Anda di halaman 1dari 7

ANALISIS DATA HASIL SEKUENING (ALIGNMENT BIOEDIT)

Oleh:
Nama : A. Dimas Cahyaning Furqon
NIM : B1A015143

LAPORAN PRAKTIKUM GENETIKA POPULASI

KEMENTERIAN RISET, TEKNOLOGI DAN PENDIDIKAN TINGGI


UNIVERSITAS JENDERAL SOEDIRMAN
FAKULTAS BIOLOGI
PURWOKERTO
2017
HASIL DAN PEMBAHASAN

A. HASIL

ACACACACTGAGCAATGACGTCCATTAACGTAAAGCTCCTTTACCATTACGTCATAACCAACCTTTTC
AACCTTTGTTTCTTTCCATTAACGGCGATCGTCGCCGGAAAAGCCTATCGGCTTACCATAGACGATCT
TCACCACTTATACTATTCCTATCTCCAACACAACCTCATAACCATTGCTCCACTCTTTGCCTTCACCGTT
TTCGGTTCGGTTCTCTACATCGCAACCCGGCCCAAACCGGTTTACCTCGTTGAGTACTCATGCTACCT
TCCACCAACGCATTGTAGATCAAGTATCTCCAAGGTCATGGATATCTTTTACCAAGTAAGAAAAGCT
GATCCTTCTCGGAACGGCACGTGCGATGACTCGTCCTGGCTTGACTTCTTGAGGAAGATTCAAGAA
CGTTCAGGTCTAGGCGATGAAACCCACGGGCCCGAGGGGCTGCTTCAGGTCCCTCCCCGGAAGACT
TTTGCGGCGGCGCGTGAAGAGACGGAGCAGGTTATCATTGGTGCGCTAGAAAATCTATTCAAGAA
CACCAATGTTAACCCTACAGATATAGGTATACTTGTGGTGAACTCAAGCATGTTTAATCCAACTCCTT
CGCTCTCCGCGATGGTCGTTAACACTTTCAAGCTCCGAAGCAACGTAAGAAGCTTTAACCTTGGTGG
CATGGGTTGTAGTGCCGGCGTTATAGCCATTGATCTAGCAAAGGACTTGTTGCATGTCCATAAAAAT
ACGTATGCTCTTGTGGTGAGCACAGAGAACATCACTTATAACATTTACGCTGGTGATAATAGGTCCA
TGATGGTTTCAAATTGCTTGTTCCGTGTTGGTGGGGCCGCTATTTTGCTCTCCAACAAGCCTAGAGA
TCGTAGACGGTCCAAGTACGAGCTAGTTCACACGGTTCGAACGCATACCGGAGCTGACGACAAGTC
TTTTCGTTGCGTGCAACAAGGAGACGATGAGAACGGCAAAACCGGAGTGAGTTTGTCCAAGGACA
TAACCGATGTTGCTGGTCGAACGGTTAAGAAAAACATAGCAACGCTGGGTCCGTTGATTCTTCCGTT
AAGCGAGAAACTTCTTTTTTCCGTTACCTTCATGGGCAAGAAACTTTTCAAAGACAAAATCAAACATT
ATTACGTCCCGGACTTCAAGCTTGCTATCGACCATTTTTGTATACATGCCGGAGGCAAAGCCGTGAT
TGATGTGCTAGAGAAGAACCTAGGCCTAGCACCGATCGATGTAGAGGCATCAAGATCAACGTTACA
TAGATTTGGAAACACTTCATCTAGCTCAATATGGTATGAGTTGGCATACATAGAAGCAAAAGGAAG
GATGAAGAAAGGTAATAAAGTTTGGCAGATTGCTTTAGGGTCAGGCTTTAAGTGTAACAGTGCAGT
TTGGGTGGCTCTAAACAATGTCAAAGCTTCGACAAATAGTCCTTGGGAACACTGCATCGACAGATAT
CCGGTTAAAATTGATTCTGATTCAGGTAAGTCAGAGACTCGTGTCCAAAACGGTCGGTCCTAA
Gambar 1. Sekuens Hasil Alignment Bioedit yang akan Dianalisis
Menggunakan BLAST
Gambar 2. Hasil analisis sekuensing dengan menggunakan BLASTX

Gambar 3. Hasil analisis sekuensing dengan menggunakan BLASTN


B. PEMBAHASAN

Seiring dengan melimpahnya sekuen biologis (DNA dan RNA) dari berbagai
organisme, para peneliti telah terbiasa untuk menganalisis sekuen biologis dan
pensejajaran sekuen (sequences alignment) (Hall, 1999). Bioedit adalah software
editor sekuen biolgis yang berfungsi untuk mengedit sekuen protein dan asam
nukleat, sequences alignment, dan analisis sekuen (Hall, 2005). Bioedit telah
digunakan untuk studi molekuler dari beberapa organisme seperti genom virus,
bakteri, tumbuhan, dan hewan (Hall, 2011)
Bioedit biasa digunakan dalam penelitian untuk melakukan sekuensing DNA.
Sekuensing DNA atau pengurutan DNA adalah proses atau teknik penentuan urutan
basa nukleotida pada suatu molekul DNA. Urutan tersebut dikenal sebagai sekuen
DNA, yang merupakan informasi paling mendasar suatu gen atau genom karena
mengandung instruksi yang dibutuhkan untuk pembentukan tubuh makhluk hidup
(Rogers, 2011). Sekuensing DNA dapat dimanfaatkan untuk menentukan identitas
maupun fungsi gen atau fragmen DNA lainnya dengan cara membandingkan sekuen-
nya dengan sekuen DNA lain yang sudah diketahui (Glick et al., 2010).
Analisis data hasil sekuensing yang dilakukan saat praktikum menggunakan
dua buah sekuen yang diambil di GenBank. Kedua sekuen dimasukkan ke aplikasi
bioedit dan dilakukan reverse complement. Hasil reverse complement akan
menunjukkan banyak bagian yang kosong (gaps), bagian tersebut merupakan variasi
antar sekuen. Kedua sekuen kemudian di-alignment, deretan sekuen yang tidak di-
reverse kemudian yang nantinya akan dianalisis dengan BLAST (Nejad et al., 2013).
Program BLAST menggunakan data sekuen simpel daripada data alignment. Dalam
kasus ini, gaps harus dihapus dan dianggap sebagai residu (Hall, 2005).
BLAST (Basic Local Alignment Search Tool) adalah program yang baik
sekali untuk mendeteksi homology sekuen biologis pada karakteristik sekuen yang
tersedia. BLAST mendeteksi homology dengan mencari daerah-daerah locally
aligned dari identitas dan atau similiaritas di antara query sequence dan sekuen di
dalam database. BLAST memiliki beberapa program yaitu BLASTN, BLASTP,
BLASTX, TBLASTN, DAN TBLASTX (Hall, 2005).
Hasil analisis dengan program BLASTX dari sekuen yang dihasilkan Bioedit
pada praktikum ini, terdeteksi Conserved Protein Domain Family PLN03169.
Domain superfamili protein tersebut memiliki keterangan chalcone synthase family
protein: Provisional, tingkatan taksonomi: Embryophyta, dan beberapa link rujukan
lainnya. Sekuen tersebut memproduksi significant alignment: 3-ketoacyl-CoA
synthase 18 [Brassica oleracea var. oleracea] dengan Query coverage 98%.
Sementara itu dari hasil analisis BLASTN, Sekuen memproduksi significant
alignment: Brassica oleracea var. oleracea 3-ketoacyl-CoA synthase 18
(LOC106333146), mRNA dengan Query coverage 100%. Query coverage
menunjukkan berapa persen sekuen yang sejajar atau sama dengan yang diprediksi.
A. KESIMPULAN

Berdasarkan pengamatan dan pembahasan di atas, maka dapat diambil


kesimpulan sebagai berikut:
1. Hasil reverse complement akan menunjukkan banyak bagian yang kosong (gaps),
bagian tersebut merupakan variasi antar sekuen. Kedua sekuen kemudian di-
alignment, deretan sekuen yang tidak direverse kemudian yang nantinya akan
dianalisis dengan BLAST
2. Hasil analisis BLASTX dari sekuen yang dihasilkan Bioedit, terdeteksi Conserved
Protein Domain Family PLN03169. Domain superfamili protein tersebut
memiliki keterangan chalcone synthase family protein: Provisional, tingkatan
taksonomi: Embryophyta. Sekuen tersebut memproduksi significant alignment: 3-
ketoacyl-CoA synthase 18 [Brassica oleracea var. oleracea] dengan Query
coverage 98%.
3. Hasil analisis BLASTN, Sekuen memproduksi significant alignment: Brassica
oleracea var. oleracea 3-ketoacyl-CoA synthase 18 (LOC106333146), mRNA
dengan Query coverage 100%.
DAFTAR REFERENSI

Glick BR, Pasternak JJ, and Patten CL. 2010. Molecular Biotechnology: Principles
and Applications of Recombinant DNA. Washington DC: ASM Press.

Hall, T. 1999. BioEdit: a user-friendly biological sequence alignment editor and


analysis program for Windows 95/98/NT. In Nucleic acids symposium series,
41(41): 95-98.

Hall, T. 2005. BioEdit version 7.0. 0. Raleigh: Department of Microbiology, North


Carolina State University.

Hall, T. 2011. BioEdit: an important software for molecular biology. GERF Bull
Biosci, 2(1): 60-1.

Nejad AM, Narimani Z, Hosseinkhan N. 2013. Next Generation Sequencing and


Sequence Assembly. New York: Springer.

Rogers K. 2011. New Thinking about Genetics. New York: Britannica Educational
Publishing.