Anda di halaman 1dari 59

LAPORAN PRAKTIKUM BIOKIMIA

BIOINFORMATIKA

Disusun oleh:
Sri Ningsih
24030115120041

KEL 5

Asisten :
Nurrizka Kurniawati
24030114140121

DEPARTEMEN KIMIA
FAKULTAS SAINS DAN MATEMATIKA
UNIVERSITAS DIPONEGORO
SEMARANG
2017

1
VI. PEMBAHASAN

Percobaan ini berjudul “Bioinformatika” bertujuan untuk mengetahui


fungsi dari filogeni, yaitu dapat menunjukkan hubungan evolusi antar organisme
(hubungan kekerabatan), dimana sampel memiliki sifat yang mirip dengan kerabat
terdekat karena sejenis. Prinsip dari percobaan ini adalah memberikan input
berupa yang urutan nukleotida dan penerjemahan kode-kode genetik, yang
berfungsi untuk mengetahui susunan asam-asam amino dalam sekuen. Metode
yang digunakan adalah metode Blast (Basic Local Aligment), yaitu salah satu
metode aligment yang sering digunakan dalam penelusuran basis data sekuens
(Fatchiah, 2009). Metode blast ini digunakan untuk mengidentifikasi spesies
berdasarkan urutan pencarian homolog, yang diasumsikan secara orthologis
dengan clustawl (Vardivalagan, 2012). Program-program yang digunakan dalam
percobaan ini adalah NCBI, Blast, Notepad++, Bioedit dan MEGA6/7. Fungsi
penelusuran blast pada data sekuens adalah mencari sekuens yang baik dari asam
nukleat, DNA maupun protein yang mirip dengan sekuens tertentu yang ada pada
sampel. Hal ini berguna untuk memeriksa keabsahan hasil sekuens atau untuk
memeriksa fungsi gen hasil sekuennya. Algoritma yang mendasari blast adalah
penyejajaran sekuens (Kuncoro, 2011).

Penyejajaran sekuen (Sequence Alignment) adalah proses penyusunan


atau pengaturan dua atau lebih sekuens, sehingga proses persamaan sekuen-
sekuen tersebut tampak nyata (Krane,V.E, 2009). Sedangkan sekuen itu sendiri
adalah sederatan pernyataan-pernyataan yang uruta dan pelaksanaan eksekusinya
runtut, yang lebih dahulu ditemukan (dibaca) akan dikerjakan (dieksekusi)
terlebih dahulu, dan apabila urutan tersebut pernyataannya dibalik, maka
maknanya akan berbeda (Kuncoro, 2011).

Dari program-program yang dipakai akan dihasilkan pohon filogeni.


Filogeni merupakan sejarah evolusi dari kelompok spesies. Untuk menyusun
filogeni, para ahli Biologis menggunakan sistematika yaitu disiplin ilmu yang
terfokus pada klaifikasi organisme dan hubugan evolusinya. Data yang digunakan
dalam sistematika untuk menyusun filogeni dapat berupa data fosil, molekul,

2
maupun data gen untuk membangun hubungan evolusi antar organisme
(hubungan kekerabatan). (Campbell,et all, 2009).

Hubungan antar spesies ini bisa dilihat dari jenis gen, urutan, panjang bp,
jarak maksimal dan jarak individu. (Vardivalagan, 2012). Bioinformatika
memiliki banyak fungsi, salah satunya adalah ketika kita mendapatkan satu
sekuen DNA yang belum diketahui fungsinya, maka dengan membandingkannya
dengan data yang ada dalam database, dapat diperkirakan fungsinya, sehingga
dapat diketahui kualitas maupun kuantitas transkripsi suatu gen yang dapat
menunjukkan gen-gen apa saja yang aktif terhadap perlakuan tertentu. (LIPI,
2009).

Data urutan DNA hasil sekuenting yang didapatkan deri lab basah dengan
nama “28092017.Fasta” akan diproses menggunakan program online Blast untuk
mengetahui seberapa banyak jenis organisme yang memiliki kemiripan urutan
DNA nya, serta mengetahui jenis organisme apa yang ada pada sampel.

Selanjutnya membuka gen bank yang dioperasikan oleh NCBI (National


Center for Biotechnology Information) yang berisi informasi dari sekuen DNA
yang sama dengan sekuen DNA dalam EMBL (European Molecular Biology
Laboratory) dan DOB (DNA Bank of Japan). NCBI ini merupakan situs
informasi database DNA, RNA dan protein. (Fachriah, 2003).

Data yang telah didapat akan disimpan dengan cara memilih “select all”
pada bagian Sequences producing significant alignments kemudian di download.
File yang didownload akan bernama seqdump dan berekstensi .txt. Data yang
didapatkan dibuka dengan Notepad ++ dan di save as dengan ekstensi .Fasta.

Banyaknya data yang muncul menunjukkan banyaknya kemiripan urutan


DNA pada suatu organisme sampel. Presentase yang muncul menandakan
seberapa dekat urutan DNA sampel dengan DNA organisme yang telah ada
(alignment). Semakin besar presentase yang dihasilkan, maka semakin tinggi
kemiripan urutan DNA sampe terhadap urutan DNA organisme yang telah ada

3
(alignment). Kemiripan suatu sampel DNA berkisar antara 100% - 97%.
Sedangkan presentase dibawah 97% biasanya adalah DNA organisme baru.

Data yang telah didapat kemudian diubah ke bahasa pemrograman, dalam


bentuk .Fasta agar dapat diproses membentuk pohon filogeni yang menunjukkan
kekerabatan dar sampel dengan organisme lainnya. Program yang digunakan ada
dua yaitu bioedit dan MEGA.

6.1 Hasil DNA dengan Software Bioedit

Percobaaninibertujuanuntukmengetahuikekerabatansampelbakteridenganb
akteri-bakteripembandingnya.Bioeditadalah software untukmengolahsekuens
DNA.Dari hasilpercobaandiperolehhasilberupasekuans DNA
daribakteri.Padahasiltersebutterdapatwarnahitam yang
menunjukkankesamaanbasa nitrogen.Semakinbanyakkesamaannya,
makasemakindekathubungankekerabatannya. Dari hasil software
bioedittersebutdiketahuibahwabahwasampelpadapercobaaninimemilikiurutanbasa
nukleotida yang miripdenganPseudomonas hussainii.
Sehinggadapatdikatakanbahwasampelpadapercobaanbioinformatikainimemilikike
kerabatandenganPseudomonas hussainii.Urutanbasanukleotidasampel yang
menjadikarakterkhas (yang dilingkarinsamasepertisampel yang istimewa).
Sehinggadapatdiperolehkarakterkhasatausampel yang
istimewadenganurutanbasanukleotida yang
berbedadariurutanbasanukleotidasekuens database NICB.

Dari hasil software bioedittersebutdiketahuibahwa DNA


BakterimemilikikemiripandenganNR 134139.1 Pseudomonas hussainii strain CC-
AMH-, ditunjukkandalambeberapahal, misalnyataksonomi (family)
danbentuktubuh. (Romadhon,2016).

4
5
Dari hasilpercobaandiperolehhasilberupasekuans DNA
daribakteri.Padahasiltersebutterdapattandakuningyang
menunjukkankesamaanbasa nitrogen.Semakinbanyakkesamaannya,
makasemakindekathubungankekerabatannya.

6.2 Filogenidenganmega 6.0

Percobaaninibertujuanuntukmengetahuikekerabatansuatuorganismemelalui
sejarahevolusinya.Berdasarkanhasilanalisisfilogenidenganmetode“Bootstrap
method”.Analisis bootstrap adalahmetode yang mengujiseberapabaik set data
model.
Sebagaicontohvaliditaspenyusunancabangdalamprediksipohonfilogenetikdapatdiu
jidengan resampled darikolomdalam multiple sequence alignment
untukmembentukbeberapapenjejeranbaru.
Penampakancabangdalampohondarisekuen resampled inidapatdiukur.
Alternatifnya,
sekuenkemungkinanharusdikeluarkandarianalisisuntukmenentukanberapabanyaks
ekuen yang mempengaruhihasildarianalisis. Bootstrap analysis
didukungolehsebagianbesarpaket software mengujicabang-cabang yang
dapatdipercaya. Semakinbesarnilaicabangberartisemakinbesar pula
perbedaanwaktuhidupnya.

berdasarkan kemiripan dan perbedaan karakteristik fisik dan/atau


genetikanya (Brinkman,2001). Dari
pohonfilogeniakandidaptkanhasilberupakemiripansampeldenganbakteriatau
archaea yang memilikikemiripandengannilai 100 yang disebutnilaiboothstrap.
Dimanasemakintingginilaiboothstrapmakasemakintingginilikemiripannya.Jikanila
i<70 dapatdiakatakanbahwakemiripannyajauhdansebaliknyajikanilai>70
dapatdikatakanbahwakekerabatannyadekat(Thiru. P, 2003)

6
6.2.1 Metode unweighted pair groupdengan rata-rata aritmatika
(UPGMA)
Metode UPGMA merupakanmetodetertuadanpertama kali
digunakandalamrekonstruksipohonfilogeni.Konsepnyaadalahindeks p-distance
terkecilantarpasanganorganismeakandigunakanuntukmenggabungkankeduaorgani
smetersebutdalam 1 kelompokfilogenetik (disebut juga "clade").Konsepmetode
MP didasarkanpadaevolusi yang berjalanefisien,
sehinggaapabilaadasejumlahcarauntukmenghasilkankeadaansepertisekaranginima
kacara yang paling singkatlah yang akandipilih (Baxevanis AD, 1998)

BakterimemilikikemiripandenganNR 134139.1 Pseudomonas hussainii


strain CC-AMH-.(pohonfilogenidapatdilihatpadalampiran .pdf)

Dari baganpohonfilogeni, didapatkankekerabatan paling


dekatdengansampelyaituNR 134139.1 Pseudomonas hussainii strain CC-AMH-
.Sehinggadapatdisimpulkanbahwasampelmempunyaikedekatandengan alignment
tersebut.Metodejarak yang telahdiuraikan di atasmemberikanestimasi yang
baikdarisebuahpohonevolusidantidakterpengaruholehvariasidalam rata-rata

7
perubahansepanjangcabangdaripohon.Metode UPGMA
adalahmetodesederhanauntukkonstruksipohon yang mengasumsi rata-rata
perubahansepanjangpohonadalahkonstandanjaraknyakira-
kiraultrametric(ultrametricbiasanyadiekspresikansebagaimolecular clok tree).
Metode UPGMA dimulaidengankalkulasipanjangcabangdiantarasekuen paling
dekat yang salingberhubungan, kemudian rata-rata
jarakantarasekueniniataukelompoksekuenberikutnyaataukelompoksekuendanberla
njutsampaisemuasekuen yang termasukdalampohon.

Padagambardiatasdimensihorizonalmemberikanjumlahperubahangenetik.
Garishorizonalmenunjukkancabangdanmewakiligarisketurunanevolusioner yang
berubahseiringwaktudankeadaan. Semakinpanjangcabangdalamdimensihorizonal,
semakinbesarjumlahperubahannya. Bar di bagianbawahgambarterdapatskala 0,5
yangmenunjukkanpanjangcabang yang mewakilijumlahperubahangenetiksebesar
0,5.
Padatiapcabang, terdapatangka yang berbeda-beda,
umumnyarentangnilaicabangtersebutsebesar 0- 1 (namun juga bisalebihdari 1) di
mana 1
menunjukkandukunganmaksimal.Nilaiinididapatkanmelaluiperhitungandenganber
bagaipendekatanstatistikseperti'bootstrap' dan'probabilitas posterior
Bayesian'.Analisis bootstrap adalahmetode yang mengujiseberapabaik set data
model.
Sebagaicontohvaliditaspenyusunancabangdalamprediksipohonfilogenetikdapatdiu
jidengan resampled darikolomdalam multiple sequence alignment
untukmembentukbeberapapenjejeranbaru.
Penampakancabangdalampohondarisekuen resampled inidapatdiukur.
Alternatifnya,
sekuenkemungkinanharusdikeluarkandarianalisisuntukmenentukanberapabanyaks
ekuen yang mempengaruhihasildarianalisis. Bootstrap analysis
didukungolehsebagianbesarpaket software mengujicabang-cabang yang
dapatdipercaya. Semakinbesarnilaicabangberartisemakinbesar pula
perbedaanwaktuhidupnya.
Panjanggarispadapohonfilogeniberbeda-beda, semakinpanjanggarispohon,
makahidupnyaakansemakinlebihmuda.
Setelahdianalisisdengan BLAST-n pada MEGA diketahuibahwa sample
28092017 memilikikemiripandenganNR 134139.1 Pseudomonas hussainii strain
CC-AMH-.

8
VII. PENUTUP

1.1 Kesimpulan

Dari sampel data


dihasilkanpohonfilogeni.Pohoninimenunjukkanhubunganevolusiantar organism (
hubungankekerabatan ), dalamhubungankekerabatan yang paling
dekatdengansampel DNA adalahNR 134139.1 Pseudomonas hussainii strain CC-
AMH-

1.2 Saran

1. Menggunakan laptop

denganspesifikasimemadaiuntukmeminimalisirkendalaketikarunning.

(Minimal RAM 2 GB, Processor 2 GHz, 64 bit)

2. Bakteri yang disekuenslebihbanyaksupayadapatditemukan species


yang memilikikemiripantinggidengansampel

3. Pastikanterhubungdengan internet

4. Menggunakanmetode-metode lain dalamsekuens DNA


untukdapatmembandingkanhasilnya.

9
DAFTAR PUSTAKA

Anonim, 2011, Prinsip Genomik untuk Programming Bioinformatika, dalam


http://teknologi.kompasiana.com, diakses pada 19 November 2011
Aprijossi,D.Adan Elpaizi,M.A, 2004, Bioinformatika : Perkembangan Disiplin
Ilmu dan Perkembangannya di Indonesia
Campbell, 2009, Sejarah Kehidupan di Bumi,dalam Mekanisme Teori Evolusi II
Nusantara, 2009, Internet untuk Biologi Molekuler, Waria Biotek Vol.14 No.2
Juni
Razia, M, 2011, 16-S rDNA Based Phylogeny of Non-Symbiotit Bacteria of
Entomopanthogenic Nematodes from Infected Insect Cadavers, Genomic
Proteomic & Bioinformatics 9(3) : 104-112
Utama,A,2003, Peran Bionformatika dalam Dunia Kedokteran, Artikel Populer
Ilmu Komputer di akses melalui hhtp://www.ilmukomputer.com pada 19
november 2012

10
LEMBAR PENGESAHAN

Mengetahui, Semarang, 25Oktober 2017

Asisten Praktikan

Nurrizka Kurniawati Sri Ningsih


24030114140121 24030115120041

11
PRETEST

12
BIOINFORMATIKA

LAPORAN PRAKTIKUM BIOKIMIA

Disusun oleh :

Ratna Kurniawati

Asisten:

Nurrizka Kurniawati 24030113140121

Ummi Laili Rochmawati 24030113130124

DEPARTEMEN KIMIA

FAKULTAS SAINS DAN MATEMATIKA

UNIVERSITAS DIPONEGORO

SEMARANG

2017

VI. PEMBAHASAN

13
Percobaan ini berjudul “Bioinformatika (Kostruksi Pohon Filogeni)” yang
bertujuanuntuk mengetahui dan menunjukkan hubungan kekerabatan antar
organisme (evolusi antar organisme) melalui konstruksi pohon filogeni yang
ditunjukkan dengan kemiripan sifat sampel yang dimiliki kerabat terdekat karena
sejenis. Prinsip dari percobaan ini adalah pemberian input berupa urutan
nukleotida dan penerjemahan kode-kode genetik yang berfungsi untuk
mengetahui susunan asam-asam amino dalam sekuen. Metode yang digunakan
adalah metode Basic Local Aligment (Metode Blast) yang merupakan salah satu
metode aligment yang sering digunakan dalam penelusuran basis data
sekuens(Fatchiah,2009). Metode ini digunakan untuk mengidentifikasi spesies
berdasarkan urutan pencarian homolog yang diasumsikan secara orthologis
dengan Clustawl (Vardivalagan,2012). Beberapa jenis program yang dipakai pada
percobaan ini adalah web browser (Chrome), notepad++, bioedit, dan MEGA 6
atau7, Bioedit, dan Blast. Penelusuran blast pada data sekuens difungsikan untuk
mencari sekuens yang baik dari asam nukleat, DNA maupun protein yang mirip
dengan sekuen tertentu yang ada pada sampel yang kita miliki, karena hal ini
sangat berguna untuk memeriksa keabsahan hasil sekuens atau memeriksa fungsi
gen hasil sekuensnya. Algoritma yang mendasari blast adalah penyejajaran
sekuens (Kuncoro,2011). Penyejajaran sekuens (Sequence Alignment) merupakan
proses penyusunan atau pengaturan dua atau lebih sequens, sehingga proses
persamaan sekuens-sekuens tersebut tampak nyata (Krane V.E, 2009). Sekuens
itu sendiri merupakan sederetan pernyataan-pernyataan yang urut dan pelaksanaan
eksekusinya runtut, yang terlebih dahulu terbaca(ditemukan) akan dikerjakan
(dieksekusi) terlebih dahulu. Apabila urutan tersebut pernyataannya dibalik,
maknanya akan berbeda(Kuncoro,2011).
Penyejajaran sekuen (Sequence Alignment) adalah proses penyusunan
atau pengaturan dua atau lebih sekuens, sehingga proses persamaan sekuen-
sekuen tersebut tampak nyata (Krane,V.E, 2009). Sedangkan sekuen itu sendiri
adalah sederatan pernyataan-pernyataan yang uruta dan pelaksanaan eksekusinya
runtut, yang lebih dahulu ditemukan (dibaca) akan dikerjakan (dieksekusi)

14
terlebih dahulu, dan apabila urutan tersebut pernyataannya dibalik, maka
maknanya akan berbeda (Kuncoro, 2011)
Bioinformatika merupakan salah satu aplikasi dari alat komputasi dan
analisis untuk menangkap dan menginterpretasikan data-data biologi dalam
software dan didukung dengan kesediaan internet (Utama,2012). Bioinformatika
sebagai salah satu disipln ilmu memiliki banyak fungsi, diantara salah satu fungsi
bioinformatika ini adalah, jika suatu ketika ada satu sekuens DNA yang belum
diketahui fungsinya,maka untuk memperkirakan fungsinya dapat dengan
membandingkan satu sekuens tadi dengan data yang ada dalam database, sehngga
dapat diketahui kualitas dan kuantitas transkripsi suatu gen dalam menunjukkan
gengen apa saja yang aktif terhadap perlakuan tertentu (LIPI,2009). Dari
program-program yang dipakai dalam bioinformatika ini akan didapatkan pohon
filogeni.filogeni itu sendiri merupakan sejarah evolusi dari suatu kelompok
spesies. Data yang digunakan untuk menyusun sistematika filogeni ini berupa data
fosil, molekul maupun data gen untuk membangun hubungan kekerabatan anatar
organisme (Campbell,et all,2009). Hubungan kekerabatan antar spesies ini dapat
diidentifikasi dari jenis gen, urutan sekuens, panjang bp, jarak maksimum dan
jarak individu (Vardivalagan,2012).
Program pertama yang digunakan adalah NCBI dimana program ini bisa
diakses melalui Chrome maupun Mozilla. NCBI (National Center for
Biotechnology Information) merupakan gen bank yang berisi situs informasi dari
database sekuens DNA, RNA maupun protein(Fachriah,2003). Merupakan
database yang tetap atau definitif di Amerika Serikat. NCBI membuat database
yang dapat diakses secara umum, mengembangkan alat bantu software untuk
menganalisis data genom yang menyebabkan informasi biomedik yang semuanya
untuk pemahaman lebih baik terhadap proses molekuler yang berdampak pada
kesehatan dan penyakit manusia. Urutan DNA pertama kali diproses
menggunakan program online Blast untuk mengetahui seberapa banyak kemiripan
urutan DNA pada suatu jenis organisme, dan juga untuk mengetahui jenis
organisme apa yang terdapat dalam sampel yang telah diberikan asisten.

15
Hasil dari bioedit :
1. Terdapat perbedaan urutan nukleotida pada basa ke-834 dan 835, yaitu
pada basa ke-834 sampel yang dianalisis, sekuens Pseudomonas
aerugi, dan Pseudomonas benzen merupakan basa guanin, namun pada
28 sekuens yang lain merupakan alanin, sedangkan pada basa ke-835
sampel yang dianalisis, sekuens Pseudomonas aerugi, dan
Pseudomonas benzen merupakan basa sitosin, namun pada 28 sekuens
yang lain merupakan alaninin dan timin, sehingga dimungkinkan/
diprediksikan sampel yang dianalisis mempunyai kekerabatan dekat
dengan Pseudomonas aerugi, dan Pseudomonas benzen.

2. Terdapat perbedaan urutan basa nukleotida pada basa ke 160-165,


yaitu pada basa ke-160-165 sampel yang dianalisis, sekuens
Pseudomonas aerugi, dan Pseudomonas benzen merupakan urutan
basa guanin, guanin, sitosin, dan timin, namun pada 28 sekuens yang
lain merupakan dalam bentuk urutan basa guanin, alani, alanin dan
timin, sehingga dimungkinkan/ diprediksikan sampel yang dianalisis
mempunyai kekerabatan dekat dengan Pseudomonas aerugi, dan
Pseudomonas benzen.

Konstruksi pohon filogenetik adalah hal yang terpenting dan menarik


dalam studi evolusi. Terdapat beberapa metode untuk mengkonstruksi pohon
filogenetik dari data molekuler (nukleotida atau asam amino) (Saitou dkk,1989).
Analisis filogenetik dari kekerabatan sekuen nukleotida atau asam amino adalah

16
analisis untuk menentukan bagaimana kekerabatan tersebut diturunkan selama
proses evolusi. Hubungan evolusi diantara sekuen digambarkan dengan
menempatkan sekuen sebagai cabang luar dari sebuah pohon. Hubungan cabang
pada bagian dalam pohon merefleksikan tingkat dimana sekuen yang berbeda
saling berhubungan. Dua sekuen yang sangat mirip akan terletak sebagai
neighboring outside dari cabang-cabang dan berhubungan dalam cabang umum
(Common branch) (Mount,2001). Filogenetik digambarkan sebagai klasifikasi
secara taksonomi dari organisme berdasarkan pada sejarah evolusi
mereka(filogeni) dan merupakan bagian integral dari ilmu pengetahuan yang
sistematik dan mempunyai tujuan untuk menentukan filogeni dari organisme
berdasarkan pada karakteristik. Lebih lanjut filogenetik adalah pusat dari evolusi
biologi seperti penyingkatan keseluruhan paradigma dari bagaimana organisme
hidup dan berkembang di alam (Mount,2001).
Selain itu, dalam filogenetik dapat menganalisis perubahan yang terjadi
dalam evolusi organisme yang berbeda. Berdasarkan analisis, sekuen yang
mempunyai kekerabatan yang dekat dapat diidentifikasi dengan menempati
cabang yang bertetangga/berdekatan pada pohon. Ketika kekerabatan gen
ditemukan dalam organisme atau kelompok organisme, hubungan filogenetik
diantara gen dapat memprediksikan kemungkinan mempunyai fungsi yang
ekuivalen. Prediksi fungsi ini dapat diuji dengan eksperimen genetik. Analisis
filogenetika juga digunakan untuk mengikuti perubahan yang terjadi secara cepat
yang mampu mengubah suatu spesies, seperti virus (Kreitman dkk,1991).
Dalam mengkonstruksi pohon filogenetika dapat diklasifikasikan menjadi
2 jenis yang digunakan sebagai strategi untuk menghasilkan pohon filogenetik
terbaik. Jenis pertama adalah memeriksa semua atau sejumlah besar kemungkinan
pohon filogenetika dan memilih satu yang terbaik dengan jenis-jenis tertentu.
Biasanya disebut dengan metode exhaustive search. Metode maximum parsimony,
Fitch Margoliash dan maximum likehood termasuk dalam jenis metode ini. Jenis
yang kedua adalah memeriksa hubungan topologi lokal dari pohon dan
mengkonstruksi pohon terbaik dengan langkah demi langkah. Metode Neighbor-
joining dan beberapa metode Distance lainnya termasuk dalam jenis yang kedua

17
ini (Saitou, 1989). Pada percobaan yang dilakukan hanya dibahas tiga metode
saja yaitu: (1) Maximum parsimony(minimum evolution)(2) Distance(salah satu
jenisnya adalah metode Neighbor-joining) dan (3) Maximum likehoood yang
secara umum digunakan untuk membentuk pohon evolusi atau pohon terbaik
untuk mengamati variasi sekuen dalam kelompok (Mount, 2001).
4.1 Metode Test Maximum Likehood Tree
Metode ini menggunakan perhitungan probabilitas kombinasi seluruh
character state ancestral yang dapat memberikan bentukan character state seperti
pada sequence alignment yang dimiliki saat ini untuk seluruh situs pada setiap
OTU. Metode MP dalam hal ini dapat dipandang sebagai pendekatan heuristik
terhadap metode ML karena hanya menggunakan kombinasi character state yang
memberikan jumlah substitusi minimum untuk menghasilkan character state
sequence yang ada pada saat ini. Prinsip dari metode ini adalah bahwa perubahan-
perubahan diantara semua basa nukleotida adalah sebanding. Masalah serius dari
metode ini adalah waktu perhitungan yang lama, walaupun telah dikembangkan
algoritma baru yang dianggap dapat mempercepat proses perhitungan.
Maximum Likelihood merupakan metode statistik berbasis karakter yang
membandingkan seluruh sekuens dalam penyejajaran untuk memperhitungkan
nilai kemungkinan pada setiap pohon (Yang dan Rannala, 2012). Metode ini
mempertimbangkan semua kemungkinan jumlah perubahan/mutasi pada sekuens
untuk setiap pohon, oleh sebab itu cocok dalam mengkonstruksi filogeni dengan
sekuens berjumlah kecil. Digunakan tes filogeni berupa metode bootstrapyang
melakukan resampling berulang kali untuk melihat tingkat validitas susunan
pohon, dengan jumlah replikasi sebanyak 500x agar mempersingkat waktu
konstruksi (Dharmayanti, 2011). Pohon filogenetik yang diperoleh menunjukkan
dekatnya kekerabatan antar bakteri Pseudomonas. Azotobacter tropicalismemiliki
kekerabatan terjauh karena merupakan outgroupdalam filogeni. Terlihat pola yang
sangat jelas di mana sampel bakteri Kelompok 1 Pagi Biobrain14 membentuk
grup monofiletik dengan Pseudomonas putida strain HR5,1. Nilai
bootstrapmenunjukkan angka sebesar 98%, mengindikasikan reliabilitas

18
kekerabatan yang sangat dekat antar kedua bakteri tersebut yang berasal dari
nenek moyang yang sama.

Pada metodeMaximum Likehood ini pada bagan pohon filogeninya


diketahui terdapat 1 kekerabatan yang paling dekat dengan sampel yaitu
Pseudomonas hussainii strain CC-AMH-11, yang mana sampel mempunyai
kedekatan/kekerabatan dengan alignment tersebut.
Bentuk dan sifat dari bakteri tersebut yaitu sebagai berikut:

Sifat sifat dan karakteristiknya:


Bakteri Pseudomonas sendiri memiliki karakteristik seperti, gram negatif,
berbentuk batang (rods) atau kokus (coccus), aerob obligat, motil mempunyai

19
flagel polar. Bakteri ini, oksidase positif, katalase positif, nonfermenter dan
tumbuh dengan baik pada suhu 4oC atau dibawah 43oC. Pseudomonas banyak
ditemukan pada tanah, tanaman dan air.
Berbentuk batang dengan ukuran sekitar 0,6 x 2 μm. Bakteri ini terlihat
sebagai bakteri tunggal, berpasangan, dan terkadang membentuk rantai yang
pendek. P. aeruginosa termasuk bakteri gram negatif. Bakteri ini bersifat aerob,
katalase positif, oksidase positif, tidak mampu memfermentasi tetapi dapat
mengoksidasi glukosa/karbohidrat lain, tidak berspora, tidak mempunyai selubung
(sheat) dan mempunyai flagel monotrika (flagel tunggal pada kutub) sehingga
selalu bergerak.
Bakteri ini dapat tumbuh di air suling dan akan tumbuh dengan baik
dengan adanya unsur N dan C. Suhu optimum untuk pertumbuhan P. aeruginosa
adalah 42o C. P. aeruginosa mudah tumbuh pada berbagai media pembiakan
karena kebutuhan nutrisinya sangat sederhana. Di laboratorium, medium paling
sederhana untuk pertumbuhannya digunakan asetat (untuk karbon) dan
ammonium sulfat (untuk nitrogen).
Bakteri ini resisten terhadap konsentrasi tinggi garam dan zat pewarna,
antiseptik, dan banyak antibodi yang sering digunakan. Suatu studi intensif
menyatakan bakteri ini mempunyai gen untuk resistensi terhadap merkuri, disebut
gen mer yang berada dalam plasmid.
Kemampuan bakteri ini menyerang jaringan bergantung pada
reproduksi enzim-enzim dan toksin-toksin, yang merusak barier tubuh dan sel-sel
inang. P. aeruginosa seperti yang dihasilkan bakteri Gram-negatif lain, misalnya
endotoksin menyebabkan gejala sepsis dan syok septik, eksotoksin A
menyebabkan nekrosis jaringan, enzim-enzim ekstra seluler bersifat histotoksik
dan mempermudah infasi kedalam pembuluh darah

20
VII. PENUTUP
7.1 Kesimpulan
7.1.1 Dari percobaan Bioinformatika ini dapat diketahui hubungan
kekerabatan antar organisme (evolusi antar organisme) melalui
konstruksi pohon filogeni yang ditunjukkan dengan kemiripan sifat
sampel yang dimiliki kerabat terdekat karena sejenis.
7.1.2 Konstruksi pohon filogeni dapat ditentukan dengan beberapa
metode tertentu, contohnya yaitu metode Maksimum Likehood.
7.1.3 Dari bagan maksimum likehood yang didapatkan bisa diketahui
hubungan kekerabatan antar organisme. Dimana dari metode ini
sampel yang dipunya memiliki kekerabatan dengan Pseudomonas
hussainii strain CC-AMH-11, yang artinya Pseudomonas hussainii
strain CC-AMH-11 memiliki kekerabatan/kedekatan karena satu
nenek moyang dengan sampel.

7.2 Saran
7.1.1 Tutupaplikasi yang tidakdigunakan agar laptop bekerja optimal
7.1.2 Sering merefresh komputer agar pemrosesan tidak berlangsung
lama

21
DAFTAR PUSTAKA

Campbell, 2009, Sejarah Kehidupan di Bumi,dalam Mekanisme Teori Evolusi II

Mashaghi, A., & Katan, A. (2013). A physicist’s view of DNA. Retrieved from
http://arxiv.org/abs/1311.2545
MCDONALD, J.H and M. KREITMAN. 1991. Adaptive protein evolution at the
Adh locus in Drosophila. Nature. 351: 652 – 654
MOUNT, D.W. 2001. Phylogenetic prediction. In: Bioinformatic, Sequence and
Genome Analysis. Cold Spring Harbor laboratory. New York Press pp. 237 –
280
Williamson DI (2003-12-31). "xviii". The Origins of Larvae (2nd ed.). Springer.
p. 261. ISBN 978-1402-01514-4.
Zhang, L., Wang, B., Pan, L., & Peng, J. (2013). Recycling Isolation of Plant
DNA, A Novel Method. Journal of Genetics and Genomics, 40(1), 45–54.
https://doi.org/10.1016/j.jgg.2012.10.001
Utama,A,2003, Peran Bionformatika dalam Dunia Kedokteran, Artikel Populer
Ilmu Komputer di akses melalui hhtp://www.ilmukomputer.com pada 19
november 2012
NIELSEN, R. and Z. YANG. 1998. Likehood models for detecting positively
selected amino acid sites and application to the HIV-1 envelope gene.
Genetics. 148: 929 – 936
SAITOU, N. and M. MEI. 1987. The neighbor-joining method: A new method for
constructing phylogenetic trees. Mol. Biol. Evol. 4: 406 – 425.
SAITOU, N. and T. IMANISHI. 1989. Relative efficiencies of the Fitch-
Margoliash, Maximum-Parsimony, MaximumLikehood, Minimum Evolution
amd Neighbor-joining Methods of phylogenetic tree construction in
obtaining the correct tree. Mol. Biol. Evol. 6(5): 514 – 525.
SCHADT, E.E., J.S. SINSHEIMER and K. LANGE. 1998. Computational
advances in maximum likehood methods for molecular phylogeny. Genome
Res. 8: 222 – 233.

22
23
HALAMAN PENGESAHAN
Laporan Praktikum Biokimia

Judul Praktikum :Bioinformatika


Nama : Ratna Kurniawati
NIM : 24030115120036

Semarang, 25Oktober 2017

Mahasiswa Praktikum,

Ratna Kurniawati
24030115120036

Mengetahui,
Asisten Praktikum

Nurizka Kurniawati Ummi Lailli Rochmawati


2403013140121 24030113130124

24
LAMPIRAN
1. Hasil Bioedit

25
26
27
28
2. Pretest

29
BIOINFORMATIKA

LAPORAN PRAKTIKUM BIOKIMIA

Disusun oleh :

Yasintha Rennidya Hapsari 24030115130088

Asisten:

Nurrizka Kurniawati 24030113140121

Ummi Laili Rochmawati 24030113130124

DEPARTEMEN KIMIA

FAKULTAS SAINS DAN MATEMATIKA

UNIVERSITAS DIPONEGORO

SEMARANG

2017

30
HALAMAN PENGESAHAN
Laporan Praktikum Biokimia

Judul Praktikum : BIOINFORMATIKA (Konstruksi Pohon Filogeni)


Nama : Yasintha Rennidya Hapsari
NIM : 24030115130088

Semarang, 24 November 2017


Mengetahui,
Asisten I Asisten II Praktikan

Nurrizka Kurniawati Ummi Laili Rochmawati Yasintha Rennidya


Hapsari
24030113140121 24030113130124 24030115130088

31
V. PEMBAHASAN

Percobaan ini berjudul “Bioinformatika (Kostruksi Pohon Filogeni)” bertujuan


untuk mengetahui fungsi dari filogeni, yaitu dapat menunjukkan hubungan evolusi
antar organisme (hubungan kekerabatan), dimana sampel memiliki sifat yang
mirip dengan kerabat terdekat karena sejenis. Prinsip dari percobaan ini adalah
memberikan input berupa yang urutan nukleotida dan penerjemahan kode-kode
genetik, yang berfungsi untuk mengetahui susunan asam-asam amino dalam
sekuen. Metode yang digunakan adalah metode Blast (Basic Local Aligment),
yaitu salah satu metode aligment yang sering digunakan dalam penelusuran basis
data sekuens (Fatchiah, 2009). Metode blast ini digunakan untuk mengidentifikasi
spesies berdasarkan urutan pencarian homolog, yang diasumsikan secara
orthologis dengan clustawl (Vardivalagan, 2012).Program-program yang
digunakan dalam percobaan ini adalah NCBI, Blast. Fungsi penelusuran blast
pada data sekuens adalah mencari sekuens yang baik dari asam nukleat, DNA
maupun protein yang mirip dengan sekuens tertentu yang ada pada sampel. Hal
ini berguna untuk memeriksa keabsahan hasil sekuens atau untuk memeriksa
fungsi gen hasil sekuennya. Algoritma yang mendasari blast adalah penyejajaran
sekuens (Kuncoro, 2011).
Sequence alignment (urutan keselarasan) adalah cara untuk mengatur urutan
DNA, RNA, atau protein untuk mengidentifikasi daerah dengan kesamaan yang
mungkin merupakan konsekuensi dari hubungan fungsional, struktural, atau
evolusioner antara sequence. Sekuens urutan residu nukleotida atau asam amino
biasanya ditunjukkan sebagai baris dalam matriks. Jarak dimasukkan di antara
residu sehingga karakter identik atau serupa diselaraskan dalam kolom berturut-
turut. Sequence alignments juga digunakan untuk urutan non-biologis, seperti
menghitung data keuangan (Mount DM, 2004).

Analisis sekuen merupakan suatu teknik yang dianggap paling baik untuk
melihat keanekaragaman hayati suatu kelompok organisme. Teknik ini
berkembang setelah orang menciptakan mesin DNA sequencer. Pada prinsipnya
polimorfisme dilihat dari urutan atau sekuen DNA dari fragmen tertentu dari suatu

32
genom organisme. Untuk melihat keanekaragaman jenis dapat dilakukan melalui
analisis sekuen gen 16S-rRNA bagi organisme prokaryota atau 18S-rRNA bagi
organisme eukaryota. Perbandingan sekuen rRNA merupakan alat yang baik
untuk mendeduksi hubungan filogeni dan evolusi di antara organisme bacteria,
archaebacteria, dan eukaryot (Weisburg et al., 1991).

Database dari sekuen data dapat digunakan untuk mengidentifikasi


homolog pada sampel yang telah disekuenkan. Pencarian database didasarkan
pada hasil alignment sekuen DNA maupun protein. Dengan membandingkan
suatu sekuen DNA/protein sampeldengan yang ada dalam database, maka bisa
diperkirakan fungsi daripadanya. Salah satu perangkat lunak pencari database
adalah BLAST (Basic Local Alignment Search Tool). Program BLAST juga dapat
digunakan untuk mendeteksi hubungan di antara sekuen yang hanya berbagi
daerah tertentu yang memiliki kesamaan (Aprijani dan Elfaizi, 2004).

Dari program-program yang dipakai akan dihasilkan pohon filogeni.


Filogeni merupakan sejarah evolusi dari kelompok spesies. Untuk menyusun
filogeni, para ahli Biologis menggunakan sistematika yaitu disiplin ilmu yang
terfokus pada klaifikasi organisme dan hubugan evolusinya. Data yang digunakan
dalam sistematika untuk menyusun filogeni dapat berupa data fosil, molekul,
maupun data gen untuk membangun hubungan evolusi antar organisme
(hubungan kekerabatan). (Campbell,et all, 2009). Selain itu, definisi lain dari
Bioinformatika adalah bidang yang mengembangkan metode dan perangkat lunak
untuk memahami data biologis. Ilmu, bioinformatika menggabungkan ilmu
komputer, statistik, matematika, dan teknik untuk menganalisis dan menafsirkan
data biologis.

Bioinformatika adalah istilah umum untuk tubuh studi biologi yang


menggunakan pemrograman komputer sebagai bagian dari metodologi mereka,
serta referensi untuk analisis spesifik "pipeline" yang berulang kali digunakan,
terutama di bidang genomik. Penggunaan bioinformatika yang umum mencakup
identifikasi gen kandidat dan polimorfisme nukleotida tunggal (SNP). Seringkali,
identifikasi semacam itu dilakukan dengan tujuan untuk lebih memahami basis

33
genetik penyakit, adaptasi unik, sifat yang diinginkan (terutama spesies
pertanian), atau perbedaan antara populasi. Dengan cara yang kurang formal,
bioinformatika juga mencoba memahami prinsip-prinsip organisasional dalam
rangkaian asam dan nukleat, yang disebut proteomic.

Bioinformatika telah menjadi bagian penting dari banyak bidang biologi.


Dalam biologi molekular eksperimental, teknik bioinformatika seperti pengolahan
citra dan sinyal memungkinkan ekstraksi hasil yang bermanfaat dari sejumlah
besar data mentah. Di bidang genetika dan genomik, ia membantu dalam
sequencing dan anotasi genom dan mutasi yang mereka amati. Ini memainkan
peran dalam pembedahan teks literatur biologi, pengembangan ontologi biologis
dan gen untuk mengatur dan mengajukan permintaan data biologis. Ini juga
berperan dalam analisis ekspresi dan regulasi gen dan protein. Perangkat
bioinformatika membantu perbandingan data genetik dan genomik dan lebih
umum lagi dalam memahami aspek evolusi biologi molekular. Pada tingkat yang
lebih integratif, ini membantu menganalisis dan memberi katalog jalur biologis
dan jaringan yang merupakan bagian penting dari biologi sistem. Dalam biologi
struktural, ia membantu dalam simulasi dan pemodelan DNA, RNA, protein serta
interaksi biomolekuler (Wong K C, 2016).

5.1 Menentukan Sifat Karakteristik Sampel Yang Berbeda Dari Database

Pada percobaan ini dilakukan dengan membuka program notepad ++ yang


berfungsi untuk menduplikat data DNA hasil sequency kemudian menyimpan
dalam format FASTA. Notepad++ bisa mengenal tag dan kode dalam berbagai
bahasa pemrograman, seperti sekuens DNA atau protein. Database sekuen didapat
dari NCBI menggunakan Nucleotide BLAST. NCBI (National Centre for
Biotechnology Information) merupakan institusi yang menyediakan sumber
informasi terkait perkembangan biologi molekuler. NCBI membuat database
yang dapat diakses oleh publik dan mengembangkan software penganalisis data
genom. Nucleotide BLAST bekerja dengan membandingkan suatu sekuen
nukleotida sampel dengan database sekuen nukleotida. Setelah proses BLAST
selesai, didapatkan 100 sekuens (diambil 25 sekuens saja) dari database dan

34
dibandingkan dengan sekuens dari sampel. Database sekuens yang telah didapat
dari NCBI kemudian dibuka menggunakan software bioedit. Bioedit adalah
software untuk mengolah sekuens DNA. Dari hasil dapat diketahui bahwa sampel
pada percobaan ini memiliki urutan basa nukleotida yang mirip dengan
Pseudomonas hussainii. Sehingga dapat dikatakan bahwa sampel pada percobaan
bioinformatika ini memiliki kekerabatan dengan Pseudomonas hussainii. Fungsi
dari bioedit yaitu menunjukkan banyaknya kemiripan urutan DNA pada suatu
organisme sampel , sebagai software untuk mengolah sekuens DNA dan bisa
untuk melakukan rekonstruksi dari pohon filogenetik.

5.2. Menentukan kekerabatan dengan metode Maximum Parsimony

Metode ini memprediksikan pohon evolusi/evolutionary tree yang


meminimalkan jumlah langkah yang dibutuhkan untuk menghasilkan variasi yang
diamati dalam sekuen. Untuk alasan ini, metode ini juga sering disebut sebagai
metode evolusi minimum/minimum evolution method. Sebuah multiple sequence
alignment dibutuhkan untuk memprediksi posisi sekuen yang sepertinya
berhubungan. Posisi ini akan menampilkan kolom vertikal dalam multiple
sequence alignment. Untuk masing-masing posisi yang disejajarkan, pohon
filogenetika membutuhkan perubahan evolusi dalam jumlah terkecil untuk
menghasilkan pengamatan perubahan sekuen yang diidentifikasi. Analisis ini
terus menerus dilakukan terhadap masing-masing posisi dalam penjejeran sekuen.
Akhirnya, pohon yang menghasilkan jumlah perubahan terkecil secara
keseluruhan dihasilkan untuk semua posisi sekuen yang diidentifikasi. Metode ini
berguna untuk sekuen yang mirip dan dalam jumlah yang sedikit. Alogaritma
yang digunakan tidak rumit tetapi dijamin untuk dapat menemukan pohon yang
terbaik, sebab semua kemungkinan pohon yang dibentuk berhubungan dengan
kelompok sekuen yang diperiksa. Untuk alasan ini, metode ini cukup
membutuhkan banyak waktu dan tidak berguna untuk data sekuen dalam jumlah
besar dan asumsi lain harus dibuat untuk root pohon yang diprediksikan.
Sedangkan metode bootstrap adalah metode yang menguji seberapa baik set data
model. Sebagai contoh validitas penyusunan cabang dalam prediksi pohon

35
filogenetik dapat diuji dengan resampled dari kolom dalam multiple sequence
alignment untuk membentuk beberapa penjejeran baru. Penampakan cabang
dalam pohon dari sekuen resampled ini dapat diukur. Alternatifnya, sekuen
kemungkinan harus dikeluarkan dari analisis untuk menentukan berapa banyak
sekuen yang mempengaruhi hasil dari analisis.

Hasil yang didapatkan kemudian akan disimpan dalam format FASTA.


FASTA adalah paket perangkat lunak penjajaran rangkaian protein dan DNA.
Sebenarnya perangkat lunak ini di rancang untuk mencari kemiripan rangkaian
protein. Perangkat lunak ini memiliki berkas ekstensi seperti .fas, atau .fasta.
Dapat dilihat dengan program penampil DNA seperti MEGA 7.0. MEGA adalah
aplikasi yang digunakan untuk menganalisis dan membandingkan sekuens DNA
yang homolog. Sehingga hubungan kekerabatan berdasarkan urutan basa
nukleotida dapat dideteksi. Tujuan penggunaan software MEGA adalah
memperkirakan keragaman evolusi netral dan selektif antar sekuens dan
menyimpulkan hubungan kekerabatan dari sekuens yang homolog. Terdapat 2
jenis penjajaran sekuens yaitu ClustalW dan Muscle. Keduanya memiliki hasil
yang sama namun Muscle lebih cepat daripada ClustalW. dengan rata-rata proses
penyelesaian PREFAB mencapai 49 sequense dari 240 sekuense dari setengah
waktu yang diperoleh ClustalW (Edgar, 2006).

Hasil yang diperoleh menunjukkan bahwa bakteri nilai bootstrap 100%


dimana memiliki kekerabatan dengan bakteri Pseudomonas hussainii strain CC-
AMH-11 16S ribosomal RNA. Sehingga dapat dikatan sampel pada percobaan ini
mempunyai hubungan kekerabatan dengan Pseudomonas hussainii. Namun,
kekerabatan sampel dengan Pseudomonas hussainii dibedakan dari umur sampel
yang lebih muda dari pada Pseudomonas hussainii ditandai pada pohon filogeni
dimana posisi sampel diatas Pseudomonas hussainii dan posisinya menjorok
kekanan. Sehingga dapat diambil kesimpulan bahwa sampel pada percobaan ini
berkerabat dekat dengan Pseudomonas hussainii dengan umur sampel yang lebih
muda.

36
Angka yang muncul di setiap titik percabangan menunjukkan nilai bostrap.
Dalam membangun pohon filogeni seringkali menggunakan metode botstrap
untuk melihat stabilitas hasil atau untuk menduga kesalahan baku (standar error)
dan selang kepercayaan (confidence intervals). Dalam algoritma membangun
pohon filogeni, setiap unit (sampel) di-sampling ulang beberapa kali dan dihitung
ulang. Dari setiap perhitungan setelah resampling kemudian menghasilkan nilai
konsistensi. Nilai bootstrap ini dijadikan tolak ukur penentu tingkat kepercayaan
pohon. Semakin besar nilai bootstrap, maka semakin tinggi pula tingkat
kepercayaan topologi pohon hasil rekonstruksi tersebut (Hillis et al. 1996; Nei &
Kumar 2000; Hall 2001). Pada pohon filogeni yang dihasilkan, terlihat perbedaan
panjang cabang,semakin panjang cabang menunjukkan semakin banyak basa
nitrogen yang beda antar bakteri.

Bila dilihat dari urutan nukleotidanya pada rentang 10 - 80, sampel memiliki
urutan nukleotida
CTCTGTTTGTTCGCTGGCGGCAGGCCTAACACATGCAAGTCGAGCGGA
TGAAGAG

Pseudomonas hussainii merupakan bakteri hidrokarbonoklastik yang


mampu mendegradasi berbagai jenis hidrokarbon. Keberhasilan penggunaan
bakteri Pseudomonas dalam upaya bioremediasi lingkungan akibat pencemaran

37
hidrokarbon membutuhkan pemahaman tentang mekanisme interaksi antara
bakteri Pseudomonas hussainii dengan senyawa hidrokarbon. Kemampuan bakteri
Pseudomonas hussainii IA7D dalam mendegradasi hidrokarbon dan dalam
menghasilkan biosurfaktan menunjukkan bahwa isolat bakteri Pseudomonas
hussainii IA7D berpotensi untuk digunakan dalam upaya bioremediasi lingkungan
akibat pencemaran hidrokarbon. Berikut ini merupakan gambar Pseudomonas
hussainii :

Klasifikasi ilmiah :
Kerajaan : Bacteria
Filum : Proteobacteria
Kelas : Gamma Proteobacteria
Ordo : Pseudomonadales
Famili : Pseudomonadaceae
Genus : Pseudomonas

38
VI. PENUTUP

6.1 Kesimpulan

Dari sampel data dihasilkan pohon filogeni. Pohon ini


menunjukkan hubungan evolusi antar organism (hubungan
kekerabatan), dalam hubungan kekerabatan yang paling dekat dengan
sampel DNA adalah Pseudomonas hussainii strain.

6.2 Saran

- Pada saat praktikum seharusnya praktikan telah mengcopy program

- Bawalah modem dan laptop untuk memudahkan pada saat


praktikum.

39
LAMPIRAN
Urutan basa nukleotida sampel yang menjadi karakter khas. Sehingga
dapat diperoleh karakter khas atau sampel yang istimewa dengan urutan basa
nukleotida yang berbeda dari urutan basa nukleotida sekuens database NICB.

40
41
42
43
PRETEST

Metode UPGMA

Metode UPGMA adalah metode sederhana untuk konstruksi pohon yang


mengasumsikan rata-rata perubahan sepanjang pohon adalah konstan dan jaraknya
kira-kira ultrameric (ultrameric biasanya diekspresikan sebagai molecular clock
tree). Metode UPGMA dimulai dengan kalkulasi panjang cabang diantara sekuen
paling dekat yang saling berhubungan, kemudian rata-rata jarak antara sekuen ini
atau kelompok sekuen dan sekuen berikutnya atau kelompok sekuen dan berlanjut
sampai semua sekuen yang termasuk dalam pohon. Akhirnya metode ini
memprediksi posisi root dari pohon

44
LAPORAN PRAKTIKUM

PERCOBAAN VIII

BIOINFORMATIKA

Nama : Rizki Septiyani

NIM : 24030115130089

Kelompok :V

Hari/Tanggal Praktikum : Kamis, 19 Oktober 2017

Asisten : Nurrizka Kurniawati

DEPARTEMEN KIMIA

FAKULTAS SAINS DAN MATEMATIKA

UNIVERSITAS DIPONEGORO

SEMARANG

2017

VI. Pembahasan

45
Percobaan ini berjudul “Bioinformatika”, tujuan dari percobaan ini
adalah untuk mengidentifikasi sampel organisme (bakteri) dengan sejumlah spesies
bakteri dari database dan bakteri pembanding melalui konstruksi pohon filogeni yang
dapat menunjukkan hubungan evolusi antar organisme (hubungan kekerabatan),
dimana sampel memiliki sifat yang mirip dengan kerabat terdekat karena sejenis.Prinsip
percobaan ini adalah memberikan input berupa urutan nukleotida dan penerjemahan
kode-kode genetik, yang berfungsi untuk mengetahui susunan asam-asam amino dalam
sekuen.Metode yang digunakan adalah metode Blast (Basic Local Aligment), yaitu salah
satu metode aligment yang sering digunakan dalam penelusuran basis data sekuens
(Fatchiah, 2009). Metode blast ini digunakan untuk mengidentifikasi spesies
berdasarkan urutan pencarian homolog, yang diasumsikan secara orthologis dengan
ClustalW (Vardivalagan, 2012). Dalam percobaan ini dibutuhkan sebuah personal
computer (PC) yang dilengkapi dengan software aplikasi berupa web browser (Chrome),
notepad++, bioedit, dan MEGA 6 atau 7.
Dalam percobaan ini disiapkan sebuah file 19102017.txt yang berisi sequence
16S rRNA suatu bakteri dari sampel (file 19102017) yang akan kita telusuri hubungan
kekerabatannya dengan bakteri tertentu melalui pencocokan sequence sampel2
tersebut dengan beberapa sequence 16S rRNA bakteri yang di unduh (download) dari
public database online NCBI dengan membuka situsnya melalui web browser (Chrome)
dengan memasukkan alamat situs (www.ncbi.nlm.nih.gov) dan memilih menu BLAST
untuk masuk ke database lokal NCBI, dilanjutkan dengan memilih BLAST nucleotide
untuk masuk ke dalam database lokal sequnce nukleotida yang tersimpan di NCBI.
Setelah masuk ke Query Squance, squance dari sampel2 dimasukkan ke kolom enter
accession lalu memilih database 16S ribosomnal RNA (Archaea & Bacteria) karena kita
ingin mencocokan 16S ribosomnal RNA dari sampel(file 19102017) yang merupakan
suatu sampel bakteri yang ingin kita identifikasi spesiesnya.Penggunaan 16S dikarenakan
metodeberbasismolekularinidinilaicepatdanakuratdalammengidentifikasibakteripatogen
sertamemilikikeunggulandibandingkandenganmetodemikrobiologikonvensional.Gen
16SrRNAjugamemilikihypervariable region yang merupakancirikhastiapmikroorganisme.
Hypervariable region adalahdaerah DNA nuklirdan DNA
mitokondriadimanapadadaerahiniterdapatpasangannukleotidadenganurutan yang
berulang (Rinanda, 2011). Ribosomal RNA ada tiga jenis 5S, 16S, dan 23S, yang sering
digunakan adalah 16S karena memiliki urutan basa yang relatif konservatif, sedangkan
5S memiliki urutan basa terlalu pendek sehingga tidak ideal dari segi analisis statistika
dan 23S memiliki struktur sekunder dan tersier yang cukup panjang sehingga
menyulitkan analisis. Oleh karena itu 16S paling sering digunakan.
Pada gen 16S rRNAterdapat suatu daerah yang dinamakan daerah variabel dan
daerah lestari (conserved area), sebagian atau seluruh urutan basa pada daerah inilah
yang akan menjadi urutan basa yang akan disebut oleh primer gen 16S. Teknik
identifikasi spesies bakteri menggunakan analisis sekuen gen 16S rRNA ini dipilih karena
teknik ini sudah dikembangkan sejak tahun 1580-an, sehingga database nukleotida gen
16S rRNA pada bakteri sudah cukup tersedia untuk menjadi acuan identifikasi isolasi
bakteri dan studi filogenik (Williamson, 2003).
Database sequance 16S rRNA dari hasil pencarian dalam BLAST NCBI tersebut
selanjutnya diunduh dan disimpan dalam format file seqdump.txt lalu dilanjutkan
pengolahannya dengan menggunakan aplikasi software bioedit. diawali dengan

46
membuka file seqdump.txt yang berisi 100 sequences spesies bakteri yang akan
dicocokan dengan sample (file 19102017).
Software yang digunakan adalah Mega 7. Tujuan penggunaan software ini
adalah untuk pengambilan kesimpulan hubungan evolusi dari sekuens gen yang
homolog dan memperkirakan keragaman evolusi netral dan selektif diantara sekuens.
Dari hasil grafik urutan nukleotida (basa nitrogen) yang ditampilkan didapati sampel (file
19202017) memiliki kemiripan dengan spesies bakteri NR 134793.1 Pseudomonas
matsuisoli. Hal ini berarti sampel (19102017) memiliki hubungan kekerabatan yang
sangat dekat dengan Pseudomonas matsuisoli.Selain MEGA 7 juga digunakan program
bioedit. Bioedit bertujuan untuk melakukan sekuensing DNA. Sekuensing merupakan
metode yang digunakan untuk menentukan urutan nukleotida (arginin(A), sitosin(S),
guanin(G), timin(T) ) pada DNA. Hasilnya adalah sampel memiliki sekuensing yang
hampir mirip dengan bakteri jenis NR 134793.1 Pseudomonas matsuisoli.
Metode yang dipakai adalah Neighbor-JoiningTree. Tujuan dari metode ini
adalah untuk membuat konstruksi pohon filogeni. Metode ini tergolong dalam metode
distance matrix yang menggunakan logika bahwa pohon terbaik adalah pohon yang
meminimalisir nilai tree length yang merupakan penjumlahan dari total branch length.
Kondisi ini dicapai dengan konstruksi kombinasi pasangan squence dari organisme yang
memberikan nilai branch length terkecil (neighbor) diantara seluruh kombinasi yang ada.
Konsepnya adalah indeks p-distance terkecil antar pasangan organisme akan digunakan
untuk menggabungkan kedua organisme tersebut dalam 1 kelompok filogenetik (disebut
juga "clade"). Dalam prosesnya metode NJ tidak mencari satu diantara jutaan pohon
dengan nilai tree length terkecil namun lebih mengedepankan metode aditifitas
(additivity), yang mengasumsikan bahwa tree length terkecil dari suatu pohon dapat
dicapai dengan pendekatan branch length terkecil (Fiona, B. & Detlef, L., 2001). Waktu
yang diperlukan untuk proses analisisnya jauh lebih singkat jika dibandingkan dengan
metode Maximum Likelihood Tree dan metode minimum evolution. Pendekatan ini
memiliki keuntungan dari segi komputasi sehingga metode ini dapat digunakan untuk
rekonstruksi pohon filogeni dengan jumlah organisme yang banyak dan juga database
yang besar dalam waktu relatif cepat karena tidak memerlukan ruang penyimpanan
sistem yang tidak terlalu besar untuk prosesnya.
Dari metode ini juga dihasilkan sebuah pohon filogeni yang menunjukkan bahwa
sampel(19102017) menunjukkan hubungan kekerabatan sangat dekat sebesar 97 %
kekerabatan dengan spesies bakteri NR 134793.1 Pseudomonas matsuisoli.
Selain metode Neighbor-Joining Tree, juga digunakan metode Maximum
Likelihood Tree, Minimum-Evolution Tree, UPGMA Tree, dan Maximum Parsimony Tree.
Perbedaan dari metode-metode tersebut adalah:
a) Metode Maximum Likelihood Tree
Metode Maximum Likelihood Tree bertujuan untuk membuat konstruksi pohon
filogeni dengan menggambarkan hubungan kekerabatan antara spesies
organisme yang lebih rinci dibandingkan metode NJ dan minimum
evolution.Metode ini digolongkan dalam metode Character-Based yang
menggunakan urutan nukleotida/asam amino secara langsung dalam
rekonstruksi pohonnya (Fiona, B. & Detlef, L., 2001).
Metodeinimenggunakankalkulasiuntukmenemukanpohon yang
mempunyaihitunganvariasiterbaikdalam set sekuen. Semuakemungkinanpohon
yang terbentukdipertimbangkan,

47
sehinggametodeinihanyacocokuntuksekuendalamjumlahkecil.
Metodeinimempertimbangkanuntukmasing-masingpohon,
jumlahperubahansekuenataumutasi yang terjadi yang
memberikanvariasisekuen.
Metodeinidapatdigunakanuntukmengekplorasihubunganantarasekuen yang
lebihberagam. Kekuranganmetodemaximum
likehoodadalahmembutuhkanpekerjaankomputer yang sangatintensif.
Jikamenggunakankomputer yang lebihcepat, metode maximum
likehooddapatdigunakanuntuk model evolusi yang lebihkomplek (SCHADT et al.,
1998). Percabangan yang dihasilkan dari metode ini lebih banyak dan variatif,
namun memerlukan waktu yang lama untuk proses analisisnya, hal ini
disebabkan dalam metode ini dilakukan analisis secara intensif sehingga
memerlukan ruang penyimpanan sistem komputer yang besar untuk prosesnya.
b) Metode Minimum-Evolution Tree
Metode Minimum Evolution (ME) Tree bertujuan untuk membuat konstruksi
pohon filogeni dengan pendekatan distance matrix yang menggunakan logika
bahwa pohon terbaik adalah pohon yang meminimalisir nilai tree length yang
merupakan penjumlahan dari total branch length. Konsepnya adalah indeks
parameter distance terkecil antar pasangan organisme akan digunakan untuk
menggabungkan kedua organisme tersebut dalam 1 kelompok filogenetik
(disebut juga "clade"). Metode ini dikenal bagus pada awalnya karena
menghasilkan pohon ultrametrik, yakni pohon yang semua organismenya
memiliki jarak percabangan/branch length yang sejajar satu sama lain jika
ditelusur dari akar/root. Ultrametrisitas akan berlaku dengan asumsi, yakni jika
laju evolusi antar organisme yang dibandingkan adalah sama. Namun demikian,
fakta pun berkata lain karena laju evolusi antar organisme bahkan untuk gen
yang sama itu tidaklah sama. Salah satu kekurangan metode ME adalah dalam
hal pencarian pohon karena metode ini harus menghitung nilai tree length
setiap pohon satu per satu. Itu artinya, jika menggunakan 10 organisme ada
2.027.025 pohon unrooted dan 34.459.425 pohon rooted yang harus dihitung
tree length-nya. Proses perhitungannya menjadi tidak efektif (Fiona, B. & Detlef,
L., 2001).
c) Metode Maximum Parsimony Tree
Metode Maximum Parsimony Tree adalah metode yang mencoba
meminimalkan panjang cabang dengan atau meminimalkan jumlah mutasi.
Masalah utama dengan metode ini adalah kegagalan untuk memperhitungkan
banyak faktor urutan evolusi (misalnya pembalikan, konvergensi, dan
homoplasi). Dengan demikian, semakin dalam perbedaan waktu yang mungkin
terjadi, metode ini akan menghasilkan kelompok yang keliru atau kurang
didukung.

48
VII. Penutup
7.1 Kesimpulan
7.1.1 Dari sampel data dihasilkan pohon filogeni. Pohon ini menunjukkan
hubungan evolusi antar organism ( hubungan kekerabatan ), dalam
hubungan kekerabatan yang paling dekat dengan sampel DNA adalah NR
134793.1 Pseudomonas matsuisoli.

7.2 Saran

7.2.1 Untuk percobaan ini disarankan menggunakan Personal Computer (PC) dengan
spesifikasi processor di atas 2 GHz sehingga proses analisis (rooting)nya berjalan
lebih cepat.
7.2.2 Diperlukan sambungan internet yang baik untuk mengakses database publik di
NCBI.

49
DAFTAR PUSTAKA
Felsenstein J. (1985). Confidence limits on phylogenies: An Approach using the
bootstrap. Evolution 39:783-791
Fiona Brinkman; Detlef Leipe (2001). Phylogenetic Analysis. John Wiley & Sons.
ISBN 0-471-38390-2. Page: 323
Kumar S., Syecher G., and Tamura K. (2016). MEGA7: Molecular Evolutionary
Genetics Analysis version 7.0 for bigger datasets.Molecular Biology and
Evolution 33:1870-1874
Saitou N. and Nei M.(1987). The neighbor-joining method: A new method for
reconstructing phylogenetic trees. Molecular Biology and Evolution 4:406-
425
Williamson DI (2003-12-31). "xviii". The Origins of Larvae (2nd ed.). Springer.
p. 261. ISBN 978-1402-01514-4

50
HALAMAN PENGESAHAN
LaporanPraktikumBiokimia

JudulPraktikum : Bioinformatika
Nama : RizkiSeptiyani
NIM : 24030115130089

Semarang, 25Oktober 2017

Menyetujui, MahasiswaPraktikum,
AsistenPraktikum,

Nurrizka Kurniawati RizkiSeptiyani

24030113140121 24030115130089

51
LAMPIRAN

Hasil Filogeni metode Neighbor-joining Tree

52
BIOINFORMATIKA

LAPORAN PRAKTIKUM BIOKIMIA

Disusun oleh :

Rahmatul Fazira 24030115130091

Asisten:

Nurrizka Kurniawati 24030113140121

Ummi Laili Rochmawati 24030113130124

DEPARTEMEN KIMIA

FAKULTAS SAINS DAN MATEMATIKA

UNIVERSITAS DIPONEGORO

SEMARANG

2017

VI. PEMBAHASAN

53
Percobaan ini berjudul “Bioinformatika”, tujuan dari percobaan ini
adalah untuk mengidentifikasi sampel organisme (bakteri) dengan
sejumlah spesies bakteri dari database dan bakteri pembanding melalui
konstruksi pohon filogeni yang dapat menunjukkan hubungan evolusi
antar organisme (hubungan kekerabatan). Prinsip dari percobaan ini
adalah memberikan input yang berupa urutan nuleotida dan penerjemah
kode-kode genetik yang berfungsi untuk mengetahui susunan asam amino
dalam sekuen. Metode yang digunakan adalah metode Blast (Basic Local
Alignment – nucleotide). Metode blast ini digunakan untuk
mengidentifikasi spesies berdasarkan urutan pencarian homolog, yang
diasumsikan secara orthologis dengan Clustal W (Vardivalagan,
2012).Program yang digunakan dalam percobaan ini adalah NCBI. Fungsi
dari NCBI adalah sebagai wadah untuk memperoleh informasi berbagai
macam peta genetika dari suatu organisme (yang sudah terdata) . Metode
Blast adalah mencari sekuen yang baik dari asam nukleat, DNA, ataupun
proteinnya mirip dengan sekuen yang ada pada sampel yang digunakan
dalam percobaan ini sehingga akhirnya dapat mengetahui hubungan
kekerabatan antara sampel dan organisme lainnya. Algoritma yang
mendasari blast adalah penyejajaran sekuen (Kuncoro, 2011).
Analisis sekuensing yang digunakan pada percobaan kali ini adalah
analisis sekuensing 16s rRNA. Metode berbasis molekular ini dinilai cepat
dan akurat dalam mengidentifikasi bakteri patogen serta memiliki
keunggulan dibandingkan dengan metode mikrobiologi konvensional. Gen
16s rRNA juga memiliki hypervariable region yang merupakan ciri khas
tiap mikroorganisme. Hypervariable region adalah daerah DNA nuklir dan
DNA mitokondria dimana pada daerah ini terdapat pasangan nukleotida
dengan urutan yang berulang (Rinanda, 2011).
Penyejajaran sekuen (Sequence Alignment) adalah proses
penyusunan atau pengaturan dua atau lebih sekuens, sehingga proses
persamaan sekuen-sekuen tersebut tampak nyata (Krane,V.E, 2009).
Tujuan dari proses penyejajaran adalah mencocokkan karakter-karakter

54
yang homolog, yaitu karakter yang mempunyai nenek moyang yang sama
(Kemena dan Notredame, 2009). Sedangkan sekuen adalah sederatan
pernyataan-pernyataan yang urut dan pelaksanaan eksekusinya runtut,
yang lebih dahulu ditemukan akan dikerjakan terlebih dahulu dan apabila
urutan tersebut pernyataannya dibalik maka maknanya akan berbeda
(Kuncoro, 2011).
Padapercobaaninidigunakanpratikanmemeperolehsampelberupa file
dengan format .Fasta. Untuk mengetahui seberapa banyak jenis organisme
yang memiliki kemiripan urutan DNA dengan sampel, maka digunakan
program online Blast yang terdapat pada website NCBI. Dari program ini
akan muncul diagram aligment (pembanding) berupa garis merah. Pada
percobaan ini diperoleh 100 garis merah. Banyaknya data yang muncul
menunjukkan banyaknya kemiripan urutan DNA pada organisme sampel.
Presentase yang muncul menandakan seberapa dekat urutan DNA sampel
dengan DNA organisme yang telah ada (aligment). Semakin besar
presentase yang dihasilkan, maka semakin tinggi kemiripan urutan DNA
sampel terhadap urutan DNA yang telah ada (aligment). Kemiripan sampel
dengan aligment yang didapatkan pada percobaan ini berkisar 100%-95%.

Kemudianmencarikekerabatan blast – n
denganbioedit.AplikasiBioeditdigunakanuntukdilakukan untuk mengetahui
kemiripan sampel dengan aligment berdasarkan urutan nukleotidanya..Dari
hasil percobaan diperoleh hasil berupa sekuans DNA dari bakteri. Pada
hasil tersebut terdapat warna hitam yang menunjukkan kesamaan basa
nitrogen. Semakin banyak kesamaannya, maka semakin dekat hubungan
kekerabatannya.
Aplikasi MEGA 6 digunakan untuk membandingkan dan
menganalisis sekuens gen yang homolog. Program ini menganalisis jauh
dekat hubungan kekerabatan berdasarkan identik atau tidak identiknya
pasangan nukleotida antar individu atau spesies yang berbeda. Program ini
juga dilengkapi dengan hasil berupa pohon filogenetik.Dari pohon filogeni
akan didapatkan hasil berupa kemiripan sampel dengan bakteri yang

55
memiliki kemiripan dengan nilai 100 yang disebut nilai boothstrap.
Dimana semakin tinggi nilai boothstrap maka semakin tinggi nilai
kemiripannya. Jika nilai <70 dapat dikatakan bahwa kemiripannya jauh
dan sebaliknya jika nilai >70 dapat dikatakan bahwa kekerabatannya
dekat. (Thiru. P, 2003)

Pada MEGA6 ditampilkan beberapa metode dalam pembuatan


pohon filogeni seperti metode Maximum Likelihood, Maximum
Parsimony, Neighboor Joining, dan Minimum Evolution.Metode Minimum
Evolution (ME) Tree bertujuan untuk membuat konstruksi pohon filogeni
dengan pendekatan distance matrix yang menggunakan logika bahwa
pohon terbaik adalah pohon yang meminimalisir nilai tree length yang
merupakan penjumlahan dari total branch length. Konsepnya adalah
indeks parameter distance terkecil antar pasangan organisme akan
digunakan untuk menggabungkan kedua organisme tersebut dalam 1
kelompok filogenetik (disebut juga "clade"). Metode ini dikenal bagus
pada awalnya karena menghasilkan pohon ultrametrik, yakni pohon yang
semua organismenya memiliki jarak percabangan/branch length yang
sejajar satu sama lain jika ditelusur dari akar. Hasil yang didapatkan
dengan metode Minimum Evolution

56
Pada pohon filogeni, organisme yang berada pada letak yang dekat
dan di cabang yang sama berarti kekerabatannya semakin dekat. Hanya
organisme yang berada pada cabang sama yang dapat diidentifikasi jauh
atau dekatnya hubungan kekerabatannya. Semakin kecil jarak / letak
organisme pada pohon filogeni menunjukkan hubungan kekerabatannya
semakin dekat. Dari pohon filogeni diatas dapat terlihat bahwa sampel
yang digunakan dalam percobaan berada pada cabang kedua dari bawah,
dimana cabang paling bawah ditempati oleh Pseudomonas hussaini strain
CC-AMH-11. Nilai bootstrap menunjukkan 100 %
mengindikasikanreabilitaskekerabatan yang
sangatdekatantarasampeldenganbakteriPseudomonas hussaini strain CC-
AMH-11 yang berasaldarinenekmoyang yang sama. Pseudomonas sendiri
merupakan genus bakteri gram negatif yang tergolong dalam kelompok
Pseudomonadaceae sebanyak 191 spesies.

Gambar bakteri Pseudomonas adalah sebagai berikut

57
Gambar 5.2 Bakteri Pseudomonas

Pseudomonas sendiri merupakan genus bakteri gram negatif yang


tergolong dalam kelompok Pseudomonadaceae sebanyak 191 spesies.
Bakteri Pseudomonas sendiri memiliki karakteristik seperti, gram negatif,
berbentuk batan (rods) atau kokus (coccus), aerob obligat, motil
mempunyai flagel polar. Bakteri ini tumbuh dengan baik pada suhu 4oC
atau dibawah 43oC. Pseudomonas banyak ditemukan pada tanah, tanaman
dan air. Sebagian bakteri ini bersifat aerobik dan sebagian anaerobik
membentuk biofilm (Suyono, 2011).

58
VII. Penutup
7.1 Kesimpulan
7.1.1 Dari sampel data dihasilkan pohon filogeni. Pohon ini menunjukkan
hubungan evolusi antar organism ( hubungan kekerabatan ), dalam
hubungan kekerabatan yang paling dekat dengan sampel DNA diduga
adalahNR 134139.1 Pseudomonas hussainii strain

7.2 Saran

7.2.1 Untuk percobaan ini disarankan menggunakan Personal Computer (PC)


dengan spesifikasi processor di atas 2 GHz sehingga proses analisis
(rooting)nya berjalan lebih cepat.

59