. R. Gogate and A. B. Pandit, “A review of imperative tech-
nologies for wastewater treatment I: oxidation technologies at
ambient conditions,” Advances in Environmental Research, vol.
8, no. 3-4, pp. 501–551, 2004.
[24] M. Qamar and M. Muneer, “A comparative photocatalytic
activity of titanium dioxide and zinc oxide by investigating the
degradation of vanillin,” Desalination, vol. 249, no. 2, pp. 535–
540, 2009.
[25] A. Eslami, S. Nasseri, B. Yadollahi, A. Mesdaghinia, F. Vaezi,
and R. Nabizadeh, “Removal of methyl tert-butyl ether (MTBE)
from contaminated water by photocatalytic process,” Iranian
Journal of Public Health, vol. 38, no. 2, pp. 18–26, 2009.
[26] D. Fu, G. Han, Y. Chang, and J. Dong, “The synthesis and
properties of ZnO-graphene nano hybrid for photodegradation
of organic pollutant in water,” Materials Chemistry and Physics,
vol. 132, no. 2-3, pp. 673–681, 2012.
[27] I. K. Konstantinou and T. A. Albanis, “TiO2 -assisted photocat-
alytic degradation of azo dyes in aqueous solution: kinetic and
mechanistic investigations: a review,” Applied Catalysis B, vol.
49, no. 1, pp. 1–14, 2004.
[28] S. Bekkouche, M. Bouhelassa, N. Hadj Salah, and F. Z. Megh-
laoui, “Study of adsorption of phenol on titanium oxide (TiO2 ),”
Desalination, vol. 166, no. 1–3, pp. 355–362, 2004.
http://dx.doi.org/10.1155/2013/745301
Research Article
A Novel Solar Driven Photocatalyst: Well-Aligned
Anodic WO3 Nanotubes
Chin Wei Lai,1 Sharifah Bee Abd Hamid,1 and Srimala Sreekantan2
1
Nanotechnology & Catalysis Research Centre (NANOCAT), Institute of Postgraduate Studies (IPS), University of Malaya,
3rd Floor, Block A, 50603 Kuala Lumpur, Malaysia
2
School of Materials and Mineral Resources Engineering, Universiti Sains Malaysia, Engineering Campus, 14300 Nibong Tebal,
Seberang Perai Selatan, Pulau Pinang, Malaysia
Correspondence should be addressed to Chin Wei Lai; cwlai@um.edu.my
Received 6 July 2013; Accepted 25 August 2013
Copyright © 2013 Chin Wei Lai et al. This is an open access article distributed under the Creative Commons Attribution License,
Well-aligned anodic tungsten trioxide (WO3 ) nanotubes were successfully synthesized by anodization of W foil at 40 V in a
bath with electrolyte composed of 1 M of sodium sulphate (Na2 SO4 ) and 0.5 wt% ammonium fluoride (NH4 F). The effect of
electrochemical anodization times on the formation mechanism of anodic WO3 nanotubular structure was investigated. It was
found that minimum of 15 min is required for completing transformation from W foil to WO3 nanotubular structure with an average
diameter of 50 nm and length of 500 nm. The photocatalytic ability of the samples was evaluated by degradation of methyl blue (MB)
dye. The results indicate that the surface morphology of anodic WO3 affected the photocatalytic MB degradation significantly under
solar illumination.
1. Introduction response to visible light illumination [19–25]. In addition, it

exhibits a broad range of functional properties, such as its
Nowadays, global warming poses one of the most serious
small band gap energy (2.4 eV to 2.8 eV), deeper valence
threats to the global environment ever faced in human history
band (+3.1 eV), stable physicochemical properties, and strong
[1, 2]. Over the past ten years, titanium dioxide (TiO2 ) photo-
catalyst has become one of the most studied materials for photocorrosion stability in aqueous solution [19–28]. In this
photocatalytic studies [3–8]. However, TiO2 photocatalyst manner, design and development of nanostructure of WO3
has wide band gap (3.0–3.2 eV), which exhibits poor respon- assemblies have gained significant interest in recent years,
sive to visible light region [9–12]. Nevertheless, much litera- especially one-dimensional nanotubular structure. However,
tures has reported that visible light driven TiO2 photocatalyst several studies have reported that growth of well-aligned
could be achieved by doping sufficient content of cations or and uniformity of anodic WO3 nanotubular structure was a
anions into the lattice of TiO2 to create certain states within difficult task and most of the studies only able to grow anodic
the band gap energy of TiO2 [5, 9–15]. However, modification WO3 into nanoporous instead of nanotubular structure [19–
of TiO2 photocatalyst has several drawbacks, such as ther- 25, 27]. To the best of our knowledge, the literature about the
mal instability, and recombination centers for photoinduced formation of well-aligned anodic WO3 nanotubes in shorter
charge carriers, which decrease the photocatalytic ability sig- time is still lacking. Therefore, considerable efforts have been
nificantly [16–18]. These issues are still far from being solved. devoted to grow the high uniformity and well-aligned anodic
In line with this objective, many efforts and studies have been WO3 nanotubes via electrochemical anodization technique.
devoted to small band gap metal oxide semiconductor for Such a mechanistic understanding is very important for the
strong absorption within solar spectrum [19–22]. controlled growth of ordered WO3 nanotubular structures,
Recently, WO3 has gained much scientific interest which may be used in several environmental applications to
because WO3 is one of very few metal oxide semiconductor realize a green economy in our future.
2. Experimental Procedure Table 1: Average elemental compositions (at%) of pure W foil and
anodic WO3 nanostructures obtained in 1 M Na2 SO4 electrolyte
2.1. Preparation of Anodic WO3 Nanostructures. Anodic WO3 containing 0.5 wt% NH4 F for 15 min at 40 V obtained from EDX
nanostructures were synthesized via electrochemical anodi- analysis.
zation of W foil (99.95% purity, 0.1 mm in thickness, Alfa
Aesar, USA) in a bath with electrolytes composed of 100 mL Sample W (at%) O (at%)
of 1 M of sodium sulfate (Na2 SO4 , Merck, USA) solution with Pure W foil (prior anodization) 100 —
0.5 wt% of ammonium fluoride (NH4 F, Merck, USA) at 40 V Anodic WO3 foil (15 min anodized) 54 46
with sweep rate of 1 V/s. Anodization process was performed
in a two-electrode cell with W foil as the anode and the plat-
inum rod as the counter electrode. The effect of anodization or pores on its surface (Figure 1(a)). As determined through
times on the formation of anodic WO3 nanostructures was EDX analysis, the pure W foils consisted of 100 at% of W
investigated (e.g., 2 min; 5 min; 10 min; 15 min; 30 min; and (Table 1), which indicate that only W element was present
60 min). After anodization process, anodized W foils were without any impurities. The FESEM images of anodized W
cleaned using acetone (J. T. Baker, Nederland) and dried in foils for different anodization times are shown in Figures 1(b)
nitrogen stream. to 1(j). The inset of FESEM images showed the higher magni-
fication of oxide layer on the surface of W foil. Interestingly, it
2.2. Characterization of Anodic WO3 Nanostructures. The was found that randomly small oxide pits were started to form
morphologies of anodic WO3 nanostructures were observed on the W surface for 2 min of anodization (Figure 1(b)). Upon
by field emission scanning electron microscopy (FESEM), increasing the time to 5 min, these randomly small oxide
using a FEI Quanta 200 (FESEM model, USA) at a working pits were grown into larger pits (Figure 1(c)). For the sample
distance of around 1 mm. The cross-sectional observation was anodized in 10 min, similar morphology of anodic WO3
carried out on mechanically bent samples to get the thickness nanostructure was observed as compared to the sample
of the oxide layer. The chemical stoichiometry of the sample anodized for 5 min (Figure 1(d)). However, these randomly
was characterized using energy dispersive X-ray (EDX) anal- oxide pits started to turn into larger pores structure and con-
ysis, which is equipped in the FESEM. The morphologies of nect to each other to form a layer. This compact oxide
anodic WO3 nanotubular structure were further confirmed nanoporous layer became more interconnected and eventu-
by transmission electron microscope (TEM), using FEI CM ally formed a uniform nanotubular structure as presented in
12 transmission microscope. Figure 1(e). The uniform nanotubular structure with an
average diameter of ∼50 nm and length of ∼500 nm was
successfully synthesized at minimum of 15 min (Figure 1(f)).
2.3. Photocatalytic MB Dye Degradation Studies. The photo- Further increase in anodization time to 30 min and 60 min,
catalytic MB dye degradation studies were conducted by dip- the anodic WO3 nanotubular structure was disappeared
ping 4 cm2 of anodic WO3 nanostructures samples into a and only irregular nanoporous structure with thickness of
100 mL of custom-made photoreactor consisting of quartz ∼100 nm could be observed (Figures 1(g)–1(j)). Representa-
glas tube containing 30 ppm of MO dye solution. A blank tive samples (15 min anodized) were selected for the EDX and
sample (without anodic WO3 ) was also prepared in order to TEM analyses. The EDX analysis was employed to examine
eliminate the effect of the light towards the degradation of MB the chemical stoichiometry of the anodic WO3 nanostruc-
dye solution. Both samples were left in the reactor for 30 min ture. It was found that the atomic percentage of W element
in dark environment to achieve the adsorption/desorption was about 54 at% whereas O element was about 46 at%
equilibrium. It was then photoirradiated at room temperature (Table 1). Furthermore, the TEM image showed that hollow
by using a 150 W Xenon solar simulator (Zolix LSP-X150, tube opening was obtained after electrochemical anodization
China) with intensity of 800 W/m2 . 5 mL of MB dye solution process (Figure 2). It was found that the existence of the
was withdrawn for every 1 h from both quartz tubes to nanotubular structure with diameter of approximately 50 nm
monitor the degradation of MB dye after irradiation. The con- is further confirmed using TEM. Besides, the nanotubular
centration of the degraded MB dye solution was determined wall thickness of approximately 10 nm could be observed.
using UV-Vis spectrometer (PerkinElmer Lambda 35, USA). In order to obtain the electrochemical information, a
curve of current density versus time transient was plotted
3. Results and Discussion and presented in Figure 3. Such transient plot is important to
explain the formation mechanism of anodic WO3 nanostruc-
In this part of the experimental study, the effect of anodiza- tures. In addition, the schematic illustrations on the possible
tion time on the morphology of anodic WO3 oxide is dis- stages undergone by the anodic oxide for the formation of the
cussed. Figure 1 shows FESEM images of the surface mor- WO3 nanotubular structure are shown in Figure 4. In this
phologies of anodized W foils in different anodization times. early stage of anodization, small oxide pits were started to
As shown in these FESEM images, the appearance of anodic form on the W surface randomly. These small oxide pits were
oxides was dependent on the anodization times. Prior to the formed through the hydrolysis process of W foil. The field-
anodization process, the W foil was degreased by sonication assisted migration of O2− ions within the electrolyte through
in acetone and analyzed via FESEM. It could be observed that the W surface towards the W/WO3 interface induce further
the W surface was relatively smooth and without any pits growth of the oxide pits under applied voltage and longer
1 𝜇m 1 𝜇m 1 𝜇m
(a) (b) (c)
100 nm 100 nm
1 𝜇m 1 𝜇m 100 nm
(d) (e) (f)
100 nm 100 nm
1 𝜇m 100 nm 1 𝜇m
(g) (h) (i)
100 nm
(j)
Figure 1: FESEM images of anodic WO3 nanostructures obtained in 1 M Na2 SO4 electrolyte containing 0.5 wt% NH4 F for different
anodization times at 40 V: (a) pure W foil before anodization; (b) 2 min; (c) 5 min; (d) 10 min; (e) 15 min; (f) cross-sectional view for 15 min
anodization; (g) 30 min; (h) cross-sectional view for 30 min anodization; (i) 60 min; (j) cross-sectional view for 60 min anodization. Insets
show the higher magnification of the surface morphology.
anodization times [19, 23]. In this case, the resultant oxide pits migrate W6+ ions and leave behind voids or pores [24, 27, 29].
will grow continuously until forming a compact oxide layer These W6+ ions will dissolve into the electrolyte and eventu-
on W foil. The chemical reaction occurred is depicted as [W6+ ally cause the porosification on the compact oxide layer. These
+ 3H2 O → WO3 + 6H+ ]. Based on the current density curve, pores or voids will be attacked by the tungsten fluorocomplex
a dramatic decrease in current density mainly attributed ions in the electrolyte, which induce chemical dissolution to
to the poor electrical conductivity caused by the randomly enlarge and deepen pores and voids. It is a well-known fact
oxide pits (stage A) [23, 25]. Meanwhile, the high elec- that those fluorocomplex ions are the key factor in achieving
tric field across the small oxide pits will subsequently induce regular nanostructure formation on valve metals via elec-
the polarization of W–O bonding, which is strong enough to trochemical anodization [8, 20–25, 27, 29–31]. The chemical
Table 2: Selected samples for MB dye degradation based on different

surface morphologies of anodic WO3 samples via electrochemical
anodization.
Sample Anodization Morphological

time
A 10 min Compact oxide layers with randomly pits
B 15 min Nanotubular structure
C 30 min Nanoporous structure
50 nm +
W foil
Figure 2: TEM image of anodic WO3 nanostructures obtained in Stage A

Formation of compact oxide pits
1 M Na2 SO4 electrolyte containing 0.5 wt% NH4 F for 15 min at 40 V.
+
4.4
W foil
4.2
Stage B Continuous growth of compact oxide pits to
Current density (mA/cm2 )
4 oxide layer with pores
A
3.8 +
3.6 W foil
C
B
3.4 Stage C Formation of nanotubular structure
3.2
3 +
0 10 20 30 40 50 60
Time (min) W foil
Figure 3: Current density versus duration response during the

Figure 4: Schematic illustration of formation and mechanistic stud-
electrochemical anodization for 60 minutes at 40 V in 1 M Na2 SO4
ies of anodic WO3 nanostructures obtained in 1 M Na2 SO4 elec-
containing 0.5 wt% NH4 F.
trolyte containing 0.5 wt% NH4 F for 15 min at 40 V.
reaction occurred in stage is depicted as [WO3 + 6H+ + The photocatalytic ability of selected anodic WO3 sam-
8F− → (WF8 )2− + 3H2 O]. From the current density curve, ples formed via electrochemical anodization was evaluated
the slight decrease in current density was due to the chemical by exposing MB organic dye under solar illumination as
dissolution by fluorocomplex ions as marked in Figure 3 shown in Table 2. The changes in concentration of MB dye
(stage B). The small pores and voids on the compact oxide lay- were analyzed as a function of exposure time (Figure 5).
ers will grow inwards and eventually will form self-organized It was found that the concentration of the MB dye was
nanotubular structure. This is a result of equilibrium estab- decreased as the solar irradiation exposure time prolonged.
lished between the electrochemical formation of WO3 and The experimental results indicate that degradation of MB
its simultaneous chemical dissolution in fluoride containing dye could be achieved in the present works. Based on the
electrolyte [22, 27]. Interestingly, the current density was photocatalytic degradation results, the degradation rate in the
increased slowly when the electrochemical anodization times presence of anodic WO3 nanotubular structure (sample B) is
prolonged (stage C). The reason might be attributed to the much faster than the other samples. In addition, it could be
concentration of fluorocomplex ions in the electrolyte was noticed that the MB concentration was reduced from 30 ppm
decreased slowly for prolonging electrochemical anodization. to ∼7 ppm after 5 h solar irradiation assisted by sample B.
In this manner, the balance between chemical dissolution It could be postulated that sample B has uniformity and
and field-assisted dissolution and field-assisted oxidation will apparent pore diameter throughout the photocatalyst surface;
be interrupted and eventually will collapse the nanotubular thus, more photocatalytic reactions could be triggered at
structure and form nanoporous structure [19, 22]. In the the surface of the nanotubes (inner and outer wall surface)
present study, 15 min was found to be the optimum duration [7, 9, 12, 32]. Whereas, sample A has compact oxide layers
for the formation of self-organized circular nanotubular with random pits on the surface of W foil. It showed
structure with lengths of approaching 500 nm. lower photocatalytic degradation of MB organic dye among
30 Solar illumination
(a)
CO2
MB dye concentration (ppm)
25 Harmless
Toxic MB substances
organic dyes
20 (b)
H2 O
15
(c)
10 (d)
5 Hydroxyl
radicals
0 Anodic WO3
0 1 2 3 4 5 nanotubes
Time (h) W foil
Figure 5: Photocatalytic degradation of MB dye solution under Figure 6: Schematic illustration of basic principal photocatalytic
solar illumination, (a) blank sample (without anodic sample); (b) degradation of MB dye under solar illumination assisted by anodic
sample A (10 min); (c) sample C (30 min); and (d) sample B (15 min). WO3 nanotubes.
the samples. This result manifested that the irregular thin the oxidative decomposing power of positive charge holes is
compact oxide layers offer the small surface area for photons stronger than the reducing power of negative charge elec-
absorption from the solar irradiation. As a consequence, the trons. The strong oxidative process creates strong oxidation
generation of photoinduced charge carriers (electrons/holes agent from the surface of photocatalyst in the presence of
pairs) from the anodic WO3 was significantly decreased [7, solar illumination and water [2–4, 22, 32]. This strong oxida-
29, 30]. On the other hand, sample C has nonuniformity tion agent is released from the positive charge holes (valence
of nanoporous structure and exhibited slightly poor photo- band) after oxidizing the water molecules into hydroxyl
catalytic performance as compared to sample B. The reason radicals (∙OH). Then, these ∙OH radicals will react with MB
mainly attributed to the numerous defects on the nanoporous molecule and eventually decompose the toxic MB molecules
structure, which could result in more recombination centers into the harmless substances, carbon dioxide, and water [4,
for electrons/holes pairs [5, 29]. Furthermore, the absorption 32]. In conclusion, a novel anodic WO3 nanotubular structure
of the photons from the solar illumination was limited with high active surface area could generate more ∙OH
in irregular nanoporous structure. Therefore, the number radicals, which enhance the photocatalytic degradation of
of photoinduced electrons/holes pairs was decreased and MB molecules under solar irradiation.
eventually leaded to poor photocatalytic degradation of MB
dye.
In the present studies, MB molecule possesses a thiazine 4. Conclusion
structure which contains polar atoms such as nitrogen,
The present experimental work shows a strongly beneficial
positively charge sulfur atom, and negatively charge chloride
effect of anodic WO3 nanotubular structure in enhancing
as counter ion [33, 34]. In this manner, anodic WO3 pho-
the photocatalytic activity. It was found that a minimum of
tocatalyst possesses significantly higher surface acidity, thus,
15 min at 40 V via electrochemical anodization was required
attracting more MB molecules for photocatalytic degradation
to form uniformity nanotubular structure in the electrolyte
reaction [21, 27]. In addition, the photocatalytic performance
composed of 1 M of Na2 SO4 and 0.5 wt% of NH4 F. The
of a photocatalyst strongly depends on the ability to gen-
irregular anodic WO3 nanoporous structure will be favored if
erate electrons/holes pairs, which will generate free radicals
the anodization time exceeded 15 min. A novel anodic WO3
(hydroxyl radicals ∙OH) that are able to undergo secondary
nanotubular structure is a cornerstone of green economy
reactions [3, 4, 12]. A simple schematic illustration of basic
because it could degrade toxic MB organic dye effectively in
principal in photocatalytic degradation of MB organic dyes
the presence of solar illumination and water (renewable
is presented in Figure 6. In theoretical perspectives, anodic
resources).
WO3 photocatalyst generates two types of charge carriers
(electrons/holes pairs) when absorption of high energy pho-
tons from solar illumination. The photons energy must be Acknowledgment
higher than band-gap energy of anodic WO3 in order to
generate electrons/holes pairs effectively [4, 9]. In ordinary The authors would like to thank University of Malaya for
substances, most of the electrons/holes pairs will recombine funding this research work under University of Malaya
very fast by releasing energy in the form of unproductive Research Grant (UMRG), (RP022-2012D).
heat or photons [18]. Based on the results obtained, anodic
WO3 nanotubular structure has a notable feature of strong References
oxidative decomposing power (positive holes) among the
samples, which plays an important role in degrading the [1] J. A. Turner, “A realizable renewable energy future,” Science, vol.
MB molecules. In the photocatalytic degradation studies, 285, no. 5428, pp. 687–689, 1999.
[2] D. Mohan and C. U. Pittman Jr., “Arsenic removal from water/ “Anodic growth of nanoporous WO3 films: morphology, photo-
wastewater using adsorbents—a critical review,” Journal of electrochemical response and photocatalytic activity for methy-
Hazardous Materials, vol. 142, no. 1-2, pp. 1–53, 2007. lene blue and hexavalent chrome conversion,” Journal of Electro-
[3] M. Kitano, M. Matsuoka, M. Ueshima, and M. Anpo, “Recent analytical Chemistry, vol. 612, no. 1, pp. 112–120, 2008.
developments in titanium oxide-based photocatalysts,” Applied [20] X. Zhang, K. Huo, L. Hu, and P. K. Chu, “Fabrication and pho-
Catalysis A, vol. 325, no. 1, pp. 1–14, 2007. tocatalytic activity of nanoporous WO3 film,” Nanoscience and
[4] A. Fujishima, X. Zhang, and D. A. Tryk, “TiO2 photocatalysis Nanotechnology Letters, vol. 2, no. 1, pp. 51–57, 2010.
and related surface phenomena,” Surface Science Reports, vol. [21] L. Meda, G. Tozzola, A. Tacca et al., “Photo-electrochemical
63, no. 12, pp. 515–582, 2008. properties of nanostructured WO3 prepared with different
[5] C. A. Grimes, “Synthesis and application of highly ordered organic dispersing agents,” Solar Energy Materials & Solar Cells,
arrays of TiO2 nanotubes,” Journal of Materials Chemistry, vol. vol. 94, no. 5, pp. 788–796, 2010.
17, no. 15, pp. 1451–1457, 2007. [22] C. W. Lai and S. Sreekantan, “Fabrication of WO3 nanostruc-
[6] S. Sreekantan and L. C. Wei, “Study on the formation and photo- tures by anodization for visible-light driven water splitting and
catalytic activity of titanate nanotubes synthesized via hydro- photodegradation of methyl orange,” Materials Science in Semi-
thermal method,” Journal of Alloys and Compounds, vol. 490, no. conductor Processing, vol. 16, pp. 303–310, 2013.
1-2, pp. 436–442, 2010. [23] W. Li, J. Li, X. Wang, S. Luo, J. Xiao, and Q. Chen, “Visible light
[7] Z. Su and W. Zhou, “Formation, morphology control and appli- photoelectrochemical responsiveness of self-organized nano-
cations of anodic TiO2 nanotube arrays,” Journal of Materials porous WO3 films,” Electrochimica Acta, vol. 56, no. 1, pp. 620–
Chemistry, vol. 21, no. 25, pp. 8955–8970, 2011. 625, 2010.
[8] A. Ghicov and P. Schmuki, “Self-ordering electrochemistry: a [24] S. Berger, H. Tsuchiya, A. Ghicov, and P. Schmuki, “High pho-
review on growth and functionality of TiO2 nanotubes and tocurrent conversion efficiency in self-organized porous WO3 ,”
other self-aligned MOx structures,” Chemical Communications, Applied Physics Letters, vol. 88, no. 20, Article ID 203119, 2006.
no. 20, pp. 2791–2808, 2009. [25] Y.-C. Nah, A. Ghicov, D. Kim, and P. Schmuki, “Enhanced elec-
[9] Y.-C. Nah, I. Paramasivam, and P. Schmuki, “Doped TiO2 and trochromic properties of self-organized nanoporous WO3 ,”
TiO2 nanotubes: synthesis and applications,” ChemPhysChem, Electrochemistry Communications, vol. 10, no. 11, pp. 1777–1780,
vol. 11, no. 13, pp. 2698–2713, 2010. 2008.
[10] C. W. Lai and S. Sreekantan, “Preparation of hybrid WO3 -TiO2 [26] T. Siciliano, A. Tepore, G. Micocci, A. Serra, D. Manno, and E.
nanotube photoelectrodes using anodization and wet impreg- Filippo, “WO3 gas sensors prepared by thermal oxidization of
nation: improved water-splitting hydrogen generation perfor- tungsten,” Sensors and Actuators B, vol. 133, no. 1, pp. 321–326,
mance,” International Journal of Hydrogen Energy, vol. 38, pp. 2008.
2156–2166, 2013. [27] V. Cristino, S. Caramori, R. Argazzi, L. Meda, G. L. Marra, and
[11] C. W. Lai and S. Sreekantan, “Optimized sputtering power to C. A. Bignozzi, “Efficient photoelectrochemical water splitting
incorporate WO3 into C-TiO2 nanotubes for highly visible by anodically grown WO3 electrodes,” Langmuir, vol. 27, no. 11,
photoresponse performance,” NANO, vol. 7, no. 6, Article ID pp. 7276–7284, 2011.
1250051, 2012. [28] C. W. Lai and S. Sreekantan, “Heat treatment effects of WO3 -
[12] A. Kubacka, M. Fernández-Garcı́a, and G. Colón, “Advanced loaded TiO2 nanotubes with enhanced water splitting hydrogen
nanoarchitectures for solar photocatalytic applications,” Chem- generation,” Materials Science in Semiconductor Processing, vol.
ical Reviews, vol. 112, no. 3, pp. 1555–1614, 2012. 16, pp. 947–954, 2013.
[13] S. A. K. Leghari, S. Sajjad, F. Chen, and J. Zhang, “WO3 /TiO2 [29] C. W. Lai and S. Sreekantan, “Effect of applied potential on the
composite with morphology change via hydrothermal formation of self-organized TiO2 nanotube arrays and its pho-
template-free route as an efficient visible light photocatalyst,” toelectrochemical response,” Journal of Nanomaterials, vol. 2011,
Chemical Engineering Journal, vol. 166, no. 3, pp. 906–915, 2011. Article ID 142463, 7 pages, 2011.
[14] C. W. Lai and S. Sreekantan, “Incorporation of WO3 species into [30] S. Sreekantan, L. C. Wei, and Z. Lockman, “Extremely fast
TiO2 nanotubes via wet impregnation and their water-splitting growth rate of TiO2 nanotube arrays in electrochemical bath
performance,” Electrochimica Acta, vol. 87, pp. 294–302, 2013. containing H2 O2 ,” Journal of the Electrochemical Society, vol.
[15] R. Beranek, J. M. Macak, M. Gärtner, K. Meyer, and P. Schmuki, 158, no. 12, pp. C397–C402, 2011.
“Enhanced visible light photocurrent generation at surface- [31] C. W. Lai and S. Sreekantan, “Photoelectrochemical perfor-
modified TiO2 nanotubes,” Electrochimica Acta, vol. 54, no. 9, mance of smooth TiO2 nanotube arrays: effect of anodization
pp. 2640–2646, 2009. temperature and cleaning methods,” International Journal of
[16] H. Song, H. Jiang, X. Liu, and G. Meng, “Efficient degradation of Photoenergy, vol. 2012, Article ID 356943, 11 pages, 2012.
organic pollutant with WOx modified nano TiO2 under visible
[32] H.-J. Oh, J.-H. Lee, Y.-J. Kim, S.-J. Suh, J.-H. Lee, and C.-S. Chi,
irradiation,” Journal of Photochemistry and Photobiology A, vol.
“Synthesis of effective titania nanotubes for wastewater purifi-
181, no. 2-3, pp. 421–428, 2006.
cation,” Applied Catalysis B, vol. 84, no. 1-2, pp. 142–147, 2008.
[17] W. Krengvirat, S. Sreekantan, A.-F. Mohd Noor et al., “Carbon-
[33] B. Bulic, M. Pickhardt, E.-M. Mandelkow, and E. Mandelkow,
incorporated TiO2 photoelectrodes prepared via rapid-anodic
“Tau protein and tau aggregation inhibitors,” Neuropharmacol-
oxidation for efficient visible-light hydrogen generation,” Inter-
ogy, vol. 59, no. 4-5, pp. 276–289, 2010.
national Journal of Hydrogen Energy, vol. 37, pp. 10046–10056,
[34] M. Havelcová, P. Kubát, and I. Němcová, “Photophysical prop-
2012.
erties of thiazine dyes in aqueous solution and in micelles,” Dyes
[18] M. Ni, M. K. H. Leung, D. Y. C. Leung, and K. Sumathy, “A
and Pigments, vol. 44, no. 1, pp. 49–54, 1999.
review and recent developments in photocatalytic water-split-
ting using TiO2 for hydrogen production,” Renewable and Sus-
tainable Energy Reviews, vol. 11, no. 3, pp. 401–425, 2007.
[19] A. Watcharenwong, W. Chanmanee, N. R. de Tacconi, C. R.
Chenthamarakshan, P. Kajitvichyanukul, and K. Rajeshwar,
http://dx.doi.org/10.1155/2013/801846
Research Article
Synthesis of Nitrogen-Doped ZnS with Camellia Brushfield
Yellow Nanostructures for Enhanced Photocatalytic Activity
under Visible Light Irradiation
Gang-Juan Lee,1 Chi-Lun Hong,1 Valentina Batalova,2

Gennady Mokrousov,2 and Jerry Wu1
1
Department of Environmental Engineering and Science, Feng Chia University, Taichung 407, Taiwan
2
Department of Chemistry, Tomsk State University, Tomsk 634050, Russia
Correspondence should be addressed to Jerry Wu; jjwu@fcu.edu.tw
Received 31 May 2013; Revised 1 August 2013; Accepted 18 August 2013
Copyright © 2013 Gang-Juan Lee et al. This is an open access article distributed under the Creative Commons Attribution License,
Nitrogen modified zinc sulfide photocatalysts were successfully prepared and characterized by X-ray diffraction (XRD),
field emission scanning electron microscopy (FE-SEM), high-resolution transmission electron microscopy (HR-TEM), X-ray
photoelectron spectroscopy (XPS), and surface area analysis. Thermal decomposition of the semisolid was carried out under
nitrogen conditions at 500∘ C for 2 hours, and a series of nitrogen-doped ZnS photocatalysts were produced by controlling inflow
flow rate of nitrogen at 15–140 mL/min. Optical characterizations of the synthesized N-doping ZnS substantially show the shifted
photoabsorption properties from ultraviolet (UV) region to visible light. The band gaps of nitrogen-doped ZnS composite catalysts
were calculated to be in the range of 2.58∼2.74 eV from the absorptions edge position. The 15N/ZnS catalyst shows the highest
photocatalytic activity, which results in 75.7% degradation of Orange II dye in 5 hrs by visible light irradiation, compared with
pristine ZnS and higher percentage N-doping ZnS photocatalysts.
1. Introduction visible light (𝜆 ≥ 420 nm), which accounts for about 43%
The photocatalytic degradation of organic pollutions present of the solar spectrum, has recently become a very important
in water and wastewater has been comprehensively investi- topic of research [5]. As visible-light-driven photocatalysts
gated with the use of photocatalysts and a solar light simulat- by doping nonmetal ions can provide more active sites and
ing source [1]. Since zinc sulfide (ZnS) is an important II–VI mechanisms on photocatalysts, those have been widely used
semiconductor with a large band gap, it has been extensively to improve the visible-light-driven photocatalytic activity [6].
studied not only for its application as a photocatalyst but also Therefore, in this paper, we attempted to prepare nitrogen-
as a device material for other purposes, such as light-emitting doped ZnS nanostructures using thermal decomposition
diodes, cathoderay tubes, thin film electroluminescence, methods to degrade Orange II dye under visible light
reflector, dielectric filter, chemical/biological sensors, and irradiation.
window layers in photovoltaic cells [2]. In addition, zinc
sulfide has the direct band gap of 3.68 eV (zinc blend) and 2. Materials and Methods
3.80 eV (wurtzite) at 300 K [3]. However, its wide band gap
restricts light absorption specifically to the wavelength of 2.1. Preparation and Modification of Nitrogen-Doped ZnS Pho-
UV less than 340 nm, where it can only take advantage of tocatalysts. Zinc chloride and potassium thiocyanate were
ultraviolet irradiation constituting only 4% of the incoming used as the source of zinc and sulfur, respectively. 12.51 g
solar light [4]. Therefore, the development of visible-light- of anhydrous ZnCl2 (Merck) was dissolved in 25 mL of
driven photocatalysts by using less energy but more abundant water, and then 50 mL of ethanol (95%) was added by
constant stirring (solution A); 20.07 g of potassium thio-
(002)
(100)
(110)
cyanate (Merck) was separately dissolved in another 25 mL
(101)
(112)
(103)
of water (solution B). Under magnetic stirring, solution B
was then added drop by drop (30 min) into solution A. 140 N/ZnS
The clear solution was stirred for another 30 min, and the
Intensity (a.u.)
solvents were evaporated on a hot plate until they became 70 N/ZnS
a semisolid, which was then transferred into a crucible
for decomposition. Thermal decomposition of the semisolid 30 N/ZnS
was carried out under nitrogen conditions at 500∘ C for
2 hours. A series of nitrogen-doped ZnS photocatalysts 15 N/ZnS
prepared by controlling the inflow flow rate of nitrogen at
15, 30, 70, and 140 mL/min denoted as 15N/ZnS, 30N/ZnS,
ZnS
70N/ZnS, and 140N/ZnS, respectively, were prepared under
nitrogen atmospheric conditions at 500∘ C. After thermal 10 20 30 40 50 60 70 80
decomposition at the desired temperature (500∘ C), the sam- 2𝜃 (deg)
ples were washed with plenty of water and methanol to
eliminate the impurities and finally dried in an oven at 60∘ C Figure 1: XRD patterns of nitrogen-doped and bare ZnS.
overnight.
2.2. Characterizations and Instruments. The X-ray diffrac-

(JCPDS card number 36-1450, the lattice parameters of 𝑎 =
tion (XRD) patterns were recorded using RigakuUltima III
3.820 Å and 𝑐 = 6.257 Å) with (100), (002), (101), (110),
diffractometer (Japan) with Cu-K𝛼1 radiation, in the scan
(103), and (112) planes were apparent for hexagonal wurtzite
angle range from 10∘ to 80∘ . The morphologies of the catalysts
crystal structure. The (002) peak intensity is stronger than
were examined by using JEOL, JSM-7401F field emission
the (100) peak when the nitrogen-doped ZnS composite
scanning electron microscope (FE-SEM). High-resolution
catalysts were prepared under different conditions. This is
transmission electron microscopic (HR-TEM) images were
due to the change in the stacking sequence of the close
recorded using JEOL JEM-2010 model. Elemental analysis
packed planes of the ZnS crystal [7]. This observation is sup-
(EA) was conducted using a PerkinElmer CS02010 elemental
ported by the TEM results, and it indicates that nanosheets
analyzer. X-ray photoelectron spectroscopy (XPS) measure-
preferential growth occurs along the 𝑐-axis. The remaining
ments were carried out using Physical Electronics PHI 5600
peaks are generally broad and probably indicate relatively
XPS instrument with monochromatic Al-K𝛼 as (1,486.6 eV)
small dimensions of the materials [8]. The (100), (002),
excitation source. The UV-visible diffuse reflectance spectra
and (101) peaks strongly overlap, implying the formation of
were recorded by a Shimadzu UV-2600 spectrophotometer
well-crystallized ZnS. At the same time, the atmospheric
equipped with an integrated sphere attachment using barium
conditions have not influenced the crystal structure of ZnS
sulfate as a reference. The concentration of the Orange II
[7].
dye was also determined by UV-2600 spectrophotometer
HR-TEM images (Figure 2(a)) of the as-synthesized cat-
equipped with a universal liquid cell attachment at the
alysts can further confirm the flowery structure of the
wavelength of 485 nm.
microspheres. The clear lattice fringes (Figure 2(b)) also
indicate the polycrystalline nature of the petals. The inter-
2.3. Photocatalytic Activity. The photocatalytic experiments planar spacing is 0.31 nm, which corresponds to the (002)
of the synthesized composite catalysts were performed in plane of wurtzite ZnS. The corresponding selected area
a 500 mL tubular quartz reactor. Catalyst dose and initial electron diffraction (SAED) patterns (Figure 2(c)) with a
dye concentration were maintained at 0.5 g/L and 40 mg/L, regular and clear ring diffraction spot array reveal that each
respectively. The experiments were carried out at neutral pH petal is polycrystalline. Moreover, the major diffraction ring
under ambient condition. Prior to experiment, the catalyst matches (100), (002), (101), (110), and (112) planes of ZnS
and dye mixtures were stirred in the dark for 1 hr to achieve phase.
adsorption equilibrium of Orange II dye on the surface of To better understand chemical states of the elements
the catalysts. For light irradiation, the photocatalytic reactor within the catalysts, XPS analyses were performed in this
was illuminated with a 350 W xenon light source, which has study. The typical XPS results are shown in Figure 3. The
a cutoff filter at wavelength 400 nm allowing visible light to peaks of S and Zn can be clearly seen in the survey spectra of
pass. all catalysts used (Figures 3(b) and 3(c)). The binding energies
of S2p3/2 and S2p1/2 at 161.1 eV and 160.2 eV (Figure 3(b)) are
3. Results and Discussion consistent with the binding energy values in the literature
[9]. Moreover, the binding energy of Zn2p3/2 and Zn2p1/2 is
3.1. Characterization of Nitrogen-Doped ZnS Photocatalysts. 1020.3 eV and 1043.3 eV (Figure 3(c)), belonging to the Zn2+
The crystallinity and crystal phase of pure ZnS and nitrogen- oxidation state in ZnS [9]. As for N, the binding energy
doped ZnS photocatalysts were characterized by XRD as of N1s at 395.9 eV belongs to atomic 𝛽-N (396 eV) [10].
shown in Figure 1. The major diffraction peaks of the ZnS According to the references, N1s peak at 396 eV is attributed
(b)
(a1)
(a) (c)
Figure 2: (a) HR-TEM images, (b) lattice fringes, and (c) the corresponding SAED pattern of 15N/ZnS.
S2p1/2
S2p3/2
Intensity (a.u.)
Intensity (a.u.)
1000 800 600 400 200 0 166 164 162 160 158 156
(a) (b)
Zn2p3/2 N1s
Zn2p1/2
Intensity (a.u.)
Intensity (a.u.)
1050 1045 1040 1035 1030 1025 1020 1015 1010 404 402 400 398 396 394 392
(c) (d)
Figure 3: The survey XPS spectra of (a) 15N/ZnS photocatalysts and the high-resolution XPS spectra of (b) S2p, (c) Zn2p, and (d) N1s of
15N/ZnS photocatalysts.
1.8 Furthermore, based on the experimental results, we con-

1.6 sidered that the formation mechanism of the as-synthesized
product of nitrogen-doped ZnS Camellia Brushfield Yellow-
1.4 like structure could be explained by a synergic effect
1.2 of Ostwald ripening and the self-assembled mechanism
Absorbance (a.u.)
as proposed in Figure 6. In the first stage, tiny crystalline

1.0
nuclei are generated in the mixed solution and grow into
0.8 nanoparticles. These nanoparticles are built and aggre-
0.6
gated into spheres to minimize their surface area through
the process known as Ostwald ripening [14, 15]. In the
0.4 second stage, the thiocyanate ion (SCN− ) coordinates with
0.2 a variety of metal ions. It can form isothiocyanate (M-NCS)
complexes that are further decomposed into metal sulfides
0.0
300 400 500 600 700 800
with high purity [9]. The thermal decomposition of the
Zn(SCN)2 complex at 500∘ C results in weakening of the
Wavelength (nm)
coordination of Zn-NCS complex, and SO2 , CO2 , and
ZnS 70 N/ZnS N2 will be released gradually [15]. Then the crystallized
15 N/ZnS 140 N/ZnS particles grow along the 2D direction, resulting in the
30 N/ZnS
formation of nanosheets as shown in Figure 2(a1). As the
Figure 4: UV-Vis absorption spectra of as-synthesized photocata- mass diffusion and Ostwald ripening process proceed, the
lysts. nanosheets can grow until all the nanoparticles are con-
sumed, accompanied by their self-organization into the
Camellia Brushfield Yellow-like structure. In addition, the
to a characteristic peak of substitutional N, resulting from the increase of inflow flowrate of nitrogen until 140 mL/min has
nitrogen substitution of sulfur in the ZnS lattice [10–12]. In resulted in the increase of N atoms in the ZnS structure.
addition, the substitutional doping of N is thought to be the According to the energy dispersive system (EDS) results
most pronounced because its 𝑝 states contribute to the band on the catalyst surface, the nitrogen atom concentration
gap narrowing by mixing with S2p states [10]. From the UV- of 15N/ZnS, 30N/ZnS, 70N/ZnS, and 140N/ZnS is 5.31%,
Vis absorption spectra results as shown in Figure 4, the band 7.88%, 12.57%, and 17.98%, respectively. To quantify the
gap of bare ZnS was calculated as 2.95 eV. The band gap of impurities of carbon in the ZnS structure, elemental anal-
nitrogen-doped ZnS composite catalysts is between 2.58 and ysis (EA) was used and the carbon impurities were found
2.74 eV. Therefore, the redshift in UV-Vis absorption spectra to be 7.0 ± 0.14% (w/w) in all as-synthesized ZnS pow-
is enhanced by the nitrogen-doped ZnS composite catalysts, ders, which implies that the thermal decomposition at
which implies the potential absorption to effectively harvest 500∘ C cannot remove the carbon impurities perfectly in the
visible light. ZnS structure, but the residual carbon concentration is
The morphology of nitrogen-doped ZnS composite cat- relatively low. The different morphology of 140N/ZnS can
alysts was characterized by FE-SEM as shown in Figure 5. be ascribed to the production of more decomposed pro-
The zinc isothiocyanate complex thermal decompositions ducts, including SO2 , CO2 , NO2 , and N2 , to go off readily
have been carried out at 500∘ C under nitrogen conditions. from the catalyst surface during the decomposition process
The ZnS photocatalysts consist of irregular spheres with [16].
an average diameter of 1 𝜇m and seem to facilitate micro-
sphere aggregation. The images in Figures 5(a)–5(e) show 3.2. Photocatalytic Activity. The photocatalytic activities of
that the nitrogen-doped ZnS Camellia Brushfield Yellow- the prepared nitrogen-doped ZnS nanoparticles were eval-
like structure comprises numerous ZnS particles (petals) and uated for the degradation of Orange II dye under visible
the nitrogen-doped ZnS crystallites are self-organized into light irradiation. Figure 7(a) shows the removal percentage
spherical assemblies, or a Camellia Brushfield Yellow-like of Orange II dye as a function of reaction time using bare
morphology, with a puffy appearance. The nitrogen-doped and nitrogen-doped ZnS catalysts. The Orange II dye concen-
ZnS products are all in this morphology with diameters tration was removed around 5.0% and 5.1% after 300 minutes
ranging from 300 to 700 nm. The gap between particles of visible-light irradiation in the presence of commercial
(petals) was observed in the average range of 100 nm. The ZnS and as-synthesized bare ZnS, respectively. The opti-
nitrogen-doped ZnS flower is quite open and puffy with mal degradation ratio of Orange II dye using 15N/ZnS
ZnS particles (petals) that have good crystallinity [13]. When photocatalyst was found to be 75.7% after 300-minute irra-
the nitrogen flowrate was increased from 15 to 140 mL/min, diation. However, the increase of nitrogen-doped amount
the morphology of the nitrogen-doped ZnS nanoparticles on the ZnS photocatalyst would result in the decrease
became more rough as seen in Figures 5(a)–5(e). Figure 5(f) of dye removal. The efficient removal of Orange II dye
clearly indicates that the flowery structures, from which using visible-light photocatalysis by nitrogen-doped ZnS can
one can see that dozens of 2D sheets are intercrossed with be attributed to the response from occupied N2p locali-
each other, have been formed throughout their self-assembly zed states slightly above the valence band edge [11]. The
mechanisms. decrease in photocatalytic activity observed in the higher
100 nm 100 nm
(a) (b)
100 nm 100 nm
(c) (d)
100 nm 100 nm
(e) (f)
Figure 5: FE-SEM images of (a) ZnS, (b) 15N/ZnS, (c) 30N/ZnS, (d) 70N/ZnS, and (e) 140N/ZnS photocatalysts.
nitrogen-doping ZnS, such as 140N/ZnS powder, may be 1.09 × 10−3 min−1 , and 1.80 × 10−4 min−1 , respectively, using
attributed to a change in the crystal structure of the sample 15N/ZnS, 30N/ZnS, 70N/ZnS, 140N/ZnS, and bare ZnS pho-
caused by the high doping of N in the crystal, though we tocatalysts. The results indicate that the N-doping ZnS shows
did not find a noticeable change in XRD. As a result, such better photocatalytic activity than bare ZnS under visible
a surface roughness can function as traps for photogenerated light irradiation due to the shorter band gap. However, the
electrons and holes, reducing the efficiency of photocatalysis increase of N-doping will negate the efficiency by its surface
[17]. roughness.
Furthermore, the decomposition process is modeled as
a pseudo-first-order reaction with the kinetics expressed 4. Conclusions
by the equation ln(𝐶0 /𝐶𝑡 ) = 𝑘𝑡, where 𝐶0 represe-
nts the initial concentration, 𝐶𝑡 denotes the concentra- In summary, we have successfully synthesized nitrogen-
tion at a given reaction time (𝑡), and 𝑘 is the reaction doped ZnS composite catalysts with the Camellia Brush-
rate constant. From the linear extrapolations as shown in field Yellow-like structure. The obtained surface and optical
Figure 5(b), the reaction rate constants were calculated as characteristics demonstrate that the nitrogen-doped ZnS can
4.63 × 10−3 min−1 , 3.04 × 10−3 min−1 , 1.41 × 10−3 min−1 , act as a good visible-light-driven photocatalyst. Their visible
Aggregation
Thermal
Evaporation decomposition
Zn(SCN)2 complex Self-assembly
(d) 140 N/ZnS (c) 70 N/ZnS (b) 30 N/ZnS (a) 15 N/ZnS
(c1) (b1) (a1)
100 nm 100 nm 100 nm
(d1) (c1) (b1) (a1)

2+
Zn CH3 CH2 OH
−
SCN Bubble (SO2 , CO2 , N2 , NO2 )
Figure 6: Schematic illustration of possible growth mechanism of nitrogen-doped ZnS Camellia Brushfield Yellow-like structure.
1.1 1.6
1.0 1.4 k = 4.63 × 10−3 min−1
Relative concentration (Ct /C0 )
0.9 1.2
0.8 1.0
k = 3.04 × 10−3 min−1
ln(C0 /Ct )
0.7 0.8
0.6
0.6
k = 1.41 × 10−3 min−1
0.5
0.4
0.4
0.2 k = 1.09 × 10−3 min−1
0.3
0.0
0.2 k = 1.80 × 10−4 min−1 k = 1.80 × 10−4 min−1
−0.2
0 50 100 150 200 250 300 0 50 100 150 200 250 300
ZnS 70 N/ZnS ZnS 70 N/ZnS
15 N/ZnS 140 N/ZnS 15 N/ZnS 140 N/ZnS
30 N/ZnS Commercial ZnS 30 N/ZnS Commercial ZnS
(a) (b)
Figure 7: (a) Photocatalytic degradation of Orange II dye in the presence of bare and different nitrogen-doped ZnS photocatalysts; (b) plot of
ln(𝐶0 /𝐶𝑡 ) versus time for photocatalytic degradation of Orange II dye in presence of bare and different nitrogen-doped ZnS photocatalysts.
light assisted photocatalytic ability has been shown by the Acknowledgments

degradation of azo dye Orange II. The effect of nitrogen- The authors wish to acknowledge the financial support by
doped amount on the photocatalytic on the removal of the National Science Council in Taiwan with the Grant no.
Orange II dye suggests that 15N/ZnS is the optimum loading NSC-101-2221-E-035-031-MY3. The support in providing the
for better photocatalytic ability. fabrication and measurement facilities from the Precision
Instrument Support Center of Feng Chia University is also [15] M. Muruganandham, Y. Kusumoto, C. Okamoto, A. Muruga-
acknowledged. nandham, M. Abdulla-Al-Mamun, and B. Ahmmad, “Minera-
lizer-assisted shape-controlled synthesis, characterization, and
photocatalytic evaluation of CdS microcrystals,” The Journal of
References Physical Chemistry C, vol. 113, no. 45, pp. 19506–19517, 2009.
[1] D. I. Kondarides, A. Patsoura, and X. E. Verykios, “Anaerobic [16] M. Muruganandham, A. Ramakrishnan, Y. Kusumoto, and M.
photocatalytic oxidation of carbohydrates in aqueous pt/TiO2 Sillanpää, “Are dopant-stabilized visible light-responsive pho-
suspensions with simultaneous production of hydrogen,” Jour- tocatalysts efficient and stable?” Physical Chemistry Chemical
nal of Advanced Oxidation Technologies, vol. 13, no. 1, pp. 116– Physics, vol. 12, no. 44, pp. 14677–14681, 2010.
123, 2010. [17] K. Maeda and K. Domen, “Solid solution of GaN and ZnO as
[2] S. K. Maji, A. K. Dutta, D. N. Srivastava, P. Paul, A. Mondal, and a stable photocatalyst for overall water splitting under visible
B. Adhikary, “Effective photocatalytic degradation of organic light,” Chemistry of Materials, vol. 22, no. 3, pp. 612–623, 2010.
pollutant by ZnS nanocrystals synthesized via thermal decom-
position of single-source precursor,” Polyhedron, vol. 30, no. 15,
pp. 2493–2498, 2011.
[3] M. Navaneethan, J. Archana, K. D. Nisha et al., “Synthesis of
wurtzite ZnS nanorods by microwave assisted chemical route,”
Materials Letters, vol. 66, no. 1, pp. 276–279, 2012.
[4] J. Zhu and M. Zäch, “Nanostructured materials for photocat-
alytic hydrogen production,” Current Opinion in Colloid and
Interface Science, vol. 14, no. 4, pp. 260–269, 2009.
[5] N. Bao, L. Shen, T. Takata, and K. Domen, “Self-templated
synthesis of nanoporous CdS nanostructures for highly efficient
photocatalytic hydrogen production under visible light,” Chem-
istry of Materials, vol. 20, no. 1, pp. 110–117, 2008.
[6] X. Chen, S. Shen, L. Guo, and S. S. Mao, “Semiconductor-
based photocatalytic hydrogen generation,” Chemical Reviews,
vol. 110, no. 11, pp. 6503–6570, 2010.
[7] M. Muruganandham and Y. Kusumoto, “Synthesis of N, C
codoped hierarchical porous microsphere ZnS as a visible light-
responsive photocatalyst,” The Journal of Physical Chemistry C,
vol. 113, no. 36, pp. 16144–16150, 2009.
[8] S. K. Maji, A. K. Dutta, D. N. Srivastava, P. Paul, A. Mondal, and
B. Adhikary, “Effective photocatalytic degradation of organic
pollutant by ZnS nanocrystals synthesized via thermal decom-
position of single-source precursor,” Polyhedron, vol. 30, no. 15,
pp. 2493–2498, 2011.
[9] Y. Liu, J. Hu, C. Ngo et al., “Gram-scale wet chemical synthesis of
wurtzite-8H nanoporous ZnS spheres with high photocatalytic
activity,” Applied Catalysis B: Environment, vol. 106, no. 1-2, pp.
212–219, 2011.
[10] R. Asahi, T. Morikawa, T. Ohwaki, K. Aoki, and Y. Taga,
“Visible-light photocatalysis in nitrogen-doped titanium
oxides,” Science, vol. 293, no. 5528, pp. 269–271, 2001.
[11] F. Peng, L. Cai, H. Yu, H. Wang, and J. Yang, “Synthesis
and characterization of substitutional and interstitial nitrogen-
doped titanium dioxides with visible light photocatalytic activ-
ity,” Journal of Solid State Chemistry, vol. 181, no. 1, pp. 130–136,
2008.
[12] H. Gao, J. Zhou, D. Dai, and Y. Qu, “Photocatalytic activity
and electronic structure analysis of N-doped anatase TiO2 :
a combined experimental and theoretical study,” Chemical
Engineering and Technology, vol. 32, no. 6, pp. 867–872, 2009.
[13] B. B. Kale, J.-O. Baeg, S. M. Lee, H. Chang, S.-J. Moon, and C.
W. Lee, “CdIn2 S4 nanotubes and “marigold” nanostructures: a
visible-light photocatalyst,” Advanced Functional Materials, vol.
16, no. 10, pp. 1349–1354, 2006.
[14] L. Zhou, W. Wang, H. Xu, S. Sun, and M. Shang, “Bi2 O3 hier-
archical nanostructures: controllable synthesis, growth mech-
anism, and their application in photocatalysis,” Chemistry—A
European Journal, vol. 15, no. 7, pp. 1776–1782, 2009.
http://dx.doi.org/10.1155/2013/245646
Research Article
Multifunctional Chitosan-Copper Oxide Hybrid Material:
Photocatalytic and Antibacterial Activities
Yuvaraj Haldorai and Jae-Jin Shim

School of Chemical Engineering, Yeungnam University, Gyeongsan, Gyeongbuk 712-749, Republic of Korea
Correspondence should be addressed to Yuvaraj Haldorai; yuvraj pd@yahoo.co.in
Received 28 May 2013; Accepted 18 August 2013
Copyright © 2013 Y. Haldorai and J.-J. Shim. This is an open access article distributed under the Creative Commons Attribution
cited.
Chitosan (CS) anchored copper oxide (CuO) hybrid material was prepared by chemical precipitation method. Fourier transform
infrared spectroscopy (FT-IR) and X-ray diffraction (XRD) confirmed the formation of CS-CuO hybrid. Transmission electron
microscopy (TEM) analysis showed the immobilization of CuO nanoparticles on the surface of CS. The hybrid was also
characterized by thermogravimetric analysis (TGA) and zeta potential. The hybrid exhibited high photocatalytic activity as evident
from the degradation of methylene blue (MB) dye. The result revealed substantial degradation of the MB dye (84%) under UV-light
illumination. The antibacterial activity of hybrid against Escherichia coli was examined by colony forming units. It was proved that
the CS encapsulated CuO hybrid exhibited excellent antibacterial activity.
1. Introduction obtained from deacetylation of chitin seems to offer numer-

ous distinct advantages [6]. CS is a super high-capacity
In general, nanotechnology can be understood as a technol-
adsorbent for contaminant removal in water with adsorption
ogy of design, fabrication, and applications of nanostructures
and nanomaterials. Nanometer size structures are an inter- capacity of 1000–1100 g Kg−15 which is higher than the acti-
mediate form of matter which exhibit exotic physical and vated carbon [7]. This high adsorption of CS is due to the
chemical properties different from those observed in bulk binding ability of CS with contaminants through hydroxyl
three-dimensional materials. Nanoscale oxides of transition and amino groups on the surface. The regeneration of CS
metals are gaining continuous importance for various appli- by acid or base is a simple and cost effective, but the appli-
cations such as catalysts, passive electronic components, and cation of acid or base for CS regeneration is not technically
ceramic materials [1, 2]. From an environmental standpoint, advantageous. The large amount of wastewater generated
heterogeneous photocatalysis is a significant cutting-edge from regeneration process needs further treatment making
technology for application in water purification [3]. The inter- the process unsustainable [8, 9]. So, the immobilization of
est in the study of biopolymer has witnessed a steady increase, photocatalyst onto the CS aids in removal of contaminants
because they are environmentally friendly alternatives to adsorbed by the CS and also gives antibacterial materials with
synthetic, nonbiodegradable polymers. However, the poor improved functional properties.
regeneration and reuse of biopolymers have limited their Cupric oxide (CuO), a p-type semiconductor with mon-
adsorption properties, which may be improved by adding oclinic structure is an interesting multifunctional material
reinforcing compounds (fillers) and forming composites due to its promising applications in magnetic storage, solar
[4]. The immobilization of an appropriate catalyst onto energy transformation, electronics, sensors, batteries, and
the surface of a natural biopolymer provides a number of catalysis [10]. CuO crystal structure possesses a narrow band
additional advantages including low-cost, high adsorption, gap due to which it has useful photocatalytic or photovoltaic
high catalytic activity, and extensive potential for reuse [5]. properties as well as photoconductive functionalities [11].
In this regard, chitosan (CS), a linear cationic, pH sensi- CuO nanoparticles with various morphologies have been
tive, nontoxic, biodegradable, biocompatible polysaccharide developed by numerous methods like oxidation of copper at
high temperature, reverse micelle, surfactant templates, solid was centrifuged to remove any suspended solid catalyst. The
state reactions, hydrothermal and thermal decomposition residual concentration of dye was measured using a Jasco V-
method [10, 12–15]. The immobilization of CuO onto CS 650 UV-visible spectrophotometer.
resolves the recollection and reuses limitation of CuO to
remove the contaminants adsorbed by CS in situ without 2.4. Antibacterial Activity. E. coli was grown in a nutrient agar
use of acid or base and generating secondary pollutants (DIFCO 0001) containing 3 g/L beef extract, 5 g/L peptones,
and sterilizes pathogens. Recently, Gouda and Hebeish [16] and 15 g/L agar in distilled water. pH of the medium was
prepared chitosan/CuO nanocomposite and investigated its adjusted to 7.0. The antibacterial activity of the CS-CuO
antibacterial activity. hybrid was evaluated through colony forming units (CFU)
In this study, we synthesized a multifunctional mate- count method. Freeze-dried sample of hybrid was sliced into
rial CS-CuO to meet the need of high adsorption, self- small pieces and sterilized at 121∘ C for 15 min. 9 mL of the
regeneration, easy separation, and cost-effective dye removal growth medium for E. coil was added to separate test tubes,
from aqueous solution with enhanced antimicrobial property. and 0.03 g/mL of finely sliced solid hybrid samples was added
The CS-CuO hybrid synthesized by precipitation method is to each of the test tubes. The tubes were then seeded with 1 mL
characterized by FT-IR, XRD, zeta potential, and TEM. The fresh culture of E. coli and incubated at 37∘ C for 12 h. Samples
CS-CuO hybrid as a reusable photocatalyst was examined were taken after 6, 12, 18, and 24 h for CFU determination.
through photodegradation of MB dye. The high antibacterial The sample was diluted with saline water and cultured on
activity of CS-CuO hybrid against E. coli is explored. Thus agar plates for 12 h. The CFU was determined by counting the
this novel CS-CuO hybrid has great potential to be used as an colonies on agar plates, and mean values were presented from
economic, environmental friendly, and sustainable material at least 3 experiments.
for dye removal with enhanced antimicrobial activity.
2.5. Characterization. Fourier transform infrared (FT-IR)
2. Experimental spectroscopy was performed using a Jasco FT/IR-620 FT-IR
spectrometer. The phase and crystallinity were characterized
2.1. Materials. Chitosan (CS) with degree of acetylation
by using a Rigaku D/max-2500 X-ray diffractometer (XRD)
85% and molecular weight 2.6 × 105 was purchased from
with Cu K𝛼 radiation in the 2𝜃 range of 10–80∘ . Thermogravi-
Aldrich. Copper nitrate trihydrate (Cu(NO3 )2 ⋅3H2 O), so-
metric analysis (TGA) was performed on a Setaram thermal
dium hydroxide (NaOH), acetic acid (CH3 COOH), and
analyzer (TGA-DSC EVO, France) from 20 to 800∘ C at a
methylene blue (MB) were of analytical grade and purchased
heating rate of 10∘ C/min under nitrogen atmosphere. Zeta
from Aldrich. Beef extract, peptone, and agar powder were
potential analysis was measured using a Malvern Zetasizer
of bacteriological grade, and Escherichia coli (E. coli) (KCCM
Nano instrument with a laser light of wavelength 633 nm at
12119) was used as a model organism for evaluation of the
25∘ C under the Smoluchowski approximation. Microscopic
antibacterial activity. Deionized water was used throughout
images were obtained using a Hitachi H-7600 transmission
the studies.
electron microscope with an accelerating voltage of 100 kV.
2.2. Preparation of CS-CuO Hybrid. The CS-CuO hybrid was Ultraviolet-visible spectra (UV-vis) were recorded using a
prepared according to the procedure given in the literature Jasco V-650 spectrophotometer.
[17]. In a typical experiment, 1 g of CuO nanoparticles
prepared by thermal decomposition of Cu(NO3 )2 ⋅3H2 O at 3. Results and Discussion
350∘ C for 2 h was dispersed in 100 mL of 1% (v/v) acetic acid,
where CuO changed into copper cations. To this, 1 g of CS Scheme 1 shows the proposed mechanism for the formation
was added and sonicated for 30 min and stirred continuously of CS-CuO hybrid. The process involved two steps. The
until the clear sol was obtained. NaOH solution (1 M) was first step is the dispersion of CS and CuO nanoparticles in
then added dropwise until the solution attained pH 10. The acetic acid solution, where CuO dissolved and changed into
precipitate obtained was heated at 80∘ C for 5 h and then copper cations (Cu2+ ). The Cu2+ ions immediately formed
filtered, washed with excess of water and dried in a vacuum coordination bonds with –OH and –NH2 groups of CS chains
oven at 60∘ C for overnight. [18]. In the second step, pH of the solution was increased to 10
by the dropwise addition of NaOH. The precipitate obtained
2.3. Photocatalytic Degradation of MB Dye. Methylene blue was heated at 80∘ C for 5 h, where the Cu2+ ions transformed
(MB) dye was used as a probe molecule to evaluate the into CuO. The possible formation reactions of CuO are given
photocatalytic activity of hybrid. The photocatalytic reaction below [19, 20]. The homogeneous dispersion of Cu2+ in the CS
was conducted at room temperature under UV light at a sol aids in the generation of homogeneous CS-CuO hybrid.
wavelength of 365 nm. In a typical experiment, 0.4 mg of CS- Consider
CuO hybrid was added into the water (10 mL) containing
Cu2+ + OH− 󳨀→ Cu–O–H+
0.2 mg of MB dye, followed by the addition of 1 mL H2 O2 . (1)
Prior to the irradiation, the suspension was magnetically Cu–O–H+ + OH− 󳨀→ CuO + H2 O
stirred in the dark for 30 min to establish the adsorp-
tion/desorption equilibrium of MB. A 2 mL of the sample was Figure 1 shows the FT-IR spectra of pure CS and CS-
withdrawn for every 10 min. Before analysis, the suspension CuO hybrid. The spectrum of pure CS exhibited a band
Cu2+
CH2 OH CH2 OH
O O
H CuO H
O O O O
OH H CH3 COOH OH H
2+
Cu
H NH2 H NH2
CS
Cu2+
NaOH
CuO Cs–OH+
CH2 OH CH2 OH
O O
H Δ, 80∘ C H
O O O O
OH H OH H
+
CuO Cs–OH
H NH2 H NH2
CuO Cs–OH+
Cs–CuO hybrid
Scheme 1: Schematic representation for the synthesis of CS-CuO hybrid.
at 3370 cm−1 was due to the stretching vibrations of –OH The thermal stability of CS and CS-CuO hybrid was
and –NH groups. The peak at 2876 cm−1 was attributed examined by TGA from 20–800∘ C under N2 atmosphere, as
to the asymmetric stretching of –CH group in polymer, illustrated in Figure 3. The two samples followed a similar
1650 cm−1 indicated the amide I group (C–O stretching decomposition trend. The as-synthesized polymer exhibited a
along the N–H deformation), 1578 cm−1 was due to –NH two-step weight loss. The first weight loss (around 10%) step
deformation, 1424 cm−1 showed the C–N axial deforma- in the TGA curve below 100∘ C was attributed to the loss of
tion (amine group), 1375 cm−1 was attributed to the COO– water. The second rapid major mass loss step in the range
of 200–500∘ C was assigned to the complex dehydration of
group in carboxylic acid salt, 1152 cm−1 showed the special
the saccharide rings, depolymerization, and decomposition
peak of 𝛽(1-4) glycosidic bond in polysaccharide unit, and
of the acetylated and deacetylated units of the polymer [25].
1047 cm−1 was assigned to the stretching vibration of C–
However, it was found that the thermal stability of hybrid was
O–C in glucose circle [21]. The CS-CuO hybrid displayed
higher than the pure CS which was obviously related to the
the characteristic bands of both CS and CuO. The band at
existence of thermally stable CuO. The residual mass left at
520 cm−1 was ascribed to the stretching mode of Cu–O [22].
800∘ C was found to be 30.4% and 61.5% for the CS and CS-
When compared to the pure CS, the bands corresponding
CuO hybrid, respectively.
to the hydroxyl, amino and amide groups in the spectrum
Zeta potential, that is, surface charge, can greatly influ-
of hybrid were shifted. The shift of IR bands confirmed the
ence the particle stability in suspension through electrostatic
interaction between the CS and CuO nanoparticles.
repulsion between particles. Zeta potential measurement is
Figure 2 shows the X-ray diffraction patterns of CS and used to analyze the nanoparticle interaction with the cell
CS-CuO hybrid. The broad peak at 19.77∘ in the XRD pattern membrane of bacteria, which is negatively charged. Figure 4
of CS showed that the polymer is amorphous [23]. In the shows the zeta potential measurement of CS-CuO hybrid.
hybrid, we observed both the CS and CuO diffraction peaks. The hybrid has a positive surface charge of about 51.5 mV,
The peaks that appeared at 32.8, 35.9, 36.25, 39.1∘ , 49.1, 53.5, while that of CuO has a negative surface charge of −32.1 mV.
58.4, 62.0, 66.4, 68.3, 72.5, and 75.4∘ in the hybrid were For CS, the positive zeta potential results from the presence
assigned to (110), (111), (111), (202), (020), (202), (113), (311), of protonated amine groups. When negatively charged CuO
(220), (311), and (004) planes of CuO with high crystallinity reacts with the positively charged CS, the net zeta potential
[24]. The diffraction peaks of CuO are in good agreement decreases. The shift may be attributed to the blockage of active
with the monoclinic CuO (JCPDS card 05-0661). The result sites on the surface of CuO nanoparticles by the adsorption
proved the successful formation of CS-CuO hybrid. of polymer chain.
Intensity (a.u.)
Cu–O
Transmittance (%)
10 20 30 40 50 60 70 80
2𝜃 (deg)
–CH CS–CuO
CS
–CN C=O
Figure 2: X-ray diffraction patterns of CS and CS-CuO hybrid.
–NH
–COO
–NH, –OH
100
C–O–C
80
500 1000 1500 2000 2500 3000 3500 4000
−1
Wavenumber (cm )
Weight (%)
60
CS–CuO
CS
40
Figure 1: FT-IR spectra of CS and CS-CuO hybrid.
20
The direct evidence for the immobilization of CuO
nanoparticles on the surface of CS was analyzed by TEM 0
(Figure 5). The image showed that the spherical CuO 0 200 400 600 800
nanoparticles exist on the CS surface with almost uni- Temperature (∘ C)
form distribution. The dark areas represent the crystalline CS
CuO nanoparticles, while the bright areas represent the CS–CuO
amorphous CS, owing to the high electron density of the
CuO nanoparticles. The interaction between CS and CuO Figure 3: TGA curves of CS and CS-CuO hybrid.
enhanced the properties of CS-CuO hybrid.
As a demonstration of application of such CS-CuO
hybrid, MB was chosen as a representative organic dyestuff to of a photocatalyst, the dye was degraded slowly by H2 O2
evaluate the photocatalytic performance. Figure 6(a) shows (20%). It is seen that the degradation of the dye was greatly
the typical time-dependent UV-vis absorption spectra of the enhanced in the presence of photocatalyst, indicating the
MB dye solution during the photodegradation in the presence excellent photocatalytic activity of CS-CuO hybrid. However,
of CS-CuO hybrid with the aid of H2 O2 . It is seen that dye the hybrid exhibited no obvious photocatalytic activity in the
exhibited a maximum absorption peak at around 653 nm. absence of H2 O2 (data not shown). According to the previous
Note that color of the dye solutions becomes less intense, and report [26], the possible mechanism for the degradation of
the intensity of absorption spectra decreases gradually with MB dye may be proposed as follows: the photodecomposition
increasing the irradiation time, indicating that a strong oxi- of H2 O2 forms a certain amount of OH radicals in the
dation of dye has occurred in the presence of CS-CuO hybrid presence of CuO first, and then these OH radicals degrade the
under UV irradiation. All these observations indicated that MB dye into CO2 , H2 O, and other mineralization through a
CS-CuO hybrid exhibited excellent performance for the series of redox reactions.
degradation of dye. Figure 6(b) shows the photocatalytic On the other hand, there is a possibility of dye degra-
performance of various catalysts for the degradation of MB dation by a Fenton-like process. Generally, the Fenton-
dye in the presence of H2 O2 . Approximately 84% of the dye like process (Cu2+ /H2 O2 ) showed lower dye degradation
was degraded by the hybrid within 30 min. In the absence than the conventional Fenton reaction (Fe2+ /H2 O2 ) [27]. In
×105
×105
2.8
3.6
3.2 2.4
2.8
2.0
Total counts
2.4
Total counts
1.6
2.0
1.6 1.2
1.2
0.8
0.8
0.4
0.4
0.0
0 20 40 60 80 100 −100 −50 0 40
Zeta potential (mV) Zeta potential (mV)
(a) (b)
Figure 4: Zeta potential measurement of (a) CS-CuO hybrid and (b) CuO at pH 7.
CS
CuO
(a) (b)
Figure 5: TEM images of CS-CuO hybrid (a) long view and (b) close inspection.
this system, the Cu2+ ions present in the aqueous solution In general, the kinetics of photocatalytic degradation of
immediately form coordination bonds with –OH and –NH2 organic pollutant on the semiconducting oxide has been
groups of CS chains. Therefore, the Cu2+ ions were not established and can be described well by the apparent first
available for Fenton-like reaction. In other words, there was order reaction:
no direct reaction between Cu2+ and H2 O2 .
Furthermore, the photostability of the CS-CuO hybrid 𝐶0
ln ( ) = 𝑘app × 𝑡, (2)
was examined based on its photocatalytic performance 𝐶
under UV-light irradiation with three cycles, as shown in
Figure 6(c). After three recycles, the catalyst did not exhibit where 𝑘app is the apparent rate constant, 𝐶0 is the initial
any significant loss of activity, indicating its high stability concentration of the dye, and 𝐶 is the concentration of dye
during photodegradation process. at time t.
1.0
1.0
0.8
0.8
Absorbance (a.u.)
0.6
0.6
C/C0
0.4
0.4
0.2 0.2
0.0 0.0
550 600 650 700 750 800 0 5 10 15 20 25 30
Wavelength (nm) Time (min)
Before UV irradiation 20 min CS–CuO
10 min 30 min Without catalyst
CuO
(a)
(b)
2.0
100
1.6
80
1.2
Efficiency (%)
In(C0 /C)
60
0.8
40
20 0.4
0 0.0
1 2 3 0 10 20 30
Number of cycles Time (min)
(c) (d)
Figure 6: (a) UV-visible spectra of the MB solution in the presence of CS-CuO hybrid at different UV-irradiation time, (b) photodegradation
of the MB dye, (c) photostability of the hybrid after three cycles, and (d) first order kinetic model for the photodegradation of MB.
Figure 6(d) shows the apparent rate constant of MB dye Table 1: Antibacterial activity of CS-CuO hybrid against E. coli.
in the presence of photocatalyst under UV-light irradiation.
CS CS-CuO
The linear correlation of the plot of ln(𝐶0 /C) versus time Incubation
suggested a pseudo-first-order reaction for the dye. The CFU Reduction in CFU Reduction in
time (h)
(mL−1 ) viability (%) (mL−1 ) viability (%)
apparent rate constant (𝑘app ) was determined as 0.059 min−1 .
0 28 × 105 0 28 × 105 0
The collective results of the viability of E. coli after being
treated with CS and CS-CuO hybrid are presented in Table 1. 6 6.9 × 105 75.36 27 × 103 99.0
The viable bacteria were monitored by counting the number 12 1.1 × 106 60.72 19 × 103 99.3
of CFU. As witnessed from Table 1, it is clear that the control 18 1.9 × 106 32.15 11 × 103 99.6
CS sample inactivated the E. coli strain by 7% after 24 h of 24 2.6 × 106 7.15 2 × 102 99.9
treatment which showed that almost all bacteria were alive
after 24 h. On the other hand, the CS-CuO hybrid inactivated
the E. coli strain by 99% after 6 h of treatment. Under the
same conditions only 0.7% of survivors were found after 12 h, result, the digital photographs of control and E. coli treated
and complete reduction was observed at 24 h. To visualize the with CS-CuO hybrids for 12 h (since the bacteria grow in
(a) (b)
Figure 7: Digital photographs of E. coli (a) without and (b) with CS-CuO hybrid for 12 h.
12 h) are shown in the Figure 7. The result indicated that Acknowledgment

the excellent reduction in the growth of bacteria confirmed
the enhanced antibacterial activity of the hybrid. The E. coli This research was supported by Basic Science Research
tended to be inactivated in a similar manner regarding the Program through the National Research Foundation of Korea
time of treatment. The antimicrobial mechanism of the CS (NRF) funded by the Ministry of Education, Science and
was attributed to the interaction with the strongly electroneg- Technology (2012009529).
ative microbial surface [16]. The CS doped with CuO showed
enhanced antibacterial activity which perhaps attributed to References
the synergistic effect of the CS and CuO nanoparticles. The
Gram-negative bacteria have a thin layer of peptidoglycan [1] C. Burda, X. B. Chen, R. Narayanan, and M. A. El-Sayed,
and more complex cell wall with two cell membranes and “Chemistry and properties of nanocrystals of different shapes,”
outer membrane and a plasma membrane. The positively Chemical Reviews, vol. 105, no. 4, pp. 1025–1102, 2005.
charged CS-CuO hybrid interacts with negatively charged [2] S. J. Guo and E. K. Wang, “Functional micro/nanostructures:
lipidic bacterial membrane and thus changes its permeability, simple synthesis and application in sensors, fuel cells, and gene
blocking the cells from nutrient intake, and thus ultimately delivery,” Accounts of Chemical Research, vol. 44, no. 7, pp. 491–
500, 2011.
affecting the cell growth and viability. It is also worth noting
that the potential antibacterial activity of CS-CuO hybrid [3] X. Zhao, L. Lv, B. Pan, W. Zhang, S. Zhang, and Q. Zhang,
could be due to reactive oxygen species generation by the “Polymer-supported nanocomposites for environmental appli-
cation: a review,” Chemical Engineering Journal, vol. 170, no. 2-3,
nanoparticles attached to the bacterial cells, which in turn
pp. 381–394, 2011.
provoked an enhancement of intracellular oxidative stress
[4] S. Sarkar, E. Guibal, F. Quignard, and A. K. SenGupta, “Polymer-
[10]. Therefore, our system showed much more efficient
supported metals and metal oxide nanoparticles: synthesis,
bactericidal activity for the sterilization of E. coli in an characterization, and applications,” Journal of Nanoparticle
ordinary living space. Research, vol. 14, no. 2, article 715, 2012.
[5] J. D. Torres, E. A. Faria, J. R. SouzaDe, and A. G. S. Prado,
4. Conclusion “Preparation of photoactive chitosan-niobium (V) oxide com-
posites for dye degradation,” Journal of Photochemistry and
In this study, the CS-CuO hybrid was prepared by chemical Photobiology A, vol. 182, no. 2, pp. 202–206, 2006.
precipitation method. The FT-IR spectrum endorsed the
[6] E. I. Rabea, M. E.-T. Badawy, C. V. Stevens, G. Smagghe, and W.
formation of hybrid. The thermal stability and crystallinity Steurbaut, “Chitosan as antimicrobial agent: applications and
of the hybrid were studied by XRD and TGA. Zeta potential mode of action,” Biomacromolecules, vol. 4, no. 6, pp. 1457–1465,
and TEM analysis confirmed the immobilization of CuO 2003.
nanoparticle on the surface of CS. The hybrid catalyst showed [7] Z. Liu, H. Bai, and D. D. Sun, “Facile fabrication of porous
a high photocatalytic activity of 84% for the photodegrada- chitosan/TiO2 /Fe3 O3 microspheres with multifunction for
tion of the MB dye under UV-light irradiation for 30 min. water purifications,” New Journal of Chemistry, vol. 35, no. 1, pp.
The result showed that the repeated use of recycled CS-CuO 137–140, 2011.
hybrid (three times) did not affect its photocatalytic activity [8] V. Singh, A. K. Sharma, and R. Sanghi, “Poly(acrylamide)
significantly. In addition, the hybrid material exhibited a functionalized chitosan: an efficient adsorbent for azo dyes from
superior antibacterial activity of 99% within 6 h of treatment aqueous solutions,” Journal of Hazardous Materials, vol. 166, no.
against E. coli which was measured by CFU. 1, pp. 327–335, 2009.
[9] V. Singh, A. K. Sharma, D. N. Tripathi, and R. Sanghi, [25] C. Peniche-Covas, W. Argüelles-Monal, and J. San Román, “A
“Poly(methylmethacrylate) grafted chitosan: an efficient adsor- kinetic study of the thermal degradation of chitosan and a
bent for anionic azo dyes,” Journal of Hazardous Materials, vol. mercaptan derivative of chitosan,” Polymer Degradation and
161, no. 2-3, pp. 955–966, 2009. Stability, vol. 39, no. 1, pp. 21–28, 1993.
[10] G. Applerot, J. Lellouche, A. Lipovsky et al., “Understanding the [26] H. Yu, J. Yu, S. Liu, and S. Mann, “Template-free hydrother-
antibacterial mechanism of CuO nanoparticles: revealing the mal synthesis of CuO/Cu2 O composite hollow microspheres,”
route of induced oxidative stress,” Small, vol. 8, no. 21, pp. 3326– Chemistry of Materials, vol. 19, no. 17, pp. 4327–4334, 2007.
3337, 2012. [27] A. Aguiar and A. Ferraz, “Fe3+ - and Cu2+ -reduction by phenol
[11] G. Ren, D. Hu, E. W. C. Cheng, M. A. Vargas-Reus, P. Reip, and derivatives associated with Azure B degradation in Fenton-like
R. P. Allaker, “Characterisation of copper oxide nanoparticles reactions,” Chemosphere, vol. 66, no. 5, pp. 947–954, 2007.
for antimicrobial applications,” International Journal of Antimi-
crobial Agents, vol. 33, no. 6, pp. 587–590, 2009.
[12] X. C. Jiang, T. Herricks, and Y. N. Xia, “CuO nanowires can be
synthesized by heating copper substrates in air,” Nano Letters,
vol. 2, no. 12, pp. 1333–1338, 2002.
[13] M. H. Cao, C. W. Hu, Y. H. Wang et al., “A controllable synthetic
route to Cu, Cu2 O, and CuO nanotubes and nanorods,” Chem-
ical Communications, vol. 9, no. 15, pp. 1884–1885, 2003.
[14] Z. L. Wang, X. Y. Kong, X. Wen, and S. Yang, “In situ structure
evolution from Cu(OH)2 nanobelts to copper nanowires,”
Journal of Physical Chemistry B, vol. 107, no. 33, pp. 8275–8280,
2003.
[15] C. K. Xu, Y. K. Liu, G. D. Xu, and G. H. Wang, “Preparation and
characterization of CuO nanorods by thermal decomposition of
CuC2 O4 precursor,” Materials Research Bulletin, vol. 37, no. 14,
pp. 2365–2372, 2002.
[16] M. Gouda and A. Hebeish, “Preparation and evaluation of
CuO/chitosan nanocomposite for antibacterial finishing cotton
fabric,” Journal of Industrial Textiles, vol. 39, no. 3, pp. 203–214,
2010.
[17] Y. Haldorai and J.-J. Shim, “Chitosan-zinc oxide hybrid com-
posite for enhanced dye degradation and antibacterial activity,”
Composite Interfaces, vol. 20, no. 5, pp. 365–377, 2013.
[18] A. Higazy, M. Hashem, A. ElShafei, N. Shaker, and M. A. Hady,
“Development of antimicrobial jute packaging using chitosan
and chitosan-metal complex,” Carbohydrate Polymers, vol. 79,
no. 4, pp. 867–874, 2010.
[19] L.-H. Li, J.-C. Deng, H.-R. Deng, Z.-L. Liu, and X.-L. Li,
“Preparation, characterization and antimicrobial activities of
chitosan/Ag/ZnO blend films,” Chemical Engineering Journal,
vol. 160, no. 1, pp. 378–382, 2010.
[20] S. Sepulveda-Guzman, B. Reeja-Jayan, E. de la Rosa, A. Torres-
Castro, V. Gonzalez-Gonzalez, and M. Jose-Yacaman, “Synthe-
sis of assembled ZnO structures by precipitation method in
aqueous media,” Materials Chemistry and Physics, vol. 115, no.
1, pp. 172–178, 2009.
[21] F. Tian, Y. Liu, K. Hu, and B. Zhao, “The depolymerization
mechanism of chitosan by hydrogen peroxide,” Journal of
Materials Science, vol. 38, no. 23, pp. 4709–4712, 2003.
[22] A. Rahnama and M. Gharagozlou, “Preparation and properties
of semiconductor CuO nanoparticles via a simple precipitation
method at different reaction temperatures,” Optical and Quan-
tum Electronics, vol. 44, no. 6-7, pp. 313–322, 2012.
[23] L.-H. Li, J.-C. Deng, H.-R. Deng, Z.-L. Liu, and L. Xin,
“Synthesis and characterization of chitosan/ZnO nanoparticle
composite membranes,” Carbohydrate Research, vol. 345, no. 8,
pp. 994–998, 2010.
[24] Y. Li, Y. Wei, G. Shi, Y. Xian, and L. Jin, “Facile synthesis of
leaf-like CuO nanoparticles and their application on glucose
biosensor,” Electroanalysis, vol. 23, no. 2, pp. 497–502, 2011.
http://dx.doi.org/10.1155/2013/975356
Research Article
Photocatalytic Decolourization of Direct Yellow 9 on
Titanium and Zinc Oxides
Elhbieta Regulska, Diana MaBgorzata BruV, and Joanna KarpiNska

Institute of Chemistry, University of Bialystok, Hurtowa 1, 15-399 Bialystok, Poland
Correspondence should be addressed to Elżbieta Regulska; e.regulska@uwb.edu.pl
Received 5 July 2013; Accepted 31 July 2013
Copyright © 2013 Elżbieta Regulska et al. This is an open access article distributed under the Creative Commons Attribution
cited.
The photodecolourization of Direct Yellow 9, a member of the group of azo dyes which are commonly used in the various branches
of the industry, was investigated. The photostability of this dye was not previously examined. Photocatalytic degradation method
was evaluated. Solar simulated light (𝐸 = 500 W/m2 ), titanium dioxide, and zinc oxide were used as irradiation source and
photocatalysts, respectively. Kinetic studies were performed on a basis of a spectrophotometric method. Degradation efficiency
was assessed by applying high performance liquid chromatography. Disappearance of a dye from titanium dioxide and zinc oxide
surfaces after degradation was confirmed by thermogravimetry and Raman microscopy. Direct Yellow 9 was found to undergo
the photodegradation with approximately two times higher efficiency when zinc oxide was applied in comparison with titanium
dioxide. A simple and promising way to apply the photocatalytic removal of Direct Yellow 9 in titanium dioxide and zinc oxide
suspensions was presented.
1. Introduction plant effluents or industrial aquatic waste. Therefore, there

is a necessity to apply efficient degradation techniques by
Wastewater from industry contains various organic com- factories and industrial plants where dyes are being created
pounds such as dyes, surfactants, excipients, and many or applied during manufacturing process [6].
others. Among all of them dyes are widely used in various Traditional techniques such as biodegradation, adsorp-
branches of the textile industry, cosmetics, and paper pro- tion, coagulation, reverse osmosis, and the others are ineffec-
duction, in food technology, and so forth [1]. The amount of tive for complete destruction of dyes [7]. Biodegradation, for
dyes produced in the world is estimated to be over 10,000 tons instance, does not work efficiently because of a high resistance
per year. Exact data on the quantity of dyes discharged in the of dye molecules. Therefore, it can lead to the generation of
environment are not available. However, it is assumed that hazardous aromatic amines [4]. Most of above-mentioned
a loss of 1-2% in production and 1–10% loss in use are a fair methods are nondestructive. They only transfer contami-
estimate [2]. nations from solution to another phase, thus producing a
Those substances enter the ecosystem modifying the envi- large amount of sludge with a secondary pollution, which is
ronment and becoming a major threat for all forms of life [3]. difficult to remove [8]. Therefore, it is essential to consider
Removing dyes is more important than colorless compounds, other, more efficient and less invasive methods [9].
because even at a low concentration (below 1 ppm), they Recently, Advanced Oxidation Processes (AOPs) seem to
can change the color and the transparency of water [4]. be an alternative to conventional treatment and can be suc-
Their presence in an aqueous environment decreases the cessfully used to destruct dyes and other organic substances
sunlight penetration and consequently reduces an activity of [10]. AOPs have employed photocatalysts, Fenton reagents,
a photosynthesis and a solubility of gases [5]. Furthermore, ozone, hydrogen peroxide, and ultraviolet or solar light,
some dyes are toxic or potentially carcinogenic. In this separately or combining some of them [11]. The mechanism
connection, it is necessary to protect the environment against is based on a generation of hydroxyl radicals which have one
that pollution and decontaminate the sewage treatment of the highest oxidative potential (𝐸0 = +2.8 V) [12]. Hence,
H3 C CH3
N N
S S SO3 Na
NaO3 S
N
N NH
Scheme 1: Chemical structure of Direct Yellow 9.
they are useful in a complete mineralization of organic water A Renishaw Raman InVia Microscope equipped with a
pollutants to carbon dioxide, water, and inorganic anions [13]. high sensitivity ultralow noise CCD detector was employed.
Among AOPs, heterogeneous photocatalysis with the usage The radiation from an argon ion laser (785 nm) at an incident
of a semiconductor as a photocatalyst is a promising method power of 1.15 mW was used as the excitation source. Raman
for color removal from water [14]. spectra were acquired with 3 accumulations of 10 s each,
In performed studies two semiconductors, namely, TiO2 2400 L/mm grating, and using 20x objective.
and ZnO, were used. Both of them are cheap, nontoxic, pho- Differential scanning calorimetric (DSC) and thermo-
tochemically stable, environmentally friendly [13], and water gravimetric (TGA) analyses were performed by a Thermal
insoluble [15], and they have similar energy of band gaps Analyzer TGA/DSC 1 (METTLER TOLEDO) with a heating
[16, 17]. Those catalysts were applied in a photodegradation rate of 15∘ C/min under nitrogen environment with flow
of Direct Yellow 9 (DY9, Scheme 1), also known as Titan rate = 20 mL/min. All runs were carried out from 25∘ C to
Yellow, Clayton Yellow, and Thiazole Yellow G, a dye which 1550∘ C. The measurements were made in alumina crucibles
photostability was not previously examined. with lids.
DY9 is used as a stain and fluorescent indicator in The chromatographic experiments with HPLC-UV sys-
microscopy. What is more, it was successfully applied in tem were carried out on a Thermo Separation liquid chro-
analytical methods of magnesium determination in serum matograph. The chromatographic column Waters Spherisorb
[18], tissue [19], plant material [20] and rocks [21]. It was ODS-2 150 mm × 4.6 mm packed with 5 𝜇m particle size was
also used for estimation of beryllium in waste water [22], used. Separation was achieved using an isocratic method. The
commercial aminoglycoside antibiotics in serum samples mobile phase consisted of an acetonitrile : water (60 : 40 v/v).
[23], and tetracycline antibiotics in chook serum and human The flow rate of the mobile phase was 1 mL/min, and the
urine samples [24]. injection volume was 100 𝜇L. The column was maintained at
a room temperature. The eluent was monitored at 322 nm.
2.1. Materials. TiO2 (anatase, Sigma-Aldrich) and ZnO 2.3. Photocatalytic Degradation Experiment
(Sigma-Aldrich), Direct Yellow 9 (Riedel-de-Haën AG), and
2.3.1. Direct Photolysis. All experiments were done using
ammonium reineckate-NH4 [Cr(SCN)4 (NH3 )2 ]⋅H2 O (BDH
50 mL glass cell. 20 mL of the working solution of Direct Yel-
Chemicals Ltd, England) were used. All above-mentioned
chemicals were analytical grade reagents and used without low 9 (DY9) at the concentration 80 𝜇mol⋅L−1 was subjected
further treatment. HPLC-grade acetonitrile was purchased to irradiation by Solar Light simulator SUNTEST CPS+ ,
from Merck. All solutions were prepared using deionized ATLAS USA emitting radiation in the range 300–800 nm
water, which was obtained by Polwater apparatus. with intensity 500 W m−2 for two hours. pH of aqueous
solution was adjusted with 0.1 mol⋅L−1 H2 SO4 or 0.1 mol⋅L−1
2.2. Apparatus. UV spectrophotometric analyses were per- NaOH. pH was measured with an Elmetron CP-501 pH-
formed with a HITACHI U-2800A UV-VIS spectrophotome- meter (produced by ELMETRON, Poland) equipped with a
ter equipped with a double monochromator and double pH-electrode EPS-1 (ELMETRON, Poland). The temperature
beam optical system (190–700 nm). UV studies were done of samples room was adjusted to 35∘ C. The spectra of
using 1 cm quartz cell. Optical density was recorded in irradiated solutions were recorded every 15 min.
the range of 190–560 nm, and the maximum absorption All tested samples were prepared in triplicate.
wavelength experimentally registered at 𝜆 = 408 nm was The photocatalytic degradation experiments were per-
used for the calibration curve and further DY9 concentration formed in 50 mL glass cell. The reaction mixture consisted
measurements. of 20 mL of Direct Yellow 9 (DY9) sample (80 𝜇mol⋅L−1 )
Photolytic as well as photocatalytic degradation experi- and a photocatalyst (1.5 g⋅L−1 ). Prior the irradiation the dye-
ments were carried out in a solar simulator apparatus, namely catalyst suspension was kept in the dark with stirring for
SUNTEST CPS+ (ATLAS, USA). The photon flux of solar 1 hour to ensure an adsorption-desorption equilibrium. To
simulated radiation was measured by chemical method— determine the DY9 degradation, the samples were collected
Reinecke’s salt actinometer [25]. The photon flux of solar at regular intervals (15 min) and centrifuged to remove the
simulated light of 500 W/m2 was 2.32 × 10−6 Einstein/s. photocatalyst.
3. Results and Discussion 3.5
3.0
3.1. The Primary Studies. As presented in Figure 1, the
absorption spectra of DY9 differ when registered at different 2.5
pH. DY9 spectrum in neutral environment is characterized
OD (a.u.)
2.0
by three bands, namely, at 202, 322, and 408 nm. The band
at 408 nm was applied for monitoring changes in DY9 1.5
concentration. It was observed that the shape and intensity of 1.0
absorption bands depend on pH of solution. The native pH
of aqueous solution of Direct Yellow 9 is 5.8. The increase in 0.5
pH causes the increase in intensity of the band at 408 nm and 0.0
decrease of bands intensity at 202 and 322 nm. The lowering 190 230 270 310 350 390 430 470 510 550
in pH causes reduction of intensity of all peaks and small Wavelength (nm)
bathochromic shift of the band at analytical wavelength. The pH = 2
stability of examined dye under simulated solar radiation pH = 7
was checked. For this purpose solutions of DY9 at pH 2, 7, pH = 10
and 10 were prepared and subjected to irradiation in solar
Figure 1: Absorption spectra of aqueous solution of DY9 (80
simulator chamber for 2 hours. The first-rate model of kinet-
𝜇mol⋅L−1 ) at different pH.
ics was assumed. The acquired experimental data showed
that studied dye is photochemically stable. The changes in its
concentration at pH 7 and 10 were negligible. The observed
rate of reactions was 4 × 104 min−1 . Slight reduction of DY9 To established the adsorption character, experimental
concentration was observed at acidic pH. The observed rate data were fitted to both of previous equations (3) and shown
of this process was 3.2 × 10−3 min−1 . in Figure 2. On the basis of the higher value of correlation
coefficients in case of Langmuir isotherm (𝑅2 = 0,9926
3.2. Adsorption Studies. Adsorption studies were performed for TiO2 , 𝑅2 = 0,9784 for ZnO) in comparison with those
in order to estimate whether the adsorption of DY9 on the obtained from Freundlich isotherm (𝑅2 = 0,9910 for TiO2 ,
TiO2 and ZnO surface has physical or chemical character. 𝑅2 = 0,9389 for ZnO), the chemical character of DY9 adsorp-
It is well known that physisorption is well described by tion on the both photocatalysts surface was established.
the Freundlich isotherm (1), whereas chemisorption by the
Langmuir isotherm (2) is as follows: 3.3. Photodegradation Studies. Photodegradation of DY9 was
𝑥 monitored spectrophotometrically. According to Figure 3,
= 𝑘𝐶𝑡1/𝑛 , (1)
𝑚 UV-Vis spectra taken during irradiation in the presence of
both photocatalysts clearly depict the decreasing concentra-
𝑥 (𝑥/𝑚)∞ 𝑘𝐶
= , (2) tion of examined dye, which is due to its decomposition. On
𝑚 1 + 𝑘𝐶 the basis of these studies the kinetics of the photocatalytic
where 𝑥 is mass of DY9 adsorbed on the photocatalyst degradation was evaluated (described in Section 3.4).
surface, 𝑚 is mass of TiO2 /ZnO, 𝐶𝑡 is concentration of DY9 in Raman microscopy, thermogravimetry, and HPLC analy-
the solution after 1 h of adsorption in the dark, 𝑘 is adsorption ses were applied to reveal whether the photodegradation with
constant, 𝑛 is constant characteristic for an exact system. the usage of TiO2 or ZnO is sufficiently destructive method
Experimental data were fitted to the plot of 𝑥/𝑚 versus 𝐶𝑡 to degrade DY9. Therefore, data before and after irradiation
and presented in Figure 2. Relationships shown in Figure 3(a) experiment (2 hours of irradiation) were presented.
(TiO2 ) and Figure 3(b) (ZnO) are typical for the adsorption Raman spectra were registered to compare the adsorbed
process. It is clear that with an increase in DY9 concentration, species present on the photocatalyst surface. Figure 4 shows
there is also, to some point, an increase in mass of dye the spectra of the examined samples taken by Raman micro-
which is adsorbed on the photocatalyst surface. However, scope. In case of both semiconductors, after adsorption,
after crossing enough high concentration value, no more without exposition to the solar light, in the region of 1100–
adsorbate is able to be adsorbed on the adsorbent surface. 1700 cm−1 certain bands appear. While after photodegrada-
Unfortunately, presented charts do not directly indicate the tion almost no bands indicating DY9 presence on the surface
adequate adsorption character. In order to determine that, can be seen. Moreover, on the images (taken by Raman
linear relationship is crucial. With the aim of doing that, the microscope) of the semiconductors surface, yellowish spots
linear transformations of (1) and (2) were expressed by the present after adsorption were not found after irradiation
following equations: treatment. Those results indicate that DY9 is adsorbed on the
𝑥 1 surface of both applied photocatalysts, and what is more, that
log = log 𝑘 + log 𝐶𝑡 , the complete degradation of DY9 takes place.
𝑚 𝑛
(3) In order to confirm Raman spectroscopic results ther-
𝐶𝑡 1 𝐶𝑡
= + . mochemical characterization was performed. Thermogravi-
(𝑥/𝑚) 𝑘(𝑥/𝑚)∞ (𝑥/𝑚)∞ metric curves were presented in Figure 5. They indicate
0.0016 0.050
0.040
0.0012
0.030
x (m)
x (m)
0.0008
0.020
0.0004
0.010
0.0000 0.000
0.00000 0.00003 0.00005 0.00008 0.00010 0.00000 0.00003 0.00005 0.00008 0.00010
−1 −1
CDY9 (mol·L ) CDY9 (mol·L )
(A) (A)
Ct Ct
−9 −8 −7 −6 −5 −4 −7 −6 −5 −4
0 0.0
−1 −0.5
y = 0.3159x − 3.2362
R2 = 0.9910 y = 0.6978x + 1.8329
−2
−1.0 R2 = 0.9389
−3
logx (m)
logx (m)
−1.5
−4
−2.0
−5
−6 −2.5
−7 −3.0
(B) (B)
0.007 0.0015
0.006
0.0012
0.005
0.004 0.0009
C/x (m)
C/x (m)
0.003 0.0006
0.002
y = 48.356x + 0.0013 0.0003 y = 12.246x + 0.0002
0.001
R2 = 0.9926 R2 = 0.9784
0.000 0.0000
0.00000 0.00003 0.00005 0.00008 0.00010 0.00000 0.00003 0.00005 0.00008 0.00010
CDY9 (mol·L−1 ) CDY9 (mol·L−1 )
(C) (C)
(a) (b)
Figure 2: Isotherms of the adsorption process of DY9 on the TiO2 (a.A) and ZnO (b.A) surface. Linear Freundlich ((a.B) and (b.B) for TiO2
and ZnO, resp.) and Langmuir ((a.C) and (b.C) for TiO2 and ZnO, resp.) adsorption isotherm of DY9 on the photocatalyst surface.
that after degradation a weight loss on the photocatalysts It could be influenced by the higher adsorption of DY9 on
surface took place. This is due to the decomposition of a dye. the TiO2 surface (8%) than on ZnO (5.8%).
This observation is true for both of used semiconductors. HPLC analyses (Figure 6) were performed in order to
However, a slightly bigger weight loss was observed when study whether any intermediate products after photocatalytic
TiO2 (2.2%) was applied in comparison with ZnO (1.9%). degradation of DY9 remained in the solution. It was found
0 1.00
0 1.00
15 15
30 0.80 30
45 0.80
45
(min)
(min)
60 0.60 60
OD (a.u)
OD (a.u)
75 0.60
75
90 0.40 90
105 0.40
105
120 120
0.20 0.20
200 200
260 260
320 0.00 320 0.00
380 380
Wavelen 440 Wavele 440
gth (n m) 500 ngth ( 500
560 nm) 560
(a) (b)
Figure 3: Normalized UV-Vis spectra of DY9 with the increasing irradiation time during application of TiO2 (a) and ZnO (b) as
photocatalysts.
1603
440
1481
142
1175
Raman intensity (a.u.)
Raman intensity (a.u.)
1441
640
1400
1225
332
517
398
143
1512
(A)
1307
1478
199
1604
1172
1400
1227
1308
(A)
440
199 145
332
640
398
518
143
(B) (B)
100 300 500 700 900 1100 1300 1500 1700 100 300 500 700 900 1100 1300 1500 1700
Wavenumbers (cm−1 ) Wavenumbers (cm−1 )
(a) (b)
Figure 4: Raman spectra of TiO2 (a.A) and ZnO (b.A) after adsorption of DY9 and after 2 hours of irradiation under solar simulated light
((a.B) and (b.B), for TiO2 and ZnO, resp.).
100 100
99 99
98
98
97
Weight loss (%)
Weight loss (%)
96 97
(B)
95 (B) 96
94 95
93 (A)
(A) 94
92
91 93
90 92
0 200 400 600 800 1000 1200 0 200 400 600 800 1000 1200
T (∘ C) T (∘ C)
(a) (b)
Figure 5: TGA curves of TiO2 (a) and ZnO (b) after adsorption of DY9 (A) and after 2 hours of irradiation under solar simulated light (B).
Table 1: Pseudofirst-order rate constants 𝑘app and half-live times 𝑡1/2

for photocatalytic degradation of DY9 upon irradiation with solar
simulated light (500 W/m2 ) at varying DY9 concentration.
DY9 concentration/ TiO2 (1.5 g⋅L−1 ) ZnO (1.5 g⋅L−1 )

𝜇mol⋅L−1 𝑘app /min 𝑡1/2 /min 𝑘app /min−1 𝑡1/2 /min
−1
10 0.0758 9 0.0989 7
Intensity (mAU)
30 0.0314 22 0.0669 10
50 0.0312 22 0.0491 14
(a) 80 0.0226 31 0.0300 23
100 0.0180 39 0.0250 28
(b) Table 2: Pseudofirst-order rate constants 𝑘app and half-live times

𝑡1/2 for photocatalytic degradation of DY9 (80 𝜇mol⋅L−1 ) upon irra-
(c) diation with solar simulated light (500 W/m2 ) at varying catalysts
loading (g⋅L−1 ).
(d)
TiO2 ZnO
0 1 2 3 Catalyst loading/g⋅L−1
t (min) 𝑘app /min 𝑡1/2 /min 𝑘app /min−1 𝑡1/2 /min
−1
0.1 0.0032 217 0.0049 141

Figure 6: Chromatograms of DY9 (a) before and after 2 hours of 0.5 0.0059 117 0.0124 56
irradiation under solar simulated light without (b) and with addition
1.0 0.0109 63 0.0138 50
of TiO2 (c) and ZnO (d).
1.5 0.0226 31 0.0300 23
that even same photolysis of DY9 led to a slight decomposi- for both photocatalysts, the rate of decomposition increases
tion of a dye since a tiny change in a peak shape was observed. with the increasing initial concentration of DY9 which
However, only after addition of a photocatalyst a significant corresponds to Langmuir-Hinshelwood adsorption model.
decrease in a peak height was noticed. HPLC analyses showed According to (5), 1/𝑘app versus [DY9]0 , as shown in the inset
that photodegradation efficiency was more than two times in Figure 7, gives a linear relationship. From the values of
bigger when ZnO was applied in comparison with the results the slope 1/𝑘 and the intercept 1/𝑘𝐾DY9 , 𝑘 and 𝐾DY9 values
obtained with TiO2 . for the photocatalytic degradation of DY9 were found to be,
HPLC analyses are in a good agreement with Raman respectively, mol/L⋅min and L/mol.
microscopy as well as thermogravimetry results. They all Integration of (4) (with the restriction of 𝐶 = 𝐶0 at 𝑡 = 0)
indicate that ZnO leads to the higher photodegradation will lead to the following relation:
efficiency in comparison with TiO2 .
𝐶0
ln = 𝑘app 𝑡. (6)
3.4. Optimalisation of the Studied Process 𝐶𝑡
The plot of ln(𝐶0 /𝐶𝑡 ) versus 𝑡 was used for the estimation
3.4.1. Effect of Dye Concentration. Many reports [26, 27] of the pseudofirst-order rate constant, 𝑘app , and the half-
have indicated that the kinetic model for heterogeneous life, 𝑡1/2 , of the photocatalytic degradation of DY9 (Table 1).
photocatalysis follows the Langmuir-Hinshelwood kinetic The decrease of 𝑘app and increase of 𝑡1/2 were observed,
expression: while DY9 concentration was rising. All the subsequent
𝑑 [TitY] 𝑘𝐾TitY [TitY]0 photolytic as well as photocatalytic degradation experiments
− = = 𝑘app [TitY]0 , (4) were performed using 80 𝜇M DY9 solutions.
𝑑𝑡 1 + 𝐾TitY [TitY]0
where [DY9]0 is the initial concentration of DY9 [mol/L], 3.4.2. Effect of Catalyst Loading. The influence of the catalyst
𝐾DY9 is Langmuir-Hinshelwood adsorption equilibrium con- loading on the photodegradation process was studied. Kinetic
stant [L/mol], 𝑘 is rate constant of the surface reaction values (𝑘app and 𝑡1/2 ) at varying catalysts loading were
[mol/L⋅min], 𝑘app is pseudofirst-order rate constant. calculated and presented in Table 2. An increase of 𝑘app with a
A linear expression can be conventionally obtained by decrease of 𝑡1/2 values was observed when the catalysts load-
plotting the reciprocal initial rate constant against initial ing was increased. Following these observations, the amount
concentration: of TiO2 and ZnO was kept constant at the optimal load
1 1 [DY9]0 of 1.5 g/L in all the subsequent photocatalytic degradation
= + . (5) experiments.
𝑘app 𝑘𝐾DY9 𝑘
The effect of initial DY9 concentration on the initial rate 3.4.3. Effect of pH. The influence of initial pH on the rate
of degradation is shown in Figure 7. The figure indicates that of photocatalytic degradation was studied in the pH 2, 7,
2.0E−06 3.0E−06
1.8E−06
1.6E−06 2.5E−06
1.4E−06 2.0E−06
50
1.2E−06 60
kapp C0
kapp C0
y = 419734x + 12.713 y = 342399x + 5.2622
1.0E−06 40 R2 = 0.9358 1.5E−06 R2 = 0.9887
1/kapp
1/kapp
25
8.0E−07
20 1.0E−06
6.0E−07
0 0
4.0E−07 0.00000 0.00005 0.00010 5.0E−07 0.00000 0.00005 0.00010
2.0E−07 C0 (mol·L )−1
C0 (mol·L−1 )
0.0E+00 0.0E+00
0 0.00002 0.00004 0.00006 0.00008 0.0001 0 0.00002 0.00004 0.00006 0.00008 0.0001
−1
C0 (mol·L ) C0 (mol·L−1 )
(a) (b)
Figure 7: Effect of initial DY9 concentration on the initial rate of degradation with the usage of TiO2 (a) and ZnO (b). The inset represents
the plot of 1/𝑘app versus initial concentration of DY9. The photocatalysts loading was kept constant (1.5 g⋅L−1 ).
and 10 at constant dye concentration (80 𝜇mol⋅L−1 ) and Table 3: Pseudofirst-order rate constants 𝑘app and half-live times 𝑡1/2
catalyst amount (1.5 g⋅L−1 ). The results presented in Table 3 for the photocatalytic degradation of DY9 (80 𝜇mol⋅L−1 ) at different
showed that the pH significantly affected the degradation initial pH.
efficiency for both semiconductors. It was observed that the
TiO2 ZnO
rate of degradation decreased with an increase in pH when pH −1 −1
TiO2 was applied, whereas in the case of ZnO, it was observed 𝑘app /min 𝑡1/2 /min 𝑘app /min 𝑡1/2 /min
reversely. The rate of degradation increased with an increase 2 0.0282 25 0.0133 52
in pH, exhibiting maximum rate constant at pH 10. Findings 7 0.0226 31 0.0300 23
of others [28] also showed this trend. Differences between 10 0.0183 38 0.0349 20
TiO2 and ZnO may result from different zero point charge
(zpc) values, which are equal to 4.5 [29] and 9.0 [30] for TiO2 Table 4: Influence of an addition of carbonate buffer on pseudofirst-
and ZnO, respectively. The pH is related to the ionization state order rate constants 𝑘app and half-live times 𝑡1/2 of the photocatalytic
of the surface in the following way: degradation of DY9 (80 𝜇mol⋅L−1 ).
M–OH + H+ ←→ M–OH2 + Addition of carbonate buffer 𝑘app /min−1 𝑡1/2 /min

(7) − 0.0226 31
M–OH + OH− ←→ MO− + H2 O TiO2
+ 0.0147 47
Therefore photocatalysts surface is positively charged − 0.0300 23
ZnO
below pHzpc , whereas it is negatively charged when pH > + 0.0172 40
pHzpc . This phenomenon strongly affects the adsorption
process, which for anionic compounds is maximum in acidic
conditions, while for cationic is maximum in basic. Since DY9 in the irradiated suspension of DY9 and photocatalyst. The
belongs to the anionic dyes, it should be strongly attached possible reason for this behaviour is that carbonate and
to the positively charged photocatalyst surface. However, bicarbonate ions react with HO∙ forming less active radicals,
photocatalytic degradation efficiency of ZnO was observed as follows:
to be the highest at alkaline pH, even though the adsorption CO3 2− + HO∙ 󳨀→ CO3 ∙− + HO−
of DY9 should be lower in this conditions. Nevertheless, this (8)
relation was also observed by others [16, 31] when another HCO3 − + HO∙ 󳨀→ HCO3 ∙ + HO−
anionic dye (Acid Brown 14) was examined. It is thought that
in alkaline pH, where a large amount of OH− ions is present,
OH∙ radicals are favorably created and can significantly
4. Conclusions
enhance the photocatalytic degradation of a dye. DY9 was found to be resistant to the photolytic decomposi-
tion in aqueous environment, but it undergoes the photocat-
3.4.4. Effect of 𝐻𝐶𝑂3 − and 𝐶𝑂3 2− Anions. The content of alytic degradation in suspension of both examined photocat-
carbonate and bicarbonate ions in an aqueous environment alysts, namely TiO2 , and ZnO. Two hours of irradiation upon
of performed photocatalytic experiments was examined and solar simulated light led to the total decomposition of DY9
found to have a negative influence on a decomposition of when ZnO was applied. In summary, we revealed the poten-
DY9. As presented in Table 4, rate constants decreased and tial application of heterogeneous photocatalysis for DY9
half-live times increased when carbonate buffer was present removal from aquatic environment. Therefore, the current
research can be considered as a step towards the commer- [12] E. Bizani, K. Fytianos, I. Poulios, and V. Tsiridis, “Photocatalytic
cialization of the photocatalytic removal of DY9 from the decolorization and degradation of dye solutions and wastewa-
aqueous environment. ters in the presence of titanium dioxide,” Journal of Hazardous
Materials, vol. 136, no. 1, pp. 85–94, 2006.
[13] W. Lin, W. Yang, and S. Jheng, “Photocatalytic degradation of
Acknowledgments dyes in water using porous nanocrystalline titanium dioxide,”
Journal of the Taiwan Institute of Chemical Engineers, vol. 43,
The authors kindly acknowledge the financial support from no. 2, pp. 269–274, 2012.
the National Science Centre, Poland (project 2012/05/N/ [14] D. Gümüş and F. Akbal, “Photocatalytic degradation of textile
ST5/01479). Thermogravimeter and Raman microscope were dye and wastewater,” Water, Air, and Soil Pollution, vol. 216, no.
funded by EU, as part of the Operational Programme 1–4, pp. 117–124, 2011.
Development of Eastern Poland 2007–2013, Project no. [15] R. J. Tayade, P. K. Surolia, R. G. Kulkarni, and R. V. Jasra,
POPW.01.03.00-20-034/09-00. “Photocatalytic degradation of dyes and organic contaminants
in water using nanocrystalline anatase and rutile TiO2 ,” Science
and Technology of Advanced Materials, vol. 8, no. 6, pp. 455–462,
References 2007.
[1] S. K. Asl, S. K. Sadrnezhaad, M. K. Rad, and D. Üner, “Compar- [16] C. F. Klingshirn, “ZnO: material, physics and applications,”
ative photodecolorization of red dye by anatase, rutile (TiO2 ), ChemPhysChem, vol. 8, no. 6, pp. 782–803, 2007.
and wurtzite (ZnO) using response surface methodology,” [17] S. Sakthivel, B. Neppolian, M. V. Shankar, B. Arabindoo, M.
Turkish Journal of Chemistry, vol. 36, no. 1, pp. 121–135, 2012. Palanichamy, and V. Murugesan, “Solar photocatalytic degrada-
[2] E. Forgacs, T. Cserháti, and G. Oros, “Removal of synthetic dyes tion of azo dye: comparison of photocatalytic efficiency of ZnO
from wastewaters: a review,” Environment International, vol. 30, and TiO2 ,” Solar Energy Materials and Solar Cells, vol. 77, no. 1,
no. 7, pp. 953–971, 2004. pp. 65–82, 2003.
[3] M. A. Rauf and S. S. Ashraf, “Fundamental principles and [18] F. W. Heaton, “Determination of magnesium by the Titan
application of heterogeneous photocatalytic degradation of dyes yellow and ammonium phosphate methods,” Journal of Clinical
in solution,” Chemical Engineering Journal, vol. 151, no. 1–3, pp. Pathology, vol. 13, pp. 358–360, 1960.
10–18, 2009. [19] C. Pallavicini, “Determination of magnesium in tissue by the
Titan yellow method in the presence of silver and mercury,” Pro-
[4] M. H. Habibi, A. Hassanzadeh, and S. Mahdavi, “The effect
ceedings of the Society for Experimental Biology and Medicine,
of operational parameters on the photocatalytic degradation of
vol. 110, pp. 235–237, 1962.
three textile azo dyes in aqueous TiO2 suspensions,” Journal of
Photochemistry and Photobiology A, vol. 172, no. 1, pp. 89–96, [20] A. H. Cornfield and A. G. Pollard, “Use of titan yellow for the
2005. determination of magnesium in plant material,” Journal of the
Science of Food and Agriculture, vol. 1, pp. 357–358, 1950.
[5] C. Chen, “Photocatalytic degradation of azo dye reactive orange
16 by TiO2 ,” Water, Air, and Soil Pollution, vol. 202, no. 1–4, pp. [21] R. Meyrowitz, “The direct spectrophotometric microdetermi-
335–342, 2009. nation of high-level magnesium in silicate minerals,” American
Mineralogist, vol. 49, pp. 769–777, 1964.
[6] C. T. Fragoso, R. Battisti, C. Miranda, and P. C. de Jesus, “Kinetic
[22] G. Hong-Wen and Z. Peng-Fei, “𝛽-correction spectrophotomet-
of the degradation of C.I. Food Yellow 3 and C.I. Food Yellow
ric determination of beryllium in waste water with titan yellow,”
4 azo dyes by the oxidation with hydrogen peroxide,” Journal of
Analytical Proceedings including Analytical Communications,
Molecular Catalysis A, vol. 301, no. 1-2, pp. 93–97, 2009.
vol. 31, no. 3, pp. 85–87, 1994.
[7] M. R. Sohrabi and M. Ghavami, “Photocatalytic degradation [23] W. Mingxia, L. Zhongfang, H. Xiaoli, L. Shaopu, and K.
of Direct Red 23 dye using UV/TiO2 : effect of operational Ling, “Study on the interaction of aminoglycoside antibiotics
parameters,” Journal of Hazardous Materials, vol. 153, no. 3, pp. with Titan Yellow by spectrophotometric method and their
1235–1239, 2008. analytical applications,” Frontiers of Chemistry in China, vol. 2,
[8] N. M. Mahmoodi, M. Arami, N. Y. Limaee, and N. S. Tabrizi, pp. 170–173, 2006.
“Kinetics of heterogeneous photocatalytic degradation of reac- [24] X. Wei, Z. Liu, and S. Liu, “Resonance Rayleigh scattering
tive dyes in an immobilized TiO2 photocatalytic reactor,” spectra of tetracycline antibiotic-Cu(II)-titan yellow systems
Journal of Colloid and Interface Science, vol. 295, no. 1, pp. 159– and their applications in analytical chemistry,” Analytical and
164, 2006. Bioanalytical Chemistry, vol. 385, no. 6, pp. 1039–1044, 2006.
[9] S. K. Kansal, M. Singh, and D. Sud, “Studies on photodegrada- [25] H. J. Kuhn, S. E. Braslavsky, and R. Schmidt, “Chemical acti-
tion of two commercial dyes in aqueous phase using different nometry (IUPAC technical report),” Pure and Applied Chem-
photocatalysts,” Journal of Hazardous Materials, vol. 141, no. 3, istry, vol. 76, no. 12, pp. 2105–2146, 2004.
pp. 581–590, 2007. [26] C. Martı́nez, M. Canle L, M. I. Fernández, J. A. Santaballa, and J.
[10] W. L. Kostedt IV, A. A. Ismail, and D. W. Mazyc, “Impact of Faria, “Kinetics and mechanism of aqueous degradation of car-
heat treatment and composition of ZnO–TiO2 nanoparticles bamazepine by heterogeneous photocatalysis using nanocrys-
for photocatalytic oxidation of an azo dye,” Industrial and talline TiO2 , ZnO and multi-walled carbon nanotubes-anatase
Engineering Chemistry Research, vol. 47, no. 5, pp. 1483–1487, composites,” Applied Catalysis B, vol. 102, no. 3-4, pp. 563–571,
2008. 2011.
[11] R. B. M. Bergamini, E. B. Azevedo, and L. R. R. de Araújo, [27] H. R. Pouretedal and A. Kadkhodaie, “Synthetic CeO2 nanopar-
“Heterogeneous photocatalytic degradation of reactive dyes in ticle catalysis of methylene blue photodegradation: kinetics and
aqueous TiO2 suspensions: decolorization kinetics,” Chemical mechanism,” Chinese Journal of Catalysis, vol. 31, no. 11, pp.
Engineering Journal, vol. 149, no. 1–3, pp. 215–220, 2009. 1328–1334, 2010.
[28] S. Naskar, S. A. Pillay, and M. Chanda, “Photocatalytic degra-

dation of organic dyes in aqueous solution with TiO2 nanopar-
ticles immobilized on foamed polyethylene sheet,” Journal of
Photochemistry and Photobiology A, vol. 113, no. 3, pp. 257–264,
1998.
[29] C. Wu and J. Chern, “Kinetics of photocatalytic decomposi-
tion of methylene blue,” Industrial and Engineering Chemistry
Research, vol. 45, no. 19, pp. 6450–6457, 2006.
[30] Elaziouti, N. Laouedj, and B. Ahmed, “ZnO-mediated pho-
tocatalytic degradation of Benzopurpurine BP4B in aqueous
solution,” Journal of Chemical Engineering & Process Technology,
vol. 2, pp. 1–9, 2011.
[31] F. Zhang, J. Zhao, T. Shen, H. Hidaka, E. Pelizzetti, and N.
Serpone, “TiO2 -assisted photodegradation of dye pollutants
II. Adsorption and degradation kinetics of eosin in TiO2
dispersions under visible light irradiation,” Applied Catalysis B,
vol. 15, no. 1-2, pp. 147–156, 1998.
http://dx.doi.org/10.1155/2013/841762
Research Article
Removal of Polyvinyl Alcohol Using
Photoelectrochemical Oxidation Processes Based on
Hydrogen Peroxide Electrogeneration
Kai-Yu Huang,1 Chih-Ta Wang,2 Wei-Lung Chou,3 and Chi-Min Shu1

1
Department of Safety Health and Environmental Engineering, National Yunlin University of Science and Technology,
Yunlin 64002, Taiwan
2
Department of Safety Health and Environmental Engineering, Chung Hwa University of Medical Technology, Tainan City 717, Taiwan
3
Department of Safety, Health and Environmental Engineering, Hungkuang University, Shalu, Taichung 433, Taiwan
Correspondence should be addressed to Wei-Lung Chou; wlchou@sunrise.hk.edu.tw
Received 25 June 2013; Revised 1 August 2013; Accepted 1 August 2013
Copyright © 2013 Kai-Yu Huang et al. This is an open access article distributed under the Creative Commons Attribution License,
This study investigates the removal efficiency of PVA from aqueous solutions using UV irradiation in combination with the
production of electrogenerated hydrogen peroxide (H2 O2 ) at a polyacrylonitrile-based activated carbon fiber (ACF) cathode.
Three cathode materials (i.e., platinum, graphite, and ACF) were fed with oxygen and used for the electrogeneration of H2 O2 . The
amount of electrogenerated H2 O2 produced using the ACF cathode was five times greater than that generated using the graphite
cathode and nearly 24 times greater than that from platinum cathode. Several parameters were evaluated to characterize the H2 O2
electrogeneration, such as current density, oxygen flow rate, solution pH, and the supporting electrolyte used. The optimum current
density, oxygen flow rate, solution pH, and supporting electrolyte composition were found to be 10 mA cm−2 , 500 cm3 min−1 , pH
3, and Na2 SO4 , respectively. The PVA removal efficiencies were achieved under these conditions 3%, 16%, and 86% using UV,
H2 O2 electrogeneration, and UV/H2 O2 electrogeneration, respectively. A UV light intensity of 0.6 mW cm−2 was found to produce
optimal PVA removal efficiency in the present study. A simple kinetic model was proposed which confirmed pseudo-first-order
reaction. Reaction rate constant (𝑘ap ) was found to depend on the UV light intensity.
1. Introduction Thus, it may prove more efficient to combine electrochem-

ical oxidation with other processes [2, 3]. Ultraviolet (UV)
Advanced oxidation processes (AOPs) have become very photolysis is another effective process. UV-based AOPs are
common for the treatment of industrial wastewater contain- characterized by the generation of strong oxidizing species,
ing organic compounds. AOPs are based on the generation principally hydroxyl radicals, using combinations of strong
of highly reactive radicals such as hydroxyl (∙ OH), a strong oxidizing agents, such as ozone and hydrogen peroxide
oxidant with 𝐸 of 2.8 V, which can be strong enough to non- (H2 O2 ) with UV radiation in the 200–280 nm range [4, 5].
selectively oxidize most organic compounds through chain Hydrogen peroxide (H2 O2 ) is an environmentally friend-
reactions at ambient temperature and pressure. Among these ly chemical, because it leaves no hazardous residues. It is a
AOPs, electrochemical oxidation is thought to be one of powerful and versatile chemical, because it reacts as both a
the most promising methods for wastewater treatment; it is reductant and an oxidant [6]. However, the oxidative power
friendly to the environment, easy to control, and efficient of hydrogen peroxide is not strong enough to degrade organic
for oxidation [1]. The electrochemical oxidation of organic compounds in some cases. Application in conjunction with
pollutants is generally accompanied by side reactions such as UV irradiation and a metal catalyst can effectively increase
oxygen or chlorine evolution due to the high voltage required the oxidative power of hydrogen peroxide due to the pro-
to destroy the organic compounds in aqueous solutions. duction of hydroxyl free radicals. The putative mechanism
for the photolysis of H2 O2 is the cleavage of the molecule The large amount of PVA discharged in industrial effluents
into hydroxyl free radicals, which can then oxidize organic is harmful to human health and to the environment [19].
compounds (RH), yielding organic radicals that can in turn It is often difficult to clean wastewaters containing PVA
carry out further oxidation. The reactions that are accepted to and to generate harmless end products such as water and
occur during the UV/H2 O2 oxidation process are as follows carbon dioxide; thus, PVA adversely affects the ecosystem
[7]: and accumulates in the human body through the food chain.
PVA also creates environmental issues due to its ability to
H2 O2 + UV 󳨀→ 2 ∙ OH (1)
prevent the sedimentation of heavy metals in lakes and
RH + ∙ OH 󳨀→ H2 O + R∙ 󳨀→ further oxidation (2) streams. Conventional biological technologies do not provide
effective treatment of PVA because the degradation capacity
Employing H2 O2 with UV radiation for the removal of most microorganisms towards PVA is extremely low and
of aqueous estrogens is one example of a homogeneous specific to PVA [20]. The formation of foam in biological
advanced oxidation process. The in situ electrochemical equipment for the treatment of wastewater containing PVA
production of H2 O2 via the reduction of oxygen on a cathode also makes stable operations and acceptable performance
can reduce the costs and hazards associated with the transport very difficult. A large number of scientific studies on the
and handling of concentrated H2 O2 . In recent years, some removal of PVA have been carried out, most of which have
combinations of electrochemical oxidation and photolysis focused on photochemically initiated degradation processes
had been reported by various researchers [8, 9]. Most of [21]. Other physicochemical studies on the removal of PVA
these researchers concentrated on electro-Fenton technology have focused on methods such as ultrasonic techniques
in combination with UV irradiation, which may facilitate [22], radiation-induced degradation [23], electro-Fenton [17],
the photodecomposition of organic compounds, increase the adsorption by activated carbon [24], and electrocoagulation
generation of hydroxyl free radicals, and regenerate Fe2+ from [25, 26].
Fe3+ species through a photoreduction mechanism [10–13]. To our knowledge so far, very little work, if any, has
However, there is little research on the combination of H2 O2 been reported in the literature to date on PVA removal by
electrogeneration with direct photolysis in the absence of photoelectrochemical oxidation processes based on H2 O2
added catalysts such as Fe2+ and TiO2 . electrogeneration. The main purpose of this study was to
Electrochemical production of H2 O2 has traditionally investigate the efficiency of H2 O2 electrogeneration in acidic
used graphite electrodes because of their low cost [14]. solutions using different cathodes fed with oxygen and to
However, the poor solubility of oxygen in aqueous solutions elucidate the removal efficiency of PVA via photoelectro-
causes mass transfer limitation, resulting in lower oxidation chemical oxidation using an ACF cathode. The influences of
efficiency. Recently, activated carbon fiber (ACF) has been several operating parameters such as current density, oxygen
recognized as a promising carbon material with excellent flow rate, solution pH, and different supporting electrolytes
characteristics for adsorption, conductivity, and catalysis [15]. on the H2 O2 electrogeneration were investigated. The effects
Because of its large surface area, ACF also exhibits a high of different processes (UV, H2 O2 electrogeneration, and
adsorption capacity and high adsorption rates. The excellent UV/H2 O2 electrogeneration), and UV irradiation intensity
mechanical integrity of ACF makes it easy to configure as on the rate of PVA removal from aqueous solutions were
a stable electrode at which electrosorption processes can be also investigated. In addition, a simple kinetic model for PVA
conducted for the purpose of adsorptive removal of various removal by photoelectrochemical oxidation was proposed to
organic pollutants in aqueous solutions. Furthermore, ACF calculate the reaction rate constant.
electrodes may be used for the electrogeneration of H2 O2
via the two-electron reduction of oxygen on its surface
[16, 17]. The H2 O2 electrogeneration rate significantly affects 2. Experimental
the treatment efficiency of any electro-Fenton technology.
Several series processes affect the electrogeneration rate of 2.1. Material and Chemical Reagents. Polyvinyl alcohol (PVA,
H2 O2 [15–17]. Oxygen gas must first be dissolved in solution. molecular weight in the range of 13,000 to 23,000 g mol−1 )
Second, it must be transferred to cathode surface, adsorbed was obtained from Sigma-Aldrich (Saint Louis, MO 63103,
onto the cathode, and finally reduced electrochemically to USA) with a hydrolysis degree ranging from 98 to 99%.
produce H2 O2 in acidic media. Possible side reactions may Na2 SO4 , NaNO3 , and NaCl were purchased from Merck
occur simultaneously at the cathode and thus decrease the (Darmstadt, Germany) and used as supporting electrolyte in
electrogeneration rate of H2 O2 [14]. the aqueous solutions. Titanium(IV) sulfate [Ti(SO4 )2 ] was
Polyvinyl alcohol (PVA) is frequently used in the textile purchased from SHOWA (Tokyo, Japan). Potassium iodide
industry in blends with nylon and as a raw material for (KI) was obtained from Union Chemical Work Ltd. (Hsin-
the production of PVA fibers. In addition, PVA is used Chu, Taiwan), and iodine (I) was obtained from Toyobo Co.
as an ophthalmic lubricant in the pharmaceutical industry Ltd. (Osaka, Japan). Boric acid (H3 BO3 ) was purchased from
and is also widely used in the adhesives, emulsion paints, Merck (Darmstadt, Germany). Sulfuric acid (H2 SO4 , 3 M)
paper coating, and detergent-based industries. It is generally was used to adjust the pH of the solution. All chemicals
recognized that PVA is a high-k polymer with interesting were analytical grade reagents and prepared by dilution with
properties such as good surface alignment effects, compati- deionized water to the desired concentrations. The activated
bility with water, low cost, and inexpensive processing [18]. carbon fiber (ACF), PAN-based rigid composite carbon felt
Oxygen
cylinder
Flow meter UV lamp
Power supply
+ −
Refrigerated
circulating bath
Magnetic stirrer
Figure 1: Schematic diagram of the photoelectrochemical oxidation equipment.
series, was obtained from Taiwan carbon Technology Co. Ltd. using the Ti(SO4 )2 titration method and spectrophotometric
(Taichung, Taiwan). analysis at 𝜆 = 410 nm [27]. The PVA concentration in the
aqueous solutions was determined using a HACH Model
DR2800 spectrophotometer (HACH Company, USA) after
2.2. Apparatus. Figure 1 is a schematic diagram of the pho-
addition of boric acid and iodine solutions according to the
toelectrochemical system and the electrode assembly used
procedure described by Finley [28]. In order to calculate
in this work. The electrolytic reactor was a 1.0 L Pyrex glass
the normalized PVA concentration was performed using the
vessel equipped with a water jacket and a magnetic stirrer.
following formula:
A magnetic stirrer bar (Suntex, SH-301, Taiwan) was spun at
the center of the bottom of the reactor. The temperature of 𝐶
the electrolytic cell was controlled by continuously circulating Normalized PVA = , (3)
𝐶0
water through the water jacket from a temperature controlled
bath (Model BL-720, Taiwan). The assembly was connected to where 𝐶0 is the initial concentration in mg L−1 , 𝐶 is the
a direct current power source (PSM-6003, Taichung, Taiwan).
concentration value at time 𝑡 in mg L−1 . All samples were
A UV lamp (8 W, UV-C, 𝜆 max = 254 nm, manufactured
measured in duplicate to ensure data reproducibility, and an
by Sankyo Denki, Tokyo, Japan) was used as a radiation
additional measurement was carried out if necessary.
source and placed above an electrolytic reactor. The UV-light
intensity was measured by a Digital Ultraviolet Radiometer
(Rixen Technology, Taipei, Taiwan). 3. Results and Discussion
3.1. Comparison of Electrogeneration of H2 O2 on Different
2.3. Experimental and Analysis. The experiments were con- Electrodes. H2 O2 is often used in the oxidation of organic
ducted in a close, and undivided glass vessel. For each test pollutants because of its high oxidation reduction potential
run, a circular container with 0.5 L of synthetic wastewater (ORP), which can facilitate the degradation of organic pol-
containing polyvinyl alcohol was used as the reactor. The lutants. The previous literature reports that electrodes made
ACF, graphite plate, and platinum were used as the cathodes from carbon materials have been used to generate H2 O2
and a platinum flat with an area of about 7.5 cm2 as the with good yields, for example, graphite [29], gas diffusion
anode. The two electrodes were approximately 2 cm apart. electrodes [30], carbon felt [31], carbon nanotube-PTFE [32],
The magnetic stirrer was turned on and set at 300 rpm. glassy carbon mesh [33], and activated carbon fiber [34]. The
The ACF felt was saturated with 1000 mg L−1 PVA solution amount of H2 O2 generated by the two-electron reduction of
for 24 h to exclude the adsorption reaction of PVA on the O2 on the cathode surface is an important parameter in the
ACF felt. During the electrolysis experiments, the cathode electrogeneration process. Apparently, the cathode material
surface was fed with O2 for electrochemical reactions. Before strongly affects the rate of formation of hydrogen peroxide.
the photoelectrochemical treatment, the pH of aqueous Therefore, it is necessary to investigate the yield of H2 O2
solution containing PVA was measured with pH meter. in photoelectrochemical oxidation processes using different
The photoelectrochemical treatment run lasted 120 min in cathode materials. To evaluate their comparative perfor-
all experiments. The H2 O2 concentration was determined mance for H2 O2 generation, several cathode materials were
25 30
20 25
H2 O2 (mg L−1 )
20
H2 O2 (mg L−1 )
15
15
10
10
5
5
0
Platinum Graphite ACF 0
0 20 40 60 80 100 120
Electrode material
Time (min)
Figure 2: Effect of different electrode materials on the H2 O2
2.5 mA cm−2 10 mA cm−2
electrogeneration. (Na2 SO4 = 0.05 M, pH = 3, oxygen flow rate =
5 mA cm−2 12.5 mA cm−2
500 cm3 min−1 , and current density = 10 mA cm−2 ).
7.5 mA cm−2
Figure 3: Effect of current density on the H2 O2 electrogeneration as

used, including ACF, graphite, and platinum. Figure 2 shows a function of time. (Na2 SO4 = 0.05 M, pH = 3, and oxygen flow rate
a comparison of the H2 O2 generation rates achieved using = 500 cm3 min−1 ).
different electrode materials. As shown in this figure, H2 O2
production rates of 1 mg L−1 , 4.9 mg L−1 , and 24.3 mg L−1
were achieved after 120 min of electrolysis using platinum, decomposition of H2 O2 , either on the electrode or directly
graphite, and ACF electrodes, respectively. This finding is in the solution (5) [35]. In addition, the electrode surface
likely explained by the fact that the ACF electrode has a reactions such as the production of oxygen and hydrogen also
large specific surface area and a great number of mesopores, retard the reactions generating H2 O2 [36]. Furthermore, a
so that oxygen can be rapidly adsorbed and reduced on the portion of the H2 O2 produced can be anodically oxidized to
cathode surface, thereby generating H2 O2 at high rates. This yield intermediate HO∙2 radicals [37]. Consequently, a current
observation was in agreement with another previous study density of 10 mA cm−2 was chosen as the optimum current
[34]. density for the subsequent experiments:
H2 O2 + 2e− 󳨀→ 2OH− (5)
3.2. Effect of Operational Parameters on
the Generation of H2 O2 H2 O2 󳨀→ HO∙2 + H+ + e− (6)
3.2.1. Effect of Current Density. To confirm the effect of HO∙2 󳨀→ O2 + H+ + e− (7)

current density on the electrochemical generation of H2 O2
on the ACF cathode, several current densities were used in 3.2.2. Effect of Oxygen Flow Rate. The rate of H2 O2 genera-
acidic solutions containing 0.05 M Na2 SO4 . Figure 3 shows tion via oxygen reduction at the cathode significantly affects
the effect of the current density on the generation of H2 O2 the treatment efficiency of photoelectrochemical oxidation
for various electrolysis durations. As the duration of the elec- processes. The effect of the oxygen flow rate on the rate
trolysis increased, concomitant increases in H2 O2 generation of H2 O2 electrogeneration was studied by varying the flow
were observed for all current densities (4): rate between 300 and 900 cm3 min−1 while keeping the
current density, the initial pH, and supporting electrolyte at
O2 + 2H+ + 2e− 󳨀→ H2 O2 (4)
10 mA cm−2 , 3, and 0.05 M Na2 SO4 , as shown in Table 1. A
After 120 min of electrolysis, the H2 O2 concentration significant increase in the H2 O2 electrogeneration rate was
gradually rose for all of the current densities, eventually observed with increases in the oxygen flow rate. After 120 min
reaching a steady state, as shown in Figure 3. An inspection of electrolysis, the oxygen flow rate increased from 300 to
of these results shows a clear maximum in the concentration 500, 700, and 900 cm3 min−1 , and the H2 O2 concentration
of H2 O2 generated at a current density of 10 mA cm−2 . In increased from 13.7 mg L−1 to 24.3 mg L−1 , 25.4 mg L−1 , and
the cases where current densities lower than 10 mA cm−2 26.1 mg L−1 , respectively. Table 1 illustrates that increasing
were applied, the H2 O2 concentration increased with increas- the oxygen flow rate can increase the amount of dissolved
ing current density, likely because increasing the applied oxygen in the solution, thereby accelerating the generation
current density can enhance the production rate of H2 O2 . of hydrogen peroxide. Namely, increasing the oxygen flow
However, the findings indicated that the H2 O2 concentration rate can increase the dissolved oxygen concentration and the
underwent a dramatic decrease when the current density mass transfer rate of dissolved oxygen and finally increase
reached 12.5 mA cm−2 . This finding can be ascribed to the the production of H2 O2 . However, above an oxygen flow
fact that higher applied current density reflects higher applied rate of 500 cm3 min−1 , the dissolved oxygen and hydrogen
voltage on the electrochemical system, which induces the peroxide concentration followed a steady trend. The results
Table 1: Effect of the oxygen flow rate and initial pH value on the H2 O2 electrogeneration.
Oxygen flow rate (cm3 min−1 ) pH

300 500 700 900 2 3 4 5
H2 O2 generation concentration (mg L−1 ) 13.7 24.3 25.4 26.1 22.2 24.3 14.4 11
implied that the electrochemical kinetics of the hydrogen 30

peroxide production correlated well with the amount of
oxygen solubility dissolved in aqueous solutions, in which 25
the saturated solubility of oxygen in aqueous solutions was
20
nearly achieved at the oxygen flow rate of 500 cm3 min−1
H2 O2 (mg L−1 )
[38]. According to these results and economic considerations, 15
an oxygen flow rate of 500 cm3 min−1 at an applied current
density of 10 mA cm−2 was adequate for further study in the 10
present work.
5
3.2.3. Effect of Initial pH. In an electrochemical oxidation
process, the solution pH is a crucial factor for the electro- 0
0 20 40 60 80 100 120
generation of H2 O2 . In H2 O2 production, a low pH is the- Time (min)
oretically favorable for the production of H2 O2 because the
conversion of dissolved oxygen to H2 O2 consumes protons in NaNO3
acidic solution. However, a low pH also promotes hydrogen Na2 SO4
NaCl
evolution, reducing the number of active sites for generating
H2 O2 . Therefore, the existence of an optimal solution pH Figure 4: Effect of supporting electrolyte on the H2 O2 electro-
might be expected. The effect of the initial pH value of the generation as a function of time. (pH = 3, oxygen flow rate =
solution on the rate of H2 O2 electrogeneration was investi- 500 cm3 min−1 , and current density = 10 mA cm−2 ).
gated by varying the initial pH between 2 and 5 while keeping
the current density, oxygen flow rate, and supporting elec-
trolyte at 10 mA cm−2 , 500 cm3 min−1 , and 0.05 M Na2 SO4 ,
as shown in Table 1. From this table, it was shown that the and NaCl were used as supporting electrolytes under the
maximum concentration of H2 O2 (24.3 mg L−1 ) was obtained same conditions, as shown in Figure 4. After 120 min of
at an initial pH = 3 after 120 min of electrolysis. However, electrolysis, we observed that 24.3 mg L−1 , 23.4 mg L−1 , and
the accumulated concentration of H2 O2 fell to 22.2 mg L−1 as 9.72 mg L−1 of H2 O2 were generated using Na2 SO4 , NaNO3 ,
the initial pH decreased to 2. This finding could be explained and NaCl, respectively. As it can be seen from Figure 4,
by the fact that the oxonium ion (H3 O+2 ) can enhance the the concentration of electrogenerated H2 O2 produced in
stability of H2 O2 (8) [39]. At the same time, two side reactions NaCl solution was lower than the concentrations produced
occur at the cathode: the reduction of H2 O2 to H2 O (9) in NaNO3 and Na2 SO4 . This observation could likely be
and hydrogen gas production (10) [40]. Therefore, these explained by the fact that Cl2 formation was observed as a
side reactions decreased the accumulation of H2 O2 in the result of chlorine oxidation at high anodic potentials during
solution at lower pH values. Based on these results, a pH the electrolysis process, and further oxidation of chlorine
value of 3 was found to be the optimal condition for H2 O2 can also occur to form HOCl [38]. Therefore, these side
electrogeneration: reactions likely decreased the accumulation of H2 O2 in the
solution. Furthermore, the electrical conductivities of SO4 2−
H2 O2 + H+ 󳨀→ H3 O2 + (8) and NO3 − solutions were greater than that of equivalent-
H2 O2 + 2H+ + 2e− 󳨀→ 2H2 O (9) strength Cl− solution [41]; thus, these solutions yielded
greater amounts of electrogenerated H2 O2 . In addition, Zhou
2H+ + 2e− 󳨀→ H2 (10) et al. reported higher concentrations of sodium sulfate, which
could accelerate the generation of H2 O2 and increase the
3.2.4. Effect of Different Supporting Electrolytes. In electro- pollutant removal efficiency [39]. Consequently, Na2 SO4 was
chemical processes that consist of heterogeneous ion and considered to be the most suitable electrolyte tested for the
electron transfer reactions, the conductivity of the solution generation of H2 O2 .
to be treated is a significant parameter. The most common
method of adjusting this parameter is to add a supporting 3.3. Removal of PVA by Photoelectrochemical Oxidation
electrolyte, which increases the solution conductivity and
thus reduces energy consumption during the electrochemical 3.3.1. Effect of UV Irradiation in the Presence of H2 O2 . Figure
process. To investigate the effect of the supporting elec- 5 shows the PVA removal efficiency as a function of time
trolyte species on the generation of H2 O2 , Na2 SO4 , NaNO3 , for experiments conducted with UV irradiation only, H2 O2
1.2 0
1
−0.5
0.8
−1
ln (C/C0 )
C/C0
0.6
−1.5
0.4
−2
0.2
0 −2.5
0 20 40 60 80 100 120 0 20 40 60 80 100
UV/H2 O2 0 W cm−2 0.4 W cm−2

H2 O2
0.2 W cm−2 0.6 W cm−2
UV
Figure 6: Derivation of pseudo-first-order kinetic model plot at
Figure 5: Effect of UV irradiation and H2 O2 electrogeneration in different UV-light intensity. (PVA = 2 mg L−1 , pH = 3, Na2 SO4 =
photoelectrochemical oxidation of PVA. (PVA = 2 mg L−1 , Na2 SO4 = 0.05 M, oxygen flow rate = 500 cm3 min−1 , and current density =
0.05 M, pH = 3, oxygen flow rate = 500 cm3 min−1 , Na2 SO4 = 0.05 M, 10 mA cm−2 ).
and 𝐼0 = 0.45 mW cm−2 ).
0.03
electrogeneration without UV irradiation, and H2 O2 electro- 0.025 kap = 0.0359 I0 + 0.0019

generation plus UV irradiation. It can be seen that there was R2 = 0.9923
no significant removal of PVA with UV irradiation alone or 0.02
kap (min−1 )
with H2 O2 electrogeneration in the absence of UV irradia-

tion; the removal efficiencies for these conditions were 3% 0.015
and 16%, respectively. In the case of H2 O2 electrogeneration
with UV irradiation, the PVA removal efficiency increased to 0.01
86%. These results reveal that the electrogeneration of H2 O2
in the presence of UV irradiation can form hydroxyl radicals 0.005
capable of remediating solutions containing PVA. Conse-
quently, this result proves that the photoelectrochemical 0
oxidation method can effectively remove PVA from aqueous 0 0.2 0.4 0.6 0.8
solutions. UV-light intensity (mW cm−2 )
Figure 7: Relation between light intensity and pseudo-first-order

reaction rate constant.
3.3.2. Effect of UV Irradiation Intensity. UV light intensity
determines the concentration of hydroxyl radicals generated.
To evaluate the influence of UV light intensity on the removal
efficiency of PVA, reaction rates were measured for various 3.3.3. PVA Removal Kinetics of Photoelectrochemical Oxida-
UV light intensities from 0 to 0.6 mW cm−2 . Figure 6 shows tion. The overall kinetics of PVA removal by photoelectro-
the effect of UV light intensity on the PVA removal efficiency. chemical oxidation is described by a pseudokinetic model in
It appears that increasing UV light intensity increases the which the rate constant depends on the initial concentration
PVA removal efficiency. This result can be explained by the and the UV light intensity. This model provides preliminary
fact that higher UV light intensity can enhance the generation data for evaluating the reaction rate constant which is
of hydroxyl radicals to remove PVA from the solution (1) an important index. This constant is calculated using the
[42, 43]. On the other hand, at low UV light intensity, the rate following model [42]:
of photolysis of H2 O2 is limited, resulting in decreased PVA
removal efficiency. 𝑘1
PVA + OH∙ 󳨀→ product (11)
The pseudo-first-order reaction constant is linearly cor-
related with UV light intensity (𝑅2 = 0.9923), which is 𝑘i
also directly proportional to the proposed model (18), as 𝑆𝑖 + OH∙ 󳨀
→ product𝑖 (12)
shown in Figure 7. Therefore, the intensity of UV light is
linearly correlated with the efficiency of PVA removal in this where 𝑆𝑖 are scavenger molecules such as intermediates,
study. excess H2 O2 , OH∙ , and HO∙2 [44].
The corresponding kinetic equations for PVA and OH∙ Table 2: Pseudo-first-order rate constants for PVA removal at
are various UV-light intensity.
𝑑 [PVA]
= −𝑘1 [OH∙ ] [PVA] , (13) UV-light intensity (mW cm−2 )
Pseudo-first-order
𝑑𝑡 𝑘ap 𝑅2
∙
𝑑 [OH ] 0 0.0024 0.9
= 𝜙𝐼𝑎 − 𝑘1 [OH∙ ] [PVA] − ∑ 𝑘𝑖 [OH∙ ] [𝑆𝑖 ] .
𝑑𝑡 0.2 0.0094 0.992
(14)
0.4 0.0152 0.994
The steady state concentration of hydroxyl radicals can be 0.6 0.0248 0.998
described by (14), which is obtained by solving (13):
𝜙𝐼𝑎
[OH∙ ]ss = ,
𝑘1 [PVA] + ∑𝑖 𝑘𝑖 [𝑆𝑖 ] line to obtain the apparent reaction rate constant (𝑘ap ).
The conformity between experimental data and the model
𝐼𝑎 = 𝐼0 𝑓H2 O2 [1 − exp (−2.3𝑙 (𝜀H2 O2 [H2 O2 ] + 𝜀PVA [PVA]))],
values was evaluated by calculating correlation coefficients
𝜀H2 O2 [H2 O2 ] (𝑅2 ). The apparent reaction rate constants and corre-
𝑓H2 O2 = , lation coefficients calculated from the pseudo-first-order
𝜀H2 O2 [H2 O2 ] + 𝜀PVA [PVA] model are listed in Table 2. Table 2 also shows that as
(15) the UV light intensity is increased, the reaction rate con-
stant increases, and thus, the removal efficiency of PVA
where 𝐼0 is the incident UV light intensity, 𝑙 is the optical increases.
path length of the system, and 𝜀H2 O2 and 𝜀PVA are the molar
extinction coefficients for H2 O2 and PVA, respectively. As
PVA and H2 O2 have high absorbances in the early stages of
4. Conclusions
the process, we can write
In this study, the removal of PVA from aqueous solution
1 − exp (−2.3𝑙 (𝜀H2 O2 [H2 O2 ] + 𝜀PVA [PVA])) ≈ 1, via photoelectrochemical oxidation was investigated in a
closed batch system. We compared the electrogeneration of
𝜙𝐼0 𝑓H2 O2
[OH∙ ]ss = . H2 O2 using three cathode materials (i.e., platinum, graphite,
𝑘1 [PVA] + ∑𝑖 𝑘𝑖 [𝑆𝑖 ] and activated carbon fiber (ACF)) fed with oxygen. The
(16) accumulation of electrogenerated H2 O2 using the ACF elec-
trode was greater than the concentrations obtained using
By inserting the previous expression into (13), the follow- other cathode materials. Several parameters were evaluated
ing overall rate law is deduced: to characterize the H2 O2 electrogeneration, such as current
𝑘1 𝜙𝐼0 𝑓H2 O2 density, oxygen flow rate, solution pH, and the type of
𝑑 [PVA]
− = [PVA] . (17) supporting electrolyte used. The results indicated that the
𝑑𝑡 𝑘1 [PVA] + ∑𝑖 𝑘𝑖 [𝑆𝑖 ] optimal conditions for H2 O2 electrogeneration were a current
If the concentration of the substrate is high, so that density of 10 mA cm−2 , an oxygen flow rate of 500 cm3 min−1 ,
𝑘1 [PVA] ≫ ∑𝑖 𝑘𝑖 [𝑆𝑖 ], the overall rate expression simplifies and pH = 3. The addition of 0.05 M Na2 SO4 as a supporting
to a zero order reaction rate: electrolyte also resulted in rapid H2 O2 electrogeneration. The
PVA removal efficiencies achieved under these conditions
𝑑 [PVA] were 3%, 16%, and 86% using UV, H2 O2 electrogeneration,
− = 𝜙𝐼0 𝑓H2 O2 . (18)
𝑑𝑡 and UV/H2 O2 electrogeneration, respectively. A UV light
However, in the present study, the concentration of PVA intensity of 0.6 mW cm−2 was found to produce the high-
is lower than that of H2 O2 ; thus, ∑𝑖 𝑘𝑖 [𝑆𝑖 ] ≫ 𝑘1 [PVA], and est rate of PVA removal in the present study. A simple
the overall rate expression simplifies to a pseudo-first-order kinetic model was proposed which confirmed the suitability
reaction rate: of pseudo-first-order reaction. Reaction rate constant (𝑘ap )
was dependent on the UV light intensity, and the pseudo-
𝑑 [PVA] 𝑘1 𝜙𝐼0 𝑓H2 O2 first-order constant was also directly proportional to UV
− = [PVA] (19)
𝑑𝑡 ∑𝑖 𝑘𝑖 [𝑆𝑖 ] light intensity. Under these conditions, the maximum PVA
removal efficiency was found to be 91%.
or
𝑑 [PVA]
− = 𝑘ap [PVA] . (20) Conflict of Interests
𝑑𝑡
The previous equation corresponds to a pseudo-first- The authors declare that there is no conflict of interests with
order reaction. The semilogarithmic graphs of PVA con- any financial organization regarding the material discussed in
centration versus time thus can be fitted with a straight this study.
Acknowledgment [14] C.-T. Wang, J.-L. Hu, W.-L. Chou, and Y.-M. Kuo, “Removal
of color from real dyeing wastewater by Electro-Fenton tech-
The authors would like to thank the National Science Council nology using a three-dimensional graphite cathode,” Journal of
of Taiwan, ROC, for financially supporting this study under Hazardous Materials, vol. 152, no. 2, pp. 601–606, 2008.
contract number NSC101-2628-E-241-013-MY3. [15] J. Jia, J. Yang, J. Liao, W. Wang, and Z. Wang, “Treatment of
dyeing wastewater with ACF electrodes,” Water Research, vol.
33, no. 3, pp. 881–884, 1999.
References
[16] C.-T. Wang, W.-L. Chou, M.-H. Chung, and Y.-M. Kuo, “COD
[1] X. Zhu, M. Tong, S. Shi, H. Zhao, and J. Ni, “Essential explana- removal from real dyeing wastewater by electro-Fenton tech-
tion of the strong mineralization performance of boron-doped nology using an activated carbon fiber cathode,” Desalination,
diamond electrodes,” Environmental Science and Technology, vol. 253, no. 1–3, pp. 129–134, 2010.
vol. 42, no. 13, pp. 4914–4920, 2008. [17] W. L. Chou, L. S. Chen, C. T. Wang, and S. R. Lee, “Electro-
[2] M. Zhou, Z. Wu, X. Ma, Y. Cong, Q. Ye, and D. Wang, “A Fenton removal of polyvinyl alcohol from aqueous solutions
novel fluidized electrochemical reactor for organic pollutant using activated carbon fiber cathode,” Fresenius Environmental
abatement,” Separation and Purification Technology, vol. 34, no. Bulletin, vol. 21, no. 12, pp. 3735–3742, 2012.
1–3, pp. 81–88, 2004. [18] J. Veres, S. Ogier, G. Lloyd, and D. De Leeuw, “Gate insulators in
[3] L. Wei, H. Zhu, X. Mao, and F. Gan, “Electrochemical oxidation organic field-effect transistors,” Chemistry of Materials, vol. 16,
process combined with UV photolysis for the mineralization of no. 23, pp. 4543–4555, 2004.
nitrophenol in saline wastewater,” Separation and Purification [19] J. A. Giroto, R. Guardani, A. C. S. C. Teixeira, and C. A.
Technology, vol. 77, no. 1, pp. 18–25, 2011. O. Nascimento, “Study on the photo-Fenton degradation of
[4] D. R. Stapleton, I. K. Konstantinou, D. G. Hela, and M. polyvinyl alcohol in aqueous solution,” Chemical Engineering
Papadaki, “Photolytic removal and mineralisation of 2- and Processing, vol. 45, no. 7, pp. 523–532, 2006.
halogenated pyridines,” Water Research, vol. 43, no. 16, pp. [20] J. G. Lim and D. H. Park, “Degradation of polyvinyl alcohol
3964–3973, 2009. by Brevibacillus laterosporus: metabolic pathway of polyvinyl
[5] O. Legrini, E. Oliveros, and A. M. Braun, “Photochemical alcohol to acetate,” Journal of Microbiology and Biotechnology,
processes for water treatment,” Chemical Reviews, vol. 93, no. vol. 11, no. 6, pp. 928–933, 2001.
2, pp. 671–698, 1993. [21] S. H. Bossmann, E. Oliveros, S. Göb et al., “Degradation of
[6] M. Panizza and G. Cerisola, “Electrochemical generation of polyvinyl alcohol (PVA) by homogeneous and heterogeneous
H2 O2 in low ionic strength media on gas diffusion cathode fed photocatalysis applied to the photochemically enhanced Fenton
with air,” Electrochimica Acta, vol. 54, no. 2, pp. 876–878, 2008. reaction,” Water Science and Technology, vol. 44, no. 5, pp. 257–
262, 2001.
[7] D. Georgiou, P. Melidis, A. Aivasidis, and K. Gimouhopoulos,
“Degradation of azo-reactive dyes by ultraviolet radiation in the [22] A. Grönroos, P. Pirkonen, J. Heikkinen, J. Ihalainen, H. Mur-
presence of hydrogen peroxide,” Dyes and Pigments, vol. 52, no. sunen, and H. Sekki, “Ultrasonic depolymerization of aqueous
2, pp. 69–78, 2002. polyvinyl alcohol,” Ultrasonics Sonochemistry, vol. 8, no. 3, pp.
259–264, 2001.
[8] X. Wang, H. Zhao, X. Quan, Y. Zhao, and S. Chen, “Visible light
photoelectrocatalysis with salicylic acid-modified TiO2 nan- [23] S. J. Zhang and H. Q. Yu, “Radiation-induced degradation of
otube array electrode for p-nitrophenol degradation,” Journal polyvinyl alcohol in aqueous solutions,” Water Research, vol. 38,
of Hazardous Materials, vol. 166, no. 1, pp. 547–552, 2009. no. 2, pp. 309–316, 2004.
[9] L. Zhou, Z. Hu, C. Zhang, Z. Bi, T. Jin, and M. Zhou, [24] S. K. Behera, J.-H. Kim, X. Guo, and H.-S. Park, “Adsorption
“Electrogeneration of hydrogen peroxide for electro-Fenton equilibrium and kinetics of polyvinyl alcohol from aqueous
system by oxygen reduction using chemically modified graphite solution on powdered activated carbon,” Journal of Hazardous
felt cathode,” Separation and Purification Technology, vol. 111, pp. Materials, vol. 153, no. 3, pp. 1207–1214, 2008.
131–136, 2013. [25] W.-L. Chou, “Removal and adsorption characteristics of
[10] M. Skoumal, R. M. Rodrı́guez, P. L. Cabot et al., “Electro- polyvinyl alcohol from aqueous solutions using electrocoagula-
Fenton, UVA photoelectro-Fenton and solar photoelectro- tion,” Journal of Hazardous Materials, vol. 177, no. 1–3, pp. 842–
Fenton degradation of the drug ibuprofen in acid aqueous 850, 2010.
medium using platinum and boron-doped diamond anodes,” [26] W.-L. Chou, C.-T. Wang, C.-W. Hsu, K.-Y. Huang, and T.-C.
Electrochimica Acta, vol. 54, no. 7, pp. 2077–2085, 2009. Liu, “Removal of total organic carbon from aqueous solution
[11] A. Altin, “An alternative type of photoelectro-Fenton process for containing polyvinyl alcohol by electrocoagulation technology,”
the treatment of landfill leachate,” Separation and Purification Desalination, vol. 259, no. 1–3, pp. 103–110, 2010.
Technology, vol. 61, no. 3, pp. 391–397, 2008. [27] M. Sudoh, H. Kitaguchi, and K. Koide, “Electrochemical pro-
[12] S. Irmak, H. I. Yavuz, and O. Erbatur, “Degradation of 4- duction of hydrogen peroxide by reduction of oxygen,” Journal
chloro-2-methylphenol in aqueous solution by electro-Fenton of Chemical Engineering of Japan, vol. 18, no. 5, pp. 409–414,
and photoelectro-Fenton processes,” Applied Catalysis B, vol. 63, 1985.
no. 3-4, pp. 243–248, 2006. [28] J. H. Finley, “Spectrophotometric determination of polyvinyl
[13] A. Model, E. Bustos, K. Esquivel, L. A. Godinez, and Y. Meas, alcohol in paper coatings,” Analytical Chemistry, vol. 33, no. 13,
“Electrochemical incineration of phenolic compounds from the pp. 1925–1927, 1961.
hydrocarbon industry using boron-doped diamond electrodes,” [29] M. Panizza and M. A. Oturan, “Degradation of Alizarin Red
International Journal of Photoenergy, vol. 2012, Article ID by electro-Fenton process using a graphite-felt cathode,” Elec-
681875, 6 pages, 2012. trochimica Acta, vol. 56, no. 20, pp. 7084–7087, 2011.
[30] Y. Y. Chu, Y. Qian, W. J. Wang, and X. L. Deng, “A dual-cathode

electro-Fenton oxidation coupled with anodic oxidation system
used for 4-nitrophenol degradation,” Journal of Hazardous
Materials, vol. 199-200, pp. 179–185, 2012.
[31] I. Sirés, E. Guivarch, N. Oturan, and M. A. Oturan, “Efficient
removal of triphenylmethane dyes from aqueous medium by in
situ electrogenerated Fenton’s reagent at carbon-felt cathode,”
[32] A. R. Khataee, M. Zarei, and L. Moradkhannejhad, “Application
of response surface methodology for optimization of azo dye
removal by oxalate catalyzed photoelectro-Fenton process using
carbon nanotube-PTFE cathode,” Desalination, vol. 258, no. 1–3,
pp. 112–119, 2010.
[33] Y. B. Xie and X. Z. Li, “Interactive oxidation of photoelec-
trocatalysis and electro-Fenton for azo dye degradation using
TiO2 -Ti mesh and reticulated vitreous carbon electrodes,”
Materials Chemistry and Physics, vol. 95, no. 1, pp. 39–50, 2006.
[34] H. Lei, H. Li, Z. Li et al., “Electro-Fenton degradation of cationic
red X-GRL using an activated carbon fiber cathode,” Process
Safety and Environmental Protection, vol. 88, no. 6, pp. 431–438,
2010.
[35] E. Brillas, J. C. Calpe, and J. Casado, “Mineralization of 2,4-D by
advanced electrochemical oxidation processes,” Water Research,
vol. 34, no. 8, pp. 2253–2262, 2000.
[36] S.-H. Yuan and X.-H. Lu, “Comparison treatment of various
chlorophenols by electro-Fenton method: relationship between
chlorine content and degradation,” Journal of Hazardous Mate-
rials, vol. 118, no. 1–3, pp. 85–92, 2005.
[37] C. A. Martı́nez-Huitle and E. Brillas, “Decontamination of
wastewaters containing synthetic organic dyes by electrochem-
ical methods: a general review,” Applied Catalysis B, vol. 87, no.
3-4, pp. 105–145, 2009.
[38] A. Özcan, Y. Şahin, A. Savaş Koparal, and M. A. Oturan,
“Carbon sponge as a new cathode material for the electro-
Fenton process: comparison with carbon felt cathode and
application to degradation of synthetic dye basic blue 3 in
aqueous medium,” Journal of Electroanalytical Chemistry, vol.
616, no. 1-2, pp. 71–78, 2008.
[39] M. Zhou, Q. Yu, L. Lei, and G. Barton, “Electro-Fenton method
for the removal of methyl red in an efficient electrochemical
system,” Separation and Purification Technology, vol. 57, no. 2,
pp. 380–387, 2007.
[40] W.-P. Ting, M.-C. Lu, and Y.-H. Huang, “Kinetics of 2,6-
dimethylaniline degradation by electro-Fenton process,” Jour-
nal of Hazardous Materials, vol. 161, no. 2-3, pp. 1484–1490,
2009.
[41] H. Golnabi, M. R. Matloob, M. Bahar, and M. Sharifian, “Inves-
tigation of electrical conductivity of different water liquids and
electrolyte solutions,” Iranian Physical Journal, vol. 3, no. 2, pp.
24–28, 2009.
[42] N. Modirshahla and M. A. Behnajady, “Photooxidative degra-
dation of Malachite Green (MG) by UV/H2 O2 : influence
of operational parameters and kinetic modeling,” Dyes and
[43] M. Muruganandham and M. Swaminathan, “Photochemical
oxidation of reactive azo dye with UV-H2 O2 process,” Dyes and
[44] N. Daneshvar, M. Rabbani, N. Modirshahla, and M. A. Behna-
jady, “Critical effect of hydrogen peroxide concentration in
photochemical oxidative degradation of C.I. Acid Red 27
(AR27),” Chemosphere, vol. 56, no. 10, pp. 895–900, 2004.
http://dx.doi.org/10.1155/2013/658231
Research Article
Catalytic Activity of Porous Phosphate Heterostructures-Fe
towards Reactive Black 5 Degradation
Marco S. Lucas,1 Manuel Algarra,2 José Jiménez-Jiménez,3

Enrique Rodríguez-Castellón,3 and José A. Peres1
1
Centro de Quı́mica de Vila Real, Universidade de Trás-os-Montes e Alto Douro, Apartado 1013, 5001-801 Vila Real, Portugal
2
Centro de Geologia do Porto, Faculdade de Ciências, Universidade do Porto, Rua do Campo Alegre 687, 4169-007 Porto, Portugal
3
Departamento de Quı́mica Inorgánica, Facultad de Ciencias, Universidad de Málaga, 29071 Málaga, Spain
Correspondence should be addressed to Marco S. Lucas; mlucas@utad.pt
Received 10 May 2013; Accepted 9 July 2013
Copyright © 2013 Marco S. Lucas et al. This is an open access article distributed under the Creative Commons Attribution License,
Fenton’s reaction is often used to decompose stable substances in wastewater. In this study, experiments based on the effect of
porous phosphate heterostructures as catalyst sorbent of Fe2+ synthesised by different procedures were planned. The examined
PPH-Fe/H2 O2 as oxidant in a heterogeneous process under mild conditions at pH 5 was found to be very efficient for discoloration
of a simulated wastewater containing 50 mg L−1 of a commercial azo dye (Reactive Black 5) reaching 95% of decolourization. Under
the described conditions total visual decolourization was achieved after 360 min. This study can provide a simple, effective, and
economic system ideal for the treatment of toxic and nonbiodegradable azo dyes.
1. Introduction oxidizing agents, such as O3 [7–9], H2 O2 [10, 11], UV light

[12], or combination of such oxidants [13, 14], known as
Synthetic dyes are extensively used for textile dyeing, paper advanced oxidation processes (AOPs).
printing, color photography, and as additives in petroleum Among these, the Fenton reaction, iron-based photo-
products [1]. In the textile manufacturing industry, up to catalytic systems via hydroxyl radicals produced by H2 O2
10–25% of the dyes are lost after the dyeing process and under UV, has attracted much attention for wastewater
about 2–20% of them are directly discharged to the aqueous treatments because of their efficient, low cost, and benignity
effluents in different environmental components [2]. Azo and to environment [15, 16]. This catalytic system decolourizes
triphenylmethane dyes are primarily produced and used in completely and partially mineralized textile dyes in short
the textile industry and cause pollution if not properly treated reaction time [17]. Common Fenton processes involve the
before discharge to the environment [3, 4]. In this context, application of ferrous or ferric salts and hydrogen peroxide in
the textile industry is concerned with these xenobiotics order to produce hydroxyl radicals (HO∙ ). However, despite
compounds to improve the existing technologies to treat the high efficiency, the process generates a high amount of
the dye containing wastewater, because they pose lethal, sludge in the coagulation step for the elimination of the
mutagenicity, genotoxicity, and carcinogenicity effects [5]. iron added. For this reason, in the last years, an important
Conventional treatment processes have long been estab- effort has been done in the field of heterogeneous catalysis to
lished such as chemical precipitation, coagulation, adsorp- facilitate the elimination and reuse of iron [18, 19].
tion, and flocculation [6], but they have their own dis- Advanced oxidation processes (AOPs) have been devel-
advantages, mainly used for insoluble dyestuff wastewater. oped in the last decades to environmental applications,
Bioremediation techniques are considered unsatisfactorily mainly focused on the removing by mineralization of refrac-
because they need further processes. The chemical methods tory organic compounds. For this, Fenton reaction catalysed
are based in the oxidation of the organic materials by by Fe2+ is used with hydrogen peroxide as oxidizing agent and
for photo-Fenton process with the UV irradiation. Normally, in deionized Millipore water accordingly to desired final
Fenton and photo-Fenton are homogeneous processes where concentrations (w/v). The pH was monitored in initial and
Fe2+ cations are in solution; however some limitations related treated samples (Denver Instrument Company).
with the eventually precipitation of insoluble ferric hydrox-
ides, which require an acidification of solution and by their 2.2. Preparation of the Catalyst. Porous phosphate hetero-
use the materials of reactor must be resistant to corrosion. structures (PPH) were synthesized according to previously
Furthermore, in homogeneous processes, an additional step reported procedures [21]. Thus, to a solution of CTMA-
of separation must be made for recovering the catalyst. Br in 1-propanol and H3 PO4 (85%), zirconium(IV) propox-
Because of these limitations heterogeneous catalyst can be ide (70%) is added with a respective molar ratio CTMA-
an alternative, and several solid catalysts which incorporate Br : H3 PO4 : Zr-oPr 1,5 : 1 : 0,5. After 3 days under stirring,
Fe2+ are tested in Fenton or photo-Fenton reactions. Thus, has the obtained cetyltrimethylamonium-ZrP (CTMAZrP) was
been tested as heterogeneous catalyst iron-containing zeolites centrifuged and washed three times with 1-propanol and
[20], clay pillared by Fe hydroxo complexes or by Fe2+ cationic suspended in water (10 g L−1 ). Next, a solution of hexadecy-
exchange, or wet impregnation with a Fe2+ solution of an lamine in 1-propanol (35 g L−1 ) was added as a cosurfactant.
adequate support. After one day of stirring, a solution (50%, v/v in 1-propanol)
On the other hand, porous phosphate heterostructures of tetraethylorthosilicate (TEOS) is added. After three days
(PPH) are a new kind of versatile porous materials, which under stirring the solid is recovered by filtration, washed
are application as catalyst and sorbent. The synthesis of three times with deionised water, and dried 1 day at 60∘ C in
this material combines the methodologies of pillared layered air. The solid was calcined at 550∘ C for 5 hours (1.5 K min−1
structures (PLS) and silica mesostructured with surfactant as heating rate) and PPH is obtained.
MCM-41 type. Thus, into interlayer space of zirconium phos- Hybrid S-PPH was obtained by a similar process [25],
phate, silica galleries are formed using surfactant molecules as but mercaptopropyltrimethoxysilane (MPTMS) was added
templates. After surfactant removing a mesoporous material together with TEOS at 5 : 1 TEOS : MPTMS molar ratio. In
is obtained with high specific area (600 m2 g−1 ) and a cationic this case, it is not possible to remove surfactant molecules
exchange capacity (CEC) of surface 1.7 meq g−1 due to the by calcination, and an acid extraction was carried out with
presence of PO-H and SiO-H surface groups [21]. Because of an HCl : ethanol solution (1 : 10 v/v). To oxidize thiol group to
these properties, this material has been tested as solid acid sulfonate, S-PPH (1 g) was suspended in methanol (10 mL),
catalyst and as support of metallic species as Ru or Cu in and H2 O2 (33%, 1 mL) was added. After 1 day under stirring,
the synthesis of catalysts [22, 23]. Also, hybrid PPH are also the solid is filtered and washed with water, ether and acidified
synthesized adding an organosilane derivate together with with a solution of H2 SO4 0.2 M [27]. The solid is dried in air at
tetraethyl orthosilicate (TEOS) as silica precursor. Thus, pro- 60∘ C, and SO3 -PPH is obtained. Thus, with the incorporation
pionitrile, aminopropyl, or mercaptopropyl groups are incor- of sulfonic acid on the surface of silica galleries, the CEC
porated on the surface of silica galleries, and surface chemical is increased from 1.7 to 3.10 meq g−1 for PPH. Fe exchanged
and physics properties can be modified for specific appli- materials were obtained by adding PPH and SO3 -PPH to
cations [24–31]. In this line, mercaptopropyl groups can be an adequate volume of solution, which contains 10 times
oxidized to sulfonic acid increasing the acidity and CEC [27]. the respective CEC. The solid was washed three times with
High specific surface area and CEC are two parameters deionised water and dried in air at 60∘ C. These solids were
interesting for the synthesis of Fe2+ exchanged PPH or named Fe-PPH (exc) and FeSO3 -PPH (exc), respectively. Fe
Fe2+ supported PPH using as well PPH pure silica or a impregnated PPH material, PPH-Fe (imp), was prepared by
hybrid sulfonic-PPH obtained by oxidation of the respective wet incipient impregnation of the PPH support using an
mercaptopropyl-PPH precursor, obtaining new materials aqueous solution FeCl2 (0.2 M) which contains 2 times the
with potential use as heterogeneous catalyst for Fenton and CEC. After impregnation the sample was dried at 60∘ C in air.
photo-Fenton reactions.
In the present work, Fe2+ -PPH materials were synthesized 2.3. Fenton’s Reagent Experiments. Batch experiments for
by different procedures, and the decolourization of Reactive Fenton oxidation were performed in a cylindrical borosilicate
Black 5, a textile azo dye, was achieved by means of heteroge- glass reactor of 800 mL of capacity, with sampling ports at
neous Fenton reagent process. Colour and iron leaching were the top. The reaction temperature was kept at the desired
followed along experiments. value within ±5∘ C using a thermostatically controlled outer
water jacket. For every experiment performed, the reactor
2. Experimental was initially loaded with PPH (1 gL−1 ) and 500 mL of RB5
(50 mgL−1 ) aqueous solution, and continuous mixing was
2.1. Materials. Azo dye Reactive Black 5 (RB5, CI 20505) maintained by means of a magnetic stirrer. In all experiments
was obtained from Dystar Anilinas Texteis Lda (Portugal) necessary quantities of freshly RB5 and H2 O2 (2 × 10−3 M)
and used without any further purification. H2 O2 (Perhydrol, were prepared from stock solutions. Experiments were car-
30% w/w) and FeSO4 ⋅7H2 O were purchased from Merck ried out, at an initial pH 5 because the nonbuffered solutions
(Darmstadt, Germany) and Sigma-Aldrich Spain, respec- used in the reaction of Fenton suffer a pH decrease during
tively, and other chemicals were at least analytical grade the reaction time to a pH range around 3-4 [23]. Absorbance
reagents. Solutions were prepared by dissolving the dye readings at visible maximum peak (𝜆 max = 595 nm) were
600 300
Quantity adsorbed (cm3 /g STP)

500 250
400 200
300 150
200 100
100 50
0 0
0 0.2 0.4 0.6 0.8 1 0 0.2 0.4 0.6 0.8 1
Relative pressure (P/Po ) Relative pressure (P/Po )
(a) (b)
600
500
400
300
200
100
0
0 0.2 0.4 0.6 0.8 1
Relative pressure (P/Po )
Adsorption
Desorption
(c)
Figure 1: N2 adsorption-desorption isotherms at 77 K: (a) Fe-PPH (exc), (b) FeSO3 -PPH (exc), and (c) PPH-Fe (imp).
performed using a Jasco V-530 spectrophotometer. Na2 SO3 diffractometer, equipped with a graphite monochromator
was used to quench the oxidation before the spectropho- and using Cu K𝛼 radiation. The specific surface areas of the
tometer analysis. The iron lixiviation from PPH support was solids were evaluated from the N2 adsorption-desorption
followed by atomic absorption spectroscopy (AAS) using a isotherms at −196∘ C in a MICROMERITICS ASAP 2020
Unicam ICE 3000 Series. All values presented are the means apparatus, after degassing at 200∘ C and 1.3.10-2 Pa for 24 h.
of at least three independent assays unless otherwise stated. Fe content was determined using inductively coupled plasma
The observed standard deviation of experimental data was spectrometry (ICP) Optima 7300 DV. For this, the solids
always less than 6% of the reported value. The concentration were dissolved in 0.2 mL of hydrofluoric acid (40%, v/v) at
of residual RB5 was calculated by Beer-Lambert law, after room temperature and diluted to an adequate concentration
dilution when necessary, using the optical density and the for ICP measurements.
molar extinction coefficient observed at the characteristic
wavelength and expressed as
𝐶dye 3. Results and Discussion
Dye decolourization = (1 − 𝐶dye,𝑡 = ) × 100%,
𝐶dye,𝑡=0
3.1. Characterization of Catalyst. All materials prepared show
(1) a diffraction peak at low angle centered around 40 Å,
where 𝐶dye,𝑡 and 𝐶dye,𝑡=0 are the concentrations of RB5 at which indicates that galleries’ structure is preserved after
reaction time 𝑡 and initial, respectively. cationic exchange as well as after the impregnation. Also,
no peak is observed at high angle, even for Fe2+ sup-
2.4. Characterization Methods. Powder X-ray diffraction ported material that evidences high dispersion of Fe2+ ions
(XRD) patterns were recorded on a Siemens D5000 and the possible aggregates of Fe2+ salt was not formed,
Table 1: Textural parameters of the different substrate used in RB5 decolourization.
Material 𝑑001 (Å) 𝑆BET (m2 g−1 ) 𝑉𝑝 ∗ (cm3 g−1 ) 𝑑𝑝 ∗ (Å) mmol Fe g−1
FeSO3 -PPH (exc) 42 372 0.448 28.9 1.39
Fe-PPH (exc) 40 490 0.610 37.3 0.8
PPH-Fe (imp) 40 462 0.677 114 1.17
∗
Porous volume and porous diameter using Cranston and Inkley method.
and due to the small size or amorphous structure, no

sharp diffraction peaks are produced (see Supplementary 100
Information in Supplementary Material available online at
http://dx.doi.org/10.1155/2013/658231). 80
Textural parameters were obtained from the N2
[RB5] (%)
adsorption-desorption isotherms at 77 K. These isotherms 60
were of type IV (Figure 1), corresponding to mesoporous
type materials, and reflected their porosity due to the 40
presence of silica galleries in the materials as is noted above
in XRD characterization (Table 1).
20
In all cases, a decrease in the Brunauer-Emmett-Teller
(BET) surface area was achieved with respect to the pure
silica PPH material (620 m2 g−1 ) [20]. The BET surface area 0
decreases with the incorporation of the Fe species. 0 50 100 150 200 250 300 350 400
This decreasing is more evidenced on FeSO3 -PPH, Time (min)
because this solid requires more steps in its formation and the FeSO3 -PPH (exc)
hybrid starting material (S-PPH) has low surface (472 m2 g−1 ) Fe-PPH (exc)
[24] than PPH. Here the Fenton’s reaction with RB5 leads PPH-Fe (imp)
to the decrease in aromaticity which eventually results in an Figure 2: RB5 decolourization through heterogeneous Fenton’s
increase in biodegradability and color removal of dye. reaction using three different PPH with Fe2+ . [RB5] = 50 mg L−1 ;
[PPH] = 1 g L−1 ; [H2 O2 ] = 2.0 × 10−3 mol L−1 .
3.2. The Fenton Process in the Decolourization of RB5.

Figure 2 presents the results obtained with the Fenton’s
reaction in the experiments using as source of iron three vanishes but at a lower rate than the visible band. Thus,
PPH catalysts. FeSO3 -PPH (exc) and Fe-PPH (exc) revealed the spectra suggest that HO∙ radicals generated first attacks
to be ineffective in promoting the Fenton process. The azo groups, through transfer of one electron, and open the
decolourization achieved with these two PPH catalysts was –N=N– bonds, destructing the long conjugated 𝜋 systems
small, 15.3 and 20.8%, respectively. This can be explained by and degrading it efficiently.
the low iron available to catalyse the generation of hydroxyl Afterwards, the aromatic rings elimination also took
radicals and consequently decolourize the RB5 solution. place but needs a relative longer period of time [33]. From
For other side, PPH-Fe (imp) showed an excellent capacity Figures 4(a) and 4(b) it is also possible to observe a fast color
to catalyse the production of hydroxyl radicals. This PPH disappearance in the first minutes. This behavior reveals that
catalyst allowed reaching an RB5 decolourization of 95%, for iron is available to react with hydrogen peroxide as long as the
the same reaction time, 360 minutes. experiment started, taking into account that any adsorption
The mechanism of reaction can be described as presented step was performed before Fenton’s experiment, H2 O2 and
in Figure 3. The iron present in the PPH-Fe (imp) structure Fe2+ generating hydroxyl radicals immediately, when Fe2+
(Fe2+ ) reacts with the H2 O2 to generate HO∙ radicals, which belongs to the PPH structure. Thus, it is possible to assume
will break the azo bonds (–N=N–) and promote the RB5 that Fenton’s process starts without any iron leaching from
decolourization. PPH catalyst. Nonetheless, the concentration of Fe in solution
Figure 4 presents the UV-Vis spectra and the RB5 colour was monitored at the end of each Fenton’s process.
evolution along the Fenton experiment with the PPH-Fe The experiment performed with FeSO3 -PPH (exc)
(imp) catalyst. The RB5 UV-Vis spectra (𝑡 = 0) consist in two revealed an iron concentration of 0.81 mg Fe L−1 , the Fe-PPH
main characteristic absorption bands: one in the UV region (exc) 1.58 mg Fe L−1 and the PPH-Fe (imp) 4.92 mg Fe L−1 ,
(at 310 nm) and other in the visible region, at 595 nm. after a reaction time of 360 minutes. Therefore, although
The UV band is characteristic of two adjacent rings, apparently at the beginning of each experiment iron is linked
whereas the visible band is owing to long conjugated 𝜋 system to the PPH, throughout the Fenton’s experiment its leaching
linked by two azo groups [32]. The RB5 decolourization occurs and influences the RB5 color removal. Moreover, the
spectra show that the intensity of the visible band (at 595 nm) highest RB5 decolourization occurs precisely with the PPH
starts to decrease faster. The UV band (at 310 nm) also catalyst that releases more iron to the solution. PPH-Fe (imp)
-Fe3+ HO2 ∙
H2 O2
−
SO3 -PPH host
H2 O2
HO2 ∙ O2
3S
SO
S -Fe2+
O
−
−
− O3 3
SO − Fe2+ 2+
Fe =
Fe2+ 3
SO3
−
−
Fe2+ −
O3 S
3 −
SO3 +H2 O2
SO
−
−
O3
O3 S
S
RB5
-Fe3+ + HO∙ + OH−
RB5 oxidation
Figure 3: Mechanistic representation of reactions possible involved in heterogeneous Fenton-like catalysed by Fe-PPH.
2.0 reaction without iron leachate, under the experimental con-

NaO 3 SOCH 2 CH 2 O2 S N N SO 3 Na ditions used, seems to be inefficient. In order to overcome the
1.6
Time (min): drawback of the fixation of Fe2+ onto PPH supports avoiding
HO 0
the iron leaks, subsequent studies are planned to improve the
H2 N
system proposed to be applicable to water treatment.
1.2 SO 3 Na
Absorbance
NaO 3 SOCH 2 CH 2 O2 S N N
10
Acknowledgments
0.8
20 The authors would like to thank the PEst-C/QUI/UI0616/2011
and Ciência 2007 from FCT (Lisbon, Portugal). Also thanks
0.4 30
are due to the Spanish Ministry of Economy and Competi-
60 tivity (Project CTQ2012-37925-C03-03) and Andalucı́a Tech
150 90
0.0
Program from University of Malaga.
200 300 400 500 600 700
Wavelength (nm) References
(a)
[1] H. Zollinger, Colour Chemistry: Synthesis, Properties and Appli-
cations of Organic Dyes and Pigments, Wiley-VCH, Weinheim,
Germany, 3rd edition, 2003.
[2] A. Baban, A. Yediler, and N. K. Ciliz, “Integrated water man-
agement and CP implementation for wool and textile blend
processes,” Clean, vol. 38, no. 1, pp. 84–90, 2010.
[3] A. B. A. Boxall, Transformation Products of Synthetic Chemicals
in the Environment, The Handbook of Environmental Chem-
(b) istry, part 2, Springer, Heidelberg, Germany, 2009.
[4] H. A. Erkurt, Biodegradation of Azo Dyes, vol. 9 of The
Figure 4: RB5 photodegradation with Fe-PPH: (a) UV-Vis spectra Handbook of Environmental Chemistry, Springer, Heidelberg,
evolution (inset the chemical structure of RB5). (b) Dye colour Germany, 2010.
evolution. [RB5] = 50 mg L−1 ; [PPH] = 1 gL−1 ; [H2 O2 ] = 2.0 × [5] L. Fishbein, Potential Industrial Carcinogens and Mutagens, vol.
10−3 mol L−1 . 4 of Studies in Environmental Science, Elsevier, New York, NY,
USA, 1979.
[6] Y. Anjaneyulu, N. S. Chary, and D. S. S. Raj, “Decolouriza-
presented the best results regarding RB5 decolourization, tion of industrial effluents—available methods and emerging
although its application as iron source did not avoid the technologies—a review,” Reviews in Environmental Science and
presence of iron on the final treated solution. Biotechnology, vol. 4, no. 4, pp. 245–273, 2005.
[7] H.-Y. Shu and C.-R. Huang, “Degradation of commercial azo
dyes in water using ozonation and UV enhanced ozonation
4. Conclusions process,” Chemosphere, vol. 31, no. 8, pp. 3813–3825, 1995.
[8] A. C. Gomes, J. C. Nunes, and R. M. S. Simões, “Determination
In summary, PPH revealed to be useful as Fe2+ support in of fast ozone oxidation rate for textile dyes by using a continuous
the Reactive Black 5 decolourization through Fenton reagent, quench-flow system,” Journal of Hazardous Materials, vol. 178,
although PPH ability to promote a heterogeneous Fenton no. 1-3, pp. 57–65, 2010.
[9] M. H. Beak, C. O. Ijagbemi, and D. S. Kim, “Azo dye Acid Red 27 [23] M. D. Soriano, J. Jiménez-Jiménez, P. Concepción, A. Jiménez-
decomposition kinetics during ozone oxidation and adsorption López, E. Rodrı́guez-Castellón, and J. M. L. Nieto, “Vanadium
processes,” Journal of Environmental Science and Health A, vol. oxide-porous phosphate heterostructure catalysts for the selec-
44, no. 6, pp. 623–629, 2009. tive oxidation of H2 S to sulphur,” Solid State Sciences, vol. 12, pp.
[10] O. Türgay, G. Ersöz, S. Atalay, J. Forss, and U. Welander, “The 996–1001, 2010.
treatment of azo dyes found in textile industry wastewater by [24] R. Piazuelo, E. Rodrı́guez-Castellón, J. Jiménez-Jiménez, A.
anaerobic biological method and chemical oxidation,” Separa- Jiménez-López, and J. Benavente, “Chemical surface and
tion and Purification Technology, vol. 79, no. 1, pp. 26–33, 2011. electrochemical characterization of zirconium phosphate het-
[11] S. M. Palácio, F. R. Espinoza-Quiñones, A. N. Módenes, D. erostructures,” Microporous and Mesoporous Materials, vol. 115,
R. Manenti, C. C. Oliveira, and J. C. Garcia, “Optimised pp. 23–32, 2008.
photocatalytic degradation of a mixture of azo dyes using a [25] J. Jiménez-Jiménez, M. Algarra, E. Rodriguez-Castellón, A.
TiO2 /H2 O2 /UV process,” Water Science and Technology, vol. 65, Jiménez-López, and J. C. G. E. da Silva, “Hybrid porous
no. 8, pp. 1392–1398, 2012. phosphate heterostructures as adsorbents of Hg(II) and Ni(II)
[12] A. R. Khataee, M. N. Pons, and O. Zahraa, “Photocatalytic from industrial sewage,” Journal of Hazardous Materials, vol.
degradation of three azo dyes using immobilized TiO2 nanopar- 190, pp. 694–699, 2011.
ticles on glass plates activated by UV light irradiation: influence [26] G. Aguilar-Armenta, M. E. Patiño-Iglesias, J. Jiménez-Jiménez,
of dye molecular structure,” Journal of Hazardous Materials, vol. E. R. Castellón, and A. Jiménez-López, “Application of porous
168, no. 1, pp. 451–457, 2009. phosphate heterostructure materials for gas separation,” Lang-
[13] C. P. Huang, Y. F. Huang, H. P. Cheng, and Y. H. Huang, “Kinetic muir, vol. 22, pp. 1260–1267, 2006.
study of an immobilized iron oxide for catalytic degradation [27] S. Hamoudi and S. Kaliaguine, “Sulfonic acid-functionalized
of azo dye reactive black B with catalytic decomposition of periodic mesoporous organosilica,” Microporous and Meso-
hydrogen peroxide,” Catalysis Communications, vol. 10, no. 5, porous Materials, vol. 59, no. 2-3, pp. 195–204, 2003.
pp. 561–566, 2009. [28] D. Eliche-Quesada, M. I. Macı́as-Ortiz, J. Jiménez-Jiménez,
[14] A. Xu, X. Li, Z. Xiong, Q. Wang, Y. Cai, and Q. Zeng, “High E. Rodrı́guez-Castellón, and A. Jiménez-López, “Catalysts
catalytic activity of cobalt (II)-triethylamine complex towards based on Ru/mesoporous phosphate heterostructures (PPH) for
orange II degradation with H2 O2 as an oxidant under ambient hydrotreating of aromatic hydrocarbons,” Journal of Molecular
conditions,” Catalysis Communications, vol. 26, pp. 44–47, 2012. Catalysis A, vol. 255, pp. 41–48, 2006.
[15] B. Ahmed, E. Limem, A. Abdel-Wahab, and B. Nasr, “Photo- [29] R. Moreno-Tost, M. L. Oliveira, D. Eliche-Quesada, J. Jiménez-
Fenton treatment of actual agro-industrial wastewaters,” Indus- Jiménez, A. Jiménez-López, and E. Rodrı́guez-Castellón, “Eval-
trial and Engineering Chemistry Research, vol. 50, no. 11, pp. uation of Cu-PPHs as active catalysts for the SCR process
6673–6680, 2011. to control NOx emissions from heavy duty diesel vehicles,”
[16] N. Klamerth, S. Malato, A. Agüera, A. Fernández-Alba, and G.
Mailhot, “Treatment of municipal wastewater treatment plant [30] M. D. Soriano, J. Jiménez-Jiménez, P. Concepción, A. Jiménez-
effluents with modified photo-fenton as a tertiary treatment López, E. Rodrı́guez-Castellón, and J. M. L. Nieto, “Selective
for the degradation of micro pollutants and disinfection,” oxidation of H2 S to sulfur over vanadia supported on meso-
Environmental Science and Technology, vol. 46, no. 5, pp. 2885– porous zirconium phosphate heterostructure,” Applied Catalysis
2892, 2012. B, vol. 92, pp. 271–279, 2009.
[17] M. S. Lucas and J. A. Peres, “Decolorization of the azo dye [31] J. Jiménez-Jiménez, P. Maireles-Torres, P. Olivera-Pastor, E.
reactive black 5 by Fenton and photo-Fenton oxidation,” Dyes Rodrı́guez-Castellón, and A. Jiménez-López, “Sol-gel synthe-
and Pigments, vol. 71, no. 3, pp. 236–244, 2006. sis of dodecyltrimethylammonium-expanded zirconium phos-
phate and its application to the preparation of acidic porous
[18] R. Gonzalez-Olmos, M. J. Martin, A. Georgi, F. D. Kopinke, I. oligomeric gallium(III)-exchanged materials,” Langmuir, vol.
Oller, and S. Malato, “Fe-zeolites as heterogeneous catalysts for 13, no. 10, pp. 2857–2862, 1997.
solar Fenton-like reactions at neutral pH,” Applied Catalysis B,
vol. 125, pp. 51–58, 2012. [32] J. A. Peres, L. Carvalho, R. Boaventura, and C. Costa, “Removal
of COD from olive mill wastewater by Fenton’s reagent: kinetic
[19] R. Idel-aouad, M. Valiente, A. Yaacoubi, B. Tanouti, and M. study,” Journal of Environmental Science and Health A, vol. 39,
López-Mesas, “Rapid decolourization and mineralization of the pp. 1–17, 2004.
azo dye C.I. Acid Red 14 by heterogeneous Fenton reaction,”
[33] R. M. C. Silverstein, G. C. Basdler, and G. C. Morrill, Spectropho-
Journal of Hazardous Materials, vol. 186, no. 1, pp. 745–750, 2011.
tometric Identification of Organic Compounds, Wiley, New York,
[20] S. Perathoner and G. Centi, “Wet hydrogen peroxide catalytic NY, USA, 1991.
oxidation (WHPCO) of organic waste in agro-food and indus-
trial streams,” Topics in Catalysis, vol. 33, pp. 207–224, 2005.
[21] J. Jiménez-Jiménez, M. R. Alonso, D. Eliche-Quesada, E.
Rodriguez-Castellón, and A. Jiménez-López, “Synthesis and
characterization of acid mesoporous phosphate heterostructure
(PPH) materials,” Journal of Materials Chemistry, vol. 15, pp.
3466–3472, 2005.
[22] J. Jiménez-Jiménez, M. Rubio-Alonso, D. Eliche-Quesada, E. R.
Castellón, and A. Jiménez-López, “Synthesis and characteriza-
tion of mixed silica/zirconia and silica/titania porous phospate
heterostructures (PPH),” Journal of Physics and Chemistry of
Solids, vol. 67, no. 5-6, pp. 1007–1010, 2006.

Advanced Oxidation Processes For Waste Water Treatment

Diunggah oleh

Informasi Dokumen

Judul Asli

Hak Cipta

Format Tersedia

Bagikan dokumen Ini

Bagikan atau Tanam Dokumen

Opsi Berbagi

Apakah menurut Anda dokumen ini bermanfaat?

Apakah konten ini tidak pantas?

Hak Cipta:

Format Tersedia

Advanced Oxidation Processes For Waste Water Treatment

Diunggah oleh

Hak Cipta:

Format Tersedia

International Journal of Photoenergy

Advanced Oxidation Processes for

Guest Editors: Meenakshisundaram Swaminathan,

Adsorption and Photocatalytic Decomposition of the 𝛽-Blocker Metoprolol in Aqueous Titanium

Solar Photo-Fenton Degradation of Electro-Optical Industry Wastewater by a Pilot-Scale Fresnel Lens

Application of Ozone Related Processes to Mineralize Tetramethyl Ammonium Hydroxide in Aqueous

Multifunctional Chitosan-Copper Oxide Hybrid Material: Photocatalytic and Antibacterial Activities,

Removal of Polyvinyl Alcohol Using Photoelectrochemical Oxidation Processes Based on Hydrogen

Catalytic Activity of Porous Phosphate Heterostructures-Fe towards Reactive Black 5 Degradation,

Meenakshisundaram Swaminathan,1 Muruganandham Manickavachagam,2

Correspondence should be addressed to Meenakshisundaram Swaminathan; chemsam50@gmail.com

Received 15 January 2014; Accepted 15 January 2014; Published 2 March 2014

of various experimental parameters, kinetics, intermediates,

Padmini Ellappan and Lima Rose Miranda

Correspondence should be addressed to Lima Rose Miranda; limamiranda2007@gmail.com

Received 22 May 2013; Accepted 3 October 2013; Published 6 January 2014

Academic Editor: Manickavachagam Muruganandham

1. Introduction composition, particle size distribution, and porosity which

140 Table 1: Physical characterization of the catalysts.

100 Catalyst Pore volume,

120 TiO2 -Ce

Figure 2: XPS analysis of TiO2 -Ce doped catalyst.

Full scale counts: 3320 TiO2 -Ce TiO2

Figure 4: EDX analysis of TiO2 -Ce doped and TiO2 catalyst.

Table 2: Catalyst composition using EDX analysis of TiO2 and

energy corresponding to the wavelength of 551.4 nm was 22.66

TiO2 -Ce (150 W)

TiO2 -Ce (300 W)

TiO2 -Ce (500 W)

Catalyst Properties Light source % degradation Reference

Nanocrystalline Particle size: 12 nm

The TOC removal % was studied for different intervals 90

removal % was maximum using Cerium doped catalyst at an

3.3. Optimization of Operational Parameters 30

of NB molecules adsorbed as well as the number of photons

representation of the plot from which the apparent rate References

Huanan Cui,1 Hong Liu,1 Jianying Shi,1 and Chuan Wang2

Received 18 July 2013; Revised 6 October 2013; Accepted 14 October 2013

Academic Editor: M. Muruganandham

1. Introduction solid solution [18], heterostructure composites [17, 19], and

Table 1: Common characterization techniques for defects.

Technique Characterization Evidence References

Acceptor∙− Potential/eV versus NHE

reactions under light irradiation. Once photoinduced e-h pair

−4 VO 󳰀󳰀 𝑒− CB + Ti4+ 󳨀→ Ti3+ trapped electron (6)

−6 Ti4+ Ti3+ 4ℎ+ VB + O2− 󳨀→ Oa + VO 󸀠󸀠 (8)

(a) (b) (c)

14 When it comes to the donor-type Nb-doped TiO2 , the

or 4. The Function of Defects in Photocatalysis

3 The function of OTDs in photocatalysis can mainly be

−2.0 and the highest occupied molecular orbital (HOMO), from

Ti3+ 3 eV O2− e󳰀 O2− O2− e󳰀 O2− O2− O2−

the subsurface of an 𝑛-type TiO2 , it can be deduced that this

4e󳰀 4.3.1. Adsorption of Oxygen. The introduction of O2 is of

O2 Oad O2 O2 O2 Oad O2 Adsorption

Figure 11: The schematic diagram for the influences of OTDs on O2

4.3.2. Adsorption of Water. The efficiency of photocat-

Adsorption energy (eV)

(3) Dissociative adsorption −1.2 Ti interstitial

Table 2: Possible reaction pathways for defective TiO2 .

Phase CO2 photoreduction with H2 O vapor

5. Conclusion Remarks 2013J4100110), the Key Laboratory of Fuel Cell Technology

Violette Romero, Pilar Marco, Jaime Giménez, and Santiago Esplugas