Anda di halaman 1dari 772

,

BIOQUIMICA
QUINTA EDICIÓN

Jeremy M. Berg
Johns Hopkins University School of Medicine

John L. Tymoczko
Carleton College

Lubert Stryer
Stanford University

Contenidos web de
Neil D. Clarke
Johns Hopkins University School of Medicine

EDITORIAL REVERTÉ, S.A.


Barcelona - Bogotá - Buenos Aires - Caracas - México
Cubierta: La cubierta posterior muestra un complejo formado por una molécula de
aminoacil-tRNA y el factor de elongación EF-Tu.

Título de la obra original:


Biochemistry, Fifth Edition

Edición original en lengua inglesa publicada por:


W. H. Freeman and Company, New York

Copyright © 2002 by W. H. Freeman and Company

Versión española de la 5ª edición:


Prof. D. José M. MacaruUa
Catedrático de Bioquímica y de Biología Molecular
Gran Cruz de la Orden Civil de Alfonso X el Sabio

Con la colaboración de los Catedráticos y Profesores de Bioquímica enumerados en el


Prólogo

Propiedad de:
EDITORIAL REVERTÉ, S. A.
Loreto, 13-15, Local B
08029 Barcelona - ESPAÑA
Tel: (34) 93 419 33 36
Fax: (34) 93 419 51 89
E-mail: reverte@reverte.com
Internet: http://www.reverte.com

Reservados todos los derechos. La reproducción total o parcial de esta obra, por cual-
quier medio o procedimiento, comprendidos la reprografía y el tratamiento informático,
y la distribución de ejemplares de ella mediante alquiler o préstamo públicos, queda ri-
gurosamente prohibida sin la autorización escrita de los titulares del copyright, bajo las
sanciones establecidas por las leyes.

Edición en español:
© EDITORIAL REVERTÉ, S. A., 2003

Impreso en España - Printed in Spain


ISBN: 84-291-7484-9
Depósito Legal: B - 23627 - 2003

Impreso por Ferrer Olsina


Viladomat 158-160
08015 Barcelona
1

I
I

A NUESTROS PROFESORES Y NUESTROS ESTUDIANTES

- _ __J
Sobre los autores

JEREMY M. BERG ha sido Catedrático y Director (Presidente del De­


partamento) de Biofísica y Biofísica Química en la Johns Hopkins University
School of Medicine desde 1990. En Standford se licenció y graduó en Quí­
mica (donde aprendió cristalografía de rayos X con Keith Hodgson y Lubert
Stryer) y se doctoró en Química en Harvard con Richard Holm. Posterior­
mente completó su periodo postdoctoral con Carl Pabo. El Profesor Berg ha
recibido el Premio de Química Pura otorgado por la American Chemical So­
ciety (1994), el Premio Eli Lilly de Investigación Básica en Química Biológica
(1995), el premio al joven científico más sobresaliente del año en Maryland
(1995) y el Premio Harrison Howe (1997). Estando en la Johns Hopkins ha
recibido el Premio de Docencia W. Barry Wood (elegido por los estudiantes
de Medicina), el Premio de Docencia a estudiantes de Postgrado y el Pre­
mio de Catedrático Docente en Ciencias Preclínicas. Es coautor, junto con
Stephen Lippard, del libro de texto Principies of Bioinorganic Chemistry.

JOHN L. TYMOCZKO posee la Cátedra Towsley de Biología en el Car­


leton College, donde ha impartido docencia desde 1976. Actualmente en­
seña Bioquímica, Laboratorio de Bioquímica, Oncogenes y Biología Mole­
cular del Cáncer y Ejercicios de Bioquímica, y comparte la docencia de un
curso introductorio de Bioenergética y Genética. El Profesor Tymoczko se li­
cenció en la Universidad de Chicago en 1970 y se doctoró en Bioquímica
en la Universidad de Chicago con Shutsung Liao en el Instituto Ben May de
Investigación sobre el Cáncer. A continuación obtuvo un puesto postdoc­
toral con Hewson Swift del Departamento de Biología de la Universidad de
Chicago. La investigación del Profesor Tymoczko se ha centrado en recep­
tores esteroideos, partículas de ribonucleoproteína y enzimas proteolíticos.

LUBERT STRYER posee actualmente la Cátedra Winzer de la Escuela de


Medicina y es Catedrático de Neurobiología en la Universidad de Standford,
en cuya Facultad ha permanecido desde 1976. Obtuvo su graduado en la
Harvard Medical School. El Profesor Stryer ha recibido múltiples galardones
por su investigación, entre los que se incluyen el Premio Eli Lilly de Investi­
gación Básica en Química Biológica (1970) y el Premio a los Inventores más
Distinguidos de la Asociación de Poseedores de la Propiedad Intelectual. Fue
elegido miembro de la Academia Nacional de Ciencias en 1984. El Profesor
Stryer fue previamente el Presidente y Director Científico del Instituto de In­
vestigación Affymax. Es fundador y miembro del Consejo de Asesores Cien­
tíficos de Senomyx, una compañía que está utilizando el conocimiento bio­
químico para el desarrollo de moléculas saborizantes y aromatizantes nuevas
y mejoradas para utilizar en productos de consumo. La publicación de la
primera edición de su libro de texto Biochemistry en 1975 transformó la en­
señanza de la Bioquímica.
~refacio
Durante más de 25 años y a lo largo de cuatro ediciones, la Bioquímica de
fcoRV Stryer ha presentado esta preciosa asignatura de una forma extraordinaria-
mente atractiva y clara. El estilo entretenido y su atractivo diseño han he-
cho que nuestros estudiantes lean y estudien este libro con deleite a lo largo
de nuestros años de docencia. Por tanto estuvimos encantados al tener la
oportunidad de participar en la revisión de este libro. La tarea ha sido emo-
tiva y un tanto frustrante, debido a los profundos cambios que están trans-
formando el campo de la Bioquímica a medida que nos adentramos en el
siglo XXI. La Bioquímica está progresando rápidamente al pasar de ser una
ciencia que se desarroUaba prácticamente por completo en la poyata del la-
boratorio a ser una ciencia que puede estudiarse mediante ordenadores. La
reciente capacidad para determinar secuencias genómicas enteras ha apor-
tado los datos necesarios para realizar comparaciones masivas de secuen-
cias derivadas de proteínas cuyos resultados pueden ser utilizados para for-
MIIM M
mular y comprobar hipótesis sobre su función bioquímica. La potencia de
fcoRI
estos nuevos métodos se explica gracias al impacto de la evolución: muchas
moléculas y vías bioquímicas se han generado por duplicación y modifica-
ción de otras ya existentes. Nuestro desafío al escribir la quinta edición de
este libro de texto ha consistido en introducir este cambio de planteamiento
en la Bioquímica manteniendo el estilo claro y seductor que ha caracteri-
zado las cuatro ediciones precedentes.

Una nueva perspectiva molecular de la evolución


¿Cómo podrían afectar a la docencia de la Bioquímica estos conceptos ba-
sados en la evolución? Con frecuencia, macromoléculas con un mismo ori-
gen evolutivo desempeñan funciones biológicas diversas a pesar de que su
.----,---., 11-------,-------estructura y el mecanismo de acción tienen muchas características comu-
nes. Un ejemplo es la familia de proteínas que contiene macromoléculas
BomHI fundamentales para mover el músculo, para informar sobre la presencia de
adrenalina en el torrente sanguíneo y para orquestar la formación de cade-
nas de aminoácidos. Las características fundamentales de una familia de
proteínas de este tipo, una vez presentadas con todo detalle al estudiante, se
convierten en un modelo que el estudioso puede aplicar cada vez que se en-
cuentre con un nuevo miembro de la familia. A continuación, el estudiante
es capaz de centrarse en cómo estas propiedades, observadas en un nuevo
contexto, se han adaptado para desempeñar otras funciones bio9~[micas. A
lo largo del texto, se coloca el icono de un árbol estilizado Y al co-
mienzo de las discusiones centradas básicamente en las homologías entre
proteínas y en los orígenes evolutivos.
MIM M
DOS CAPÍTULOS NUEVOS. Para permitir que los estudiantes capten la po-
FIGURA 9.44 Un nucleo tencialidad de estos conceptos se han añadido dos capítulos completamente
estructural conservado en los nuevos. El primero, "Evolución bioquímica" (Capítulo 2) es un breve tra-
enzimas de restricción de tipo 11. yecto desde el origen de la vida hasta el desarrollo de organismos plurice-
lulares. Por una parte, este capítulo supone una introducción a las molé-
culas y a las vías bioquímicas en su contexto dentro de la célula. Por otra
~ vi
PREFACIO

parte, intenta que los estudiantes obtengan un conocimiento la mayoría de los demás conductos y bombas importantes
más profundo examinando cómo estas moléculas y vías sur- están emparentados evolutivamente con estas proteínas,
gieron en respuesta a desafíos biológicos fundamentales. estas dos estructuras constituyen poderosas plataformas
Además, la perspectiva evolutiva del Capítulo 2 hace que al- para examinar el fundamento molecular de la actividad de
gunos aspectos aparentemente extraños de la Bioquímica estas clases de moléculas tan importantes para el funcio-
sean más lógicos para el estudioso. Por ejemplo, la presen- namiento, entre otros, del sistema nervioso.
cia de fragmentos de ribonucleótidos en los cofactores bio-
químicos puede explicarse por la probable existencia de un
La PARTE 11, TRANSFORMACIÓN Y ALMACENAMIENTODE LA ENERGIA,
mundo primitivo basado fundamentalmente en el RNA. El
examina las vías para la interconversión de las distintas for-
segundo capítulo nuevo, "Investigación de la Evolución" (Ca-
mas de energía. El Capítulo 15, que trata de la transducción
pítulo 7), desarrolla las bases conceptuales de la compara-
de señales, se centra en cómo fragmentos de DNA que codi-
ción de secuencias de proteínas y ácidos nucleicos. Este ca-
fican módulos proteicos relativamente sencillos en vez de pro-
pítulo puede compararse con los capítulos "Investigación en
teínas completas se han mezclado y acoplado durante el trans-
proteínas" (Capítulo 4) e "Investigación en genes" (Capítulo
curso de la evolución para generar el hilo conductor que define
6) que tan concienzudamente han analizado las técnicas ex-
las rutas de transducción de señales. El grueso de la Parte II
perimentales en las ediciones anteriores. Su objetivo es ca-
analiza las vías de generación de ATP y otras moléculas que
pacitar a los estudiantes para que utilicen la vasta informa-
almacenan energía. Estas vías se han organizado en grupos
ción disponible en las bases de datos de secuencias y de
que comparten enzimas comunes. Las reacciones que las in-
estructuras de una forma crítica y eficiente.
tegran pueden analizarse una vez y, mientras estas reacciones
están aún frescas en la mente del estudiante, se puede ilustrar
su participación en distintos contextos biológicos.
ORGANIZACIÓN DEL TEXTO. El enfoque evolutivo afecta a la
organización del texto, que se divide en cuatro partes princi-
pales. Como en la edición precedente, la Parte I introduce el El Capítulo 16 abarca la glicolisis y la gluconeogénesis,
lenguaje de la bioquímica y las estructuras de los tipos de mo- En algunos aspectos, una vía es la inversa de la otra, y un
léculas biológicas más importantes. Las tres partes restantes núcleo de enzimas que son comunes a ambas vías catali-
se corresponden con tres importantes desafíos evolutivos: es zan muchas de las etapas centrales de ambas rutas. El es-
decir, la interconversión de las distintas formas de energía, la tudio conjunto de las vías ayuda a ilustrar cómo influye
reproducción molecular y la adaptación de células y organis- la energía libre a la hora de dirigir el proceso global bien
mos a entornos cambiantes. Esta disposición es comparable a en la dirección de la degradación de la glucosa, bien en la
la vía evolutiva bosquejada en el Capítulo 2 y sigue su curso dirección de síntesis de glucosa.
de forma natural desde lo sencillo hacia lo más complejo.
El Capítulo 17, que trata del ciclo del ácido cítrico, enlaza
a través de aspectos evolutivos el complejo piruvato des-
La PARTE 1, EL DISEÑO MOLECULAR DE LA VIDA, presenta los ti-
hidrogenasa, que aporta moléculas al ciclo del ácido cí-
pos más importantes de macrornoléculas biológicas, inclu-
trico, y el complejo o-cetoglutarato deshidrogenasa, que
yendo las proteínas, ácidos nucleicos, carbohidratos y lípidos,
cataliza una de las etapas clave del propio ciclo.
e introduce los conceptos básicos de catálisis y actividad en-
zimática. Aquí hay dos ejemplos de cómo una perspectiva evo-
lutiva ha dado forma al material de estos capítulos: La fosforilación oxidativa, en el Capítulo 18, continúa in-
mediatamente en el Capítulo 19 con las reacciones lumi-
El Capítulo 9, que trata de estrategias catalíticas,
examina cuatro clases de enzimas que han evo-
lucionado para afrontar desafíos específicos: pro-
mover una reacción química básicamente lenta;
potenciar al máximo la velocidad absoluta de una
reacción; catalizar una reacción en un lugar y no
en otros muchos lugares alternativos; y evitar una
reacción secundaria nociva. En cada caso, el texto
considera el papel de la evolución en el ajuste
fino de la propiedad clave.

El Capítulo 13, que trata de conductos de mem- Ras


activada
brana y sistemas de bombeo, incluye las prime-
ras estructuras tridimensionales detalladas de un
conducto iónico y de una bomba de iones. Como FIGURA 15.34 Via de señalización de EGF.
1

1 vii r-
Prefacio

I
nosas de la fotosíntesis para resaltar las múltiples carac- a los cambios del entorno. De nuevo, la adaptación de las pro-
terísticas comunes de estas vías. teínas a nuevas funciones es un aspecto clave de estas argu-
mentaciones.
La discusión de las reacciones luminosas de la fotosínte-
sis en el Capítulo 19 conduce de forma natural a la discu-
sión de las reacciones oscuras -es decir, las integrantes
del ciclo de Calvin- en el Capítulo 20. Esta vía enlaza de
Conceptos químicos integrados
forma natural con la vía de las pentosas fosfato, también A lo largo del texto hemos intentado integrar los conceptos
contemplada en el Capítulo 20, porque en ambas rutas exis- químicos. Aquí se incluyen los fundamentos del mecanismo
ten enzimas comunes que interconvierten azúcares de tres, de acción de enzimas seleccionados, los fundamentos ter-
cuatro, cinco, seis y siete átomos de carbono. modinámicos del plegamiento y ensamblaje de proteínas y
otras macromoléculas y las estructuras y reactividades quí-
micas de los cofactores más frecuentes. Estos importantes as-
La PARTE 111, sfNTEs1s DE LAS MOLÉCULAS DE LA vtus , se cen- pectos constituyen la base de nuestro conocimiento sobre to-
tra en la síntesis de macromoléculas biológicas y sus com- dos los procesos biológicos. Nuestro objetivo no es
ponentes. proporcionar un estudio enciclopédico de los mecanismos de
las reacciones enzimáticas. En vez de ello, hemos escogido
El Capítulo 24, que trata de la biosíntesis de aminoácidos, determinados temas para un estudio a nivel químico más de-
está conectado con el capítulo precedente que trata de la tallado que permita a los estudiantes comprender cómo las
degradación de aminoácidos por medio de una familia de características químicas contribuyen a satisfacer las necesi-
enzimas que incorporan o retiran grupos amino del es- dades biológicas.
queleto carbonado de los aminoácidos. Con frecuencia, la visión
química depende de que ten-
El Capítulo 25 abarca la biosíntesis de nucleótidos e in-
cluye el papel de los aminoácidos como precursores bio-
gamos un conocimiento claro
de las estructuras de las bio- ºXº",,OYCH,
ºº
sintéticos. Un aspecto evolutivo clave subrayado aquí es moléculas. Cuando ha sido
que muchos de los enzimas de estas vías son miembros necesario, hemos adoptado
de la misma familia y catalizan reacciones químicas aná- considerables precauciones a
Aspirina (ácido acetilsalicílico)
logas. El enfoque sobre los enzimas y las reacciones co- la hora de elaborar ilustra-
munes a estas rutas biosintéticas permite al estudiante ciones estereoquímicas pre-
comprender la lógica de las vías en vez de tener que me- cisas de estas moléculas. Estas estructuras favorecerán que
el estudiante adquiera un conocimiento intuitivo de sus for-
morizar un conjunto de reacciones que aparentemente no
mas y comprenda cómo estas formas afectan a su reactivi-
están relacionadas.
dad.

Los Capítulos 27, 28 y 29 tratan sobre la replicación, re-


combinación y reparación del DNA, la síntesis y madu-
ración del RNA y la síntesis de proteínas. Las conexio- Nueva puesta al día para incluir
nes evolutivas entre los sistemas procarióticos y descubrimientos recientes
eucarióticos ponen de manifiesto cómo los procesos bio-
químicos básicos se han adaptado para funcionar en se- Dado el espectacular avance de la bioquímica moderna, no
res vivos más complejos. La recién determinada estruc- sorprende que se hayan producido hallazgos sustanciales
tura del ribosoma ofrece al estudiante una visión de un desde la publicación de la cuarta edición. De entre ellos, el
posible mundo temprano de RNA en el que los ácidos nu- más destacado es la secuenciación del genoma humano y de
cleicos y no las proteínas desempeñaban casi todos los los genomas de muchos organismos más sencillos. El enfo-
papeles principales a la hora de catalizar las vías impor- que evolutivo del texto nos permite incorporar de forma na-
tantes. tural la información que surge de estos esfuerzos históricos.
La determinación de las estructuras tridimensionales de las
proteínas y ensamblajes macromoleculares también se ha ido
La PARTE IV, RESPUESTAA CAtvrnrosAMBIENTALES, dirige una mi- desarrollando a un ritmo asombroso.
rada a cómo las células monitorizan y se adaptan a cambios
en su entorno. De hecho, la Parte IV explora los sistemas sen-
soriales, el sistema inmunitario, los motores moleculares y el Como ya se ha señalado anteriormente, la discusión sobre
citoesqueleto. Estos capítulos ilustran cómo los procesos de membranas excitables del Capítulo 13 incorpora las es-
señalización y respuesta, introducidos con anterioridad en el tructuras detalladas de un conducto iónico (el conducto pro-
texto, se integran en los organismos pluricelulares para gene-
rar potentes sistemas bioquímicos que detectan y responden 1 cariótico del potasio) y de una bomba de iones (la ATPasa
del retículo sarcoplásmico).

_[
­­­1 viii
PREFACIO

l uustraclones nuevas y mejoradas


La relación entre estructura y función siempre ha sido
un tema dominante en Bioquímica. Esta relación se
hace aún más evidente a los estudiantes que utilizan
la quinta edición gracias al uso generalizado de mo-
delos moleculares. Estos modelos superan a los de la
cuarta edición en varios aspectos.

Todos han sido diseñados y elaborados por uno de


nosotros (JMB), mediante MOLSCRIPT, para re-
saltar las características estructurales más impor-
~ FIGURA 9.21 Complejo proteasa de VIH­Crixivan. tantes. La aspiración de los autores es que el lec-
tor sea capaz de escribir el pie a partir de la
observación de la figura.
Se ha generado gran expectación en el campo de la trans-
ducción de señales gracias a la determinación, por vez Hemos seleccionado el diagrama de cintas como el mé-
primera, de la estructura de un receptor transmembranal todo más eficiente y más claro de representar la estructura
de siete hélices -la proteína rodopsina del sistema vi- molecular. Todos los modelos moleculares se representan
sual- analizado en los Capítulos 15 y 32. con un estilo consistente. Así, los estudiantes pueden com-
parar fácilmente estructuras y adquirir familiaridad y fa-
La capacidad para describir los procesos de la fosforila- cilidad a la hora de interpretar los modelos. Las anota-
ción oxidativa en el Capítulo 18 se ha beneficiado enor- ciones resaltan las características clave de los modelos
memente de la determinación de las estructuras de dos moleculares.
grandes complejos de proteínas de membrana: la cito-
cromo e oxidasa y el citocromo be 1. Se han añadido muchos modelos moleculares nuevos, que
sirven de base para la comprensión estructural de molé-
En el Capítulo 18 se recogen los recientes descubrimien- culas adicionales y, en algunos casos, permiten la repre-
tos en relación con la estructura tridimensional de la ATP sentación de múltiples facetas de la misma molécula.
sintasa, entre los cuales se incluye el notable hecho de que
durante el trascurso de la catálisis hay partes del enzima Además de los modelos moleculares, la quinta edición incluye
que rotan. más esquemas que proporcionan una visión de conjunto de
las vías y procesos y que sitúa estos procesos en su contexto
En el Capítulo 29, la determinación de la estructura del ri- biológico.
bosoma transforma la discusión de la síntesis de proteínas.

La determinación de la estructura de la partícula central


del nucleosoma (un complejo proteína-DNA de gran ta- Proteína
maño) facilita la descripción, en el Capítulo 31, de los pro-
cesos clave de la regulación génica en eucariotas.

Por último, cada uno de los tres capítulos de la Parte IV está


basado en recientes logros estructurales.

La capacidad del estudiante para retener los conceptos


clave de los sistemas sensoriales (Capítulo 32) está favo-
recida por las estructuras de la rodopsina y del conducto
iónico antes mencionado.

El Capítulo 33, que trata del sistema inmunitario, incluye


ahora las estructuras recientemente determinadas de los
receptores de las células T y de sus complejos.

¡ La determinación de las estructuras de las proteínas que


actúan como motores moleculares rniosina y quinesina han
puesto de manifiesto por vez primera las conexiones evo-
lutivas en las que se basa el Capítulo 34, que trata de mo-
tores moleculares. 3'
El ribosoma
(al principio del
capítulo 29).
ix f­­
Prefacio

Nuevos elementos
pedagógicos CaM
4 Ca2 quin asa
La quinta edición ofrece herramientas adicio-
nales para ayudar al estudiante a aprender la
~ ~
materia de la asignatura.
ICONOS. Los iconos se utilizan para resaltar tres
categorías de material, Jo que hace más fácil la
localización de estos tópicos por parte del es-
tudiante interesado o del profesor.
FIGURA 15.23 La calmodulina se une a alfa-hélices antipáticas
~ Un caduceo indica el comienzo de una
~ aplicación clínica.

El icono de un árbol estilizado señala las secciones o NUEVOS CONTENIDOS DE LOS CAPÍTULOS Y TÉRMINOS CLAVE.
párrafos que exploran principal o exclusivamente as- Al principio de cada capítulo se presentan los contenidos a
pectos evolutivos de la bioquímica. modo de titulares principales que sirven de base al estudiante
a la hora de organizar la información del capítulo. Los prin-
Un ratóny un dedo hacen referencia a animaciones del si- cipales titulares aparecen de nuevo en el resumen del capí-
tio Webdel libro de texto(www.whfreeman.com/biochem5) tulo, ayudando a organizar la información para repasarla de
para aquellos estudiantes que deseen reforzar su com- forma más fácil. Un conjunto de términos clave también ayuda
prensión de los conceptos con medios electrónicos. a los estudiantes a centrarse y a repasar los conceptos impor-
tantes.
MÁS PROBLEMAS. El número de problemas ha aumentado en
un 50%. Se han creado cuatro nuevas categorías de proble-
mas para adquirir destreza en aspectos específicos.
Piruvato

Los Problemas de mecanismos requieren que el estu-


diante sugiera o elabore un mecanismo químico.
Los Problemas de interpretación de datos hacen pre-
guntas sobre un conjunto de datos que se ofrecen en forma
Acetil-CoA
gráfica o tabulada. Estos ejercicios dan una idea a los es-
tudiantes sobre cómo se alcanzan conclusiones científicas.
Los Problemas de integración de capítulos requieren
que los estudiantes utilicen la información procedente de
múltiples capítulos para conseguir una respuesta. Estos
problemas refuerzan en el estudiante la noción de que los
diversos aspectos de la bioquímica se encuentran interre- GTP
lacionados.
Los Problemas multimedia estimulan y ayudan a los es-
tudiantes a sacar provecho de las animaciones y semina-
rios que ofrece nuestro sitio Web. Los problemas multi-
media se encuentran tanto en el libro corno en nuestro sitio FIGURA 17.4 La glicolisis y el ciclo del ácido cítrico están
Web. conectados.

{
~X
PREFACIO

Herramientas y técnicas
La quinta edición de Bioquímica ofrece tres capítulos que presentan las herramientas y técnicas de
la Bioquímica: "Investigación en proteínas" (Capítulo 4), "Investigación en genes" (Capítulo 6) e
"Investigación de la evolución" (Capítulo 7). Cuando se considera oportuno, en otras partes del
texto se presentan técnicas experimentales adicionales.

Tecnología del DNA recombinante Secciones 6.2 - 6.4


Investigación en proteínas (Capítulo 4) Clonaje del DNA en bacterias Secciones 6.2.2 y 6.2.3
Purificación de proteínas Sección 4.1 Recorrido cromosómico Sección 6.2.4
Centrifugación diferencial Sección 4.1.2 Clonaje de genes eucarióticos en bacterias Sección 6.3.1
Salting out Sección 4.1.3 Análisis de los niveles de expresión (chips génicos)
Diálisis Sección 4.1.3 Sección 6.3.2
Cromatografía de tamizado molecular Sección 4.1.3 Introducción de genes en eucariotas Sección 6.3.3
Cromatografía de intercambio iónico Sección 4.1.3 Animales transgénicos Sección 6.3.4
Cromatografía de afinidad Sección 4.1.3 Alteración de genes Sección 6.3.5
Cromatografía líquida de alta presión Sección 4. l .3 Plásmidos que provocan tumores Sección 6.3.6
Electroforesis en gel Sección 4.1.4 Mutagénesis dirigida Sección 6.4
Isoelectroenfoque Sección 4.1.4
Electroforesis bidimensional Sección 4.1.4
Evaluación cualitativa y cuantitativa de la purificación de
Investigación en genes (Otros capítulos)
proteínas Sección 4.1.5 Sedimentación en equilibrio de gradiente de densidad
Ultracentrifugación Sección 4.1.6 Sección 5.2.2
Espectrometría de masas (MALDI-TOF) Sección 4.1.7 Técnica de la huella para aislar y caracterizar lugares
Huella dactilar de la masa de un péptido Sección 4.1.7 promotores Sección 28.1. 1
Degradación de Edman Sección 4.2 Inmunoprecipitación de la cromatina (ChIP) Sección 31.2.3
Secuenciación de proteínas Sección 4.2
Producción de anticuerpos policlonales Sección 4.3.1 Investigación de la evolución (Capítulo 7)
Producción de anticuerpos monoclonales Sección 4.3.2 Métodos de comparación de secuencias Sección 7 .2
Ensayo de inmunoabsorción asociado a enzimas (ELISA) Métodos de alineación de secuencias Sección 7 .2
Sección 4.3.3 Valoración del significado estadístico de los alineamientos
Transferencia Western Sección 4.3.4 (mediante barajado) Sección 7.2.l
Microscopía de fluorescencia Sección 4.3.5 Matrices de sustitución Sección 7.2.2
Marcaje con la proteína fluorescente verde Sección 4.3.5 Patrones de secuencias Sección 7.3.2
Microscopía inmunoelectrónica Sección 4.3.5 Representaciones auto-diagonales para encontrar motivos
Síntesis automática de péptidos en fase sólida Sección 4.4 repetidos Sección 7.3.3
Espectroscopía de resonancia magnética nuclear Sección 4.5.l Cartografiado de estructuras secundarias por comparación de
Espectroscopía NOESY Sección 4.5.1 secuencias de RNA Sección 7.3.5
Crsitalografía de rayos X Sección 4.5.2 Construcción de árboles evolutivos Sección 7.4
Química combinatoria Sección 7.5.2
Investigaciónen proteínas (Otroscapítulos)
Fundamento de la fluorescencia de la proteína fluorescente Otras técnicas
verde Sección 3.6.5 Secuenciación de carbohidratos por espectrometría de
Cristalografía resuelta en el tiempo Sección 8.3.2 masas MALDI-TOF Sección 11.3.7
Utilización de la espectroscopía de fluorescencia para Uso de liposomas para investigar la permeabilidad de
analizar interacciones enzima-sustrato Sección 8.3.2 membranas Sección 12.4.1
Utilización de inhibidores irreversibles para cartografiar Uso de diagramas de hidropatía para localizar hélices
el centro activo Sección 8.5.2 transmembranales Sección 12.5.4
Utilización de análogos del estado de transición para Recuperación de la florescencia tras el fotoblanqueado
estudiar los centros activos de los enzimas Sección 8.5.3 (FRAP) para medir difusión lateral en membranas
Anticuerpos catalíticos como enzimas Sección 8.5.4 Sección 12.6
Técnica de patch-clamp para medir la actividad de
conductos Sección 13.5.1
Investigación en genes (Capítulo 6) Medida del potencial redox Sección 18.2.1
Análisis mediante enzimas de restricción Sección 6.1.1 y Imagen por resonancia magnética funcional (fMRI)
6.1.2 Sección 32.1.3
Técnicas de transferencia Southem y Northem Sección 6.1.2
Método didesoxi de Sanger para la secuenciación del DNA ~ Técnicas animadas: En la dirección
Sección 6.1.3 www.whfreeman.com/biochemS se pueden encontrar
Análisis de ácidos nucleicos en fase sólida Sección 6.1.4 explicaciones animadas de técnicas experimentales
Reacción en cadena de la polimerasa .(PCR) Sección 6.1.5 utilizadas para explorar genes y proteínas.
xi r­
Prefacio

Aplicaciones clínicas
T En el texto, este icono indica el comienzo de una aplicación clínica. Cuando se ha considerado
oportuno, aparecen en el texto otras correspondencias clínicas más breves sin el icono.

Enfermedades priónicas Sección 3.6.1 Degradación de proteínas y la respuesta inmunitaria


Escorbuto y estabilización del colágeno Sección 3.6.5 Sección 23.2.3
Detección de antígenos con ELISA Sección 4.3.3 Trastornos heredados del ciclo de la urea (hiperamonemia)
Insuficiencia de vasopresina Sección 4.4 Sección 23.4.4
Acción de la penicilina Sección 8.5.5 Errores innatos en la degradación de aminoácidos Sección 23.6
Vitaminas hidrosolubles Sección 8.6.1 Niveles elevados de homocisteína y enfermedad vascular
Vitaminas liposolubles en la coagulación de la sangre y en la Sección 24.2.9
visión Sección 8.6.2 Trastornos hereditarios del metabolismo de las porfirinas
Inhibidores de la proteasa Sección 9.1.7 Sección 24.4.4
Anhidrasa carbónica y osteoporosis Sección 9.2 Fármacos anticancerígenos que bloquean la síntesis de tirnidi-
Uso de isozimas para el diagnóstico de lesiones tisulares lato Sección 25.3.3
Sección 10.3 Pelagra Sección 25.5
Enfisema Sección 10.5.4 Gota Sección 25.6.1
Prevención de trombosis Sección L0.5.7 Síndrome de Lesch-Nyhan Sección 25.6.2
Hemofilia Sección 10.5.8 Interrupción del metabolismo de lípidos como causa del sín-
Regulación de la coagulación de la sangre Sección 10.5.9 drome de Insuficiencia respiratoria aguda y la enfermedad
de Tay-Sachs Sección 26.1.6
Grupos sanguíneos Sección 11.2.5
Uso diagnóstico de los niveles de colesterol en sangre
Antibióticos que inhiben la glicosilación Sección 11 .3.3
Sección 26.3.2
Enfermedad de las células T Sección 11.3.5
Hipercolesterolemia y ateroesclerosis Sección 26.3.5
Selectinas y la respuesta inflamatoria Sección 11.4.1
Tratamiento clínico de los niveles de colesterol Sección 26.3.6
Virus de la gripe Sección 11.4.2
Raquitismo y vitamina D Sección 26.4.7
Uso clínico de liposomas Sección 12.4.1
Antibióticos dirigidos contra la DNA girasa Sección 27.3.4
Aspirina e ibuprofeno Sección 12.5.2
Reparación defectuosa del DNA y cáncer Sección 27.6.5
La digital y fallo cardiaco congestivo Sección 13.2.3
Corea de Huntington Sección 27 .6.6
Resistencia a múltiples fármacos y fibrosis quística
Detección de carcinógenos (test de Ames) Sección 27.6.7
Sección 13.3
lnhibidores de la proteína quinasa como fármacos anticancerí- Antibióticos que inhiben la transcripción Sección 28. l.9
genos Sección 15.5.1 Linfoma de Burk.itt y leucemia de las células B Sección
Cólera y tos ferina Sección 15.5.2 28.2.6
Intolerancia a la lactosa Sección 16.l.12 Talasemia Sección 28.3.3
Toxicidad de la galactosa Sección 16.1.13 Antibióticos que inhiben la síntesis de proteínas Sección 29.5.1
Cáncer y glicolisis Sección 16.2.5 Difteria Sección 29.5.2
Insuficiencia de fosfatasa y acidosis láctica Sección 17 .2. l Inanición prolongada Sección 30.3.I
Beriberi y envenenamiento por mercurio y arsénico Diabetes Sección 30.3.2
Sección 17.3.2 Regulación del peso corporal Sección 30.3.3
Enfermedades mitocondriales Sección 18.6.5 Efectos metabólicos del etanol Sección 30.5
Anemia hemolítica Sección 20.5.1 Esteroides anabólicos Sección 31.3.3
Insuficiencia de glucosa 6-fosfato deshidrogenasa Sección SERMs y cáncer de pecho Sección 31.3.3
20.5.2 Ceguera a los colores Sección 32.3.5
Trastornos del almacenamiento del glucógeno Sección 21.5.4 Uso de la capsaicina para el tratamiento del dolor
Esteatorrea en el trastorno hepático Sección 22.1.1 Sección 32.5.1
Insuficiencia de carnitina Sección 22.2.3 Supresores del sistema inmunitario Sección 33.4.3
Síndrome de Zellweger Sección 22.3.4 MHC y rechazo a los trasplantes Sección 33.5.6
Cetosis diabética Sección 22.3.6 Vacuna del SIDA Sección 33.5.7
Uso de inhibidores de la ácido graso sintetasa como fármacos Enfermedades autoimunitarias Sección 33.6.2
Sección 22.4.9 Sistema inmunitario y cáncer Sección 33.6.3
Efectos de la aspirina en las vías de señalización Miosinas y sordera Sección 34.2.1
Sección 22.6.2 Quinesinas y trastornos del sistema nervioso Sección 34.3
Cáncer cervical y ubiquitina Sección 23.2.1 Taxol Sección 34.3.1
------j xii
PREFACIO

~volución Molecular
Este icono indica el inicio de muchas discusiones que resaltan la similitud de proteínas u
otros aspectos evolutivos a nivel molecular que proporcionan una plataforma que ayuda al
estudiante a organizar la información.

¿Por qué este conjunto de 20 aminoácidos? Sección 3.1 Orígenes evolutivos de la fotosíntesis Sección 19.6
Muchos exones codifican dominios proteicos Sección 5.6.2 Evolución de la vía C4 Sección 20.2.3
Triadas catalíticas en enzimas hidrolíticos Sección 9.1.4 Aumenta la complejidad en la regulación de la glucógeno fos-
Principales tipos de enzimas que escinden péptidos Sección 9.1.6 forilasa Sección 2 l.3.3
Centros activos basados en el zinc en las anhidrasas carbónicas La familia n-arnilasa Sección 21.4.3
Sección 9.2.4 Un motivo recurrente en la activación de grupos carboxilo
Un núcleo catalítico común en los enzimas de restricción de tipo Sección 22.2.2
11 Sección 9.3.4 Los poliquétidos y las sintetasas de péptidos no ribosómicos se
Dominios de las NTPasas con bucle P Sección 9.4.4 parecen a la ácido graso sintetasa Sección 22.4.1 O
Hemoglobina fetal Sección 10.2.3 Equivalentes procarióticos de la vía de la ubiquitina y el protea-
Un núcleo catalítico común en las proteína quinasas soma Sección 23.2.4
Sección 10.4.3 Una familia de enzimas dependientes del piridoxal
¿Por qué existen varios grupos sanguíneos en humanos? Sección 23.3.3
Sección 11.2.5 Evolución del ciclo de la urea Sección 23.4.3
Bombas de iones relacionadas evolutivamente Sección 13.2 El dominio NTPasa con bucle P en la nitrogenasa Sección 24.1.1
ATPasas de tipo P Sección 13.2.2
Etapas recurrentes en la síntesis del anillo de purina
Dominios cassette de unión al ATP Sección 13.3 Sección 25.2.3
Familias de transportadores secundarios Sección 13.4 Ribonucleótido reductasas Sección 25.3
Subunidades del receptor de la acetilcolina Sección 13.5.2
Aumento de los niveles de urato durante la evolución de los pri-
Comparaciones de las secuencias de cDNA de conductos de so- mates Sección 25.6. I
dio Sección 13.5.4
La superfamilia del citocromo P450 Sección 26.4.3
Homologías en los conductos de potasio y sodio Sección 13.5.5
DNA polimerasas Sección 27.2.1
Uso de la comparación de secuencias para comprender los con-
Helicasas Sección 27 .2.5
ductos de sodio y calcio Sección 13.5.7
Relaciones evolutivas de las recombinasas y topoisomerasas
Evolución de las vías metabólicas Sección 14.3.4
Sección 27.5.2
¿Cómo adquirió su oncogén el sarcoma de Rous? Sección 15.5
Similitudes en la maquinaria transcripcional de arqueobacterias
Características recurrentes de las vías de transducción de seña-
y eucariotas Sección 28.2.4
les Sección 15.6
Evolución del procesamiento catalizado por el espliceosoma
¿Por qué es la glucosa un combustible tan importante?
Sección 28.2.4
Sección 16.0.1
Clases de aminoacil-tRNA sintetasas Sección 29.2.5
Un lugar de unión común en las deshidrogenasas Sección 16.1.1 O
La superfamilia de transportadores MF (el principal facilitador) Composición del ribosoma primordial Sección 29.3.1
Sección 16.2.4 Evolución de la mímica molecular Sección 29.4.4
lsoenzimas de la lactato deshidrogenasa Sección 16.4.2 Una familia de proteínas con dominios comunes para la unión
Relación evolutiva de la glicolisis y la gluconeogénesis Sección del ligando Sección 31.1.4
16.4.3 Evolución independiente de los lugares de unión al DNA de las
Descarboxilación del o-ceroglutarato y piruvato proteínas reguladoras Sección 31.1.5
Sección 17.1.6 Islas de CpG Sección 31.2.5
Evolución de la succinil-CoA sintetasa Sección 17.1.7 Elementos de respuesta al hierro Sección 31.4.2
Historia evolutiva del ciclo del ácido cítrico Sección 17 .3.3 La familia de receptores de sustancias aromáticas Sección 32.1.1
Orígenes endosimbióticos de las mitocondrias Sección 18.1.2 Evolución del mRNA del receptor del gusto Sección 32.2.5
Conservación de la estructura del citocromo e Sección 18.3.7 Evolución de fotorreceptores Sección 32.3.4
Características comunes de la ATP sintasa y las proteínas G El plegamiento de las inmunoglobulinas Sección 33.2
Sección 18.4.5 Relación entre la actina y la hexoquinasa y otras proteínas pro-
Proteínas desacoplantes emparentadas Sección 18.6.4 carióticas Sección 34.2.2
Evolución de los cloroplastos Sección 19.1.2 Tubulinas y la familia de NTPasas con bucle P Sección 34.3.1
------------; xiii r­
Prefacio

Suplementos de apoyo a la
quinta edición de Bioquímica

La quinta edición de esta Bioquímica ofrece una amplia selección de suplementos


de gran calidad para ayudar a los estudiantes y a los educadores.

I Para el profesor
Banco de preguntas impresas y en CD-ROM NUEVO
Marilee Benore Parsons, University of Michigan-Dearbom. Print Test Bank
0-7167-4384- 1; Computerized Test Bank CD-ROM (híbrido Windows/Macintosh)
O-7167-4368-8
El banco de preguntas ofrece más de 1700 preguntas planteadas en formatos de
múltiple elección, emparejamientos o respuestas cortas. La versión electrónica del
banco de preguntas permite que los educadores puedan introducir cambios, reorga-
nizar las preguntas o incluir su propio material de forma sencilla.

CD-ROM lnstructor 's ResourceNUEVO


© W. H. Freeman and Company and Sumanas, lnc. 0-7167-4385-X
El Instructor's Resource CD-ROM contiene todas las ilustraciones del libro de
texto. Se incluye Presentation Manager Pro, una aplicación para organizar presen-
taciones fácil de usar. Cada imagen se almacena en varios formatos y resoluciones,
desde los sencillos ficheros jpg y gif hasta diapositivas de Power Point® predise-
ñadas, para los educadores que utilizan otros programas de presentación.

Transparencias
O-7167-4422-8
Un volumen con las ilustraciones del libro de texto a todo color, optimizadas
para la proyección en clase.

I Para el estudiante
Student Companion to accompany
StudentCompanion
Richard l. Gumport, College of Medicine at Ur- -1 ~ 'Lo cH]~us\;ity''
bana-Champaign, University of lllinois; Frank,
H. Deis, Rutgers University y Nancy Counts Ger-
ber; San Francisco State University, Soluciones
ampliadas a los problemes del libro de texto pro-
porcionados por Roger E. Koeppe ll, University
of Arkansas 0-7167-4383-3.
Más que una simple guía de estudio, el Stu-
dent Companion es un recurso docente esen-
cial diseñado para satisfacer las necesidades
del estudiante a todos los niveles. Cada capí-
­­­1 xiv r­­­­­­­­­­­­
PREFACIO

tulo comienza con un extracto resumido del capítulo del libro


de texto correspondiente. Una amplia lista de objetivos do- Experimental Biochemistry,tercera
centes permite que el estudiante repase rápidamente los con- edición
ceptos clave. Un ejercicio de autoevaluación permite que los Robert L. Switzer; University of lllinois, y liam F. Garrity, Pierce
estudiantes refresquen rápidamente sus conocimientos y una Chemical Corporation. 0-7167-3300-5
serie de problemas adicionales invita al estudiante a aplicar
La nueva edición de Experimental Biochemistry se ha re-
sus conocimientos de bioquímica. Se incluye la solución com-
visado por completo y se ha actualizado para convertirla en una
pleta de cada problema del texto para ayudar a los estudian-
pieza perfecta para un curso moderno de laboratorio de bio-
tes a comprender mejor las ideas fundamentales. Se pueden
química. Aborda de forma extensa las técnicas importantes uti-
adquirir y descargar capítulos sueltos del Student Companion
lizadas en la investigación bioquímica actual y ofrece a los es-
en la dirección:
tudiantes el fundamento teórico necesario para comprender los
www.whfreeman.com/biochem5 experimentos. Probado
concienzudamente en
clase, los experimentos
incorporan la serie com-
I Clinical Companion NUEVO pleta de materiales bio-
Kirstie Saltsman, Ph.D., y Cordon Tomaselli, M. D. Johns químicos en un intento de
Hopkins University School of Medicine. 0-7167-4738-3 simular el trabajo en un
laboratorio de investiga-
Diseñado para estu- ción. Además, un amplio
diantes y educadores in- apéndice ofrece procedi-
teresados en las aplica- Clinical Companion to accompany
mientos detallados para
ciones clínicas,
Clínica/ Companion es
el
l ~rdc1fü11.1sºfffv""' la preparación de reacti-
vos y materiales, así
un vasto compendio de como útiles sugerencias
casos médicos y discu- para el educador.
siones clínicas. Contiene
numerosos problemas y TAMBIÉN ACCESIBLE A TRAVÉS DEL PROGRAMA HABITUAL DE
referencias al libro de PUBLICACIONES DE w. H. FREEMAN, Experimental Bioche-
texto. Temas tales como mistry está diseñado para satisfacer todas las necesidades del
el glaucoma, la fibrosis laboratorio de bioquímica. Visite http://custompub.whfree-
quística, la enfermedad man.com para conocer más acerca de cómo crear su propio
de Tay-Sachs y las en- manual de laboratorio.
fermedades autoinmuni-
tarias se abordan desde
una perspectiva bioquí- Recursosmultimedia para los
mica. I estudiantes
~ Este icono conecta los materiales del libro con nues-
tro sitio Web. Consulte en el interior de la cubierta frontal
I Lecture Notebook NUEVO la descripción completa de los recursos disponibles en
www.whfreeman.com/biocbem5.
O-7 167-4682-4
Para los estudiantes que se encuentran demasiado ocupa- narurcpublishinggroup. W. H. Freeman and Company tiene el
dos tomando apuntes y no prestan atención a la clase, el Lec- orgullo de presentar una colección semanal de resúmenes y
ture Notebook reúne una colección de ilustraciones del libro un artículo de aparición mensual de la familia de revistas Na-
de texto en blanco y negro dispuestas en el mismo orden en ture, incluyendo Nature, sus títulos mensuales asociados y el
que aparecen en el libro y con mucho espacio alrededor para recientemente lanzado Nature Review Journals. Por favor, vi-
que los estudiantes tomen sus notas. site www.whfreeman.com/biochem5.
XV r­
Prefacio

~gradecimientos
Hay un viejo proverbio que afirma que uno nunca aprende realmente una asignatura
hasta que la enseña. Ahora sabemos que se aprende todavía mejor una asignatura cuando
se escribe sobre ella. Preparar la quinta edición de Biochemistry nos ha proporcionado
una maravillosa oportunidad de reunir nuestro amor por la bioquímica y la docencia y
compartir nuestro entusiasmo con estudiantes de todo el mundo. Aún así, el proyecto
también ha resultado descorazonador porque desde la publicación de la cuarta edición
se han llevado a cabo multitud de interesantes descubrimientos. La pregunta que nos
planteábamos continuamente era: ¿Cuáles son los conocimientos bioquímicos que me-
recen la pena? Para responder a esta pregunta es preciso dominar la mayor cantidad
posible de material nuevo y, posteriormente, decidir qué se incluye y, todavía peor, qué
se excluye.
Sin embargo, nosotros no empezamos a partir de cero. Nos sentimos a la vez
afortunados e intimidados al estar escribiendo la quinta edición de la Bioquímica
de Stryer. Afortunados porque tuvimos como material de partida el mejor texto de
bioquímica jamás escrito. Intimidados porque tuvimos el desafío de mejorarlo. En
la medida en que lo hayamos conseguido, ha sido gracias a la ayuda de mucha
gente.
Las gracias se dirigen en primer y destacado lugar a nuestros estudiantes de la
Johns Hopkins University y Carleton College. No se ha escrito una palabra ni se ha
elaborado una ilustración sin tener en cuenta que brillantes y comprometidos estu-
diantes detectarían inmediatamente vaguedades y ambigüedades. Uno de nosotros
(JMB) agradece especialmente a los miembros del laboratorio Berg el haber sopor-
tado con tan buen ánimo años de negligencia y requerimientos para revisar los borra-
dores de las ilustraciones cuando deberían haber estado discutiendo sobre sus inves-
tigaciones. Concretamente, da las gracias a las Dras. Barbara Arnann y Kathleen Kolish,
que han ayudado a mantener algo de orden en medio del caos. También agradecemos
a nuestros colegas de la Universidad Johns Hopkins y Carleton College que nos han
apoyado, aconsejado, instruído y, sencillamente, soportado durante esta ardua tarea.
Uno de nosotros (JLT) fue galardonado generosamente con una beca del Carleton Co-
llege para liberarle de parte de sus tareas académicas de forma que pudo centrarse más
en el libro.
También estamos agradecidos a nuestros colegas de todo el mundo que han ac-
tuado de revisores de la nueva edición. Sus comentarios meditados, sus sugerencias y
sus muestras de aliento nos han ayudado inmensamente a mantener la excelencia de
las ediciones precedentes. Estos revisores son:

MarkAlper Michael Ba.rbush Lukas K. Buehler


University of California at Baker University University of California
Berkeley at San Diego
Douglas Barrick
L. Mario Amzel Johns Hopkins University C. Allen Bush
Johns Hopkins University University of Maryland,
Loran L. Bieber
Paul Azari Michigan State University Baltimore County
Colorado State University
Margaret Brosnan Tom Cech
Ruma Banerjee University of Howard Hughes Medica!
University of Nebraska Newfoundland Institute
---J xvi >--~~~~~~~~~~

PREFACIO

Osear P. Chilson Neville R. Kallenbach Carl Rhodes


Washington University New York University Howard Hughes Medical
lnstitute
Steven Clarke Harold Kasinsky
University of California at Los University of British Columbia Gale Rhodes
Angeles University of Southern Maine
Dan Kirschner
Philip A. Cole Boston College Mark Richter
Johns Hopkins University School of
University of Kansas
Medicine G. Barrie Kitto
University of Texas at Austin Anthony S. Serianni
Paul A. Craig
Rochester Institute of Technology James F. Koerner University of Notre Dame
University of Minnesota Ann E. Shinnar
David L. Daleke
Indiana University John Koontz Barnard College
David Deamer University of Tennessee
Jessup M. Shively
University of California at Santa Gary R. Kunkel Clemson University
Cruz Texas A&M University
Roger D. Sloboda
Frank H. Deis Dartmouth University
David O. Lambeth
Rutgers University
University of North Dakota
Eric S. Eberhardt Carolyn M. Teschke
Vassar College Timothy Logan University of Connecticut
Florida State University
Duane C. Eichler Dean R. Tolan
University of San Francisco School Douglas D. McAbee Boston University
of Medicine California State University at Long
Beach Gordon Tollin
Stephen H. Ellis University of Arizona
Auburn University William R. Marcotte, Jr.
Clemson University Jeffrey M. Voigt
Nuran Ercal Albany College of Pharmacy
University of Missouri at Rolla Alan Mellors
University of Guelph M. Gerard Waters
Gregg B. Fields
Florida Atlantic University Dudley G. Moon Princeton University
Albany College of Pharmacy
Gregory J. Gatto Jr. Linette M. Watkins
Johns Hopkins University Kelley W. Moremen Southwest Texas State
University of Georgia University
Nancy Counts Gerber
San Francisco State University Scott Napper Gabriele Wienhausen
University of Saskatchewan University of California at
Claiborne Glover III San Diego
University of Georgia Jeremy Nathans
Johns Hopkins University School of James D. Willett
E. M. Gregory Medicine George Masan University
Virginia Polytechnic Institute and
State University James W. Phillips
Gail R. Willsky
University of Health Sciences
Mark Griep State University of New York at
University of Nebraska at Lincoln Terry Platt Buffalo
University of Rochester Medical
Hebe M. Guardiola-Diaz Center Dennis Winge
Trinity College University of Utah
Gary J. Quigley
James R. Heitz Hunter College, City University of Charles F. Yocum
Mississippi State University New York University of Michigan
----------- xvii f­­­
Prefacio

Trabajar con nuestros colegas de W. H. Freeman and Company ha sido una expe-
riencia maravillosa. Nos gustaría reconocer especialmente el esfuerzo de las siguientes
personas. Nuestra editora de desarrollo, Susan Moran, ha contribuido inmensamente al
éxito del proyecto. Durante este proceso, Susan se convirtió, a la fuerza, en una estu-
diante de bioquímica. Su comprensión sobre cómo la materia de la asignatura, el texto y
las ilustraciones serían percibidos por los estudiantes y su devoción por la excelencia han
sido una verdadera fuente de inspiración. Nuestra editora del proyecto, Georgia Lee Had-
ler, consiguió manejar la totalidad del proyecto, desde el manuscrito hasta el producto fi-
nal, algunas veces con guante de terciopelo y otras veces con más fuerza, pero siempre
de forma eficaz. La meticulosa editora del manuscrito, Patricia Zimmerman, aumentó la
consistencia literaria y la claridad del texto. Las diseñadoras Vicki Tomaselli y Patricia
McDermond han elaborado un diseño y una maquetación claros desde el punto de vista
organizativo y agradables desde el punto de vista estético. La búsqueda incansable de
nuestras investigadoras fotográficas, Vikii Wong y Dena Betz, de las mejores fotografías
posibles ha contribuido eficazmente a la claridad y al atractivo del texto. Cecilia Varas,
la coordinadora de las ilustraciones, supervisó sabiamente el aspecto de cientos de nue-
vas ilustraciones y Julia de Rosa, la directora de producción, manejó con astucia todas
las dificultades asociadas a la planificación, composición y manufacturación.
Neil Clarke, de la Universidad Johns Hopkins, Sonia di Vittorio y Mark Santee en-
cabezaron los proyectos multimedia asociados al libro. La habilidad de Neil como pro-
fesor y su conocimiento de las ventajas y desventajas de los ordenadores, el talento de
Sonia para editar y coordinar y su sentido del estilo y la gestión de Mark al frente de un
proyecto en continuo estado de cambio han hecho del sitio Web un poderoso suplemento
del texto cuya exploración resulta muy divertida. También nos gustaría reconocer a los
desarrolladores multimedia que han convertido los guiones en las animaciones que se
pueden encontrar en nuestro sitio Web. Por los módulos sobre Visiones Conceptuales da-
mos las gracias a Nick McLeod, Koreen Wykes, el Dr. Roy Tasker, Robert Bleeker y Da-
vid Hegarty, todos de diseños CADRE. Por las visualizaciones tridimensionales de las
moléculas en los módulos de Visiones estructurales damos las gracias a Timothy Dris-
coll (molvisions.com -visualización 3D de moléculas). Daniel J. Davis de la Universi-
dad de Arkansas en Fayetteville preparó los exámenes interactivos.
La editora Michelle Julet fue nuestra animadora, capataz, consoladora y engatusadora.
Cuando estábamos cansados, frustrados o descorazonados nos mantenía en movimiento.
Junto a Michelle, los expertos en marketing John Britch y Carol Coffey nos introdujeron
en el negocio de las publicaciones. También queremos dar las gracias a los agentes de
ventas de W. H. Freeman and Company por sus excelentes sugerencias y su concepción
del mercado, especialmente a la vicepresidenta de ventas Marie Schappert y también a
David Kennedy, Chris Spavins, Julie Hirshman, Cindi Weiss-Goldner, Kimberly Manzi,
Connaught Colbert, Michele Merlo, Sandy Manly y Mike Krotine. Damos las gracias a
Elizabeth Widdicombe, presidenta de W. H. Freeman and Company por no perder nunca
la fe en nosotros.
Por último, el proyecto no habría sido posible sin el apoyo constante de nuestras fa­
milias, especialmente nuestras esposas Wendie Berg y Alison Unger. Su paciencia, apoyo
y entusiasmo han hecho posible esta empresa. También damos las gracias a nuestros ni-
ños, Alex, Corey y Mónica Berg y Janina y Nicholas Tymoczko por su paciencia y buen
humor y por ofrecernos continuamente una perspectiva de lo que es realmente importante
en la vida.
~ xviii 1------------
PREFACIO

~rólogo a la 5ª edición española


Con una regularidad cronométrica -una edición cada siete años- el profesor Stryer
acaba de sacar a la luz la quinta edición de su libro admirable. Aparte de la proverbial
claridad expositiva y elevado nivel didáctico, en esta ocasión se advierten unas nove-
dades muy notorias que quiero resaltar aquí.
Primero: la colaboración de dos autores prestigiosos que actualizan el libro -como
ellos mismos explican- con las aportaciones más recientes en cuanto a texto, pro-
blemas y figuras.
Segundo: existen desde el principio materiales docentes complementarios muy úti-
les para facilitar el aprendizaje, entre los que se incluyen las páginas Web y un libro
de problemas.
Al lector español o hispanohablante debemos decirle como siempre que, en la tra-
ducción, aceptamos que las abreviaturas tienen rango de fórmulas y son por tanto in-
traducibles (se apoyan en el nombre inglés: el idioma oficial de la bioquímica). Así,
por ejemplo, decimos DNA y no ADN (por deoxyribonucleic acidi, llamamos VLDL
a las lipoproteínas de muy baja densidad (very low density lipoproteins), etc. En ge-
neral, estas siglas, aceptadas universalmente, aclaran muy bien el concepto que encar-
nan y facilitan intuir su sentido cuando éste no se recuerda con exactitud.
Sin embargo, en esta traducción nos hemos resistido a utilizar excesivos anglicis-
mos, tan comunes en otros textos hispanos, tales como, por ejemplo, llamar a las mu-
taciones de punto, puntuales, a los RNA ribosámicos, ribosomales, a las proteínas ví-
ricas, virales, para no llegar algún día - corno dicen mis alumnos - a tratar los asuntos
anímicos, como animales. Pero hemos llegado demasiado tarde para salvar a las es-
tructuras "mitocándricas" que ya son, para siempre, mitocondriales. A los biocatali-
zadores les seguirnos llamando los enzimas (aunque respetamos naturalmente a quie-
nes les adjudican el género femenino) y a los conductos a través de las membranas no
les llamamos canales (un semiconducto se comprende bien, pero un "semicanal" ¿qué
podrá ser?), aunque sí adoptamos otros términos, como "patch clamp, cassette, es-
pliceosoma, primasa, ... " y otros mil barbarismos rápidamente difundidos y univer-
salmente aceptados.
Confío en haber plasmado con fidelidad las ideas de los autores -más el espíritu
que la simple letra- y deseo que esta obra excelente sirva de ayuda eficaz para mu-
chos universitarios. Por último quiero agradecer a Editorial Reverté el grato encargo
de esta traducción en la que han participado con competencia, dedicación y generosi-
dad imponderables varios catedráticos, profesores titulares y doctores en bioquímica,
cuya lista anexo y a quienes agradezco muy de veras su valiosa ayuda para culminar
-espero que con éxito- este trabajo.
José María Macarulla
Profesores que han colaborado
Alicia Alonso Aida Marino
José Ramón Fedriani Begoña Ochoa
Juan Manuel González Mañas Adelina Prado
José Carlos González Milicua José Luis Rodríguez Arrondo
Félix MªGoñi Miguel Trueba
Alberto Macarulla Matxalen Uriarte
Mª Teresa Macarulla
,
Indice resumido -

PARTE I DISEÑO MOLECULAR DE LA VIDA Capítulo 18 Fosforilación oxidativa 491

Capítulo 19 Las reacciones de la fase luminosa de la


Capítulo Preludio: la bioquímica y la revolución
fotosíntesis 527
genómica 3
Capítulo 20 El ciclo de Calvin y la vía de las pentosas
Capítulo 2 Evolución bioquímica 19
fosfato 551
Capítulo 3 Estructura y función de las proteínas 41
Capítulo 21 Metabolismo del glucógeno 577

Capítulo 4 Investigación en proteínas 77


Capítulo 22 Metabolismo de los ácidos grasos 601
Capítulo 5 DNA, RNA y el flujo de la información
Capítulo 23 Recambio de las proteínas y catabolismo de
genética 11 7
los aminoácidos 633
Capítulo 6 Investigación en genes 143

Capítulo 7 Investigación de la evolución 171 PARTE III SÍNTESIS DE LAS MOLÉCULAS DE


LA VIDA
Capítulo 8 Enzimas: conceptos básicos y cinética 189
Capítulo 24 Biosíntesis de aminoácidos 665
Capítulo 9 Estrategias catalíticas 227
Capítulo 25 Biosíntesis de nucleótidos 693
Capítulo 10 Estrategias reguladoras: los enzimas y la
hemoglobina 261 Capítulo 26 Biosíntesis de lípidos de membrana y de
esteroides 715
Capítulo 11 Carbohidratos 295
Capítulo 27 Replicación, recombinación y reparación del
Capítulo 12 Lípidos y membranas celulares 319
DNA 745
Capítulo 13 Conductos y bombas de membrana 345
Capítulo 28 Síntesis y maduración del RNA 781

Capítulo 29 Síntesis de proteínas 813


PARTE II TRANSDUCCIÓN V
ALMACENAMIENTO DE LA Capítulo 30 Integración del metabolismo 845
ENERGÍA Capítulo 31 El control de la expresión génica 867

Capítulo 14 Metabolismo: conceptos básicos y visión de


conjunto 373
PARTE IV RESPUESTAS A CAMBIOS
Capítulo 15 Vías de la transducción de señales: una AMBIENTALES
introducción al metabolismo de la
información 395 Capítulo 32 Sistemas sensoriales 897

Capítulo 16 Glicolisis y gluconeogénesis 425 Capítulo 33 El sistema inmunitario 921

Capítulo 17 El ciclo del ácido cítrico 465 Capítulo 34 Motores moleculares 951
.,

1
1 •

l
r
Índice

Prefacio V 2.2 La evolución necesita reproducción, variación y


Herramientas y técnicas X presión selectiva 21
Aplicaciones clínicas xi 2.2.1 Los principios de la evolución pueden demostrarse
Evolución molecular xii in vitro 22
Agradecimientos XV
2.2.2 Las moléculas de RNA pueden actuar como
catalizadores 23
PARTE I DISEÑO MOLECULAR DE LA VIDA 2.2.3 Los aminoácidos y sus polímeros pueden llevar
a cabo funciones biosintéticas y catalíticas 23
2.2.4 La síntesis de las cadenas polipeptídicas, dirigida por un
CAPÍTULO 1 Preludio: la bioquímica y molde de RNA, une el mundo del RNA y el de las proteínas 24
la revolución genómica 3 2.2.5 El código genético revela el mecanismo de
la evolución 25
1.1 El DNA ilustra la relación entre forma y función 4
2.2.6 Los RNA de transferencia ilustran la evolución
1.1.1 El DNA está constituido por cuatro tipos
a través de la duplicación de los genes 26
de precursores 4
2.2.7 El DNA es una forma estable de almacenamiento
1.1.2 Dos hebras sencillas de DNA se emparejan para
de la información genética 26
formar un doble helicoide 5
1.1.3 El RNA es un intermediario en el flujo de 2.3 Las transformaciones energéticas son necesarias
la información genética 6 para sustentar a los seres vivos 28
1.1.4 Las proteínas, codificadas por los ácidos nucleicos, 2.3.1 El ATP, una divisa común en la energética
realizan la mayoría de las funciones celulares 6 bioquímica, se puede generar mediante la ruptura
de moléculas orgánicas 28
1.2 En la diversidad biológica subyace la unidad
2.3.2 Las células se formaron cuando los ácidos
bioquímica 7
nucleicos se rodearon de membranas 29
1.3 Los enlaces químicos en bioquímica 8 2.3.3 La compartimentación necesita del desarrollo
de bombas de iones 30
2.3.4 Los gradientes de protones se pueden utilizar
para dirigir la síntesis de ATP 31
2.3.5 El oxígeno molecular, un subproducto tóxico
de algunos procesos fotosintéticos, se puede utilizar
con fines metabólicos 32
2.4 Las células pueden responder a cambios ambientales 33
2.4.1 Estructuras filamentosas y motores moleculares
permiten los movimientos intracelulares y celulares 34
1.3.1 Las interacciones reversibles entre las biomoléculas 2.4.2 Algunas células pueden interaccionar para formar
están mediadas por tres clases de enlaces no covalentes 9 colonias con funciones especializadas 35
1.3.2 Las propiedades del agua afectan a la capacidad de 2.4.3 El desarrollo de organismos multicelulares necesita
enlace de las biomoléculas IO la diferenciación organizada de las células 36
1.3.3 La entropía y las leyes de la termodinámica lI 2.4.4 La unidad de la bioquímica permite que la biología
humana pueda ser eficazmente comprobada mediante
1.3.4 El plegamiento de las proteínas puede comprenderse
estudios en otros organismos 37
en términos de cambios en la energía libre 14
1.4 La bioquímica y la biología humana 15
Apéndice: Representación de las estructuras moleculares 16 CAPÍTULO 3 Estructura y función de
las proteínas 41
3.1 Las proteínas se construyen a partir de una colección
CAPÍTULO 2 Evolución bioquímica 19 de 20 aminoácidos 43
2.1 Los seres vivos utilizan moléculas orgánicas clave 20 3.2 Estructura primaria: los aminoácidos están unidos por
2.1.1 Muchos componentes de las macromoléculas enlaces peptídicos para formar cadenas polipeptídicas 51
bioquímicas se pueden producir en reacciones 3.2. l Las proteínas tienen secuencias de aminoácidos
prebióticas sencillas 20 específicas que son determinadas por los genes 53
2.1.2 El origen de algunas moléculas clave está 3.2.2 Las cadenas polipeptídicas son flexibles aunque están
ensombrecido por la incertidumbre 21 restringidas en su conformación 54
----j xxii r- ÍNDICE

3.3 Estructura secundaria: las cadenas polipeptíficas 4.1.7 La masa de una proteína se puede determinar con
se pueden plegar en estructuras regulares como la exactitud por espectrometría de masas 89
hélice alfa, la hoja plegada beta y giros y bucles 56
4.2 Las secuencias de aminoácidos se pueden
determinar por degradación de Edman automatizada 91
4.2.1 Para facilitar el análisis, las proteínas se pueden
fragmentar específicamente en péptidos pequeños 94
4.2.2 Las secuencias de aminoácidos suministran muchos
tipos de información 96
4.2.3 La tecnología del DNA recombinante ha
revolucionado la secuenciación de las proteínas 97

4.3 La inmunología proporciona técnicas importantes


para la investigación sobre las proteínas 98
4.3.1 Se pueden generar anticuerpos contra proteínas
3.3.l La hélice O'. es una estructura helicoidal estabilizada específicas 98
por puentes de hidrógeno intracatenarios 56 4.3.2 Hoy se pueden preparar fácilmente anticuerpos
3.3.2 Las hojas 13 se estabilizan por puentes de hidrógeno monoclonales de prácticamente cualquier especificidad
entre las cadenas polipeptídicas 58 deseada 100
3.3.3 Las cadenas polipeptídicas pueden cambiar de 4.3.3 Las proteínas se pueden detectar y determinar utilizando
dirección por medio de giros inversos y bucles 60 un ensayo de inmunoabsorción asociada a enzima 101
3.4 Estructura terciaria: las proteínas solubles en agua se 4.3.4 La transferencia Western permite la detección de
pliegan en estructuras compactas con un núcleo no polar 61 proteínas separadas por electroforesis en gel 103
4.3.5 Los marcadores fluorescentes hacen posible la
3.5 Estructura cuaternaria: las cadenas polipeptídicas se
visualización de proteínas en la célula 103
pueden ensamblar en estructuras de múltiples
subunidades 63 4.4 Los péptidos se pueden sintetizar por métodos
3.6 La secuencia de aminoácidos de una proteína automatizados en fase sólida 104
determina su estructura tridimensional 64 4.5 La estructura tridimensional de las proteínas se
3.6.1 Los aminoácidos tienen diferentes propensiones puede determinar por espectroscopía de NMR y
a formar hélices O'., hojas 13 y giros 13 66 cristalografía de rayos X 107
3.6.2 El plegamiento proteico es un proceso 4.5.1 La espectroscopía de resonancia magnética nuclear
muy cooperativo 68 puede revelar las estructuras de las proteínas en disolución 107
3.6.3 Las proteínas se pliegan por estabilización progresiva 4.5.2 La cristalografía de rayos X proporciona la estructura
de intermediarios más que por búsqueda aleatoria 68 tridimensional con detalle atómico 110
3.6.4 La predicción de la estructura tridimensional a
partir de la secuencia continúa siendo un gran reto 69
3.6.5 La modificación y escisión de las proteínas les CAPÍTULO5 DNA, RNA y el flujo de
confieren nuevas capacidades 69 la información genética 117
Apéndice: Conceptos ácido-base 73 5.1 Un ácido nucleico está formado por cuatro tipos de
bases unidas a un eje de azúcar-fosfato 118

J CAPÍTULO4 Investigación en proteínas 77 5.1.l El RNA y el DNA difieren en su componente


de azúcar y en una de las bases 118
4.0.1 El proteoma es la representación funcional del genoma 78
5.1.2 Los nucleótidos son las unidades monoméricas
4.1 La purificación de las proteínas es un primer paso de los ácidos nucleicos 120
esencial para el conocimiento de su función 78
5.2 Una pareja de cadenas de ácido nucleico con
4.1.l El experimento: ¿Cómo reconocemos a la proteína secuencias complementarias puede formar
que estamos buscando? 78 una estructura de doble hélice 121
4.1.2 Para su purificación, las proteínas deben ser liberadas
de la célula 79
4.1.3 Las proteínas se pueden purificar de acuerdo con su
solubilidad, tamaño, carga y capacidad de unión 80
4.1.4 Las proteínas se pueden separar y mostrar por
electroforesis en gel 83
4.1.5 Un protocolo de purificación de proteínas se puede
evaluar cuantitativamente 86
4.1.6 La ultracentrifugación es valiosa para separar las
biomoléculas y determinar sus masas moleculares 87
Índice ­­j xxiii r­ \
5.2.l La doble hélice es estable gracias a puentes de 6.2. l Los enzimas de restricción y la DNA ligasa son
hidrógeno e interacciones hidrofóbicas 121 instrumentos esenciales para formar moléculas
recombinantes de DNA 152
5.2.2 La doble hélice facilita la transmisión precisa
de la información hereditaria 123 6.2.2 Los plásmidos y el fago lambda son vectores
124 de elección para el clonado de DNA en bacterias 153
5.2.3 La doble hélice se puede fundir reversiblemente
5.2.4 Algunas moléculas de DNA son circulares y están 6.2.3 Se pueden clonar genes determinados a partir de
superenrolladas 125 fragmentos de DNA genómico 155
5.2.5 Los ácidos nucleicos de hebra simple pueden adoptar 6.2.4 Se pueden analizar eficientemente secuencias
estructuras complicadas 126 largas de DNA por recorrido cromosómico 156

5.3 Las polimerasas replican el DNA tomando 6.3 Manipulación de los genes de eucariotas 157
instrucciones de moldes 127 6.3.1 A partir de mRNA se puede preparar DNA
5.3.1 Las DNA polimerasas catalizan la formación complementario y expresarlo en células hospedadoras 157
de enlaces fosfodiéster 127 6.3.2 Se pueden examinar los niveles de expresión
5.3.2 Los genes de algunos virus son de RNA 128 génica de forma exhaustiva 159
5.4 La expresión génica es la transformación de la 6.3.3 Pueden expresarse de manera eficiente genes nuevos
información del DNA en moléculas funcionales 129 insertados en células eucarióticas 160
5.4.l Varios tipos de RNA juegan un papel clave en 6.3.4 Los animales transgénicos albergan y expresan
la expresión génica 129 genes que fueron introducidos en su línea germinal 161
5.4.2 Todo el RNA celular se sintetiza por las RNA 6.3.5 Las alteraciones en los genes proporcionan
polimerasas 130 las claves de la función génica 162
5.4.3 Las RNA polimerasas reciben instrucciones 6.3.6 Los plásmidos productores de tumores pueden servir
de DNA moldes 131 para introducir genes nuevos en células vegetales 163
5.4.4 la transcripción comienza junto a centros promotores 6.4 Por mutagénesis dirigida se pueden fabricar
y finaliza en los centros de terminación 131 nuevas proteínas 164
5.4.5 El RNA de transferencia es la molécula adaptadora 6.4. l Se pueden crear proteínas con funciones nuevas por
en la síntesis de proteínas I 32 medio de cambios dirigidos en el DNA 164
5.5 Los aminoácidos se codifican por grupos de 6.4.2 La tecnología del DNA recombinante ha abierto
tres bases comenzando desde un punto fijo 133 nuevos horizontes 165
5.5.1 Características principales del código genético 134
5.5.2 El RNA mensajero contiene señales de iniciación I CAPÍTULO7 Investigación de la evolución 171
y de parada para la síntesis de proteínas 135
7.1 Los homólogos descienden de un antecesor común 173
5.5.3 El código genético es prácticamente universal 135
7.2 La homología puede detectarse mediante el análisis
5.6 La gran mayoría de los genes eucarióticos son
estadístico de secuencias alineadas 173
mosaicos de intrones y exones 136
7.2.1. El significado estadístico de los alineamientos
5.6.1 El procesamiento del RNA genera el RNA maduro 137
puede ser valorado reordenando los componentes al azar
5.6.2 Muchos exones codifican dominios de proteínas 137 ("shuffling") 175
7.2.2. Los parentescos evolutivos lejanos pueden detectarse
I CAPÍTULO6 Investigación en genes 143 mediante la utilización de matrices de sustitución 177
7 .2.3. Para descubrir secuencias homólogas se
6.1 Los instrumentos básicos de la investigación pueden utilizar los bancos de datos 178
en genes 144
6.1. l Los enzimas de restricción cortan el DNA 7.3 El estudio de las estructuras tridimensionales
en fragmentos específicos 144 potencia nuestro conocimiento de los parentescos
evolutivos 179
6.1.2 Los fragmentos de restricción pueden separarse por
electroforesis en gel y visualizarse 145
6.1.3 El DNA se secuencia habitualmente por interrupción
controlada de la replicación (Método del didesoxi de Sanger) 146
6.1.4 Se pueden sintetizar genes y sondas de DNA por
métodos automatizados en fase sólida 148
6.1.5 Las secuencias de DNA seleccionadas se pueden
amplificar enormemente por la reacción en cadena de la
polimerasa 149
6.1.6 La PCR es una técnica poderosa en diagnóstico
médico, medicina forense y evolución molecular 151
6.2 La tecnología del DNA recombinante ha 7 .3.1 La estructura terciaria se conserva más que
revolucionado todos los aspectos de la biología 151 la primaria 179
~ xxiv r- ÍNDICE

7.3.2 El conocimiento de las estructuras tridimensionales 8.4.3 La mayoría de las reacciones bioquímicas incluye
puede ayudar a la evaluación de los alineamientos de múltiples sustratos 207
secuencias 180 8.4.4 Los enzimas alostéricos no siguen la cinética de
7.3.3 Al alinear las secuencias consigo mismas se pueden Michaelis-Menten 208
detectar motivos repetidos 181
8.5 Los enzimas pueden inhibirse mediante moléculas
7.3.4 Evolución convergente: Soluciones semejantes para específicas 209
los desafíos bioquímicos 182 8.5.l La inhibición competitiva y no competitiva son
7.3.5 La comparación de las secuencias del RNA puede arrojar distinguibles cinéticarnente 210
nueva luz para penetrar en las estructuras secundarias 182 8.5.2 Los inhibidores irreversibles se pueden utilizar para
7.4 Sobre la base de la información de las secuencias trazar el mapa del centro activo 210
se pueden construir los árboles evolutivos 183 8.5.3 Los análogos del estado de transición son eficaces
inhibidores de los enzimas 213
7 .5 Técnicas modernas hacen posible el estudio
experimental de la evolución 184 8.5.4 Los anticuerpos catalíticos demuestran la importancia
de la unión selectiva del estado de transición para
7.5.1 A veces pueden amplificarse y secuenciarse
la actividad enzimática 213
moléculas muy antiguas 184
8.5.5 La penicilina inactiva irreversiblemente un enzima
7.5.2 La evolución molecular puede examinarse de forma
clave en la síntesis de la pared celular bacteriana 214
experimental 184
8.6 Las vitaminas son con frecuencia precursoras
de los coenzimas 216
CAPÍTULO 8 Enzimas: conceptos básicos 8.6.1 Las vitaminas hidrosolubles funcionan como coenzimas 217
y cinética 189
8.6.2 Las vitaminas liposolubles participan en procesos tan
8.1 Los enzimas son catalizadores eficaces y muy diversos como la coagulación de la sangre y la visión 219
específicos 190 Apéndice: Vmax y KM se pueden determinar mediante la
8.1.1 Muchos enzimas requieren cofactores para su actividad 191 representación doble recíproca 221
8.1.2 Los enzimas interconvierten diferentes formas de energía 192
8.1.3 Los enzimas se clasifican en base al tipo de CAPÍTULO 9 Estrategias catalíticas 227
reacción que catalizan 192
9 .0.1 Muchos enzimas utilizan unos pocos principios
8.2 La energía libre es una función termodinámica catalíticos básicos · 228
útil para la comprensión de los enzimas 193 9.1 Proteasas: facilitan una reacción difícil 228
8.2.1 Los cambios de energía libre proporcionan 9.1.l La quimotripsina posee un residuo de serina
información sobre la espontaneidad, pero no sobre la sumamente reactivo 229
velocidad, de una reacción 193
9.1.2 La acción de la quimotripsina tiene Jugar en dos pasos
8.2.2 El cambio de energía libre estándar de una reacción enlazados mediante un intermediario unido covalentemente 230
está relacionado con la constante de equilibrio 194
9.1.3 La serina forma parte de una tríada catalítica
8.2.3 Los enzimas modifican sólo la velocidad de reacción que incluye también a la histidina y al ácido aspártico 231
y no alteran el equilibrio de la reacción 196
9 .1.4 Las triadas catalíticas se encuentran en otros
8.3 Enzimas aceleran las reacciones mediante la enzimas hidrolíticos 234
facilitación de la formación del estado de transición 196 9 .1.5 La tríada catalítica se ha analizado minuciosamente
mediante rnutagénesis dirigida 236
9.1.6 Las cisteinproteasas, aspartilproteasas y metaloproteasas
son otras clases importantes de enzimas que escinden péptidos 236
9.1.7 Los inhibidores de las proteasas son fármacos
importantes 238
9.2 Anhidrasas carbónicas: aceleran las reacciones
rápidas 239
9.2.1 Las anhidrasas carbónicas contienen un ion zinc
esencial para la actividad catalítica 240
9.2.2 La catálisis supone la activación del agua por el zinc 241
8.3.1 La primera etapa de la catálisis enzimática es la
9.2.3 La regeneración rápida de la forma activa del enzima
formación de un complejo enzima-sustrato 197
se facilita mediante una lanzadera de protones 242
8.3.2 Los centros activos de los enzimas tienen algunas
9.2.4 La evolución convergente ha generado centros activos
características comunes 198
basados en el zinc en diferentes anhidrasas carbónicas 244
8.4. El modelo de Michaelis-Menten explica las
propiedades cinéticas de muchos enzimas 9.3 Enzimas de restricción: llevan a cabo la escisión
200
del DNA mediante reacciones muy específicas 245
8.4.1 Significado de los valores de KM y Vmax 203 9.3.1 La escisión del DNA se realiza por una molécula de
8.4.2 Perfección cinética en la catálisis enzimática: agua activada por magnesio, mediante un desplazamiento
el criterio kca/KM 205 en linea del oxigeno 3' del fósforo 246
Índice xxv ~

9.3.2 Los enzimas de restricción necesitan magnesio 10.2.2 La unión del oxígeno modifica ostensiblemente
para la actividad catalítica 248 la estructura cuaternaria de la hemoglobina 271
9.3.3 El aparato catalítico completo sólo se reúne 10.2.3 El efecto del 2,3-bisfosfoglicerato modula
en los complejos de moléculas de DNA reconocido la afinidad de la hemoglobina por el oxígeno 272
para asegurar la especificidad 248 10.2.4 El efecto Bohr: los hidrogeniones y el dióxido de
9.3.4 Las endonucleasas de restricción de tipo Il tienen un carbono potencian la liberación de oxígeno 273
núcleo catalítico común y probablemente están relacionadas
mediante transferencia horizontal de genes 251 10.3 Los isozimas aportan modos de regulación
específicos a los diferentes tejidos y en distintas
9.4 Nucleósido monofosfato quinasas: catalizan el fases del desarrollo 274
intercambio del grupo fosforito entre nucleótidos sin
provocar la hidrólisis 252 10.4 Una forma de regular la actividad enzimática
9.4.1 Las NMP quinasas son una familia de enzimas que consiste en la modificación covalente 275
contienen estructuras de bucle P 253 10.4.1 La fosforilación es un mecanismo muy eficaz para
9.4.2 Los auténticos sustratos para prácticamente todos regular las actividades de las proteínas diana 276
los enzimas dependientes de NTP son los complejos de 10.4.2 El AMP cíclico activa a la proteína qui nasa A
nucleósido trifosfato y magnesio (o manganeso) 254 porque altera su estructura cuaternaria 278
9.4.3 La unión del ATP induce grandes cambios 10.4.3 El ATP y la proteína diana se unen a una profunda
conformacionales 255 hendidura de la subunidad catalítica de la proteína quinasa A 279
9.4.4 Los dominios NTPasa con bucles P están presentes 10.5 Muchos enzimas se activan por escisiones
en diversas proteínas importantes 255 proteolíticas específicas 280
10.5.1 El quimotripsinógeno se activa por ruptura
CAPÍTULO 1 o Estrategias reguladoras: específica de un único enlace peptídico 28 J
los enzimas y la hemoglobina 261 10.5.2 La activación proteolítica del tripsinógeno origina
10.1 La aspartato transcarbamilasa se inhibe la formación de un centro para la unión del sustrato 281
alostéricamente por el producto final de su propia vía 10.5.3 La generación de tripsina a partir de tripsinógeno
metabólica 262 conduce a la activación de otros zimógenos 282
10.1.l La ATCasa consta de subunidades catalíticas y 10.5.4 Algunos enzimas proteolíticos tienen inhibidores
reguladoras separables 263 específicos 283
10.1.2 Las interacciones alostéricas en la ATCasa están 10.5.5 La coagulación sanguínea se consigue mediante
mediadas por grandes cambios en la estructura cuaternaria 264 una cascada de activaciones de zimógenos 284
10.1.3 Los enzimas regulados alostéricamente no 10.5.6 Mediante la trombina, el fibrinógeno se convierte
siguen la cinética de Michaelis-Menten 267 en el coágulo de fibrina 285
10. l.4 Los reguladores alostéricos modulan 10.5.7 Una modificación dependiente de la vitamina K
el equilibrio entre los estados T y R 267 prepara a la protrombina para su activación 287
10.1.5 El modelo concertado puede formularse en 10.5.8 La hemofilia reveló una de las primeras etapas
términos cuantitativos 268 de la coagulación 288
10.l.6 Los modelos secuenciales también dan cuenta 10.5.9 El proceso de la coagulación debe ser regulado
de los efectos alostéricos 269 con exactitud 289
10.2 La hemoglobina transporta eficazmente el oxígeno .
porque se une a él de forma cooperativa 269
I CAPÍTULO11 Carbohldratos 295
11.1 Los monosacáridos son aldehídos o cetonas con
múltiples grupos hidroxilo 296
11.1.1 Las pentosas y hexosas se ciclan para formar
anillos de furanosa y piranosa 298
l l.1.2 Conformación de los anillos de piranosa y de furanosa 300
11.1.3 Los monosacáridos se unen a alcoholes y aminas
por medio de enlaces glicosídicos 300
11.2 Los carbohidratos complejos se forman por
unión de monosacáridos 301
11.2.1 La sacarosa, lactosa y maltosa son los disacáridos
más comunes 302
11.2.2 El glucógeno y el almidón son almacenes de
glucosa movilizables 302
11.2.3 La celulosa, el principal polímero estructural de las plantas,
está formada por cadenas lineales de unidades de glucosa 303
10.2.1 La unión del oxígeno induce cambios estructurales 11.2.4 Los glicosarninoglicanos son cadenas de polisacáridos
importantes en las posiciones del hierro en la hemoglobina 270 aniónicos formados por repetición de unidades de disacáridos 304
--, xxvi f­­ ÍNDICE

11.2.5 Unos enzimas específicos son responsables del 12.3.5 Los Lípidos de membrana son moléculas anfipáticas
ensamblaje de los oligosacáridos 304 que poseen una parte hidrofilica y otra hidrofóbica 325
11.3 Los carbohidratos pueden unirse a proteínas para 12.4 Los fosfolípidos y glicolípidos forman fácilmente
formar glicoproteínas 306 bicapas en medios acuosos 326
11.3.1 Los carbohidratos pueden unirse a las proteínas a 12.4.1 Los fosfolípidos pueden formar vesículas lipídicas 327
través de residuos de asparragina (enlaces N­) o bien
12.4.2 Las bicapas lipídicas son muy impermeables a
serina o treonina (enlaces 0­). 306
los iones y a la mayoría de las moléculas polares 328
11.3.2 La glicosilación de las proteínas tiene lugar en
el interior del retículo endoplásmico y en el complejo 12.5 Las proteínas llevan a cabo la mayoría de
de Golgi 307 los procesos que tienen lugar en las membranas 329
11.3.3 Las glicoproteínas N-enlazadas obtienen sus azúcares 12.5.1 Las proteínas se asocian con la bicapa lipídica
iniciales de dadores de dolicol en el retículo endoplásmico 308 mediante formas muy variadas 329
11.3.4 Las vesículas de transporte llevan las proteínas 12.5.2 Las proteínas interaccionan con las membranas de
desde el retículo endoplásmico hasta el complejo de Golgi maneras muy diversas 330
para su posterior glicosilación y distribución 309 12.5.3 Algunas proteínas se asocian con las membranas
11.3.5 La manosa 6-fosfato dirige a los enzimas mediante grupos hidrofóbicos unidos de forma covalente 333
lisosómicos hacia sus destinos 310 12.5.4 Se puede predecir la presencia de hélices
11.3.6 Los residuos de glucosa se añaden y se eliminan transmembranales a partir de la secuencia de aminoácidos 334
para facilitar el plegamiento de las proteínas 31 O
12.6 Los lípidos y muchas proteínas difunden
11.3.7 Los oligosacáridos pueden "secuenciarse" 311 rápidamente en el plano de la membrana 335
11.4 Las lectinas son proteínas que se unen a 12.6.1 El modelo del mosaico fluido admite el movimiento
carbohidratos específicos 312 lateral pero no la translocación a través de la membrana 336
11.4.1 Las Jectinas propician interacciones entre las células313 12.6.2 La fluidez de la membrana está controlada
11.4.2 El virus de la gripe se une a residuos de ácido siálico 314 por la composición de sus ácidos grasos y su contenido
en colesterol 337
12.6.3 Todas las membranas biológicas son asimétricas 338
CAPÍTULO 12 Lípidos y membranas celulares 319
12.7 Las células eucarióticas contienen compartimientos
12.1 Las diversas membranas biológicas tienen delimitados por membranas internas 338
una serie de características comunes 320
12.7.1 Las proteínas se dirigen hacia compartimientos
12.2 Los ácidos grasos son componentes clave de específicos mediante secuencias señal 339
los lípidos 320 12.7.2 La fusión y la gemación de membranas implican
muchos procesos biológicos importantes 341

CAPÍTULO 13 Conductos y bombas


de membrana 345
13.1 El transporte de moléculas a través de
las membranas puede ser activo o pasivo 346
13.l. l Muchas moléculas requieren proteínas
transportadoras para atravesar las membranas 346
13. l.2 Se puede cuantificar la energía libre almacenada
en los gradientes de concentración 347
12.2. l La nomenclatura de los ácidos grasoss 320 13.2 Una familia de proteínas de membrana emplea la
12.2.2 La longitud de la cadena y el grado de insaturación hidrólisis del ATP para bombear iones a través de las
de los ácidos grasos pueden variar considerablemente 321 membranas 347
12.3 En las membranas hay tres tipos principales 13.2.1 La ATPasa de calcio del retículo sarcoplásrnico
de lípidos 322 es una proteína integral de membrana 348
12.3.1 Los fosfolípidos son los Lípidos más importantes 13.2.2 Las ATPasas de tipo P están conservadas desde un
de las membranas 322 punto de vista evolutivo y desarrollan una amplia gama de
funciones 350
12.3.2 Las membranas de las arqueobacterias están
formadas por éteres lipídicos con cadenas ramificadas 324 13.2.3 La digital inhibe específicamente la bomba de Na+
y K+ porque bloquea su desfosforilación 350
12.3.3 Los Lípidos de membrana pueden contener también
hidratos de carbono 324 13.3 La múltiple resistencia a fármacos y la fibrosis quística
12.3.4 El colesterol es un lípido basado en un núcleo han llamado la atención sobre una familia de proteínas de
estero ideo 325 membrana con dominios de unión a ATP de tipo cassette 351
Índice ~xxviir-
\
14.1.5 El potencial de transferencia de fosforilos es una
forma importante en la transformación de la energía celular 379
14.2 La oxidación de las moléculas carbonadas es una
fuente importante de la energía celular 380
14.2.l Los compuestos de alto potencial de transferencia
de fosforilos pueden acoplar la oxidación del carbono
con la síntesis de ATP 381
14.2.2 Los gradientes de iones a través de membranas
proporcionan una forma importante de energía celular que
puede ser acoplada con la síntesis de ATP 382
14.2.3 Etapas en la extracción de energía de los alimentos 382
14.3 Las vías metabólicas presentan muchos motivos
recurrentes 383
14.3.l Los transportadores activados son un ejemplo del
13.4 Los transportadores secundarios utilizan diseño modular y de la economía del metabolismo 383
un gradiente de concentración para potenciar 14.3.2 Las reacciones clave se repiten a lo largo del
la formación de otro gradiente 352 metabolismo 386
13.5 Conductos específicos pueden realizar rápidamente 14.3.3 Los procesos metabólicos están regulados
el transporte de iones a través de las membranas 353 principalmente de tres formas 390
13.5.1 Las medidas de conductancia por "patch-clamp" 14.3.4 Evolución de las vías metabólicas 391
revelan la actividad de conductos individuales 354
13.5.2 Las proteínas de los conductos iónicos están
CAPÍTULO15 Vías de la transducción de señales:
construidas a partir de unidades similares 355
una introducción al metabolismo de la
13.5.3 Los potenciales de acción están mediados por información 395
cambios transitorios en la permeabilidad al Na+ y K+ 357
15.0.1 La Transducción de Señales depende de los
13.5.4 El conducto de sodio es un ejemplo de conducto
Circuitos Moleculares: una visión general 396
controlado por voltaje 358
13.5.5 Los conductos de potasio son homólogos del 15.1 Los receptores de siete hélices transmembranales
conducto de sodio 359 cambian su conformación en respuesta a la unión
con el ligando y activan proteínas G 398
13.5.6 La estructura del conducto de potasio revela el
mecanismo del flujo iónico rápido y específico 359 15.1.1 La unión del ligando a los receptores 7TM causa
la activación de las proteínas G 399
13.5.7 La estructura del conducto de potasio explica las
rápidas velocidades del transporte 362 15 .1.2 Las Proteínas G oscilan entre las formas unidas
a GDP y las unidas a GTP 399
13.5.8 Un conducto puede inactivarse por oclusión
del poro: el modelo de la cadena de presidiario 363 15.1.3 Las proteínas G activadas transmiten las señales
mediante su unión a otras proteínas 401
13.6 Los nexus, o uniones íntimas, permiten el flujo de
15.1.4 Las Proteínas G se desactivan de forma espontánea
iones y moléculas pequeñas entre células comunicantes 363
mediante la hidrólisis del GTP 402
15.1.5 El AMP cíclico estimula la fosforilación de
PARTE II TRANSDUCCIÓN Y muchas proteínas diana mediante la activación
ALMACENAMIENTO de la proteína quinasa A 403
DE LA ENERGÍA 15.2 La hidrólisis del fosfatidilinositol bisfosfato por la
fosfolipasa C genera dos mensajeros 403
CAPÍTULO14 Metabolismo: conceptos básicos 15.2.1 El inositol 1,4,5-trisfosfato abre conductos para
y visión de conjunto 373 liberar iones calcio de los depósitos intracelulares. 405
14.0.1 Las células transforman distintos tipos de energía 374 15.2.2 El diacilglicerol activa a la proteína quinasa C,
la cual fosforila muchas proteínas diana 406
14.1 El metabolismo está constituido por muchas
reacciones acopladas e interconectadas 374 15.3 El ion calcio es un mensajero citosólico universal 408
14. l.l Una reacción termodinámicamente desfavorable 15.3.1 Los Ionóforos permiten la visualización de
puede ser dirigida por otra favorable 375 los cambios de concentración del calcio 408
J 4.1.2 El ATP es la divisa universal de energía libre en 15.3.2 El Calcio activa a la Calmodulina,
los sistemas biológicos 376 una proteína reguladora que estimula a muchos enzimas
14.1.3 La hidrólisis del ATP dirige el metabolismo mediante y transportadores 410
el desplazamiento del equilibrio de las reacciones acopladas 377 15.4 Algunos receptores se dimerizan en respuesta a la
· 14. 1 .4 Bases estructurales del elevado potencial de unión con el ligando y expresan la señal mediante
trasferencia de grupos fosforilo del ATP 378 fosforilación cruzada 411
­­­,xxviiir ÍNDICE

15.4.l Algunos receptores contienen dominios tirosina 16.2 La vía glicolítica está rigurosamente controlada 443
quinasa dentro de sus estructuras covalentes 414 16.2.1 La fosfofructoquinasa es el enzima clave en
15.4.2 Ras, otro tipo de proteína G señalizadora 415 el control de la glicolisis 444
16.2.2 Un enzima bifuncional regulado sintetiza y
15.5 Los defectos en las vías de señalización pueden
degrada la fructosa 2,6-bisfosfato 445
conducir al cáncer u otras enfermedades 416
16.2.3 La hexoquinasa y la piruvato quinasa marcan
15.S. l Los inhibidares de la proteína quinasa pueden ser
también el ritmo de la glicolisis 447
fármacos anticancerosos eficaces 418
16.2.4 Una familia de transportadores posibilita la
15.5.2 El cólera y la tosferina se deben a una actividad
entrada y salida de glucosa en las células animales 448
alterada de la proteína G 418
16.2.5 Cáncer y glicolisis 449
15.6 Los aspectos recurrentes en las vías de
transducción revelan las relaciones evolutivas 419 16.3 La glucosa puede sintetizarse a partir de
precursores no carbohidratados 450

I CAPÍTULO16 Gllcollsls y gluconeogénesls 425 16.3.1 La gluconeogénesis no es la simple inversión


de la glicolisis 450
16.0. l La glucosa es un combustible importante para la
mayoría de los organismos 426 16.3.2 La conversión de piruvato a fosfoenolpiruvato
comienza con la formación de oxalacetato 452
16.0.2 Las fermentaciones suministran energía disponible
en ausencia de oxígeno 426 16.3.3 El oxalacetato se transporta al citosol y se
convierte en fosfoenolpiruvato 454
16.1 La glicolisis es una vía de conversión de energía 16.3.4 La conversión de fructosa 1,6-bisfosfato
en muchos organismos 428 en fructosa 6-fosfato y ortofosfato es un paso irreversible 454
16.1.1 La hexoquinasa retiene la glucosa en la célula y 16.3.5 La generación de glucosa libre es un
comienza la glicolisis 428 importante punto de control 455
16.1.2 La formación de fructosa 1,6-bisfosfato a partir de 16.3.6 En la síntesis de glucosa a partir de piruvato se
glucosa 6-fosfato 430 consumen seis grupos fosforilo de alto potencial de
16.1.3 La aldolasa escinde el azúcar de seis carbonos transferencia 455
en dos fragmentos de tres carbonos 431
16.4 La gluconeogénesis y la glicolisis se regulan
16.1.4 La triosa fosfato isomerasa recupera un fragmento
de forma recíproca 456
de tres carbonos 431
16.4.1 Los ciclos de sustrato amplifican las señales
16.1.5 Transformación de la energía: la fosforilación está
metabólicas y producen calor 457
acoplada a la oxidación del gliceraldehído 3-fosfato por
un intermediario tioéster 433 16.4.2 El lactato y la alanina formados en el músculo
contráctil se utiliza en otros órganos 458
16.1.6 Formación de ATP a partir de 1,3-bisfosfoglicerato 435
16.4.3 La glicolisis y la gluconeogénesis están
16.1.7 Generación de otro ATP y formación de piruvato 435
entrecruzadas evolutivamente 460
16.1.8 Rendimiento de energía de la conversión de
glucosa en piruvato 437
I CAPÍTULO17 El ciclo del ácido cítrico 465
17 .0.1 Una visión general del ciclo del ácido cítrico 466

17.1 El ciclo del ácido cítrico oxida unidades de dos


carbonos 467
17. l. l Formación de acetilcoenzirna A a partir de piruvato 467
17.1.2 Los enlaces flexibles permiten a la lipoamida
desplazarse entre distintos centros activos 470
17.1.3 La citrato sintasa produce citrato a partir
de oxalacetato y acetil-CoA 472
16.1.9 Mantenimiento del balance redox: los diversos 17 .1.4 El citrato se isomeriza a isocitrato 473
destinos del piruvato 438 17 .1.5 El isocitrato se oxida y descarboxila hasta
16.1.10 El centro de unión del NAD+ es similar en o-cetoglutarato 474
muchas deshidrogenasas 440 17 .1.6 Por la descarboxilación oxidativa del
16.1.11 Entrada de la fructosa y la galactosa en o-cetoglutarato se forma succinil-coenzirna A 475
la glicolisis 440 17.1.7 A partir del succinil-coenzima A se genera un
16.1.12 Muchos adultos son intolerantes a la leche compuesto con alto potencial de transferencia de grupos
porque son deficientes en lactasa 442 fosfato 475
16.1.13 Cuando falta la transferasa la galactosa resulta 17 .1.8 El oxalacetato se regenera por oxidación
muy tóxica 443 del succinato 477
Índice ­­­­1 xxix r-
17.1.9 Estequiometría del ciclo del ácido cítrico 478 l 8.3.2 El ubiquinol es el punto de entrada para los
electrones procedentes del FADH2 de las flavoproteínas 501
17.2 La entrada en el ciclo del ácido cítrico y sus
18.3.3 Los electrones fluyen desde el ubiquinol al
reacciones están controladas 480
citocrorno e a través de la Q-citocromo e oxidorreductasa 501
17 .2.1 El complejo piruvato deshidrogenasa se regula
l8.3.4 Transporte de protones a través de la membrana:
alostéricamente mediante fosforilación reversible 480
el ciclo Q 502
17 .2.2 El ciclo del ácido cítrico está controlado en varios
18.3.5 La citocromo e oxidasa cataliza la reducción del
puntos 481 oxígeno molecular a agua 503
17.3 El ciclo del ácido cítrico es una fuente de J 8.3.6 Los derivados tóxicos del oxígeno molecular como
precursores biosintéticos 482 el radical superóxido son neutralizados mediante enzimas
17 .3. J El ciclo del ácido cítrico debe ser capaz de protectores 506
reponerse con rapidez 482 18.3.7 La conformación del citocromo e ha permanecido
17 .3.2 La interrumpción del metabolismo del piruvato es prácticamente constante durante más de mil millones de años 507
la causa del beriberi y del envenenamiento por mercurio 18.4 Un gradiente de protones impulsa la síntesis
y arsénico 483 de ATP 507
l7.3.3 Especulaciones relativas a la historia evolutiva 18.4.1 La ATP sintasa está formada por una unidad
del ciclo del ácido cítrico 484 transportadora de protones y una unidad catalítica 509

17.4 El ciclo del glioxilato permite a las plantas y 18.4.2 El flujo de protones a través de la ATP sintasa
bacterias crecer en acetato 484 provoca la liberación del ATP fuertemente unido:
el mecanismo de cambio de unión 509
18.4.3 El motor molecular más pequeño del mundo:
I CAPÍTULO 18 Fosforilación oxidativa 491 catálisis rotacional 5 ll
18.1 En eucariotas, la fosforilación oxidativa tiene 18.4.4 El flujo de protones alrededor del anillo e impulsa
lugar en las mitocondrias 492 la síntesis de ATP 511
18. l. l Las mitocondrias están rodeadas por una doble 18.4.5 La ATP sintasa y las proteínas G tienen varias
membrana 492 características comunes 513
18.1.2 Las mitocondrias son el resultado de una 18.5 Diversas lanzaderas permiten atravesar las
endosimbiosis 493 membranas mitocondriales 514
18.5.1 Los electrones del NADH citosólico entran en las
18.2 La fosforilación oxidativa requiere la mitocondrias mediante lanzaderas 514
transferencia de electrones 494
18.5.2 La entrada del ADP a las mitocondrias está acoplada
18.2.1 Electrones de alta energía: potenciales redox a la salida de ATP gracias. a la ATP-ADP translocasa 515
y cambios de la energía libre 494
18.5.3 En las mitocondrias, los transportadores de
18.2.2 Una diferencia de potencial de 1,14 voltios entre metabolitos presentan un motivo tripartito común 516
el NADH y el 02 impulsa el transporte de electrones
a través de la cadena y permite la formación de 18.6 La fosforilación oxidativa está regulada, en
un gradiente de protones 496 primera instancia, por las necesidades de ATP 517
18.2.3 Puede haber transferencia de electrones entre 18.6. l La oxidación completa de la glucosa origina
grupos que no están en contacto 497 aproximadamente 30 moléculas de ATP 517

18.3 La cadena respiratoria está formada por cuatro 18.6.2 La velocidad de la fosforilación oxidativa está
complejos: tres bombas de protones y una conexión determinada por las necesidades de ATP 518
física con el ciclo del ácido cítrico 498 18.6.3 La fosforilación oxidativa se puede inhibir en
muchas de sus etapas 519
18.6.4 El desacoplamiento regulado provoca la
generación de calor 519
18.6.5 Se están descubriendo enfermedades mitocondriales 520
18.6.6 La mitocondrias desempeñan un papel clave en la
apoptosis 521
18.6.7 Transmisión de energía mediante gradientes de
protones: un concepto clave en la Bioenergética 521

CAPÍTULO19 Las reacciones de la fase


luminosa de la fotosíntesis 527
19.0.1 Una visión general de la fotosíntesis 528
18.3.1 Los electrones de alto potencial del NADH entran
en la cadena respiratoria por la NADH-Q oxidorreductasa 499 19.1 La fotosíntesis tiene lugar en los cloroplastos 528
~ XXX 1­­ ÍNDICE

19.1. l Los procesos iniciales de la fotosíntesis tienen 20. l.3 A partir del fosfoglicerato se obtienen hexosas
lugar en las membranas tilacoidales 529 fosfato y se regenera la ribulosa 1,5-bisfosfato 556
19.l.2 Evolución de los cloroplastos 529 20.l.4 Para conducir el dióxido de carbono al nivel de
una hexosa se utilizan tres moléculas de ATP y dos
19.2 La absorción de la luz por la clorofila induce la moléculas de NADPH 559
transferencia de electrones 529
20. l.5 El almidón y la sacarosa son los principales
19.2.1 Los centros de reacción fotosintéticos de las plantas carbohidratos almacenados en las plantas 559
verdes y de las bacterias fotosintetizantes tienen un núcleo
común 531 20.2 La actividad del ciclo de calvin depende de las
19.2.2 Un par especial de clorofilas inicia la separación condiciones ambientales 560
de cargas 532 20.2.l La rubisco se activa mediante los cambios en las
concentraciones de protones e ion magnesio inducidos
19.3 En la fotosíntesis productora de oxígeno, por la luz 560
dos fotosistemas generan un gradiente de protones
20.2.2 La tiorredoxina desempeña un papel clave en la
y NADPH 533
regulación del ciclo de Calvin 560
19.3.1 El fotosistema II transfiere electrones del agua a la
plastoquinona y genera un gradiente de protones 534
19.3.2 El fotosistema Il y el fotosistema I están
conectados mediante el citocromo bf 536
19.3.3 El fotosistema I utiliza la energía de la luz para
generar ferredoxina reducida, un potente reductor 537
19.3.4 La ferredoxina-Né.Dl'" reductasa convierte
el NADP+ en NADPH 539

19.4 El gradiente de protones a través de la membrana


tilacoidal conduce la síntesis de ATP 540
19 .4.1 La ATP sin tasa de los cloroplastos se parece mucho
a la mitocondrial y a la procariótica 540
19.4.2 El flujo cíclico a través del fotosistema Ida lugar
a la producción de ATP en vez de NADPH 541 20.2.3 La vía C4 de las plantas tropicales acelera la
19.4.3 La absorción de ocho fotones produce una fotosíntesis al concentrar el dióxido de carbono 561
molécula de 02, dos moléculas de NADPH y tres de ATP 542
20.2.4 El metabolismo ácido de las crasulaceas les
19.5 Los pigmentos auxiliares canalizan la energía permite crecer en ecosistemas áridos 562
hacia los centros dé reacción 543
20.3 La vía de las pentosas fosfato genera NADPH
19.5.l La transferencia de energía por resonancia permite y sintetiza azúcares de cinco carbonos 563
que ésta se desplace del lugar inicial de absorción
al centro de reacción 543 20.3.l En la conversión de glucosa 6-fosfato en ribulosa
5-fosfato se generan dos moléculas de NADPH 564
19.5.2 Los complejos captadores de luz contienen
clorofilas y carotenoides auxiliares 544 20.3.2 La vía de las pentosas fosfato y la glicolisis están
relacionadas por la transcetolasa y la transaldolasa 564
19.5.3 Los ficobilisomas sirven de conductores moleculares
para la luz en las cianobacterias y las algas rojas 545 20.3.3 La transcetolasa y la transaldolasa estabilizan
intermediarios carbaniónicos mediante mecanismos
19.5.4 Los componentes de la fotosíntesis están muy
distintos 566
organizados 546
19.5.5 Muchos herbicidas inhiben las reacciones de la fase 20.4 El metabolismo de la glucosa 6-fosfato a través
luminosa de la fotosíntesis 546 de la vía de las pentosas fosfato está relacionado
con la glicolisis 568
19.6 La capacidad de transformar la energía luminosa
en energía química es muy antigua 547 20.4.1 La actividad de la vía de las pentosas fosfato está
controlada por el nivel de NADP+ 568
20.4.2 El flujo de glucosa 6-fosfato depende de las
CAPÍTULO 20 El ciclo de Calvin y la vía de las necesidades de NADPH, ribosa 5-fosfato y ATP 568
pentosas fosfato 551 20.4.3 Otra visión: el ciclo del Calvin y la vía de
las pentosas fosfato 571
20.1 El ciclo de calvin sintetiza hexosas a partir de
dióxido de carbono y agua 552 20.5 La glucosa 6-fosfato deshidrogenasa tiene un
20.1.l El dióxido de carbono reacciona con la ribulosa papel clave en la protección frente a las especies
1,5-bisfosfato para formar dos moléculas de 3-fosfoglicerato 553 reactivas del oxígeno 571
20.1.2 Una imperfección catalítica: La rubisco también 20.5.1 La deficiencia en glucosa 6-fosfato deshidrogenasa
cataliza una reacción oxigenasa inútil 555 origina un tipo de anemia hemolítica inducida por fármacos 571
Índice ­­i xxxi r-
20.5.2 En ocasiones una deficiencia de glucosa 6-fosfato 21.5 La degradación y síntesis del glucógeno se
deshidrogenasa puede ser una ventaja evolutiva 572 regulan recíprocamente 592
21.5.1 La proteína fosfatasa I invierte los efectos reguladores
de las quinasas en el metabolismo del glucógeno 592
CAPÍTULO21 Metabolismo del glucógeno 577 21.5.2 La insulina estimula la síntesis del glucógeno
al activar la proteína fosfatasa 1 593
21.0.1 Una visión general del metabolismo del glucógeno 578
21.5.3 El metabolismo del glucógeno en el higado regula
21.1 La degradación del glucógeno requiere el nivel de glucosa en sangre 594
la intervención de varios enzimas 579 21.5.4 Las enfermedades del almacenamiento de
21.1.l La fosforilasa cataliza la escisión fosforolítica del glucógeno pueden entenderse en términos bioquímicos 595
glucógeno para dar glucosa l-fosfato 579
21. 1.2 Para la degradación del glucógeno se necesita
también un enzima desramificante 580 CAPÍTULO22 Metabolismo de los ácidos grasos 601
21.1.3 La fosfoglucomutasa convierte la glucosa l-fosfato 22.0.1 Una visión general del metabolismo de los
en glucosa 6-fosfato 581 ácidos grasos 601
21.1.4 El hígado contiene glucosa 6-fosfatasa, un enzima 22.1 Los triacilgliceroles son depósitos de energía
hidrolítico ausente en el músculo 581 muy concentrada 603
21.1.5 El piridoxal fosfato participa en la escisión 22.1. l Los lípidos de la dieta se digieren mediante
fosforolítica del glucógeno 582 las lipasas pancreáticas 603
22.1.2 Los lípidos de la dieta se transportan en los
21.2 La fosforilasa se regula por interacciones
qui lomicrones 604
alostéricas y fosforilación reversible 583
22.2- La utilización de los ácidos grasos como
combustible requiere tres etapas de procesamiento 605
• 1
ATP ADP 22.2.l Lasr.~asas reguladas por AMP cíclico hidrolizan
~ a los tri~ilgliceroles 605
22.2.2 tos ácidos grasos se unen al coenzima A antes
de oxidarse 606
22.2.3 La carnitina transporta los ácidos grasos de cadena
larga activados hasta la matriz m.itocondrial 607
21.2.l La fosforilasa de músculo se regula por la carga 22.2.4 En cada vuelta de la oxidación de los ácidos grasos
energética intracelular 583 se genera acetil-CcA, NADH y FADH2 607
21.2.2 La fosforilasa de hígado genera glucosa para su 22.2.5 La oxidación completa del palmitato rinde 106
uso en otros tejidos 585 moléculas de ATP 609
21.2.3 La fosforilasa quinasa se activa por fosforilación 22.3 Ciertos ácidos grasos requieren etapas
y por los iones calcio 586 adicionales para su degradación 610
21.3 La adrenalina y el glucagón son señales para la 22.3.1 Para la oxidación de los ácidos grasos insaturados
degradación del glucógeno 586 se requieren una isomerasa y una reductasa 61 O
21.3. l Las proteínas G transmiten la señal para el inicio 22.3.2 Los ácidos grasos de cadena impar producen
de la degradación del glucógeno 586 propionilcoenzima A en la tiolisis de la etapa final 611
22.3.3 El propionil-CoA se convierte en suécinil-CoA en
21.3.2 La degradación del glucógeno debe poderse
una reacción que requiere vitamina 812 611
desactivar rápidamente 588
22.3.4 Los ácidos grasos también se oxidan en los
21.3.3 La regulación de la glucógeno fosforilasa se hizo
peroxisornas 614
más compleja a medida que el enzima evolucionó 588
22.3.5 Si predomina la degradación de las grasas, a partir
21.4 El glucógeno se sintetiza y degrada por vías del acetil-coenzirna A se forman cuerpos cetónicos 615
diferentes 589 22.3.6 Los cuerpos cetónicos son un combustible
21.4.J La UDP-glucosa es una forma activada de importante en ciertos tejidos 616
la glucosa 589 22.3.7 Los animales no pueden convertir los ácidos
21.4.2 La glucógeno sintasa cataliza la transferencia de grasos en glucosa 617
glucosa desde UDP-glucosa a una cadena en crecimiento 589 22.4 Los ácidos grasos se sintetizan y degradan por
21.4.3 Un enzima ramificante forma los enlaces cx-J,6 590 vías diferentes 617
21.4.4 La glucógeno sintasa es el enzima regulador clave 22.4.1 La formación de malonil-coenzima A es la etapa
en la síntesis de glucógeno 591 limitante en la síntesis de ácidos grasos 617
21.4.5 El glucógeno es una forma muy eficiente de 22.4.2 Los intermediarios en la síntesis de los ácidos grasos
almacenamiento de glucosa 591 están unidos a una proteína portadora de acilos 618
­­hxxii~ ÍNDICE

22.4.3 El ciclo de elongación en la síntesis de los ácidos 23.4 El ion amonio se convierte en urea en la mayoría
grasos 618 de los vertebrados terrestres 644
22.4.4 En los eucariotas los ácidos grasos son sintetizados 23.4.1 El ciclo de la urea comienza con la formación de
por un complejo enzimático multifuncional 620 carbamilfosfato 645
22.4.5 La unidad flexible de fosfopanteteína de la ACP 23.4.2 El ciclo de la urea está ligado al ciclo del ácido cítrico 646
transporta el sustrato de un centro activo a otro 621 23.4.3 Evolución del ciclo de la urea 646
22.4.6 Estequiometría de la síntesis de ácidos grasos 622 23.4.4 Defectos hereditarios del ciclo de la urea producen
22.4.7 El citrato transporta grupos acetilo desde la hiperamonernia y pueden ocasionar lesiones cerebrales 647
mitocondria hasta el citosol para la síntesis de ácidos 23.4.5 La urea no es la única manera de deshacerse del
grasos 622 exceso de nitrógeno 648
22.4.8 Fuentes de NADPH para la síntesis de ácidos grasos 623
23.5 Los átomos de carbono de los aminoácidos
22.4.9 Los inhibidores de la ácido graso sintetasa pueden degradados aparecen en los principales
ser fármacos útiles 623 intermediarios metabólicos 649
22.4.1 O Variaciones sobre un tema: la sintetasa de 23.5.1 El piruvato como punto de entrada al metabolismo 650
poliquétidos y la sintetasa no ribosómica de péptidos se
parecen a la ácido graso sintetasa 624 23.5.2 El oxalacetato como punto de entrada al metabolismo 650
23.5.3 El o-cetcglutarato como punto de entrada al
22.5 La acetilcoenzima a carboxilasa ejerce una función metabolismo 651
clave en el control del metabolismo de los ácidos grasos 624
23.5.4 El succinil-coenzirna A es un punto de entrada
22.6 La elongación y la insaturación de los ácidos para varios aminoácidos no polares 652
grasos se realizan por sistemas enzimáticos accesorios 626 23.5.5 La degradación de la metionina requiere la formación
22.6.1 Los enzimas unidos a la membrana generan de un donante de metilos, la S-adenosilmetionina 652
ácidos grasos insaturados 626 23.5.6 Los aminoácidos de cadena ramificada originan
22.6.2 Las hormonas eicosanoideas derivan de ácidos acetil- CoA, acetacetato y propionil-CoA 652
grasos poliinsaturados 626 23.5.7 Para la degradación de los aminoácidos aromáticos
se requieren oxigenasas 654
23.6 Los errores innatos del metabolismo pueden
CAPÍTULO 23 Recambio de las proteínas y alterar la degradación de los aminoácidos 655
catabolismo de los aminoácidos 633
23.1 Las proteínas se degradan a aminoácidos 634
23.1.1 Digestión y absorción de las proteínas de la dieta 634 PARTE III SÍNTESIS DE LAS MOLÉCULAS
23.1.2 Las proteínas celulares se degradan a velocidades DE LA VIDA
diferentes 634
23.2 El recambio proteico está muy regulado 635
23.2.1 La ubiquitina etiqueta a las proteínas para su
I CAPÍTULO 24 Biosíntesis de aminoácidos 665
destrucción 635 24.0.1 Una visión de conjunto de la síntesis de aminoácidos 666
23.2.2 El proteasoma digiere las proteínas marcadas con 24.1 Fijación del nitrógeno: los microorganismos utilizan
ubiquitina 636 ATP y un potente reductor para reducir el nitrógeno
23.2.3 La degradación de las proteínas puede utilizarse atmosférico a amoniaco 666
para regular funciones biológicas 638 24.1.1 El cofactor hierro-molibdeno de la nitrogenasa se
23.2.4 La vía de la ubiquitina y el proteasoma tiene sus une al nitrógeno atmosférico y lo reduce 667
correspondientes procarióticos 638 24.1.2 El ion amonio se incorpora a los aminoácidos a
23.3 La primera etapa de la degradación de través de glutamato y de glutarnina 668
aminoácidos es la eliminación del nitrógeno 639 24.2 Los aminoácidos se construyen a partir de
23.3.l Los grupos a-amino se convierten en ión amonio intermediarios del ciclo del ácido cítrico y de
por desaminación oxidativa del glutamato 639 otras vías importantes 670
23.3.2 En las aminotransferasas, el piridoxal fosfato 24.2.l Los seres humanos pueden sintetizar algunos
forma bases de Schiff intermediarias 640 aminoácidos pero deben obtener el resto a partir de
23.3.3 La aspartato aminotransferasa es miembro de la dieta 671
una familia grande y versátil de enzimas dependientes 24.2.2 La quiralidad se establece en una etapa común
de piridoxal 642 a todos los aminoácidos 671
23.3.4 La serina y la treonina pueden desaminarse 24.2.3 Para formar asparragina a partir de aspartato
directamente 643 se necesita un intermediario adenilado 673
23.3.5 Los tejidos periféricos transportan el nitrógeno al 24.2.4 El glutamato es el precursor de la glutarnina,
hígado 643 prolina y arginina 673
25.1.4 El orotato incorpora un anillo de ribosa procedente
del PRPP para formar un nucleótido pirimidínico que se
convierte en uridilato 696
25.1.5 Los nucleótidos mono-, di- y trifosfato son
interconvertibles 697
25. L.6 La CTP se forma por arninación de UTP 697

25.2 Las bases púricas se pueden sintetizar de novo o


reciclar mediante vías de rescate 698

24.2.5 La serina, la cisteína y la glicina se forman a partir


del 3-fosfoglicerato 674
24.2.6 El tetrahidrofolato transporta fragmentos
monocarbonados activados con diversos grados
de oxidación 674
24.2.7 La S-adenosilmetionina es el principal donador
de grupos metilo 676
24.2.8 La cisteína se sintetiza a partir de serina
y homocisteína 678
24.2.9 Un nivel elevado de homocisteína está relacionado
con enfermedades vasculares 678
24.2.1 O El siquimato y el corismato son intermediarios
en la biosíntesis de aminoácidos aromáticos 678
24.2.11 La triptófano sintetasa ilustra la canalización de
sustratos durante la catálisis enzimática 681
24.3 La biosíntesis de aminoácidos está regulada por
retroinhibición 681
24.3.1 Las vías ramificadas requieren una regulación
compleja 682 25.2.1 Las vías de recuperación disminuyen el gasto de
energía intracelular 698
24.3.2 La actividad de la glutarnina sintetasa está
modulada por una cascada enzimática 684 25.2.2 El sistema de anillos de la purina se ensambla
sobre la ribosa fosfato 698
24.4 Los aminoácidos son los precursores de muchas
25.2.3 El anillo de purina se ensambla mediante sucesivas
biomoléculas 685
etapas de activación por fosforilación y sustitución 699
24.4.1 El glutatión, un -y-glutarnil-péptido, actúa como
25.2.4 El AMP y el GMP se forman a partir de IMP 701
amortiguador de sulfhidrilos y como antioxidante 686
24.4.2 El óxido nítrico, una molécula señal de vida 25.3 Los desoxirribonucleótidos se sintetizan por
media muy breve, se forma a partir de la arginina 686 reducción de ribonucleótidos mediante un mecanismo
24.4.3 Las porfirinas de mamíferos se sintetizan a en el que intervienen radicales 702
partir de glicina y succinil-Coenzima A 687 25.3.1 El tirnidilato se forma por metilación del
24.4.4 Algunos trastornos congénitos del metabolismo desoxiuridilato 704
de las porfirinas provocan su acumulación 688 25.3.2 La dihidrofolato reductasa cataliza la regeneración
del tetrahidrofolato, un transportador de fragmentos
I CAPÍTULO25 Biosíntesis de nucleótidos 693 monocarbonados 705
25.0.1 Visión de conjunto de la biosíntesis de nucleótidos 25.3.3 Ciertos fármacos anticancerígenos de gran eficacia
y su nomenclatura 694 bloquean la síntesis de tirnidilato 705

25.1 En la síntesis de novo, el anillo de pirimidina se 25.4 Las etapas clave de la biosíntesis de nucleótidos
construye a partir de bicarbonato, aspartato y se regulan mediante retroinhibición 707
glutamina 694
25.5 NAO+, FAD y coenzima a se forman a partir
25.1.1 El bicarbonato y otros compuestos de carbono del ATP 708
oxigenados se activan por fosforilación 695
25.1.2 La cadena lateral de la glutamina se puede 25.6 Alteraciones del metabolismo de los nucleótidos
hidrolizar para generar amoniaco 695 pueden provocar situaciones patológicas 709
25.1.3 Los intermediarios se pueden desplazar entre los 25.6.1 En los seres humanos, las purinas se degradan
centros activos por canalización 696 a urato 709
--jxxxivt- ÍNDICE

25.6.2 El síndrome de Lesch-Nyhan es una consecuencia 26.4.7 La vitamina D deriva del colesterol por la acción de la
dramática de mutaciones en un enzima de las vías de luz que rompe uno de sus anillos 737
recuperación 71 O 26.4.8 El isopentilpirofosfato es precursor de una amplia
variedad de biomoléculas 738

CAPÍTULO 26 Blosíntesis de lípidos de


membrana y de esteroides 71 S CAPÍTULO 27 Replicación, recombinación y
26.1 El fosfatidato es un intermediario común en reparación del DNA 745
la síntesis de fosfolípidos y triacilgliceroles 716
27.1 El DNA puede adoptar diversas formas estructurales 745
26.1.1 La síntesis de fosfolípidos requiere un
27.1.1 El DNA-A es una doble hélice con características
intermediario activado 716 diferentes de las del DNA-B, la forma más frecuente 747
26.1.2 Los plasmalógenos y otros eterfosfolípidos 27.1.2 Los surcos mayor y menor están recubiertos por
se sintetizan a partir de dihidroxiacetona fosfato 718 grupos capaces de formar puentes de hidrógeno específicos
26. 1.3 Los esfingolípidos se sintetizan a partir de un cerámido 720 de la secuencia 748
26.1.4 Los gangliósidos son esfingolípidos ricos en 27.1.3 Los resultados de estudios de cristales de moléculas
carbohidratos que contienen azúcares ácidos 721 idénticas de DNA han puesto de manifiesto variaciones
26.1.5 Los esfingolípidos confieren diversidad a la locales en la estructura del DNA 748
estructura y función de los lípidos 721 27.1.4 El DNA-Z es una doble hélice levógira en la que
26.1.6 El síndrome de la dificultad respiratoria y la los fosfatos del esqueleto se disponen en forma de zigzag. 749
enfermedad de Tay-Sachs son resultado de trastornos del 27.2 Las DNA polimerasas necesitan un molde y un
metabolismo lipídico 72 l cebador 750
26.2 El colesterol se sintetiza a partir de
acetilcoenzima a en tres etapas 722
26.2.1 La síntesis de mevalonato, que se activa a
isopentilpirofosfato, inicia la síntesis del colesterol 723
26.2.2 El escualeno (C30) se sintetiza a partir de seis
moléculas de isopentilpirofosfato (C5) 725
26.2.3 El escualeno se cicla para formar colesterol 725
26.3 La compleja regulación de la biosíntesis de
colesterol tiene lugar a varios niveles 726
26.3.1 Las lipoproteínas transportan colesterol y
triacilgliceroles por todo el organismo 727
27.2.l Todas las DNA polimerasas presentan
26.3.2 Las concentraciones sanguíneas de ciertas características estructurales comunes 750
lipoproteínas pueden ser útiles para el diagnóstico 728
27.2.2 En la reacción de la polimerasa intervienen
26.3.3 Las Jipoproteínas de baja densidad desempeñan un dos iones metálicos unidos 751
papel clave en el metabolismo del colesterol 728 27.2.3 La especificidad de la replicación está determinada
26.3.4 El receptor de LDL es una proteína transmembranal por la formación de puentes de hidrógeno y por la
con cinco regiones funcionales diferentes 730 complementariedad de formas entre las bases 751
26.3.5 La carencia del receptor de LDL origina 27.2.4 Muchas polimerasas corrigen las bases recién
hipercolesterolemia y aterosclerosis 730 añadidas y eliminan los errores 752
26.3.6 El mantenimiento clínico de las concentraciones de 27.2.5 La separación de las hebras de DNA requiere
colesterol puede comprenderse a nivel bioquímico 731 helicasas específicas y la hidrólisis de ATP 753
26.4 Entre los derivados importantes del colesterol se 27.3 El DNA de doble hebra se puede enrollar sobre sí
incluyen las sales biliares y las hormonas esteroideas 731 mismo para formar estructuras superenrolladas 754
26.4.1 Nomenclatura de las hormonas esteroideas 733 27.3.l El número de enlace del DNA, una propiedad
26.4.2 Los esteroides se hidroxilan mediante las citocromo topológica, determina el grado de superenrollamiento 754
P450 monooxigenasas que utilizan NADPH y 02 734 27.3.2 El número de giros completos de la hélice y el
26.4.3 El sistema citocromo P450 es general y realiza una grado de torsión de la superhélice están relacionados
función de protección 735 entre sí mediante el número de enlace 755
26.4.4 La pregnenolona, un precursor de otros muchos 27.3.3 Las topoisomerasas de tipo I relajan estructuras
esteroides, se forma a partir del colesterol por ruptura de superenrolladas 756
su cadena lateral 735 27.3.4 Las topoisomerasas de tipo II pueden introducir
26.4.5 Síntesis de la progesterona y de los corticosteroides superenrollamientos negativos por medio del acoplamiento
a partir de la pregnenolona 735 a la hidrólisis del ATP 757
26.4.6 Síntesis de los andrógenos y de los estrógenos a 27.4 La replicación de las dos hebras del DNA tiene lugar
partir de pregnenolona 736 rápidamente a partir de lugares específicos de iniciación 759
Índice --ixxxvf--
27.4.1 La primerasa sintetiza un cebador que permite el 28.1.7 La proteína ro ayuda a finalizar la transcripción
comienzo de la síntesis del DNA 760 de algunos genes 789
27.4.2 Una de las hebras del DNA se sintetiza de forma 28.1.8 Los precursores del RNA de transferencia y
continua mientras que la otra se sintetiza a base de fragmentos 761 ribosómico sufren hidrólisis y modificaciones químicas
27.4.3 La DNA ligasa une los extremos del DNA en después de la transcripción 790
regiones de doble hebra 761 28.1.9 Antibióticos inhibidores de la transcripción 791
27.4.4 La replicación del DNA requiere polimerasas con 28.2 En eucariotas, la transcripción y la traducción
un elevado nivel de progresividad 762 están separadas en el espacio y en el tiempo 792
27.4.5 Las hebras guía y retardada se sintetizan de forma 28.2.1 En los eucariotas, el RNA se sintetiza mediante
coordinada 763 tres tipos de RNA polimerasas 793
27.4.6 La síntesis de DNA es más compleja en eucariotas 28.2.2 Elementos que actúan en cis y en trans: Bloqueos
que en procariotas 764 y llaves de la transcripción 794
27.4.7 Los telómeros son estructuras características de los 28.2.3 La mayoría de los promotores de la RNA
extremos de cromosomas lineales 765 polimerasa II presentan un compartimiento TATA ("TATA
27.4.8 Los telómeros se replican mediante la telomerasa, box") próximo a la secuencia de inicio de la transcripción 794
una polimerasa especializada que lleva su propio molde 28.2.4 La proteína que se une al compartimiento TATA
de RNA 765 inicia el ensamblado del complejo de transcripción activo 795
27.5 A veces, moléculas de DNA de doble hebra con 28.2.5 Con los promotores de eucariotas interaccionan
secuencias parecidas se recombinan 766 múltiples factores de transcripción 796
27.5.1 Las reacciones de recombinación se realizan a 28.2.6 Las secuencias potenciadoras pueden estimular la
través de intermediarios con uniones de Holliday 766 transcripción de secuencias con inicio a miles de bases de
27.5.2 Las recombinasas están relacionadas distancia 797
evolutivamente con las topoisomerasas 768 28.3 Los productos de la transcripción de las tres
27.6 Las mutaciones implican cambios en la secuencia polimerasas de eucariotas deben procesarse 797
de bases del DNA 768 28.3.1 En los extremos del transcrito pre-mRNA se sitúa
27.6.1 Algunos mutágenos químicos son bastante específicos 769 una cofia en 5' y una cola poli(A) en 3' 798
27.6.2 La luz ultravioleta produce dímeros de pirimidina 770 28.3.2 La modificación post-transcripcional del RNA
modifica las proteínas codificadas por el mRNA 798
27.6.3 Se utiliza toda una gama de vías de reparación
del DNA 770 28.3.3 Los puntos de corte y empalme de los precursores
de mRNA se especifican mediante secuencias situadas
27.6.4 En el DNA, la presencia de tirnina en lugar de en los extremos de los intrones 799
uracilo permite la reparación de las citosinas desaminadas 771
28.3.4 El empalme consiste en dos reacciones de
27 .6.5 Muchos tipos de cáncer se deben a una reparación transesterificación 800
defectuosa del DNA 772
28.3.5 Los RNAs nucleares pequeños (snRNAs) de los
27.6.6 Algunas enfermedades genéticas se deben a la espliceosomas catalizan el empalmado de los precursores
expansión de repeticiones de tres nucleótidos 773 del mRNA 801
27.6.7 Muchos carcinógenos potenciales se pueden 28.3.6 Algunas moléculas de pre-mRNA pueden sufrir empalmes
detectar a partir de su acción rnutagénica en bacterias 773
según vías alternativas y producir mRNAs diferentes 803

28.4 El descubrimiento del RNA catalítico resultó


CAPÍTULO 28 Síntesis y Maduración del RNA 781 revelador tanto desde el punto de vista del mecanismo
como de la evolución 804
28.0.1 Una visión general de la síntesis del RNA 782

28.1 La transcripción está catalizada por la RNA


polimerasa 783
I CAPÍTULO 29 Síntesis de proteínas 813

28.1.1 La transcripción comienza en las secuencias 29.1 La síntesis proteica requiere la traducción de
promotoras del molde de DNA 784 secuencias de nucleótidos a secuencias de aminoácidos 814
28.1.2 La subunidad sigma de la RNA polimerasa 29.1.1 La síntesis de proteínas largas requiere una
reconoce a las secuencias promotoras 785 frecuencia de error pequeña 814
28.1.3 Para que tenga lugar la transcripción la RNA 29.1.2 Las moléculas de RNA de transferencia tienen un
polimerasa debe desenrollar la doble hélice del molde 786 diseño común 815
28.1.4 Las cadenas de RNA se forman de novo y crecen 29. l.3 El aminoácido activado y el anticodón del tRNA están
en el sentido de 5' a 3' 786 en los extremos opuestos de la molécula con forma de L 817

28.1.5 La elongación tiene lugar en burbujas de transcripción 29.2 Las aminoacil-tRNA sintetasas interpretan el
que se desplazan a lo largo del molde de DNA 787 código genético 817
28.1.6 Una horquilla de RNA seguida por varios residuos de 29.2.l Los aminoácidos se activan al comienzo por
uracilo determina el fin de la transcripción de algunos genes 788 adenilación 818
~xxxvif-- ÍNDICE

29.2.2 Las aminoacil-tRNA sintetasas tienen lugares de 29.5.1 Muchos antibióticos actúan por inhibición de
activación muy discriminativos para los aminoácidos 819 la síntesis proteica 838
29.2.3 La corrección de pruebas de las aminoacil-tRNA 29.5.2 La toxina de la difteria bloquea la síntesis de
sintetasas aumenta la fidelidad en la síntesis de las proteínas 820 proteínas en eucariotas al inhibir la translocación 839
29.2.4 Las sintetasas reconocen los lazos anticodón y los
tallos aceptores de las moléculas de RNA de transferencia 820
29.2.5 Las aminoacil-tRNA sintetasas pueden dividirse CAPÍTULO30 Integración del metabolismo 845
en dos clases 822 30.1 El metabolismo consta de vías metabólicas
29.3 Un ribosoma es una partícula ribonucleoproteica fuertemente interconectadas 845
(70S) formada por una subunidad pequeña (30S) 30. l. l Mecanismos frecuentes en la regulación metabólica 846
y otra grande (SOS) 823 30.1.2 Principales vías metabólicas y centros de control 847
30. l.3 Conexiones clave: glucosa 6-fosfato, piruvato y
acetil-CoA 849
30.2 Cada órgano tiene un perfil metabólico
característico 851
30.3 La toma de alimento y el ayuno inducen
cambios metabólicos 854
30.3.1 Las adaptaciones metabólicas al ayuno prolongado
reducen al mínimo la degradación de proteínas 856
30.3.2 Los desajustes metabólicos en la diabetes derivan de
una relativa deficiencia de insulina y exceso de glucagón 858
30.3.3 Homeostasis calórica: una forma de regular
29.3.1 Los RNAs ribosómicos (SS, 16S y 23S rRNAs) el peso corporal 859
desempeñan un papel fundamental en la síntesis de las 30.4 La selección de combustibles durante el ejercicio
proteínas 824 viene determinada por la intensidad y la duración
29.3.2 Las proteínas se sintetizan en la dirección del de la actividad 860
extremo amínico al carboxílico 826
30.5 El etanol altera el metabolismo energético
29.3.3 El RNA mensajero se traduce en la dirección del hígado 861
de 5' a 3' 826
29.3.4 La señal de partida es AUG (o GUG) precedida
por varias bases que se aparean con el rRNA de 16S 827 CAPÍTULO31 El control de la expresión génica 867
29.3.5 La síntesis de proteínas en las bacterias se inicia 31.1 En procariotas, las proteínas que se unen al DNA
con el formilmetionil-RNA de transferencia 828
lo hacen de forma específica a los lugares de
29.3.6 Los ribosomas tienen tres lugares de unión para regulación de los operones 868
los tRNAs conformados por las subunidades 30S y 70S 828
31.1.1 Un operón está formado por elementos de
29.3.7 Cuando se forma del enlace peptídico, la cadena regulación y por genes que codifican proteínas 869
polipeptídica en crecimiento se transfiere de un tRNA a otro 829 31.1.2 El operador lac tiene una secuencia de
29.3.8 Sólo las interacciones codón-anticodón determinan bases simétrica 870
el aminoácido que se incorpora 831
31. l.3 En ausencia de lactosa, la proteína represora lac
29.3.9 Algunas moléculas de RNA de transferencia se une al operador y bloquea la transcripción 870
reconocen más de un codón a causa del balanceo
31.1.4 La unión de ligandos puede provocar cambios
en el apareamiento de las bases 832 estructurales en proteínas reguladoras 871
29.4 Los factores proteicos desempeñan papeles clave 31.1.5 En procariotas, el operón es una unidad de
en la síntesis de las proteínas 833 regulación habitual 872
29.4.l El forrnilmetionil-tRNAf se coloca en el lugar P del 31.1.6 La transcripción se puede estimular mediante
ribosoma durante la formación del complejo de iniciación 70S 833 proteínas que establecen contactos con la RNA polimerasa 873
29.4.2 Los factores de elongación transportan los 31.1.7 El motivo hélice-giro-hélice es frecuente en
aminoacil-tRNAs al ribosoma 834 muchas proteínas procarióticas que se unen al DNA 873
29.4.3 La formación de un enlace peptídico va seguida de la 31.2 La mayor complejidad de los genomas eucarióticos
translocación, dependiente de GTP, de los tRNAs y el mRNA 834 requiere intrincados mecanismos de regulación génica 874
29.4.4 La síntesis de la proteína se termina por medio de 31.2.1 Los nucleosomas son complejos de DNA e histonas 875
factores de liberación que leen los codones stop 835
31.2.2 El DNA eucariótico se enrolla alrededor de
29.5 La síntesis de proteínas eucarióticas difiere de la las histonas para formar los nucleosomas 876
síntesis de proteínas procarióticas principalmente en la 31.2.3 El control de la expresión génica requiere la
iniciación de la traducción 837 reestructuración de la cromatina 877
Índice --jxxxviir-

31.2.4 Los intensificadores estimulan la transcripción al 32.2 El gusto es una combinación de sentidos que
perturbar la estructura de la cromatina 878 funcionan a través de diferentes mecanismos 903
31.2.5 La modificación del DNA puede alterar los patrones 32.2.1 La secuenciación del genoma humano ha permitido
de expresión génica 878 descubrir una gran familia de receptores 7TM para el
sabor amargo 904
31.3 La activación y la represión de la transcripción
están mediadas por interacciones proteína-proteína 879 32.2.2 Una familia de receptores 7TM responde a los
compuestos dulces 906
32.2.3 Los sabores salados se detectan inicialmente
por el paso de iones sodio a través de conductos iónicos 906
32.2.4 El sabor agrio procede de los efectos de los
hidrogeniones (ácidos) en los conductos 906
32.2.5 Umarni, el sabor del glutamato, se detecta por
una forma especializada de receptor de gutamato 907

31.3. J Los esteroides y otras moléculas hidrofóbicas


similares atraviesan la membrana y se unen a receptores
que se unen al DNA 879
31.3.2 Los receptores hormonales nucleares regulan la
transcripción mediante la incorporación de coactivadores
y correpresores al complejo de transcripción 881 32.3 Las moléculas fotorreceptoras del ojo detectan
la luz visible 907
31.3.3 Ciertos fármacos actúan sobre los receptores de
32.3.1 La rodopsina, un receptor 7TM especializado,
hormonas esteroideas 883
absorbe la luz visible 908
31.3.4 La estructura de la cromatina se modula mediante
32.3.2 La absorción de la luz induce una isomerización
modificaciones covalentes de las colas de las histonas 884
específica del 11-cis-retinal unido 909
31.3.5 Las desacetilasas de histonas contribuyen a
reprimir la transcripción 885 32.3.3 La disminución de los niveles de calcio, inducida
por la luz, coordina la recuperación 91 O
31.3.6 La unión de ligandos a receptores de la membrana puede
regular la transcripción mediante cascadas de fosforilación 886 32.3.4 La visión en color está mediada por tres receptores
de los conos, que son homólogos de la rodopsina 911
31.3.7 La estructura de la cromatina disminuye el tamaño
del genoma de una forma muy eficaz 887 32.3.5 Ciertas recombinaciones en los genes de los
pigmentos verde y rojo provocan la "ceguera a los colores" 912
31.4 La expresión génica se puede controlar a
niveles post-transcripcionales 887 32.4 La audición depende de la detección rápida de
31.4. l En procariotas, la atenuación es un mecanismo que estímulos mecánicos 913
regula la transcripción modulando la estructura secundaria 32.4.1 Las células auditivas emplean un haz conectado de
del RNA naciente 887 estereocilios para detectar movimientos muy pequeños 913
31.4.2 En animales, los genes relacionados con el 32.4.2 Se han identificado conductos mecanosensibles en
metabolismo del hierro se regulan a nivel de la traducción 888 Drosophila y en bacterias 914

32.S El tacto incluye la sensibilidad a la presión,


PARTE IV RESPUESTA A CAMBIOS temperatura y a otros factores 915
AMBIENTALES 32.5.1 Estudios sobre la capsaicina, el principio activo de
las guindillas, revelan la existencia de un receptor sensible
CAPÍTULO32 Sistemas sensoriales 897 a las altas temperaturas y otros estímulos dolorosos 915
32.5.2 Sistemas sensores sutiles detectan otros factores
32.1 El olfato detecta una amplia variedad de ambientales como el campo magnético terrestre 917
compuestos orgánicos 898
32.1.1 La capacidad olfativa está mediada por una familia
enorme de receptores con siete hélices transmembranales 899 I CAPÍTULO33 El sistema inmunitario 921
32.1.2 Las sustancias olorosas están codificadas por un 33.0.1 El sistema inmunitario se adapta utilizando los
mecanismo combinatorio 901 principios de la evolución 921
32. l.3 Imágenes por resonancia magnética funcional revelan 33.1 Los anticuerpos poseen dos unidades distintas:
regiones del cerebro que procesan información sensorial 902 una que se une al antígeno y otra efectora 922
­­.lxxxviii1-- ÍNDICE

33.2 El plegamiento de la inmunoglobulina está 33.6.2 Las enfermedades autoinmunitarias surgen a partir
formado por un armazón con estructura de de la generación de respuestas inmunitarias frente
sandwich beta que contiene bucles hipervariables 926 a antígenos propios 944
33.3 Los anticuerpos se unen a moléculas específicas 33.6.3 El sistema inmunitario desempeña un papel en la
por medio de sus bucles hipervariables 927 prevención del cáncer 945
33.3. l Los estudios de rayos X han puesto de manifiesto
cómo se unen los anticuerpos a los antígenos 927 I CAPÍTULO34 Motores moleculares 951
33.3.2 Los antígenos grandes se unen a los anticuerpos 34.1 La mayoría de las proteínas de los motores
por medio de numerosas interacciones 929 moleculares son miembros de la superfamilia de
las NTPasas con lazo P 951
33.4 La diversidad surge por los reordenamientos
de los genes 929 34.l.l Un motor proteico está formado por un núcleo
ATPasa y una estructura extendida 952
33.4.1 Los genes J (de empalme) y los genes O (diversidad)
aumentan la diversidad de anticuerpos 930 34.1.2 La unión e hidrólisis del ATP inducen cambios
conformacionales y de afinidad de unión en los motores
33.4.2 Mediante la asociación combinatoria y la mutación
proteicos 954
somática se pueden generar más de 108 anticuerpos distintos 931
33.4.3 La oligomerización de anticuerpos expresados en 34.2 Las miosinas se desplazan a lo largo de filamentos
la superficie de células B inmaduras desencadena de actina 956
la secreción de anticuerpos 932 34.2.1 El músculo es un complejo de miosina y actina 957
33.4.4 Gracias a la translocación de los genes V H se 34.2.2 La actina es un polímero polar, autoensamblante
forman distintos tipos de anticuerpos 933 y dinámico 958

33.5 Las proteínas del complejo principal de 34.2.3 Los movimientos de las proteínas motrices
histocompatibilidad exponen antígenos peptídicos en aisladas se pueden observar directamente 960
la superficie de las células para que los receptores 34.2.4 La Liberación de fosfato dispara al golpe de
de las células T los reconozcan 934 potencia de la miosina 960
33.5.1 Los péptidos presentados por las proteínas MHC 34.2.5 La longitud del brazo de palanca determina la
ocupan un profundo surco flanqueado por hélices alfa 935 velocidad del motor 962
33.5.2 Los receptores de las células T son proteínas 34.3 La quinesina y la dineína se desplazan a lo largo
parecidas a los anticuerpos que presentan regiones de los microtúbulos 962
variables y constantes 937
34.3.1 Los microtúbulos son polímeros cilíndricos huecos 963
33.5.3 El CD8 de las células T citotóxicas actúa de forma
34.3.2 El movimiento de la quinesina es muy progresivo 964
coordinada con los receptores de células T 937
34.3.3 Pequeños cambios estructurales pueden invertir
33.5.4 Las células T ayudantes (o auxiliares) estimulan a
la polaridad del motor 966
las células que presentan péptidos extraños unidos
a proteínas MHC de clase II 939 34.4 El movimiento bacteriano se genera mediante
33.5.5 Las células T ayudantes dependen del receptor de un motor rotativo 967
células T y de CD4 para reconocer péptidos extraños en 34.4.1 Las bacterias nadan mediante la rotación de sus flagelos 967
las células que presentan antígenos 940 34.4.2 La rotación de los flagelos bacterianos se genera
33.5.6 Las proteínas MHC son muy variadas 941 por un flujo de protones 968
33.5.7 Los virus de la inmunodeficiencia humana inutilizan 34.4.3 La quimiotaxis bacteriana depende de la inversión
el sistema inmunitario al destruir las células T ayudantes 942 de la rotación flagelar 969
33.6 Las respuestas inmunitarias frente a antígenos Apéndices Al
propios se anulan 943 Glosario Bl
33.6.1 En el timo, las células T se someten a una Respuestas a los problemas Cl
selección positiva y a una selección negativa 943 Índice alfabético DI
Preludio: la bioquímica y
.,,
_,
la revolución genómica ---1
e
r-
o
La enfermedad y el genoma. Los estudios sobre
el genoma humano están descubriendo los
orígenes de las enfermedades y otros misterios
bioquímicos. Los cromosomas humanos, a la
izquierda, contienen las moléculas de DNA que
constituyen el genoma humano. El patrón de
tinción sirve para identificar regiones específicas
de un cromosoma. A la derecha se representa un
diagrama del cromosoma 7 humano en el que la
banda q31.2 se señala mediante una flecha. Un
gen en esta región codifica una proteína cuya
disfunción es responsable de la fibrosis quística.
((izquierda) Alfred Pasieka/ Peter Arnold).]

GACTfCACTTCTAATGATGATTATGGGAGAACTGGAGCCTTCAGAGGGT
AAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTG
GATTATGCCTGGCACCATTAAAGAAAATATCTTTGGTGTTTCCTATGAT
GAATATAGATACAGAAGCGTCATCAAAGCATGCCAACTAGAAGAG ....
Esta cadena de letras A, C, G y Tes parte de una secuencia de DNA. Desde que
se desarrollaron por vez primera las técnicas bioquímicas para la secuenciación
del DNA, hace más de tres décadas, se ha secuenciado el genoma de docenas de
organismos, y muchas más secuencias están por venir. La información contenida
en estas secuencias de DNA promete arrojar luz sobre muchas fascinantes e im-
portantes preguntas. ¿Qué genes de Yibrio cholerae, la bacteria
que causa el cólera, la distinguen de sus parientes más benig- CONTENIDO
nos? ¿Cómo se controla el desarrollo de organismos complejos?
¿Cuáles son las relaciones evolutivas entre los distintos orga- 1.1 El DNA ilustra la relación entre forma y
nismos? función
Los estudios de secuenciación nos han conducido a un formi- 1.2 En la diversidad biológica subyace la
dable hito en la historia de la biología y, por supuesto, de la hu- unidad bioquímica
manidad. Se ha determinado, casi por completo, la secuencia de
todo el genoma humano. La cadena de Aes, Ces, Ges y Tes con 1.3 Los enlaces químicos en bioquímica
la cual comenzarnos este libro es una parte diminuta de la se- 1.4 La bioquímica y la biología humana
cuencia del genoma humano, que tiene más de 3 mil millones de
letras. Si incluyésemos la secuencia entera, nuestra frase de ini-
cio llenaría más de 500 000 páginas.
Las implicaciones de este conocimiento no pueden ser sobre-
valoradas. Utilizando este bosquejo de lo que significa el ser hu-
mano, los científicos pueden comenzar la identificación y carac-
~4 terización de secuencias que predicen la aparición de enfermedades determinadas y
CAPÍTULO 1 • Preludio: la bioquímica y atributos físicos particulares. Una consecuencia será el desarrollo de mejores méto-
la revolución genómica dos de diagnóstico y tratamiento de las enfermedades. En última instancia, los mé-
dicos serán capaces de diseñar planes para prevenir o controlar enfermedades del
corazón o el cáncer, las cuales están sujetas a variaciones individuales. Si bien la
secuenciación del genoma humano es un paso importante hacia la total compren-
sión de los seres vivos, todavía queda mucho trabajo por hacer. En una secuencia,
¿dónde están los genes funcionales y cómo interaccionan entre sí? ¿Cómo se con-
vierte la información de los genes en características funcionales de un determinado
organismo? Algunos de nuestros objetivos en el estudio de la Bioquímica son co-
nocer los conceptos, herramientas y hechos que nos permitirán abordar estas pre-
guntas. Es, ciertamente, un periodo emocionante, el comienzo de una nueva era en
la Bioquímica.

1.1 EL DNA ILUSTRA LA RELACIÓN ENTRE FORMA Y


FUNCIÓN

La estructura del DNA, la abreviatura de (1esoxyribonucleicqcid, o ácido desoxi-


rribonucleico, ilustra un principio básico común a todas las biomoléculas: la estre-
cha relación entre estructura y función. Las extraordinarias propiedades de esta sus-
tancia química le permiten funcionar como un vehículo robusto y eficiente en el
almacenamiento de la información. Comenzaremos con un análisis de la estructura
covalente del DNA y su extensión en las tres dimensiones.

1.1.1 El DNA está constituido por cuatro tipos de precursores


El DNA es un polímero lineal formado por cuatro monómeros distintos. Posee un
esqueleto fijo del cual sobresalen distintos sustituyentes (Figura 1.1 ). Este esque-
leto está constituido por unidades repetitivas de azúcar-fosfato. Los azúcares son
las moléculas de desoxirribosa que dan nombre al DNA. A cada desoxirribosa se
puede unir una de estas cuatro bases: adenina (A), citosina (C), guanina (G) o ti-
mina (T).

H­<xi !i" H­OC;: xxCH,


NH2
o o
N

N # H O~N H
/ N / N NH2 O H

1 1

Adenina (A} Citoslna (C) Guanina (G) Timlna (T)

Aunque las cuatro bases son planas, en otros aspectos se diferencian significativa-
mente. Así pues, los monómeros del DNA están formados por unidades de azúcar-
fosfato, con una de las cuatro bases unida al azúcar, y dispuestas en cualquier or-
den a lo largo de una hebra de DNA. El orden de esas bases es lo que está
representado en la secuencia que inicia este capítulo. Así, por ejemplo, la primera

FIGURA 1.1 Estructura covalente del


DNA. Cada unidad de la estructura
polimérica está constituida por un azúcar
(desoxirribosa), un fosfato y una base
variable que sobresale del esqueleto de
azúcar­fosfato. Azúcar Fosfato
base en la secuencia es G (guanina), la segunda es A (adenina), y así sucesivamente. 5 r­
La secuencia de bases a lo largo de una hebra de DNA constituye la información DNA: estructura y función
genética: las instrucciones para la construcción de las proteínas, las cuales, a su vez,
organizan la síntesis de un conjunto de otras moléculas que forman las células y, fi-
nalmente los organismos.

1.1.2 Dos hebras sencillas de DNA se emparejan para formar


un doble helicoide
La mayor parte de las moléculas de DNA poseen no una sino dos
hebras. (Figura 1.2). ¿Cómo se colocan esas hebras una respecto
a la otra? En 1953, James Watson y Francis Crick dilucidaron el
ordenamiento de esas hebras y propusieron una estructura tridi-
mensional para las moléculas de DNA. Esta estructura es un do-
ble helicoide, formada por las dos hebras superenrolladas, dis-
puestas de tal manera que el esqueleto de azúcar-fosfato se FIGURA 1.2 El doble helicoide. Estructura
encuentra en el exterior y las bases en el interior. La clave de esta estructura está en de doble helicoide del DNA propuesta por
que se forman pares de bases específicos (pb) unidos por puentes de hidrógeno (Sec- Watson y Crick. El esqueleto de azúcar­
ción 1.3.1 ): la adenina empareja con la timina (A-T) y la guanina empareja con la fosfato de las dos cadenas se muestra en
citosina (G-C), como se muestra en la Figura 1.3. Los puentes de hidrógeno son mu- rojo y azul y las bases en verde, morado,
naranja y amarillo.
cho más débiles que los enlaces covalentes, tales como los enlaces carbono-carbono
o carbono-nitrógeno que definen la estructura de las propias bases. Dichos enlaces
son cruciales para los sistemas bioquímicos, porque son lo suficientemente débiles
para romperse de modo reversible en los procesos bioquímicos; si bien son lo sufi-
cientemente fuertes, cuando se forman varios a la vez, como para ayudar a estabili-
zar determinadas estructuras tales como la del propio helicoide.

FIGURA 1.3 Pares de bases de Watson y


Crick. La adenina empareja con la tirnina
(A­T), y la guanina con la citosina (G­C).
Las lineas de trazos representan puentes
Adenina (A) Timina (T) Guanina (G) Citosina (C) de hidrógeno.

La estructura propuesta por Watson y Crick tiene dos propiedades de vital im-
portancia para el papel del DNA como material hereditario. Primero, la estructura
es compatible con cualquier secuencia de bases. Los pares de bases tienen esen-
cialmente la misma forma (Figura 1.4) y por tanto encajan igual de bien en el cen-
tro de la estructura del doble helicoide. Segundo, debido al emparejamiento de las
bases, la secuencia de éstas en una hebra determina, por completo, la secuencia en
la otra hebra. Tal como Watson y Crick tan tímidamente escribieron: "No se nos
escapa que el emparejamiento específico que hemos propuesto sugiere de inmediato
,.&...
un posible mecanismo de copia del material genético". Así, si la doble hélice de -
~~ ...'.)
DNA se separa en dos hebras sencillas, cada hebra puede actuar como molde para Hebras 0/ .)
la generación de su pareja mediante la formación de pares de bases específicos (Fi- e e

Y:·
recién A T T
sintetizadas ' '
gura 1.5). La estructura tridimensional del DNA ejemplifica de modo bellísimo la
estrecha relación entre la forma y la función de las moléculas. o e
' '
t A A e
'•c.,
- /......
­(.)

FIGURA 1.4 Emparejamiento de bases en


el DNA. Se representan los pares de bases FIGURA 1.5 Replicación del DNA. Si una
A­T (azul) y C­G (rojo) superpuestos. Los molécula de DNA se separa en sus dos
pares de bases de Watson y Crick tienen el hebras, cada una puede actuar corno
mismo tamaño global y forma, permitiendo molde para la génesis de su hebra
un ajuste perfecto en el doble helicoide. complementaria.
~6 1.1.3 El RNA es un intermediario en el flujo de la información
CAPÍTULO 1 • Preludio: la bioquímica y genética
la revolución genómica
Aparte del DNA, un ácido nucleico importante es el ácido ribonucleico (RNA, "ri-
bonucleic acid"}. Algunos virus utilizan el RNA como material genético, e incluso
los organismos que emplean el DNA, tienen que convertir primero la información

HO--\;o~OH
~ H genética en RNA para que ésta sea accesible o funcional. Estructuralmente, el RNA
es muy semejante al DNA. Es un polímero lineal, hecho de un número limitado de
monómeros repetitivos, cada uno compuesto por un azúcar, un fosfato y una base.

H._H'
HO OH
H
El azúcar es la ribosa en lugar de desoxirribosa (de ahí, RNA) y una de las bases
es uraciJo (U), en lugar de timina (T). Al contrario que en el DNA, una molécula
de RNA, normalmente, existe como una hebra sencilla, si bien segmentos signifi-
Ribosa cativos en una molécula de RNA pueden ser de doble hebra, con G emparejándose
fundamentalmente con C y A emparejándose con U. Este emparejamiento de bases

H60H
intracatenario genera moléculas de RNA con estructuras y actividades complejas,
entre las que se incluye la catálisis.
El RNA desempeña tres papeles básicos en la célula. Primero, funciona como
el intermediario en el flujo de información del DNA a la proteína, las moléculas
1
O~ H funcionales primarias de la célula. El DNA es copiado, o transcrito, a RNA men-
sajero (mRNA), y el RNA es traducido a proteínas. Segundo, las moléculas de RNA
1 sirven como adaptadores que traducen la información de la secuencia del ácido nu-
Uracilo (U) cleico mRNA en la información que designa la secuencia de los componentes que
formarán una proteína. Por último, las moléculas de RNA son componentes fun-
cionales, muy importantes, de una maquinaria molecular, los ribosomas, que llevan
a cabo el proceso de la traducción. Como veremos en el Capítulo 2, la peculiar po-
sición del RNA entre el almacenamiento de la información genética en el DNA y
la expresión funcional de esta información en las proteínas, así corno su potencial
para combinar capacidades catalíticas y genéticas, son indicios de que el RNA ha
ejercido un papel fundamental en la evolución de la vida.

1.1.4 Las proteínas, codificadas por los ácidos nucleicos,


realizan la mayoría de las funciones celulares
El papel principal de muchas secuencias de DNA es el de codificar las secuencias
de las proteínas, los "animales de carga" de la célula, que participan en todos los
procesos esenciales. Algunas proteínas son componentes estructurales clave, mien-
tras otras son catalizadores específicos (llamados enzimas) que activan reacciones
químicas. Al igual que el DNA y el RNA, las proteínas son polímeros lineales.
Sin embargo, las proteínas son más complicadas ya que están formadas, en lugar
de por 4, por una selección de 20 precursores o bloques de construcción, llama-
dos aminoácidos.
Las propiedades funcionales de las proteínas, al igual que las de otras biorno­
léculas, están determinadas por sus estructuras tridimensionales. Las proteínas po-
seen una propiedad extremadamente importante: se pliegan espontáneamente en
una estructura tridimensional elaborada y muy bien definida que está determinada
totalmente por la secuencia de aminoácidos de su cadena (Figura 1.6). La natu-
raleza del autoplegamiento de las proteínas constituye la forma de transición
desde el mundo unidimensional de la información de la secuencia, al mundo tri-
dimensional de la función biológica. Esta maravillosa capacidad de las proteínas
de auto-ensamblarse en estructuras complejas es la responsable de su papel pri-
mordial en la bioquímica.
¿Cómo se traduce la secuencia de bases a lo largo del DNA en una secuencia
de aminoácidos a lo largo de una cadena proteica? Consideraremos los detalles
de este proceso en capítulos posteriores, pero el descubrimiento importante es que
tres bases a lo largo de la cadena de DNA codifican un solo aminoácido. A la re-
lación específica entre un conjunto de tres bases y 1 de los 20 aminoácidos se le
denomina código genético. Al igual que la utilización del DNA como material ge-
nético, el código genético es esencialmente universal; la misma secuencia de tres
bases codifica el mismo aminoácido en todas las formas de vida, desde los mi-
croorganismos más sencillos a los organismos multicelulares más complejos, ta-
les como el ser humano.
7 1--
La unidad es la base de la diversidad

Una secuencia de aminoácidos

FIGURA 1.6 Plegamiento de una


proteína. La estructura tridimensional de
Otra secuencia de aminoácidos
una proteína, un polímero lineal de
aminoácidos, está dictada por su secuencia
de aminoácidos.

El conocimiento de las propiedades funcionales y estructurales de las proteí-


nas es absolutamente esencial para entender el significado de la secuencia del ge-
noma humano. Así, por ejemplo, la secuencia que aparece al principio de este ca-
pítulo corresponde a una región del genoma que es diferente en personas que sufren
la enfermedad genética conocida como fibrosis quística. La mutación más común Fibrosis quística
que origina la fibrosis quística, la pérdida de tres Tes de la secuencia del gen, con- Enfermedad que resulta de una disminu­
duce a la pérdida de un solo aminoácido en una cadena proteica de 1480 aminoá- ción en la secreción de fluidos y sal por
una proteína transportadora denomi­
cidos. Esta diferencia aparentemente pequeña -la pérdida de un aminoácido en nada "regulador de conductanciatrans­
un total de casi 1500- crea una situación que amenaza la vida. ¿Cuál es la fun- membranal de la fibrosis quística
ción normal de la proteína codificada por este gen? ¿Qué propiedades de la prote- (CFTR)". Como consecuencia de este
ína codificada están comprometidas por este pequeño defecto? ¿Se puede usar esta defecto, se bloquea la secrecióndel
información para desarrollar nuevos tratamientos? Estas preguntas entran en el páncreas y se acumula en el pulmón
campo de la bioquímica. El conocimiento de la secuencia del genoma humano ace- una mucosidad pesada y deshidratada,
conduciendo a infecciones pulmonares
lerará en gran medida el ritmo al que se establezcan las conexiones entre la se-
crónicas.
cuencia del DNA y las enfermedades, así como otras características humanas. Sin
embargo, estas conexiones no tendrían sentido sin los conocimientos bioquímicos
necesarios para interpretarlas y utilizarlas.

FIGURA 1.7 La diversidad de los seres


1.2 EN LA DIVERSIDAD BIOLÓGICA SUBYACE vivos. Las distintas morfologías de los tres
LA UNIDAD BIOQUÍMICA organismos de la imagen: una planta
(el falso eléboro, o Veratrum viride) y dos
animales (erizo de mar y un gato
La asombrosa variedad de los seres vivos (Figura 1.7) parece contradecir su sor- domestico común) podría sugerir que
prendente similitud. El uso universal del DNA y el código genético por todos los tienen poco en común. Sin embargo
organismos, subraya uno de los descubrimientos más imponentes del siglo pasado: bioquímicamente poseen una considerable
a saber, que los organismos son asombrosamente uniformes a nivel molecular. To- semejanza que apunta a un antecesor
dos los organismos están construidos con componentes moleculares semejantes único. [(izquierda y derecha) John
que se distinguen por variaciones relativamente pequeñas. Esta uniformidad re- Dudak/Phototake. (Medio) Jeffrey L Rotman
vela que todos los organismos del planeta Tierra proceden de un antecesor co- /Peter Arnold.)]
BACTERIA EUKARYA ARCHAEA mún Un núcleo de procesos bioquímicos esenciales, el
..... mismo para todos los organismos, apareció tempranamente
.2
~"' en la evolución de la vida. La diversidad de la vida en el
E
~
~e:
o
.....
::, o
e mundo moderno se ha producido mediante procesos evolu-
o .e: tivos que han actuado sobre ese núcleo durante millones o
"' .§o io Eo
-s ~o
.l'.) V, a:, :r: V, ~ incluso miles de millones de años. Tal y como veremos de
forma repetitiva, la generación de la diversidad ha sido, muy
a menudo, el resultado más de la adaptación de componen-
tes bioquímicos ya existentes a nuevos papeles que del de-
sarrollo de nueva tecnología bioquímica fundamental. La
sorprendente uniformidad de la vida a nivel molecular pro-
porciona al estudiante de bioquímica una visión particular-
mente clara de la esencia de los procesos biológicos que se
aplica a todos los organismos, desde los seres humanos al
más sencillo de los microbios.
Sobre la base de sus características bioquímicas, los di-
versos organismos del mundo moderno se pueden dividir en
tres grupos fundamentales llamados dominios: Eukarya (eu-
FIGURA 1.8 El árbol de la vida. A partir del análisis de las secuencias
cariotas), Bacteria (bacterias) y Archaea (arqueobacterias).
de DNA se puede deducir una posible vía evolutiva desde la célula
Los eucariotas abarcan todos los organismos macroscópicos,
ancestral común a las diversas especies presentes en el mundo
moderno. incluido el ser humano, así como muchos organismos mi-
croscópicos y unicelulares tales como las levaduras. La ca-
racterística definitoria de los eucariotas es la presencia de un
núcleo muy bien definido en cada célula. Los organismos unicelulares tales como
las bacterias, que no tienen núcleo, se denominan procariotas. Los procariotas fue-
ron reclasificados en dos dominios separados como resultado del descubrimiento de
Carl Woese en 1977 de que ciertos organismos semejantes a bacterias son, desde el
punto de vista bioquímico, muy distintos de otras especies bacterianas mejor ca-
racterizadas. Estos organismos, de los que hoy se sabe que han divergido de las bac-
terias en etapas muy tempranas de la evolución, son las arqueobacterias. Las vías
evolutivas, desde un antecesor común a los organismos modernos, se pueden desa-
rrollar y analizar en base a la información genética. Una de tales vías se muestra en
la Figura 1.8.
Si examinamos la bioquímica en el contexto del árbol de la vida, podemos a
menudo comprender cómo determinadas moléculas o procesos ayudan a que los
organismos se adapten a entornos específicos o a diferentes estilos de vida. No
sólo podemos preguntar qué proceso bioquímico tiene lugar, sino, además, por
qué una determinada estrategia aparece en el curso de la evolución. Además de
ser una fuente de preguntas históricas, Las respuestas a tales preguntas son, a
menudo, muy instructivas con relación a la bioquímica de los organismos con-
temporáneos.

1.3 LOS ENLACES QUÍMICOS EN BIOQUÍMICA

La esencia de los procesos biológicos -las bases de la uniformidad de los seres


vivos- son en su sentido último las interacciones moleculares; en otras palabras,
la química que tiene lugar entre las moléculas. La bioquímica es la química que
se produce en los seres vivos. Para entender totalmente la bioquímica necesita-
mos entender el enlace químico. Vamos a revisar aquí los tipos de enlaces quí-
micos más importantes para los compuestos bioquímicos y sus transformaciones
mutuas.
Los enlaces más fuertes que están presentes en los compuestos bioquímicos son
los enlaces covalentes, tales como los que mantienen unidos a los átomos de las ba-
ses individuales mostradas en la Figura 1.3. Un enlace covalente está formado por
la compartición de un par de electrones entre átomos adyacentes. Un típico enlace
covalente carbono-carbono (C-C) tiene una longitud de 1,54 Á y una energía de en-
lace de 85 kcal mol-1 (365 kJ mol-1). Dado que esta energía es relativamente alta,
se debe gastar una cantidad considerable de energía para romper los enlaces cova-
Ientes. Se pueden compartir más de un par de electrones entre dos átomos para for-
mar un enlace covalente múltiple. Así, por ejemplo, tres de las bases en la Figura 9 ¡­­
1.4 incluyen dobles enlaces carbono-oxígeno (C­­0).Estos enlaces son incluso más Enlaces químicos
fuertes que los enlaces sencillos C-C, con energías próximas a las 175 kcal mol-1
(732 kJ mol-1).
Algunas moléculas se pueden describir utilizando más de una distribución de
sus enlaces covalentes. Por ejemplo, el benceno se puede escribir de dos mane-
ras equivalen tes llamadas estructuras resonantes. La auténtica estructura del ben-
ceno es una combinación de estas dos estructuras de resonancia. Una molécula
que pueda representarse como varias estructuras de resonancia de energías apro-
ximadamente iguales tiene mayor estabilidad que una molécula sin esas múlti- Estructuras de resonancia
ples estructuras de resonancia. Así, debido a sus estructuras de resonancias, el del benceno
benceno es especialmente estable.
Las reacciones químicas suponen la ruptura y la formación de enlaces covalen-
tes. El flujo de electrones en el transcurso de la reacción puede representarse por
flechas curvadas, un método de representación llamado "flechas dirigidas". Cada
flecha representa un par electrónico.
H /o-
\ +
H­~C­H
I \
H H

1.3.1 Las interacciones reversibles entre las biomoléculas están


mediadas por tres clases de enlaces no covalentes
Las interacciones moleculares totalmente reversibles y no covalentes son pasos clave
en la danza de la vida. Tales fuerzas débiles, de naturaleza no covalente, desempe-
ñan un papel esencial en la replicación fiel del DNA, el plegamiento de las proteí-
nas en intrincadas formas tridimensionales, el reconocimiento específico de los sus-
tratos por los enzimas y en la detección de señales moleculares. Ciertamente, todas
las estructuras y procesos biológicos dependen de interacciones covalentes y no co-
valentes. Los tres enlaces no covalentes fundamentales son las uniones electrostá-
ticas, los puentes de hidrógeno y las interacciones de van der Waals. Se diferen-
cian en la geometría, la fuerza y la especificidad. Además, esos enlaces son
influenciados de forma distinta por la presencia del agua. Vamos a considerar las
características de cada uno:

l. Los enlaces electrostáticos. Una interacción electrostática depende de las cargas


eléctricas de los átomos. La energía de una interacción electrostática viene dada por
la ley de Coulomb:

donde E es la energía, q, y q2 son las cargas en los dos átomos (en unidades de
carga eléctrica), res la distancia entre los dos átomos (en angstroms), Des la cons-
tante dieléctrica (que refleja el efecto del medio circundante) y k es una constante
de proporcionalidad (k = 332, cuando se da la energía en kilocalorías por mol, ó
1389, para energías expresadas en kilojulios por mol). Así, la interacción electros-
tática entre dos átomos, que posean carga opuesta, separados por 3 A, en el seno
del agua (la cual tiene una constante dieléctrica de 80) tiene una energía de 1,4 kcal Donador de Aceptor de
mol-1 (5,9 kJ mol-1). enlace de enlace de
hidrógeno hidrógeno
N­H­­­­···N
2. Los enlaces de hidrógeno o puentes de hidrógeno. Los puentes de hidrógeno ¡¡­s- ¡¡­
son interacciones relativamente débiles, las cuales, sin embargo, resultan crucia- N­H·······O
les para las macromoléculas biológicas tales como el DNA y las proteínas. Estas
interacciones también son responsables de muchas de las propiedades que hacen 0­H­­­­···N
del agua un disolvente tan especial. El átomo de hidrógeno en un puente de hi-
0­H·­­····O
drógeno está parcialmente compartido entre dos átomos relativamente electrone-
gativos, tales como el nitrógeno y el oxígeno. El donador o dador del enlace de FIGURA 1.9 Puentes de hidrógeno entre
hidrógeno es el grupo que incluye tanto al átomo al que el hidrógeno está más es- átomos de nitrógeno y oxígeno.
trechamente unido como al propio átomo de hidrógeno, mientras que el aceptar Se muestran las posiciones de
del enlace de hidrógeno es el átomo menos estrechamente unido al átomo de hi- las cargas parciales (6 y ¡¡­).
drógeno (Figura 1.9). Los puentes de hidrógeno son fundamentalmente interac-
ciones electrostáticas. La electronegatividad del átomo al cual el hidrógeno está
Donador de Aceptar de
hidrógeno hidrógeno
unido covalentemente aparta la densidad electrónica del átomo de hidrógeno, de
forma que éste desarrolla una carga positiva parcial (8+). Por tanto, puede inte-
\o,9A 2,oA /
raccionar con un átomo que tenga una carga negativa parcial (8-) a través de una

u
N--H------·O
interacción electrostática.
Los puentes de hidrógeno son mucho más débiles que los enlaces covalentes.
180°
Tienen energías de l a 3 kcal mol- 1 ( 4 -13 kJ mol - 1) comparado con las apro-
ximadamente l 00 kcal mol- 1 ( 418 kJ mol- 1) para un enlace covalente de car-
bono-hidrógeno. Los enlaces de hidrógeno son también algo más largos que los
enlaces covalentes; sus distancias de enlace (medidas desde el átomo de hidró-
geno) varían entre l,5 a 2,6 Á; por tanto, las distancias entre dos átomos unidos
a través del hidrógeno van desde 2,4 hasta 3,5 A. Los enlaces de hidrógeno más
fuertes tienen tendencia a ser aproximadamente lineales, de tal forma que el do-
e nador del hidrógeno, el átomo de hidrógeno y el aceptor se encuentran en línea
-o
·¡;:; recta.
:i
a. Distancia de contacto
a,
ce:: de van der Waals 3. Interacciones de van der Waals. La base de las interacciones de van der Waals,
,!!!
/ Distancia
está en que la distribución de la carga electrónica en torno a un átomo cambia con
e' 01--~-+-~~~~~~~~~
a,
e el tiempo. En cualquier momento la distribución de carga no es perfectamente si-
UJ
e métrica. Esta asimetría transitoria en la carga electrónica alrededor de un átomo ac-
-o
'ou túa a través de interacciones electrostáticas, para inducir una asimetría comple-
~ mentaria en la distribución electrónica alrededor de sus átomos vecinos. La atracción
:e resultante entre dos átomos aumenta a medida que se acercan, hasta que su separa-
1 ción coincide con la distancia de contacto de van der Waals (Figura 1.10). A dis-
tancias menores predominan las intensas fuerzas repulsivas, porque las nubes elec-
FIGURA 1.10 Energía de las interacciones trónicas más externas se solapan.
de van der Waals cuando dos átomos se Las energías asociadas con las interacciones de van der Waals son bastante pe-
aproximan uno al otro. La energía aumenta queñas; típicamente, la contribución de estas interacciones por par atómico es de
rápidamente debido a las repulsiones
0,5 a 1,0 kcal mol-1 (de 2 a 4 kJ mol-1). Sin embargo, cuando las superficies de
electrón-electrón cuando los átomos se
aproximan a menos de esta distancia. dos moléculas grandes se aproximan, un gran número de átomos establecen con-
tactos de van der Waals y el efecto neto de sumar muchos pares de átomos puede
llegar a ser considerable.

1.3.2 Las propiedades del agua afectan a la capacidad de


enlace de las biomoléculas

H
/0....._
H 1: Las interacciones débiles son el instrumento clave por el cual las moléculas inte-
raccionan entre sí: los enzimas con sus sustratos, las hormonas con sus recepto-
res, los anticuerpos con sus antígenos. La fuerza y la especificidad de las inte-
racciones débiles es muy dependiente del medio en el que tienen
lugar, y la mayor parte de las interacciones biológicas tienen lu-
gar en el agua. Dos propiedades del agua son especialmente im-
portantes a este respecto:
1. El agua es una molécula polar. La molécula de agua es trian-
gular, no lineal, y por tanto la distribución de cargas es asimétrica.
El núcleo de oxígeno atrae electrones de los núcleos de hidrógeno,
dejando, por ello, la región alrededor de éstos con una carga posi-
tiva neta. La molécula de agua es por tanto una estructura eléctri-
camente polar.
2. El agua es muy cohesiva. Las moléculas de agua establecen in-
teracciones fuertes entre ellas a través de puentes de hidrógeno. Es-
tas interacciones se manifiestan en la estructura del hielo (Figura
1.11). Una malla de puentes de hidrógeno mantiene cohesionada la
estructura; interacciones semejantes unen las moléculas en el agua
líquida y explican su cohesión, si bien, en el estado líquido, algu-
FIGURA 1.11 Estructura del hielo. Entre las moléculas de nos de los puentes de hidrógeno están rotos. La naturaleza altamente
agua se forman puentes de hidrógeno (aparecen como líneas cohesiva del agua afecta drásticamente las interacciones entre las
de trazos). diversas moléculas en disolución acuosa.
¿Qué efecto tienen las propiedades del agua en las interacciones débiles estu- 11 r­
diadas en la sección 1.3.l? La polaridad y la capacidad del agua de formar puen- Enlaces químicos
tes de hidrógeno la convierten en una molécula muy reactiva. El agua es un di-
solvente excelente para las moléculas polares. La razón es que el agua debilita
mucho las fuerzas electrostáticas y los enlaces por puente de hidrógeno entre mo-
léculas polares al competir por su atracción. Por ejemplo, consideremos el efecto
del agua en el enlace de hidrógeno entre un grupo carbonilo y el grupo NH de
una amida.

"( "~
o
11 H,0,.H
9 H,0,.H ~ '
H,.O,H ..­­ ' o
' '
' H
H 1
H
1 1
0­H
/~ /~

Un átomo de hidrógeno del agua puede reemplazar al átomo de hidrógeno de una


amida que actúe como donador de puentes de hidrógeno, mientras que el átomo de
oxígeno del agua puede reemplazar al oxígeno de un grupo carbonilo, que actúe
como aceptor de puentes de hidrógeno. Por tanto, un enlace de hidrógeno fuerte en-
tre un grupo CO y un grupo NH sólo se forma cuando se excluye el agua.
La constante dieléctrica del agua es 80, por tanto el agua disminuye la fuerza
de las interacciones electrostáticas unas 80 veces, en comparación con la fuerza de
las mismas interacciones en el vacío. La constante dieléctrica del agua es extraor-
dinariamente alta debido a su polaridad y a su capacidad para formar capas orien-
tadas de disolvente en torno a los iones. Esas capas de disolvente orientadas for-
man sus propios campos eléctricos, los cuales se oponen a los campos producidos
por los iones. Así pues, la presencia del agua debilita de forma significativa las in-
teracciones electrostáticas entre los iones.
La existencia de la vida en la Tierra depende de forma crítica de la capacidad
del agua de disolver un conjunto importante de moléculas polares que sirven como
combustibles, precursores, catalizadores y transmisores de información. En el agua
pueden coexistir elevadas concentraciones de estas moléculas polares, donde es-
tán libres para difundir e interaccionar entre sí. Sin embargo, las cualidades del
agua como disolvente suponen un problema, puesto que debilitan las interaccio-
nes entre moléculas polares. La presencia de microentornos libres de agua en los
sistemas biológicos evita este problema. Vamos a ver muchos ejemplos de estos
nichos especiales en las proteínas. Sin embargo, la presencia del agua con su na-
turaleza polar permite otro tipo de interacciones débiles, las que dirigen el plega-
miento de proteínas (Sección 1.3.4) y la formación de los límites celulares (Sec-
ción 12.4).
La esencia de estas interacciones, como la de todas las interacciones en bio-
química, es la energía. Para comprender la mayor parte de la bioquímica -for-
mación de enlaces, estructura molecular, catálisis enzimática- necesitamos es-
tudiar la energía. La termodinámica proporciona una herramienta muy válida
para tratar este tema. Revisaremos este asunto con más detalle cuando conside-
remos los enzimas (Capítulo 8) y los conceptos básicos del metabolismo (Ca-
pítulo 14).

1.3.3 La entropía y las leyes de la termodinámica


La altamente organizada y estructurada naturaleza de los seres vivos resulta evi-
dente. Esta organización se extiende a todo el organismo, desde el nivel celular al
molecular. Sin duda, los procesos biológicos pueden parecer mágicos en el sentido
de que de un mundo de objetos desordenados e inanimados emergen estructuras y
patrones muy ordenados. Sin embargo, la organización evidente de una célula o una
molécula surge de sucesos biológicos que están sujetos a las mismas leyes físicas
que gobiernan todos los procesos: en particular, las leyes de la termodinámica.
­­j 12 ¿Cómo podemos entender la creación de orden a partir del caos? Comenzare-
CAPÍTULO 1 • Preludio: la bioquímica y mos por señalar que las leyes de la termodinámica hacen una distinción entre un
la revolución genómica sistema y su entorno. Un sistema se define como la materia en una región defi-
nida del espacio. La materia en el universo restante se denomina entorno. La Pri-
mera Ley de la Termodinámica establece que la energía total de un sistema y su
entorno permanece constante. En otras palabras, el contenido energético del uni-
verso es constante; la energía no puede ser creada ni destruida. La energía puede,
sin embargo, adoptar diferentes formas. El calor, por ejemplo, es una forma de
energía. El calor es una manifestación de la energía cinética asociada con el mo-
vimiento al azar de las moléculas. Por otra parte, la energía se puede representar
como energía potencial, haciendo referencia a la capacidad de que esta sea libe-
rada al darse determinados sucesos. Pensemos, por ejemplo, en un balón en lo alto
de una torre. El balón tiene una energía potencial considerable ya que, si se suelta,
el balón liberará la energía cinética asociada con su movimiento al caer. En un
sistema químico, la energía potencial se relaciona con la probabilidad de que los
átomos puedan reaccionar entre sí. Por ejemplo, una mezcla de gasolina y oxí-
geno tiene mucha energía potencial porque esas moléculas pueden reaccionar para
formar dióxido de carbono y liberar energía en forma de calor. La Primera Ley
implica que cualquier energía liberada en la formación de enlaces químicos pueda
utilizarse para romper otros enlaces, se libere como calor, o se almacene de al-
guna otra manera.
Otro concepto termodinámico importante es el de la entropía. La entropía es
una medida del nivel de libertad o desorden de un sistema. La Segunda Ley de la
Termodinámica establece que la entropía total de un sistema y su entorno au-
menta siempre, en los procesos espontáneos. A primera vista, esta ley parece con-
tradecir la experiencia más habitual, sobre todo acerca de los seres vivos. Muchos
procesos biológicos, tales como la generación de una estructura muy bien defi-
nida como la de una hoja, a partir del gas dióxido de carbono y otros nutrientes,
claramente aumenta el nivel de orden y por tanto disminuye la entropía. La en-
tropía se puede disminuir localmente en la formación de tales estructuras orde-
nadas sólo si la entropía de otras partes del universo aumenta en una cantidad
igual o mayor.
Un ejemplo puede ayudar a explicar la aplicación de las leyes de la termodi-
námica a un sistema químico. Imaginemos un recipiente con dos moles de gas hi-
drógeno en una cámara separada de 1 mol de gas oxígeno en otra cámara (Figura
1.12). Si retiramos el separador, los gases se mezclaran espontáneamente para for-
mar una mezcla homogénea. El proceso de mezcla aumenta la entropía localmente,
de forma que una disposición ordenada es sustituida por una mezcla distribuida
al azar.
Otros procesos en este sistema pueden disminuir la entropía localmente, mien-
tras aumentan la entropía del universo. Una chispa aplicada a la mezcla inicia la
reacción química en la que el hidrógeno y el oxígeno se combinan para formar
agua:
2 H2 + 02­2 H20
Si la temperatura del sistema se mantiene constante, la entropía disminuye por-
que 3 moles de dos reactivos distintos se han combinado para formar dos moles
de un solo producto. El gas está formado ahora de un conjunto uniforme de mo-
léculas indistinguibles. Sin embargo, la reacción libera una cantidad significativa
de calor al entorno, y este calor aumentará la entropía de las moléculas del en-

..........
,,,,,
, ,....
. . ,.
I '­."­.
FIGURA 1.12 Desde el orden al desorden. La mezcla espontánea de gases es dirigida por
un aumento en la entropía.
13 ~
Enlaces químicos

FIGURA 1.13 Cambios de entropía. Cuando el hidrógeno y el oxígeno se C lor


combinan para formar agua, la entropía del sistema se reduce, pero la
entropía del universo aumenta debido a la liberación de calor al entorno.

torno aumentando su movimiento al azar. Este aumento de entropía es suficiente


para permitir que se forme agua espontáneamente a partir de hidrógeno y oxígeno
(Figura 1.13).
El cambio en la entropía del entorno será proporcional a la cantidad de calor
transferido por el sistema e inversamente proporcional a la temperatura del entorno,
porque un aporte de calor conduce a un mayor aumento de entropía a temperaturas
más bajas que a temperaturas más altas. En los sistemas biológicos, T (temperatura
absoluta, en kelvin (K)) se supone que es constante. Si definimos el contenido en
calor de un sistema como entalpía (H), entonces podemos expresar la relación que
une la entropía (S) del entorno para la transferencia de calor y la temperatura como
una simple ecuación:

6.Sentomo = - Ó.HsistemalT (1)

El cambio total de entropía viene dado por la expresión

Ó.S101al = Ó.Ssistema + 6.Sentomo (2)

La sustitución de la ecuación 1 en la 2 da
(3)

Multiplicando por ­T resulta

-T6.S101al = LÍHsistema - Tó.Ssistema (4)


La función -Tó.S tiene unidades de energía y se denomina energía libre, o energía
libre de Gibbs, en nombre de Josiah Willard Gibbs, que desarrolló esta función en
1878:
(5)

El cambio de energía libre, 6.G, se usará a lo largo de este texto, para describir la
energética de las reacciones bioquímicas.
Recordemos que la Segunda Ley de la Termodinámica establece que, para que
una reacción sea espontánea, la entropía del universo debe aumentar. El análisis de
la ecuación 3 muestra que la entropía total solamente aumentará si
(6)

Reorganizando estas ecuaciones resulta Tó.Ssisiema > 6.H, es decir que la entropía
crecerá solamente si

6.G = 6.Hsistema - TÓ.Ssistema <O (7)

En otras palabras, el cambio de energía libre debe ser negativo para que una re-
acción resulta espontánea. Un cambio de energía libre negativo, viene acompañado
de un aumento en la entropía total del universo. Así pues, necesitamos considerar
sólo un término, la energía libre del sistema, para decidir si una reacción puede
transcurrir espontáneamente; cualquier efecto de los cambios en el sistema sobre el
resto del universo se tiene en cuenta de forma automática.
Conjunto de proteínas desplegadas 1.3.4 El plegamientode las proteínas puede comprenderse en
términosde cambios en la energía libre
El problema del plegamiento de proteínas ilustra la utilidad del concepto de ener-
gía libre. Pensemos en un sistema formado por un conjunto de moléculas de pro-
teínas desplegadas en disolución acuosa (Figura 1.14). Cada molécula de prote-
ína desplegada puede adoptar una conformación particular, por tanto, el sistema
resulta bastante desordenado y la entropía de la colección de moléculas es relati-
vamente alta. Sin embargo, en las condiciones adecuadas, el plegamiento de las
proteínas se lleva a cabo espontáneamente. Por lo tanto, la entropía debe haber
aumentado en algún otro lugar del sistema o en el entorno. ¿Cómo podemos re-
conciliar la aparente contradicción de que las proteínas adopten espontáneamente
una estructura ordenada, y aún así la entropía aumente? La disminución de en-
tropía en el sistema debida al plegamiento no es tan grande como parece ser, de-
bido a las propiedades del agua. En efecto, las moléculas proteicas en disolución
acuosa interaccionan con las moléculas de agua, mediante la formación de enla-
ces electrostáticos y puentes de hidrógeno. Sin embargo, algunas moléculas (lla-
Conjunto de proteínas plegadas
madas moléculas apolares) no pueden participar en los enlaces electrostáticos o
en los puentes de hidrógeno. Las interacciones de moléculas apolares con el agua
no son tan favorables como lo son las interacciones entre las propias moléculas
de agua. Las moléculas de agua en contacto con esas superficies apolares forman
"cestas o jaulas" alrededor de las moléculas apolares, ordenándose más (y, por
tanto, disminuyendo la entropía) que las moléculas de agua libres en la disolu-
ción. Cuando dos de esas moléculas apolares se juntan, algunas de las moléculas
de agua son liberadas, y entonces pueden interaccionar libremente con el resto del
agua (Figura 1.15). Por tanto, las moléculas apolares tienen tendencia a agregarse
en el agua, porque la entropía del agua aumenta debido a la liberación de sus mo-
léculas. Este fenómeno, llamado efectohidrofóbico, ayuda a activar muchos pro-
cesos bioquímicos.
¿Cómo favorece el efecto hidrofóbico el plegamiento de las proteínas? Algunos
de los aminoácidos que componen las proteínas tienen grupos apolares. Estos ami-
FIGURA 1.14 Plegamiento de proteínas. noácidos apolares tienen una fuerte tendencia a asociarse entre sí, en el interior de
El plegamiento de proteínas supone la una proteína plegada. El aumento de entropía del agua debido a la interacción en-
transición de una mezcla desordenada de tre estos aminoácidos hidrofóbicos ayuda a compensar la pérdida de entropía inhe-
moléculas desplegadas a una disolución
rente al proceso de plegamiento.
relativamente uniforme de moléculas de
Las interacciones hidrofóbicas no son la única manera de estabilizar la estruc-
proteína plegadas.
tura de las proteínas. Muchos enlaces débiles, incluyendo los puentes de hidrógeno
y las interacciones de van der Waals, se forman en el proceso de plegamiento de la
proteína, y como consecuencia se libera calor al entorno. Si bien estas interaccio-
nes sustituyen las interacciones con el agua, que tienen lugar en la proteína no ple-
gada, el resultado neto es la liberación de calor al entorno y por tanto un cambio
negativo (favorable) en la entalpía del sistema.
El proceso de plegamiento tiene lugar cuando la combinación de la entropía aso-
ciada con el efecto hidrofóbico y el cambio de entalpía asociado con los puentes de
hidrógeno y las interacciones de van der Waals hacen que el cambio de energía li-
bre total resulte negativo.

» "fil


"fil "fil
Molécula
» "fil » !°
a polar
!° Molécula
» "fil
"fil
a polar
Molécula
"fil
~
!° » "fil !°
a polar

FIGURA 1.15 El efecto hidrofóbico. La Molécula !° "fil
agregación de grupos apolares en el agua "fil
»
a polar
!° !° »
»
da lugar a un aumento en entropía debido
a la liberación de moléculas de agua en la
disolución.
15 t
1.4 LA BIOQUÍMICA Y LA BIOLOGÍA HUMANA La bioquímica y la biología humana

Nuestra comprensión de la bioquímica ha tenido y seguirá teniendo una gran re-


percusión en muchos aspectos de la actividad humana. Primero, la bioquímica es
un conjunto de conocimientos lntrinsicamente bello y fascinante. Conocemos ahora
la esencia y muchos de los detalles de los procesos bioquímicos fundamentales en
bioquímica, por ejemplo, cómo una única molécula de DNA se replica para gene-
rar dos copias idénticas de sí misma y cómo la secuencia de bases en una molé-
cula de DNA determina la secuencia de aminoácidos en la proteína que codifica.
Nuestra capacidad para describir con detalle esos procesos, en términos mecani-
cistas, proporciona una sólida base química a otras ciencias biológicas. Además, el
darnos cuenta de que podemos entender procesos vitales esenciales, tales como la
transmisión de la información hereditaria, en términos de estructuras químicas y
. sus reacciones, tiene implicaciones filosóficas importantes. ¿Qué significa, bio-
químicamente, el ser humano? ¿Cuáles son las diferencias bioquímicas entre un
ser humano, un chimpancé, un ratón y una mosca de la fruta? ¿Somos más pare-
cidos o más diferentes?
Segundo, la bioquímica tiene una gran influencia en la medicina y en otros cam-
pos. Las lesiones moleculares que originan la anemia falciforme, fibrosis quística,
hemofilia y otras enfermedades genéticas han sido determinadas a nivel bioquímico.
Se han identificado algunos de los mecanismos moleculares que contribuyen al de-
sarrollo del cáncer. La comprensión de Los efectos subyacentes abre la puerta al des-
cubrimiento de posibles terapias eficaces. La bioquímica hace posible el diseño ra-
cional de nuevos fármacos, incluyendo inhibidores específicos de enzimas necesarios
para la replicación de virus, tales como el virus de la inmunodeficiencia humana
(HIV). Bacterias y otros organismos obtenidos por ingeniería genética se pueden
utilizar como "factorías" para producir proteínas de gran valor, tales como la insu-
lina y estimuladores del desarrollo de las células sanguíneas. La bioquímica está
también contribuyendo poderosamente al desarrollo del diagnostico clínico. Por
ejemplo, niveles altos de enzimas marcadores en la sangre ponen de manifiesto si
un paciente ha sufrido, recientemente, un infarto de miocardio (ataque al corazón).
La agricultura también se está beneficiando de los avances en la bioquímica con el
desarrollo de herbicidas y pesticidas más eficientes y seguros para el medio am-
biente y la creación de plantas obtenidas por ingeniería genética que son, por ejem-
plo, más resistentes a los insectos. Los avances en la secuenciación del genoma han
acelerado todos estos esfuerzos.
Tercero, los avances en bioquímica están permitiendo a los investigadores
abordar algunas de las cuestiones más interesantes de la biología y la medicina.
¿Cómo, a partir de un óvulo fecundado, se originan células tan diferentes como
las de los músculos, el cerebro y el hígado? ¿Cómo funcionan los sentidos? ¿Cuá-
les son las bases moleculares de enfermedades mentales tales como el Alzheimer
y la esquizofrenia? ¿Cómo distingue el sistema inmune entre lo propio y lo ajeno?
¿Cuáles son los mecanismos moleculares de la memoria a corto y a largo plazo?
Las respuestas a tales cuestiones, que una vez parecieron tan remotas, han sido
desveladas parcialmente y probablemente serán totalmente conocidas en un futuro
no lejano.
Dado que todos los seres vivos de la Tierra están unidos por un origen común,
la evolución constituye un tema muy importante para la bioquímica. Este libro
está organizado para resaltar los principios unificadores descubiertos por las con-
sideraciones evolutivas. Comenzaremos el siguiente capítulo con un breve reco-
rrido a lo largo de una posible vía evolutiva que va desde la formación de algu-
nos de los compuestos químicos asociados ahora con los organismos vivos hasta
la evolución de los procesos esenciales para el desarrollo de organismos multice-
lulares complejos. El resto de la Parte I del libro presenta en profundidad los ti-
pos de compuestos químicos más importantes, así como la catálisis y la regula-
ción. La Parte II, Transducción y almacenamiento de energía, describe cómo la
energía de los compuestos químicos o de la luz se convierte en formas útiles y
cómo está regulada esta conversión. Tal como veremos, un conjunto pequeño de
moléculas, como la adenosina trifosfato (ATP), actúan como divisas de intercam-
bio energético que permiten que la energía, ya capturada, sea utilizada en toda
­­­­­j 16 una serie de procesos bioquímicos. Esta parte del texto examina las vías impor-
CAPÍTULO 1 • Preludio: la bioquímica y tantes para la conversión de la energía del entorno en moléculas tales como ATP
la revolución genómica y desvelar varios principios unificadores. La Parte III, Síntesis de las moléculas
de la vida, ilustra el uso de las moléculas presentadas en la Parte II para sinteti-
zar los precursores clave, tales como las bases de DNA y los aminoácidos y mues-
tra como estos precursores se ensamblan en DNA, RNA y proteínas. En las par-
tes II y III, resaltaremos la relación entre la reacción en cada vía y entre las de
vías diferentes, con el fin de sugerir cómo esas reacciones individuales se pueden
haber combinado en etapas tempranas de la historia evolutiva para producir las
moléculas necesarias. Desde la perspectiva del estudiante, la existencia de reac-
ciones comunes a varias vías permite que los conocimientos adquiridos en un con-
texto se puedan aplicar a otro nuevo. La Parte IV, Respuesta a los cambios am-
bientales, explora algunos de los mecanismos que las células y los organismos
multicelulares han desarrollado para detectar y responder a los cambios en el en-
torno. Los temas abarcan desde los mecanismos generales, comunes a todos los
organismos, para la regulación de la expresión de los genes, a los sistemas sen-
soriales usados por los seres humanos y otros organismos complejos. En muchos
casos, podemos ver ahora como estos complicados sistemas evolucionaron a par-
tir de vías que existieron en épocas tempranas de la historia evolutiva. Muchas de
las secciones en la Parte IV unen la bioquímica con otros campos, tales como la
biología celular, la inmunología y las neurociencias. Ahora estamos preparados
para comenzar nuestro viaje a través de la bioquímica con sucesos que tuvieron
lugar hace más de 3 mil millones de años.

----i APÉNDICE: REPRESENTACIÓN DE LAS ESTRUCTURAS MOLECULARES~


Los autores de textos de bioquímica se enfrentan al problema de te- de 109,5 grados, mientras el átomo de carbono en el formaldehído
ner que representar las moléculas que son tridimensionales en las presenta hibridación sp2, con ángulos de enlace de 120 grados.
dos dimensiones disponibles en una página impresa. La interacción
entre las estructuras tridimensionales de las biomoléculas y sus fun- o
11
ciones biológicas se estudiará extensamente en este libro. Con este c
fin, usaremos con frecuencia representaciones que, aunque por ne- H/ "'H
cesidad están dispuestas en dos dimensiones, resaltan la estructura Metano Formaldehído
tridimensional de las moléculas.
Para representar la estereoquímica correcta de un átomo de car-
bono, utilizaremos cuñas para indicar la dirección de un enlace ha-
Representaciones estereoquímicas
cia dentro o hacia fuera del plano de la página. Una cuña con el ex-
La mayor parte de las fórmulas químicas en este texto están dibuja- tremo ancho lejos del carbono denota un enlace dirigido hacia el
das para representar la disposición geométrica de los átomos, esen- espectador, fuera del plano. Una cuña de trazos, con el extremo an-
ciales para el enlace químico y la reactividad, con tanta precisión cho del enlace hacia el carbono representa un enlace dirigido lejos
como ha sido posible. Así, por ejemplo, el átomo de carbono del me- del espectador hacia dentro del plano de la página. Los otros dos en-
tano tiene hibridación sp3 tetrahédrica, con ángulos de enlace H­ C­H laces se representan como líneas rectas.

FIGURA 1.16 Representaciones moleculares. Comparación de (A) modelo espacial


compacto, (B) esferasy varillas, y (C) modelo esquelético del ATP.
Apéndice ~ 17 r­
Proyecciones de Fischer 2. Modelo de esferas y varillas. Los modelos de esferas y varillas
no son tan realistas como los modelos espaciales, porque los átomos
Si bien son una representación más fiel de la estructura real del com- se representan como esferas de radios más pequeños que sus radios
puesto, las estructuras estereoquímicas son a menudo difíciles de di- de van der Waals. Sin embargo, el ordenamiento de los enlaces es
bujar con rapidez. Un método alternativo de representar estructuras más fácil de ver porque están representados explícitamente por va-
con centros de carbonos tetrahédricos, son las proyecciones de Fis- rillas. En un dibujo, la conicidad de la varilla, representando un pa-
cher. ralaje, nos indica cuál de los átomos enlazados está más próximo al
observador. Un modelo de esferas y varillas representa una estruc-
w w z w
X
tura compleja con mayor claridad que un modelo espacial.
z+x • z-c-x• y X 3. Modelos esqueléticos. Se puede obtener una imagen, incluso más
y y simple, con un modelo esquelético, el cual muestra sólo la disposi-
Proyección Representación ción molecular. En los modelos esqueléticos, los átomos no están ex-
de Fischer estereoquímica
plícitamente indicados. Su posicion se deduce por la unión de los
enlaces y sus extremos. Los modelos esqueléticos se utilizan fre-
En una proyección de Fischer, los enlaces con el carbono cen-
cuentemente para representar macromoléculas más grandes y más
tral se representan con lineas verticales y horizontales desde los áto-
complejas.
mos de los sustituyentes al átomo de carbono, el cual se supone que
A medida que la bioquímica ha ido avanzando se ha ido prestando
se encuentra en el centro de la cruz. Por convenio, se acepta que los
más atención a la estructura de las macromoléculas biológicas y sus
enlaces horizontales se proyectan hacia el espectador, fuera de la pá-
complejos. Estas estructuras abarcan miles o incluso cientos de miles
gina. El Glosario de compuestos que se encuentra al final del libro
de átomos. Si bien estas estructuras se pueden representar a nivel ató-
es un glosario estructural de las moléculas clave en bioquímica, cada
mico, es dificil distinguir los aspectos estructurales relevantes debido
una representada de dos maneras: con ángulos de enlace estereoquí-
al gran número de átomos. Por tanto, se han desarrollado representa-
micamente precisos y como una proyección de Fischer.
ciones más esquemáticas- diagramas de cintas y representaciones de
Para representar la arquitectura molecular con más detalle, se
superficie- para dibujar las estructuras macromoleculares en las que
usarán cinco tipos de modelos distintos: espaciales compactos, esfe-
los átomos no se representran de forma explícita (Figura 1.18).
ras y varillas, esqueléticos, de cintas y representaciones de superfi-
cie (Figura 1.16). Los primeros tres tipos muestran las estructuras a
4. Diagramas de cintas. Estos diagramas son muy esquemáticos y
nivel atómico. se usan más frecuentemente para resaltar unos pocos aspectos so-
l. Modelos espaciales compactos. Estos modelos espaciales son los bresalientes de la estructura de una proteína, tales como el et-heli-
más realistas. El tamaño y la posición de un átomo en el espacio en coide (una cinta enrollada), la hoja f3 (una flecha ancha), y bucles
un modelo espacial compacto están determinadas por las propieda- (lineas sencillas), para proporcionar una visión simple y clara del pa-
des de sus enlaces y el radio de van der Waals, o distancia de con- trón de plegamiento de esa proteína.
tacto (Sección 1.3.1 ). Un radio de van der Waals describe lo cerca
que pueden estar dos átomos cuando no están unidos por un enlace 5. Representaciones de superficie. A menudo, las interacciones en-
covalente. Los colores del modelo se establecen por convenio. tre macromoléculas tienen lugar exclusivamente en su superficie. Las
representaciones de superficie se han desarrollado para visualizar
Carbono, negro Hidrógeno, blanco Nitrógeno, azul mejor las superficies de las macromoléculas. Estas representaciones
Oxígeno, rojo Azufre, amarillo Fósforo, morado muestran las formas globales de las macromoléculas y se les puede
En la Figura 1.17 se muestran modelos espaciales compactos de al- sombrear o colorear para indicar hechos particulares tales como la
gunas moléculas simples. topografia de la superficie o la posición de las cargas eléctricas.

Agua Acetato Formamida ~-o-glucosa Cisteína

X
SH
H C_........OH

w"o-'
~HH
J-ifto" +H N
3
C~­
1: -
o
H o
FIGURA 1.17 Modelos espaciales. Fórmulas estructurales y representaciones espaciales de
algunas moléculas seleccionadas.
­­­j 18 r- CAPÍTULO 4 • Preludio: la bioquímica y la revolución genómica

~ FIGURA 1.18 Representaciones alternativas de la estructura de una proteína.


Un diagrama en cinta (A) y una representación de superficie (8) de una proteína clave del
sistema inmune resaltan diferentes aspectos de su estructura.

~ TÉRMINOS CLAVE 1----------------------


ácido desoxirribonucleico (DNA) (p. 4) eucariota (p. 8) energía libre (p. 13)
doble helicoide (p. 5) procariota (p. 8) efecto hidrofóbico (p. 14)
ácido ribonucleico (RNA) (p. 6) enlace covalente (p. 8) estereoquímica (p. 16)
proteína (p. 6) estructura de resonancia (p. 9) proyección de Fischer (p. 17)
aminoácido (p. 6) enlaces electrostáticos (p. 9) modelo espacial (p. 17)
código genético (p. 6) puente de hidrógeno (p. 9) modelo de esferas y varillas (p. 17)
Eukarya (Eucariotas)(p. 8) interacciones de van der Waals (p. 9) modelo esquelético (p. 17)
Bacteria (Bacterias)(p. 8) entropía (p. 12) diagrama de cintas (p. 17)
Arquea (Arqueobacterias)(p. 8) entalpía (p. 13) representación de superficie (p. 17)
n
r--~~~~~~~~~~~>
Evolución bioquímica
.,,_,....._
. ·, ­'., e.....

.
3
. •~'
,..,,... ..1·
• • . • .
. ...,.,'.· .

'
N

La selección natural, una de las fuerzas clave que Impulsan la evolución, abre todo un
conjunto de nichos ecológicos poco habitables a las especies que puedan adaptarse
bioquímicamente. (Izquierda) Las pozas de sal, donde las concentraciones de sal pueden ser
superiores a 1,5 M, podrían parecer unos entornos muy inhóspitos para la vida. Sin
embargo, ciertas arqueobacterias halófilas, tales como Haloferax mediterranei (derecha)
poseen adaptaciones bioquímicas que les permiten prosperar en estas duras condiciones.
[(izquierda) Kaj R. Svensson/Science Photo Library/Photo Researchers; (derecha) Wanner/Eye of
Science/Photo Researchers.)

El planeta Tierra tiene, aproximadamente, 4500 millones de años. Sorprendente-


mente, hay evidencias fósiles convincentes de que organismos que morfológica-
mente (y, muy probablemente, bioquímicamente) se asemejan a ciertas bacterias mo-
dernas, existieron ya hace 3500 millones de años. Usando los resultados de estudios
programados y descubrimientos accidentales, es posible, ahora, construir una vía
evolutiva, hipotética y sin embargo plausible, desde el mundo prebiótico hasta el
presente. Hay cierto número de incertidumbres que todavía permanecen, funda-
mentalmente en relación con los periodos más tempranos. Sin embargo, una refle-
xión sobre las etapas a lo largo de esta ruta y los problemas bioquímicos que han
tenido que resolverse proporciona una perspectiva útil desde la que contemplar los
procesos que se dan en los organismos modernos. Esas conexio-
nes evolutivas hacen más fácil la comprensión de muchos aspec-
tos de la bioquímica. CONTENIDO
Podemos imaginar la senda que conduce a las especies mo-
dernas vivas como formada por etapas, si bien es importante re- 2.1 Los seres vivos utilizan moléculas
cordar que estas no fueron, casi con toda seguridad, tan pronun- orgánicas clave
ciadas como se presentan aquí. La primera etapa la constituyó la 2.2 La evolución necesita reproducción,
producción inicial de algunas de las moléculas claves de la vida variación y presión selectiva
-ácidos nucleicos, proteínas, hidratos de carbono y lípidos- me-
diante procesos no biológicos. La segunda etapa fue fundamen- 2.3 Las transformaciones energéticas son
necesarias para sustentar a los seres vivos
tal: la transición de bioquímica prebiótica a sistemas capaces de
replicarse. Con el paso del tiempo, estos sistemas se hicieron cada 2.4 Las células pueden responder
vez más complejos, permitiendo la formación de las células vi- a cambios ambientales
vas. En la tercera etapa, los mecanismos evolucionaron para con-
vertir la energía de las fuentes químicas y del Sol en formas que
pudieran ser utilizadas para dirigir las reacciones químicas. Estos
procesos de conversión de energía están interconectados con las
vías para sintetizar los componentes de los ácidos nucleicos, las
~ 20 proteínas y otras sustancias clave, a partir de moléculas más sencillas. Con el per-
CAPÍTULO 2 • Evolución bioquímica feccionamiento de los procesos de transformación de la energía y de las vías de bio-
síntesis, se desarrollaron una gran variedad de organismos unicelulares. La cuarta
etapa fue la evolución de los mecanismos que permitían a las células ajustar su bio-
química a entornos diferentes y, a menudo, cambiantes. Organismos con estas ca-
pacidades pudieron formar colonias compuestas por grupos de células capaces de
interaccionar y algunos finalmente evolucionaron hacia organismos pluricelulares
complejos.
Este Capítulo describe los retos principales que se presentaron en la evolución
de la vida, cuyas soluciones serán desarrolladas en capítulos posteriores. La utili-
zación de esos procesos fundamentales es más comprensible cuando exploramos su
posible origen evolutivo en constraste con otras alternativas.

2.1 LOS SERES VIVOS UTILIZAN MOLÉCULAS


ORGÁNICAS CLAVE

Como ya hemos mencionado, la vida apareció aproximadamente mil millones de


años después de la formación de la Tierra. Pero antes de que la vida pudiese exis-
tir fue necesario que otro proceso fundamental tuviese lugar- la síntesis de las mo-
léculas orgánicas necesarias para los sistemas vivos, a partir de moléculas sencillas
presentes en el entorno. Los componentes de los ácidos nucleicos y las proteínas
son moléculas orgánicas relativamente complejas, y uno podría esperar que sólo se
pudieran producir por vías biosintéticas complicadas. Sin embargo, no parece que
esto fuese necesario. ¿Cómo aparecieron los bloques de construcción o precursores
de la vida?

2.1.1 Muchos componentesde las macromoléculas bioquímicas


se pueden producir en reacciones prebióticas sencillas
Entre las distintas teorías que compiten para explicar las condiciones del mundo
Condensador prebiótico, ninguna es totalmente satisfactoria o está libre de interrogantes. Una te-
oría sostiene que la primera atmósfera de la Tierra era muy reductora, rica en me-
tano (CH4), amoniaco (NH3), agua (H20) e hidrógeno (H2) y que esta atmósfera
estaba sometida a grandes cantidades de radiación solar y relámpagos. De momento
supondremos que esas condiciones fueron las de la Tierra prebiótica. ¿Se pueden
sintetizar moléculas complejas en estas condiciones? En los años 50, Stanley Mi-
ller y Harold Urey elaboraron una respuesta a esta pregunta. Hicieron saltar una
descarga eléctrica, simulando relámpagos, a través de una mezcla de metano, amo-

W ):\ Muestra recoqida


para el análisis
niaco, agua e hidrógeno (Figura 2.1). Asombrosamente, estos experimentos dieron
una mezcla de compuestos orgánicos muy determinada, que incluía aminoácidos y
otras sustancias fundamentales para la bioquímica. El proceso produce los amino-
FIGURA 2.1 El experimento de Urey­Miller. ácidos glicina y alanina con un rendimiento aproximado del 2%, dependiendo de
Una descarga eléctrica (simulando un rayo) la cantidad de carbono añadido en forma de metano. Aminoácidos más complejos,
pasando a través de una atmósfera de CH4, tales como ácido glutámico y leucina se producen en cantidades más pequeñas (Fi-
NH3, H20 e H2 conduce a la producción de gura 2.2). El ácido cianhídrico (HCN), otro probable componente de la atmósfera
compuestos orgánicos clave, tales como los primitiva, se condensa al exponerse al calor o la luz para producir adenina, una de
aminoácidos.

H~ _,H
c
•H3N/ -.. . . .coo-
Gllclna

FIGURA 2.2 Productos de la síntesis prebiótica. Aminoácidos sintetizados en el


experimento de Urey­Miller.
21 r­
Requisitos de la evolución

FIGURA 2.3 Síntesis preblótlca de un


componente de los ácidos nucleicos.
La adenina se puede producir a partir de
Adenlna la condensación de HCN.

las cuatro bases de los ácidos nucleicos (Figura 2.3). Otras moléculas sencillas se
combinan para formar el resto de las bases. Una gran cantidad de azúcares, inclu-
yendo la ribosa, se pueden formar a partir de formaldehído en condiciones pre-
bióticas,

2.1.2 El origen de algunas moléculas clave está ensombrecido


por la incertidumbre
La observación anterior sugiere que muchos de los precursores que se encuentran
en Biología son inusualmente sencillos de sintetizar y que se podrían haber acu-
mulado en cantidades significativas a través de la acción de procesos no biológi-
cos. No obstante, es importante tener presente que hay muchas incertidumbres. Por
ejemplo, la ribosa es uno de los muchos azúcares que se forman en condiciones
prebióticas. Sin embargo, la ribosa es bastante inestable en condiciones prebióti-
cas y además se presenta en dos formas que son imágenes especulares, de las cua-
les sólo una está presente en el RNA actual. Para resolver este problema se ha su-
gerido que la primera molécula de tipo ácido nucleico tenía las bases unidas a un
esqueleto distinto, y que la incorporación de la ribosa para formar ácidos nuclei-
cos, tal y como los conocemos hoy, sólo se produjo más tarde en la evolución.
Aunque no sabemos cómo, de alguna manera se produjeron un conjunto de molé-
culas prebióticas y, de este conjunto, las que tenían propiedades favorables para
el proceso que nosotros ahora asociamos con la vida, comenzaron a interaccionar
y a formar compuestos más complejos. Los procesos mediante los que los orga-
nismos actuales sintetizan los precursores moleculares se estudiarán en los Capí-
tulos 24, 25 y 26.

2.2 LA EVOLUCIÓN NECESITA REPRODUCCIÓN,


VARIACIÓN V PRESIÓN SELECTIVA

Una vez que los precursores estuvieron disponibles, ¿cómo surgieron y evolucio-
naron los seres vivos? Antes de la aparición de la vida, debieron haber existido sis-
temas moleculares sencillos que, posteriormente, evolucionaron hacia los sistemas
químicos complejos que caracterizan a los organismos. Para abordar el estudio de
esta evolución, necesitamos considerar el proceso evolutivo. Hay varios principios
básicos comunes a los sistemas en evolución, tanto si son simples colecciones de
moléculas como poblaciones de organismos en competición. Primero, la propiedad
fundamental de los sistemas en evolución es su capacidad para replicarse o repro-
ducirse. Sin su capacidad de reproducción, cada "especie molecular" que pueda apa-
recer está condenada a la extinción, tan pronto como todas sus moléculas indivi-
duales se degraden. Por ejemplo, las moléculas individuales de los polímeros
biológicos, tales como los ácidos ribonucleicos, son degradadas mediante reaccio-
nes de hidrólisis y otros procesos. Sin embargo, las moléculas capaces de replicarse
seguirán representadas en la población, incluso si el tiempo de vida de cada mo-
lécula individual sigue siendo corto.
---, 22 1----------- El segundo principio fundamental de la evolución es la variación. Los sistemas
CAPÍTULO 2 • Evolución bioquímica que se replican deben sufrir cambios. Después de todo, si un sistema se replica siem-
pre perfectamente, la molécula replicada será igual a las moléculas progenitoras o
parentales y la evolución no podrá tener lugar. La naturaleza de estas variaciones
en los sistemas vivos se trata en la sección 2.2.5.
El tercer principio básico de la evolución es la competición. Las moléculas
que se replican compiten entre sí por los recursos disponibles, tales como los pre-
cursores químicos, y la competición permite que ocurra el proceso biológico de
la evolución por selección natural. La variación producirá distintas poblaciones
de moléculas. Algunas de las variantes que surjan pueden estar, por casualidad,
mejor adaptadas que las moléculas progenitoras para sobrevivir y replicarse en las
condiciones predominantes. Las condiciones predominantes ejercen una presión
selectiva que proporciona una ventaja a una de las variantes. Esas moléculas que
son más capaces de sobrevivir y replicarse, aumentarán en concentración relativa.
Por tanto, surgen nuevas moléculas que son más capaces de replicarse en las con-
diciones de su entorno. El mismo principio es válido para los organismos actua-
les. Los organismos se reproducen, presentan variaciones entre organismos indi-
viduales y compiten por los recursos; las variantes con ventajas evolutivas se
reproducirán con más éxito. Los cambios que conducen a la variación todavía tie-
nen lugar a nivel molecular, pero la ventaja evolutiva se manifiesta a nivel del or-
ganismo.

2.2.1 Los principios de la evolución pueden demostrarse


in vitro
Existen pruebas de que la evolución puede tener lugar a nivel molecular. En 1967,
Sol Spiegelman demostró, en un experimento que le permitió observar la evolu-
ción molecular en un tubo de ensayo, que las moléculas que se replican pueden
desarrollar nuevas formas. Utilizó como potagonistas evolutivos, moléculas de
RNA obtenidas de un virus bacteriano llamado bacteriófago Qj3. El genoma del
bacteriófago Ql3 es un RNA de una sola hebra de aproximadamente 3300 pares de
bases, cuya replicación depende de la actividad de un complejo proteico llamado
replicasa Qj3. Spiegelman mezcló la replicasa con una población inicial de molé-
culas de RNA de Qj3. En condiciones en las que hay cantidad suficiente de pre-
cursores, sin restricciones de tiempo y sin otra presión selectiva, la composición
de la población no cambia con respecto a la de las moléculas progenitoras que se
replican. Sin embargo, cuando se aplica presión selectiva, la composición de lapo-
blación de moléculas puede cambiar drásticamente. Por ejemplo, la disminución
del tiempo disponible para la replicación de 20 a 5 minutos daría, al mantenerla
durante 75 generaciones, una población de moléculas dominadas por una especie
única compuesta de sólo 550 bases. Esta especie se replica 15 veces más rápida-
mente que el Ql3 RNA parental (Figura 2.4). Spiegelman aplicó otras presiones se-
lectivas, por ejemplo, limitando la concentración de precursores o añadiendo com-
puestos que inhiben el proceso de replicación. En todos los
casos, aparecieron nuevas especies que se replicaban más efi-
l cazmente en las condiciones establecidas.
"'·~> El proceso evolutivo demostrado en este estudio, depende
550 bases de la existencia de una maquinaria para la replicación de los
~"' fragmentos de RNA que consiste en la replicasa de Qj3. Como
e
-o mencionamos en el Capítulo 1, una de las características más
'o
"'o
J5 elegantes de los ácidos nucleicos es que el mecanismo para
o.. su replicación se infiere de forma natural de su estructura mo-
lecular. Esta observación sugiere que los ácidos nucleicos,
o 25 50 75 quizás el RNA, podrían haberse transformado en autorrepli-
Número de generaciones cativos. Ciertamente los resultados de los estudios han de-
FIGURA 2.4 La evolución en un tubo de ensayo. Ejerciendo una mostrado que RNAs de una sola hebra pueden servir como
presión selectiva se pueden generar especies altamente replicativas moldes para la síntesis de su hebra complementaria y que esta
de moléculas de RNA a partir de Qi3 RNA. Las curvas verde y azul biosíntesis puede transcurrir espontáneamente; es decir, sin
corresponden a especies de tamaño intermedio que se acumulan una maquinaria de replicación producida biológicamente. Sin
y luego desaparecen durante el experimento. embargo, los investigadores no han encontrado todavía las
condiciones en las que una molécula de RNA sea totalmente capaz de una auto- 23 r­
rreplicación independiente a partir de un material de partida sencillo. Requisitos de la evolución

2.2.2 Las moléculas de RNA pueden actuar como catalizadores


El desarrollo de capacidades más allá de la simple replicación necesita de la pro-
ducción de catalizadores específicos. Un catalizador es una molécula que acelera
una reacción química determinada, sin que ella se altere en el proceso. Las propie-
dades de los catalizadores serán comentadas con detalle en los Capítulos 8 y 9. Al-
gunos catalizadores son muy específicos; activan ciertas reacciones sin afectar sus-
tancialmente procesos estrechamente relacionados. Tales catalizadores permiten que
tengan lugar, de forma preferente, las reacciones de vías específicas en lugar de las
de posibles vías alternativas. Hasta los años ochenta se creía que todos los catali-
zadores biológicos, llamados enzimas, eran proteínas. Entonces, Tom Cech y Sid-
ney Altman, independientemente, descubrieron que ciertas moléculas de RNA po-
dían ser catalizadores eficientes. A estos RNA catalizadores se les ha denominado
ribozimas. El descubrimiento de los ribozimas ha sugerido la posibilidad de que las
moléculas de RNA catalíticas pudieran haber desempeñado papeles esenciales en
etapas tempranas de la evolución de la vida.
La capacidad catalítica de las moléculas de RNA está relacionada con la posi-
bilidad de adoptar estructuras específicas y complejas. Este principio está ilustrado
por el ribozima "cabeza de martillo", una estructura del RNA que fue identificada
por primera vez en virus de plantas (Figura 2.5). Esta molécula de RNA induce la
hidrólisis de moléculas de RNA determinadas en lugares específicos; esta hidróli-
sis es necesaria en ciertos momentos del ciclo de vida de los virus. El ribozima, que
necesita Mg2+ y otros iones para que tenga lugar la hidrólisis, forma un complejo
~ Este icono, que aparece a lo largo
con la molécula de RNA sustrato que puede adoptar, entonces, una conformación del libro, indica la posibilidad de explorar
reactiva. otros recursos disponibles en la página
La existencia de moléculas de RNA que establecen uniones específicas y tienen Web de Biochemistry, www.whfreeman.
propiedades catalíticas hace plausible la idea de un mundo primitivo de RNA, habi- com/biochem5. Este icono, en la leyenda
tado por formas de vida en las que las moléculas de RNA realizarían las funciones de una figura, indica una Figura Animada
que permite interaccionar con representa­
principales, incluyendo las importantes en la herencia, el almacenamiento de la in-
ciones tridimensionales de la ilustración.
formación y la activación de reacciones específicas; es decir, el metabolismo bio- Véase la página web y seleccione el Capí­
síntético y energético. tulo y el número de la figura.

(A) Ribozima

C C AGCCG---5'
3'

Sustrato

~ FIGURA 2.5 RNA catalítico.


(A) Patrón de complementariedad de bases
3' 5' de un ribozima "cabeza de martillo" y su
sustrato. (B) Conformación plegada del
complejo. El ribozima hidroliza el enlace en
el sitio de escisión. El curso de los esqueletos
de los ácidos nucleicos está resaltado en rojo
y azul.

2.2.3 Los aminoácidos y sus polímeros pueden llevar a cabo


funciones biosintéticas y catalíticas
En un mundo primitivo de RNA, la población creciente de moléculas de RNA ca-
paces de replicarse, habría consumido los precursores del RNA que se hubieran
formado a lo largo de periodos de tiempo larguísimos, mediante las reacciones
prebióticas. La escasez de estos compuestos habría favorecido la evolución de me-
~ 24 1----------
CAPÍTULO 2 • Evolución bioquímica
Glicina

e
e

Acido aspártico Pirlmldlna

FIGURA 2.6 Biosíntesis de las bases de


RNA. Los aminoácidos son los precursores de
las purinas y pirimidinas. Glutamlna

canismos alternativos para su síntesis. Existe un gran número de vías posibles. El


análisis de las vías biosínteticas utilizadas por los organismos actuales puede ser
una manera de determinar qué vías han sobrevivido. Un dato sorprendente es que,
como precursores para las bases del RNA, se utilizan aminoácidos sencillos (Fi-
gura 2.6). Tanto para las purinas (adenina y guanina) como para las pirimidinas
(uracilo y citosina), un aminoácido sirve de núcleo sobre el que se construye el
resto de la base. Por otra parte, los átomos de nitrógeno son donados por el grupo
amino del aminoácido aspártico y el grupo amida de la cadena lateral de la glu-
tamina.
Enlaces peptídicos
Los aminoácidos son químicamente más versátiles que los ácidos nucleicos, por-
que sus cadenas laterales poseen una gran diversidad de funciones químicas. Así
pues, los aminoácidos o los polímeros cortos de aminoácidos unidos por enlaces
peptídicos, llamados polipéptidos(Figura 2.7), quizás hayan funcionado como com-
ponentes de ribozimas para proporcionar una actividad específica. Además, los po-
lipéptidos más largos son capaces de plegarse espontáneamente para formar estruc-
turas tridimensionales muy definidas, determinadas por la secuencia de aminoácidos
a lo largo de sus cadenas polipeptídicas. La capacidad de los polipéptidos para ple-
Aminoácido Aminoácido Aminoácido garse espontáneamente dando estructuras elaboradas, las cuales permiten interac-
1 2 3
ciones químicas muy específicas con otras moléculas, puede haber favorecido la ex-
FIGURA 2.7 Un polímero funcional pansión de sus funciones durante la evolución y es crucial para explicar su posición
alternativo. Las proteínas están constituidas dominante en los organismos actuales. Hoy en día, la mayor parte de los cataliza-
por aminoácidos unidos mediante enlaces dores biológicos (enzimas) no son ácidos nucleicos, sino cadenas polipeptídicas
peptídicos. grandes, llamadas proteínas.

2.2.4 La síntesis de las cadenas polipeptídicas, dirigida por un


molde de RNA, une el mundo del RNA y el de las proteínas
Los polipéptidos habrían desempeñado un papel muy limitado en las etapas tem-
pranas de la evolución de la vida, porque sus estructuras no están adaptadas a la
autorreplicación de la misma manera que lo está la estructura de los ácidos nu-
cleicos. Sin embargo, los polipéptidos podrían haber estado indirectamente im-
plicados en los procesos evolutivos. Por ejemplo, si las propiedades de un poli-
péptido determinado favorecían la supervivencia y la replicación de una clase de
moléculas de RNA, entonces estas moléculas de RNA podían haber desarrollado
actividades de ribozimas que promovieran activamente la síntesis de polipépti-
dos. Este método de producir polipéptidos con secuencias de aminoácidos espe-
cíficas tiene varias limitaciones. Primero, parece probable que sólo se podrían
producir de esta manera determinados polipéptidos relativamente cortos. Se-
gundo, sería difícil unir, en el polipéptido, de forma precisa y reproducible, un
aminoácido particular. Por último, sería necesario un ribozima distinto para cada
polipéptido. El punto crítico en la evolución se alcanzó cuando se desarrolló un
La cadena polipeptídica

b
Un tRNA transportando en crecimiento
un aminoácido se transfiere al nuevo
Am~~::::o{I\
polipeptídica se une al aminoácido El RNA
en crecimiento 2 molde de RNA. incorporado. libre sale.

tRNA AU (j
5'· ... G UACG UAG CUU ... ­3' 5'· ... G UACG UAG C uu ... ­3' 5'­ ... G UACG UAG C uu ... ­3' 5'­ ... G UACGUAGC UU ... ­3'

FIGURA 2.8 Unión de los mundos del RNA y las proteínas. La síntesis de polipéptidos está
dirigida por un molde de RNA. Las moléculas del RNA adaptador, con aminoácidos unidos,
se unen secuencialmente al molde de RNA para facilitar la formación de un enlace peptídico
entre cada dos aminoácidos. La cadena polipeptídica creciente permanece unida a un RNA
adaptador hasta que se completa la síntesis.

aparato para la síntesis de polipéptidos que permitía que La secuencia de bases


de una molécula de RNA dictase directamente la secuencia de aminoácidos en
el polipéptido. Se desarrolló un código que estableció una relación entre una de-
terminada secuencia de tres bases en el RNA y un aminoácido. Ahora, a este con-
junto de combinaciones de tres bases, cada una codificando un aminoácido, lo
llamamos código genético. Hoy en día existe, en los organismos actuales, un sis-
tema de descodificación o traducción, formado por el ribosoma y los factores
asociados que son responsables de las síntesis de, prácticamente, todos los poli-
péptidos, a partir de moldes de RNA. La esencia de esta forma de síntesis de po-
lipéptidos se recoge en la Figura 2.8.
Una molécula de RNA (RNA mensajero o mRNA), conteniendo en su secuen-
cia de bases la información que especifica una determinada proteína, actúa como
molde para dirigir la síntesis del polipéptido. Cada aminoácido se dirige al molde
unido a una molécula adaptadora específica para ese aminoácido. Estos adapta-
dores son moléculas de RNA especializadas (llamadas RNA de transferencia o tR-
NAs). Después del inicio de la cadena polipeptídica, una molécula de tRNA con
su aminoácido asociado se une al molde a través de interacciones de pares de ba-
ses de Watson-Crick específicas. Dos de tales moléculas se unen al ribosoma y
un RNA componente de éste (llamado RNA ribosámico o rRNA) cataliza la for-
mación del enlace peptídico. El primer RNA sale, sin la cadena polipéptidica ni
el aminoácido unidos, y otro RNA con su aminoácido se une al ribosoma. La ca-
dena polipeptídica creciente se transfiere al nuevo aminoácido, recién incorpo-
rado, con la formación de un nuevo enlace peptídico. Este ciclo se repite. Este es-
quema permite que la secuencia del RNA molde codifique la secuencia del
polipéptido y, por consiguiente, haga posible la producción de largos polipéptidos
con secuencias específicas. El mecanismo de la síntesis de proteínas será estu-
diado en el Capítulo 29. Significativamente, el ribosoma está compuesto princi-
palmente por RNA y es un ribozima muy complejo, sugiriendo que quizás sea una
reliquia superviviente de aquel mundo de RNA.

2.2.5 El código genético revela el mecanismo de la evolución


La secuencia de bases que codifica la molécula de una proteína funcional se llama
gen. El código genético -es decir, la relación entre la secuencia de bases de un gen
y la secuencia de aminoácidos del polipéptido cuya síntesis dirige el gen- es vá-
lido, con pequeñas excepciones, para todos los organismos actuales. Esta universa-
lidad indica que el código genético se fijó muy pronto en el curso de la evolución
y se ha mantenido hasta nuestros días.
Ahora podemos examinar el mecanismo de la evolución. Primeramente, hemos
considerado cómo las variaciones son necesarias para la evolución. Podemos ver
ahora que tales variaciones en los sistemas vivos son cambios que alteran el signi-
ficado del mensaje genético. Estas variaciones se llaman mutaciones. Una mutación
puede ser, simplemente, un cambio en un único nucleótido (llamada mutación de
punto), de modo que una secuencia de bases que codificaba un aminoácido deter-
minado puede ahora codificar otro (Figura 2.9A). Una mutación puede también con-
sistir en la inserción o deleción de varios nucleótidos.
­­j 26 t------------- (A)
t AGCTGCGCATCTAG 1
t
CAPÍTULO 2 • Evolución bioquímica _ TCGACGCGTAGATC _

Sustitución de nucleótidos

1 .
_
AGCTGCACATCTAG ...
... TCGACGTGTAGATC. ..
1

1 ~. 1
(B)
AGCTGCGCATCTAG ...

t
_ ... TCGACGCGTAGATC. .. _
FIGURA 2.9 Mecanismos de la evolución.
Un cambio en un gen puede ser (A) tan Duplicación de genes
simple como el cambio en una sola base ó
(B) tan espectacular como una duplicación ... AGCTGCGCATCTAG... . .. AGCTGCGCATCTAG ...
génica parcial o completa. ... TCGACGCGTAGATC... . .. TCGACGCGTAGATC. ..

Otro tipo de alteraciones permiten la evolución más rápida hacia nuevas ac-
tividades bioquímicas. Por ejemplo, secciones enteras del material codificante
pueden ser duplicadas, un proceso conocido como duplicación génica (Figura
2.9B). Uno de los productos de la duplicación puede acumular mutaciones y, fi-
nalmente, evolucionar para dar un gen con una función distinta, aunque relacio-
nada con la anterior. Además, partes de un gen pueden ser duplicadas y añadi-
das a partes de otro para dar lugar a un gen completamente nuevo, que codifica
una proteína con propiedades relacionadas con cada uno de los genes progenito-
res. Los organismos superiores contienen muchas familias de enzimas y otras ma-
cromoléculas que están, de forma evidente, emparentadas entre sí, de esta ma-
nera. Por tanto, la duplicación de genes seguida de la especialización ha sido un
proceso crucial en la evolución, ya que permite la generación de macrornolécu-
las que desarrollan determinadas funciones, sin la necesidad de empezar desde
cero. La acumulación de genes con diferencias sutiles o muy grandes, permite la
generación de procesos y vías bioquímicas más complicadas y por tanto, orga-
nismos más complejos.

2.2.6 Los RNA de transferencia ilustran la evolución a través de


la duplicación de los genes
3'
Lugar de unión Los RNA de transferencia son los adaptadores que asocian un aminoácido con
del aminoácido su secuencia correcta de bases. Las moléculas del RNA de transferencia son es-
tructuralmente similares entre sí; cada una adopta una forma tridimensional de
hoja de trébol por la interacción de grupos de pares de bases (Figura 2.10). Di-
ferencias sutiles en sus estructuras permiten a la maquinaria de síntesis de pro-
teínas distinguir moléculas de RNA de transferencia específicas para cada ami-
noácido.
Esta familia de moléculas de RNA de transferencia emparentadas se originó, con
toda probabilidad, mediante la duplicación de genes seguida de especialización. Una
secuencia de ácidos nucleicos codificando un miembro de la familia se duplicó y
las dos copias evolucionaron independientemente para generar moléculas con es-
pecificidades para distintos aminoácidos. Este proceso se repitió, empezando por un
gen de RNA de transferencia primigenio, hasta que aparecieron los 20 (o más) dis-
tintos miembros de la familia de los RNAs de transferencia, presentes en los orga-
nismos actuales.

2.2.7 El DNA es una forma estable de almacenamiento de la


FIGURA 2.10 Modelo de hoja de trebol informacióngenética
del tRNA. El patrón de interacciones en el
emparejamiento de bases para todos los Es muy posible que el RNA fuese utilizado, en épocas muy tempranas de la histo-
RNAs de transferencia demuestra que ria de la vida, para almacenar información. Sin embargo, en los organismos actua-
todas estas moléculas tienen un origen les (con la excepción de algunos virus), el DNA (ácido desoxirribonucleico) deri-
evolutivo común. vado del RNA, lleva a cabo esta función (secciones 1.1.1 y 1.1.3). El grupo
27
o Requisitos de la evolución

base

~
O OH o
º-~I º-~I
-
o
.)\ o -
o
,,;\ o

FIGURA 2.11 Comparación entre el RNA


O OH o y el DNA. La eliminación del grupo
- º-~I º-~I
·,P.
o-/\ p
-
o
.)\ p hidroxilo en posición 2' en el RNA para
formar el DNA da lugar a un eje que es
, menos susceptible de ser hidrolizado y por
tanto permite un almacenamiento más
RNA DNA estable de la información genética.

2' -hidroxilo de la unidad de ribosa del esqueleto del RNA está reemplazado por un
átomo de hidrógeno en el DNA (Figura 2.1.1).
¿Cuál es la ventaja selectiva del DNA en relación con el RNA como material
genético? El material genético debe ser extremadamente estable, de forma que la
información de su secuencia pase de una generación a la siguiente sin degradación.
El propio RNA es una molécula muy estable; las cargas negativas en el esqueleto
de azúcar-fosfato la protegen del ataque de iones hidroxilo que conduciría a una
escisión hidrolítica. Sin embargo, los grupos hidroxilo en posición 2' hacen que el
RNA sea susceptible a una hidrólisis catalizada por bases. Al quitar los grupos hi-
droxilo de la posición 2' de la ribosa, disminuye la velocidad de hidrólisis, aproxi-
madamente unas 100 veces en condiciones neutras y quizás aún más en condicio-
nes extremas. Por tanto, la conversión del material genético de RNA a DNA habría
aumentado su estabilidad química de forma considerable.
La transición evolutiva de RNA a DNA se refleja en la síntesis del DNA en
los organismos actuales. En todos los casos, los precursores que se usan en la sín-
tesis del DNA están sintetizados a partir de los correspondientes precursores del
RNA mediante la acción de enzimas llamados ribonucleótido reductasas. Estos
enzimas convierten los ribonucleótidos (una base y grupos fosfato unidos a un
azúcar ribosa) en desoxirribonucleótidos (una base y fosfatos unidos a un azúcar
desoxirribosai.

Ribonucleótido
reductasa

HO OH
Ribonucleótido Oesoxlrribonucleótldo

Las propiedades de las ribonucleótido reductasas varían significativamente de una


especie a otra, pero las evidencias sugieren que tienen un mecanismo de acción co-
mún y parecen haber evolucionado a partir de un mismo enzima primigenio.
Las estructuras covalentes del RNA y del DNA difieren en otro aspecto. Mien-
tras el RNA contiene uracilo, el DNA contiene un derivado metilado del uracilo de-
----j28>--~~~~~~- nominado timina. Esta modificación sirve también para proteger la integridad de la
CAPÍTULO 2 • Evolución bioquímica secuencia genética, si bien lo hace de una manera más indirecta. Tal y como vere-
mos en el Capítulo 27, el grupo metilo presente en la timina facilita la reparación
del DNA dañado, proporcionando una ventaja selectiva adicional.
Si bien el DNA reemplazó al RNA en la función de almacenador de la infor-
mación genética, el RNA mantiene muchas de sus otras funciones. El RNA todavía
proporciona el molde que dirige la síntesis de polipéptidos, las moléculas adapta-
doras, la actividad catalítica de los ribosomas y otras funciones. Así, el mensaje ge-
nético se transcribe del DNA al RNA y luego se traduce en proteínas.

Transcripción Traducción Plegamiento proteína


DNA RNA polipéptido
funcional
Ácido Ácido Secuencia de Estructura
nucleico nucleico aminoácidos tridimensional
lineal lineal lineal

Este flujo secuencial de información del DNA al RNA y a la proteína (que será es-
tudiado con detalle en los Capítulos 5, 28 y 29) se aplica a todos los organismos
actuales (con ligeras excepciones para ciertos virus).

2.3 LAS TRANSFORMACIONES ENERGÉTICAS SON


NECESARIAS PARA SUSTENTAR A LOS SERES VIVOS

La gran mayoría de las reacciones que conducen a la biosíntesis de ácidos nuclei-


cos y otras biomoléculas no están, en la mayor parte de las condiciones, favoreci-
das termodinámicamente, sino que necesitan de un aporte de energía para que se
lleven a cabo. Por tanto, se realizan sólo si están acopladas a procesos que liberan
energía. ¿Cómo pueden acoplarse las reacciones que necesitan energía y las que li-
beran energía? ¿Cómo se transforma la energía del entorno en una forma de ener-
gía que puedan utilizar los seres vivos? El objetivo de la mayor parte de este libro
es contestar esas preguntas fundamentales de la bioquímica.

2.3.1 El ATP, una divisa común en la energética bioquímica,


se puede generar mediante la rupturade moléculasorgánicas
Así como la mayor parte de las econornias simplifican el comercio usando mo-
nedas en lugar del trueque, los sistemas bioquímicos han desarrollado monedas
comunes para el intercambio de energía. Las más importantes de esas monedas
son moléculas relacionadas con la adenosina trifosfato (ATP), que contiene un
conjunto de tres fosfatos unidos (Figura 2.12). Los enlaces que unen los fosfa-
tos son estables en disolución en una amplia gama de condiciones, pero cuando
se rompen, se libera una cantidad de energía poco común, que se puede utilizar
para activar otros procesos. El papel del ATP y su uso para inducir otros proce-
sos será tratado en el Capítulo 14 y en muchos otros capítulos a lo largo de este
libro.

NH2
2- - -

__ _j IT IT ( o ~N

FIGURA 2.12 ATP, la divisa energética de


los seres vivos. Los enlaces fosfodiester HO OH
(en rojo) liberan mucha energía cuando se Adenosina trifosfato
rompen por hidrólisis u otro proceso. (ATP)
NH2
Punto de hidrólisis 2- 2-

(e H2
+
~\;°H
+
IT IT ( b ~N

+H3N "coo- o_).P"'·o

HO OH
Glicina Fosfato ADP

NH2
2- o
11 ­i ­i () ~N

=:
:.:.:-=:;P

FIGURA 2.13 Un posible método o


primitivo para producir ATP.
La síntesis de ATP podría haber sido
dirigida por la degradación de la HO OH
glicina. Acido acético Amoniaco ATP

El ATP debe ser producido en cantidades adecuadas a fin de estar disponible para
esas reacciones. La energía necesaria para la síntesis del ATP se puede obtener me-
diante la ruptura de otros compuestos químicos. Ciertos enzimas específicos han evo-
lucionado para acoplar estos procesos degradativos a la fosforilación de la adenosina
difosfato (ADP) para dar ATP. Aminoácidos tales como la glicina, los cuales proba-
blemente existían en cantidades relativamente grandes en el mundo prebiótico y en
etapas tempranas de la evolución, fueron, posiblemente, fuentes de energía para la
generación de ATP. La degradación de glicina a ácido acético pudo ser un sistema
de generación de ATP que funcionase al principio de la evolución (Figura 2.13). En
esta reacción, el enlace carbono-nitrógeno de la glicina se hidroliza por reducción
(la adición de electrones) y la energía liberada por la hidrólisis de este enlace con-
duce al acoplamiento del ADP y el ortofosfato (P;) para producir ATP.
Los organismos modernos siguen hidrolizando aminoácidos para producir ATP.
Sin embargo, los azúcares, tales como glucosa, son la fuente de energía más común-
mente utilizada, porque pueden metabolizarse más fácilmente y, además, pueden al-
macenarse. El proceso más importante para la síntesis directa de ATP en los organis-
mos actuales es la glicolisis, un proceso complejo que obtiene energía de la glucosa.

Glucosa Piruvato

La glicolisis probablemente evolucionó como un proceso para la generación de ATP


después de que hidratos de carbono, tales como la glucosa, se produjesen en cantida-
des significativas por otras vías. La glicolisis se estudiará con detalle en el Capítulo 16.

2.3.2 Las células se formaron cuando los ácidos nucleicos


se rodearon de membranas
Los organismos actuales están formados por células. Una célula está formada por
ácidos nucleicos, proteínas y otras moléculas bioquímicas rodeadas por una mem-
brana construida con lípidos. Estas membranas delimitan su contenido y, por tanto,
las células tienen un exterior y un interior muy definido. Un lípido que, típica.mente,
forma membranas es la fosfatidilcolina.
---j 30 Hidrofóbico Hidrofílico
CAPÍTULO 2 • Evolución bioquímica
11

Fosfatidilcolina

La característica más importante de las moléculas que forman membranas, ta-


les como la fosfatidilcolina, es que son anfipáticas o anfifílicas, es decir, que con-
tienen ambos componentes hidrofílicos (que les gusta el agua) e hidrofóbicos (que
evitan el agua). Las moléculas que forman membranas constan de ácidos grasos,
cuyos largos grupos alquilo son hidrofóbicos, unidos a grupos hidrofílicos más
FIGURA 2.14 Representación cortos "grupos de cabeza" o "cabezas polares". Cuando tales lípidos están en con-
esquemática de una bicapa lipídica. tacto con el agua, se agregan espontáneamente para formar estructuras específi-
Estas estructuras definen los límites de cas, de manera que las partes hidrofóbicas de las moléculas se empaqueten jun-
las células. tas, lejos del agua, mientras que las partes hidrofílicas se exponen a la disolución
acuosa. La estructura más importante para la formación de las membranas es la
bicapa lipídica (Figura 2.14). La bicapa está constituida por dos capas de lípidos
colocados de tal forma que las colas de los ácidos grasos de cada capa interac-
cionan entre sí para formar un interior hidrofóbico, mientras que los grupos hi-
drofílicos interaccionan con la disolución acuosa de cada lado. Tales estructuras
de bicapas pueden plegarse sobre sí mismas para formar esferas huecas con el
compartimento interior lleno de agua. El interior hidrofóbico de la bicapa forma
una barrera entre las dos fases acuosas. Si tales estructuras se originan en pre-
sencia de otras moléculas, tales como ácidos nucleicos y proteínas, estas molé-
culas pueden quedar atrapadas en el interior, formando así estructuras semejantes
a células. La estructura de los lípidos y las bicapas lipídicas se estudiará con de-
talle en el Capítulo 12.
En algún momento de la evolución, se debió haber acumulado, mediante bio-
síntesis u otros procesos, suficiente cantidad de las moléculas anfipáticas apro-
piadas como para permitir que algunos ácidos nucleicos quedasen atrapados y se
formasen organismos semejantes a células. Tal compartimentación tiene muchas
ventajas. Cuando los componentes de una célula se rodean de una membrana, los
productos de las reacciones enzimáticas no difunden hacia el entorno sino que
se acumulan donde pueden ser utilizados por la célula que los produce. El al-
macenamiento está facilitado por el hecho de que casi todos los intermediarios
y otros compuestos bioquímicos poseen uno o más grupos cargados, tales como
fosfatos o carboxilatos. Al contrario que la mayor parte de las moléculas no car-
gadas o neutras, las moléculas cargadas no atraviesan fácilmente las membranas
lipídicas.

2.3.3 La compartimentación
necesita del desarrollo de bombas
de iones
A pesar de sus muchas ventajas, el encerrar los ácidos nucleicos y las proteínas
con membranas plantea varios problemas. Quizás los más significativos sean los
efectos de la ósmosis. Las membranas son algo permeables al agua y a molé-
culas no polares pequeñas, mientras que son impermeables a las macrornolécu­
Osmosis
las tales como los ácidos nucleicos. Cuando las macrornoléculas se concentran
El movimiento de un disolvente a través
en el interior de un compartimiento rodeado por una membrana semipermeable,
de una membrana en la dirección que
tiende a igualar la concentración de so­ las fuerzas osmóticas dirigen el agua a través de las membranas hacia ese com-
luto a ambos lados de la membrana. partimiento. Sin un efecto equilibrante, el flujo de agua reventaría la célula (Fi-
gura 2.15).
31 ~
Transformaciones energéticas

FIGURA 2.15 El "estrés osmótico".


Una célula formada por macromoléculas
rodeadas de una membrana semipermeable,
captará agua del exterior celular y estallará.

Las células actuales tienen dos mecanismos distintos para resistir estas fuerzas
osmóticas. Un mecanismo consiste en reforzar la membrana celular mediante la in-
corporación de una estructura adicional tal como una pared celular. Sin embargo,
una estructura química tan elaborada no puede haberse desarrollado rápidamente,
sobre todo porque para ser eficiente tiene que rodear la célula por completo. El
otro mecanismo es el uso de bombas de iones dependientes de energía. Estas bom-
bas pueden disminuir la concentración de iones en el interior de la célula con re-
lación al exterior, favoreciendo el flujo de agua desde el interior hacia el exterior.
La distribución desigual de iones a través de una membrana impermeable es lo que
se denomina un gradiente iónico. Gradientes iónicos apropiados pueden equilibrar
las fuerzas osmóticas y mantener una célula con un volumen constante. Las pro-
teínas de membrana, tales como las bombas de iones, serán estudiadas en el Ca-
pítulo 13.
Los gradientes iónicos pueden evitar el estrés osmótico, pero necesitan ener-
gía para originarse. Muy probablemente, el primer componente de la maquinaria
para la generación de un gradiente iónico que existió fue una bomba de proto-
nes propulsada por ATP (Figura 2.16). Tales bombas, que se encuentran prácti-
camente en todas las células actuales, hidrolizan ATP a ADP y fosfato inorgánico
y utilizan la energía liberada para transportar protones desde el interior hacia el
exterior de la célula. La bomba, por tanto, genera un gradiente de protones que,
a su vez, se puede acoplar a otros procesos de transporte a través de membranas FIGURA 2.16 La formación de un
tales como la eliminación de iones sodio de la célula. El gradiente de protones gradiente iónico. La hidrólisis de ATP se
y otros gradientes iónicos generados por este, actúan en conjunto para contra- puede utilizar para dirigir el bombeo de
rrestar los efectos osmóticos y proteger las células de la tumefacción y la rup- protones (y otros iones) a través de la
tura. membrana.

2.3.4 Los gradientes de protones se pueden utilizar para dirigir


la síntesis de ATP
Los enzimas actúan acelerando las reacciones, pero no pueden alterar la posición H+
H+ H+
del equilibrio químico. Un enzima que acelera una reacción hacia la derecha tam- H+ H"
bién debe acelerarla en la misma medida en sentido contrario. Por tanto, la exis- H+ H"
tencia de un enzima que utilizaba la hidrólisis del ATP para generar un gradiente de H+
protones proporcionó una gran oportunidad para la evolución de sistemas alternati- H+
vos para la generación de ATP. Tales enzimas podrían sintetizar ATP invirtiendo el w H+
proceso que produce el gradiente. Los enzimas que denominamos ATP sintasas usan, H+
de hecho, gradientes de protones para unir ADP a P; para formar ATP (Figura 2.17). H+
w
Estas proteínas serán estudiadas con detalle en el Capítulo 18.
Los organismos han desarrollado un gran número de mecanismos para la pro-
ducción de gradientes de protones a través de las membranas. Un ejemplo es el
de lafotosíntesis, un proceso que fue utilizado primero por las bacterias y ahora FIGURA 2.17 La utilización de un
también por las plantas, para recoger la energía lumínica del sol. La esencia de gradiente de protones para sintetizar
la fotosíntesis consiste en la transferencia dirigida por la luz de un electrón a tra- ATP. El ATP puede ser sintetizado por la
vés de una membrana. Los procesos fundamentales están representados en la Fi- acción de una bomba de protones
gura 2.18. dependiente de ATP, actuando a la inversa.
~ 32 f­­­­­­­­­­

CAPÍTULO 2 • Evolución bioquímica

Absorción
de luz

CD

FIGURA2.18 La fotosíntesis. La absorción


de luz (1) conduce a una transferencia de
l
+
lntercambio del
aceptor y reducción
,­,\!Transferencia
\V de electrones

­
electrones a través de una membrana (2).
Captación
Por cada electrón transferido, se genera un de protones
excesode iones hidroxilo en el interior de la
célula (3). El proceso produce un gradiente
de protones a través de la membrana que
puede conducir a la síntesis de ATP. OH

El aparato fotosintético, que está embebido en una membrana, contiene los pig-
mentos que absorben, con eficiencia, la luz del sol. La luz absorbida proporciona la
energía para elevar un electrón de la molécula de pigmento a un estado excitado.
El electrón de alta energía puede saltar a una molécula aceptora apropiada locali-
zada en la cara de la membrana que mira al interior de la célula. La molécula acep-
tora, ahora reducida, toma un protón de una molécula de agua, generando un ion
hidroxilo en el interior de la célula. El vacío electrónico que queda en el pigmento
de la cara externa de la membrana puede rellenarse mediante la donación de un elec-
trón de un reductor apropiado en la cara externa de la membrana. Dado que la ge-
neración de un ion hidroxilo en la célula es equivalente a la generación de un pro-
tón en el exterior celular, se establece un gradiente de protones a través de la
membrana. Los protones fluyen a favor de gradiente a través de las ATP sintasas
para generar ATP.
La fotosintésis es sólo uno entre una gama de procesos, en diferentes organis-
mos, que conducen a la síntesis de ATP mediante la acción de proteínas emparen-
tadas evolutivamente con las bombas primigenias dirigidas por ATP. En los anima-
les, la degradación de los hidratos de carbono y otros compuestos orgánicos es la
fuente del flujo de electrones a través de las membranas que se puede usar para de-
sarrollar gradientes de protones. La formación de gradientes de protones que gene-
ran ATP mediante metabolismo degradativo será tratado en el Capítulo 18 y la ab-
sorción de luz en el Capítulo 19.

2.3.5 El oxígeno molecular, un subproducto tóxico de algunos


procesos fotosintéticos, se puede utilizar con fines metabólicos
Tal y como hemos señalado antes, la fotosíntesis genera vacíos electrónicos en el
aparato fotosintético de la cara externa de la membrana. Estos vacíos son agentes
oxidantes muy poderosos, es decir, tienen mucha afinidad por los electrones y pue-
den extraerlos de muchos tipos de moléculas. Pueden incluso oxidar el agua. Por
tanto, para muchos organismos biosintéticos, el donador de electrones que completa
el ciclo fotosintético es el agua. El producto de la oxidación del agua es el oxígeno
gas, es decir, el oxígeno molecular (02):

El uso del agua como donador de electrones aumenta significativamente la eficien-


cia de la síntesis fotosintética de ATP, porque la generación de una molécula de oxí-
geno viene acompañada, no sólo de la liberación de cuatro electrones (e-), sino
también de la liberación de cuatro protones en una de las caras de la membrana. Por
tanto, por cada equivalente de protones producido en el proceso inicial de transfe- 33 r-
rencia de electrones se libera un protón adicional, de manera que están disponibles Respuesta al ambiente
el doble de protones para dirigir la síntesis de ATP. La producción de oxígeno será
tratada en el Capítulo 19.
Antes de que se desarrollasen organismos capaces de oxidar el agua, el oxígeno
estaba presente en la atmósfera sólo en muy pequeñas cantidades. La "contamina-
ción" del aire con el oxígeno producido por los organismos fotosintéticos afectó en
gran medida al devenir de la evolución. El oxígeno es bastante reactivo y, por tanto,
resultó muy tóxico para muchos seres vivos. Muchos procesos bioquímicos se han
desarrollado para proteger a las células de los efectos nocivos del oxígeno y de otras
especies reactivas, que se pueden generar a partir de esta molécula. Posteriormente,
los organismos desarrollaron mecanismos para aprovechar la reactividad del oxí-
geno para inducir otros procesos que resultasen favorables. Entre estos mecanismos,
los más importantes son los relacionados con la oxidación de compuestos orgáni-
cos, tales como la glucosa. A través de la acción del oxígeno, una molécula de glu-
cosa puede transformarse completamente en dióxido de carbono y agua, con la li-
beración de suficiente energía como para sintetizar, aproximadamente, unas 30
moléculas de ATP.
H C_......OH
H 2 O
Glucosa + 6 02 ~ 6 C02 + 6 H20 + energía
H~Ho­/­~OH
Esta cantidad representa un aumento de 15 veces en el rendimiento en ATP, com-
~H~
parado con el rendimiento de la degradación de glucosa en la glicolisis en ausencia
H
de oxígeno. Este incremento en la eficiencia se hace evidente en la vida diaria; nues-
Glucosa
tros músculos agotan sus reservas de combustible y se cansan más rápidamente si
no reciben suficiente oxígeno y se ven obligados a utilizar la glicolisis como única
fuente de ATP. El papel del oxígeno en la extracción de energía de las moléculas
orgánicas se tratará en el Capítulo 18.

2.4 LAS CÉLULAS PUEDEN RESPONDER


A CAMBIOS AMBIENTALES

El entorno en el que crecen las células cambia, a menudo, rápidamente. Por ejem-
plo, las células pueden consumir totalmente una fuente de alimento particular y de-
ben utilizar otra. Para sobrevivir en un mundo de cambios, las células desarrollaron
mecanismos para ajustar su bioquímica en respuesta a señales que indican cambios
en el entorno. Esos ajustes pueden presentar distintas formas, incluyendo cambios
en las actividades de moléculas enzimáticas preexistentes, cambios en la velocidad
de síntesis de nuevas moléculas de enzimas y cambios en los procesos de transporte
a través de las membranas.
Inicialmente, la detección de señales ambientales tuvo lugar en el interior de las
células. Ciertos compuestos químicos que podían pasar al interior de las células,
bien por difusión a través de la membrana celular o bien por la acción de proteínas
de transporte, eran capaces de unirse directamente a proteínas en el interior de la
célula y modular sus actividades. Un ejemplo es el uso del azúcar arabinosa por la
bacteria Escherichia coli (Figura 2.19). Las células de E. coli son normalmente in-
capaces de utilizar la arabinosa eficientemente como fuente de energía. Sin embargo,

Arabinosa.


Expresión de
Captura de los genes de
arabinosa arabinosa


• ••
FIGURA 2.19 Respondiendo a las condiciones ambientales. En las células de E. coli, la captura
de arabinosa del entorno dispara la producción de los enzimas necesarios para su utilización.
~ 34<--~~~~~~- si la arabinosa es la única fuente de carbono, las células de E. coli sintetizan enzi-
CAPÍTULO 2 • Evolución bioquímica mas que catalizan la conversión de este azúcar en moléculas útiles. Esta respuesta
está mediada por la propia arabinosa. Si está presente en cantidad suficiente en el
exterior de la célula, la arabinosa puede entrar a su interior a través de proteínas de
transporte. Una vez dentro de la célula, la arabinosa se une a una proteína llamada
AraC. Esta unión altera la estructura de AraC, de forma que puede unirse entonces
a lugares específicos del DNA bacteriano y estimular la transcripción a RNA de ge-
nes que codifican enzimas para metabolizar la arabinosa. El mecanismo de la re-
gulación génica se tratará en el Capítulo 31.
Posteriormente, aparecieron mecanismos para detectar señales en la superficie
celular. Las células podían entonces responder a las moléculas señal, incluso si ta-
les moléculas no pasaban al interior de la célula. Se desarrollaron proteínas recep-
toras que, embebidas en la membrana, podían unirse a compuestos químicos pre-
sentes en el entorno celular. La unión producía cambios en la estructura de la proteína
receptora que podían ser detectados en la cara interna de la membrana celular. De
esta manera, compuestos químicos en el exterior de la célula, podían influenciar
acontecimientos en el interior. Muchas de estas vías de transducción de señales uti-
lizan sustancias tales como adenosina monofosfato cíclico (cAMP) e iones calcio
como "segundos mensajeros" que pueden difundir a través de la célula, propagando
la información del cambio en el entorno.

2+
OH2
H20 1 ..' OH2

/J <,
H20­­­Céf"···
OH2
H20
OH2
AMP cíclico (cAMP) Ion calcio en agua

El segundo mensajero puede unirse a proteínas sensoras específicas del interior ce-
lular y disparar respuestas tales como la activación de enzimas. Los mecanismos de
transducción de señales se tratan con detalle en el Capítulo 15 y en varios otros ca-
pítulos a lo largo de este libro.

2.4.1 Estructuras filamentosas y motores moleculares permiten


los movimientos intracelulares y celulares
El desarrollo de la capacidad para moverse fue otra etapa importante en la evolu-
ción de las células para adaptarse a un entorno cambiante. Sin esta capacidad, las
células no fotosintéticas podrían haber muerto por inanición después de consumir
los nutrientes disponibles en las proximidades inmediatas.
Las bacterias se deslizan utilizando estructuras filamentosas denominadas fla-
gelos, que se extienden a partir de la membrana celular (Figura 2.20). Cada cé-
lula bacteriana tiene varios flagelos, los cuales, en condiciones apropiadas, for-
man haces rotativos que permiten a la célula desplazarse con eficiencia dentro del
agua. Estos flagelos son polímeros largos que constan, fundamentalmente, de mi-
les de subunidades proteicas idénticas entre sí. En la base de cada flagelo se en-
cuentran conjuntos de proteínas que pueden actuar como motores que dirigen su
rotación. La rotación de un motor flagelar está dirigida por el flujo de protones
desde el exterior al interior de la célula. Por tanto, la energía almacenada en forma
FIGURA 2.20 Bacteria con flagelos.
de un gradiente de protones se transduce a otra forma energética, el movimiento
Una bacteria (Proteus mirabilis) se desplaza de rotación.
nadando mediante la rotación de Otros mecanismos para el movimiento también dependientes de estructuras fi-
estructuras filamentosas llamadas flagelos. lamentosas se desarrollaron en otro tipo de células. Las estructuras más importan-
[Fred E. Hossler/Visuals Unlimited.] tes son los microfilamentos y los microtúbulos. Los rnicrofilarnentos son polímeros
de la proteína actina, y los microtúbulos son polímeros de dos proteínas estrecha-
mente relacionadas llamadas a y {3-tubulina. A diferencia de los flagelos bacteria-
nos, estas estructuras filamentosas son muy dinámicas; pueden aumentar o dismi-
nuir su longitud mediante la adición o sustracción de las moléculas proteicas que
las componen. Los microfilamentos y los microtúbulos también sirven como rieles
sobre los que otras proteínas se desplazan, impulsadas por la hidrólisis de ATP. Las
células pueden cambiar de forma mediante el movimiento de motores moleculares
proteicos a través de dichas estructuras filamentosas que, a su vez, cambian de forma
como resultado de una polimerización dinámica (Figura 2.21). Estos cambios co-
ordinados en la forma, pueden ser una manera de desplazar una célula sobre una
superficie y son cruciales en la división celular. Las proteínas motrices son, tam-
bién, responsables del transporte de orgánulos y otras estructuras en las células eu-
carióticas. Los motores moleculares se tratarán en el Capítulo 34.

2.4.2 Algunas células pueden interaccionar para formar colonias


con funciones especializadas FIGURA 2.21 Movimiento alternativo.
La movilidad celular se puede conseguir
Los organismos primitivos vivían exclusivamente como células independientes. Ta- cambiando la forma de la célula.
les organismos interaccionaban entre sí sólo de forma indirecta, al competir por los
recursos de su entorno. Algunos de estos organismos, sin embargo, desarrollaron la
capacidad de formar colonias compuestas por muchas células en interacción mutua.
En tales grupos, el entorno de cada célula está dominado por la presencia de las cé-
lulas que la rodean, las cuales estarán en contacto directo entre sí. Estas células se
comunican entre ellas mediante distintos mecanismos de señalización y pueden res-
ponder a las señales modificando la actividad enzimática o los niveles de expresión
génica. Un resultado pudo ser la diferenciación celular; las células diferenciadas
son genéticamente idénticas, pero tienen distintas propiedades porque sus genes se
expresan de forma diferente.
Varios organismos modernos son capaces de alternar entre una forma de cé-
lula aislada y otra forma de colonia multicelular de células diferenciadas. Uno de
los mejor caracterizados es el hongo acrasial Dictyostelium. En un entorno favo-
rable, este organismo vive como una célula individual; en condiciones de inani-
ción, sin embargo, las células se agrupan para formar un agregado celular. Este
agregado, a veces llamado pseudoplasmodio, se puede mover como una unidad
hacia un entorno potencialmente más favorable, donde forma una estructura mul-
ticelular, llamada cuerpo fructífero, que se eleva de forma notoria por encima de
la superficie donde las células están creciendo. El viento puede transportar las cé-
lulas liberadas de la copa del cuerpo fructífero a lugares donde el suministro de
alimento sea bastante mayor. Al llegar a un lugar con buenas reservas, las célu-
las crecen, se reproducen y viven como células independientes hasta que las re-
servas de comida se acaban (Figura 2.2.2).
La transición de un crecimiento unicelular a un crecimiento pluricelular, se dis-
para por la comunicación célula a célula y revela mucho acerca del proceso de se-
ñalización entre y en las células. En condiciones de inanición, las células de
Dictyostelium, liberan la molécula señal de AMP cíclico. Esta molécula informa a
las células del entorno uniéndose a una proteína receptora unida a membrana de la

FIGURA 2.22 La transición de unicelular a pluricelular en Dictyostelium.


Esta imagen de microscopía electrónica de barrido muestra la transformación
experimentada por el hongo acrasial Dictyostelium. Cientos de miles de células
individuales se agregan para formar una pseudoplasmodio en movimiento, como
se ve en la esquina inferior izquierda. Una vez que el pseudoplasmodio se para,
gradualmente se alarga para formar el cuerpo fructífero. [Cortesía de M.J. Grimsan y R.L.
Blanton, Texas, Tech University.]
-----1 36 !­­­­­­­­­­
CAPÍTULO 2 • Evolución bioquímica

FIGURA 2.23 Señales intracelulares. El AMP cíclico, detectado por receptores de la


superficie celular, inicia la formación de agregados en Dictyostelium.

superficie celular. La unión de las moléculas de cAMP a estos receptores dispara


varias respuestas, incluyendo el desplazamiento en dirección hacia concentraciones
de cAMP más elevadas, así como la producción y liberación de más moléculas de
cAMP (Figura 2.23).
Al seguir los gradientes de cAMP, las células se agregan. Una vez en contacto,
intercambian señales adicionales y entonces se diferencian en distintos tipos ce-
lulares, cada uno de los cuales expresa un conjunto de genes adecuados para su
papel final en la formación del cuerpo fructífero (Figura 2.24). El ciclo de vida
de organismos tales como Dictyostelium presagia la evolución hacia organismos
que son pluricelulares a lo largo de toda su vida. Es interesante señalar que el
cAMP es la "señal de hambre" en muchos organismos, incluyendo los seres hu-
manos.

2.4.3 El desarrollo de organismos multicelulares necesita la di-


FIGURA 2.24 Diferenciación celular en
Dictyostelium. Los colores representan la
ferenciación organizada de las células
distribución de tipos celulares que El registro fósil indica que los organismos pluricelulares macroscópicos aparecie-
expresan un mismo grupo de genes en el ron hace aproximadamente 600 millones de años. La mayor parte de los organis-
cuerpo fructífero de Dictyostelium. mos que nos son familiares están formados por muchas células. Por ejemplo, un ser
humano adulto contiene, aproximadamente, 100 billones de células (1014). Las cé-
lulas que forman distintos órganos son diferentes e, incluso, en un mismo órgano,
se encuentran presentes muchos tipos celulares distintos. Sin embargo, la secuencia
del DNA en cada célula es idéntica. Las diferencias entre tipos celulares son el re-
sultado de diferencias en la manera en que estos genes se expresan.
Todos los organismos pluricelulares empiezan como una única célula. Para que
esta célula se desarrolle hasta un organismo complejo, las células embrionarias de-
ben seguir un complicado programa de expresión génica, división celular y movi-
miento celular regulado. El programa de desarrollo depende sustancialmente de la
respuesta de las células al entorno creado por las células vecinas. Células en posi-
ciones específicas en el embrión en desarrollo se dividen para formar tejidos deter-
minados, tales como los músculos. Las vías de desarrollo han sido estudiadas ex-
haustivamente en numerosos organismos, incluido el nemátodo Caenorhabditis
elegans (Figura 2.25), una lombriz de 1 mm de longitud que tiene 959 células. En
la Figura 2.26 se muestra un mapa detallado que describe el destino de cada célula
de C. elegans, desde el huevo fecundado al adulto. Curiosamente, el desarrollo apro-
piado necesita no sólo la división celular, sino además la muerte de determinadas
células en momentos prefijados a través de un proceso llamado muerte celular pro-
gramada o apoptosis.
Las investigaciones sobre los genes y las proteínas que controlan el desarrollo
en un amplio grupo de organismos, han revelado muchos hechos universales. Mu-
chas de las moléculas que controlan el desarrollo humano están relacionadas desde
FIGURA 2.25 El nemátodo Caenorhabditis el punto de vista evolutivo con las de organismos relativamente sencillos tales como
e/egans. Este organismo sirve como C. elegans. Por tanto, las soluciones al problema de controlar el desarrollo en or-
modelo muy útil para estudiar el ganismos pluricelulares aparecieron tempranamente en la evolución y han sido apli-
desarrollo. [Sinclair Stammers Science Photo cadas muchas veces en el curso de ésta, generando así una gran diversidad de or-
Library/Photo Researchers.] ganismos complejos.
Cigoto (una célula)

·1~~ínea
germinal

o
c..
E
Q)
i=

2.4.4 La unidad de la bioquímica permite que la biología FIGURA 2.26 Vías del desarrollo de
C. elegans. El nemátodo se desarrolla a
humana pueda ser eficazmente comprobada mediante
partir de una sola célula, llamada cigoto,
estudios en otros organismos hasta un organismo complejo. El destino
Todos los organismos de la Tierra tienen un origen común (Figura 2.27). ¿Cómo de cada célula individual en C. elegans se
conoce y puede seguirse mediante el
pudieron los organismos complejos, como los seres humanos, haber evolucio-
diagrama de linea celular.
nado a partir de los organismos tan simples, que existían al inicio de la vida? El Las etiquetas indican células que forman
recorrido bosquejado en este Capítulo pone de manifiesto que la mayor parte de órganos específicos. Las células que
los procesos fundamentales de la bioquímica se establecieron en etapas tempra- experimentan muerte celular programada
nas de la historia de la vida. La complejidad de organismos, tales como los se- se muestran en rojo.
res humanos, se manifiesta, a nivel bioquímico, en la interacción entre vías que
se solapan y compiten, lo cual lleva a la producción de grupos de células espe-
cializadas complejamente conectadas. La evolución de la complejidad bioquí-
mica y fisiológica es posible debido a los efectos de la duplicación de genes se-
guida por la especialización. Paradójicamente, la dependencia de la duplicación
de genes hace incluso más fácil comprender esta complejidad. Consideremos, por
ejemplo, las proteína quinasas: enzimas que transfieren grupos fosforilo del ATP
a determinados aminoácidos en las proteínas. Estos enzimas juegan papeles esen-
ciales en muchas rutas de transducción de señales, en el control del crecimiento
celular y en la diferenciación. El genoma humano codifica, aproximadamente,
500 proteínas de este tipo; incluso organismos sencillos, tales como las levadu-
ras unicelulares de la cerveza, tienen más de 100 proteína quinasas. Sin embargo,
cada uno de estos enzimas es el descendiente evolutivo de un enzima común an-
cestral. Por tanto, podemos aprender mucho acerca del comportamiento esencial
de esta gran colección de proteínas a través de estudios de un solo miembro de
la familia. Después de entender el comportamiento esencial, se pueden evaluar
las adaptaciones específicas que permiten a cada miembro de la familia llevar a
cabo su función biológica específica.
La mayor parte de los procesos básicos de la biología han sido caracterizados,
primero en organismos relativamente sencillos, con frecuencia a través de una com-

~
Q)
i=
~ "'o
Q) E "'
o "'oe
"O "'
·1: ro
o c.. "'
V,-~

e o
-o
ro
e' "'
....,
ro E'º º§ E:::,
·o o o "'u
·­"' ro s:
ro
E e ·.:::
ro Formación de
e
ro.._o
u "'e
o "'
o u O\ Q)
u .._ ro
:::, una atmósfera Qi
u.. ~ w
de oxígeno
OE ci V>

t t t t t t FIGURA 2.27 Un posible diagrama


cronológico para la evolución
4,5 4,0 3,5 3,0 2,5 2,0 1,5 1,0 0,5 0,0 bioquímica. Se señalan los sucesos clave.
~ 38 binación de estudios genéticos, fisiológicos y bioquímicos. Muchos de los procesos
CAPÍTULO2 • Evolución bioquímica que controlan las fases tempranas del desarrollo embrionario se han descubierto me-
diante estudios realizados sobre la mosca de la fruta. Los acontecimientos que con-
trolan la replicación del DNA y el ciclo celular fueron descifrados por primera vez
en levaduras. Los investigadores pueden ahora, comprobar las funciones de una de-
terminada proteína en mamíferos inutilizando los genes que codifican estas proteí-
nas en el ratón y examinando los efectos obtenidos. La investigación de organismos
unidos a nosotros mediante rutas evolutivas comunes constituye una herramienta
poderosa para explorar toda la biología y para desarrollar una nueva comprensión
de las funciones humanas normales y patológicas.

RESUMEN

Los seres vivos utilizan moléculas orgánicas clave


La evolución de la vida necesita una serie de etapas, empezando con la gene-
ración de moléculas orgánicas que puedan servir como precursores o bloques
de construcción de las moléculas complejas. El cómo se produjeron estas mo-
léculas está aún sujeto a conjeturas, pero distintos experimentos han estable-
cido que se pudieron formar en determinadas condiciones prebióticas hipotéti-
cas.
La evolución necesita reproducción, variación y presión selectiva
La siguiente transición importante en la evolución de la vida fue la formación
de moléculas capaces de replicarse. La replicación, acoplada con la variación
y presión selectiva, señala el principio de la evolución. La variación se intro-
dujo por distintos medios, desde la simple sustitución de una base a la dupli-
cación de genes enteros. El RNA parece haber sido una de las moléculas pri-
mitivas que fue capaz de replicarse. Además, algunas moléculas de RNA tienen
actividad catalítica. Sin embargo, la gama de reacciones que el RNA es capaz
de catalizar es limitado. Con el tiempo, la actividad catalítica se transfirió a las
proteínas: polímeros lineales de los químicamente versátiles aminoácidos. El
RNA dirigió la síntesis de estas proteínas y todavía lo hace en los organismos
actuales a través del desarrollo de un código genético, el cual relaciona la se-
cuencia de las bases con la secuencia de los aminoácidos. Finalmente, el RNA
perdió su papel como gen para cedérselo al, químicamente similar pero más es-
table, ácido desoxirribonucleico, DNA. En los organismos modernos el RNA
todavía sirve como enlace entre el DNA y las proteínas.
Las transformaciones energéticas son necesarias para sustentar a los seres
vivos
Otra transición importante en la evolución fue la capacidad para transformar la
energía del entorno en formas que pudieran ser utilizadas por los seres vivos.
El ATP sirve como la moneda o divisa de energía celular que conecta las reac-
ciones que producen energía con las reacciones que la necesitan. El propio ATP
es un producto de la oxidación de las moléculas combustibles, tales como los
aminoácidos y azúcares. Con la evolución de las membranas -barreras hidro-
fóbicas que delimitan las células- se necesitaron gradientes iónicos para evi-
tar el estrés osmótico. Estos gradientes se formaron a expensas de la hidrólisis
de ATP. Más tarde, los gradientes iónicos producidos por la luz o la oxidación
de las moléculas combustibles se utilizaron para sintetizar ATP.
Las células pueden responder a cambios ambientales
La transición final fue la evolución de mecanismos de detección y señalización
que permitiesen a la célula responder a cambios en su entorno. Estos mecanis-
mos de señalización condujeron, finalmente, a la comunicación célula -célula,
la cual permitió el desarrollo de organismos más complejos. El registro de la
mayor parte de lo que ha ocurrido desde la formación de los organismos pri-
mitivos está escrito en el genoma de los organismos actuales. El estudio de es-
tos genomas y del mecanismo de la evolución potenciará nuestro conocimiento
de la historia de la vida en la Tierra así como la comprensión plena de los or-
ganismos existentes.
Problemas ~ 39 r­
~TÉRMINOS CLAVE1----------------------
mundo prebiótico (p. 20) mundo de RNA (p. 23) membrana (p. 29)
reproducción (p. 21) proteínas (p. 24) bomba de iones (p. 31)
variación (p. 22) código genético (p. 25) gradiente de iones (p. 31)
competición (p. 22) traducción (p. 25) fotosíntesis (p. 31)
presión selectiva (p. 22) gen (p. 25) vías de transducción de señales (p. 34)
catálisis (p. 23) mutación (p. 25) motores moleculares proteicos (p. 35)
enzima (p. 23) duplicación de genes (p. 26) diferenciación celular (p. 35)
ribozima (p. 23) ATP (adenosina trifosfato) (p. 28) la unidad de la bioquímica (p. 37)

~ LECTURAS SELECCIONADADAS 1-----------------


Bibliografía básica Wilson, D. S., y Szostak, J. W., 1999. In vitro selection of functional nucleic
acids. A111111. Rev. Biochem. 68:611-647.
Pace, N. R., 2000. The universal nature of biochemistry. Proc. Natl. Acad.
Sci. USA 98:805-808.
Replicación y RNA catalítico
Orgel, L. E., 1987. Evolution ofthe genetic apparatus: A review. Cold Spring
Harbar Symp. Q11a111. Bio/. 52:9-16. Cech, T. R., 1993. The efficiency and versatility of caralytic RNA: Implica-
Lazcano, A., y Miller, S. L., 1996. The origin and early evolution of life: Pre- tions for an RNA world. Ge11e 135:33-36.
biotic chemistry, che pre-RNA world, and time. Ce/1 85:793-798. Orgel, L. E., 1992. Molecular replicalion. Nature 358:203-209.
Orgel, L. E. 1998. The origin of life: A review of faces and speculalions. Zielinski, W. S., y Orgel, L. E., 1987. Autocatalytic synthesis of a tetranu-
Trends Biochem. Sci. 23:491-495. cleotide analogue. Na111re 327:346---347.
Nelson, K. E., Levy, M., y Miller, S. L., 2000. Peptide nucleic acids rather
Libros than RNA may have been the first genetic molecule. Proc. Natl. Acad.
Sci. USA 97:3868-3871.
Darwin, C., 1975. 011 the Origin of Species, a Facsímile of the First Edition.
Harvard University Press.
La transición desde el RNA al DNA
Gesteland, R. F., Cech, T., y Atkins, J. F., 1999. The RNA World. Cold Spring
Harbor Laboratory Press. Reichard, P., 1997. The evolution of ribonucleotide reduce ion. Trends
Dawkins, R., 1996. The 8/i11d Watclunaker. Norton. Biochem. Sci. 22:81-85.
Smith, J. M., y Szathmáry, E., 1995. The Majar Transitions in Evolution. W. Jordan, A., y Reichard, P., 1998. Ribonucleotide reductases. Amw. Rev.
H. Freeman and Company. Biochem. 67:71-98.

Química prebiótica Membranas


Miller, S. L., 1987. Which organic compounds could have occurred on the Wilson, T. H., y Maloney, P. C., 1976. Speculations on the evolution of ion
prebiotic earth? Cold Spring Harbar Symp. Q11a111. Biol. 52: 17-27. transport rnechanisms. Fed. Proc. 35:2174-2179.
Westheimer, F. H., 1987. Why nature chose phosphates. Science Wilson, T. H., y Lin, E. C., 1980. Evolution of membrane bioenergetics. J.
235: 1173-1178. Supramol. Struct. 13:421-446.
Levy, M., y Miller, S. L., 1998. The stability of che RNA bases: lmplications
for the origin of life. Proc. Natl. Acad. Sci. USA 95: 7933-7938.
Organismos pluricelulares y desarrollo
Sanchez, R., Ferris, J., y Orgel, L. E., 1966. Conditions for purine synthesis: Mangiarotti, G., Bozzaro, S., Landfear, S., y Lodish, H. F.. 1983. Cell-cell
Did prebiotic synthesis occur ac low ternperarures? Sci-ence 153:72-73. contact, cyclic AMP, and gene expression during developrnent of Dict-
yostelium discoideum. C11rr. Top. Del'. Biol. 18:117-154.
Evolución in vitro Kenyon, C., 1988. The nematode Caenorhabditis elegans. Science
Milis, D. R., Peterson, R. L., y Spiegelman, S., 1967. An extracellular Dar- 240: 1448-1453.
winian experiment with a self-duplicating nucleic acid molecule. Proc. Hodgkin, J., Plasterk, R. H., y Waterston, R. H., 1995. The nernatode
Nat/. Acad. Sci. USA 58:217-224. Caenorhabditis elegans and its genome. Science 270:410-414.
Levisohn, R., y Spiegelman, S., 1969. Further extracellular Darwinian exper-
irnents with replicating RNA molecules: Diverse variants isolated under
different selective conditions, Proc. Natl. Acad. Sci. USA 63:805-811.

~PROBLEMAS!---------------------
1. Encontrar los fragmentos. Identificar la fuente más probable está formada por 99 moléculas idénticas, cada una de las cuales se
(CH4, NH3, H20 ó H2) de cada átomo en la alanina generada en el replica una vez cada 15 minutos, y I molécula que se replica una
experimento de MiJler-Urey. vez cada 5 minutos. Estimar la composición de la población después
de 1, 10 y 25 "generaciones", si una generación se define como la
2. Seguimiento de la población. En un experimento análogo al de replicación durante 15 minutos. Supongamos que están disponibles
Spiegelman, supongamos que una población de moléculas de RNA todos los componentes necesarios.
­­­j 40 f­­ CAPÍTULO 2 • Evolución bioquímica
3. Ventajaselectiva. Supongamos que una molécula de RNA que mientras, en el otro lado de la membrana, la reacción es:
se replica tiene una mutación (cambio genotípico) y que el fenotipo 2 H20 ­ 02 + 4 e- + 4 H+
resultante une monórneros de nucleótido con más fuerza de cómo lo
hacen otras moléculas de RNA de la población. ¿Cuál podría ser la ¿Cuántos protones se consiguen para dirigir la síntesis de ATP en
ventaja evolutiva de esta mutación? ¿En que condiciones cabría es- cada ciclo de la reacción?
perar que esta ventaja evolutiva fuese la más importante? 7. Una vía alternativa. Para responder a la disponibilidad de azú-
cares, tales como arabinosa, una célula debe tener, al menos, dos ti-
4. Lo opuesto a lo aleatorio. Los gradientes iónicos evitan el es-
pos de proteínas: una proteína transportadora, para permitir que la
trés osmótico, pero necesitan energía para formarse. ¿Por qué la for-
arabinosa entre en la célula y una proteína de control génico, la cual
mación de un gradiente necesita energía?
se una a la arabinosa y modifique la expresión de los genes. Para
5. Gradientes acoplados. ¿Cómo se puede utilizar un gradiente de responder a la disponibilidad de algunas moléculas muy hidrofóbi-
protones, con una alta concentración de protones en el interior de la cas, la célula necesita sólo una proteína ¿Cuál y por qué?
célula, para bombear iones al exterior de la célula? 8. ¿Cuámas divisiones? En las vías de desarrollo de C. elegans, la
6. Contajede protones. Pensemos en las reacciones que tienen lu- división celular se inicia de forma sincronizada, es decir, todas las
gar a través de una membrana fotosintética. En un lado de la mem- células se dividen a la misma velocidad. Más tarde durante el desa-
brana tiene lugar la siguiente reacción: rrollo, algunas células se dividen con más frecuencia que otras.
¿Cuántas veces se divide una célula en el periodo de sincronización?

~
4 e- + 4 A ­ + 4 H20 ­ 4 AH + 4 OH­ Referirse a la Figura 2.26.

I
¿Necesita ayuda extra? Consulte los capítulos del·" Stu-
dent Companion" (Libro del estudiante) con todas las soluciones
en la red en www.whfreeman.com/biochem5.
3.1 LAS PROTEÍNAS SE CONSTRUYEN A PARTIR DE
43 r­
Un repertorio de 20 aminoácidos
UNA COLECCIÓN DE 20 AMINOÁCIDOS
Los aminoácidos son los precursores moleculares de las proteínas. Un a-aminoá- Regla para distinguir estereoisómeros
cido consta de un átomo de carbono central, llamado el carbono a, unido a un grupo Los cuatro sustituyentes diferentes de
amino, un grupo ácido carboxílico, un átomo de hidrógeno y un grupo R caracte- un átomo de carbono asimétrico tienen
rístico. El grupo R se denomina habitualmente cadena lateral. Con cuatro grupos asignada una prioridad de acuerdo con
diferentes conectados al átomo de carbono a, los a-aminoácidos son quirales; las sus números atómicos. El sustituyente
dos formas especulares se llaman isómero L e isómero D (Figura 3.4). de prioridad más baja, a menudo el hi­
drógeno, se orienta en dirección con­
traria al observador. La configuración
alrededor del carbono se llama 5, del
latín sinister "izquierda", si la dirección
de la progresión de los sustituyentes de
mayor a menor prioridad es contraria a
las agujas del reloj. La configuración se
conoce como R, del latín rectus "dere­
cha", si la progresión es en el sentido
de las agujas del reloj.

Isómero L Isómero D

FIGURA 3.4 Los isómeros L y o de los aminoácidos. R se refiere a la cadena lateral. Los
isómeros L y o son imágenes especularesentre sí.

Solamente los aminoácidos L son constituyentes de las proteínas. Para casi to-
dos los aminoácidos, el isómero L tiene configuración absoluta S (en vez de R)
(Figura 3.5). Aunque se ha empleado un enorme esfuerzo para entender porqué
los aminoácidos en las proteínas tienen esta configuración absoluta, todavía no se
ha llegado a una explicación satisfactoria. Parece probable que la selección de L
sobre D fuese arbitraria pero, una vez realizada, se fijó en la historia evolutiva
temprana.
Los aminoácidos en disolución a pH neutro existen predominantemente como
iones dipolares (también llamados zwitteriones). En la forma dipolar, el grupo
amino está protonado (-NH3 +) y el grupo carboxílico desprotonado (-COO-). El
estado de ionización de un aminoácido varía con el pH (Figura 3.6). En disolu-
ción ácida (p.ej., pH 1), el grupo amino está protonado (-NH3 +) y el grupo car-
boxilo no está disociado (-COOH). Cuando se eleva el pH, el grupo carboxílico
es el primero en ceder un protón, ya que su pK es cercano a 2. La forma dipo-
0
FIGURA 3.5 Sólo se encuentran
aminoácidos L en las proteínas.
Casi todos los aminoácidos L tienen una
configuración absoluta S (del latín sinister,
que significa "izquierda"). La dirección
contraria a las agujas del reloj de los
sustituyentes de mayor a menor prioridad
indica que el centro quiral es de
configuración S.

~ Ambos grupos

1
e:
desprotonados

-o
'o
~e: / Ambos grupos
Q)
u / protonados FIGURA 3.6 El estado de ionización
e:
o como función del pH. El estado de
u
ionización de los aminoácidos se altera
por un cambio en el pH. Cerca del pH
o 2 4 6 8 10 12 14 fisiológico predomina la forma
pH zwitteriónica.
~ 44 1---------- Glicina Alanina
CA PÍTUL O 3 • Estructura y función de (Gly, G) (Ala, A)
las proteínas

FIGURA 3.7 Estructuras de la glicina y la


alanina. (Arriba) Modelos de esferas y
varillas que indican la distribución de
átomos y enlaces en el espacio. (En medio)
Fórmulas estereoquímicamente realistas
que muestran la distribución geométrica
de los enlaces alrededor de los átomos (ver
capítulo 1 Apéndice). (Abajo) Las
proyecciones de Fischer muestran todos
los enlaces como perpendiculares para una
representación simplificada (ver Capítulo 1
Glicina Ala ni na
Apéndice). (Gly, G) (Ala, A)

Valina Leucina lsoleucina Metionina


(Val, V) (Leu, L) (lle, 1) (Met, M)

CH3
1
H-C-CH3

+H3N­J­coo­
l
H
Valina Leucina lsoleucina Metionina
(Val, V) (Leu, L) (lle, 1) (Met, M)

FIGURA 3.8 Aminoácidos con cadenas laterales alifáticas. El centro quiral adicional de la
isoleucina se indica con un asterisco.
lar persiste hasta que el pH se acerca a 9, cuando el grupo amino protonado pierde 45 r­
un protón. Para una revisión de los conceptos ácido-base y pH, ver el apéndice a Un repertorio de 20 aminoácidos
este capítulo.
En las proteínas se encuentran habitualmente 20 tipos de cadenas laterales que
varían en tamaño, forma, carga, capacidad de formar puentes de hidrógeno, ca-
rácter hidrofábico y reactividadquímica. De hecho, todas las proteínas de todas las
especies -bacterianas, arqueobacterianas y eucarióticas- se construyen con los
mismos 20 aminoácidos. Este alfabeto fundamental de las proteínas tiene varios mi-
les de millones de años de antigüedad. La extraordinaria variedad de funciones re-
alizadas por las proteínas es el resultado de la diversidad y versatilidad de estos 20
bloques de construcción. Conocer cómo se utiliza este alfabeto para crear las in-
trincadas estructuras tridimensionales que permiten a las proteínas llevar a cabo tan-
tos procesos biológicos es un área apasionante de la bioquímica a la que volvere-
mos en la Sección 3.6.
Fijémonos en este repertorio de aminoácidos. El más sencillo es la glicina, que
tiene solamente un átomo de hidrógeno como cadena lateral. Con dos átomos de hi-
drógeno unidos al átomo de carbono a, la glicina es especial al ser el único ami-
noácido aquiral. La alanina, el siguiente aminoácido en sencillez, tiene un grupo
metilo (-CH3) como cadena lateral (Figura 3.7).
La valina, la leucina y la isoleucina tienen cadenas laterales hidrocarbonadas de
mayor tamaño (Figura 3.8). La metionina contiene una cadena lateral alifática larga
que incluye un grupo tioéter (-S-). La cadena lateral de la isoleucina incluye un
centro quiral adicional; sólo el isómero que se muestra en la Figura 3.8 se encuen-
tra en las proteínas. Las cadenas laterales alifáticas grandes son hldrofábicas;tien-
den a agruparse entre ellas en vez de establecer contacto con el agua. La estructura
tridimensional de las proteínas solubles en agua se estabiliza por esta tendencia de
los grupos hidrofóbicos a agruparse, lo que se conoce como efecto hidrofábico(ver
Sección 1.3.4). Los diferentes tamaños y formas de estas cadenas laterales hidro-
carbonadas les permiten empaquetarse para formar estructuras compactas con po-
cas cavidades. La prolina también tiene una cadena lateral alifática, pero difiere de
los otros miembros del repertorio de 20 en que su cadena lateral está unida tanto al
átomo de nitrogeno corno al carbono a (Figura 3.9). La prolina influye notable-
mente en la arquitectura proteica debido a que su estructura en anillo produce una
restricción conformacional superior al resto de aminoácidos.

H2
e
He/ ""-cH
2 \ / 2
w-c-coo-
H2 1 FIGURA 3.9 Estructura cíclica de la
H prolina. La cadena lateral está unida tanto
al carbono a como al grupo amino.

Tres aminoácidos con cadenas laterales aromáticas relativamente sencillas for-


man parte del repertorio fundamental (Figura 3.10). 1,a~nilalanina, como su pro-
pio nombre indica, contiene un anillo fenílico sustituyendo a uno de los hidrógenos
de la alanina. El anillo aromático de la tiiasina contiene un grupo hidroxilo. Este
grupo hidroxilo es reactivo, a diferencia de las cadenas laterales relativamente iner-
tes de los otros aminoácidos citados hasta ahora. El triptájano tiene un anillo indol
unido a un grupo metileno (-CHi-); el grupo indol consiste en dos anillos fundi-
dos y un grupo NH. La fenilalanina es estrictamente hidrofóbica, mientras que la
tirosina y el triptófano lo son menos debido a sus grupos hidroxilo y NH. Los ani-
llos aromáticos del triptófano y la tirosina contienen electrones -rr deslocalizados
que absorben fuertemente la luz ultravioleta (Figura 3.1 L).
El coeficiente de extinción de un compuesto indica su capacidad de absorber
luz. La ley de Beer da la absorbancia (A) de luz a una longitud de onda determi-
nada para un compuesto:
­j 46 ~­­­­­­ Fenilalanlna Tirosina Triptófano
(Phe, F) (Tyr, Y) (Trp, W)
CAPÍTULO 3 • Estructura y función de
las proteínas

H
HO C
~e,:::::::, ""'­­cH
1 11
FIGURA 3.10 Aminoácidos con cadenas HC~/~
C CH2
laterales aromáticas. La fenilalanina,
la tirosina y el triptófano tienen carácter
H I
+H3N­c­coo­
hidrofóbico. La tirosina y el triptófano
también tienen propiedades hidrofílicas
l
H
debido a sus grupos ­OH y ­NH­, Fenilalanlna Tiroslna Triptófano
respectivamente. (Phe, F) (Tyr, Y) (Trp, W)

A= ecl Ley de Beer


10 000 donde e es el coeficiente de extinción [en unidades que son los
recíprocos de la molaridad y de la distancia en centímetros
í (M-1 cm-1)], e es la concentración de los compuestos que ab-
E
u
8000 sorben luz (en unidades de molaridad, M) y les el paso óptico;
í la longitud que la luz atraviesa (en centímetros). Para el triptó-
6 fano, la absorción es máxima a 280 nm y el coeficiente de ex-
e
-o
'o
6000 tinción es 3400 M- 1 cm- 1, mientras que para la tirosina, la ab-
·É)( sorción es máxima a 276 nm y el coeficiente de extinción es
111 de una intensidad menor, de 1400 M- 1 cm - '. La fenilalanina
111
-e 4000 absorbe la luz con menos fuerza y a menores longitudes de onda.
~e La absorción de la luz a 280 nm se puede usar para estimar la
111
'o
~o 2000
u
FIGURA 3.11 Espectros de absorción de los aminoácidos
o aromáticos triptófano (en rojo) y tirosina (en azul). Sólo estos
220 240 260 280 300 320 aminoácidos absorben intensamente alrededor de 280 nm. [Cortesía de
Longitud de onda (nm) Gregory J. Gatto, Jr.].
Serina
(Ser, S)
Treonina
(Thr, T)
47 r-
Un repertorio de 20 aminoácidos

OH
1
H­C­CH3 FIGURA 3.12 Aminoácidos que
1 contienen grupos hidroxilo alifáticos .
... H3N­c­coo­
La serina y la treonina contienen grupos
H
l hidroxilo que les dan carácter hidrofílico.
Treonina
El centro quiral adicional de la treonina
Serlna
(Ser, S) (Thr, D esta indicado con un asterisco.

concentración de una proteína en disolución si se conoce el número de residuos de


triptófano y tirosina de esa proteína.
Dos aminoacidos, la serina y la treonina, contienen grupos hidroxilo alifáti-
cos (Figura 3.12). La serina se puede considerar como una versión hidroxilada de
la alanina, mientras que la treonina se asemeja a la valina con un grupo hidroxilo
en Jugar de uno de sus grupos metilo. Los grupos hidroxilo de la serina y de la
treonina las hacen mucho más hidrofilicas (que les gusta el agua) y reactivos que
la alanina y la valina. La treonina, al igual que la isoleucina, contiene un centro
asimétrico adicional; de nuevo sólo uno de los isómeros se encuentra en las pro-
teínas.
La cisteina es estructuralmente similar a la serina, pero contiene un sulfhidrilo,
o grupo tiol (-SH), en lugar del grupo hidroxilo (-OH) (Figura 3.13). El grupo sulf-
hidrilo es mucho más reactivo. Parejas de grupos sulfhidrilo se pueden juntar para
formar enlaces disulfuro, que son especialmente importantes en la estabilización de
algunas proteínas, como se verá enseguida.

SH
1
CH2
1
... H3N­c­coo­
l
H
FIGURA 3.13 Estructura de la cisteína.

Pasamos ahora a los aminoácidos con cadenas laterales muy polares que les con-
vierten en altamente hidrofílicos. La lisina y la arginina tienen cadenas laterales re-
lativamente largas que acaban en grupos que están cargados positivamente a pH
neutro. La lisina está rematada por un grupo amino primario y la arginina por un
grupo guanidino. La histidina contiene un grupo imidazol, un anillo aromático que
también puede estar cargado positivamente (Figura 3.14).
--i48 f--~~~~~~~ Lisina Arginina Histidina
CAPÍTULO 3 • Estructura y función de (Lys, K) (Arg, R) (His, H)
las proteínas

FIGURA 3.14 Los aminoácidos básicos:


Lisina Arginina Histidina
lisina, arginina e histidina. (Lys, K) (Arg, R) (His, H)

NH2
il +

H2~_C.~NH2

Guanldlnlo lmidazol

Con un valor de pK0 cercano a 6, el grupo imidazol puede estar sin carga o cargado
positivamente en las proximidades del pH neutro, en función del entorno local (Fi-
gura 3.15). Por esta causa, la histidina se encuentra a menudo en los centros acti-
vos enzimáticos, donde el anillo de imidazol puede captar y liberar protones durante
las reacciones enzimáticas.
El conjunto de aminoácidos también incluye dos con cadenas laterales acidi-
cas: el ácido aspártico y el ácido glutámico (Figura 3.16). Estos aminoácidos se
conocen habitualmente como aspartato y glutamato para resaltar que sus cadenas
FIGURA 3.15 Ionización de la histidina. laterales están normalmente cargadas a pH fisiológico. Sin embargo, en algunas pro-
La histidina puede captar o liberar teínas estas cadenas laterales aceptan protones, capacidad que a menudo es impor-
protones alrededor del pH fisiológico. tante desde el punto de vista funcional. Además, el conjunto incluye derivados sin
Aspartato Glutamato Asparragina Glutamina
(Asp, D) (Glu, E) (Asn, N) (Gin, Q)

H2N
~ -

\
­ ¡¡
,O
l~º /
NH2

O=­=­=<\ H2C"'­ O=<\ H2C"'­


CH2
CH2 CH2 CH2

+H3NXC00­ +H3NXC00­ +H3NXC00­ +H3NXC00­

o ­ O~ ,..,.­NH2
~­e;;­º e
-
O~ ,..,.­NH2 1
º~·e;;­º 1
CH2 e CH2
1 1 1 1
CH2 CH2 CH2 CH2
1 1 1 1

+H3N­c­coo­ +H3N­c­coo­ +H3N­c­coo­ +H3N­c­coo­


1 1 1 1
H H H H
Aspartato Glutamato Asparragina Glutamina
(Asp, D) (Glu, E) (Asn, N) (Gin, Q)

FIGURA 3.16 Aminoácidos con carboxilatos y carboxamidas en la cadena lateral.

carga del aspartato y el glutamato -asparragina y glutamina- que incluyen una


carboxamida terminal en lugar de un ácido carboxílico libre (Figura 3.16).
Siete de los 20 aminoácidos tienen cadenas laterales fácilmente ionizables.
Estos 7 aminoácidos son capaces de donar o aceptar protones para facilitar re-
acciones, así como para formar enlaces iónicos. En la Tabla 3.1 se muestran los
equilibrios y los valores característicos de pK0 para la ionización de las cadenas
laterales de tirosina, cisteína, arginina, lisina, histidina y los ácidos aspártico y
glutámico en las proteínas. Otros dos grupos se pueden ionizar en las proteínas
-los a-amino y o-carboxilo terminales- y sus valores característicos de pK0
se incluyen también en la Tabla 3.1.
Los aminoácidos se designan a menudo por una abreviatura de tres letras o
bien por símbolos de una letra (Tabla 3.2). Las abreviaturas para los aminoáci-
dos son las primeras tres letras de sus nombres ingleses, excepto para la aspa-
rragina (Asn), la glutamina (Gin), la isoleucina (Ile) y el triptófano (Trp). Los
símbolos para muchos de los aminoácidos son las primeras letras de sus nom-
bres (p.ej., G para la glicina y L para la leucina); los otros símbolos se han acor-
dado por convención. Estas abreviaciones y símbolos son una parte integrante
del vocabulario de los bioquímicos.
­l(¡y ¿Cómo se convirtió este conjunto específico de aminoácidos en los precur-
T sores? En primer lugar, como conjunto son variados; sus propiedades quí-
micas y estructurales abarcan un amplio espectro, proporcionando a las proteínas
una versatilidad que les permite asumir diversas funcionalidades. En segundo tér-
mino, como se indica en la Sección 2.1. l , muchos de estos aminoácidos estaban
probablemente disponibles en las reacciones prebióticas, En último término, una ex-
cesiva reactividad intrínseca puede haber eliminado otros posibles aminoácidos. Por
--l 50 f­­­­­­­­­­­

CAPÍTULO 3 • Estructura y función de TABLA 3.1 Valores característicos del pKa de los grupos ionizables de las proteínas
las proteínas
Grupo Ácido Base pK. * característico

o
I! ­
.,, c.-s,o
Grupo u-carboxilo terminal 3,1

Ácido aspártico
Ácido glutámico 4,1

Histidina ~ NI 6,0
~N 'H
+ H
Grupo ex-amino terminal ­N:\H
__ -N,\H 8,0
H H
~
Cisteína ~ -s- 8,3

Tirosina 10,9

+ H
Lisina ­N:__\H -N\'"H 10,8
H H
H H
1 1
H + ,':'J­H N
\ // H, //
Arginina N=C N-C 12,5
/ \\ / \
H/
N-H N-H
H/

•Los valores de pK3 dependen de la temperatura, la fuerza iónica y el microentorno del grupo ionizable.

TABLA 3.2 Abreviaturas de los aminoácidos

Abreviatura Abreviatura Abreviatura Abreviatura


Aminoácido de tres letras de una letra Aminoácido de tres letras de una letra
Alanina Ala A Metionina Met M
Arginina Arg R Fenilalanina Phe F
Asparragina Asn N Prolina Pro p
Ácido aspártico Asp D Serina Ser s
Cisteína Cys e Treonina Thr T
Glutamina Gin Q Triptófano Trp w
Ácido glutámico Glu E Tirosina Tyr y
Glicina Gly G Valina Val V
Histidina His H Asparragina o Asx B
Isoleucina lle 1 ácido aspártico
Leucina Leu L Glutamina o Glx z
Lisina Lys K ácido glutámico
ejemplo, aminoácidos tales como la homoserina y la homocisteína tienden a adop- 51 f­
tar formas cíclicas de cinco átomos que limitan su uso en las proteínas; los amino- Estructura primaria
ácidos alternativos que se encuentran en proteínas -serina y cisteína- no se ci-
clan facilmente, porque los anillos que adoptarían en su forma cíclica sería
demasiado pequeños (Figura 3. 17).

+ HX
FIGURA 3.17 Reactividad indeseable en
aminoácidos. Algunos aminoácidos son
Homoserina inapropiados para las proteínas debido a
su delación indeseada. La homoserina se
puede ciclar para formar un anillo estable
de cinco miembros, lo que puede romper

*
el enlace peptídico. La delación de la
+ HX serina formaría un anillo tenso de cuatro
miembros y por lo tanto desfavorecido.
X puede ser un grupo amino de un
Serina
aminoácido vecino u otro grupo químico.

3.2 ESTRCTURA PRIMARIA: LOS AMINOÁCIDOS ESTÁN


UNIDOS POR ENLACES PEPTÍDICOS PARA FORMAR
CADENAS POLIPEPTÍDICAS
Las proteínas son polímeros lineales formados por la unión del grupo o-carboxilo
de un aminoácido al grupo a-amino de otro aminoácido por medio de un enlace
peptidico (también llamado enlace amida). La formación de un dipéptido a partir
de dos aminoácidos se acompaña por la pérdida de una molécula de agua (Figura
3.l 8). En esta reacción, el equilibrio está más desplazado hacia la hidrólisis que ha-
cia la síntesis. Por ello, la biosíntesis de los enlaces peptídicos requiere un aporte
de energía libre. No obstante, los enlaces peptídicos son muy estables cinéticamente;
la vida de un enlace peptídico en disolución acuosa en ausencia de un catalizador
es cercana a los 1000 años.

H R1
J
/'t, ,,o
+H N'
3
"e'
1: -
FIGURA 3.18 Formación del enlace
o peptídico. La unión de dos aminoácidos
se acompaña de la pérdida de una
Enlace peptídico molécula de agua.

Una serie de aminoácidos unidos por enlaces peptídicos forman una cadena po-
lipepttdica y cada unidad aminoacídica en un polipéptido se conoce como residuo.
Una cadena polipepttdica tiene polaridad porque sus extremos son diferentes: hay
un grupo a-amino en un extremo y un grupo o-carboxilo en el otro. Por convención,
se considera que el extremo amino terminal es el comienzo de la cadena polipepti-
dica, por lo que la secuencia de aminoácidos de una cadena polipeptídica se escribe
comenzando con el residuo amino terminal. Así, en el pentapéptido Tyr-Gly-Gly-
Phe-Leu (YGGFL), la tirosina es el residuo amino terminal (N-terrninal) y la leucina
es el residuo carboxilo terminal (C-terrninal) (Figura 3.19). Leu-Phe-Gly-Gly-Tyr
(LFGGY) es un pentapéptido diferente, con propiedades químicas distintas.
Una cadena polipeptídica consiste en una parte, repetida regularmente, llamada
la cadena principal o esqueleto y una parte variable constituida por las cadenas la-
terales distintivas (Figura 3.20). El esqueleto polipeptídico es potencialmente rico
en capacidad para formar puentes de hidrógeno. Cada residuo contiene un grupo
carbonilo, que es un buen aceptor de puentes de hidrógeno y, con la excepción de
~ 52 !­­­­­­­­­­

OH
CAPÍTULO 3 • Estructura y función de
las proteínas

FIGURA 3.19 Las secuencias de


aminoácidos tienen dirección.
Esta ilustración del pentapéptido Tyr­Gly­
Gly­Phe­Leu (YGGFL) muestra la secuencia
desde el amino terminal hasta el carboxilo
terminal. Este pentapéptido, Leu­encefalina,
es un péptido opiáceo que modula la
percepción del dolor. El pentapéptido
inverso, Leu­Phe­Gly­Gly­Tyr (LFGGY) es Tyr Gly Gly Phe Leu
una molécula diferente que no muestra Residuo Residuo
tales efectos. amino terminal carboxilo terminal

FIGURA 3.20 Componentes de una


cadena polipeptídica. Una cadena
polipeptídica consiste en un esqueleto
constante (en negro) y cadenas laterales
variables ( en verde).

la prolina, un grupo NH que es buen dador de puentes de hidrógeno. Estos grupos


interaccionan entre sí y con grupos funcionales de las cadenas laterales para esta-
Dalton
bilizar estructuras particulares, como se verá en detalle.
La mayoría de cadenas polipeptídicas naturales contienen entre 50 y 2000 resi-
Unidad de masa casi igual a la del
átomo de hidrógeno. Nombrada así en duos de aminoácidos y se conocen comúnmente como proteínas. Los péptidos que
honor de John Dalton (1 766-1844) constan de un pequeño número de aminoácidos se llaman oligopéptidos o simple-
que desarrolló la teoría atómica de la mente péptidos. El peso molecular medio de un residuo de aminoácido es aproxi-
materia. madamente 110, por lo que el peso molecular de la mayoría de las proteínas está
entre 5500 y 220 000. Nos podemos referir también a la masa de una proteína, que
se expresa en unidades de daltons; un dalton equivale a una unidad de masa ató-
mica. Una proteína con un peso molecular de 50 000 tiene una masa molecular de
Kilodalton (kd) (ó kDa)
50 000 daltons o 50 kd *(kilodaltons).
Unidad de masa equivalente a 1000
daltons. En algunas proteínas, la cadena polipeptídica lineal posee enlaces cruzadas. Los
entrecruzamientos más habituales son los puentes disulfuro, que se forman por la

Cisterna
Oxidación
+ 2 W + 2 e·
Reducción

FIGURA 3.21 Enlaces cruzados.


La formación de un enlace disulfuro a
partir de dos residuos de cisteína es una
reacción de oxidación. Cisteína Cistina

* Nota del traductor: la mayoría de los autores utilizan como abreviatura de kilodalton, kDa.
oxidación de un par de residuos de cisteína (Figura 3.21). El conjunto resultante de 53 ~
la unión de dos cisteínas se llama cistina. Las proteínas extracelulares tienen a me- Estructura primaria
nudo varios puentes disulfuro, mientras que no existen normalmente en proteínas
intracelulares. Ocasionalmente, se pueden encontrar en algunas proteínas enlaces
cruzados sin azufre originados por otras cadenas laterales. Por ejemplo, las fibras
de colágeno en el tejido conjuntivo se refuerzan de esta forma, al igual que los co-
águlos sanguíneos de fibrina.

3.2.1 Las proteínastienen secuencias de aminoácidos específicas


que son determinadaspor los genes
En 1953, Frederick Sanger determinó la secuencia de aminoácidos de la insulina,
una hormona proteica (Figura 3.22). Este trabajo supone un hito en la bioquímica
porque demostró por vez primera que una proteína tiene una secuencia de amino-
ácidos definida con precisión. Además, demostró que la insulina consta solamente
de L-aminoácidos unidos por enlaces peptídicos entre grupos a-amino y o-carbo-
xilo. Este logro estimuló a otros científicos a realizar estudios de secuencias en una
amplia gama de proteínas. De hecho, en la actualidad se conoce la secuencia com-
pleta de aminoácidos de más de 100 000 proteínas. El hecho excepcional es que
cada proteína tiene una secuencia de aminoácidos única y definida con precisión.
La secuencia de aminoácidos de una proteína se conoce a menudo como su estruc-
tura primaria.
Una serie de estudios incisivos a finales de los 50 y principios de los 60 de-
mostraron que las secuencias de aminoácidos de las proteínas estaban determinadas
genéticamente. La secuencia de nucleótidos en el DNA, la molécula de la herencia,
codifica una secuencia complementaria de nucleótidos en el RNA, la cual, a su vez
especifica la secuencia de aminoácidos de la proteína. En particular, cada uno de
los 20 aminoácidos de la colección esta codificado por una o más secuencias espe-
cíficas de tres nucleótidos (Sección 5.5).
Conocer las secuencias de aminoácidos es importante por varias razones. Pri-
mero, el conocimiento de la secuencia de una proteína es normalmente esencial
para averiguar su mecanismo de acción (p. ej., el mecanismo catalítico de un en-
zima). Además, se pueden generar proteínas con nuevas propiedades variando la
secuencia de proteínas conocidas. Segundo, las secuencias de aminoácidos deter-
minan las estructuras tridimensionales de las proteínas. La secuencia de aminoá-
cidos es el enlace entre el mensaje genético del DNA y la estructura tridimensio-
nal que condiciona la función biológica de la proteína. El análisis de la relación
entre la secuencia de aminoácidos y la estructura tridimensional de las proteínas
está descubriendo las reglas que gobiernan el plegamiento de las cadenas poli-
peptídicas. Tercero, la determinación de la secuencia es un factor importante de
la patología molecular, un área de la medicina que crece rápidamente. Alteracio-
nes de la secuencia de aminoácidos pueden producir funciones anormales y pro-
vocar enfermedades. Algunas enfermedades graves y a veces mortales, como son
la anemia falciforme y la fibrosis quística, se pueden producir por el cambio de
un único aminoácido en la proteína. Cuarto, la secuencia de una proteína nos re-
vela mucho sobre su historia evolutiva (ver Capítulo 7). Las proteínas se parecen
en su secuencia de aminoácidos solamente cuando tienen un antecesor común. En
consecuencia, los sucesos moleculares de la evolución se pueden indagar a partir
de las secuencias de aminoácidos; la Paleontología Molecular es un área flore-
ciente de investigación.

s s FIGURA 3.22 Secuencia de aminoácidos


Cadena A
r I
Gly­lle­Val­Glu­Gln­Cys­Cys­Ala­Ser­Val­Cys­Ser­Leu­Tyr­Gln­Leu­Glu­Asn­Tyr­Cys­Asn
de la insulina bovina.

5 1 1o 15 1 21
s s
s
r s
I
Cadena B r I
Phe­Val­Asn­Gln­His­Leu­Cys­Gly­Ser­His­Leu­Val­Glu­Ala­Leu­Tyr­Leu­Val­Cys­Gly­Glu­Arg­Gly­Phe­Phe­Tyr­Thr­Pro­Lys­Ala
5 1O 15 20 25 30
3.2.2 Las cadenas polipeptídicas son flexibles
aunque están restringidas en su conformación
El examen de la geometría del esqueleto de una proteína re-
vela varios rasgos importantes. Primero, el enlace peptidico es
esencialmente plano (Figura 3.23). Por lo tanto, por cada par
de aminoácidos unidos por un enlace peptídico, seis átomos es-
tán en el mismo plano: el átomo de carbono a y el grupo CO
del primer aminoácido; y el grupo NH y el átomo de carbono
a del segundo aminoácido. Esta preferencia geométrica se ex-
plica por la naturaleza del enlace químico del péptido. El en-
lace peptídico tiene un carácter parcial de doble enlace, lo que
evita la rotación a su alrededor.

FIGURA 3.23 Los enlaces peptídicos son planos. En una pareja


de aminoácidos unidos, seis átomos (C .., C, O, N, H, y c ..)
permanecen en un mismo plano. Las cadenas laterales se muestran
como esferas verdes.

Estructuras resonantes del enlace peptídico

La incapacidad de rotación del enlace restringe la conforma-


ción del esqueleto polipeptídico y es la causa de la planaridad
del enlace. Este carácter parcial de doble enlace también se ob-
serva en la longitud del enlace entre los grupos CO y NH. La
distancia C-N en un enlace peptídico es típicamente 1,32 Á,
que está entre los valores esperados para un enlace C-N sen-
cillo (1,49 Á) y un enlace C=N doble (1,27 Á), como se apre-
cia en la Figura 3.24. Finalmente, el enlace peptídico no tiene
carga, lo que permite a los polímeros de aminoácidos unidos
por enlaces peptídicos formar estructuras globulares fuerte-
mente empaquetadas.
Un enlace peptídico plano tiene dos configuraciones posi-
FIGURA 3.24 Longitudes de enlace estándar en una unidad bles. En la configuración trans, los dos átomos de carbono a
peptídica. La unidad peptídica se muestra en la configuración están en lados opuestos del enlace peptídico. En la configura-
trans. ción cis, estos grupos están en el mismo lado del enlace pep-
tídico. Casi todos los enlaces en las proteínas son trans. Esta preferencia de trans
sobre cis se puede explicar por el hecho de que los choques estéricos entre los gru-
pos unidos a los átomos de carbono a impiden la adopción de la forma cis mien-
tras que no se producen en la forma trans (Figura 3.25). Los enlaces peptídicos cis
más comunes son las uniones X-Pro (donde X representa cualquier residuo). Di-
chos enlaces muestran menos preferencia por la configuración trans porque el ni-
trógeno de la prolina está unido a dos átomos de carbono tetraédricos, lo que limita
las diferencias estéricas entre las formas trans y cis (Figura 3.26).
A diferencia del enlace peptídico, los enlaces entre el grupo amino y el átomo
de carbono a; y entre el átomo de carbono a y el grupo carbonilo son enlaces sen-
cillos puros. Las dos unidades peptídicas adyacentes rígidas pueden girar alrededor
de estos enlaces, dando lugar a varias orientaciones. Esta libertad de rotación al-
rededor de dos enlaces de cada aminoácido permite a las proteínas plegarse de

FIGURA 3.25 Enlaces péptídicos cis y


trans. La forma trans está enormemente
favorecida debido a los choques estéricos
que se dan en la forma cis. Trans Cis
55 r­
Estructura primaria

FIGURA 3.26 Enlaces X­Pro cis y trans.


Las energías de estas formas están
relativamente equilibradas porque los
choques estéricos se producen en las dos
Trans Cis conformaciones.

forma muy diversa. Los giros alrededor de estos ángulos se concretan en los lla-
Ángulo diedro
mados ángulos diedros (Figura 3.27). El ángulo de giro alrededor del enlace entre
Una medida de la rotación alrededor
el átomo de nitrógeno y el carbono a se conoce como fi (<!>). El ángulo de giro en de un enlace normalmente va desde
el enlace entre el carbono a y el carbonilo se llama psi (iv). Un giro en la dirección ­180º hasta + 180º. Los ángulos die­
de las agujas del reloj sobre cualquiera de estos enlaces desde el frente hasta parte dros se conocen a veces como ángulos
trasera corresponde a un valor positivo. Los ángulos <!> y i¡, determinan la arquitec- de torsión.
tura de la cadena polipeptídica.
¿Son posibles todas las combinaciones de <!> y i¡,? G.N. Ramachandran descu-
brió que muchas combinaciones están prohibidas debido a los choques estéricos en-
tre los átomos. Los valores permitidos se pueden visualizar en unas representacio-
nes bidimensionales que se conocen como diagramas de Ramachandran (Figura
3.28). Tres cuartos de las combinaciones Ió, iv) posibles están excluidas por los cho-
ques estéricos locales. La exclusión estérica, el hecho de que dos átomos no pue-
den estar en el mismo sitio al mismo tiempo, puede ser un poderoso principio or-
ganizativo.
La capacidad de polímeros biológicos como las proteínas para plegarse en es-
tructuras bien definidas es termodinámicamente relevante. Consideremos el equili-
brio entre un polímero desplegado que existe como un ovillo estadístico -es decir,
como una mezcla de muchas conformaciones posibles no estables- y la forma ple-
gada que adopta una conformación específica. La entropía favorable asociada con
el gran número de conformaciones en la forma desplegada se opone al plegamiento
y debe ser superada por interacciones que favorezcan la forma plegada. De este
modo, los polímeros altamente flexibles con un gran número de conformaciones po-
sibles no se pliegan en estructuras únicas. La rigidez de la unidad peptídica y las
restricciones de los ángulos de enlace <p y !/¡ limitan suficientemente el número de
estructuras posibles como para que La cadena desplegada se pliegue.

(A) (C)

4>=­80° lj/=+85º

FIGURA 3.27 La rotación alrededor de los enlaces de un polipéptido. La estructura de


cada aminoácido de un polipéptido se puede ajustar mediante la rotación alrededor de dos
enlaces sencillos. (A) Fi (<!>) es el ángulo de rotación alrededor del enlace entre el átomo de
nitrógeno y el átomo de carbono a mientras que psi (tj,) es el ángulo de rotación alrededor
del enlace entre el átomo de carbono a y el átomo de carbonilo. (B) Vista inferior del enlace
entre el nitrógeno y el carbono a, que muestra cómo se mide <!>. (C) Vista superior del
enlace entre el carbono a y el carbonilo, que muestra cómo se mide tj,.
-----, 56 r­­­­­­­­­
CAPÍTULO 3 • Estructura y función de
las proteínas

FIGURA 3.28 El diagrama de


Ramachandran indica los valores de el> y r
'I'
de lf,. No todos los valores de <!> y tj, son
posibles sin colisiones entre los átomos.
Las regiones más favorables se muestran
en verde oscuro; las regiones frontera se
muestran en verde claro. La estructura de -180 t::::==11=:=!._ __L _ _.l__J___J

la derecha es desfavorable a causa de los -180 -120 -60 O 60 120 +180 (ip = 90°, 'I' = -90°)
Desfavorecida
choques estéricos. ip­

3.3 ESTRUCTURA SECUNDARIA: LAS CADENAS


POLIPEPTÍDICAS SE PUEDEN PLEGAR EN
ESTRUCTURAS REGULARES COMO LA HÉLICE ALFA,
LA HOJA PLEGADA BETA V GIROS V BUCLES

¿Se puede plegar una cadena polipeptídica en una estructura regular repetitiva? En
1951 Linus Pauling y Robert Corey propusieron dos estructuras periódicas llama-
das la hélice a y la hoja plegada {3. Posteriormente, se identificaron otras estructu-
ras como el giro f3 y el bucle O (bucle omega). Aunque no son periódicas, estas es-
tructuras habituales de giros o bucles están bien definidas y contribuyen, junto con
las hélices ex y las hojas 13, para formar la estructura proteica final.

~
I
~ VISIONES ESTRUCTURALES VISIONES ESTRUCTURALES. Elementos de estructura proteica suministra repre-
que aparecen a lo largo de todo el libro, sentaciones interactivas de algunos de los elementos de arquitectura proteica descritos en este
son tutorías basadas en modelado capítulo, incluyendo un resumen de motivos de la estructura secundaria.
molecular que permiten revisar la estruc­
tura y aprender lo que las últimas investi­
gaciones nos dicen sobre los trabajos mo­
leculares. Para acceder, ir al sitio Web: 3.3.1 La hélice a es una estructura helicoidal estabilizada por
www.whfreeman.com/biochem5 y selec­ puentes de hidrógenointracatenarios
cionar el capítulo, "Structural lnsights"
(web en inglés) y el título. Al evaluar las estructuras potenciales, Pauling y Corey consideraron qué confor-
maciones peptídicas estaban permitidas estéricarnente y cuáles aprovechaban mejor
la capacidad de los grupos NH y CO del esqueleto para formar puentes de hidró-
geno. La primera de las estructuras que propusieron, la hélice o helicoide e, es una
estructura en forma de cilindro (Figura 3.29). Un esqueleto helicoidal plegado muy
firmemente forma la parte interior del cilindro, mientras que las cadenas laterales
se extienden hacia fuera en una distribución helicoidal. La hélice ex se estabiliza por
puentes de hidrógeno entre los grupos NH y CO de la cadena principal. En parti-
cular, el grupo CO de cada aminoácido forma un puente de hidrógeno con el grupo
NH del aminoácido situado cuatro residuos más adelante en la cadena principal (Fi-
gura 3.30). Por lo tanto, salvo para los aminoácidos cercanos al final de una hélice
o., todos los grupos CO y NH de la cadena principal están unidos por puentes de
Sentido de giro hidrógeno. Cada residuo se relaciona con el siguiente por un incremento de 1,5 Á
Describe la dirección en la que una es- en el paso de hélice y una rotación de 100 grados, lo que equivale a 3,6 residuos
tructura helicoidal gira con respecto a de aminoácido por vuelta de la hélice. Así, aminoácidos que están a una distancia
su eje. Si se observa el eje de la hélice de tres o cuatro residuos en la secuencia se encuentran espacialmente muy cerca-
desde abajo, la cadena gira en el sen­ nos en una hélice ex. Por contraste, aminoácidos que se encuentran a una distancia
tido de las agujas del reloj, tiene un
de dos lugares están situados en los lados opuestos de la hélice, por lo que es im-
sentido de giro dextrógiro. Si el sentido
es contrario a las agujas del reloj, el probable que establezcan contactos. El paso de la hélice ex, que es el producto del
sentido de giro es levógiro. movimiento (1,5 Á) por el número de residuos por giro (3,6) es 5,4 A. El sentido
de giro de una hélice puede ser dextrógiro (sentido de las agujas del reloj) o levó-
(A)

FIGURA 3.29 Estructura de la a-hélice. (A) Un diagrama de cintas que muestra los átomos
del carbono a y las cadenas laterales (en verde). (B) Una vista lateral, en versión esferas y
varillas, representa los puentes de hidrógeno (líneas discontinuas) entre los grupos NH y CO.
(C) Una visión apical muestra el esqueleto enrollado como el interior de la hélice y las
cadenas laterales (en verde) proyectándose hacia afuera. (O) Una visión de esferas compactas
de la parte C muestra el núcleo interior de la hélice estrechamente empaquetado.

FIGURA 3.30 Esquema de puentes de


hidrógeno para una a-hélice. En la
a-hélice el grupo CO del residuo n forma
un puente de hidrógeno con el grupo NH
del residuo n + 4.

giro (sentido contrario a las agujas del reloj). El diagrama de Ramachandran nos
muestra que ambas hélices, la dextrógira y la levógira, están entre las conforma-
ciones permitidas (Figura 3.31 ). Sin embargo, las hélices dextrógiras son más fa­
vorables energéticamente porque hay menos choques estéricos entre las cadenas la-

l
terales y el esqueleto. Precisamente todas las hélices a que se encuentran en las
protetnas son dextrógiras. En diagramas esquemáticos de proteínas, las hélices ex
se representan como cintas retorcidas o como cilindros (Figura 3.32). 11'
Pauling y Corey predijeron la estructura de la hélice ex 6 años antes de que se
viera en la reconstrucción por rayos X de la estructura de la miogoblina. La pro-
-120 Hélice dextrógira
puesta de la estructura de hélice a es un hito en bioquímica porque demostró que (común)
la conformación de una cadena polipepttdica se puede predecir si las propiedades -180 l==!==::1.--1..._....L_L_J
de sus componentes se conocen de forma precisa y rigurosa. -180 -120 -60 O 60 120 +180
El contenido en ex-hélice de las proteínas oscila entre amplios límites, desde FIGURA 3.31 Diagrama de Ramachandran
prácticamente nada hasta casi el 100%. Por ejemplo, aproximadamente el 75% de para las hélices. Tanto las hélices
los residuos de la ferritina, una proteína que ayuda a almacenar hierro, están orga- dextrógiras como las levógiras se encuentran
nizados en hélices ex (Figura 3.33). Las hélices ex sencillas tienen normalmente una en regiones de conformaciones permitidas
longitud menor que 45 A. Sin embargo, dos o más ex-hélices se pueden entrelazar en el diagrama de Ramachandran. Sin
para formar una estructura muy estable que puede tener una longitud de 1000 Á embargo, casi todas las a-hélices de las
(100 nm, ó 0,1 urn) o más (Figura 3.34). Tales superhelicoides de ex-hélices se en- proteínas son dextrógiras.
­­­i 58 (B) (C)
CAPÍTULO 3 • Estructura y función de
las proteínas

FIGURA 3.32 Vistas esquemáticas de


o-hélices. (A) Modelo de esferas y varillas.
(B) Una representación de cintas. (C) Una
representación cilíndrica.

cuentran en la miosina y la tropomiosina del músculo, en la fibrina de los coágulos


sanguíneos y en la queratina capilar. Los cables helicoidales de estas proteínas tie-
nen un papel mecánico formando agrupaciones fibrilares, como ocurre en las espi-
nas del puercoespín. El citoesqueleto (andamiaje interno) celular es rico en los lla-
mados filamentos intermedios, que son también superhelicoides con dos cadenas.
Muchas proteínas transmembrana, que se encuentran atravesando las membranas
biológicas, también contienen hélices ce.
~ FIGURA 3.33 Una proteína
principalmente en o-hélice. La ferritina,
una proteína de almacenamiento de
hierro, está formado por un haz de
a-hélices.

20Á

~ FIGURA 3.34 Superhelicoide de hélices «. Las dos hélices se enrollan una alrededor
de la otra para formar una superhélice. Tales estructuras se encuentran en muchas proteínas
como la queratina del pelo, púas, pinzas y cuernos.

3.3.2 Las hojas (3 se estabilizan por puentes de hidrógeno entre


las cadenas polipeptídicas
+180
Pauling y Corey descubrieron otro motivo estructural periódico al que llamaron hoja
120 Hebras beta plegada /3 (13 porque era la segunda estructura que desentrañaron, siendo la hélice
ce la primera). La hoja plegada 13 (o más simplemente la hoja 13) es muy diferente
60 de las hélices ce cilíndricas. La hebra /3, una cadena polipeptídica que forma parte
~ de una hoja 13, está casi completamente extendida en vez de estar enrollada y em-
r o
paquetada como en la hélice ce. Existe toda una gama de estructuras extendidas per-
"' -60
mitidas estéricamente (Figura 3.35).
La distancia entre aminoácidos adyacentes en una hebra 13 es aproximadamente
-120 3,5 Á, por contraste con la distancia de 1,5 Á en una ce-hélice. Las cadenas late-
rales de aminoácidos contiguos apuntan en direcciones opuestas (Figura 3.36). Una
-180 l=::::::l=::::L.­_l.._
-180 -120 -60 O
_ _.¡__L__J
60 120 +180
hoja 13 se forma uniendo dos o más hebras 13 mediante puentes de hidrógeno. Las
cadenas adyacentes de una hoja 13 pueden dirigirse en sentidos opuestos (hoja 13
ip­ antiparalela) o en el mismo sentido (hoja 13 paralela). En el ordenamiento antipa-
FIGURA 3.35 Diagrama de ralelo, los grupos NH y CO de cada aminoácido establecen puentes de hidrógeno,
Ramachandran para las hebras jl. El área respectivamente, con un grupo CO y NH de un aminoácido situado en la cadena
roja muestra las conformaciones permitidas adyacente (Figura 3.37). En el ordenamiento paralelo, el esquema de puentes de
estéricamente para las estructuras hidrógeno es ligeramente más complicado. En cada aminoácido, el grupo NH forma
extendidas, tipo hebra [3. puentes de hidrógeno con el grupo CO de un aminoácido de la cadena adyacente,
FIGURA 3.42 Estructura de un giro
inverso. i de la
El grupo CO del residuo
cadena polipeptídica se une por puente de
hidrógeno al grupo NH del residuo i + 3
para estabilizar el giro.

teínas y por ello participan en interacciones entre las proteínas y otras moléculas.
La distribución de o-hélices, hebras 13 y giros en una cadena proteica se conoce a
menudo como su estructura secundaria.
~ FIGURA 3.43 Bucles en una
superficie proteica. Fragmento de una
3.4 ESTRUCTURA TERCIARIA: LAS PROTEÍNAS molécula de anticuerpo que tiene bucles en
SOLUBLES EN AGUA SE PLIEGAN EN ESTRUCTURAS la superficie (mostrados en rojo) que median
las interacciones con otras moléculas.
COMPACTAS CON UN NÚCLEO NO POLAR

Examinemos ahora cómo los aminoácidos se agrupan en una proteína completa. Los
estudios de cristalografía de rayos X y resonancia magnética nuclear (Sección 4.5)
han revelado las estructuras tridimensionales detaJladas de miles de proteínas. Em-
pezamos con una visión de la mioglobina, la primera proteína conocida en detaJle
atómico.
La mioglobina, el transportador de oxígeno en el músculo, posee una cadena
polipeptídica única de 153 aminoácidos (ver también los capítulos 7 y 10). La ca-
pacidad de la mioglobina para unir oxigeno depende de la presencia de un grupo
hemo, un grupo prostético (ayudante) no polipeptídico que consiste en una proto-
porfirina IX y un átomo de hierro central. la mioglobina es una molécula extraor-
dinariamente compacta. Sus dimensiones globales son 45 X 35 X 25 A, un orden
de magnitud menor que si estuviese totalmente extendida (Figura 3.44). Aproxima-

(B)

~ FIGURA 3.44 Estructura tridimensional de la mioglobina. (A) Este modelo de


esferas y varillas muestra todos los átomos salvo los hidrógenos y revela muchas
interacciones entre los aminoácidos. (B) Una vista esquemática muestra que la proteína
consiste mayoritariamente en a­hélices. El grupo hemo se muestra en negro y el átomo de
hierro como una esfera púrpura.
~ FIGURA 3.45 Distribución de
los aminoácidos en la mioglobina.
(A) Modelo espacial compacto de la
mioglobina con los aminoácidos
hidrofóbicos marcados en amarillo, los
aminoácidos cargados en azul y el resto en
blanco. La superficie de la molécula tiene
muchos aminoácidos cargados así como
algunos aminoácidos hidrofóbicos. (B) Un
corte en sección muestra que en el interior
de la estructura se encuentran muchos
aminoácidos hidrofóbicos, mientras que
los aminoácidos cargados se encuentran
en la superficie de la proteína.

damente el 70% de la cadena principal está plegada en ocho ex-hélices y casi todo
el resto de la cadena forma giros y bucles entre las hélices.
El plegamiento de la cadena principal de la mioglobina, al igual que en la ma-
yor parte de las demás proteínas, es complejo y desprovisto de simetría. La forma
global de la cadena polipeptídica de una proteína se conoce como su estructura
terciaria. Un principio unificador emerge de la distribución de las cadenas late-
rales. Lo más llamativo es que el interior consta casi completamente de residuos
no polares, como leucina, valina, metionina y fenilalanina (Figura 3.45). Los re-
siduos cargados como aspartato, glutamato, lisina y arginina están ausentes del
interior de la mioglobina. Los únicos residuos polares en el interior son dos resi-
duos de histidina, que desempeñan papeles vitales en la unión de hierro y oxí-
geno. Por otra parte, el exterior de la mioglobina consiste en residuos polares y
no polares. Los modelos de esferas rellenas demuestran que en el interior hay muy
poco espacio vacío.
Esta distribución sorprendente de residuos polares y no polares pone en claro
una faceta clave de la arquitectura proteica. En un entorno acuoso, el plegamiento
proteico está dirigido por la fuerte tendencia de los residuos hidrofóbicos a ser ex-
cluidos del agua (ver Sección 1.3.4). Recordemos que un sístema es más estable ter-
modinámicamente cuando los grupos hidrofóbicos están agrupados en vez de estar
expuestos al entorno acuoso. La cadena polipeptidica se pliega por lo tanto para
que sus cadenas hidrofábicas laterales estén en el interior y sus cadenas polares,
cargadas, estén en la superficie. Muchas hélices ex y hebras 13 son anfipáticas; es
decir, las hélices ex o las hebras 13 tienen una cara hidrofóbica, que apunta hacia el
interior de la proteína, y una cara más polar, dirigida hacia el entorno acuoso. El
destino de la cadena principal que acompaña a las cadenas laterales hidrofóbicas es
también importante. Un grupo peptídico NH o CO desapareado prefiere sustancial-
mente el agua a un medio no polar. El secreto para fijar un segmento de la cadena
principal en un entorno hidrofóbico es el emparejamiento de todos los grupos NH
y CO por medio de puentes de hidrógeno. Este emparejamiento se cumple total-
mente en una hélice ex o una hoja 13. Las interacciones de van der Waals entre las
cadenas laterales fuertemente empaquetadas también contribuyen a la estabilidad de
las proteínas. Podemos entender ahora por qué la serie de 20 aminoácidos contiene
varios que difieren sutilmente en tamaño o forma: proporcionan una paleta de la
que escoger para rellenar el interior de una proteína perfectamente, potenciando al
máximo las interacciones de van der Waals que requieren un contacto íntimo.
Las proteínas transmembrana, que atraviesan las membranas biológicas, son "las
excepciones que confirman la regla" por lo que se refiere a la distribución de los
aminoácidos hidrofóbicos e hidrofílicos en estas estructuras tridimensionales. Con-
sideremos, por ejemplo, las porinas, proteínas que se encuentran en las membranas
externas de muchas bacterias (Figura 3.46). Las barreras de permeabilidad de las
membranas se construyen principalmente por cadenas de alcanos que son extrema-
damente hidrofóbicas (Sección 12.4). Así, el exterior de las porinas está recubierto
63
Estructura cuaternaria

~ FIGURA 3.46 Distribución de


aminoácidos "invertida" en la porina.
El exterior de la porina (que establece
contacto con los grupos hidrofóbicos de
las membranas) está cubierto

Conducto hidrofílico
\
Exterior mayoritariamente
principalmente por residuos hidrofóbicos,
mientras que el centro contiene un
conducto acuoso lineal con aminoácidos
lleno de agua hidrofóbico polares y cargados.

principalmente con residuos hidrofóbicos que interaccionan con las cadenas de al-
cano vecinas. En cambio el centro de la proteína contiene muchos aminoácidos car-
gados y aminoácidos polares que rodean un canal lleno de agua que pasa por el me-
dio de la proteína. Por ello, como las porinas funcionan en entornos hidrofóbicos,
tienen una distribución inversa de los aminoácidos con respecto a las proteínas que
funcionan en disoluciones acuosas.
Hay cadenas polipeptídicas que se pliegan en dos o más regiones compactas que
pueden estar conectadas por un segmento flexible de la cadena polipeptídica, como
perlas en un collar. Estas unidades globulares compactas, llamadas dominios, tienen
un tamaño entre 30 y 400 residuos de aminoácidos. Por ejemplo, la parte extrace-
lular del CD4, la proteína de la superficie celular del sistema inmune a la que se
une el virus de la inmunodeficiencia humana (VIH), está compuesto de cuatro do-
minios similares de aproximadamente unos 100 aminoácidos cada uno de ellos (Fi-
gura 3.47). A menudo, las proteínas tienen dominios comunes incluso si sus es-
tructuras terciarias globales son diferentes.

~ FIGURA 3.47 Dominios proteicos.


La proteína CD4 de la superficie celular
consta de cuatro dominios similares.

3.5 ESTRUCTURA CUATERNARIA: LAS CADENAS


POLIPEPTÍDICAS SE PUEDEN ENSAMBLAR EN
ESTRUCTURAS DE MÚLTIPLES SUBUNIDADES
Frecuentemente, se citan cuatro niveles de estructura en las discusiones sobre ar-
quitectura de proteínas. Hasta ahora, hemos considerado tres de ellos. La estructura
primaria es la secuencia de aminoácidos. La estructura secundaria se refiere al or-
denamiento espacial de los residuos de aminoácidos que están cerca en la secuen-
cia. Algunos de estos ordenamientos son regulares, dando lugar a estructuras pe-
riódicas. La hélice a y la hebra 13 son elementos de estructura secundaria. La
----, 64 !­­­­­­­­­­­
CAPÍTULO 3 • Estructura y función de
las proteínas

~ FIGURA 3.48 Estructura cuaternaria. La proteína ~ FIGURA 3.49 El tetrámero o:2fh de la hemoglobina
Cro del bacteriófago A es un dímero de subunidades humana. La estructura de dos subunidades a idénticas (en rojo) es
idénticas. similar pero no idéntica a la de las dos subunidades 13 (en amarillo).
La molécula contiene cuatro grupos hemo (en negro con el átomo
de hierro púrpura).

estructura terciaria nos habla del ordenamiento espacial de los residuos de amino-
ácidos que se encuentran alejados en la secuencia y del esquema de enlaces disul-
furo. Ahora nos dirigimos a las proteínas que tienen más de una cadena polipeptí-
dica. Tales proteínas exhiben un cuarto nivel de organización estructural. Cada
cadena polipeptídica en estas proteínas se conoce como una subunidad. La estruc-
tura cuaternaria se refiere al ordenamiento espacial de las subunidades y la natu-
raleza de sus interacciones. La forma más simple de estructura cuaternaria es un dí-
mero, que consta de dos subunidades idénticas. Esta organización se presenta en la
proteína de unión a DNA, Cro, que se encuentra en un virus bacteriano llamado X.
(Figura 3.48). También son comunes estructuras cuaternarias más complicadas. Po-
demos encontrar más de un tipo de subunidades, a menudo en proporciones varia-
bles. Por ejemplo, la hemoglobina humana, la proteína transportadora de oxígeno
en la sangre, contiene dos subunidades de un tipo (llamadas a) y dos subunidades
de otro tipo (conocidas como 13), como se muestra en la Figura 3.49. Así, la molé-
(B) cula de hemoglobina es un tetrámero o.2132. Cambios sutiles en el ordenamiento de
las subunidades en la molécula de hemoglobina le permiten transportar oxigeno
desde los pulmones hasta los tejidos con una gran eficiencia (Sección 10.2).
Los virus utilizan la mayor parte de su información genética limitada para for-
mar sus envolturas que usan el mismo tipo de subunidad de forma repetitiva en un
ordenamiento simétrico. La envoltura del rinovirus, el virus que produce el resfriado
común, incluye 60 copias de cada una de las cuatro subunidades que la integran (Fi-
gura 3.50). Las subunidades se agrupan para formar una cápsida prácticamente es-
férica que encierra al genoma vírico.

FIGURA 3.50 Estructura cuaternaria 3.6 LA SECUENCIA DE AMINOÁCIDOS DE


compleja. La envoltura del rinovirus UNA PROTEÍNA DETERMINA SU ESTRUCTURA
contiene 60 copias de sus cuatro TRIDIMENSIONAL
subunidades proteicas. (A) Una vista
esquemática representando los tres tipos
de subunidades (en rojo, azul y verde) ¿Cómo se consigue la elaborada estructura tridimensional de las proteínas? ¿Cómo
visibles desde el exterior del virus. (B) Una se relaciona la estructura tridimensional con la información de la secuencia unidi-
micrografia electrónica mostrando las mensional de aminoácidos? El trabajo clásico de Christian Anfinsen en los años 50
partículas de rinovirus. [Cortesía de Norm sobre el enzima ribonucleasa manifestó la relación entre la secuencia de aminoáci-
Olson, Depto. de Ciencias Biológicas, dos de una proteína y su conformación. La ribonucleasa tiene una cadena polipep-
Universidad de Purdue]. tídica única con 124 residuos de aminoácidos unidos por cuatro enlaces disulfuro
s
1
s

FIGURA 3.51 Secuencia de aminoácidos de la FIGURA 3.52 Papel del ¡l-mercaptoetanol en la reducción de los puentes disulfuro.
ribonucleasa bovina. Los cuatro enlaces disulfuro Nótese que, cuando se reducen los disulfuros, el Jl-mercaptoetanol se oxida y forma
se muestran en color. [Tomadode C.H.W. Hirs, S. dímeros.
Moore y W.H. Stein, j.Biol.Chem.235 (1960); 633.)

(Figura 3.51). La estrategia de Anfisen fue destruir la estructura tridimensional del


enzima y luego determinar qué condiciones se requirían para restaurar esa estruc-
tura.
Agentes como la urea o el cloruro de guanidinio rompen eficazmente los enla-
ces no covalentes, aunque su mecanismo de acción no se comprende por completo.
Los enlaces disulfuro se pueden romper reversiblemente reduciéndolos con un re-
activo como el {3-mercaptoetanol (Figura 3.52). En presencia de un gran exceso de
[3-mercaptoetanol, se origina una proteína en la que los disulfuros (cistinas) se con- cr
vierten completamente en sultbidrilos (cisteínas).
La mayoría de las cadenas polipeptídicas desprovistas de enlaces cruzados adop-
Cloruro de guanidinio
tan una conformación de ovillo estadístico en urea 8 M o cloruro de guanidinio 6
M, como se evidencia estudiando algunas propiedades físicas, tales como la visco- H2
sidad y la actividad óptica. Cuando la ribonucleasa se trató con [3-mercaptoetanol HO'­... ,,....-e~ .Ji
en urea 8 M, el producto fue una cadena polipeptídica completamente reducida, en
e s
H2
conformación de ovillo estadístico y desprovista de actividad enzimática. En otras jl-Mercaptoetanol
palabras, con este tratamiento la ribonucleasa se desnaturalizó (Figura 3.53).
Anfisen hizo entonces la observación clave de que la ribonucleasa desnatura-
1 izada, liberada de la urea y del [3-mercaptoetanol por diálisis, recuperaba lenta-
mente la actividad enzimática. Él se dió cuenta enseguida del significado de este
hallazgo casual: los grupos sulfhidrilo del enzima desnaturalizado se oxidaban por
el aire y el enzima se replegaba espontáneamente en una forma catalíticamente
activa. Estudios detallados demostraron entonces que casi toda la actividad enzi-
mática original se recobraba si los grupos sulfhidrilos se oxidaban en condicio-
nes adecuadas. Todas las propiedades físicas y químicas medidas en el enzima re-
plegado eran prácticamente idénticas a las del enzima nativo. Estos experimentos
demostraron que la información necesaria para especificar la estructura catali-
ticamente activa de la ribonucleasa está contenida en su secuencia de aminoáci-
dos. Estudios posteriores han establecido la generalidad de este principio primor-
dial de la bioquímica: la secuencia especifica la conformación. La dependencia
de la conformación con respecto a la secuencia es especialmente significativa de-
bido a la conexión íntima entre la conformación y la función.

Urea 8 M y
¡3-mercaptoetanol 11 O

FIGURA 3.53 Reducción y


Ribonucleasa nativa Ribonucleasa reducida desnaturalizada desnaturalización de la ribonucleasa.
66 - Un resultado muy diferente se obtuvo cuando la ribonucleasa reducida se reo-
CAPÍTULO 3 • Estructura y función de xidó mientras estaba todavía en urea 8M y la preparación se dializó posteriormente
las proteínas para quitar la urea. La ribonucleasa reoxidada de esta forma tenia solamente el lo/o
de la actividad enzimática de la proteína nativa. ¿Por qué los resultados eran tan
dispares cuando la ribonucleasa reducida se reoxidaba en ausencia o presencia de
urea? La razón radica en que en presencia de la urea se forman disulfuros equivo-
cados. Hay 105 modos diferentes de aparear ocho moléculas de cisteína para for-
mar cuatro puentes disulfuro; y sólo una de estas combinaciones es enzimáticamente
activa. Los 104 apareamientos erróneos se han llamado de forma pintoresca ribo-
nucleasas "revueltas". Anfisen encontró que la ribonucleasa revuelta se convertía
espontáneamente en ribonucleasa nativa, totalmente activa, cuando a una disolución
acuosa del enzima se le añadían cantidades mínimas de 13-mercaptoetanol (Figura
3.54). El 13-mercaptoetanol añadido catalizaba el reordenamiento de los pares di-
sulfuros hasta que la estructura nativa se recuperaba en unas 10 horas aproximada-
mente. Este proceso estaba guiado por el descenso en energía libre cuando las con-
Ribonucleasa revuelta formaciones revueltas se convertían en la conformaciónnativa y estable del enzima.
Los apareamientos nativos de los disulfuro de la ribonucleasa contribuían de esta

!
manera a la estabilización de la estructura termodinámicamente preferida.
Trazas de
J3-mercaptoetanol Experimentos similares de replegamiento se han efectuado en muchas otras pro-
teínas. En muchos casos, la estructura nativa se regeneraba en condiciones apro-
piadas. Sin embrago, para otras proteínas, el replegamiento no se produce con efi-
ciencia. En estos casos, las moléculas de proteína desplegadas normalmente se
quedan enredadas entre ellas formando agregados. En el interior de la célula, unas
proteínas especiales, llamadas chaperonas, bloquean tales interacciones inconve-
nientes (Sección 11.3.6).

3.6.1 Los aminoácidos tienen diferentes propensiones a formar


Ribonucleasa nativa hélices o, hojas J3 y giros J3

FIGURA 3.54 Restableciendo el ¿Cómo puede la secuencia de aminoácidos de una proteína especificar su estructura
emparejamiento correcto de los tridimensional? ¿Cómo una cadena polipeptídica alcanza la forma de la proteína na-
dlsulfuros. La ribonucleasa nativa se puede tiva? Estas cuestiones fundamentales en bioquímica se pueden abordar preguntán-
regenerar desde la ribonucleasa revuelta en dose primero otra más sencilla: ¿ Qué es lo que determina si una secuencia particu-
presencia de trazas de fl-mercaptoetanol. lar de una proteína va a formar una hélice a, una hoja 13, o un giro? El examen de
la frecuencia de aparición de un residuo aminoacídico particular en estas estructu-
ras secundarias (Tabla 3.3) puede ser una fuente de conocimiento para esta deter-
minación. Hay residuos como la alanina, el glutamato y la leucina que suelen estar
presentes en hélices a, mientras que la valina y la isoleucina suelen estarlo en he-
bras 13. La glicina, la asparragina y la prolina tienen tendencia a estar presentes en
los giros.
Los resultados de estudios en proteínas y péptidos sintéticos han desvelado al-
gunas de las razones para estas preferencias. La a-hélice se puede considerar como
la conformación habitual. Ramificaciones del átomo de carbono 13, como en la va-
lina, la treonina y la isoleucina, tienden a desestabilizar las a-hélices debido a
choques estéricos. Estos residuos se acomodan fácilmente en las hebras 13, en las
que sus cadenas laterales se proyectan hacia fuera del plano que comprende la ca-
dena principal. La serina, el aspartato y la asparragina tienden a romper las a-he-
lices porque sus cadenas laterales contienen dadores o aceptores de puentes de hi-
drógeno que están muy cerca de la cadena principal, donde compiten por los grupos
NH y CO de dicha cadena. La prolina tiende a desestabilizar tanto las hélices a
como las hebras 13 porque le falta un grupo NH y porque su estructura en anillo
restringe su valor de <I> a cerca de -60 grados. La glicina encaja fácilmente en
todas las estructuras y por esa razón no favorece en particular la formación de la
a-hélices.
¿Se puede predecir la estructura secundaria de las proteínas usando este co-
nocimiento de las preferencias conformacionales de los residuos de aminoácidos?
Las predicciones de la estructura secundaria adoptada por un pequeño fragmento
de seis o menos residuos han demostrado que son correctas en un 60-70%. ¿Qué
se opone a una predicción más precisa? Tengamos en cuenta que las preferencias
conformacionales de los residuos de aminoácidos no están limitadas simplemente
1 67
TABLA 3.3 Frecuencias relauvas de los residuos aminoacídicos en Estructura tridimensional
estructuras secundarias

Aminoácido hélice o: hoja 13 Giro

Ala 1,29 0,90 0,78


Cys 1,11 0,74 0,80
Leu 1,30 1,02 0,59
Met 1,47 0,97 0,39
Glu 1,44 0,75 1,00
Gin 1,27 0,80 0,97
His 1,22 1,08 0,69
Lys 1,23 0,77 0,96
Val 0,91 1,49 0,47
lle 0,97 1,45 0,51
Phe 1,07 1,32 0,58
Tyr 0,72 1,25 1,05
Trp 0,99 1,14 0,75
Thr 0,82 1,21 1,03
Gly 0,56 0,92 1,64
Ser 0,82 0,95 1,33
Asp 1,04 0,72 1,41
Asn 0,90 0,76 1,28
Pro 0,52 0,64 1,91
Arg 0,96 0,99 0,88

Nota: Los aminoácidos están ordenados de acuerdo a su preferencia por las hélices a (grupo superior),
hojas J) (segundo grupo) o giros (tercer grupo). La arginina no demuestra una preferencia significativa
por ninguna de estas estructuras.
Basado en T.E. Creighton. Proteins: Structures and Molecular Properties, 2ª ed. (W.H. Freeman and
Company, 1992) p. 256.

a una estructura (ver Tabla 3.3). Por ejemplo, el glutamato,


uno de los más firmes formadores de hélices, prefiere la hé-
lice a a la hoja 13 únicamente por un factor de dos. Las rela-
ciones de preferencia de la mayor parte de los otros residuos
son aún más pequeñas. De hecho, se ha visto que algunas se-
cuencias de penta y hexapéptidos adoptan una estructura en
una proteína y otra completamente diferente en otra proteína
(Figura 3.55). Por lo tanto, las secuencias de aminoácidos de-
finidas no son los únicos determinantes de la estructura se-
cundaria. Las interacciones terciarias -interacciones entre
residuos lejanos en la secuencia- podrían ser decisivas para
especificar la estructura secundaria de algunos segmentos. El
contexto es a menudo crucial al determinar el resultado con-
formacional. La conformación de una proteína ha evolucio-
nado para trabajar en un entorno o contexto particular.

~ FIGURA 3.55 Conformaciones


~ Si una proteína adopta una conformación inapropiada para su contexto
alternativas de una secuencia peptídica.
&;i pueden producirse situaciones patológicas. Ejemplos llamativos son las en- En diferentes proteínas, muchas secuencias
fermedades priánicas, tales como la enfermedad de Creutzfeldt-Jacob, kuru y la en- pueden adoptar conformaciones
fermedad de las vacas locas. Estas situaciones se producen cuando una proteína ce- alternativas La secuencia VDLLKN que se
rebral, llamada prión, cambia su conformación normal (llamada Prl") por una muestra en rojo, adopta una conformación
alterada (PrP8c). Esta conversión es auto-reproducible, dando lugar a grandes agre- en a-hélice en un contexto proteico
gados de PrP8c. El papel exacto de estos agregados en la generación de las situa- (izquierda) y una hebra J) en otro
ciones patológicas todavía no se conoce. (derecha).
100
3.6.2 El plegamiento proteico es un proceso muy cooperativo
~
~
"O
Como se ha señalado anteriormente, las proteínas se pueden desnaturalizar por ca-
"'01 lor o por medio de desnaturalizantes químicos como la urea o el cloruro de guani-
C1I
a. dinio. En muchas proteínas, una comparación del grado de desplegamiento cuando
"'
C1I
"O se incrementa la concentración del desnaturalizante ha revelado una transición re-
"'e lativamente abrupta desde la forma plegada, o nativa, a la desplegada, o desnatura-
] lizada, sugiriendo que estas dos conformaciones son las únicas presentes con enti-
e dad significativa (Figura 3.56). Si se comienza con proteínas desplegadas y se quita
!=.
o el desnaturalizante, permitiendo que las proteínas se plieguen, se observa una tran-
[Agente desnaturalizante] ---> sición brusca similar.
El plegamiento y desplegamiento de una proteína es, por lo tanto, práctica-
FIGURA 3.56 Transición desde el estado mente un proceso de "todo o nada" que se produce por una transición coope-
plegado al desplegado. La mayor parte rativa. Por ejemplo, supongamos que se pone una proteína en condiciones en las
de las proteínas experimentan una que algunas partes de la estructura proteica son termodinámicamente inestables.
transición brusca desde la forma plegada
Cuando esta parte de la estructura plegada se desorganiza, se pierden sus inte-
hasta la desplegada cuando se les trata
racciones con el resto de la proteína. La pérdida de estas interacciones, desesta-
con concentraciones crecientes de agentes
desnaturalizantes. bilizará a su vez al 'resto de la estructura. Así, las condiciones que producen la
desestabilización de cualquier parte de la estructura proteica probablemente de-
senredan completamente la proteína. Las propiedades estruc-
turales de las proteínas proporcionan una base clara para la
transición cooperativa.
Las consecuencias del plegamiento cooperativo se pue-
den ilustrar considerando el contenido de una disolución pro-
100
teica en condiciones que corresponden al punto medio de la
transición entre las formas plegada y desplegada. En estas
condiciones, la proteína está "medio plegada". Sin embargo,
la disolución no contendrá moléculas medio plegadas sino
que, en cambio, habrá una mezcla 50/50 de unas moléculas
completamente plegadas y otras completamente desplegadas
(Figura 3.57). Las estructuras que están parcialmente intac-
tas y parcialmente desestabilizadas no son estables termodi-
námicamente y sólo existen de forma transitoria. El plega-
miento cooperativo asegura que las estructuras parcialmente,
[Agente desnaturalizante] --->
plegadas que podrían interferir con procesos dentro de las cé-
FIGURA 3.57 Componentes de una
lulas, no se acumulen.
disolución proteica desnaturalizada
parcialmente. En una disolución de 3.6.3 Las proteínas se pliegan por estabilización progresiva de
proteína medio desplegada, la mitad de intermediarios más que por búsqueda aleatoria
las moléculas están completamente
plegadas y la otra mitad completamente El plegamiento cooperativo de las proteínas es una propiedad termodinámica; su
desplegadas. existencia no revela nada sobre la cinética y el mecanismo del plegado de prote-
ínas. ¿Cómo realiza una proteína la transición de un conjunto diverso de estruc-
turas desplegadas a una conformación única en la forma nativa? Una posibilidad
a priori sería que se intentasen todas las conformaciones posibles para hallar la
más favorable energéticamente. ¿Cuanto tardaría esta búsqueda aleatoria? Consi-
deremos una proteína pequeña de 100 residuos. Cyrus Levinthal calculó que, si
cada residuo puede asumir tres conformaciones diferentes, el número total de es-
tructuras sería 3100, que es igual a 5 X 1047. Si la conversión de una estructura en
otra tarda 10-13 s, el tiempo total de búsqueda sería 5 X 1047 X 10-13 s, lo que
equivale a 5 X 1034 s, es decir, 1.6 X 1027 años. Sin duda, llevaría mucho tiempo,
incluso para una proteína pequeña, plegarse adecuadamente adoptando todas las
conformaciones posibles de forma aleatoria. La enorme diferencia entre los tiem-
pos calculados y los reales para el plegamiento se conoce como la paradoja de
Levinthal.
La salida a este dilema es reconocer la fuerza de la selección acumulativa.
Richard Dawkins en El relojero ciego, se preguntaba cuanto tardaría un mono
tecleando al azar en una máquina de escribir para reproducir el comentario de
Hamlet a Polonius, "Pensaría que es como una comadreja ("Methinks it is like a
weasel") (Figura 3.58). Se requeriría un número astronómicamente grande de
pulsaciones, del orden de 1040. Sin embargo supongamos que guardamos cada
carácter correcto y sólo permitimos al mono volver a teclear los incorrectos. En 69 f­
este caso, sólo se necesitarían unos miles de pulsaciones, de media. La diferen- Estructura tridimensional
cia crucial entre estos casos es que en el primero se emplea una búsqueda com-
pletamente aleatoria, mientras que, en el segundo, los intermediarios parcial-
200 ?T(\G(+s x[A.N5-,ffATxSGpn·i!,[]@
mente correctos se retienen. 400 oDr'Jh7s DFR:W4l'u+Av6zpJseOi
La esencia del plegamiento proteico es la retención de los intermediarios par- 600 e2ih'8zs n527x818d_ih•Hldseb.
cialmente correctos. Sin embargo, el problema del plegamiento proteico es mu- 800 S#dh>}/s JtZqC%1P%DK<l!Aasez.
cho más difícil que el que se le presenta a nuestro simio shakespeariano. Primero, 1000 VOth>nLs ut/isjl ojj~f.
el criterio de exactitud no se deriva de un escrutinio residuo a residuo de la con- 1200 juth+nvs it
formación por un observador omnisciente, sino de la energía libre total de las es- 1400 Iithdn4s it
pecies transitorias. Segundo, las proteínas son sólo ligeramente estables. La dife- 1600 M?thinrs it
rencia de energía libre entre los estados plegado y desplegado de una proteína 1800 MSthinWs it
típica de 100 residuos es 10 kcal mol-1 (42 kJ mol-1) y, por ello, cada residuo 2000 Mhthin's it
contribuye, de media, solamente en 0,1 kcal mol-1 (0,42 kJ mol-1) de energía a 2200 MMthin.ns it is
mantener el estado plegado. Esta cantidad es menor que la de la energía térmica, 2400 Methi it is likydaqw} asel.
que es 0,6 kcal mol-1 (2,5 kJ mol-1) a temperatura ambiente. Esta escasa ener- 2600 ethin4s it is
gía de estabilización indica que se pueden perder los intermediarios correctos, es- 2800 MethinHs it is
pecialmente los formados al comienzo del plegamiento. La analogía es que el 2883 Methinks it is like a weasel.
mono sería, en cierto modo, libre para deshacer sus pulsaciones correctas. Sin em-
bargo, las interacciones que conducen al plegamiento cooperativo pueden estabi-
lizar intermediarios cuando se van construyendo las estructuras. Por ello, las re- 200 )z-hg)W4[(cu!kO(d6jS!NlEyUx)p
giones locales, que tienen una preferencia estructural significativa, aunque no 400 "W \ .<&CfA%4-YlG!iT$6((16
necesariamente estables por ellas mismas, tenderán a adoptar sus estructuras fa­ 600 .L= inlcm4(uMGP~lAWoE6klwW•yiS
vorecidas y, cuando se formen, podrán interaccionar entre ellas, produciendo una 800 AthinkaPa_vYH iR\Hb,Uo4\-"(
estabilización incrementada. 1000 OFthinksP)@fZO li8v) /+Eln26B
1200 6ithiñics'Mv -V i +glffK-JBFk
1400
3.6.4 La predicción de la estructura tridimensional a partir 1600
de la secuencia continúa siendo un gran reto 1800
La secuencia de aminoácidos determina completamente la estructura tridimensional 2000
2200
de las proteínas. Sin embargo, la predicción de una estructura tridimensional a par- 2 4 00 ;.=;:.=;=;=;:;....- ·~~::::"" ~-.-.--.-.
tir de la secuencia ha resultado ser extremadamente difícil. Como hemos visto, la
secuencia local parece determinar sólo entre el 60 y el 70 % de la estructura se-
cundaria; se requieren interacciones de largo alcance para fijar la estructura secun- FIGURA 3.58 Analogía del mono
daria completa y la estructura terciaria. mecanógrafo. Un mono tecleando al azar
Los investigadores están explorando dos aproximaciones completamente di- en una máquina de escribir podría escribir
ferentes para predecir la estructura tridimensional a partir de la secuencia de ami- una línea del Hamlet de Shakespeare,
noácidos. La primera es la predicción ab initio, que intenta predecir el plegamiento siempre que las teclas correctas se
de una secuencia de aminoácidos sin ninguna referencia directa a otras estructu- conservaran. En las dos simulaciones por
ras conocidas en proteínas. Se emplean cálculos computacionales para intentar re- ordenador que se muestran, el número
acumulativo de pulsaciones se indica a la
ducir al mínimo la energía libre de una estructura con una determinada secuencia
izquierda de cada línea.
de aminoácidos o para simular el proceso de plegamiento. La utilidad de estos
métodos es limitada debido al inmenso número de conformaciones posibles, la es-
tabilidad marginal de las proteínas, y la sutil energética de las interacciones dé-
biles en disoluciones acuosas. El segundo abordaje se aprovecha de nuestro co-
nocimiento creciente de las estructuras tridimensionales de muchas proteínas. En
estos métodos basados en el conocimiento, una secuencia de aminoácidos de es-
tructura desconocida se compara con cualquier estructura proteica ya conocida. Si
se detecta un emparejamiento significativo, la estructura conocida se utiliza como
modelo inicial. Los métodos basados en el conocimiento han sido fuente de in-
tuición sobre la conformación tridimensional de proteínas de secuencia conocida
pero estructura desconocida.

3.6.5 La modificación y escisión de las proteínas les confieren


nuevas capacidades
~ Las proteínas son capaces de realizar numerosas funciones basándose úni-
'&P camente en la versatilidad de sus 20 aminoácidos. Sin embargo, muchas
proteínas están modificadas covalentemente para aumentar sus funciones por
unión de grupos que no son aminoácidos (Figura 3.59). Por ejemplo, se pueden
unir grupos acetilo al amino terminal de muchas proteínas, una modificación que
~ 70 1--~~~~~~~~~~
2-
CAPÍTULO 3 • Estructura y función de
las proteínas
-o oc

­­.
"cw--coo-
/

o
Hydroxlprolina y-Carboxlglutamato Complejo carbohldrato- Fosfoserlna
asparraglna

FIGURA 3.59 Toques finales.


Se muestran algunas modificaciones
covalentes comunes e importantes de las
cadenas laterales.
convierte a estas proteínas en más resistentes a la degradación. La adición de
grupos hidroxilo a muchos residuos de prolina estabiliza las fibras recién sinte-
tizadas de colágeno, una proteína fibrosa que se encuentra en el tejido conjun-
tivo y en el hueso. El significado biológico de esta modificación resulta evidente
en la enfermedad del escorbuto: una deficiencia de vitamina C ocasiona una hi­
droxilación insuficiente del colágeno y las fibras anormales de colágeno resul-
tantes son incapaces de mantener la resistencia normal del tejido. Otro aminoá-
cido especializado producido por un cambio final es el -y-carboxiglutamato. En
la deficiencia de vitamina K, la carboxilación insuficiente del glutamato de la
protrombina, una proteína de la coagulación, puede provocar hemorragias. Mu-
chas proteínas, especialmente las que están presentes en la superficie celular o
se secretan, llevan unidades de carbohidrato unidas a residuos específicos de as-
parragina. El añadir azúcares hace a las proteínas más hidrofílicas y capaces de
participar en interacciones con otras proteínas. A la inversa, el añadir un ácido
graso a un grupo a-amino o al grupo sulfhidrilo de una cisteína produce una pro-
teína más hidrofóbica.
Muchas hormonas, como la adrenalina (epinefrina), alteran las actividades de
los enzimas estimulando la fosforilación de los grupos hidroxilo de los aminoáci-
dos serina y treonina, lafosfoserina y la fosfotreonina son los aminoácidos modi-
ficados más comunes en las proteínas. Los factores de crecimiento como la insu-
lina actúan provocando la fosforilación de los grupos hidroxilo de los residuos de
tirosina, formandofosfotirosina Los grupos fosforilo de estos tres aminoácidos mo-
dificados se pueden liberar con facilidad; por ello, son capaces de actuar como in-
terruptores reversibles en la regulación de los procesos celulares. Los papeles de
la fosforilación en la transducción de señales se tratarán ampliamente en el capí-
tulo 15.
Las modificaciones precedentes consisten en añadir grupos especiales a los ami-
noácidos. Otros grupos especiales se generan por reorganización química de las ca-
denas laterales y, a veces, del esqueleto peptídico. Por ejemplo, algunas medusas
producen una proteína fluorescente verde (Figura 3.60). La fuente de la fluores-
cencia es un grupo formado por reorganización espontánea y oxidación de la se-
cuencia Ser-Tyr-Gly en el centro de la proteína. Esta proteína es de gran utilidad a
los investigadores como marcador intracelular (Sección 4.3.5)
Por último, muchas proteínas se cortan y adaptan tras la síntesis. Por ejemplo,
los enzimas digestivos se sintetizan como precursores inactivos que se pueden al-
macenar con seguridad en el páncreas. Tras su liberación al intestino, estos precur-
sores se activan por ruptura de enlaces peptídicos. En la coagulación sanguínea, la
ruptura de enlaces convierte el fibrinógeno soluble en fibrina insoluble. Una serie
de hormonas polipeptídicas, como la hormona adrenocorticotrópica, se producen por
la división de una proteína precursora más extensa. De modo similar, muchas pro-
teínas víricas se producen por escisión de proteínas precursoras de mayor tamaño.
Encontraremos muchos más ejemplos de modificación y ruptura como rasgos cla-
ves en la formación y función de las proteínas. Evidentemente, estos toques finales
tienen mucho que ver con la versatilidad, precisión y elegancia de la acción pro-
teica y su regulación.
(B)
(A)

~ FIGURA 3.60 Reorganizaciones


químicas en GFP. (A) Estructura de la
proteína verde fluorescente (GFP, "green
ñuorescent protein"). La reorganización y
oxidación de la secuencia Ser­Tyr­Gly es la
fuente de la fluorescencia. (B) Micrografía
fluorescente de un embrión de cuatro
células (las células están resaltadas) del
gusano C. elegans que contiene una
proteína, PIE­1, marcada con GFP. La
RESUMEN proteína se expresa sólo en la célula (arriba)
que dará lugar a la línea germinal. [(B)
Las proteínas son los agentes activos de la bioquímic 1, ya que participan en Cortesía de Geraldine Seydoux).
prácticamente todos los procesos celulares clave. La estructura de las prote-
ínas se puede describir en cuatro niveles. La estructura primaria se relaciona
con la secuencia de aminoácidos. La estructura secundaria se refiere a la con-
formación adoptada por regiones locales de la cadena polipeptídica. La es-
tructura terciaria describe el plegamiento global de la cadena polipeptídica.
Finalmente, la estructura cuaternaria se refiere a la asociación específica de
varias cadenas polipeptídicas para formar complejos de múltiples subunida-
des.
Las proteínas se construyen a partir de una colección de
20 aminoácidos
Las proteínas son polímeros lineales de aminoácidos. Cada aminoácido está
formado por un átomo de carbono central tetraédrico unido a un grupo
amino, un grupo ácido carboxílico, una cadena lateral específica y un hi-
drógeno. Estos centros tetraédricos, con la excepción del de la glicina, son
quirales; en las proteínas naturales sólo existe el isómero L. Todas las pro-
teínas naturales se construyen a partir del mismo conjunto de 20 aminoáci-
dos. Las cadenas laterales de estos 20 bloques de construcción varían enor-
memente en tamaño, forma y presencia de grupos funcionales. Se pueden
agrupar como sigue: (1) cadenas laterales alifáticas: glicina, alanina, valina,
leucina, isoleucina, metionina y prolina; (2) cadenas laterales aromáticas:
fenilalanina, tirosina y triptófano; (3) cadenas laterales alifáticas con gru-
pos hidroxilo: serina y treonina; (4) cisteína con un grupo sulfhidrilo; (5)
cadenas laterales básicas: lisina, arginina e histidina; (6) cadenas laterales
acídicas: ácido aspártico y ácido glutámico; y (7) cadenas laterales con car-
boxamida: asparragina y glutamina. Estos agrupamientos son en cierto modo
arbitrarios y también son posibles otros muchos agrupamientos razonables.
~72,__~~~~~~- Estructura primaria: Los aminoácidos están unidos por enlaces peptídicos
CAPÍTULO 3 • Estructura y función de para formar cadenas polipeptídicas
las proteínas Los aminoácidos de un polipéptido están unidos por enlaces amida formados
entre el grupo carboxilo de un aminoácido y el grupo amino del siguiente.
Esta unión, conocida como enlace peptídico, tiene varias propiedades impor-
tantes. Primero, es resistente a la hidrólisis por lo que las proteínas son muy
estables cinéticamente. Segundo, el grupo peptídico es plano porque el en-
lace C­N tiene un fuerte carácter de doble enlace. Tercero, cada enlace pep-
tídico tiene tanto un dador de puente de hidrógeno (el grupo NH) como un
aceptor (el grupo CO). El puente de hidrógeno entre estos grupos del esque-
leto es un rasgo característico de la estructura proteica. Finalmente, el enlace
peptídico no tiene carga, lo que permite a las proteínas formar estructuras glo-
bulares fuertemente empaquetadas que tienen cantidades significativas del es-
queleto encerradas en su interior. Debido a que son polímeros lineales, las
proteínas se pueden describir como secuencias de aminoácidos. Tales se-
cuencias se escriben desde el extremo amino terminal hasta el carboxilo ter-
minal.
Estructura secundaria: Las cadenas polipeptídicas se pueden plegar en
estructuras regulares como la hélice alfa, la hoja plegada beta y giros y
bucles
Dos elementos principales de la estructura secundaria son la hélice a y la he-
bra l3. En la a-hélice, la cadena polipeptídica se enrosca en un cilindro muy
empaquetado Dentro de la hélice, el grupo CO de cada aminoácido se une por
puente de hidrógeno al grupo NH del aminoácido situado cuatro residuos más
lejos en la cadena polipeptídica. En la hebra 13, la cadena polipeptídica está
prácticamente de forma totalmente extendida. Dos o más hebras 13 conectadas
por puentes de hidrógeno entre NH y CO se juntan para formar hojas 13.
Estructura terciaria: Las proteínas solubles en agua se pliegan en
estructuras compactas con un núcleo no polar
La estructura compacta y asimétrica que forman las proteínas se conoce como
estructura terciaria. Las estructuras terciarias de las proteínas solubles en agua
tienen características comunes: (1) un interior formado por aminoácidos con
cadenas laterales hidrofóbicas y (2) una superficie formada principalmente por
aminoácidos hidrofílicos que interaccionan con el entorno acuoso. La fuerza
que provoca la formación de la estructura terciaria de las proteínas solubles en
agua reside en las interacciones hidrofóbicas entre los residuos interiores. Al-
gunas proteínas que se encuentran en un entorno hidrofóbico, en membranas,
poseen una distribución inversa de los aminoácidos hidrofóbicos e hidrofílicos.
En estas proteínas, los aminoácidos hidrofóbicos están en la superficie para in-
teraccionar con el entorno, mientras que los grupos hidrofílicos están apanta-
llados del entorno en el interior de la proteína.
Estructura cuaternaria: Las cadenas polipeptídicas se pueden ensamblar
en estructuras de múltiples subunidades
Las proteínas que contienen más de una cadena polipeptídica presentan estruc-
tura cuaternaria y cada cadena polipeptídica individual se conoce como subu-
nidad. La estructura cuaternaria puede ser tan simple como dos subunidades
idénticas o tan compleja como docenas de subunidades diferentes. En la mayor
parte de los casos, las subunidades se mantienen unidas por enlaces no cova-
lentes.
La secuencia de aminoácidos de una proteína determina su estructura
tridimensional
La secuencia de aminoácidos determina totalmente la estructura tridimensional
y, consecuentemente, todas las otras propiedades de la proteína. Algunas pro-
teínas se pueden desplegar completamente y luego replegarse de forma eficaz
cuando se las coloca en condiciones en las que la forma plegada de la proteína
es estable. La secuencia de aminoácidos de una proteína está determinada por
la secuencia de bases de una molécula de DNA. Esta información unidimen-
sional de la secuencia se proyecta al mundo tridimensional por la capacidad de

1 •
las proteínas de plegarse espontáneamente. El plegamiento de las proteínas es
un proceso altamente cooperativo; no se acumulan los intermediarios estructu-
73 r-
Apéndice: conceptos ácido-base
rales entre las formas plegada y desplegada.
La versatilidad de las proteínas se ve incrementada posteriormente por las
modificaciones covalentes. Tales modificaciones pueden incorporar grupos fun-
cionales no presentes en Jos 20 aminoácidos. Otras modificaciones son impor-
tantes para la regulación de la actividad proteica. Gracias a su estabilidad es-
tructural, diversidad y reactividad química, las proteínas posibilitan la mayor
parte de los procesos clave asociados con la vida.

~ APÉNDICE: CONCEPTOS ÁCIDO-BASE, _


Ionización del agua El pK0 de un ácido se define como

El agua se disocia en los iones hidronio (H30+) e hidroxilo (OH-). pK. = -log K. = log(I/K0) (5)
Para simplificar, nos referimos al ión hidronio como ión hidrógeno Observando la ecuación 4 nos muestra que el pK. de un ácido es el
(H+) y escribimos el equilibrio como pH en el cual la mitad está disociado, es decir, cuando [A-) = [HA].
H20 :.==== H+ + OH-
La ecuación de Henderson­Hasselbalch
La constante de equilibrio Keq de esta disociación viene dada por
¿Cual es la relación entre el pH y la proporción de ácido a base?
(1)
Una expresión útil puede deducirse de la ecuación 4. Reagrupando
donde los términos entre corchetes indican concentraciones molares. esa ecuación se obtiene
Dado que la concentración del agua (55,5 M) cambia muy poco por (6)
la ionización, la expresión 1 se puede simplificar para dar
Aplicando logaritmos en ambos lados de la ecuación 6 se obtiene
(2)
log(l/[H+]) = log(l/K.) + log([A -]/[HA]) (7)
en la que Kw es el producto iónico del agua. A 25 ºC, K; es 1,0 X 10-14_
Sustituyendo log 1/[H+] por pH y log llK. por pK.en la ecuación 7
Nótese que las concentraciones de H+ y OH- están relaciona-
resulta
das recíprocamente. Si la concentración de H+ es alta, entonces la
pH = pK. + log([A -]/[HA]) (8)
concentración de OH- debe ser baja y viceversa. Por ejemplo, si
[H+] = 10­2 M, entonces [OH-]= 10­12 M. que se conoce habitualmente como la ecuación de Henderson-Has-
selbalcb.
Definición de ácido y base El pH de una disolución se puede calcular mediante la ecuación
8 si se conocen la proporción molar de A - respecto a HA y el pK.
Un ácido es un dador de protones. Una base es un aceptor de pro-
de HA. Consideremos una disolución O,! M de ácido acético y 0,2
tones.
M de ión acetato. El pK. del ácido acético es 4,8. Por lo tanto, el pH
Ácido:.==== H+ + base de la disolución viene dado por
pH = 4,8 + Jog(0,2/0,l) = 4,8 + log 2,0 = 4,8 + 0,3 = 5,1
Ácido acético Acetato Inversamente, el pK. se puede calcular si se conocen la relación mo-
NH4 + :.==== H + + NH3 lar entre A - y HA y el pH de la disolución.
Ión amonio Amoniaco
Amortiguadores
La especie formada por la ionización de un ácido es su base conju-
Un par ácido-base conjugado (como el ácido acético y el ión ace-
gada. A la inversa, la protonación de una base da su ácido conju-
tato) tiene una propiedad importante: resiste cambios en el pH de la
gado. El ácido acético y el ión acetato son un par ácido-base conju-
disolución. En otras palabras, actúa como un amortiguador (buffer
gado.
o tampán). Si añadimos OH- a una disolución de ácido acético (HA):

Definición de pH y pK HA+ OH-:.==== A - + H20

El pH de una disolución es la medida de su concentración de H+. Una representación de la dependencia del pH de esta disolución res-
El pH se define como pecto a la cantidad de OH- añadido se conoce como una curva de
valoracián (Figura 3.61). Observemos que hay un punto de inflexión
(3) en la curva a pH 4,8 que es el pK3 del ácido acético. En la cercanía
El equilibrio de ionización de un ácido débil viene dado por de este pH, una cantidad relativamente grande de OH- produce un
cambio pequeño del pH. En otras palabras, el amortiguador man-
HA :.==== H+ + A - tiene el valor el pH cercano a un valor dado, a pesar de la adición
de otros iones, protones o hidróxidos. En general, un ácido débil es
La constante aparente de equilibrio K. para esta ionización es
más efectivo amortiguando los cambios de pH en la cercanía de su
(4) valor de pK0•
-----, 74 r- CAPÍTULO 3 • Estructura y función de las proteínas
1

TABLA 3.4 Valores de pK. de algunos aminoácidos


"'o
"O valores de pK0 (25°C)
'6
"'
.c grupo grupo Cadena
"'
1
J:
Aminoácido a-COOH a-NH3 + lateral
o
Q)
"O
0,5 Alanina 2,3 9,9
s"'
e:
Glicina 2,4 9,8
Q) Fenilalanina 1,8 9,1
"ia
> 2,1 9,2
's Serina
O"
u.J
Valina 2,3 9,6
Ácido aspártico 2,0 10,0 3,9
4 Ácido glutámico 2,2 9,7 4,3
pH Histidina 1,8 9,2 6,0
FIGURA 3.61 Curva de valoración del ácido acético. Cisteína 1,8 10,8 8,3
Tirosina 2,2 9,L 10,9
Lisina 2,2 9,2 10,8
Arginina 1,8 9,0 12,5

Tomado de J. T. Edsall y J. Wyman, Biophysical Chemistry


Valores de pK. de los aminoácidos (Academic Press, 1958), Capítulo 8.
Un aminoácido como la glicina contiene dos grupos ionizables: un
grupo o-carboxilo y un grupo a-amino protonado. Conforme se añade bla 3.4). Algunos aminoácidos, como el ácido aspártico, también con-
una base, estos dos grupos se valoran (Figura 3.62). El pK. del grupo tienen una cadena lateral ionizable. Los valores de pK. de las cade-
a-COOH es 2,4, mientras que el del grupo a-NH3 + es 9,8. Los va- nas laterales ionizables en los aminoácidos oscilan desde 3,9 (ácido
lores de pK. de estos grupos en otros aminoácidos son similares (Ta- aspártico) hasta 12,5 (arginina).

R OW HOH
)( \,,_¿
FIGURA 3.62 Valoración de los grupos
+H3N COO­ ====::::::;:=:::
H+ a-carboxilo y a-amino de un aminoácido.

~ TÉRMINOS CLAVE
cadena lateral (grupo R) (p.43) ángulo psi ("1) (p.55) estructura terciaria (p.62)
L aminoácido (p.43) diagrama de Ramachandran (p.55) dominio (p. 63)
ión dipolar (zwitterion) (p.43) hélice a (p.56) subunidad (p. 64)
enlace peptídico (enlace amida) (p.51) hoja plegada f3 (p.58) estructura cuaternaria (p.64)
enlace disulfuro (p.52) hebra f3 (p.58) transición cooperativa (p.68)
estructura primaria (p.53) giro inverso (giro [3; giro en horquilla) (p.60)
ángulo fi ( <!>) (p.55) estructura secundaria (p. 61)

~ LECTURAS SELECCIONADAS

Bibliografía fundamental Perutz, M. F., 1992. ProteinStructure: New Approaches ro Disease and Ther-
apy. W. H. Freeman and Company.
Richardson, J. S., 1981.The anatomy and taxonomy of protein structure. Adv.
Creighton, T. E., 1992. Proreins: Structures and Molecular Principies (2d
Protein Chem. 34: 167-339.
ed.). W. H. Freeman and Company.
Doolittle, R. F., 1985. Proteins. Sci. Am. 253(4):88-99.
Schultz, G. E., y Schirmer, R. H., 1979. Principies of Protein Structure.
Richards, F. M., 1991. The protein folding problem. Sci. Am. 264(1): 54-57.
Springer-Verlag.
Weber, A. L., y Miller, S. L., 1981. Reasons for the occurrence of the twenty
coded protein amino acids. J. Mol. Evo/. 17:273-284. Conformación de proteínas
Richardson, J. S., Richardson, D. C., Tweedy, N.B., Gemert, K. M., Quinn,
Libros T. P., Hecht, M. H., Erickson, B. W., Yan, Y., McClain, R. D., Donlan,
Branden, C., Tooze, J., 1999. Introduction to Protein Structure (2d ed.). Gar- M. E., y Suries, M.C., 1992. Looking at proteins: Representations, fold-
land. ing, packing, and design. Biophys. J. 63: 1186-1220.
Chothia, C., y Finkelstein, A. V., 1990. The classification and origin of pro-
tein folding patterns. Annu. Rev. Biochem. 59:1007-1039.
Problemas ~ 75 r­
Baldwin, R. L., y Rose, G. D., 1999. Is protein folding hierarchic? I. Local
structure and peptide folding, Trends Biochem. Sci. 24:26-33.
\
Baldwin, R. L., y Rose, G. D., 1999. Is protein falding hierarchic? ll. Fold-
Hélices ex, hojas 13 y bucles ing intermediates and transition states. Trends Biochem. Sci. 24:77-83.
O'Neil, K. T., y DeGrado, W. F., 1990. A thermodynamic scale far the he- Staley, J. P., y Kim, P. S., 1990. Role of a subdomain in the folding of bovine
lix-forrning tendencies of the commonly occurring amino acids. Science pancreatíc trypsin inhibitor. Nature 344:685-688.
250:646-651. Neira, J. L., y Fersht, A. R., 1999. Exploring the falding funnel of a polypep-
Zhang, C., y Kim, S. H., 2000. The anatomy of protein beta-sheet topology. tide chain by biophysical studies on protein fragments.
J. Mol. Biol. 299:1075-1089. J. Mol. Biol. 285: 1309-1333.
Regan, L., 1994. Protein structure: Born to be beta. Curr. Biol. 4:656-658.
Leszczynski, J. F., y Rose, G. D., 1986. Loops in globular proteins: A novel
Modificación covalente de proteínas
category of secondary structure. Science 234:849-855. Krishna, R. G., y Wold, F., 1993. Post-translational modification of proteins.
Srinivasan, R., y Rose, G. D., 1999. A physical basis far protein secondary Adv. Enzymol. Relat. Areas. Mol. Biol. 67:265-298.
structure, Proc. Natl. Acad. Sci. USA 96:14258-14263. Aleua, J. M., Cimato, T. R., y Ertinger, M. J., 1998. Protein methylation: A
signa) event in posr-translational modification. Trends Biochem. Sci.
Dominios 23:89-91.
Bennett, M. J., Choe, S., y Eisenberg, D., 1994. Domain swapping: Entan- Glazer, A. N., DeLange, R. J., y Sigman, D. S., 1975. Chemical Modifica-
gling alliances between proteins. Proc. Natl. Acad. Sci. USA tion o/ Proteins. North­Holland.
91:3127-3131. Tsien, R. Y., 1998. The green fluorescent protein. Annu. Rev. Biochem.
Bergdoll, M., Eltis, L. D., Cameron, A. D., Dumas, P., y Bolin, 67:509-544.
J. T., 1998. Ali in the family: Structural and evolutionary relationships
among three modular proteins with diverse functions and variable as-
Gráficas moleculares
sembly. Protein Sci. 7:1661-1670. Kraulis, P., 1991. MOLSCRTPT: A program to produce bolh detailed and
Hopfner, K. P., Kopetzki, E., Kresse, G. B., Bode, W., Huber, R., y Engh, schematic plots of protein structures. J. Appl. Cryst. 24:946-
R. A., 1998. New enzyme lineages by subdomain shuffling. Proc. Natl. 950.
Acad. Sci. USA 95:9813-9818. Ferrin, T., Huang, C., Jarvis, L., y Langridge, R., 1988. The MIDAS display
Ponting, C. P., Schultz, J., Copley, R. R., Andrade, M. A., y Bork, P., 2000. system. J. Mol. Graphics 6: 13-27.
Evolution of domain families. Adv. Protein Chem. 54: Richardson, D. C., y Richardson, J. S., 1994. Kinemages: Simple macro-
185-244. molecular graphics far interactive teaching and publication. Trends
Biochem. Sci. 19: 135-138.
Plegamiento de proteínas
Anfinsen, C. B., 1973. Principies that govern the falding of protein chains.
Science 181 :223-230.

~ PROBLEMAS
1. Forma y dimensión. (a) La tropomiosina, una proteína muscular principal se extienda completamente en la cercanía del enlace pep-
de 70 kd, está formada por un superhelicoide de ex-hélices con dos tidico vulnerable?
hebras. Calcular la longitud de la molécula. (b) Suponer que un seg-
6. A menudo irremplazable. La glicina es un residuo de aminoá-
mento proteico de 40 residuos se pliega en una estructura ¡3-antipa-
ralela de dos hebras con un giro en horquilla de 4 residuos. Cual es cido muy conservado en la evolución de las proteínas. ¿Por qué?
la longitud máxima de este motivo? 7. Socios potenciales. Identificar los grupos de una proteína que
2. Contraste entre isómeros La poli-L-leucina es una ex-hélice en un pueden formar puentes de hidrógeno y enlaces electrostáticos con
disolvente orgánico como el dioxano, mientras que la poli-i.-isoleu- una cadena lateral de arginina a pH 7.
cina no lo es. ¿Por qué estos aminoácidos con el mismo número y
8. Ondulación permanente. La forma del pelo está determinada en
tipo de átomos tienen diferentes tendencias para formar hélices?
parte por el patrón de enlaces disulfuro de la queratina, su proteína
3. De nuevo activo. Una mutación que cambia un residuo de ala- principal. ¿Cómo se pueden crear rizos?
nina por valina en el interior de una proteína produce pérdida de ac-
9. la ubicación lo es todo. Las proteínas transmembrana contienen
tividad. Sin embargo, la actividad se recupera cuando una segunda
a menudo ex-hélices. Habida cuenta que el interior de las membra-
mutación en una posición diferente cambia un residuo de isoleucina
nas es muy hidrofóbico (Seción 12.2.1), predecir qué tipo de ami-
por glicina. ¿Cómo podría esta segunda mutación conducir a un res-
noácidos habría en estas hélices. ¿Por qué una ex-hélice es especial-
tablecimiento de la actividad?
mente adecuada para encontrarse en el entorno hidrofóbico del
4. Ensayo desconcertante. Se ha aislado un enzima llamado prote- interior de una membrana?
ína disulfuro isomerasa (PDI) que cataliza las reacciones de inter-
cambio disulfuro-sulfhidrilo. El POI convierte rápidamente la ribo- 10. Rasgos de estabilidad. Las proteínas son muy estables. La vida
nucleasa revuelta en ribonucleasa enzimáticamente activa. Por media de un enlace peptídico en disolución acuosa es casi 1000 años.
contraste, la insulina se inactiva rápidamente por PDI. ¿Qué implica Sin embargo, el ó.Gº' de la hidrólisis de las proteínas es negativo y
esta importante observación en la relación entre la secuencia de ami- muy grande. ¿Cómo se puede justificar la estabilidad del enlace pep-
noácidos de la insulina y su estructura tridimensional? tídico teniendo en cuenta el hecho de que la hidrólisis libera una gran
cantidad de energía?
5. Extender una diana. Una proteasa es un enzima que cataliza la
hidrólisis de los enlaces peptídicos de las proteínas diana ¿Cómo 11. Especies menores. En un aminoácido como la alaruna, la forma
puede la proteasa unirse a la proteína diana de modo que su cadena principal a pH 7 en disolución es la zwitteriónica, Suponiendo un
~ 76 f­­ CAPÍTULO 3 • Estructura y función de las proteínas
valor de pK. de 8 para el grupo amino y un valor de pK. de 3 para 16. Concentrado en la concentración. Una disolución de una prote-
el ácido carboxílico, calcular la proporción entre la concentración de ína cuya secuencia incluye tres residuos de triptófano, sin residuos
la forma neutra del aminoácido (con el ácido carboxílico protonado de tirosina, ni de fenilalanina tiene una absorbancia de O, 1 a 280 nm
y el grupo amino neutro) y la forma zwitteriónica a pH 7. en una celda de 1 cm de paso óptico. Obtener la concentración de
la proteína en unidades de molaridad. Si la proteína tiene una masa
12. Cuestión de convención. Todos los t-aminoácidos tienen una
molecular de 100 kd, hallar la concentración en miligramos de pro-
configuración absoluta S, excepto la i.-cisteína que tiene una confi-
teína por mililitro de disolución.
guración R. Explicar por qué se considera que la i.-cisteína tiene una
configuración absoluta R.

13. Mensaje oculto. Traducir la siguiente secuencia de aminoácidos ~ Problema en la Red


en código de una letra: Leu-Glu-Ala-Arg-Asn-Ile-Asn-Gly-Ser-Cys- Se pueden usar las Visiones estructurales (Structural lnsights) y
Ile-G lu-Asn-Cys-G I u-Ile-Ser-G I y-Arg-G I u-Ala-Thr. las Visiones conceptuales (Conceptual lnsight) como ayuda visual
para ayudarse a contestar los Problemas en la Red. Ir al sitio Web:
14. ¿Quién va primero? ¿Se esperaría que los enlaces peptídicos www.whfreeman.com/biochem5, y seleccionar el módulo aplicable.
Pro-X tendieran a adoptar una conformación cis corno los enlaces
X-Pro?. ¿Por qué o por qué no? 17. De dentro afuera, de atrás adelante. En la Sección de Proble-
15. Buscar la pareja. Para cada uno de los derivados de aminoáci- mas en la red del módulo Visiones estructurales, se pueden exa-
dos mostrados abajo (A-E) encontrar su correspondiente serie de va- minar los modelos moleculares de cuatro estructuras potenciales de
lores <l> y lj, (a-e). proteínas. Una de las cuatro estructuras se ha resuelto por cristalo-
grafía de rayos X. Las otras tres se han construido y de hecho es
(A) (B) (C) (D) (E) muy difícil que existan. ¿Cuáles son las estructuras improbables y

Y(Áf(~Y(
por qué?

(a) (b) (e) (d) (e)


<!> = 120º, <!> = 180°, <!> = 180°, el>= Oº, <!> = -60°,
IV= 120º IV= Oº IV= 180º lj, = 180° IV= -40º
n
~~~~~~~~~~~~>
Investigación en proteínas
.,,_,
---1
e:
....o
Caseína2+
Caseína

i
Lactoglobulina
Lactalbúmina

Ü'--~-'-~-'-~--"'".._~ ....................... ~..,_._,,___.._..,_.,_--'-'..__--JL----'


2000 16000 30 000
Masa/carga

La leche, una fuente de alimento para todos los mamíferos, se compone, en parte,
de un conjunto de proteínas. Los componentes proteicos de la leche se desvelan mediante
la técnica de espectrometría de masas MALDI-TOF, que separa las moléculas en base a su
relación entre masa y carga. [(Izquierda) Jean Paul lris/FPG; (derecha) cortesía de Brian Chait.J

En el capítulo precedente hemos visto que las proteínas desempeñan un papel cru-
cial en casi todos los procesos biológicos: en la catálisis, la transducción de seña-
les y como soportes estructurales. Esta gama considerable de funciones diferentes
se debe a la existencia de miles de proteínas, cada una plegada en una estructura
tridimensional específica, que les permite interaccionar con una o
más moléculas de un conjunto muy diverso. Una finalidad pri-
mordial de la bioquímica es determinar cómo las secuencias de CONTENIDO
aminoácidos especifican la conformación de las proteínas. Otras
metas son el saber cómo las proteínas individuales se unen a sus- 4.1 La purificación de proteínas es un
tratos específicos y a otras moléculas, cómo median la catálisis y primer paso esencial en el conocimiento
transducen energía e información. de su función
El primer paso de una serie de estudios dirigidos a explorar la 4.2 Las secuencias de aminoácidos se
función de una proteína es la purificación de esa proteína de in- pueden determinar por degradación
terés. Las proteínas se pueden separar entre sí en base a su solu- de Edman automatizada
bilidad, tamaño, carga y capacidad de unión. Cuando se purifica
4.3 La inmunología proporciona técnicas
una proteína, se puede determinar su secuencia de aminoácidos.
importantes para la investigación sobre
La estrategia es "divide y vencerás", es decir, obtener fragmentos
las proteínas
específicos que puedan ser secuenciados fácilmente. La secuen-
ciación automatizada de péptidos y la aplicación de métodos de 4.4 Los péptidos se pueden sintetizar por
DNA recombinante han aportado tal riqueza de datos de secuen- métodos automatizados en fase sólida
cias de aminoácidos que se han abierto nuevas perspectivas. Para 4.5 La estructura tridimensional de las
comprender el contexto fisiológico de una proteína, los anticuer- proteínas se puede determinar por
pos son las sondas a elegir para localizar las proteínas in vivo y espectroscopía de NMR y cristalografía
medir sus cantidades. Se pueden.obtener anticuerpos monoclona- de rayos X
les en grandes cantidades para reconocer proteínas específicas. Es
posible la síntesis de péptidos, lo que hace factible la síntesis de
----j 78 nuevos fármacos, fragmentos funcionales de proteínas y antígenos que induzcan la
CAPÍTULO 4 • Investigación en proteínas formación----ee-antie-t:1erpos~esp-ecíficos=:Laes ectroscopía de resonancia magnética
nuclear (NMR) y la cristalografía de rayos X son las principales técnicas para.ave-
.riguar la estructura tridimensional, el determinante clave de la función de una pro-
teína.
La exploración de las proteínas por esta batería de técnicas físicas y químicas
ha enriquecido enormemente nuestro entendimiento de las bases moleculares de la
vida y hace posible el abordar algunas de las cuestiones más complejas de la bio-
logía en términos moleculares.

4.0.1 El proteoma es la representación funcional del genoma


Muchos organismos, incluyendo varios metazoos, están revelando sus secuencias
de bases del DNA a los secuenciadores de genes. La lombriz intestinal Caenor-
hadbitis elegans tiene un genoma con 97 millones de bases y aproximadamente
19 000 genes que codifican proteínas, mientras que la mosca de la fruta Drosophila
melanogaster contiene 180 millones de bases y aproximadamente 14 000 genes. El
increíble progreso que se ha conseguido en la secuenciación de genes ha culminado
ya en el conocimiento de la secuencia completa del genoma humano, los
3000 millones de bases con unos 40 000 genes estimados. Pero este conocimiento
genómico es análogo a la lista de componentes de un coche: no explica como és-
tos funcionan juntos. Se ha acuñado una nueva palabra, el proteoma, para repre-
sentar un contenido más complejo del nivel de información, el nivel de la informa-
ción funcional, que abarca el tipo, funciones e interacciones de las proteínas que
comprenden una unidad funcional.
El término proteoma se deriva de proteínas expresadas por el genoma. Mientras
que el genoma nos dice lo que es posible, el proteoma nos dice lo que está presente
funcionalmente; por ejemplo, qué proteínas interaccionan para formar una vía trans-
ductora de señal o un conducto iónico en una membrana. El proteoma no es una ca-
racterística fija de la célula. Como representa la expresión funcional de la informa-
ción, varía con el tipo de célula, estado de desarrollo y condiciones ambientales,
como pueden ser la presencia de hormonas. El proteoma es mucho mayor que el
genoma debido a factores tales como el RNA escindido alternativamente, la modi-
ficación post-traduccional de las proteínas, la regulación temporal de la síntesis de
proteínas y las interacciones variables proteína-proteína. A diferencia del genoma,
el proteoma no es estático.
El conocimiento del proteoma se obtiene investigando, caracterizando y catalo-
gando las proteínas. El proceso comienza habitualmente cuando un investigador se-
para una proteína particular del resto de las biomoléculas de la célula.

4.1 LA PURIFICACIÓN DE LAS PROTEÍNAS ES


UN PRIMER PASO ESENCIAL PARA EL
CONOCIMIENTO DE SU FUNCIÓN

Un proverbio bioquímico es: "Nunca desperdicies pensamientos puros en una


proteína impura". Comenzando con proteínas puras, podemos precisar las se-
cuencias de aminoácidos y las relaciones evolutivas entre proteínas de diferen-
tes organismos y podemos investigar la función bioquímica de cada proteína.
Además, se pueden hacer crecer cristales proteicos a partir de la proteína pura y,
a partir de estos cristales, podemos obtener datos de rayos X que nos proporcio-
narán una descripción de la estructura terciaria de las proteínas: la verdadera uni-
dad funcional.

4.1.1 El experimento: ¿Cómo reconocemos a la proteína que


estamos buscando?
La purificación debería proporcionarnos una muestra proteica que contuviera sólo
un tipo de molécula, la proteína en la que el bioquímico estuviese interesado. Esta
porosa de celulosa (Figura 4.2). Las moléculas con dimensiones
significativamente mayores que el diámetro del poro se retienen
dentro de la bolsa de diálisis, mientras que las moléculas más pe-
.
queñas y los iones atraviesan los poros de esta membrana y apa-
recen en el dializado, fuera de la bolsa. Esta técnica es útil para Saco de diálisis
·~·
:·...
retirar la sal u otras moléculas pequeñas, pero no discriminará de

forma efectiva las proteínas entre sí.
...:··· ·.·.
.,,...•. ..·. •
. . ·.
Cromatografía de filtración por gel. Se pueden conseguir
separaciones más discriminatorias, basadas en el tamaño, por
medio de la técnica de cromatografía de filtración por gel (Fi-
.... ·.......• :
:...... ·.
. ..
..
gura 4.3). La muestra se coloca en lo alto de una columna re- ~. . :··...
·.. • •
llena de bolitas porosas compuestas de un polímero insoluble, Amortiguador ·. ·.·
...
pero altamente hidratado, tales como el dextrano o la agarosa
(carbohidratos) o la poliacrilamida. Sephadex, Sepharosa y
Biogel son preparaciones comerciales de estas bolitas usadas
normalmente, que tienen un tamaño de unos 100 µm (0, 1 mm)
de diámetro. Las moléculas pequeñas pueden entrar en estas . . . ., ..
bolitas, pero no las grandes. El resultado es que las moléculas Al principio de la diélisis En el equilibrio
pequeñas se distribuyen tanto en el interior de las bolitas como entre ellas, míen- FIGURA 4.2 Diálisis. Las moléculas de
tras que las moléculas grandes se localizan solamente en la disolución entre las proteína (en rojo) se quedan dentro de
bolitas. Las moléculas grandes fluyen más rápidamente a través de esta columna la bolsa de diálisis, mientras que las
y salen antes porque disponen de un volumen accesible menor. Las moléculas moléculas pequeñas (en azul) difunden
que son de un tamaño intermedio y que pueden penentrar en las bolitas sólo par- al medio que las rodea.
cialmente fluirán de la columna en una posición intermedia y las moléculas pe-
queñas, que siguen un camino más largo y tortuoso, saldrán las últimas.

Bolitas de un
polímero de
carbohidrato

Las moléculas
pequeñas entran
en los espacios
acuosos dentro
de las bolitas

Muestra
de proteínas
~ Las moléculas
grandes no
pueden entrar
Gel de en las bolitas
exclusión
molecular
1

00000 00000 000000


FIGURA 4.3 Cromatografía de filtración por gel. Una mezcla de proteínas en un volumen
pequeño se coloca en una columna rellena con bolitas porosas. Como las proteínas grandes
no pueden penetrar en el volumen interno de las bolitas, se eluyen antes que las pequeñas.

Cromatografía de intercambio iónico. Las proteínas se pueden separar en


base a su carga neta por cromatografía de intercambio iónico. Si una proteína
tiene una carga neta positiva a pH 7, se unirá normalmente a una columna debo-
litas que contengan grupos carboxilato, mientras que una proteína con carga neta
negativa no lo hará (Figura 4.4). Una proteína cargada positivamente unida a esta
columna puede eluirse (liberarse) incrementando la concentración de cloruro só-
dico u otra sal en el amortiguador de elución porque los iones de sodio compiten
La proteína cargada con los grupos de la proteína cargados positivamente para unirse a la columna.
positivamente se une Las proteínas con una densidad baja de cargas positivas netas tenderán a apare-
a las bolitas cargadas
negativamente cer primero, seguidas por las que tienen una densidad de carga mayor. Las prote-
ínas cargadas positivamente (proteínas catiónicas) se pueden separar en columnas
de carboximetilcelulosa (CM-celulosa) cargadas negativamente. A su vez, las pro-
teínas cargadas negativamente (proteínas aniónicas) se pueden separar por cro-
matografía en columnas de dietilaminoetilcelulosa (DEAE-celulosa) cargadas po-
sitivamente.

Las proteínas cargadas


negativamente
fluyen libremente

FIGURA 4.4 Cromatografía de


intercambio iónico. Esta técnica separa
las proteínas principalmente por sus cargas Grupo Grupo
netas. carboximetilo (CM) dletllamlnoetllo (DEAE)
(forma ionizada) (forma protonada)

Cromatograña de afinidad. La cromatografía de afinidad es otro procedi-


La proteína que
se une a la glucosa miento poderoso y generalmente aplicable para purificar proteínas. Esta técnica
se pega a los se aprovecha de la alta afinidad de muchas proteínas por grupos químicos espe-
residuos de cíficos. Por ejemplo, la proteína vegetal concanavalina A se puede purificar pa-
glucosa (G) sando un extracto crudo a través de una columna de bolitas que contienen resi-
de las bolitas
duos de glucosa unidos covalentemente. La concanavalina A se une a esta columna
debido a su afinidad por la glucosa, que no tienen otras proteínas. La concanava-
lina A unida se libera posteriormente de la columna si se añade una disolución
concentrada de glucosa. La glucosa en disolución desplaza a la concanavalina A
de los centros de unión de los residuos de glucosa fijados en la columna (Figura
4.5). La cromatografía de afinidad es un potente sistema para aislar factores de
transcripción, proteínas que regulan la expresión génica uniéndose a secuencias
genéticas específicas. Una mezcla proteica se eluye a través de una columna que

!
contiene secuencias específicas de DNA unidas a una matriz; las proteínas con
Adición de
glucosa (G) alta afinidad por la secuencia se unirán y quedarán retenidas. En este punto, el
factor de transcripción se libera lavando con una disolución que contiene una alta
concentración de sal. En general, la cromatografía de afinidad se puede utilizar
de modo efectivo en el aislamiento de una proteína que reconoce a determinados
grupos X por (1) la unión covalente de X o un derivado suyo a una columna, (2)
la adición de una mezcla de proteínas a esta columna, que Juego se lava con amor-
tiguador para eliminar las proteínas no unidas, y (3) la elución de la proteína de-
seada añadiendo una concentración elevada de una forma soluble de X o cam-
biando las condiciones para alterar la afinidad de la unión. La cromatografía de
afinidad es más efectiva cuando la interacción de la proteína y la molécula que
se usa como atrayente es muy específica.
Las proteínas
que se unen a Cromatografía líquida de alta presión. El poder de resolución de todas las téc-
glucosa se liberan
tras la adición de
nicas que usan columnas se puede mejorar sustancialmente utilizando una técnica que
glucosa se conoce como cromatografíalíquida de alta presión (HPLC, "high-pressureliquid
chromatography"),que es una versión mejorada de las técnicas de columna que he-
FIGURA 4.5 Cromatografía de afinidad. mos expuesto hasta ahora. Los materiales propios de las columnas están divididos mu-
Cromatografía de afinidad de cho más finamente y, como consecuencia, hay más centros de interacción y, por lo
concanavalina A (en amarillo) en un tanto, mayor poder de resolución. Dado que la columna se construye de material más
soporte sólido que contiene residuos de fino, se debe aplicar presión para obtener las velocidades de flujo adecuadas. El re-
glucosa (G) unidos de forma covalente. sultado neto es una elevada resolución y una separación rápida (Figura 4.6).
4.1.4 Las proteínas se pueden separar y mostrar por 83
electroforesis en gel Purificación de proteínas

¿Cómo podemos afirmar si un protocolo de purificación es útil? Una forma es ase-


0,24
gurar que la actividad específica crece con cada paso de purificación. Otra es vi-
sualizar esta eficacia mostrando las proteínas presentes en cada paso. La técnica de
5
electroforesis hace posible este último método.
0,20

Electroforesis en gel. Una molécula con una carga eléctrica neta se desplazará E 0,16
en un campo eléctrico. Este fenómeno, llamado electroforesis, ofrece un procedi- e:
o
N
miento poderoso para separar proteínas y otras rnacromoléculas, como el DNA y el N

RNA. La velocidad de migración, v, de una proteína (o cualquier otra molécula) en "'"'


'o 0,12
un campo eléctrico depende de la fuerza de ese campo eléctrico, E, la carga neta de e:
la proteína, z. y el coeficiente de fricción, f "'o
.o
"'
.o
<( 0,08
Ez
v=­ (1)
f
0,04
La fuerza eléctrica, Ez, que arrastra a la molécula cargada hacia el electrodo de carga
opuesta, sufre la resistencia, Jv, debida a la fricción viscosa entre la molécula que
se desplaza y el medio en el que lo hace. El coeficiente de fricción f depende tanto
o
de la masa y de la forma de la molécula que emigra como de la viscosidad del me-
dio 11· Para una esfera de radio r, o 5 10
Tiempo (minutos)
J= frrn¡r (2)
FIGURA 4.6 Cromatografía líquida de
alta presión (HPLC). La filtración en gel
Las separaciones electroforéticas se realizan casi siempre sobre geles (o sobre so-
por HPLC define claramente las proteínas
portes sólidos como el papel) porque el gel sirve como un tamiz molecular que po- individuales debido a su gran poder de
tencia la separación (Figura 4.7). Las moléculas más pequeñas que los poros del gel resolución: (1) tiroglobulina (669 kd), (2)
se desplazan fácilmente a su través, mientras que las moléculas mucho mayores que catalasa (232 kd), (3) albúmina de suero
los poros del gel permanecen casi inmóviles. Las moléculas de tamaño intermedio bovino (67 kd), (4) ovoalbúmina (43 kd) y
se desplazan a través del gel con diversos grados de dificultad. La electroforesis se (5) ribonucleasa (13,4 kd) [Según K.J. Wilson
lleva a cabo en un bloque delgado, vertical, de poliacrilamida. La dirección del flujo and T.D. Schlabach. En Curren! Protocols in
es vertical descendente. Los geles de poliacrilamida, formados por la polimeriza- Molecular Biology, vol. 2, supl. 41, F.M. Ausbel, R.
Brent, R.E. Kingston, D.D. Moore, J.C. Seidman,
J.A. Smith and K. Struhl, Eds. (Wiley, 1998), p.
10.14.1.]

(A) (B)

Mezcla de
macromoléculas

Electroforesis
Dirección de la
electroforesis

Gel poroso

FIGURA 4.7 Electroforesis en gel de poliacrilamida. (A) Aparato de electroforesis en gel.


Normalmente, se separan varias muestras por electroforesis en un gel plano de poliacrilamida.
Se usa una micropipeta para colocar las disoluciones de las proteínas en los pocillos del gel.
Se coloca una tapa sobre la cámara del gel y se aplica un voltaje. Los complejos SDS
(dodecilsulfato sódico}­proteína cargados negativamente migran en dirección al ánodo, en
la parte inferior del gel. (B) La acción de tamizado de un gel poroso de poliacrilamida separa
las proteínas de acuerdo con su tamaño, moviéndose más rápidamente las más pequeñas.
-------1 84
CAPÍTULO4 • Investigación en proteínas

Acrilamida Metilenbisacrilamida

(persulfato)

l (el radical sulfato


inicia la polimerización)

FIGURA 4.8 Formación de un gel de


poliacrilamida. Por copolimerización del
monómero activado (en azul) y el
enlazante (en rojo) se forma una malla
tridimensional.

ción de la acrilamida entrecruzada por metilenbisacrilamida, son el soporte prefe-


rido para la electroforesis porque son inertes químicamente y se forman con facili-
dad (Figura 4.8). La electroforesis se diferencia de la filtración en gel en que todas
so - las moléculas, independientemente de su tamaño, están impelidas a moverse a tra-
/ 3
o vés de la misma matriz. El gel se comporta como una de las bolitas de la columna
de filtración en gel.
Las proteínas se pueden separar de acuerdo con sus masas moleculares, utili-
zando electroforesis en gel de poliacrilamida, en condiciones desnaturalizantes. La
mezcla de proteínas se disuelve primero en un medio con dodecilsulfato sódico
(SDS, "sodium dodecyl sulfete"), un detergente aniónico que rompe casi todas las
interacciones no covalentes en las proteínas nativas. También se añade mercaptoe-
tanol (2-tioetanol) o ditiotreitol para reducir los puentes disulfuro. Los aniones de
SDS se unen a la cadena principal a razón de un SDS por cada dos residuos de ami-
noácido. Este complejo de SDS con una proteína desnaturalizada tiene una gran
carga negativa, que es aproximadamente proporcional a la masa de la proteína. La
carga negativa conseguida por unión de SDS es normalmente mucho mayor que la
carga de la proteína nativa, por lo que esta se considera no significativa. Los com-
plejos SOS-proteína se someten entonces a electroforesis. Cuando la electroforesis
se acaba, las proteínas en el gel se pueden visualizar tiñéndolas con plata o con un
colorante como el azul de Coomassie, que manifiesta una serie de bandas (Figura
4.9). Los marcajes radiactivos se pueden detectar colocando una hoja de película de
Dodecilsulfato sódico rayos X sobre el gel, un procedimiento conocido como autorradiografia.
(SOS)

FIGURA 4.9 Tinción de las proteínas tras


la electroforesis. Las proteínas sometidas a
electroforesis en un gel de SDS­poliacrilamida
se pueden visualizar tiñéndolas con azul de
Coomasie [Cortesía de Kodak Scientific lmaging
Systems.]
las proteínas pequeñas se desplazan rápidamente a través del gel, mientras que 70
las grandes se quedan arriba, junto al lugar de aplicación de la mezcla. El des-
plazamiento en estas condiciones de la mayor parte de los polipéptidos es lineal- 60
mente proporcional al logaritmo de su masa (Figura 4.10). Sin embargo, algunas 50
proteínas ricas en carbohidratos y las proteínas de membrana no cumplen esta re-
lación empírica. La electroforesis sobre gel SDS- poliacrilarnida (SDS-PAGE, "pol­ 40
yqcrylamide gel electrophoresis") es rápida, sensible y capaz de un alto grado de
resolución. Cuando se tiñe con azul de Coomassie, basta O, 1 µg (­2 pmol) de una
proteína para dar una banda diferenciada y, con la tinción de plata se puede detec-
tar incluso cantidades menores (-0,02 µg). Se puede distinguir, normalmente, en-
tre proteínas que difieren entre sí aproximadamente en un 2 % de sus masas (p.ej.,
20
entre 40 y 41 kd, lo que corresponde a una diferencia de unos 10 residuos de ami-
noácidos).
Podemos examinar la eficacia de un protocolo de purificación analizando una
parte de cada fracción por SDS-PAGE. Las fracciones iniciales mostrarán desde do-
cenas hasta centenares de proteínas. Conforme progrese la purificación, el número
de bandas disminuirá y la prominencia de una de las bandas deberá aumentar. Esta 10'--~-'-~--L~~-'-~--'-~--'
o 0,2 0,4 0,6 0,8 1,0
banda corresponderá a la proteína de interés.
Movilidad relativa
Isoelectroenfoque. Las proteínas también pueden separarse electroforética-
mente en base a sus contenidos relativos de aminoácidos ácidos o básicos. El FIGURA 4.10 La electroforesis puede
determinar las masas moleculares.
punto isoeléctrico (pi) de una proteína es el pH en el que su carga neta es cero.
La movilidad electroforetica de muchas
En este pH, su movilidad electroforética es cero porque en la ecuación (1 ), z es
proteínas en geles de SDS­poliacrilamida es
igual a cero. Por ejemplo, el pi del citocromo e, una proteína de transporte elec- inversamente proporcional al logaritmo de
trónico muy básica es 10,6, mientras que el de la albúmina sérica, una proteína su masa. [Según K. Weber y M. Osborn, The
sanguínea ácida, es 4,8. Supongamos que una mezcla de proteínas se somete a proteins, vol.1, 3rd ed. (Academic Press, 1975),
electroforesis en gradiente de pH en un gel y en ausencia de SDS. Cada prote- p. 179.)
ína se desplazará hasta que alcance una posición en el gel en la que el pH es
igual al pi de la proteína. Este método para separar proteínas de acuerdo a su
punto isoeléctrico se conoce como isoelectroenfoque. El gradiente de pH en el
gel se consigue sometiendo a electroforesis previa una mezcla de polianfolitos
(polímeros pequeños con múltiple carga) con diferentes valores de pi. El isoe-
lectroenfoque permite distinguir proteínas que difieren en sus pi tan poco como
0,01, lo que significa que se pueden separar proteínas que difieran en una sola
carga neta (Figura 4.11 ).

(A)
Bajo pH
(+)
-1'~

+­­+
± +
e
--
±
+-
±
+­­­­ Alto pH
(­)
FIGURA 4.11 El principio del
isoelectroenfoque. Antes de cargar la
muestra, se establece un gradiente de pH
en un gel. (A) Se carga la muestra y se
aplica el voltaje. Las proteínas emigrarán
(B) hacia su pH isoeléctrico, el lugar en el que
Bajo pH
(+)
11 Alto pH
(-)
no tienen carga neta. (B) Las proteínas
forman bandas que se pueden separar y
usar en experimentos futuros.

Electroforesis bidimensional. El isoelectroenfoque se puede combinar con


SDS-PAGE para obtener separaciones con una resolución muy elevada. Una mues-
tra única se somete primero a isoelectroenfoque. Este gel de calle única se coloca
horizontalmente en la parte superior de un gel de SDS-poliacrilamida. Así, las pro-
teínas quedan distribuidas en la parte superior del gel de acuerdo con su movilidad
durante el electroenfoque. A continuación se someten de nuevo a electroforesis en
dirección perpendicular (verticalmente) para obtener una distribución bidimensio-
nal de las manchas. En este gel, las proteínas se han separado en dirección hori-
zontal de acuerdo con su punto isoeléct:rico y en dirección vertical según sus ma-
sas moleculares. Es sorprendente que si se aplica este sistema bidimensional a las
proteínas de la bacteria Escherichia coli se pueden resolver por electroforesis bidi-
mensional más de mil proteínas diferentes en un único experimento (Figura 4.12).
(A) (B) lsoelectroenfoque

.=r.: ­ ......---~
•. ­ -~~­­ ­
11 . ; -- - - -=---- ·:··-,.. -­.: . ,.;.­ ­
.... ­:;
1
Bajo pH
(+)
­­ • .-.­ ~­~­­~· ·=·~:­;.­­ ­
. ­-- --- .----e-~·~~
- ·--~ ,~s..- A O U:. - ..,

..
- - . -·- -~ • 7 ~- - -~ -
- ....­_
1 • 7,~-- -.-,.. - ,;~--;- -~- •
1
"~.E"'
--... . .. ·--:, -. , ,.--.~ ­­=·-- .- - - ­ ­ .
­
1 ·- .,_':
•.;:,;,,
~ _,-_
- ­
UJ
Q
s.;, ,_
­ -
·¡:

-:...~ ...
1

'·- - --
u
.!!! 1 o ~~.r - - - ..._-.
oa. 1
-- -- -·-
,,
V,

-
J,
o 1 1

. - . ---
V,
1

-
Cll

"
Q
-a;
1
1

1 -·
FIGURA 4.12 Electroforesis bidimensional
en gel. (A) Una muestra de proteína se Las proteínas aisladas de células en diferentes condiciones fisiológicas se pue-
fracciona inicialmente en una dimensión
den someter a electroforesis bidimensional, seguida de un examen de la intensidad
por isoelectroenfoque como se ha
descrito en la Figura 4.11 . El gel de de las señales. De este modo, se pueden ver aumentos o descensos en la concen-
isoelectroenfoque se une entonces a un tración de determinadas proteínas en respuesta a un estado fisiológico. ¿ Cómo po-
gel de SDS-poliacrilamida y la electroforesis demos afirmar qué proteína está siendo regulada? Anteriormente, una desventaja del
se realiza en una segunda dimensión, poder de los geles bidimensionales era que, aunque se observaban muchas proteí-
perpendicular a la separación original. nas, no estaban identificadas. Actualmente, es posible identificar las proteínas aco-
Las proteínas con el mismo pi se separan plando la electroforesis en gel bidimensional con técnicas de espectrometría de ma-
ahora en base a su masa. (B) Las proteínas sas. Consideraremos estas técnicas cuando veamos cómo se determina la masa
de E. coli se separaron por electroforesis molecular de una proteína (Sección 4.1.7).
bidimensional en gel, resolviendo más de
mil proteínas diferentes. Las proteínas se
separaron primero según sus puntos 4.1.5 Un protocolode purificación de proteínas se puede
isoeléctricos en la dirección horizontal y, evaluar cuantitativamente
después, según sus masas aparentes en la
dirección vertical. [(B) Cortesía del Dr. Patrick Para determinar el éxito de un protocolo de purificación de proteínas, controlamos
H. O'Farrell.] el procedimiento en cada paso midiendo la actividad específica y realizando un aná-
lisis de SDS-PAGE. Consideremos los resultados de la purificación de una proteína
imaginaria, resumidos en la Tabla 4.1 y la Figura 4.13. En cada paso, se miden los
siguientes parámetros:
Proteína total. La cantidad de proteína presente en una fracción se obtiene deter-
minando la concentración de proteína en una alícuota de cada fracción y multipli-
cándola por el volumen total de la fracción.
Actividad total. La actividad enzimática de la fracción se obtiene midiendo la acti-
vidad enzimática en una alícuota de cada fracción y multiplicándola por el volumen
total de la fracción.

TABLA 4.1 Resolución cuantitativa de un protocolo de purificación para una proteína ficticia
Proteína total Actividad Actividad específica Rendimiento Nivel de
Paso (mg) total (unidades) (unidades mg ") (%) purificación

Homogenización 15 000 150 000 10 100 1


Fraccionamiento salino 4 600 138 000 30 92 3
Cromatografía de intercambio iónico 1 278 115 500 90 77 9
Cromatografía de exclusión 68,8 75 000 1 100 50 110
molecular
Cromatografía de afinidad 1,75 52 500 30 000 35 3 000
Homogenado Fraccionamiento Cromatografía Cromatografía Cromatografía 87 ~
salino de intercambio de exclusión de afinidad
molecular Purificación de proteínas
4

­ ­
- FIGURA 4.13 Análisis electroforético de
una purificación proteica. El protocolo de
purificación de la Tabla 4.1 se analizó por
SDS-PAGE. Cada calle contenía 50 µ.g de
muestra. La eficacia de la purificación se
puede visualizar conforme la banda de la
proteína de interés se hace más prominente
en comparación con las otras bandas.

Actividad específica. Este parámetro se obtiene dividiendo la actividad total por la


proteína total.
Rendimiento. Este parámetro es una medida de la actividad existente después de
cada paso de purificación expresada como porcentaje de la actividad del extracto
crudo. La actividad del extracto inicial se toma como el 100 %.
Grado de purificación. Este parámetro mide el incremento en pureza y se obtiene
dividiendo la actividad específica, calculada después de cada paso de purificación,
por la actividad específica del extracto inicial.
Como se ve en la Tabla 4.1, el primer paso de purificación, el fraccionamiento sa-
lino, produce un incremento en pureza de sólo tres veces, pero recuperamos casi
toda la proteína objeto de purificación en el extracto original, dado que el rendi-
miento es del 92 %. Tras la diálisis para reducir la alta concentración de sal sobrante
del fraccionamiento salino, la fracción se pasa a través de una columna de inter-
cambio iónico. La purificación se incrementa ahora 9 veces comparado con el ex-
tracto original, mientras que el rendimiento original cae hasta el 77 %. La croma-
tografía de exclusión molecular eleva el nivel de purificación hasta 100 veces, pero
el rendimiento es ahora del 50 %. El paso final es la cromatografía de afinidad
usando un ligando específico para el enzima objetivo. Este paso, el más potente de
estos procedimientos de purificación, consigue un nivel de purificación de 3000 ve-
ces, mientras que el rendimiento cae al 35 %. El SDS-PAGE de la Figura 4.13 de-
muestra que si cargamos una cantidad constante de proteína en cada calle, después
de cada paso, el número de bandas disminuye en proporción al nivel de purifica-
ción y la cantidad de la proteína de interés incrementa en relación al total de la pro-
teína presente.
Un buen esquema de purificación tiene en cuenta tanto los niveles de purifica-
ción como el rendimiento. Un alto grado de purificación y un bajo rendimiento pro-
porcionan poca proteína con la que experimentar. Un alto rendimiento con una baja
purificación deja muchos contaminantes (proteínas diferentes de la de interés) en la
fracción y complica la interpretación de los experimentos.

4.1.6 La ultracentrifugación es valiosa para separar


las biomoléculas y determinar sus masas moleculares
Hemos visto ya que la centrifugación es un método poderoso y, en general, eficaz
para separar una mezcla compleja de componentes celulares, pero también es útil
para separar y analizar las propias biomoléculas. Con esta técnica, podemos deter-
­­i 88 !­­­­­­­­­­ 1

CAPÍTULO 4 • Investigación en proteínas TABLA4.2 Valores de S y pesos moleculares de proteínas tipo

Valor de S Peso
Proteína (unidades Svedberg) molecular
Inhibidor de la tripsina pancreática l 6 520
Citocromo e 1,83 12 310
Ribonucleasa A 1,78 13 690
Mioglobina 1,97 17 800
Tripsi na 2,5 23 200
Anhidrasa carbónica 3,23 28 800
Concanavalina A 3,8 51 260
Malato deshidrogenasa 5,76 74 900
Lactato deshidrogenasa 7,54 146 200

Tomado de T. Creighton, Proteins, 2' edición (W.H. Freeman and Company, 1993), Tabla 7.1

minar parámetros tales como la masa y la densidad, conocer algo sobre la forma de
la molécula e investigar las interacciones entre moléculas. Para deducir estas pro-
piedades de los datos de centrifugación, necesitarnos una descripción matemática
de cómo se comporta una partícula en una fuerza centrífuga.
Una partícula se desplazará en un medio líquido cuando se someta a una fuerza
centrífuga. Un medio conveniente para valorar numéricamente la velocidad de mo-
vimiento es calcular el coeficiente de sedimentación, s, de una partícula utilizando
la siguiente ecuación:
s = m(l - vp)/J
en la quemes la masa de la partícula, ves el volumen específico parcial (el recí-
proco de la densidad de la partícula) p es la densidad del medio y fes el coeficiente
de fricción (una medida de la forma de la partícula). El término (1 - vp) es la fuerza
de flotación ejercida por el medio líquido.
Los coeficientes de sedimentación se expresan normalmente en unidades Sved-
berg (S), equivalentes a 10-13 s. Cuanto menor sea el valor de S, la molécula se
moverá más lentamente por la fuerza centrífuga. En la Tabla 4.2 y la Figura 4.14
se mencionan los valores de S para una serie de biomoléculas y componentes ce-
lulares.
De la ecuación precedente se pueden extraer una serie de conclusiones impor-
tantes:
2, 1 1. La velocidad de sedimentación de una partícula depende en
RNA
parte de su masa. Una partícula de mayor masa sedimenta más
rápidamente que otra de masa menor que tenga la misma forma

....
1,9
........ y densidad .
l u 1,7
DNA
2. La forma influye también en la velocidad de sedimentación
e Ribosomas y porque afecta a la resistencia debida a la viscosidad. El coefi-
"O ~polisomas ciente de fricción,!, de una partícula compacta es menor que el
] "' 1,5 de una partícula extendida de la misma masa. Por lo tanto, las
e
Q) Proteínas Núcleos partículas alargadas sedimentan más lentamente que las esféri-
o solubles
1,3
Cloroplas¡,,, .. cas de la misma masa.

._ Mitocondrias
3. Una partícula densa se mueve más rápidamente que una de
1,1 '-~--'~~-'-~~-'-~~-'-~~'--~--'~~-' menor densidad porque la fuerza de flotación opuesta (1 - vp)
1 1o 102 101 1 o4 1 o5 106 1 o7 es menor para la partícula menos densa.
Coeficiente de sedimentación (S)
4. La velocidad de sedimentación también depende de la den-
FIGURA 4.14 Densidad y coeficiente de sedimentación de los sidad de la disolución (p). Las partículas se hunden cuando
componentes celulares. [Tomado de LJ. Kleinsmith y V.M. Kish, Principies of vp < 1, flotan cuando vp > 1, y no se desplazan cuando
Ce// and Molecular Biology. 2• ed (Harper Collins, 1995), p.138.l vp = 1.
Disolución de Disolución de

U.~
alta densidad Separación por
baja d\;d,d Fracciones

Ir
coeficiente de
sedimentación

I
ar~~~!~~~~sn
agujero en
Colocación de el fondo del tubo
la muestra

Rotor

uuuuuu~
Tubo de centrifuga

Gradiente de densidad

(A) (B) (C) (D)

FIGURA 4.15 Centrifugación Zonal. Las


Una técnica que se conoce como zonal, en bandas, o más comúnmente centri- etapas son: (A) formación de un gradiente
fugación en gradiente se puede usar para separar proteínas con diferentes coefi- de densidad, (B) colocación de la muestra
cientes de sedimentación. El primer paso es formar un gradiente de densidad en un encima del gradiente, (C) colocación del
tubo en un rotor oscilante y su
tubo de centrífuga. Proporciones diferentes de una disolución de baja densidad (tal
centrifugacióny (D) recolección de las
como sacarosa al 5 %) y otra de alta densidad (tal como sacarosa al 20 %) se mez- muestras. [Tomadode D. Freifelder, Physycal
clan para crear un gradiente lineal de concentraciones de sacarosa que va desde el Biochemistry, 2' ed. (W.H. Freeman and
20 % en el fondo del tubo hasta el 5 % en la parte superior (Figura 4.15). El papel Company, 1982), p. 397.]
del gradiente es evitar un flujo de convección. La mezcla con la proteína a separar
se coloca en un pequeño volumen en la parte superior del gradiente de densidad.
Cuando el rotor gira, las proteínas se mueven a través del gradiente y se separan de
acuerdo con sus coeficientes de sedimentación. El tiempo y la velocidad de la cen-
trifugación se determina empíricamente. Las bandas separadas, o zonas, de la pro-
teína se pueden recolectar perforando el fondo del tubo y recogiendo las gotas. Las
gotas se pueden ensayar para ver el contenido en proteínas y la actividad catalítica
u otras propiedades funcionales. Esta técnica de velocidad de sedimentación separa
fácilmente proteínas que difieren en coeficientes de sedimentación por un factor de
dos o bien mayor.
La masa de una proteína (peso molecular) se puede determinar directamente por
equilibrio de sedimentación, donde una muestra se centrifuga a velocidades relati-
vamente bajas en las que la sedimentación esta equilibrada por la difusión. La téc-
nica de equilibrio de sedimentación para determinar la masa molecular es muy pre-
cisa y se puede aplicar en condiciones no-desnaturalizan/es en las que la estructura
cuaternaria de las proteínas multiméricas se mantiene. Contrariamente, la electro-
foresis en gel de SDS-poliacrilamida (Sección 4.1.4) nos da una estimación del peso
molecular de las cadenas polipeptídicas en condiciones desnaturalizantes. Nótese
que si conocemos la masa de los componentes disociados de una proteína multi-
mérica, determinados por análisis de SDS-poliacrilamida y la masa de la proteína
multirnérica intacta, determinada por análisis de equilibrio de sedimentación, se
puede determinar cuantas copias de cada cadena polipeptídica están presentes en la
proteína multimérica.

4.1.7 La masa de una proteína se puede determinar con


exactitud por espectrometría de masas
La espectromet:ría de masas ha sido una técnica analítica implantada en química orgá-
nica desde hace muchos años. Sin embargo, hasta hace poco, la volatilidad tan baja de
las proteínas hacía que la espectrometría de masas fuera poco útil para el estudio de
estas moléculas. Esta dificultad se ha superado introduciendo técnicas que dispersan
las proteínas y otras macromoléculas de forma efectiva en la fase gaseosa. Estos mé-
todos se conocen como desorcián-ionizacián en matriz inducida por láser (MALD!,
"matrix-assisted laser desorption-ionization") y espectrometria de electrospray. Nos
centraremos en la espectrometría MALDI. En esta técnica, se generan proteinatos (io-
1
----, 90
CAPÍTULO 4 • Investigación en proteínas
Partidor de haz

(1)
La muestra de
proteína se
ioniza

1
FIGURA 4.16 Espectrometría de masas 1
MALDI­TOF. (1) La muestra de proteína "'"­­ Fuente :
absorbida en una matriz apropiada se de iones'"'! (3)
ioniza por aplicación de un haz de láser. Los iones más Detector
(2) Un campo eléctrico acelera los iones ligeros llegan
formados a través del tubo de vuelo hacia Haz de antes al detector
el detector. (3) Los iones más ligeros láser
llegan primero. (4) El pulso de láser
ionizante también activa un reloj que mide
el tiempo de vuelo (TOF, "time of flight") Matriz
de los iones. [Tomado de J.T. Watson,
lntroduction to Mass Spectrometry, 3• ed. Proteína
(Lippincott­Raven, 1997), p. 279.]

nes de proteínas) y se aceleran a través de un campo eléctrico (Figura 4.16). Estos via-
jan a través del tubo de vuelo, siendo los más pequeños los que viajan más rápido y
llegan antes al detector. Así, el tiempo de vuelo (TOF, "time of flight"] en el campo
eléctrico mide la masa (o de forma más precisa, la relación masa/carga). Pequeñas can-
tidades de biomoléculas, tan poco como unos picomoles (pmol) o femtomoles (fmol)
se pueden analizar de esta manera. En la Figura 4.17 se muestra un espectro de masas
MALDI-TOF de una mezcla de las proteínas insulina y 13-lactoglobulina. Las masas
determinadas por MALDI-TOF son respectivamente 5733,9 y 18 364, respectivamente,
comparables con los valores calculados de 5733,5 y 18 388. Ciertamente, MALDI-
TOF es una forma precisa de calcular la masa exacta de una proteína.

Insulina
(1 + H)+ = 5733,9

FIGURA 4.17 Espectro de masas MALDI­


TOF de la insulina y la 13­lactoglobulina.
Una mezcla de 5 pmol de insulina (1) y 5
l
pmol de 13­lactoglobulina (L) se ionizó por
MALDI, lo que produce de modo
predominante iones moleculares de carga
única de los péptidos y las proteínas (1 + H •
(L +2 H)2+
para la insulina y L + H para la ~­Lactoglobulina
lactoglobulina). Sin embargo, también se (L + H)+ = 18 364
producen moléculas con cargas múltiples así (1 +2 H)2+ (L + 3 H)3+
(21 + H)+
como cantidades de un dímero de insulina
con carga única, (2 1 + H) . [Tomado de J.T.
Watson, lntroduetian ta Mass Speetrometry, 3• ed. o 5 000 10000 15 000 20 000
(Lippincott­Raven, 1997), p. 282.J Masa/carga
de masas ha acreditado el desarrollo de las huellas dacti-
La espectrometría 91
lares de masas peptidicas. Esta técnica para identificar péptidos ha promovido en Determinación de la secuencia
gran manera la utilidad de los geles bidimensionales. La electroforesis bidimen- de aminoácidos
sional se realiza como se describe en la Sección 4.1.4. La muestra de interés se
extrae y escinde específicamente por medios químicos o enzimáticos. Se deter-
minan entonces las masas de los péptidos de interés por espectrometría de masas.
Las masas de los fragmentos proteicos se determinan entonces por espectrosco-
pía de masas. Finalmente, las masa de los péptidos, o huella dactilar, se compa-
ran con las huellas dactilares que se han "escindido electrónicamente" utilizando
una simulación por ordenador que usa la misma técnica de fragmentación que la
muestra experimental. Esta técnica ha producido resultados excelentes. Por ejem-
plo, de J 50 proteínas de levadura analizadas usando geles bidimensionales, las
huellas dactilares de masas peptídicas identificaron sin ambigüedad el 80 %. La
espectrometría de masas ha conseguido identificar muchas proteínas en geles bi-
dimensionales.

4.2 LAS SECUENCIAS DE AMINOÁCIDOS SE PUEDEN


DETERMINAR POR DEGRADACIÓN DE EDMAN
AUTOMATIZADA
Una vez purificada la proteína de interés y determinada su masa, el siguiente aná-
lisis a realizar suele ser la determinación de su secuencia de aminoácidos, o es-
tructura primaria. Cómo se ha dicho previamente (Sección 3.2.1), desde la estruc-
tura primaria se puede obtener una información valiosa sobre la función de una
proteína y su historia evolutiva. Examinemos primero como se puede secuenciar un
péptido simple, tal como

Ala-Gly-Asp-Phe-Arg-Gly

OQ<:
El primer paso sería determinar la composición de aminoácidos del péptido. El
péptido se debe hidrolizar en sus aminoácidos constituyentes calentándolo en HCl
6N a 110 ºC, durante 24 horas. Los aminoácidos del hidrolizado se pueden separar
por cromatografía de intercambio iónico en columnas de poliestireno sulfonado. La
identidad de los aminoácidos se manifiesta por su volumen de elución, que es el vo-
lumen de amortiguador utilizado para eluir el aminoácido de la columna (Figura
o
Nlnhldrlna
4.18) y se cuantifica por su reacción con la ninhidrina. Los aminoácidos tratados
con ninhidrina dan un color azul intenso, excepto la prolina, que da un color ama-
rillo porque contiene un grupo amino secundario. La concentración de un aminoá-
cido en disolución, tras su calentamiento con ninhidrina, es proporcional a la ab-
sorbancia óptica de la disolución. Esta técnica puede detectar un microgramo (10
nmoles) de un aminoácido, que es aproximadamente la cantidad presente en una

FIGURA 4.18 Determinación de la


PERFIL DE EVOLUCIÓNDEL HIDROUZADO PEPTÍDICO composición en aminoácidos.
Los diferentes aminoácidos de un
Gly
hidrolizado peptídico se pueden separar
por cromatografía de intercambio iónico
Asp Ala Phe Arg en una resina de poliestireno sulfonado

l (como la Dowex­50). Para eluir los


aminoácidos de la columna se usan
"'e:
'ü amortiguadores (en este caso, citrato
-e"'
.,,
o
sódico) de pH creciente. La cantidad de
cada aminoácido presente se determina
.D
<(
8­ por absorbancia. El aspartato, que tiene
una cadena lateral ácida, es el primero en
1 1 1 aparecer, mientras que la arginina, que
PERFIL DE EVOLUCIÓN DE AMINOÁCIDOS ESTÁNDAR tiene una cadena lateral básica, es el
último. Se observa que el péptido original
pH 3,25 pH 4,25 pH 5,28
0,2 M Na citrato 0,2 M Na citrato 0,35 M Na citrato está compuesto por un residuo de
aspartato, uno de alanina, uno de
Volumen de elución ­­­­+ fenilalanina, uno de arginina y dos de
glicina.
~ 92 1-----------
CAPÍTULO 4 • Investigación en proteínas

FIGURA 4.19 Derivados fluorescentes de


los aminoácidos. La fluorescamina
reacciona con el grupo a­amino de un OH
aminoácido para formar un derivado
fluorescente. Fluorescamina Derivado de amina

huella dactilar. Se puede detectar tan poco como un nanogramo ( 1 O pmol) de un


aminoácido si se sustituye la ninhidrina por fluoroescamina, que reacciona con el
grupo a-amino para formar un producto altamente fluorescente (Figura 4.19). U na
comparación de los modelos cromatográficos del hidrolizado de nuestra muestra con
una mezcla estándar de aminoácidos nos demostraría que la composición en ami-
noácidos del péptido es

(Ala, Arg, Asp, Gly2, Phe)

El paréntesis indica que ésta es la composición en aminoácidos del péptido, no su


secuencia.
Habitualmente, el siguiente paso es identificar el aminoácido N-terminal mar-
cándolo con un compuesto que forma un enlace covalente estable. El Fluorodinitro-
benceno (FDNB) lo utilizó por primera vez Frederick Sanger con esta finalidad. Ac-
tualmente, se suele usar el cloruro de dabsilo porque forma derivados fluorescentes
que se pueden detectar con alta sensibilidad. Reacciona con un grupo a-NH2 para
formar un derivado sulfonarnidico que es estable en condiciones en las que se hi-
drolizan los enlaces peptídicos (Figura 4.20). La hidrólisis de nuestra muestra de dab-
sil-péptido en HCl 6N daría un dabsil-aminoácido, que se podría identificar como
dabsil-alanina por sus propiedades cromatográficas. También el cloruro de dansilo
es un reactivo marcador válido, ya que también forma sulfonamidas fluorescentes.

NOi
F S02CI
Fluorodlnitrobenceno Cloruro de dabsilo Cloruro de dansilo

Aunque el método del dabsilo para la determinación del residuo amino termi-
nal es sensible y poderoso, no puede usarse repetidamente sobre el mismo péptido,
porque el péptido se degrada completamente en el paso de la hidrólisis ácida y, por
ello, se pierde toda la información de la secuencia. Pehr Edman diseñó un método
para marcar y separar el amino terminal del péptido sin perturbar los enlaces pep-
tídicos entre los otros residuos de aminoácidos. La degradación de Edman separa
secuencialmente del extremo amino terminal un residuo tras otro (Figura 4.21). El
Fenllisoüocianato reacciona con el grupo amino terminal no cargado del péptido
para formar un derivado de feniltiocarbamato. Posteriormente, bajo condiciones áci-
das suaves, se libera un derivado cíclico del aminoácido terminal, lo que deja un
péptido intacto acortado en un aminoácido. El compuesto cíclico es un aminoácido-
feniltiohidantoína (PTH) aminoácido, que se puede identificar por procedimientos
93 f­­
Determinación de la secuencia
H3C

H2N
X tr­:
H
Gly ­Asp ­ Phe ­Arg­ Gly
de aminoácidos

o
Cloruro de dabsilo

1 Marcaje

o H3C

"N
502

H
H
Xy,'Gly ­Asp ­
o
Phe ­Arg­ Gly

1 Hidrólisis

Dabsilalanina
o Arg
Phe Gly
Asp
Gly

FIGURA 4.20 Determinación del residuo amino terminal de un péptido. El cloruro de


dabsilo marca el péptido, que luego se hidroliza por medio de ácido clorhídrico. El
dabsil­aminoácido (dabsilalanina en este ejemplo) se identifica por sus características
cromatográficas.

O H H
DEGRADACIÓN DE EDMAN
+
H2N0
, N
>y' Asp­Phe­Arg­Gly
·' H
H3C H O

1
­
Fenilisotiocianato Ala Gly
Marcaje

Primera
1 Marcaje

vuelta

l Liberación

l Marcaje
1 Liberación
Segunda
vuelta

1 Liberación
s
H H
.....___NH .>, ./Asp­Phe­Arg­Gly
+ H2N lr
o

PTH­alanina Peptldo acortado en un residuo

FIGURA 4.21 La degradación de Edman. El residuo amino terminal marcado (PTH­alanina


en la primera vuelta) se puede liberar sin hidrolizar el resto del péptido. Por lo tanto, el
residuo amino terminal del péptido acortado (Gly­Asp­Phe­Arg­Gly) se puede determinar en la
segunda vuelta. Tres vueltas más de la degradación de Edman revelan la secuencia completa
del péptido original.
0,06 ~
cromatográficos. La técnica de Edman se puede repetir en el péptido acortado, dando
otro PTH-aminoácido, que de nuevo se puede identificar por cromatografía. Tres
E
e: vueltas más de la degradación de Edman revelarán la secuencia completa del pen-
'<t"
V") tapéptido original.
N 0,04 >-
"'"' El desarrollo de secuenciadores automáticos ha disminuido de modo importante
'o
e: el tiempo necesario para determinar secuencias proteicas. Un ciclo de la degrada-
"'o
..o 0,02 >-
ción de Edman -la ruptura de un aminoácido de un péptido y su identificación-
se realiza en menos de 1 hora. Mediante degradaciones repetidas, se puede deter-
"'
..o
-c minar la secuencia arninoacídica de unos 50 aminoácidos de una proteína. La cro-
~ .... iu '- matografía líquida de alta presión resulta un método sensible para diferenciar los
o 1
distintos aminoácidos (Figura 4.22). Los secuenciadores en fase gaseosa pueden ana-
4 8 12 16 20
Tiempo de elución (minutos) lizar cantidades de picomoles de péptidos y proteínas. Esta alta sensibilidad hace
factible analizar la secuencia de una muestra de proteína obtenida de una banda
FIGURA 4.22 Separación de única en un gel de SDS-poliacrilamida.
PTH­aminoácidos. Los PTH­aminoácidos
se pueden separar rápidamente por
4.2.1 Para facilitar el análisis, las proteínas se pueden
cromatografía líquida de alta presión
(HPLC). En este perfil de HPLC, una fragmentar específicamente en péptidos pequeños
mezcla de PTH­aminoácidos se resuelve
En principio, debería ser posible secuenciar una proteína entera usando el mé-
perfectamente en sus componentes.
Un aminoácido desconocido se puede
todo de Edman. En la práctica, los péptidos no pueden ser mucho más largos que
identificar por su posición relativa de unos 50 residuos. La razón es que las reacciones del método de Edman, espe-
elución respecto a los conocidos. cialmente el paso de liberación, no son 100 % eficaces, por lo que no todos los
péptidos de la mezcla de reacción liberan el derivado del aminoácido en cada
paso. Por ejemplo, si la eficiencia de la liberación fuera del 98 % en cada paso,
la proporción de aminoácido "correcto" liberado tras 60 rondas sería (0,986º), es
decir, 0,3; una decepcionante mezcla impura. Este obstáculo se puede sortear cor-
tando, de modo específico, la proteína original en péptidos más pequeños que se
pueden secuenciar individualmente. En suma, la estrategia es "divide y vence-
rás".
La ruptura específica se puede conseguir por medios químicos o enzimáticos.
Por ejemplo, el bromuro de cianógeno (CNBr) corta la cadena polipeptídica sola-
mente por el lado carboxílico de los residuos de metionina (Figura 4.23).

FIGURA 4.23 Ruptura por


bromuro de cianógeno.
El bromuro de cianógeno
/~
~N
./ H H
w
H

/yl~+~,N~ i H H ' H
corta los polipéptidos por el R1 o R1 R3
lado carboxilo de los residuos Metionina Homoserina
de metionina. lacto na

Una proteína que contiene 10 residuos de metionina, al cortarla con CNBr, dará ha-
bitualmente 11 péptidos. También se consigue una ruptura altamente específica con
tripsina, un enzima proteolítico del jugo pancreático. La tripsina corta las cadenas
polipéptidicas por el lado carboxílico de los residuos de arginina y lisina (Figura
4.24 y Sección 9.1.4). Una proteína que contiene 9 residuos de lisina y 7 de argi-
nina dará normalmente 17 péptidos tras la digestión con tripsina. Cada uno de es-

/~. x
lisina lisina

FIGURA 4.24 Ruptura por


tripsina. La tripsina hidroliza
o
arqinina H H_ y o
argininaH

los polipéptidos por el lado


carboxilo de los residuos de A / H
"N
H
/NA
./ H
"­­N
H
arginina y lisina. R1 O R1 Ó
1 95 f­­
TABLA 4.3 Ruptura específica de los polipéptidos Determinación de la secuencia
de aminoácidos
Reactivo Lugar de ruptura

Ruptura química
Bromuro de cianógeno Lado carboxilo de los residuos de metionina
O- Iodosobenzoato Lado carboxilo de los residuos de triptófano
Hidroxilamina Enlaces asparragina-glicina
2-Nitro-5-tiocianobenzoato Lado amino de los residuos de cisteína

Ruptura enzimática
Tripsina Lado carboxilo de residuos de lisina
y arginina
Clostripaina Lado carboxilo de los residuos de arginina
Proteasa de Staphylococcus Lado carboxilo de los residuos de aspartato
y glutamato (el glutamato sólo en ciertas
condiciones)
Trombina Lado carboxilo de la arginina
Quimotripsina Lado carboxilo de la tirosina, triptófano,
fenilalanina, leucina y metionina
Carboxipeptidasa A Lado amino del aminoácido C-terrninal
(salvo arginina, lisina, o prolina)

tos péptidos trípticos, excepto el péptido carboxilo terminal de la proteína, acabará


con arginina o lisina. La Tabla 4.3 indica otras formas diferentes de romper espe-
cíficamente las cadenas polipeptídicas.
Los péptidos obtenidos por ruptura específica química o enzimática se separan
por alguna forma de cromatografía. La secuencia de cada péptido purificado se de-
termina entonces por el método de Edman. En este punto, se conocen las secuen-
cias de aminoácidos de la proteína, pero no está definido todavía el orden de estos
segmentos. ¿ Cómo podemos ordenar los péptidos para obtener la estructura prima-
ria de la proteína original? La información complementaria que se requiere se ob-
tendrá por solapamiento de los péptidos (Figura 4.25). Se utiliza un segundo en-
zima para fraccionar la cadena polipeptídica cortándola a nivel de enlaces diferentes.
Por ejemplo, la quimotripsina corta preferentemente por el lado carboxilo de los re-
siduos aromáticos y otros residuos no polares voluminosos (Sección 9.1.3). Debido
a que estos péptidos quimotrípticos se superponen a dos o más péptidos trípticos,
se pueden usar para establecer el orden de los péptidos. Así se llega a conocer la
secuencia completa de la cadena polipeptídica.

Péptidos trípticos Péptido quimotríptico


Ala-Ala-Trp-Gly-Lys Val-Lys-Ala-Ala-Trp
Thr-Phe-Val-Lys
FIGURA 4.25 Péptidos solapados.
Péptido tríptico Péptido tríptico El péptido obtenido por digestión
Thr- Phe-Val-Lys-Ala-Ala-Trp-Gly-Lys quimotríptica se solapa con dos péptidos
Péptido quimotríptico solapado trípticos, estableciendo su orden.

Se necesitan pasos adicionales si la muestra inicial de proteína consta de va-


rias cadenas polipeptídicas. La electroforesis en SDS-gel en condiciones reduc-
toras debería mostrar el número de cadenas. Alternativamente, se puede deter-
minar el número de aminoácidos N-terminales diferentes. Para una proteína
consistente en dos o más cadenas polipeptídicas unidas por enlaces no-covalen-
tes, se utilizan agentes desnaturalizantes, como son la urea o el cloruro de gua-
s--s nidina, para disociarlas. Las cadenas disociadas deben separarse entre ellas an-
R­­­¿
H2 H2
"-c-R' tes de comenzar la determinación de las secuencias. Las cadenas polipeptídicas
unidas por puentes disulfuro se separan con tioles como el 13-mercaptoetanol o
Cadenas unidas por disulfuro el ditiotreitol. Para evitar que los residuos de cisteína se recombinen, se alquilan

w
posteriormente con yodoacetato para formar derivados estables S-carboximetilo
(Figura 4.26). La secuenciación se puede llevar a cabo entonces como se ha des-
crito hasta ahora.
Para completar nuestro conocimiento de la estructura de la proteína, necesita-
mos determinar las posiciones de los puentes disulfuro originales. Esta información
HO OH
se puede obtener usando la técnica de electroforesis en diagonal para aislar las se-
Dltlotreltol (en exceso) cuencias peptídicas que contienen estos enlaces (Figura 4.27). En primer lugar, la
proteína se fragmenta específicamente en péptidos bajo condiciones en las que los

w
puentes disulfuro permanecen intactos. La mezcla de péptidos se coloca en la es-
quina de una hoja de papel y se somete a electroforesis en una sola calle en una di-
rección. La hoja resultante se expone a vapores de ácido perfórmico, que rompen
los puentes disulfuro y los convierte en residuos de ácido cisteico. Los péptidos uni-
dos originalmente por puentes disulfuro se vuelven independientes y más ácidos de-
HO OH bido a la formación de un grupo S03- .
SH HS
R­­­¿ + "c­R'
H2 H2
Cadenas reducidas separadas
s~
u >=o ~
H­'C"­(Y"O'H
Ácido perfórrnico

NH
/
Cistina Ácido cisteico
lodoacetato
Esta mezcla se somete a electroforesis en dirección perpendicular a la anterior en las
mismas condiciones que la primera electroforesis. Los péptidos que estaban despro-
vistos de disulfuros tendrán la misma movilidad que anteriormente y, por ello, esta-
o
rán situados en una diagonal única. Por el contrario, los péptidos recién formados
R---c/~c/c".~ que contienen ácido cisteico migrarán normalmente de forma diferente a los pépti-
H2 H2 dos originales y, por lo tanto, se situarán fuera de la diagonal. Estos péptidos se pue-
den aislar y secuenciar y se puede establecer la localización del puente disulfuro.
o
;.;;-c,~~c-R'
H2 H2
Cadenas carboximetiladas separadas e:
l

'ü FIGURA 4.27 Electroforesis en diagonal.
FIGURA 4.26 Reducción de los puentes ·¡;; o
o u Los péptidos unidos por medio de puentes
c..·-
disulfuro. Los polipéptidos unidos por x E
'11 ... disulfuro se pueden detectar por
puentes disulfuro se pueden separar por .,,,o
"''t electroforesis en diagonal. La mezcla de
reducción con ditiotreitol seguido de ~~ péptidos se somete a electroforesis en una
alquilación para prevenir que se vuelvan a ·¡;; o
calle en una dirección (horizontal) y se
._,.,,
'11 'O
formar esos puentes. O'ü trata después con ácido perfórmico, que
tíe"' rompe y oxida los puentes disulfuro.
'11
¡¡¡ La muestra se somete entonces a
electroforesis en dirección perpendicular
Primera dirección de la electroforesis ­­+ (vertical).

4.2.2 Las secuencias de aminoácidos suministran muchos tipos


de información
Una vez que se determina la secuencia de aminoácidos de una proteína, ésta es una
fuente valiosa de información sobre la función de la proteína, su estructura y su his-
toria.
1. La secuencia de una proteína de interés puede compararse con todas las otras
secuencias conocidas para averiguar si existen similitudes significativas. ¿ Perte-
nece esta proteína a una de las familias conocidas? Una búsqueda de similitud en-
(A) (B)
Sitio de
Sitio de
unión
Sitio de al antígeno Sitio de
unión unión
al antígeno al antígeno

Dominio Fab

S-S

Cadena
pegada

~ FIGURA 4.30 Estructura de un


anticuerpo. (A) Los anticuerpos tipo lgG
consisten en cuatro cadenas: dos cadenas
conocido y esté asociada a un transportador macromolecular. La pequeña molé- pesadas (en azul) y dos ligeras (en rojo),
cula ajena se conoce como hapteno. Los animales tienen un amplio repertorio de unidas por puentes disulfuro. Las cadenas
ligera y pesada se unen para formar los
células productoras de anticuerpos; cada una de ellas puede producir un único an-
dominios Fab, que tienen los centros de
ticuerpo específico. Un antígeno actúa estimulando la proliferación de un número unión al antígeno en sus extremos. Las dos
pequeño de células que ya eran capaces de formar un anticuerpo capaz de reco- cadenas pesadas forman el dominio Fe. Los
nocer el antígeno (Capítulo 33). dominios Fab se unen al dominio Fe
Las técnicas inmunológicas dependen de nuestra capacidad de generar anti- mediante conexiones flexibles. (B) Una
cuerpos contra un antígeno específico. Para obtener anticuerpos que reconozcan representación más esquemática de una
a una proteína determinada, un bioquímico inyecta dos veces la proteína a un co- molécula de lgG.

Anticuerpo

~ FIGURA 4.31 Interacciones


antígeno-anticuerpo. Una proteína
antígénica, en este caso lisozima, se une al
extremo del dominio Fab de un anticuerpo.
El extremo del anticuerpo y el antígeno
tienen formas complementarias,
permitiendo que tras la unión se oculte una
gran cantidad de superficie.
Anticuerpos policlonales nejo, separadas por un intervalo de tres semanas. La proteína inyectada estimula
la reproducción de las células que producen anticuerpos que reconocen a la sus-
tancia extraña. Varias semanas más tarde, se extrae sangre del conejo inmunizado
y se centrifuga para separar las células sanguíneas del sobrenadante, o suero. El
suero, conocido como antisuero, contiene anticuerpos contra todos los antígenos
a los que ha estado expuesto el conejo. De ellos, solamente algunos serán anti-
cuerpos contra la proteína inyectada. Además, los anticuerpos de una especifici-
dad determinada no son una única especie molecular. Por ejemplo, el 2,4-dinitro-
fenol (DNP) se ha utilizado como hapteno para generar anticuerpos contra el DNP.
Los análisis de los anticuerpos anti-DNP revelaron una amplia gama de afinida-
des de unión -las constantes de afinidad estaban en el intervalo de 0,1 nM a l
µM. Asimismo, cuando el anticuerpo anti-DNP se sometía a isoelectroenfoque, se
Anticuerpos monoclonales
veía un gran número de bandas. Estos resultados indican que las células están pro-
duciendo muchos anticuerpos diferentes, cada uno de ellos capaz de reconocer un
rasgo diferente de la superficie del mismo antígeno. Los anticuerpos son hetero-
géneos, o policlonales (Figura 4.32). Esta heterogeneidad es una barrera, que puede
complicar el uso de estos anticuerpos.

4.3.2 Hoy se pueden preparar fácilmente anticuerpos


monoclonales de prácticamente cualquier especificidad deseada
El descubrimiento de un modo de producir anticuerpos monoclonales de prácti-
FIGURA 4.32 Anticuerpos policlonales y camente cualquier especificidad deseada fue un avance importante que intensificó
monoclonales. La mayor parte de los la capacidad de los abordajes inmunológicos. Al igual que el trabajar con proteí-
antígenos tienen varios epítopos. Los
nas impuras hace difícil interpretar los datos y entender la función, lo mismo su-
anticuerpos policlonales son mezclas
heterogéneas de anticuerpos, cada uno
cede cuando se trabaja con una mezcla heterogénea de anticuerpos. El ideal sería
específico para uno de los diversos aislar un don de células que produjeran un único anticuerpo. El problema es que
epítopos del antígeno. Los anticuerpos las células productoras de anticuerpo aisladas de un organismo mueren rápida-
monoclonales son todos idénticos, mente.
producidos por clones de una única célula Existen líneas celulares inmortales que producen anticuerpos monoclonales. Es-
productora de anticuerpos. Reconocen un tas líneas celulares se derivan de un tipo de cáncer, el mieloma múltiple, una alte-
epítopo específico. [Tomado de R.A. Goldsby, ración maligna de las células productoras de anticuerpos. En este cáncer, una única
T.I. Kindt, B.A. Osborne, Kuby lmmunology,4ª ed. célula plasmática transformada se divide descontroladamente, generando un gran
(W.H. Freeman and Company, 2000), p. 154.]
número de células de una clase única. Son un clan porque descienden de la misma
célula y tienen las mismas propiedades. Las células idénticas del mieloma segregan
grandes cantidades de inmunoglobulina normal de una clase única, generación tras
generación. Un mieloma se puede transplantar de un ratón a otro, donde continúa
proliferando. Estos anticuerpos fueron útiles para averiguar la estructura de los an-
ticuerpos, pero no se conoce nada sobre su especificidad, por lo que son inútiles
para los métodos inmunológicos que se describen en las páginas siguientes.
Cesar Milstein y Georges Kohler descubrieron que podían obtenerse grandes
cantidades de anticuerpo homogéneo de casi cualquier especificidad deseada por
medio de la fusión de una célula productora de anticuerpo de corta vida con una
célula inmortal de mieloma. Se inyecta un antígeno en un ratón y unas semanas más
tarde se le extrae el bazo (Figura 4.33). Una mezcla de células plasmáticas de este
bazo se fusionan in vitro con células de mieloma. Cada una de las células híbridas
resultantes, llamadas células hibridoma, producen indefinidamente un anticuerpo
homogéneo especificado por la célula parental del bazo. Las células hibridoma se
pueden entonces tamizar, usando algún tipo de ensayo para la interacción antí-
geno-anticuerpo, para determinar cuáles producen el anticuerpo con la especifici-
dad deseada. Las células recolectadas que producen el anticuerpo deseado se sub-
dividen y reensayan. Este proceso se repite hasta que se aísla una línea celular pura,
un clon que produzca un anticuerpo único. Estas células positivas pueden hacerse
crecer en un medio de cultivo o inyectarse a ratones para inducir mielomas. Alter-
nativamente, las células pueden congelarse y almacenarse durante largos periodos.
El método del hibridoma para producir anticuerpos monoclonales ha abierto nue-
vos horizontes en biología y en medicina. Se pueden preparar fácilmente grandes
cantidades de anticuerpos homogéneos con especificidades hechas a medida. Son
fuente de conocimiento en las relaciones entre la estructura del anticuerpo y su es-
~~~~~~~~~101r--
Línea de mieloma
en cultivo celular
Técnicas inmunológicas

~
Fusión en
polietilenglicol
l[iijJ

••
••• •••
••
Células de mieloma

1
Células de bazo

Selección y crecimiento de células híbridas

1
Selección de células que producen el
anticuerpo de especificidad deseada

Propagación de los~­­­­­­­­­­• Congelación


clones deseados ~ Descongelación

Crecimiento_ en cultivos / Inducción de FIGURA 4.33 Preparación de anticuerpos


masivos /

•!
monoclonales. Las células hibridoma se
forman por fusión de células productoras
de anticuerpos y células de mieloma. Las
células híbridas se dejan proliferar
haciéndolas crecer en un medio selectivo.
Luego se tamizan para determinar cuáles
producen el anticuerpo de la especificidad
deseada [Tomadode C. Milstein. Monoclonal
antibodies. Copyright © 1980 por Scientific
Anticuerpo Anticuerpo American, lnc. Todos los derechos reservados.]

pecificidad. Además, los anticuerpos monoclonales sirven como reactivos analíti-


cos y preparativos muy precisos. Por ejemplo, se puede obtener un anticuerpo puro
contra un antígeno que no se ha aislado todavía (Sección 4.4). Se han identificado
proteínas que dirigen el desarroJlo utilizando anticuerpos monoclonales como eti-
quetas (Figura 4.34). Los anticuerpos monoclonales unidos a soportes sólidos se
pueden usar como columnas de afinidad para purificar proteínas escasas. Este mé-
todo ha servido para purificar 5000 veces el interferón (una proteína antivírica) a
partir de una mezcla cruda. Los laboratorios clínicos utilizan anticuerpos mono-
clonales en muchos ensayos. Por ejemplo, la detección en sangre de isozimas que
normalmente se encuentran en el corazón apunta a un infarto de miocardio (ataque
cardiaco). Las transfusiones sanguíneas son más seguras gracias al tamizado de an-
ticuerpos de la sangre del donante para los virus que causan SIDA (síndrome de in-
munodeficiencia adquirida), hepatitis y otras enfermedades infecciosas. Los anti-
cuerpos monoclonales se están evaluando también para su uso como agentes
terapeúticos, como ocurre en el tratamiento del cáncer. Además, el amplio reperto-
rio de la especifidad de los anticuerpos se puede extender a la generación de anti-
cuerpos catalíticos que tienen características nuevas que no se encuentran en los en-
zimas naturales. FIGURA4.34 Micrografía de fluorescencia
de un embrión de Drosophila en
desarrollo. El embrión se tiñó con un
4.3.3 Las proteínas se pueden detectary determinarutilizando anticuerpo monoclonal, marcado con
un ensayo de inmunoabsorción asociada a enzima fluorescencia, contra la proteína de unión
al DNA, codificada por engrailed, un gen
Los anticuerpos se pueden usar como reactivos analíticos exquisitamente específi- esencial para especificar el desarrollo del
cos para la determinación de la cantidad de una proteína u otro antígeno. La téc- cuerpo. [Cortesía del Dr. Nipam Patel y el Dr.
nica es el ensayo de inmunoabsoción asociada a enzima (ELISA, "enzyme-linked Corey Goodman.]
-----11021---~~~~~~~- immunoabsorbent assay"). Por este método, un enzima que reaccione con un sus-
CAPÍTULO 4 • Investigación en proteínas trato no coloreado para dar un producto 'con color, se une covalentemente a un an-
ticuerpo específico que reconoce un antígeno diana. Si el antígeno está presente, el
complejo enzima-anticuerpo se unirá a él y el componente enzimático del complejo
enzima-anticuerpo catalizará la reacción que generará el producto coloreado. Así,
la presencia del producto coloreado indica la presencia del antígeno. Este ensayo
inmunosorbente asociado a enzima, que es rápido e idóneo, puede detectar menos
de un nanogramo (10-9 g) de una proteína. El ELISA se puede efectuar con anti-
cuerpos policlonales o monoclonales, pero el uso de anticuerpos monoclonales da
resultados más fiables.
~ Vamos a considerar dos de los diferentes tipos de ELISA. El ELlSA indi-
~ recto se utiliza para detectar la presencia de anticuerpo y es la base del
test para la infección de HIV. En este test, proteínas del núcleo del virus (el antí-
geno) se absorben en el fondo de un pocillo. Los anticuerpos del paciente se aña-
den a este pocillo revestido y pueden unirse al antígeno. Finalmente, los anticuer-
pos contra anticuerpos humanos, unidos a enzima (por ejemplo, anticuerpos de cabra
que reconocen anticuerpos humanos), pueden reaccionar en el pocillo y los anti-
cuerpos no unidos se liberan por lavado. Se añade entonces el sustrato. Una reac-
ción enzimática sugiere que los anticuerpos asociados a enzima estaban unidos a
los anticuerpos humanos, lo que a su vez implica que el paciente tenía anticuerpos
contra el antígeno vírico (Figura 4.35).
El ELISA sandwich permite tanto la detección como la medición cuantitativa
del antígeno. El anticuerpo contra un enzima particular se absorbe primero en el
fondo de un pocillo. Seguidamente se añade el antígeno (o sangre u orina que
contenga el antígeno) al pocillo y se une al anticuerpo. Finalmente, se añade un
segundo anticuerpo, diferente, al antígeno. Este anticuerpo está asociado a en-
zima y se procesa como se ha indicado para el ELISA indirecto. En este caso, la
cuantía de la reacción es directamente proporcional a la cantidad de antígeno pre-
sente. Por ello, permite la medida de pequeñas cantidades de antígeno (ver Fi-
gura 4.35).

(A) ELISA indirecto

Lavado Lavado Lavado


Antígenos El anticuerpo El anticuerpo Se añade el sustrato y
absorbidos específico se unido a enzima se convierte en un producto
en el pocillo une al antígeno se une al anticuerpo coloreado por el enzima;
específico la velocidad de formación
del color es proporcional a la
cantidad de anticuerpo específico
(B) ELISA "Sandwich"

Lavado Lavado Lavado

Anticuerpos El antígeno Un segundo anticuerpo Se añade el sustrato y


monoclonales se une al monoclonal, unido a se convierte en un producto
absorbidos anticuerpo enzima, se une al coloreado por el enzima;
en el pocillo antígeno inmovilizado la velocidad de formación
del color es proporcional a la
cantidad de antígeno

FIGURA 4.35 ELISA indirecto y ELISA "sandwich". (A) En el método ELISA indirecto, la
producción de color indica la cantidad de anticuerpo contra un antígeno específico. (B) En
el ELISA "sandwich", la producción de color indica la cantidad de antígeno. [Tomado de R.A.
Goldsby, T.J. Kindt, B.A. Osborne, Kuby lmmunology, 4ª ed. (W.H. Freeman and Company, 2000), p. 162.]
4.3.4 La transferencia Western permite la detección de ----------4 103 ,-
proteínas separadas por electroforesis en gel Técnicas inmunológicas

A menudo es necesario detectar pequeñas cantidades de una proteína particular en


presencia de otras muchas proteínas, como las proteínas víricas en la sangre. Can-
tidades muy pequeñas de una proteína determinada en una célula o un líquido cor-
poral se pueden detectar por una técnica de inmunoensayo conocida como transfe-
rencia Western ("Western blotting ") (Figura 4.36). Se somete la muestra a
electroforesis en un gel de SDS-poliacrilamida. Las proteínas separadas en el gel
se transfieren (o más normalmente electrotransfieren) a la superficie de una lámina
de polímero para hacerlas más accesibles a la reacción. Se añade a la lámina un an-
ticuerpo que sea específico para la proteína de interés y éste reacciona con su antí-
geno. El complejo antígeno-anticuerpo en la lámina se puede detectar con un se-
gundo anticuerpo específico para el primero (p. ej., anticuerpo de cabra que reconozca
anticuerpo de ratón). Una marca radiactiva en el segundo anticuerpo produce una
banda oscura en una película de rayos X (un autorradiograma). Alternativamente,
FIGURA 4.36 Transferencia Western.
un enzima sobre el segundo anticuerpo generaría un producto coloreado, como en Las proteínas en un gel de
el método ELISA. La transferencia Western hace posible encontrar una proteína en SDS-poliacrilamida se transfieren a una hoja
una mezcla compleja, la proverbial "aguja en un pajar". Es la base para el test de de polímero y se tiñen con un anticuerpo
infección por hepatitis C, donde se usa para detectar una proteína del núcleo del vi- radiactivo. Aparece en el autorradiograma
rus. Esta tácnica es muy útil también en la clonación de genes. una banda correspondiente a la proteína a
la que se une el anticuerpo.

Proteína que reacciona con el anticuerpo


Banda de proteína
detectada por el
anticuerpo específico

Adición de anticuerpo
específico radiomarcado. Superponer la
Transferencia Lavar para eliminar película fotográfica.
de proteínas el anticuerpo no unido Exponer y revelar

Gel SDS­pollacrilamlda Hoja de pollmero Hoja de polímero expuesta al anticuerpo Autorradlograma

4.3.5 Los marcadores fluorescentes hacen posible


la visualización de proteínas en la célula
Los trabajos bioquímicos se efectúan a menudo en tubos de ensayo o en geles de
poliacrilamida. Sin embargo, la mayor parte de las proteínas funcionan en el con-
texto de una célula. Los marcadores fluorescentes constituyen unos recursos pode-
rosos para examinar las proteínas en su entorno biológico. Así, por ejemplo, las cé-
lulas se pueden teñir con anticuerpos marcados con fluorescencia u otras proteínas
fluorescentes y examinarlas por microscopía de fluorescencia para localizar a una
proteína de interés. Así, en las células teñidas con un anticuerpo específico para la
actina, una proteína que polimeriza en filamentos, se hacen evidentes una serie de
haces paralelos (Figura 4.37). Los filamentos de actina son constituyentes del cito-
esqueleto, el andamiaje interno de las células que controla su forma y movimiento. FIGURA 4.37 Fiiamentos de actlna.
Rastreando la localización de las proteínas, los marcadores fluorescentes también Micrografía de fluorescencia de filamentos
aportan claves para conocer la función proteica. Por ejemplo, la proteína receptora de actina en una célula teñida con un
de glucocorticoides es un factor de transcripción que controla la expresión génica anticuerpo específico contra la actina.
en respuesta a la hormona esteroide cortisona. El receptor se unió a la proteínafluo- [Cortesía del Dr. Elias Lazarides.]
FIGURA 4.38 Localización nuclear de un (A)
receptor de esteroides. (A) El receptor,
visualizado por unión de la proteína
fluorescente verde, se localiza
principalmente en el citoplasma de la
célula en cultivo. (B) Tras la adición de
corticoesterona (un esteroide
glucocorticoide), el receptor se desplaza al
núcleo. [Cortesía del Profesor William B.
Pratt/Departamento de Farmacología,
Universidad de Michigan.J

(B)

.....
....
• rescente verde (GFP, "green fluorescent protein"), una proteína fluorescente natural
• aislada de la medusa Aequorea victoria (Sección 3.6.5). La microscopía de fluo-
rescencia reveló que, en ausencia de la hormona, el receptor se localiza en el cito-
plasma (Figura 4.38A). Tras añadir el esteroide, el receptor se transloca al nucleo,

.· ••
...,. ,.•·.
••
:~
donde se une al DNA (Figura 4.38B).
El mayor poder de resolución de la microscopía de fluorescencia es de unos
0,2 u.m (200 nm, o 2000 Á), la longitud de onda de la luz visible. Se puede obte-
,:
:~•
ner una resolución espacial más afinada mediante microscopía electrónica utili-
~
~·­· zando anticuerpos etiquetados con marcadores densos en electrones. Por ejemplo,
la ferritina conjugada con un anticuerpo se puede visualizar fácilmente por mi­
croscopía electrónica porque contiene un núcleo rico en hierro, denso en electro-
nes. También se pueden conjugar agrupaciones de oro con anticuerpos para hacer-
los muy visibles en el microscopio electrónico. La microscopía inmunoelectránica
puede definir la posición de los antígenos hasta una resolución de 10 nm (100 Á)
o aún mayor (Figura 4.39).
FIGURA 4.39 lnmunomicroscopía
electrónica. Las partículas opacas (150 A,
o 15 nm de diámetro) en esta micrografía
electrónica son grupos de átomos de oro 4.4 LOS PÉPTIDOS SE PUEDEN SINTETIZAR
unidos a moléculas de anticuerpo. Estas POR MÉTODOS AUTOMATIZADOS
vesículas de membrana que provienen de
EN FASE SÓLIDA
sinapsis neuronales contienen una proteína
de un conducto que es reconocida por el
anticuerpo específico. [Cortesía del Dr. Peter La capacidad para sintetizar péptidos de secuencia definida es una técnica poderosa
Sargent.J para ampliar los análisis bioquímicos por varias razones.
1. Los péptidos sintéticos pueden servir como antígenos para estimular la forma-
ción de anticuerpos específicos. Por ejemplo, como se ha expuesto anteriormente,
a menudo es más eficaz obtener una secuencia proteica a partir de una secuencia de
ácidos nucleicos que secuenciar la propia proteína (ver también el capítulo 6). Los
péptidos se pueden secuenciar en base a la secuencia de su ácido nucleico y se pue- ~~~~~~~~-1105f--
den formar anticuerpos dirigidos contra estos péptidos. Estos anticuerpos se pueden Síntesis de péptido
utilizar entonces para aislar la proteína intacta de la célula.
/CH3
2. Los péptidos sintéticos se pueden usar para aislar receptores de muchas hor-

~,i?
monas y otras moléculas señal. Por ejemplo, los leucocitos son atraídos hacia las
bacterias por péptidos con formilmetionilo (tMet) que se liberan en la ruptura de
las proteínas bacterianas. Péptidos sintéticos con formilmetionilo han sido útiles en
la identificación del receptor de la superficie celular de este tipo de péptidos. Ade-
más, los péptidos sintéticos se pueden unir a bolitas de agarosa para preparar co-
H N C
lumnas de cromatografía de afinidad para la purificacción de proteínas receptoras
H 11
que los reconozcan específicamente. o
Péptldo fMet
~ 3. Los péptidos sintéticos pueden utilizarse como fármacos. La vasopre-
~ sina es una hormona peptídica que estimula la reabsorción de agua en los
túbulos distales del riñón para formar una orina más concentrada. Los pacientes
con diabetes insípida son deficientes en vasopresina (también llamada hormona
anüdiurética), por lo que excretan grandes volúmenes de orina (más de 5 litros por
día) y están continuamente sedientos. Este defecto se puede tratar administrando
l-desamino-8-0-arginina vasopresina, un análogo sintético de la hormona que falta
(Figura 4.40). Este péptido sintético se degrada in vivo mucho más lentamente que
la propia vasopresina y, por añadidura, no incrementa la presión sanguínea.

~~H2

. NH2
s s

Cys Cys Arg Gly


l 2 3 4 5 6 7 8 9
8-Arginina vasopresina
(A) (hormona antidiurética, ADH)

H2~>=H

H,: ~
FIGURA 4.40 Vasopresina y vasopresina

H~sTy,-Phe-Gl,-A,p"-
N
H
~s,
Pro­e, >yH
'N
H
~
"­­­e
H2
L NH2
sintética. Fórmulas estructurales de
(A) vasopresina, una hormona peptídica
que estimula la absorción de agua y,
(B) 1-desamino-8-o-arginina vasopresina,
O o o un análogo sintético de esta hormona
(B) 1-Desamino-8-o-arginina vasopresina antidiurética más estable.

4. Finalmente, el estudio de péptidos sintéticos puede ayudar a definir las reglas


que gobiernan la estructura tridimensional de Las proteínas. Podemos preguntarnos
si una secuencia particular en sí misma se pliega en una hélice a, hebra 13, giro en
horquilla, o bien se comporta como un ovillo estadístico.
¿Cómo se construyen estos péptidos? El grupo amino de un aminoácido se
une al grupo carboxilo de otro. Sin embargo, sólo se forma un producto único
cuando un único grupo amino y un único grupo carboxilo están accesibles para
reaccionar. Por ello, es necesario bloquear algunos grupos y activar otros para
prevenir reacciones no deseadas. El grupo a-amino del primer aminoácido del
péptido deseado se bloquea con un grupo tert-butiloxicarbonilo (r-Boc), dando
lugar a un t-Boc-aminoácido. El grupo carboxilo de este mismo aminoácido se
activa haciéndolo reaccionar con un reactivo como la diciclohexilcarbodiimida
(DCC), como se ilustra en la Figura 4.41. El grupo amino libre del siguiente
t­Butiloxicarbonilaminoácido
(t­Boc aminoácido)
aminoácido a unirse ataca el carboxilo activado, originando un enlace peptídico
y liberando diciclohexilurea. El grupo carboxilo del dipéptido resultante se ac-
tiva con DCC y reacciona con el grupo amino libre del aminoácido que va a ser

Diciclohexilcarbodiimida
(DCC)

Aminoácido protegido n

l
Resina reactiva

(D Anclaje

t-Boc aminoácido n - 1
Rn H
t-Boc'--... ,)(____ /o
N e
H I
o
(\ @ l Desprotección con CF3COOH

N
/"'/

Aminoácido activado @ ¡ Acoplamiento con el


aminoácido protegido n - 1
+DCC

H IIe Rn .H
o
Aminoácidon unido a la resina t-Boc/
N
y .· H
\.P
'-..N/'-.....e/
H ,1
R,,_1 O
H ~ Rn H ­

t-Boc~e'-~c~
Rn-1 O
l-1
r>. J Des protección subsiguiente
y ciclos de acoplamiento

Dipéptido unido a la resina


+ G) l Liberación con HF

O O R
ll~H 11 \,,H
H2N"""'- ..,..,...-e N......._ ,_....,..e......._ »<: /,­º
A ,}\ N el.­
/H 'H H :­
Diciclohexilurea R1 R,,_1 O

FIGURA 4.41 Activación de aminoácidos. FIGURA 4.42 Síntesis de péptidos en fase sólida. Las etapas son: (1) anclaje del
La diciclohexilcarbodiimida se usa para aminoácido e-terminal, (2) desprotección del amino terminal y (3) acoplamiento del
activar grupos carboxilo para la formación siguiente residuo. Los pasos 2 y 3 se repiten para cada aminoácido que se añade. Por
de enlaces peptídicos. último, en el paso 4, el péptido terminado se libera de la resina.
el tercer residuo del péptido. Este proceso se repite hasta que se sintetiza todo
el péptido deseado. La exposición del péptido a ácido diluido libera el grupo t­ Determinación de la
Boc protector del primer aminoácido y deja el resto de los enlaces peptídicos estructura tridimensional
intactos.
De este modo se pueden sintetizar péptidos que contienen más de 100 ami-
noácidos por repetición secuencial de las reacciones precedentes. La unión de
la cadena peptídica creciente a una matriz insoluble, tal como bolitas de po-
liestireno, incrementa aún más la eficiencia. Una ventaja importante de este mé-
todo en Jase sólida es que el producto esperado en cada fase queda unido a las
bolitas que se pueden filtrar y lavar rápidamente, por lo que no es necesario pu-
rificar intermediarios. Todas las reacciones se llevan a cabo en el mismo reci-
piente, por lo que se evitan las pérdidas causadas por la transferencia repetida
de los productos. El aminoácido carboxilo-terminal de la secuencia peptídica
deseada se ancla primero a las bolitas de poliestireno (Figura 4.42). Se separa
entonces el grupo t-Boc protector de este aminoácido. El siguiente aminoácido
(en la forma t-Boc protegida) y la diciclohexilcarboxidiimida, el agente aco-
plante, se añaden juntos. Tras formarse el enlace peptídico, el exceso de reacti-
vos y la diciclohexilurea se lavan, dejando el producto dipéptido deseado unido
a las bolitas. Se van uniendo más aminoácidos por la misma secuencia de reac-
ciones. Al final de la síntesis, el péptido se libera de las bolitas por adición de
ácido fluorhídrico (HF), que rompe el anclaje de éster carboxílico sin alterar los
enlaces peptídicos. Los grupos protectores de las cadenas laterales potencial-
mente reactivas, como las de la lisina, también se quitan en este momento. Este
ciclo de reacciones se puede automatizar fácilmente, lo que lo hace adecuado
para la síntesis rutinaria de péptidos de unos 50 residuos con un buen rendi-
miento y pureza. De hecho, el método de fase sólida se ha usado para sinteti-
zar interferones (155 residuos) que tienen actividad antivírica y también ribo-
nucleasa (124 residuos) catalíticamente activa.

4.5 LA ESTRUCTURA TRIDIMENSIONAL DE


LAS PROTEÍNAS SE PUEDE DETERMINAR POR
ESPECTROSCOPÍA DE NMR Y CRISTALOGRAFÍA
DE RAYOS X

Una cuestión crucial es: ¿qué apariencia tiene la estructura tridimensional de una
proteína determinada? La estructura de una proteína condiciona su función, habida
cuenta que la especificidad de los centros activos y los centros de unión dependen
precisamente de la conformación tridimensional. La espectroscopía de resonancia 1

magnética nuclear y la cristalografía de rayos X son dos de las más importantes téc- TABLA 4.4 Núcleos de importancia
nicas para averiguar la conformación de las proteínas. biológica que dan señales de NMR
Abundancia
4.5.1 La espectroscopía de resonancia magnética nuclear puede natural
(% en peso
revelar las estructuras de las proteínas en disolución
Núcleo del elemento)
La espectroscopía de resonancia magnética nuclear (NMR) es una técnica singu-
'H 99,984
lar ya que es capaz de revelar la estructura atómica de las macromoléculas en di­
2H 0,016
solución, suponiendo que se puedan obtener disoluciones altamente concentradas
(­ 1 mM, o 15 mg ml-1 para una proteína de 15 kd). Esta técnica se basa en el •Je 1,108
hecho de que algunos núcleos atómicos son intrínsicamente magnéticos. Sólo un 14N 99,635
número limitado de isótopos poseen esta propiedad, conocida como spin (rota- 1sN 0,365
ción), de los que los más importantes en bioquímica se citan en la Tabla 4.4. El 170 0,037
ejemplo más sencillo es el núcleo de hidrógeno (1H) que es un protón. La rota- 23Na 100,0
ción de un protón genera un momento magnético. Cuando se aplica un campo 2sMg 10,05
magnético externo, este momento puede adoptar una de dos orientaciones, o es- 31p 100,0
tados de spin (llamados a y 13) (Figura 4.43). La diferencia de energía entre es-
tos estados es proporcional a la fuerza del campo magnético aplicado. El estado 35CI 75,4
a tiene una energía ligeramente más baja y por ello está ligeramente más poblado 39K 93,1
(por un factor de 1,00001 en un experimento típico) porque está alineado con el
---,1081--~~~~~~~-
campo. Un protón en rotación en estado a puede elevarse al estado excitado (es-
CAPÍTULO 4 • Investigación en proteínas tado [3) si se aplica un pulso de radiación electromagnética (un pulso de radio-
frecuencia, o RF), siempre y cuando la frecuencia corresponda a la diferencia de
energía entre los estados a y [3. En estas circunstancias, el spin cambiará de a a
[3; en otras palabras, se obtendrá una resonancia. Un espectro de resonancia para
una molécula se puede obtener variando el campo magnético a frecuencia cons-
tante de la radiación electromagnética, o manteniendo el campo magnético cons-
t tante y variando la radiación electromagnética.
Estas propiedades se pueden utilizar para estudiar los entornos químicos del
·e,"' núcleo de hidrógeno. El flujo de electrones alrededor de un núcleo magnético ge-
QJ
e
UJ nera un pequeño campo magnético local que se opone al campo aplicado. El
grado de oposición depende de la densidad electrónica que rodea al núcleo. Por
consiguiente, núcleos en diferentes ambientes cambiarán de estado, o resonarán,
Fuerza de campo magnético ~ a fuerzas de campo o frecuencias de radiación ligeramente distintas. Los núcleos
de la muestra perturbada absorben radiación electromagnética a una frecuencia
FIGURA 4.43 Base de la espectroscopía que se puede medir. Las diferentes frecuencias, conocidas como desplazamiento
de NMR. Las energías de las dos químico, se expresan como unidades fraccionales 6 (partes por millón, o ppm)
orientaciones de un núcleo de rotación 'Yi relativas a los desplazamientos de un compuesto estándar, como el derivado hi-
(como el 31P y el 1H) dependen de la drosoluble del tetrametilsilano, que se añade con la muestra a estudiar. Por ejem-
fuerza del campo magnético aplicado. La
plo, un protón de un -CH3 presenta normalmente un desplazamiento químico (6)
absorción de radiación electromagnética
de l ppm, mientras que un protón aromático tiene 7 ppm. El desplazamiento quí-
de frecuencia apropiada induce una
transición del nivel inferior al superior.
mico de la mayor parte de los protones de las proteínas está entre O y 9 ppm (Fi-
gura 4.44). Es posible resolver la mayor parte de los protones en muchas prote-
ínas usando esta técnica de NMR unidimensional. Con esta información, se
pueden deducir los cambios de un grupo químico determinado en diferentes con-
diciones, tales como el cambio conformacional de una proteína de una estructura
desordenada a una a-hélice en respuesta a un cambio de pH.
Podemos acumular incluso más información examinando cómo las rotaciones
de los diferentes protones afectan a sus vecinos. Si se induce una magnetización
transitoria en una muestra por aplicación de un pulso de radiofrecuencia, es po-
sible alterar la rotación de un núcleo y examinar el efecto producido en la rota-
ción de otro núcleo vecino. Especialmente revelador es un espectro bidimensio-
nal obtenido por espectroscopía de intensificación nuclear Overhauser
(NOESY, "nuclear Overhauser enhancement spectroscopy"), que muestra gráfi-
FIGURA 4.44 Espectro de NMR camente pares de protones que están muy cercanos, incluso aunque no estén jun-
unidimensional. (A) El espectro 1H­NMR tos en la estructura primaria. La base de esta técnica es el efecto nuclear Over-
del etanol (CH3CH20H) muestra que los hauser (NOE), una interacción entre núcleos que es proporcional al inverso de la
desplazamientos químicos del hidrógeno sexta potencia de su distancia. La magnetización se transfiere desde un núcleo ex-
están resueltos claramente. (B) El espectro citado a otro que no lo está si están a una distancia menor de 5 Á (Figura 4.45A).
1H­NMR
de un fragmento de 55 En otras palabras, el efecto proporciona un medio para detectar la localización re-
aminoácidos de una proteína que actúa en lativa de un átomo respecto a otro en la estructura tridimensional de la proteína.
el corte del RNA muestra un mayor grado La diagonal de un espectro NOESY corresponde al espectro unidimensional. Los
de complejidad. Hay un gran número de
picos fuera de la diagonal proporcionan una nueva información crucial: identifi-
picos y muchos se solapan. [(A) Tomado de
C. Branden and J. Tooze, lntroduction to Protein
Structure (Garland 1991 ), p. 280; (B) Cortesía de
Barbara Amann y Wesley McDermott.]

(A) (B)

(a) (b) (e)


CH3­CH2­0H

i (a)

(b)
(c)

B 7 6 5 4 3 2 o 9 8 7 6 5 4 3 2 o
Desplazamiento químico (ppm) Desplazamiento químico (ppm)
El cristal de proteína se monta y se sitúa con una orientación precisa con res-
pecto al haz de rayos X y a la película. Se hace girar el cristal de forma que el haz
pueda incidir en él desde muchas direcciones. Este movimiento rotacional produce
una fotografía de rayos X que consiste en una serie de manchas llamadas reflexio- (A)
nes. La fotografía de rayos X mostrada en la Figura 4.51 es una sección bidimen-
sional obtenida de una serie tridimensional de 25 000 manchas. Se mide la intensi-
dad de cada mancha y estas intensidades y sus posiciones son los datos
experimentales básicos para el análisis cristalográfico de rayos X. El siguiente paso
es reconstruir una imagen de la proteína a partir de las intensidades observadas. En
microscopía óptica o microscopía electrónica, los haces difractados se enfocan por
medio de lentes para formar directamente la imagen. Sin embargo, no existen len-
tes apropiadas para enfocar los rayos X. En cambio, la imagen se forma aplicando
una relación matemática que se conoce como transformada de Fourier. Esta ope-
ración asigna para cada mancha una onda de densidad electrónica cuya amplitud es
proporcional a la raíz cuadrada de la intensidad observada en la mancha. Cada onda
tiene también una/ase, es decir, un ritmo de crestas y valles en relación a las otras
ondas. La fase de cada onda determina si refuerza o anula las ondas provenientes
de las otras manchas. Estas fases se pueden deducir a partir de patrones de difrac-
ción bien conocidos, provenientes de marcadores de referencia, átomos pesados den-
sos electrónicamente, como el uranio o el mercurio situados en sitios específicos de
la proteína.
El escenario está ya preparado para el cálculo del mapa de densidad electró-
nica, que nos da la densidad de los electrones en un gran número de puntos es-
paciados regularmente en el cristal. Esta distribución tridimensional de la densi-
dad electrónica se representa por una serie de secciones paralelas dispuestas una
sobre otra. Cada sección es una hoja de plástico transparente (o, más reciente-
mente, una capa en una imagen de ordenador) en la que la distribución de la den-
sidad electrónica se representa por contornos (Figura 4.52) como los contornos
usados en mapas geológicos para representar la altura (Figura 4.53). El siguiente
paso es interpretar el mapa de densidad electrónica. Un factor crítico es la reso-
lución de los análisis de rayos X, que viene determinada por el número de inten-
sidades dispersas usadas en la síntesis de Fourier. La fidelidad de la imagen de- FIGURA 4.51 Cristal de mioglobina y
pende de la resolución de la síntesis de Fourier, como se muestra en la analogía rayos X. (A) cristal de mioglobina. (B)
Fotografía de la difracción de un cristal de
mioglobina. [(A) Mel Pollinger/Fran Heyl
Associates.]

FIGURA 4.52 Sección del mapa de


densidad electrónica de la mioglobina.
Esta sección del mapa de densidad
electrónica muestra el grupo hemo. El pico
del centro de esta sección corresponde a la
posición del átomo de hierro [Tomado de J.C. FIGURA 4.53 Sección de un mapa del
Kendrew. The three dimensional structure of a Servicio Geológico de Estados Unidos.
protein molecule. Copyright O 1961 by Scientific Rectángulo correspondiente al Monte
American, lnc. Todos los derechos reservados.] Capitolio en Colorado.
~ 112 f­­­­­­­­­­
CAPÍTULO 4 • Investigación en proteínas

FIGURA 4.54 La resolución afecta a la


calidad de la imagen. El efecto de la
resolución sobre la calidad de una imagen (A) (B)
reconstruida se evidencia por una analogía
óptica; la difracción de rayos X: (A) Una
fotografía del Partenón; (B) Un esquema de
difracción óptica del Partenón; (C y O)
imágenes reconstruidas del esquema de la
parte B. Se utilizaron más datos para obtener
la imagen O que la imagen C, lo que
produce una mayor calidad en la imagen O.
[(A) Cortesía del Dr. Thomas Steitz. (8) Cortesía del
Dr. David DeRosier).l (C) (O)

óptica de la Figura 4.54. Una resolución de 6 Á revela la dirección de la cadena


polipeptídica, pero pocos detalles estructurales. La razón es que las cadenas de
polipéptido se empaquetan juntas y sus centros están separados entre 5 y 10 Á.
Se necesitan mapas a mayor resolución para delinear los grupos de átomos que
están separados entre 2,8 y 4 Á, y los átomos individuales, que están separados
entre 1,0 y l,5 Á. La resolución máxima de un análisis de rayos X viene deter-
minada por el grado de perfección del cristal. Para proteínas, esta resolución li-
mitante está normalmente alrededor de 2 Á.
Hacia mediados del 2000, se habían determinado por NMR y cristalografía
de rayos X la estructura de más de 10 000 proteínas y cada día se determinan
varias estructuras nuevas. Las coordenadas se recogen en el banco de datos de
proteínas (PDB, "Protein Data Bank") (http://www.rcsb.org/pdb) donde las es-
tructuras están accesibles para su visualización y análisis. El conocimiento de
la arquitectura molecular detallada de las proteínas ha permitido ver cómo las
proteínas reconocen y se unen a otras moléculas, cómo funcionan como enzi-
mas, cómo se pliegan y cómo evolucionan. Esta cosecha extraordinariamente
rica está prosiguiendo a pasos agigantados y está influyendo sobremanera en
el mundo entero de la bioquímica.

RESUMEN

El rápido progreso en la secuenciación génica ha propiciado otro de los éxitos


de la bioquímica: el conocimiento del proteoma. El proteoma es el conjunto
completo de proteínas expresadas e incluye información sobre cómo se modi-
fican, cómo funcionan y cómo interaccionan con otras moléculas.

La purificación de proteínas es un primer paso esencial en


el conocimiento de su función
Se pueden separar conjuntos de proteínas y de otras moléculas en base a ca-
racterístisticas como la solubilidad, tamaño, carga y afinidad de unión. La
electroforesis en gel de SDS-poliacrilmida separa las cadenas de polipéptido
de las proteínas en condiciones desnaturalizantes principalmente de acuerdo
con su masa. Las proteínas también se pueden separar electroforéticarnente
en base a su carga neta por isolectroenfoque en un gradiente de pH. La ul-
tracetrifugación y la cromatografía de filtración en gel separan las proteínas
de acuerdo con su tamaño, mientras que la cromatografía de intercambio ió-
nico las separa principalmente en base a su carga neta. La alta afinidad de
muchas proteínas por grupos químicos específicos se utiliza en la cromato-
grafía de afinidad, en la que las proteínas se unen a columnas que contienen
Problemas ~ 115 r­
Goding, J. W., 1996. Mo11oc/011al Antibodies: Principies and Practice. Aca- Síntesis química de proteínas
demic Press.
Mayo, K. H., 2000. Recent advaaces in the design and construction of syn-
lmmunology Today; 2000. Volume 21, issue 8. thetic peptides: For the love of basics or just for the technology of it.
Tsien, R. Y., 1998. The green fluorescent protein. A111w. Rev. Biochem.
Trends Biotechnol. 18:212-217.
67:509-544.
Borgia, J. A., y Fields, G. B., 2000. Chemical synthesis of proteins. Trends
Kendall, J. M., y Badminton, M. N., 1998. Aequorea victoria biolumines-
Biotechnol. 18:243-251.
cence rnoves into an exciting era. Trends Biotechnol. 16:216-234.

­­j PROBLEMAS
1. Reactivos valiosos. Los siguientes reactivos se utilizan habi- 5. Movimiento lento. La troporruosma, una proteína muscular de
tualmente en química de proteínas: 93 kd, sedimenta más lentamente que la hemoglobina (65 kd). Sus co-
Feni I isotíocianato eficientes de sedimentación respectivos son 2,6S y 4,31S. ¿Cuál es la
CNBr Ácido perfórmico
Quimotripsina característica estructural responsable de su lentitud en la sedimentación?
Urea Cloruro de dabsilo
Mercaptoetanol HCI 6N 6. Esferas que sedimentan. ¿Cuál es la dependencia entre el coe-
Tri psi na Ninhidrina ficiente de sedimentación S de una proteína esférica y su masa?
¿Cúal es el más adecuado para cumplir con cada una de las siguientes ¿Cuánto más rápidamente sedimentará una proteína de 80 kd que
funciones? una de 40 kd?.

(a) Determinación de la secuencia de aminoácidos de un péptido pe- 7. Determinación del tamaño. Las movilidades electroforéticas re-
queño. lativas de una proteína de 30 kd y una de 92 kd utilizadas como es-
(b) Identificación del residuo amino terminal de un péptido (del que tándar en un gel de SDS-poliacrilamida son, respectivamente, 0,80
tenemos menos de O, 1 µg) y 0,41. ¿ Cuál es la masa aparente de una proteína que tiene una mo-
(e) Desnaturalización reversible de una proteína que no tiene enla- vilidad de 0,62 en este gel?
ces disulfuro. ¿Qué reactivo adicional se necesitaría si hubiese en- 8. [Una asociación nueva? El gen que codifica una proteína que
laces disulfuro? tiene un único puente disulfuro experimenta una mutación que susti-
(d) Hidrólisis de enlaces peptídicos en el lado carboxílico de resi- tuye un residuo de serina por uno de cisteína. Se quiere comprobar si
duos aromáticos. el apareamiento de sulfhidrilos en este mutante es el mismo que en la
(e) Ruptura de enlaces peptídicos en el lado carboxílico de la me- proteína original. Proponer un experimento que resuelva esta cuestión.
tionina, 9. Clasificando células. La clasificación de células activada por
(f) Hidrólisis de enlaces peptídicos en el lado carboxílico de los re-
fluorescencia (FACS) es una técnica eficaz para separar células de
siduos de arginina y lisina. acuerdo con su contenido en moléculas determinadas. Por ejemplo,
2. Buscando un extrenw. La hidrazina anhidra (H2N-NH2) se ha un anticuerpo, marcado con fluorescencia, específico para una pro-
utilizado para romper los enlaces peptídicos de las proteínas. ¿Cuá- teína de la superficie celular se puede utilizar para detectar células
les son los productos de la reacción? ¿Cómo se podría utilizar esta que contengan dicha molécula. Suponer que se quiere aislar células
técnica para identificar el aminoácido carboxilo terminal? que poseen un receptor que les permita detectar productos de de-
3. Creando 1111 nuevo sirio de ruptura. La etilenimina reacciona con gradación bacteriana. Sin embargo, no se dispone todavía de un an-
las cadenas laterales de cistefna en las proteínas para formar S-arruno- ticuerpo contra este receptor. ¿Qué molécula marcada con fluores-
etilderivados. Los enlaces peptídicos del lado carboxilo de estas ciste- cia prepararíamos para identificar estas células?
Inas modificadas son susceptibles de hidrólisis por tripsina. ¿Por qué? 10. Escoger la columna. (a) El octapéptido AVGWRVKS se digirió
4. Espectrometria. La absorbancia A de una disolución se define como con tripsina. ¿Sería el intercambio iónico o la exclusión molecular
A = log.¿ (/off) la técnica más apropiada para separar estos productos? Explicarlo.
(b) Suponer que el péptido se digiere con quimotripsina. ¿Cuál se-
donde /0 es la intensidad de la luz incidente e / la intensidad trans-
ría la técnica de separación óptima? Explicarlo.
mitida. La absorbancia está relacionada con el coeficiente de absor-
ción molar (coeficiente de extinción) e (en cm-1 M­1), la concen- 11. ¿ Haciendo más enzima? Durante la purificación de un enzima,
tración e (en M) y el paso óptico (en cm) por la expresión un investigador realiza un paso de purificación que produce un in-
A= ele cremento en la actividad total dando un valor mayor que el que está
presente en el extracto crudo. Explicar cómo se puede incrementar
El coeficiente de absorción de la mioglobina a 580 nm es 15 000
la cantidad de actividad total.
M-1 cm-1• ¿Cuál es la absorbancia de una disolución de I mg ml-1
con un paso de I cm? ¿Qué porcentaje de la luz incidente transmi- 12. Problema de purificación de proreínas. Completar la siguiente
tirá esta disolución? tabla:

Procedimiento Proteína total Actividad total Actividad específica Nivel de Rendimiento


de purificación (mg) (unidades) (unidades mg"") purificación (%)

Extracto crudo 20 000 4.000 000 100


Precipitación con (NH4)iS04 5 000 3.000 000
Cromatografía DEAE-celulosa 1 500 1.000 000
Cromatografía de exclusión molecular 500 750 000
Cromatografía de afinidad 45 675 000
--1116 f­­ CAPÍTULO 4 • Investigación en proteínas
Problemas de integración del capítulo Problemas de interpretación de datos
13. Estructura cuaternaria. Una proteína se purificó hasta homo- 16. Secuenciación de proteínas l. Determinar la secuencia de un he-
geneidad. La determinación del peso molecular por cromatografía xapéptido basándose en los siguientes datos. Nota: Cuando no seco-
de exclusión molecular da 60 kd. La cromatografía en presencia de noce la secuencia, los aminoácidos se separan con una coma (Ver
urea 6M da una especie de 30 kd. Cuando se repite la cromato- Tabla 4.3)
grafía en presencia de urea 6M y 13-mercaptoetanol 10 mM, apa-
Composición de aminoácidos: (2R,A,S,V,Y)
rece una especie molecular única de 15 kd. Describir la estructura
de la molécula. Análisis N-terminal del hexapéptido: A
Digestión por tripsina: (R,A,V) y (R,S,Y)
14. Transiciones hélice-ovillo
Digestión por carboxipeptidasa: No hay digestión.
(a) Las medidas de NMR han mostrado que la poli-L-lisina es un Digestión por quimotripsina: (A,R,V,Y) y (R,S)
ovillo estadístico a pH 7, pero se vuelve a-hélice cuando el pH se
17. Secuenciacián de proteínas 11. Determinar la secuencia de un
eleva por encima de LO. Explicar esta transición conformacional de-
péptido de 14 aminoácidos en base a los siguientes datos.
pendiente del pH. (b) Predecir la dependencia del pH en la transi-
ción hélice-ovillo del poli-L-glutamato. Composición de aminoácidos: (4S,2L,F,G,I,K,M,T,W,Y)
15. Péptidos en un chip. Se pueden sintetizar un gran número de Análisis N-terminal: S
péptidos diferentes en una pequeña área sobre un soporte sólido. Este Digestión por carboxipeptidasa: L
ordenamiento de alta densidad se puede ensayar con una proteína Digestión por tripsina: (3S,2L,F,I,M,T,W) (G,K,S,Y)
marcada con fluorescencia para averiguar que péptidos se recono- Digestión por quimotripsina:
cen. En la figura se muestra la unión de un anticuerpo a un ordena- (F,l,S) (G,K,L) (L,S) (M,T) (S,W) (S,Y)
miento de 1024 péptidos diferentes que ocupan una superficie simi- Análisis N-terminal del péptido (F, 1, S): S
lar a la de una uña. ¿Cómo sintetizaríamos tal ordenamiento
Tratamiento con bromuro de cianógeno:
peptídico? [Sugerencia: Utilizar luz en vez de ácido para desprote-
(2S,F,G,I,K,L,M•,T,Y) (2S,L,W)
ger el grupo amino-terminal en cada ciclo de síntesis.]
M*, metionina detectada como homoserina

18. Degradación de Edman. La alanina amidada se trató con feni-


lisotiocianato para formar PTH-alanina. Escribir un mecanismo para
esta reacción.

Barrido fluorescente de una serie de 1024 péptidos en un área


del,6 cm2• Cada lugar de síntesis es un cuadrado de 400 µm. Se
añade un anticuerpo monoclonal marcado con fluorescencia a la
serie para identificar los péptidos que son reconocidos. La altura y el
color de cada cuadrado indican la intensidad de la fluorescencia.
[Tomado de S.P.A. Fodor, J.O. Read, M.C. Pirrung, L. Stryer, A.T. Lu y D. Solas.
Science 251 (1991):767.]

~ TÉCNICAS ANIMADAS !-----------------

~ Visitar www.vhfreeman.com/biochem5 para ver animaciones [Cortesía de Lodish et al., 2000, Molecular Ce// Biolagy, 4th ed. W.H.
de electroforesis en SDS-gel, inmunotransporte, preparación de an- Freeman and Company.]
ticuerpos monoclonales, construcciones de informadores (GFP).
DNA, RNA y el flujo
.,,
_,
de la información genética -1
e
....o

La posesión de genes comunes justifica el parecido de una madre


con sus hijas. Los genes deben expresarse para ejercer un efecto y
las proteínas regulan esa expresión. Una de tales proteínas
reguladoras, una proteína de dedo de zinc (el ion zinc se muestra en
azul, la proteína en rojo), se muestra unida a una región control o
promotora del DNA (en negro). [(Izquierda) Barnaby Hall/Photonica.]

El DNA y el RNA son polímeros lineales largos, llamados ácidos nucleicos, que
contienen información de tal forma que pueda ser transmitida de una generación a
la siguiente. Estas macromoléculas están formadas por un gran número de nucleó-
tidos unidos, cada uno de ellos compuesto por un azúcar, un grupo fosfato y una
base. Los azúcares se unen a través de los grupos fosfato y for-
man un eje (o esqueleto) común, mientras que las bases varían en-
CONTENIDO
tre cuatro tipos. La información genética está almacenada en la
secuencia de las bases dispuestas a lo largo de una cadena de 5.1 Un ácido nucleico está formado
ácido nucleico. Las bases tienen una propiedad adicional especial: por cuatro tipos de bases unidas a
forman pares específicos entre ellas que se estabilizan mediante un eje de azúcar-fosfato
puentes de hidrógeno. El emparejamiento de bases da lugar a la
5.2 Una pareja de cadenas de ácido
formación de una doble hélice, una estructura helicoidal consti-
nucleico con secuencias complementarias
tuida por dos hebras. Estos pares de bases aportan un mecanismo
puede formar una estructura de doble
para copiar La información genética de una cadena de ácido nu-
hélice
cleico existente para formar una nueva cadena. A pesar de que,
probablemente, el RNA funcionó corno el material genético en la 5.3 Las polimerasas replican el DNA
historia temprana de la evolución, los genes de todas las células a partir de las instrucciones
modernas y muchos virus son de DNA. El DNA se replica gra- de moldes
cias a la acción de enzimas DNA polimerasas. Estos enzimas tan 5.4 La expresión génica es
sumamente específicos copian las secuencias de moldes de ácido la transformación de la información
nucleico con una frecuencia de error menor de I por cada I 00 mi- del DNA en moléculas funcionales
llones de nucleótidos. 5.5 Los aminoácidos se codifican
Los genes especifican los tipos de proteínas que fabricarán las por grupos de tres bases comenzando
células, pero el DNA no es el molde directo para la síntesis de desde un punto fijo
proteínas. De forma precisa, los moldes para la síntesis proteica
5.6 La mayoría de los genes de eucariotas
son moléculas de RNA (ácido ribonucleico). En particular, una
son mosaicos de intrones y exones
clase de moléculas de RNA llamadas RNA mensajeros (mRNA)
son las intermediarias portadoras de información en la síntesis de
~ 118 proteínas. Otras moléculas de RNA, tales como el RNA de transferencia (tRNA) y
CAPÍTULO 5 • DNA, RNA y el flujo de el RNA ribosómico (rRNA) forman parte de la maquinaria de la síntesis proteica.
la información genética Todas las formas de RNA celulares se sintetizan por las RNA polimerasas que to-
man las instrucciones del DNA molde. Este proceso de transcripción se continua
con la traducción, es decir, la síntesis de proteínas de acuerdo con las instrucciones
transmitidas por el mRNA molde. Así pues, el flujo de la información genética, o
expresión génica, en células normales es:
Transcripción Traducción
DNA RNA ­­­­­­+ Proteína
Este flujo de información depende del código genético, que define la relación en-
tre la secuencia de bases del DNA (o de su transcrito, el mRNA) y la secuencia de ami-
noácidos de una proteína. El código es prácticamente el mismo para todos los orga-
nismos: una secuencia de tres bases, llamada codón, especifica a un aminoácido. Las
moléculas de tRNA leen secuencialmente los codones del mRNA y sirven de adapta-
dores en la síntesis de las proteínas. La síntesis de proteínas tiene lugar en los riboso-
mas, que son asociaciones complejas de rRNAs y más de 50 clases de proteínas.
El último tema que se considerará será el carácter discontinuo de la mayoría de
los genes de eucariotas, que son mosaicos de secuencias de ácidos nucleicos deno-
minadas intrones y exones. Ambos se transcriben, pero los intrones se cortan y eli-
minan de las moléculas de RNA recién sintetizadas, dejando a las moléculas de RNA
maduro sólo con exones consecutivos. La existencia de intrones y exones tiene im-
plicaciones cruciales en la evolución de las proteínas.

5.1 UN ÁCIDO NUCLEICO ESTÁ FORMADO POR


CUATRO TIPOS DE BASES UNIDAS A UN EJE
DE AZÚCAR-FOSFATO
Los ácidos nucleicos DNA y RNA son muy apropiados para funcionar como por-
tadores de información genética en virtud de sus estructuras covalentes. Estas ma-
cromolécu las son polímeros lineales construidos a partir de unidades similares co-
nectadas por los extremos (Figura 5.1). Cada unidad monomérica del polímero
contiene tres componentes: un azúcar, un grupo fosfato y una base. La secuencia de
bases es característica de cada ácido nucleico y representa una forma de informa-
ción lineal.

Base; Base;+i Base;+2

H
5' 1 ,,­H

Ho­~~o
1~H
H H Fosfato Fosfato Fosfato Fosfato Fosfato
H H
3' 2' FIGURA 5.1 Estructura polimérica de los ácidos nucleicos.
HO OH
Ribosa

5.1.1 El RNA y el DNA difieren en su componente de azúcar


y en una de las bases
La desoxirribosa es el azúcar del ácido desoxirribonucleico (DNA). El prefijo desoxi
indica que el átomo de carbono 2' del azúcar carece del átomo de oxígeno que sí
está unido al átomo de carbono 2' de la ribosa (el azúcar del ácido ribonucleico, o
RNA), como muestra la Figura 5.2. Los azúcares de los ácidos nucleicos están uni-
dos por puentes fosfodiéster. Concretamente, el grupo 3 '-hidroxilo (3 '-OH) del com-
Desoxirribosa
ponente de azúcar de un nucleótido se esterifica a un grupo fosfato, que, a su vez,
FIGURA 5.2 Ribosa y desoxirribosa. se une al grupo 5 '-hidroxilo del azúcar adyacente. La cadena de azúcares unidos por
Los átomos están numerados con primas puentes fosfodiéster es conocida como el eje (o esqueleto) del ácido nucleico (Figura
para diferenciarlos de los átomos de las 5.3). Mientras que el eje es constante tanto en el DNA como en el RNA, las bases
bases (ver Figura 5.4). varían de un monómero al siguiente. Dos de las bases son derivados de la purina-
119 r­
Ácidos nucleicos
H b~se0
H ~aseo H

<. /o <. /o <. /º"""'


3' 5' 3' 5' 3'

l\
d_O
l.
d_O
l\
d_O
DNA

FIGURA 5.3 Ejes del DNA y RNA. Los ejes


de estos ácidos nucleicos están formados
por uniones fosfodiéster de 3'­+ 5'. Una
unidad de azúcar está resaltada en rojo y
un grupo fosfato en azul.

adenina (A) y guanina (G)­ y dos de la pirimidina- citosina (C) y tirnina (T, sólo
en el DNA) o uracilo (U, sólo en RNA), corno se muestra en la Figura 5.4.
El RNA, así corno el DNA, es un polímero largo no ramificado que consiste en
nucleótidos unidos por enlaces fosfodiéster 3' ~ 5' (ver Figura 5.3). La estructura
covalente del RNA difiere de la del DNA en dos aspectos. Corno se afirmó ante-
riormente y corno indica su nombre, las unidades de azúcar en el RNA son ribosas
en lugar de desoxirribosas, La ribosa contiene un grupo 2' -hidroxilo que no está
presente en la desoxirribosa. Corno consecuencia, además de la unión estándar
3' ~ 5', en el RNA es posible un enlace 2' ~ 5'. Este último enlace es importante
en la eliminación de intrones y unión de exones para la formación del RNA maduro
(Sección 28.3.4). La otra diferencia, como ya se ha mencionado, es que una de las
cuatro bases principales en el RNA es el uracilo (U) en lugar de la timina (T).
Observar que cada puente fosfodiéster contiene una carga negativa. Esta carga
negativa repele especies nucleofílicas como el ion hidróxido; como consecuencia,
los enlaces fosfodiéster son mucho menos susceptibles a un ataque hidrolítico que
otros ésteres como los del ácido carboxílico. Esta resistencia es crucial para man-
tener la integridad de la información que está almacenada en los ácidos nucleicos.
La ausencia en el DNA del grupo 2' -hidroxilo aumenta aún más su resistencia a la
hidrólisis. Esta mayor estabilidad del DNA es probablemente la razón por la que se
utiliza, en lugar del RNA, como material hereditario en todas las células modernas
y en muchos virus.

NH2 o

kOCN ÓC>­H H,~~>­H


H

PURINAS
:~H
H ::::::,.._ N H ::::::,.._ N
1 N I
H H H
Purina Adenina Guanina

PIRIMIDINAS

Pirimidina Citosina Uracilo Timina

FIGURA 5.4 Purinas y pirimidinas. Los átomos dentro de las bases están numerados sin
primas. En el RNA se utiliza uracilo en lugar de timina.
~ 120 1----------- 5.1.2 Los nucleótidos son las unidades monoméricas de los áci­
CAPÍTULO5 • DNA, RNA y el flujo de dos nucleicos
la información genética

~ VISIONES ESTRUCTURALES, Los ácidos nucleicos ofrecen una perspectiva tridimen­


sional de la estructura nucleotídica, el emparejamiento de bases y otros aspectos de las estruc­
~turas del DNA y RNA.

Una unidad consistente en una base unida a un azúcar se denomina nucleósido. Las
cuatro unidades de nucleósido del RNA se llaman adenosina, guanosina, citidina y
uridina, mientras que las del DNA se llaman desoxiadenosina,desoxiguanosina,de-
soxicitidinay timidina. En cada caso, el N-9 de una purina o el N-1 de una pirimi-
dina se une al C-1' del azúcar (Figura 5.5). La base descansa por encima del plano
del azúcar cuando se escribe la estructura en la orientación estándar; es decir, la
configuración del enlace N-glicosídico es [3. Un nucleátido es un nucleósido unido
a uno o más grupos fosfato mediante enlaces éster. El sitio de esterificación más
FIGURA5.5 Enlace (3­glicosídico en un
común en nucleótidos que se dan de forma natural es el grupo hidroxilo unido al
nucleósido.
C-5' del azúcar. Un compuesto formado por la unión de un grupo fosfato al C-5'
de un azúcar nucleósido se llama un nucleásido 5' -fosfatoo un 5' -nucleátido, Por
ejemplo, el ATP es adenosina 5' -trifosfato. Otro nucleótido podría ser la desoxi-
guanosina 3'-monofosfato (3'-dGMP; Figura 5.6). Este nucleótido difiere del ATP
en que contiene guanina en lugar de adenina, desoxirribosa en lugar de ribosa (in-
dicado por el prefijo "des"), un fosfato en lugar de tres y tiene el fosfato esterifi-
cado en el grupo-hidroxilo de la posición 3' en lugar de la 5'. Los nucleótidos son
los monómeros que se unen para formar el RNA y el DNA. Las cuatro unidades
nucleotídicas del DNA se denominan desoxiadenilato, desoxiguanilato, desoxiciti-
dilato y timidilato. Observar que el timidilato contiene desoxirribosa; se ha conve-
nido que no se añada el prefijo desoxi porque los nucleótidos de tirnidina raramente
se encuentran en el RNA.

NH2 o
~O N N
:¡ 9 9 ~
: il il \ A ~N ( A NH

HO OH

º""o·/loi
p~
·­­o
2-

5'-ATP 3'-dGMP

FIGURA 5.6 Nucleótidos adenosina 5'­trifosfato (5'­ATP) y desoxiguanosina 3'­monofos­


fato (3'­dGMP).

Las anotaciones abreviadas pApCpG o pACG indican un trinucleótido de DNA


que consiste en los bloques de construcción desoxiadenilato monofosfato, desoxi-
A e G citidilato monofosfato y desoxiguanilato monofosfato unidos por un puente fosfo-
3' 3' 3'
diéster, donde "p" indica el grupo fosfato (Figura 5.7). El extremo 5' a menudo tiene
OH un fosfato unido al grupo 5'-0H. Observar que, al igual que un polipéptido (ver
Sección 3.2), una cadena de DNA tiene polaridad. Un extremo de la cadena tiene
un grupo 5'-0H libre (o un grupo 5'-0H unido a un fosfato), mientras que el otro
FIGURA 5.7 Estructura de una cadena extremo tiene un grupo 3' -0H y ninguno de los dos está unido a otro nucleótido.
de DNA. La cadena tiene un extremo 5', Por convenio, la secuencia de bases se escribe en la dirección 5' a 3'. Por tanto,
que normalmente está unido a un fosfato, el símbolo ACÓ indica que el grupo 5 '-OH libre está en el desoxiadenilato, mien-
y un extremo 3' que presenta normal­ tras que el grupo 3' -OH libre está en el desoxiguanilato. Debido a esta polaridad,
mente un grupo hidroxilo libre. ACG y GCA corresponden a compuestos diferentes.
Una característica extraordinaria de las moléculas de DNA que se dan en la na-
turaleza es su longitud. Una molécula de DNA debe constar de muchos nucleótidos
para portar la información genética necesaria incluso para los organismos más sen-
cillos. Por ejemplo, el DNA de un virus corno el del polioma, que puede provocar
cáncer en ciertos organismos, tiene una longitud de 5100 nucleótidos. Se puede
cuantificar la capacidad de información que portan los ácidos nucleicos de la si-
guiente forma. Cada posición puede ser una de las cuatro bases, que corresponden
a dos bits de información (22 = 4). Por tanto, una cadena de 5100 nucleótidos co-
rresponde a 2 X 5100 = 10 200 bits, o 1275 bytes (1 byte= 8 bits). El genoma de
E. coli es una única molécula de DNA que consiste en dos cadenas de 4,6 millones
de nucleótidos, correspondiendo a 9,2 millones de bits, o l,15 rnegabytes de infor-
mación (Figura 5.8).
Las moléculas de DNA de organismos superiores pueden ser mucho mayores. El
genoma humano contiene aproximadamente 3000 millones de nucleótidos, repartidos
en 24 clases de moléculas de DNA de diferentes tamaños (22 autosornas y los cro-
mosomas sexuales X e Y). Una de las mayores moléculas de DNA conocidas se en-
cuentra en el rnuntjak: indio, un venado asiático; su genoma es casi tan grande corno FIGURA 5.8 Micrografía electrónica de
el genoma humano pero está distribuído únicamente en 3 cromosomas (Figura 5.9). parte del genoma de E. co/i. [Dr. Gopal
El mayor de estos cromosomas tiene cadenas de más de 1000 millones de nucleóti- Murti/Science Photo Library/Photo Researchers.]
dos. Si tal molécula de DNA pudiera extenderse totalmente, alcanzaría una longitud
de más de 30 cm. Algunas plantas contienen moléculas de DNA aún mayores.

FIGURA 5.9 El muntjak indio y sus cro­


mosomas. Las células de un muntjak indio
hembra (derecha) contienen tres pares de
cromosomas muy grandes (teñidos de na­
ranja). La célula mostrada es un híbrido
que contiene un par de cromosomas hu­
manos (teñidos en verde) para su compa­
ración. [(Izquierda) M. Birkhead, OSF/Animals
Animals. (Derecha) )­Y Lee, M. Koi, E. ). Stan­
bridge, M. Oshimura, A. T. Kumamoto, y A. P.
Feinberg. Nature Genetics 7(1994):30.]

5.2 UNA PAREJA DE CADENAS DE ÁCIDO NUCLEICO


CON SECUENCIAS COMPLEMENTARIAS PUEDE FORMAR Espacio de 3,4 Á
UNA ESTRUCTURA DE DOBLE HÉLICE
La estructura covalente de los ácidos nucleicos les confiere la capacidad de portar
la información en forma de una secuencia de bases a lo largo de una cadena de ácido


nucleico. Otra de las características de la estructura del ácido nucleico es que faci-
lita el proceso de replicación, es decir, la generación de dos copias de ácido nu-


cleico a partir de una. Estas características son consecuencia de la capacidad de las
bases que se encuentran en los ácidos nucleicos para formar pares específicos de
bases de tal modo que originan una estructura helicoidal de dos hebras. La estruc-
ti
tura de doble hélice del DNA posibilita la replicación del material genético (Sec- ..-
ción 5.2.2).

5.2.1 La doble hélice es estable gracias a puentes de hidrógeno


e interacciones hidrofóbic as
w
Durante los estudios encaminados a determinar la estructura tridimensional del DNA FIGURA 5.10 Fotografía de difracción de
se descubrió la existencia de interacciones específicas del emparejamiento de ba- rayos X de una fibra de DNA hidratada.
ses. Maurice Wilkins y Rosalind Franklin obtuvieron fotografías de la difracción de La cruz central es característica de una es­
rayos X de fibras de DNA (Figura 5.10). Las características de estos patrones de di- tructura helicoidal. Los arcos marcados so­
fracción indicaron que el DNA estaba formado por dos cadenas que marcaban una bre el meridiano surgen por la acumulación
estructura helicoidal regular. De éstos y otros datos, James Watson y Francis Crick de las bases apareadas, que están separa­
dedujeron un modelo estructural para el DNA que explicaba el patrón de difracción das 3,4 Á. [Cortesía del Dr. Maurice Wilkins.]
(A) FIGURA 5.11 Modelo de Watson y Crick de la doble hélice
de DNA. Una de las cadenas de polinucleótido se muestra en
azul y la otra en rojo. Las bases púricas y pirimidínicas se indican
en colores más claros que el eje de azúcar-fosfato. (A) Vista
lateral. La estructura se repite a lo largo del eje helicoidal
(vertical) a intervalos de 34 Á, que corresponden a 1 O
nucleótidos en cada cadena. (B) Vista frontal, tomada desde la
base del eje helicoidal.

34Á
y fue también la fuente de conocimientos notables de las propiedades funcionales
de los ácidos nucleicos (Figura 5.11).
Las características del modelo de DNA de Watson y Crick deducido a partir de
los patrones de difracción son:
l. Hay dos cadenas helicoidales de polinucleótidos enrolladas a lo largo de un eje
común. Las cadenas transcurren en direcciones opuestas.
2. Los ejes de azúcar-fosfato se sitúan en el exterior y, por tanto, las bases de pu-
rina y pirimidina están en el interior de la hélice.
3. Las bases son casi perpendiculares al eje de la hélice, y las bases adyacentes es-
tán separadas 3,4 Á. La estructura helicoidal se repite cada 34 Á, de modo que hay
lO bases(= 34 Á por vuelta/3,4 Á por base) por cada vuelta de hélice. Hay una ro-