Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy 150 (2015) 268–279

Contents lists available at ScienceDirect

Spectrochimica Acta Part A: Molecular and

Biomolecular Spectroscopy
journal homepage: www.elsevier.com/locate/saa

Structural characterization of new Schiff bases of sulfamethoxazole

and sulfathiazole, their antibacterial activity and docking computation
with DHPS protein structure
Sudipa Mondal a, Santi M. Mandal b, Tapan Kumar Mondal a, Chittaranjan Sinha a,⇑
a
Department of Chemistry, Jadavpur University, Kolkata 700 032, India
b
Central Research Facility, Indian Institute of Technology Kharagpur, Kharagpur 721302, India

h i g h l i g h t s g r a p h i c a l a b s t r a c t

 Sulfamethoxazole and sulfathiazole New Schiff bases of sulfamethoxazole (SMX-SB, 1)/sulfathiazole (STZ-SB, 2) are characterized and found
Schiff bases of substituted effective against several Gram-positive and Gram-negative bacterial strain. Derivatives are more effective
salicylaldehydes. than their parent sulfonamides. DFT optimized structures of the Schiff bases are used for molecular dock-
 Spectroscopic characterization and ing studies to predict the best pose interaction in the cavity of DHPS protein and the results have been
single crystal X-ray structure. correlated with experimental MIC data. The most proficient drug is (E)-4-((3,5-dichloro-2-hydroxybenz
 DFT computation of the Schiff bases ylidene)amino)-N-(thiazol-2-yl)benzenesulfonamide (2c) (MIC, 8.0 lg mL1).
for energy minimized structure.
 Antibacterial study against
Gram-positive and Gram-negative
bacteria.
 Molecular docking studies of the
Schiff bases with DHPS to support
experimental results.

a r t i c l e i n f o a b s t r a c t

Article history: New Schiff bases (1, 2) of substituted salicylaldehydes and sulfamethoxazole (SMX)/sulfathiazole (STZ) are
Received 17 March 2015 synthesized and characterized by elemental analysis and spectroscopic data. Single crystal X-ray structure
Received in revised form 17 May 2015 of one of the compounds (E)-4-((3,5-dichloro-2-hydroxybenzylidene)amino)-N-(5-methylisoxazol-3-yl)
Accepted 19 May 2015
benzenesulfonamide (1c) has been determined. Antimicrobial activities of the Schiff bases and parent sul-
Available online 27 May 2015
fonamides (SMX, STZ) have been examined against several Gram-positive and Gram-negative bacteria and
sulfonamide resistant pathogens; the lowest MIC is observed for (E)-4-((3,5-dichloro-2-hydroxybenzyli
Keywords:
dene)amino)-N-(thiazol-2-yl)benzene sulfonamide (2c) (8.0 lg mL1) and (E)-4-((3,5-dichloro-2-hydrox
Sulfonamide Schiff bases
Spectra and structure
ybenzylidene)amino)-N-(5-methylisoxazol-3-yl)benzene sulfonamide (1c) (16.0 lg mL1) against sulfon-
DFT computation amide resistant pathogens. DFT optimized structures of the Schiff bases have been used to carry out
Antibacterial activity molecular docking studies with DHPS (dihydropteroate synthase) protein structure (downloaded from
Molecular docking study Protein Data Bank) using Discovery Studio 3.5 to find the most preferred binding mode of the ligand inside
the protein cavity. The theoretical data have been well correlated with the experimental results. Cell
viability assay and ADMET studies predict that 1c and 2c have good drug like characters.
Ó 2015 Elsevier B.V. All rights reserved.

⇑ Corresponding author. Fax: +91 2414 6584.

E-mail address: c_r_sinha@yahoo.com (C. Sinha).

http://dx.doi.org/10.1016/j.saa.2015.05.049
1386-1425/Ó 2015 Elsevier B.V. All rights reserved.
 S. Mondal et al. / Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy 150 (2015) 268–279
Introduction
Microbial infections are major health problems around the
world. The antimicrobial drug research has received renewed
interest because of life threatening invasive infections and devel-
opment of drug resistant microbes. The sulfonamides are being
used clinically since 1930s [1] in human medicine and livestock
production [2]. Dihydropteroate synthase (DHPS) is the key
enzyme in folate synthesis which catalyzes the condensation of
dihydropterin pyrophosphate (DHPP) to p-aminobenzoic acid
(PABA) to form dihydropteroate which is a key step in bacterial
folate biosynthesis. Sulfonamides prevent bacterial growth by act-
ing as a competitive inhibitor [3–6] of DHPS during folate synthe-
sis. In spite of its wide spread application in the treatment of
several infections the use of sulfonamides has been limited due
to a range of severe immunological reactions and toxicity that
causes fever, skin rashes, breathing trouble, abdomen pain, nausea,
headache, vomiting, diarrhea, loss of appetite, kidney damage etc.
in case of prolonged administration [7–12]. Development of resis-
tant bacterial strains is another challenge against the use of con-
ventional drugs. Severe side effects of sulfonamides and
induction of resistance have prompted worldwide effort to find
new generation drugs [13]. To improve drug activity and reduce
toxicity the researchers have already engaged in the design, syn-
thesis and to explore the drug–protein interaction of functional-
ized sulfonamides and their complexes [14–17].
Schiff bases are among the most important groups of biomole-
cules [18–22], especially those derived from salicylaldehydes;
since, they have shown antibacterial activity in the wobble range
of MIC [23] which led us to combine sulfonamides with various
substituted salicylaldehydes to synthesize new derivatives. In this
work we have chosen sulfamethoxazole (SMX) and sulfathiazole
(STZ) at the first phase to synthesize a series of Schiff bases
(SMX-SB, 1; STZ-SB, 2) using substituted salicylaldehydes
(XYC6H2(o-OH)CHO). The compounds have been characterized by
spectroscopic analysis (FTIR, NMR, Mass) and the structure of one
of the compounds has been confirmed by single crystal X-ray
diffraction study. The antibacterial activity of the compounds has
been examined against several Gram-positive and Gram-negative
bacterial strain. The minimum inhibitory concentration (MIC) of
the newly synthesized compounds (1a–1e; 2a–2e) have been
compared with parent sulfonamides (SMX, STZ) to get the best
substituent in the phenolato ring for antimicrobial activity. Some
of the compounds have shown good activity against sulfonamide
resistant pathogens. The energy minimized structure of all the
newly synthesized compounds have been obtained by DFT compu-
tational study and that have been used for Molecular Docking stud-
ies with DHPS protein structure (obtained from Protein Data Bank)
to predict the most probable mode of interaction for the efficiency
of the drugs.
Results and discussion
Synthesis and characterization of Schiff bases
Substituted salicylaldehydes (XYC6H2(o-OH)CHO) 3,5-dimethyl
salicylaldehyde (3,5-Me2C6H2(OH)CHO) (a), 3,5-di-tertiarybutyl
salicylaldehyde (3,5-But2C6H2(OH)CHO) (b), 3,5-dichloro salicylalde-
hyde (3,5-Cl2C6H2(OH)CHO) (c), 5-nitro salicylaldehyde
(5-NO2C6H3(OH)CHO) (d), 4-methyl di-formyl phenol
(5-MeC6H2(OH)-1,3-(CHO)2) (e) are used in this work. They have
been prepared by the formylation of substituted phenols following
Duff reaction [24] except 5-NO2C6H3(OH)CHO (d). The condensation
of substituted salicylaldehyde separately with SMX and STZ has pro-
duced SMX-SB (1) and STZ-SB (2), respectively (Scheme 1). All these
269
compounds are characterized by microanalytical, FTIR, 1H and 13C
NMR, and ESI-MS spectral data (Supplementary materials,
Table S1, Figs. S1–S11). The azomethine group (–CH@N–) is recog-
nized by a peak at 9.0 ppm in the 1H NMR spectra and a sharp band
at 1600–1630 cm1 in the IR spectra of 1 and 2. The presence of
molecular ion peak (m/z) supports the chemical identity of the com-
pounds. All the compounds show absorption band at 350–420 nm
and 270–315 nm due to n–p⁄ and p–p⁄ transition respectively
(Supplementary material, Fig. S12a and b).
Crystal structure of SMX-N@CH-C6H2Cl2(o-OH) (1c)
An ORTEP view of SMX-N@CH-C6H2Cl2(o-OH) (1c) is shown in
Fig. 1 and selected bond parameters are listed in Table 1. There
are three aromatic units in the molecule: phenolato (A-ring), aryl
sulfonamide (B-ring) and oxazolyl (C-ring). The C-ring is linked to
B-ring by the sulfonamide (–NH–SO2–) group and the B-ring that
is connected to 3,4-dichlorosalicylaldehyde (A-ring) by –N@CH–
group. Two phenyl groups (3,5-Cl2C6H2(OH)- and –C6H4(SO2)–)
bonded by –N@CH– make dihedral 17.24(17)°, oxazolyl ring is
inclined at 86.78(17)° with –C6H4(SO2)–. The overall structure is lar-
gely deviated from planarity and looks like an envelope. The N@CH
bond length is 1.275(4) Å. The bond distances involved in ‘–SO2–
NH–’ group that bridges arylsulfonamide (B-ring) and oxazolyl
(C-ring) are C(14)–N(2), 1.405(3); S(1)–N(2), 1.634(3) and S(1)–
C(11), 1.759(3) Å. Sulfonyl (–SO2–) S@O distances are S(1)–O(2),
1.424(2) and S(1)–O(3), 1.436(2) Å. An intramolecular hydrogen
bond exists at 3,5-Cl2C6H2O-H  N@CH-C6H4-SO2- (O–H  N, \
O(1)–H(1)  N(1), 146.00(2)°; H(1)  N(1), 1.890(2) Å; O(1)  N(1),
2.614(4) Å). Two aryl rings, phenolato (A-ring), aryl sulfonamide
(B-ring) of two adjacent molecules show cross p  p interaction,
A  B, 3.56 Å (Fig. 2).
In vitro antimicrobial assay
In vitro antimicrobial activity of the newly synthesized Schiff
bases (1, 2) have been examined against both the Gram-positive
and Gram-negative bacteria control and clinical strains. Two par-
ent sulfonamides (SMX, STZ) are used as reference drugs. The com-
pound 1c (MIC, 16.0 lg mL1 against Escherichia coli ATCC25922)
and 2c (MIC, 8.0 lg mL1 against E. coli ATCC25922) have shown
appreciable in vitro inhibitory activity against all the tested strains
(Table 2). Further attempt has been made to check the inhibitory
activity against clinically isolated sulfonamide resistant pathogens.
The strains have been identified as E. coli and Enterobacter cloaceae
after their partial 16S rDNA sequencing (data not shown). The
compounds 1c and 2c have shown eight fold better activity than
sulfonamide itself against the resistant strains (Table 3).
Antimicrobial activity of sulfathiazole (STZ) is more effective than
sulfamethoxazole (SMX), similarly STZ-SB (2) are better in vitro
inhibitor than SMX-SB (1). The compound 2c (containing two chlo-
rine atoms and thiazolyl moiety) has shown lowest MIC
(8.0 lg mL1) and the highest zone of inhibition followed by the
compound 1c (MIC, 16.0 lg mL1) against sulfonamide resistant
pathogens (Table 3). The 2nd best compounds are 1d and 2d, the
Schiff bases containing nitro group with MIC, 32 lg mL1 against
Staphylococcus aureus ATCC21737 (Table 2). Antimicrobial activity
of 1a, 2a (containing di-methyl group); 1b, 2b (containing
di-tert-butyl) have shown higher MIC (64 lg mL1) against S. aur-
eus ATCC21737 (Table 2). All the newly synthesized azomethine
compounds have shown antimicrobial activity but the presence
of two chlorine atoms along with o-hydroxyl group to azomethine
bridge may be required for better activity. It is obviously promising
that modification of primary amine group of sulfonamides may be
helpful to design better sulfonamide antibiotics.
270 S. Mondal et al. / Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy 150 (2015) 268–279

Scheme 1. General procedure for the preparation of Schiff bases 1a–1e, 2a–2e.

Fig. 1. Molecular structure of 1c with 50% ellipsoid probability.

 S. Mondal et al. / Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy 150 (2015) 268–279 271

Table 1 cytotoxicity assay is Primary mouse embryonic fibroblasts

Some selected bond distances and bond angles of 1c and comparison with calculated (PMEFs). Cells have been treated with the solution of 1c or 2c with
data obtained from DFT optimized structure.
different strength (5–100 lg mL1) following standard procedure.
Bond distance (Å) Bond angle (°) The data obtained from the MTT assay (Fig. 3) has revealed that
X-ray Calculated X-ray Calculated compound 1c and 2c are non toxic in their required concentration
S(1)–O(2) 1.424(2) 1.463 O(2)–S(1)–O(3) 119.95(14) 122.99
for antimicrobial activity. IC50 values are observed only at the
S(1)–O(3) 1.436(2) 1.463 O(2)–S(1)–N(2) 104.86(14) 103.66 higher concentration (>500 lg mL1), therefore the compounds
S(1)–N(2) 1.634(3) 1.706 O(3)–S(1)–N(2) 107.92(12) 106.11 1c and 2c are biocompatible for clinical application.
S(1)–C(11) 1.759(3) 1.795 O(2)–S(1)–C(11) 108.11(13) 108.27
Cl(1)–C(2) 1.724(4) 1.745 N(2)–S(1)–C(11) 107.84(13) 106.74
Docking studies with DHPS
Cl(2)–C(4) 1.738(4) 1.755 O(1)–C(1)–C(2) 119.0(3) 119.24
O(1)–C(1) 1.331(5) 1.337 O(1)–C(1)–C(6) 122.7(3) 122.50
N(1)–C(8) 1.414(4) 1.406 C(3)–C(2)–Cl(1) 119.6(3) 116.60 The docking studies have been performed to predict the most
N(1)–C(7) 1.275(4) 1.292 C(1)–C(2)–Cl(1) 118.8(3) 119.17 probable mode of binding of the sulfonamide Schiff bases
N(2)–C(14) 1.405(3) 1.400 C(5)–C(4)–C(12) 119.7(3) 120.13
(SMX-SB, STZ-SB) with dihydropteroate synthase (DHPS) by
N(3)–O(4) 1.408(3) 1.401 C(3)–C(4)–C(12) 119.6(3) 119.28
N(3)–C(1)4 1.292(4) 1.318 C(14)–N(3)–O(4) 104.9(2) 104.73
CDOCKER module of receptor-ligand interaction section available
under Discovery studio client 3.5. The docking studies reveal cru-
cial information regarding interaction mode of ligand with enzyme
inside binding pockets. Sulfamethoxazole bound crystallographic
Activity against sulfonamide resistant gene structure of dihydropteroate synthase of Yersinia pestise has been
downloaded from RCSB-PDB (Protein Data Bank, http://www.
The emergence of bacterial resistance is a prime concern now rcsb.org/pdb/home/home.do) with PBD ID 3TZF which is resolved
and has led to a significant decrease in the clinical utility of many at 2.10 Å using X-ray diffraction. The DFT calculation has been used
antibacterial agents. Sulfonamides have been widely used in clini- to get energy minimized geometry optimized structure of the
cal and veterinary medicine as they have a structural analog of Schiff bases. The calculated bond parameters of 1c are comparable
PABA, which binds to dihydropteroate synthatase (DHPS). with experimental data (Table 1), hence the DFT optimized struc-
Inhibition of DHPS catalytic activity is a strategy to stop the syn- tures are used as ligand during in silico docking studies in the bind-
thesis of dihydrofolic acid [25]. Recently, sulfonamides drug resis- ing site of sulfamethoxazole inside the 3TZF cavity. Docking data of
tant are very common in clinics which are conferred by mutations the synthesized compounds are given in Table 5. Interaction
in the DHPS gene [26] or from the acquisition of an alternative energy and antimicrobial activity have shown good correlation.
DHPS gene (sul, sulfonamide resistant genes) [27]. The first of the The most favored binding modes of twelve molecules (SMX, STZ,
three known alternative DHPS genes, sul1, sul2 and sul3 genes are 1a–1e, 2a–2e) with DHPS are illustrated in Table S4
identified earlier in several sulfonamide resistant E. coli isolates (Supplementary materials). Seventeen amino acid residues those
[28,29]. We have confirmed the presence of sul1 and sul2 genes are actively involved in the active site of our interest are Phe 28,
in the sulfonamide resistant clinical isolates after their amplifica- Ser61, Thr62, Arg63, Pro 64, Gly65, Met148, Gln149, Phe188,
tion using conserved primers (Fig. S16a and b). Thus, the results Gly189, Phe 190, Gly191, Arg220, Lys 221, Ser 222, Met 223,
from antimicrobial assay may reveal that the newly synthesized Arg235. In the binding sphere, the sulfonamide derivatives interact
derivatives strongly bind to DHPS or sul. In general, sulfonamides with the enzyme by H-bonding, p–p stacking, hydrophobic and
are mainly used in combination with trimethoprim, an inhibitor ionic interactions (Table S4). Protein–ligand complex is more
of dihydrofolate synthase (Scheme 2). Immediately, we have stable for 2c than 1c (Table 5). The calculated data show that the
checked their synergistic potentiality with trimethoprim. We have free energy of DHPS@2c complex is 23,141 kcal/mol and that of
pursued the synergistic checkerboard assay of compounds 1c and DHPS@1c complex is 23,134 kcal/mol. The 1c forms an ionic
2c with trimethoprim, have showed good synergism as the values interaction with Arg235 (Table S4, Figs. 4–6) and total three hydro-
are obtained 60.5 (Table 4). gen bonds with the three amino acid residue Thr62 (2.58 Å, \D–H–
A (Thr NH. . .N oxazolyl, 162°);, Ser61 (2.77Å, \D–H–A (Ser O–
Cytotoxicity assay H. . .N oxaxolyl, 158°) and Arg235 (1.65 Å, \D–H–A (Arg NH. . .O
phenol, 152°) whereas the compound 2c forms two hydrogen
Standard MTT [(3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymet bonds, one with Thr62 (2.17 Å, \D–H–A (Thr NH. . .N thiazolyl,
hoxyphenyl)-2-(4-sulfophenyl)-2Htetrazolium)] cytotoxicity assay 178°) and one with Arg235 (1.72 Å, \DHA (Arg NH. . .O phenol,
has been performed to investigate the cell viability in presence and 146°) (Table S4, Fig. 7–9) and also there is an ionic interaction with
absence of experimental substance. The cell line used for Arg253. The ionic interaction gets stronger due to the presence of

Fig. 2. Packing pattern in 1c.

272 S. Mondal et al. / Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy 150 (2015) 268–279

Table 2
Minimum inhibitory concentration (MIC) of Schiff bases (1, 2).

Compounds MIC (lg mL1)

Gram positive Gram negative
S. aureus ATCC21737 P. aeruginosa ATCC27853 S. typhi MTCC734 K. pneumonia ATCC 714 E. coli ATCC25922 S. epidermidis NCIM 2493
1a 64 64 64 32 64 128
1b 64 64 64 64 64 128
1c 16 16 16 8 16 32
1d 32 64 64 32 32 64
1e 32 128 64 128 32 128
2a 32 64 128 128 64 128
2b 128 128 64 64 128 128
2c 8 16 8 8 8 16
2d 32 32 64 128 64 128
2e 64 64 128 64 32 64
SMX 64 32 32 32 16 32
STZ 64 32 32 16 16 32

Table 3
Antimicrobial activity of compounds 1c and 2c against sulfonamide resistant clinical
isolates.

Sulfonamides MIC (lg mL1)

E. coli E. cloacae
Sulfamethoxazole 128 128
Sulfathiazole 64 64
1c 16 16
2c 8 8

Fig. 3. Cell viability data of 1c and 2c. IC50 values are observed at a concentration of
>500 lg mL1. The line in graph with blue color (2c) and black color (1c) show the
viability plot against 3T3 non-carcinoma cell line. (For interpretation of the
references to color in this figure legend, the reader is referred to the web version of
this article.)

Scheme 2. Plausible synergistic potentiality of the ligands with trimethoprim.

Table 5
Details of docking studies at best fit phase of DHPSa and Schiff bases (1, 2).

Compounds CDOCKER Binding Ligand Energy of protein

Table 4 interaction energy energy ligand complex
Determination of synergistic action following checkerboard assay of compounds 1c energy (kcal/mol) (kcal/mol) (kcal/mol)
and 2c with DHFR inhibitor, trimethoprim.a
DHPS@SMX 32.53 55.07 2.12 22888.0
Strains 1c 2c DHPS@1a 41.80 62.12 11.72 22881.0
DHPS@1b 45.31 72.53 15.55 22888.0
FICA FICB RFIC FICA FICB RFIC
DHPS@1c 63.46 327.56 25.52 23134.0
E. coli 0.061 0.030 0.091 0.061 0.061 0.122 DHPS@1d 60.36 233.60 9.43 23051.0
E. cloacae 0.061 0.061 0.122 0.030 0.061 0.091 DHPS@1e 48.06 45.67 37.32 22839.0
a
DHPS@STZ 27.66 66.85 11.81 22886.0
FICA = MIC of A in combination/MIC of A alone; FICB = MIC of B in combination/
DHPS@2a 38.87 64.79 9.14 22887.0
MIC of B alone; RFIC = FICA + FICB.
DHPS@2b 43.24 62.80 13.26 22881.0
DHPS@2c 59.84 319.32 9.30 23141.0
DHPS@2d 58.96 320.26 3.65 23148.0
DHPS@2e 48.85 114.52 28.07 22918.0
two electron withdrawing chlorine group in Ring A resulting a
a
CDOCKER interaction energy is CHARM based energy and
more stable protein–ligand complex. That may be the reason of
EBinding = EComplex  Eligand  Ereceptor. E (free energy) of DHPS in docking pose is
higher binding energy (EBinding = Ecomplex  Eligand  Ereceptor) and 22,831 kcal/mol.
higher antimicrobial activity for 1c and 2c. Similar interaction is
present for 1d and 2d (compound with nitro group) who have docking data, with the biological assay data suggest that electron
shown second best result in their respective best dock pose withdrawing group may be required in Ring-A for potential
(Supplementary material Figs. S22 and S26). This molecular antibacterial activity of the Schiff bases of sulfonamides. The
 S. Mondal et al. / Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy 150 (2015) 268–279
Fig. 4. 3D view of the best docked pose of 1c inside the binding pocket of DHPS.
Fig. 5. Amino acid residues close to 1c in the best docked pose inside the binding
pocket of 3TZF (2D view).
frontier molecular orbitals (obtained from DFT data) of the Schiff
bases show that the HOMO is mainly localized to Ring A
(Table S3) so any substituent in Ring-A may play crucial role in
the biological activity of the Schiff bases. However, the interaction
of SMX-SB or STZ-SB with DHPS protein could not be followed by
spectroscopic route because of no availability of protein in the
market.
Druglikeness and ADMET prediction
Druglikeness of all the compounds have been examined follow-
ing Lipinski’s rule of five (Table S5). All the compounds except 1e
and 2e have passed Lipinski’s filter. Using ADMET module of
Discovery studio 3.5 software we have checked ADMET (absorp-
tion, distribution, metabolism, excretion and toxicity) property
and have predicted the toxicity under the Calculate Molecular
Property module of Small molecule tool of Discovery Studio client
3.5. Aqueous solubility, Blood Brain barrier penetration, Human
Intestinal Absorption, Ames Mutagenicity have been calculated
also. The predicted data have been summarized in the Table S5
and according to the prediction the compounds may not have
273
acute toxicity. The ADMET plots (Fig. 10) reveal that 1a, 2a, 2b,
1c, 2c and 2d have good absorption in the cells. Lipinski’s criteria
for drug likeness are also predicted, most of the compounds are
within the range of Lipinski’s rule of five and could be good candi-
date for drug development.
Conclusion
Ten Schiff bases of sulfamethoxazole (SMX-SB) and sulfathia-
zole (STZ-SB) have been characterized by spectroscopic data and
one structure has been confirmed by single crystal X-ray diffrac-
tion data. Parent sulfonamides and these derivatives have been
evaluated in vitro against both Gram-positive and Gram-negative
bacteria strain as well sulfonamide resistant gene. Best results
have shown for 1c (MIC 16.0 lg mL1) and 2c (8.0 lg mL1).
Docking study reveals the mechanism of drug activity through
their molecular interaction with dihydropteroate synthase
(DHPS). Drug likeness and cytotoxicity has also been checked. 1c
and 2c have shown best interaction in this series of compounds
and it is supported by in silico docking score and drug likeness.
We will carry out the microbiological activity and docking studies
to explore the best suited antibacterial agent from sulfonamide
Schiff bases and with their different metal complexes (transition
and non transition).
Experimental
Chemistry
Sulfamethoxazole (SMX) and sufathiazole (STZ) were purchased
from Hi-Media, other solvents and reagents were purchased from
E-Merck and used as they were received. Melting points were
determined on a melting Point apparatus using open capillary
and the reported values are uncorrected. The IR spectra (in KBr pel-
lets) were recorded on a RX-1 Perkin Elmer spectrophotometer in
the range 4000–400 cm1. The 1H and 13C NMR spectra were
recorded in DMSO-d6 on Bruker 300 MHz FT-NMR spectrometer
using TMS as internal standard. The mass spectra were recorded
on a Water HRMS model XEVO-G2QTOF#YCA351 spectrometer.
General procedure for the synthesis of substituted salicylaldehydes
Substituted salicylaldehydes were prepared following the Duff
reaction. 6.5 g (0.04 mol, 1.0 eqv) of 2,4-dichlorophenol was
274 S. Mondal et al. / Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy 150 (2015) 268–279

Fig. 6. Protein surface (with respect to H-bond donor acceptor) in the best docked pose of 1c.

Fig. 7. 3D view of the best docked pose of 2c inside the binding pocket of DHPS.

dissolved in 20 ml of acetic acid followed by the addition of 7.0 g
(0.048 mol, 1.2 eqv) of paraformaldehyde and 7.0 g
(0.048 mol, 1.2 eqv) of hexamine and the mixture was refluxed
for 3 h till the color became orange. The mixture was cooled to
room temperature and 3 ml of concentrated H2SO4 was added
and refluxed again for 30 min. Reaction mixture was cooled and
poured to ice cooled water, yellow precipitate was appeared. The
precipitate was collected by filtration and washed thoroughly with
water (3  100 ml). The light yellow colored solid was dissolved in
toulene and filtered, the filtrate was collected, dried over MgSO4
and concentrated under reduced pressure to get the desired prod-
uct. Finally it was crystallized from methanol to get pure
crystalline product (c) with 54% yield (4.0 g). Other aldehydes
(1, b, d, e) were prepared following the same procedure.
Synthesis of (E)-4-((2-hydroxy-3,5-dimethylbenzylidene)amino)-N-
(5-methylisoxazol-3-yl) benzenesulfonamide (1a)
To 2-hydroxy-3,5-dimethylbenzaldehyde (0.15 g, 1 mmol) in
25 ml super dry ethanol sulfamethoxazole (SMX) (0.28 g, 1.1 mmol)
was added and was stirred at room temperature for 15 min followed
by reflux for 5 h (Scheme 1). Upon cooling to room temperature,
orange precipitate appeared and was filtered, washed with ethanol
(3  15 ml). The product was dried and crystallized from ethanol at
 S. Mondal et al. / Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy 150 (2015) 268–279
Fig. 8. Amino acid residues close to 1c in the best docked pose inside the binding
pocket of 3TZF (2D view).
room temperature and the purity was tested by TLC spot. Yield,
0.30 g (78%).
Other Schiff bases, 1b–1d and 2a–2d were also synthesized fol-
lowing identical procedure in the yield of 65–85%.
4-((E)-(2-hydroxy-5-methyl-3-((E)-((4-((5-methylisoxazol-3-yl)
sulfonyl)phenyl)imino) methyl)benzylidene)amino)-N-(5-methyl-
isoxazol-3-yl)benzenesulfonamide (1e)
To 2-hydroxy-5-methylisothalaldehyde (0.16 g, 1 mmol) in
25 ml super dry ethanol sulfamethoxazole (SMX) (0.55 g,
2.17 mmol) was added and was stirred at room temperature for
15 min followed by reflux for 8 h (Scheme 1). Upon cooling to room
temperature an orange precipitate appeared. It was filtered and
washed with cold ethanol and recrystallized from hot ethanol.
The purity of the product was checked by TLC. Yield, 0.40 g (63%).
The compound 2e was also synthesized following identical
procedure in the yield of 68%.
Fig. 9. Protein surface (with respect to H-bond donor acceptor) in the best docked pose of 2c.
275
Physical and spectroscopic characteristic data are given below.
(E)-4-((2-hydroxy-3,5-dimethylbenzylidene)amino)-N-(5-methylisox-
azol-3-yl) benzenesulfonamide (1a). Yellowish orange solid; yield
82%; mp 226–228 °C. M+, m/z = 386.13; IR: 3138, 3089, 2991,
2843, 2906, 2843, 1620 (azomethine, C@NH–), 1592, 1473, 1402,
1346, 1252, 1164 (–S@O of SO2), 1086, 1037, 938, 910, 840, 812,
749, 651, 559. 1H NMR (300 MHz, DMSO-d6): d 12.8 (1H, s, OH),
11.46 (1H, s, SO2NH), 8.9 (1H, s, 7-H), 7.91 (2Hs, d, J = 9 Hz, 10-H,
12-H), 7.58 (2Hs, d, J = 9 Hz, 9-H, 13-H), 7.25 (1H, s, 5-H), 7.17
(1H, s, 3-H), 6.15 (1H, s, 15-H), 2.28 (3Hs, s, –CH3 at 16-C), 2.23
(3Hs, s, -CH3 at 2-C), 2.17 (3Hs, s, -CH3 at 4-C). 13C NMR
(300 MHz, DMSO-d6): 170.8, 166.8, 157.1, 153.8, 139.1, 136.4,
129.3, 128.8, 127.8, 125.6, 122.7, 118.3, 95.8, 20.3, 15.5, 12.5.
UV–Vis (kmax, nm (e, 103 M1 cm1) in acetonitrile): 360 (12.9),
315 (18.8). Anal. Calcd. for C19H19N3O4S (385.11): C, 59.21; H,
4.97; N 10.90; S, 8.32%. Found: C, 59.30; H, 4.90; N, 10.78 S, 8.20%.
(E)-4-((3,5-di-tert-butyl-2-hydroxybenzylidene)amino)-N-(5-
methylisoxazol-3-yl) benzenesulfonamide (1b). Light yellow solid;
yield 65%; mp 148–150 °C. [M+] m/z = 471.27; IR: 3475, 3377,
3293, 3145, 2956, 1627 (azomethine, C@NH–), 1592, 1501, 1466,
1367, 1304, 1262, 1150 (–S@O of SO2), 1093, 1016, 924, 889,
826, 686, 538. 1H NMR (300 MHz, DMSO-d6): d 13.70 (1H, s, OH),
9.00 (1H, s, 7-H), 7.88 (2Hs, d, J = 8.46 Hz, 10-H, 12-H), 7.58 (2Hs,
d, J = 8.46 Hz, 9-H, 13-H), 7.50 (1H, s, 5-H); 7.43 (1H, s, 3-H), 6.15
(1H, s, 15-H), 2.26 (3Hs, s, –CH3 at 16-C), 1.40 (9Hs, s, –tertbutyl
at 4-C), 1.27 (9Hs, s, –tertbutyl 2-C). 13C NMR (300 MHz,
DMSO-d6): 170.9, 165.7, 158.2, 153.4, 151.5, 139.5, 137.3, 130.2,
128.5, 127.5, 124.3, 122.4, 119.0, 95.6, 35.1, 34.37, 29.5, 29.0,
12.5. UV–Vis (kmax, nm (e, 103 M1 cm1) in acetonitrile): 350
(15.7), 270 (37.9). Anal. Calcd. for C25H31N3O4S (469.60): C,
63.94; H, 6.65; N, 8.95; S, 6.83%. Found: C, 64.0; H, 6.60; N, 8.90;
S, 6.78%.
(E)-4-((3,5-dichloro-2-hydroxybenzylidene)amino)-N-(5-methylisox-
azol-3-yl) benzenesulfonamide (1c). Orange solid; yield 82%; mp
240–242 °C. M+, m/z = 427.01; IR: 3152, 3082, 2991, 2843, 2810,
1613 (azomethine, C@NH–), 1585, 1466, 1402, 1332, 1262, 1170
(–S@O of SO2), 1086, 1030, 938, 912, 854, 812, 749, 643, 573. 1H
276 S. Mondal et al. / Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy 150 (2015) 268–279

Fig. 10. ADMET plots of SMX-SB (1a–1e) and STZ-SB (2a–2e).

2752, 1620 (azomethine, C@NH–), 1571, 1522, 1473, 1402, 1339,

Table 6 1290, 1164 (–S@O of SO2), 1087, 1037, 938, 903, 833, 791, 756,
X-ray crystallographic information and structure refinement parameters of 1c.
686, 630, 573. 1H NMR (300 MHz, DMSO-d6): d 12.50 (1H, s, OH),
Empirical formula C17H13Cl2N3O4S
Formula weight 426.27
10.32 (1H, s, –SO2NH), 9.10 (1H, s, 7-H), 8.73 (1H, s, 5-H), 8.45
Temperature (K) 293(2) (1H, d, J = 3.0 Hz, 3-H), 7.90 (2Hs, d, J = 9.0 Hz, 10-H, 12-H), 7.58
System Monoclinic
(2Hs, d, J = 9.0 Hz, 9-H, 13-H), 7.30 (1H, d, J = 3.0 Hz, 2-H) 6.20
Space group P21/c
a (Å) 10.1367(3) (1H, s, 15-H), 2.30 (3Hs, s, –CH3 at 16-H). 13C NMR (300 MHz,
b (Å) 11.5649(3) DMSO-d6): 171.0, 167.5, 166.5, 160.8, 152.8, 141.0, 138.5, 134.3,
c (Å) 16.3931(4) 131.5, 130.8, 128.8, 122.8, 120.0, 95.5, 12.7. UV–Vis (kmax, nm
b (°) 107.755(2)
(e, 103 M1 cm1) in acetonitrile): 420 (8.8), 367 (6.5), 268 (6.8).
V (Å)3 1830.23(9)
Z 4 Anal. Calcd. for C17H14N4O6S (402.06): C, 50.74; H, 3.51; N, 13.92;
l (MoKa) (mm1) 0.498 S, 7.97. Found: C, 50.82; H, 3.55; N, 14.00; S, 7.90%.
h range 2.11–25.00
Dcalc (mg m3) 1.547
Refine parameters 0.051 4-((E)-(2-hydroxy-5-methyl-3-((E)-((4-((5-methylisoxazol-3-yl)sul-
Total reflections 18,681 fonyl)phenyl)imino) methyl)benzylidene)amino)-N-(5-methylisoxa-
Unique reflections 3188 zol-3-yl)benzenesulfonamide (1e). Red solid; yield 80%; mp 170–
R1a [I > 2r (I)] 0.0507
172 °C. [M+], m/z = 635.70 IR: 3086, 2896, 2841, 2810, 1613
wR2b 0.1518
GOFc 1.00 (azomethine, C@NH–), 1470, 1400, 1345, 1258, 1164, 1085, 1037,
P P 935, 911, 857, 817, 738, 645, 572. 1H NMR (300 MHz, DMSO-d6):
a
R = ||Fo|  |Fc||/ |Fo|.
b P P
wR = { [w(Fo2Fc2)2]/ [w(F2o)2]}1/2; w = [r2(Fo)2 + (0.0948P)2]1 where
d 10.88 (1H, s, –OH); 10.38 (1H, s, –OH0 ); 9.03 (1H, s, 7-H); 8.95
P = (Fo2 + 2Fc2)/3. (1H, s, 70 -H); 7.91 (2Hs, d, J = 9 Hz, 10-H, 12-H); 7.86 (2Hs, d,
c
Goodness-of-fit.
J = 9 Hz, 100 -H, 120 -H); 7.63 (1H, s, 3-H); 7.61 (1H, s, 5-H); 7.52
(2Hs, d, J = 9 Hz, 9-H, 13-H); 7.49 (2H, d, J = 9 Hz, 90 -H, 130 -H),
NMR (300 MHz, DMSO-d6): d 10.90 (1H, s, SO2NH), 10.11 (1H, s, 6.57 (1H, s, 15-H), 6.54 (1H, s, 150 -H), 2.34 (3Hs, s, –CH3 at 4-C),
OH), 9.00 (1H, s, 7-H), 7.93 (2Hs, d, J = 9 Hz, 10-H, 12-H), 7.89 2.32 (3Hs, s, –CH3 at 40 -C), 2.28 (3H, s, –CH3 at 16-H), 2.26 (3H, s,
(1H, s, 3-H), 7.74 (1H, s, 5-H), 7.63 (2Hs, d, J = 9 Hz, 9-H, 13-H), –CH3 at 160 -H). 13C NMR (300 MHz, DMSO-d6): 170.9, 170.6,
6.15 (1H, s, 15-H), 2.27 (3Hs, s, –CH3 at 16-H); C NMR 13 166.9, 166.5, 157.2, 156.7, 153.8, 139.1, 138.8, 129.3, 129.1,
(300 MHz, DMSO-d6): 170.2, 166.0, 160.2, 158.5, 152.0, 140.5, 129.2, 128.8, 125.6, 122.7, 122.7, 118.4, 118.3, 96.1, 95.9, 15.6,
139.7, 138.0, 131.2, 128, 124.27, 122.8, 121, 95.5, 12.8. UV–Vis 12.7, 12.7. UV–Vis (kmax, nm (e, 103 M1 cm1) in acetonitrile):
(kmax, nm (e, 103 M1 cm1) in acetonitrile): 355 (25.0), 311 420 (88.2), 367 (66.3), 268 (6.8). Anal. Calcd. for C29H25N5O7S2
(31.8), 273 (39.8). Anal. Calcd. for C17H13Cl2N3O4S (426.27): C, (634.68): C, 54.88; H, 4.13; N, 13.24; S, 10.10%. Found: C, 54.57;
47.90; H, 3.07; N, 9.86; S, 7.52%. Found: C, 47.95; H, 3.15; N, H, 4.18; N, 13.28; S, 10.24%.
9.90; S, 7.58%.
(E)-4-((2-hydroxy-3,5-dimethylbenzylidene)amino)-N-(thiazol-2-
yl)benzenesulfonamide (2a). Yellowish orange solid; yield 85%; mp
(E)-4-((2-hydroxy-5-nitrobenzylidene)amino)-N-(5-methylisoxazol- 208–210 °C. [M+] m/z = 388.27; IR: 3145, 3026, 2914, 1578
3-yl)benzene sulfonamide (1d). Orange solid; yield 75%; mp 222– (azomethine, C@NH–), 1543, 1459, 1417, 1325, 1262, 1136
224 °C. [M+] m/z = 403.27; IR: 3089, 2991, 2906, 2843, 2808, (–S@O of SO2), 1086, 1051, 938, 840, 784, 742, 665, 566. 1H NMR
 S. Mondal et al. / Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy 150 (2015) 268–279
(300 MHz, DMSO-d6): d 12.93 (1H, s, OH); 8.88 (1H, s, 7-H); 7.85
(2Hs, d, J = 8.28 Hz, 10-H, 12-H); 7.51 (2Hs, d, J = 8.28 Hz, 9-H,
13-H); 7.25 (2Hs, m, 5-H, 15-H); 7.16 (1H, s, 3-H); 6.83 (1H, s,
16-H); 2.23 (3H, s, –CH3 at 2-C); 2.17 (3H, s, –CH3 at 4-C). 13C
NMR (300 MHz, DMSO-d6): 169.6, 157.2, 153.8, 140.2, 139.1,
135.8, 129.32, 128.6, 126.8, 125.6, 122.7, 118.8, 108.2, 18.0, 14.2.
UV–Vis (kmax, nm (e, 103 M1 cm1) in acetonitrile): 375 (18.9),
314 (35.2). Anal. Calcd. for C18H17N3O3S2 (387.07): C, 55.80; H,
4.42; N, 10.84; S, 16.55%. Found: C, 55.75; H, 4.45; N, 10.88; S,
16.50%.
(E)-4-((3,5-di-tert-butyl-2-hydroxybenzylidene)amino)-N-(thiazol-2-
yl) benzenesulfonamide (2b). Light yellow solid; yield 68%; mp
226–228 °C. M+: m/z = 472.18 IR: 3145, 3096, 2962, 2906, 2864,
1614, 1571 (azomethine, C@NH–), 1536, 1466, 1423, 1311, 1248,
1156 (–S@O of SO2), 1093, 988, 938, 861, 742, 657, 559. 1H NMR
(300 MHz, DMSO-d6): d 13.60 (1H, s, –OH); 8.98 (1H, s, 7-H);
7.86 (2H, d, J = 8.46 Hz, 10-H, 12-H); 7.53 (2H, d, J = 8.46 Hz, 9-H,
13-H); 7.49 (1H, s, 5-H); 7.41 (1H, s, 3-H); 7.25 (1H, d,
J = 4.56 Hz, 15-H); 6.80 (1H, d, J = 4.56 Hz, 16-H); 1.40 (9Hs, s,
-But at 2-C); 1.27 (9Hs, s, But at 4-C). 13C NMR (300 MHz,
DMSO-d6): 168.4, 158.2, 152.7, 151.2, 140.9, 140.6, 136.4, 128.5,
127.7, 125.13, 124.7, 122.3, 118.6, 108.1, 35.1, 34.4, 31.5, 29.6.
UV–Vis (kmax, nm (e, 103 M1 cm1) in acetonitrile): 360 (24.4),
314 (35.2). Anal. Calcd. for C24H29N3O3S2 (471.17): C, 61.12; H,
6.2; N, 8.91; S, 13.60%. Found: C, 61.03; H, 6.29; N, 8.88; S, 13.65%.
(E)-4-((3,5-dichloro-2-hydroxybenzylidene)amino)-N-(thiazol-2-yl)
benzenesulfonamide (2c). Orange solid; yield 84%; mp 226–228 °C.
M+, m/z = 427.97, IR: 3145, 3096, 3026, 2892, 1620, 1564 (azome-
thine, C@NH–), 1536, 1437, 1332, 1304, 1185, 1142 (–S@O of SO2),
1086, 932, 847, 798, 742, 700, 651, 559. 1H NMR (300 MHz,
DMSO-d6): d 10.11 (1H, s, –OH); 9.00 (1H, s, 7-H); 7.89 (2Hs, d,
J = 8.37 Hz, 10-H, 12-H); 7.77 (1H, s, 3-H); 7.73 (1H, s, 5-H); 7.58
(2H, d, J = 8.37 Hz, 9-H, 13-H); 7.25 (1H, d, J = 4.47 Hz, 15-H);
6.84 (1H, d, J = 4.47 Hz, 16-H); 5.81 (1H, bs, –SO2NH). 13C NMR
(300 MHz, DMSO-d6): 171.5, 159.2, 158.4, 154.0, 140.7, 140.4,
139.6, 139.0, 129.2, 128.5, 124.2, 122.3, 120.7, 108.7. UV–Vis (kmax,
nm (e, 103 M1 cm1) in acetonitrile): 354 (24.6), 330 (28.3), 280
(38.3). Anal. Calcd. for C16H11Cl2N3O3S2 (426.96): C, 44.87; H,
2.59; N, 9.81; S, 14.97%. Found: C, 44.76; H, 2.75; N, 9.77; S, 14.85%.
(E)-4-((2-hydroxy-5-nitrobenzylidene)amino)-N-(thiazol-2-yl)ben-
zenesulfonamide (2d). Orange solid; yield 84%; mp 246–248 °C. [M]
m/z = 405.2; IR: 3152, 3096, 3012, 2906, 2815, 1620, 1578 (azome-
thine, C@NH–), 1536, 1480, 1417, 1332, 1290, 1192, 1150 (–S@O of
SO2), 1093, 938, 861, 833, 735, 665, 567. 1H NMR (300 MHz,
DMSO-d6): d 12.40 (1H, s, –SO2NH); 10.28 (1H, s, –OH); 9.00 (1H,
s, 7-H); 8.68 (1H, s, 5-H); 8.42 (1H, s, 3-H); 7.88 (2H, d,
J = 8.40 Hz, 10-H, 12-H); 7.55 (2H, d, J = 8.40 Hz, 9-H, 13-H); 7.39
(1H, s, 2-H); 7.26 (1H, d, J = 4.42 Hz, 15-H), 6.8 (1H, d, J = 4.42 Hz,
16-H). 13C NMR (300 MHz, DMSO-d6): 171.6, 167.4, 160.2, 155.3,
141.5, 140.0, 139.8, 136.1, 131.0, 130.16, 128.85, 122.32, 120.70,
109.0. UV–Vis (kmax, nm (e, 103 M1 cm1) in acetonitrile): 416
(9.7), 370 (9.8), 294 (46.2). Anal. Calcd. for C16H12N4O5S2
(404.02): C, 47.52; H, 2.99; N, 13.85; S, 15.86. Found: C, 47.47; H,
3.05; N, 13.76; S, 15.92%.
4-((E)-(2-hydroxy-5-methyl-3-((E)-((4-(thiazol-2-ylsul-
fonyl)phenyl)imino)methyl) benzylidene)amino)-N-(thiazol-2-yl)ben-
zenesulfonamide (2e). Orange solid; yield 68%; mp 300 °C. [M]
m/z = 639.17; IR: 3469, 3363, 3104, 2921, 1571 (azomethine,
C@NH–), 1529, 1410, 1325, 1284, 1129 (–S@O of SO2), 1094, 925,
277
827, 686, 630, 559. 1H NMR (300 MHz, DMSO-d6): d 10.39 (1H, s,
–OH); 10.20 (1H, s, –OH0 ), 9.03 (1H, s, 7-H); 8.95 (1H, s, 70 -H);
7.84 (2H, d, J = 8.5 Hz, 10-H, 12-H); 7.81 (2H, d, J = 8.5 Hz, 10-H0 ,
12-H0 ), 7.53 (2H, s, 3-H, 5-H), 7.43 (2H, d, J = 8.5 Hz, 9-H, 13-H);
7.39 (2H, d, J = 8.5 Hz, 90 -H, 130 -H); 7.25 (1H, s, 15-H); 7.16 (1H,
d, 150 -H), 6.68 (1H, d, J = 4.57 Hz, 16-H); 6.54 (1H, d, J = 4.57 Hz,
160 -H); 5.95 (1H, s, –SO2NH); 5.81 (1H, s, –SO2NH); 2.32 (3H, s,
–CH3 at 4-C). 13C NMR (300 MHz, DMSO-d6): 169.9, 169.6, 157.2,
157.2, 153.8, 140.3, 140.1, 139.2, 139.1, 129.8, 129.1, 128.7,
128.6, 127.04, 122.7, 122.6, 118.9, 118.7, 108.2, 108.1, 14.8. UV–
Vis (kmax, nm (e, 103 M1 cm1) in acetonitrile): 360 (14.3), 302
(33.2). Anal. Calcd. for C27H21N5O5S4 (638.05): C, 50.77; H, 3.47;
N, 13.16; S, 20.08%. Found: C, 50.85; H, 3.53; N, 13.10; S, 19.97%.
X-ray crystal structure analysis of 1c
(E)-4-((3,5-Dichloro-2-hydroxybenzylidene)amino)-N-(5-meth
ylisoxazol-3-yl)benzene- sulfonamide (1c) was crystallized by
slow diffusion of CH2Cl2 solution to hexane (0.17  0.13 
0.10 mm). Data were collected (Table 6) by Bruker Smart Apex II
CCD Area Detector at 293(2) K. Diffraction was recorded with 2h
in the range 2.11 6 h 6 25.00°. Fine-focus sealed tube was used
as the radiation source of graphite-monochromatized MoKa radia-
tion (k = 0.71073 Å). Data were corrected for Lorentz and polariza-
tion effects and an empirical absorption correction in the h k l
range: –12 6 h 6 12; –14 6 k 6 14; –20 6 l 6 20. Multi-scan
absorption corrections were applied. The structure was solved by
direct methods and refined by full-matrix least-squares techniques
on F2 using the SHELXL-97 [30]. The absorption corrections were
done by the multi-scan technique. All data were corrected for
Lorentz and polarization effects, and the non-hydrogen atoms were
refined anisotropically. Hydrogen atoms were generated using
SHELXL-97 and their positions calculated based on the riding mode
with thermal parameters equal to 1.2 times that of the associated C
atoms, and participated in the calculation of the final R-indices.
The ORTEP [31] plot of the crystal is depicted in Fig. 1.
DFT computation data
Geometry optimization of all the compounds were carried out
in B3LYP [32] using Gaussian09 software [33] package. The
6-31G(d, p) basis set was assigned for all the elements except sul-
fur. For sulfur atom 6-31+G(d, p) basis set was used. The DFT
Optimized structures, calculated Molecular Orbital diagrams and
their composition, energy correlation data are given in
Supplementary materials (Figs. S13–S16).
Pharmacology
Antimicrobial assay
All the synthesized compounds were tested against several con-
trol strain as well as several clinical isolates of sulfonamide resis-
tant strains. The used control strains were E. coli ATCC25922,
Pseudomonas aeruginosa ATCC27863, Salmonella typhi MTCC734,
Klebsiella. penumonia ATCC 714, S. aureus ATCC21737 and
Staphylococcus epidermidis NCIM 2493. Minimum inhibitory con-
centration (MIC) values of compounds and antibiotics were deter-
mined according to CLSI guidelines by broth microdilution method
[34]. MIC values were determined where no visible growth was
observed. The culture conditions and bacterial growth were moni-
tored as described earlier by Samanta et al. [35] and all indepen-
dent experiments were repeated three times. The DHFR inhibitor,
trimethoprim in combinations studies were performed by broth
micro dilution checkerboard method [36]. The RFICs were
278 S. Mondal et al. / Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy 150 (2015) 268–279
calculated as follows: RFIC = FICA + FICB, where FIC A is the MIC of
drug A in the combination/MIC of drug A alone, and FIC B is the MIC
of drug B in the combination/MIC of drug B alone [37]. The combi-
nation is considered synergistic when the RFIC is 60.5, indifferent
when the RFIC is >0.5 to <2, and antagonistic when the RFIC is P2.
Detection of sulfonamide resistant gene:Primer design, PCR
amplification and sequencing of Sul genes
Clinically isolated strains were selected on the basis of their sul-
fonamide resistant ability following disc diffusion methods. Two
strains were selected due to their highest resistant ability among
them. The bacterial strains were isolated clinically from infected
patients. DNA was isolated from resistant strains following
Sambrook et al. [38] and identified following 16S rDNA sequencing
using the primers; forward primers, AGAGTTTGATCCTGGCTCAG
and reverse primer, AAGGAGGTGATCCAGCCGCA. High level of
sul1 gene expression in the strains has been confirmed by PCR
using the primers, forward primer: CTTCGATGAGAGCCGGCGGC,
reverse primer: GCAAGGCGGAAACCCGCGCC and sul2 gene; for-
ward primer: TCGTCAACATAACCTCGGACAG, reverse primer:
GTTGCGTTTGATACCGGCAC of specific gene sequences from the
NCBI database following Byrne-Bailey et al. [39]. Using those pri-
mers (20 pmol each) and 200 mg DNA of each strain in a 50 lL
reaction buffer containing 2 mM dNTP, 1.5 mM magnesium chlo-
ride and 5 units Taq polymerase (Bioline, USA), PCR was performed
in a thermocycler (ABI, USA). The PCR conditions were an initial
denaturation for 1 min and 30 s, followed by 30 cycles of denatur-
ing at 94 °C for 45 s, annealing at 58–60 °C for 30 s and extension at
72 °C for 1 min and a final extension step at 72 °C for 10 min. PCR
products were analyzed by 1.0% agarose gel electrophoresis,
stained with ethidium bromide and visualized under
UV-transilluminator. The PCR amplified DNA was eluted from gel,
purified by QIA quick gel extraction kit (QIAGEN), sequenced using
Bigdye terminator kit (ABI) and same primers (used for PCR) in an
automated DNA sequencer (ABI model 3100, Hitachi).
Cytotoxicity assay
MTT [(3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphen
yl)-2-(4-sulfophenyl)-2H tetrazolium)], assay was performed to
determine cell cytotoxicity following the method described earlier
by Mandal et al. [40]. 3T3, primary mouse embryonic fibroblast
(2.0  103) cells were seeded in 100 lL complete DMEM medium
per well in 96 well plates. Plates were incubated at 37 °C in 5%
CO2 for 24 h for cell attachment. Cells were treated with individual
compounds with variable concentration from 5 to 1000 lg mL1
and incubated at 37 °C in 5% CO2 for 48 h. Three wells were used
in the 96 well plates for each derivative and repeated three times.
For the MTT assay, thiazolyl blue tetrazolium bromide solution
(100 lL; 1 mg mL1) in incomplete medium was added and this
mixture incubated for 4 h. After that, 100 lL of dimethylsulphox-
ide (DMSO) was added and the plates were rotated for 5 min.
Optical density was recorded at 550 nm with DMSO as the blank.
Percentage of cell viability was plotted against concentrations of
derivatives. Cells treated with no compound used as control.
In silico docking studies
Molecular docking was used to predict how a small molecule
(ligand) interact with protein and plays a major role to its biolog-
ical activity [41]. Crystal structure of DHPS (Dihydroptorat
Synthase of yersinia pestis, PDB ID 3TZF) was downloaded from
RCSB protein data bank (http://www.pdb.org) and used for dock-
ing. The enzyme was co-crystallized with sulfamethoxazole, 6-hy
droxymethylpterin-diphosphate and magnesium ion. We per-
formed the in silico docking studies by using CDOCKER module of
Receptor–Ligand interactions protocol section of Discovery Studio
client 3.5 [42]. Initially there was a pretreatment process for both
the protein and ligand. Energy minimized structure of all the com-
pounds (previously done under ‘‘X-ray crystal structure analysis of
1c’’) were taken for ligand preparation. Ligand preparation was
done using Prepare Ligand module in Receptor–Ligand interactions
tool of Discovery studio 3.5 and prepared ligands were used for
docking. Protein preparation was done under Prepare Protein mod-
ule of Receptor–Ligand interactions tool of Discovery Studio 3.5
and that was used for docking. The prepared protein was consid-
ered as receptor and active site was selected based on the ligand
binding domain of sulfamethoxazole, the pre-existing ligand was
removed and prepared ligand was placed. Most favorable docked
pose was selected based on the minimum free energy of protein–
ligand complex and analyzed to investigate the interaction.
ADMET prediction
Adsorption, distribution, metabolism, excretion and toxicity
(ADMET) prediction was done in ADMET descriptor module of
Small molecules protocol of Discovery studio client 3.5.
Druglikeness of the compounds was checked too following
Lipniski’s rule of five [43,44]. Using ADMET module of small mole-
cule protocol of Discovery studio 3.5 software ADMET property and
toxicity of the compounds have been checked.
Acknowledgments
Financial support from West Bengal DST (228/1(10)/(Sanc.)/S
T/P/S&T/9G-16/2012), Kolkata and University Grants Commission
(F.42-333/2013 (SR)), New Delhi are gratefully acknowledged.
One of us (S.M.) thanks UGC, New Delhi for providing fellowship.
We heartily thank Dr. Prabir Ojha of Department of
Pharmaceutical Technology, Jadavpur University for helping us to
work with Discovery studio client 3.5.
Appendix A. Supplementary data
Crystallographic data for the structure of 1c was submitted to
the Cambridge Crystallographic Data center, CCDC No. 1014370
for (E)-4-((3,5-Dichloro-2-hydroxybenzylidene)amino)-N-(5-meth
ylisoxazol-3-yl)benzene- sulfonamide (1c). These data could be
obtained at the free of cost via http://www.ccdc.cam.ac.uk/conts/
retrieving.html, or from the Cambridge Crystallographic Data
Centre, 12 Union Road, Cambridge CB2 1EZ, UK; fax: +44 1223
336 033; or e-mail: deposit@ccdc.cam.ac.uk. Supplementary data
associated with this article can be found, in the online version, at
http://dx.doi.org/10.1016/j.saa.2015.05.049.
References
[1] G. Domagk, Dtsch. Med. 61 (1935) 250–253.
[2] S.J. Thiele-Bruhn, Plant Nutr. Soil Sci. 166 (2003) 145–167.
[3] V.S. Misra, V.K. Saxena, R. Srivastava, J. Indian Chem. Soc. 59 (1982). 781–781.
[4] F. Zani, P. Vicini, Arch. Pharm. 331 (1998) 219–223.
[5] T.H. Maren, Annu. Rev. Pharmacol. Toxicol. 16 (1976) 309–327.
[6] C.T. Supuran, A. Scozzafava, B.C. Jurca, M.A. Iiies, Eur. J. Med. Chem. 33 (1998).
83–83.
[7] G.C. Slatore, A.S. Tilles, Immunol. Allergy Clin. North Am. 24 (2004) 477–490.
[8] G. Choquet-Kastylevsky, T. Vial, J. Descotes, Curr. Allergy Asthma Rep. 2 (2002)
16–25.
[9] A. Carr, A.S. Gross, J.M. Hoskins, R. Penny, A.D. Cooper, Aids 8 (1994) 333–337.
[10] M.F. Gordin, L.G. Simon, B.C. Wofsy, J. Mills, Ann. Intern. Med. 100 (1984) 495–
499.
[11] L.S. Walmsley, S. Khorasheh, J. Singer, O. Djurdjev, J. Acquir. Immunodefic.
Syndr. Hum. Retrovirol. 19 (1998) 498–505.
[12] S. Mukesh, E.C. Alastair, Chem. Biol. Interact. 142 (2002) 155–173.
[13] J.P. Sanderson, D.J. Naisbitt, J. Farrell, C.A. Ashby, M.J. Tucker, M.J. Rieder, M.
Pirmohamed, S.E. Clarke, B.K. Park, J. Immunol. 178 (2007) 5533–5542.
[14] G.G. Mohamed, C.M. Sharaby, Spectrochim. Acta A 66 (2007) 949–958.
 S. Mondal et al. / Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy 150 (2015) 268–279
[15] M.S. Iqbal, A.H. Khan, B.A. Loothar, I.H. Bukhari, Med. Chem. Res. 18 (2009) 31–
42.
[16] Z.H. Chohan, M. Ul-Hassan, K.M. Khan, C.T. Supuran, J. Enzyme Inhib. Med.
Chem. 20 (2005) 183–188.
[17] Z.H. Chohan, H.A. Shad, Appl. Organomet. Chem. 25 (2011) 591–600.
[18] D.N. Dhar, C.L. Taploo, J. Sci. Ind. Res. 41 (1982) 501–506.
[19] P. Przybylski, A. Huczynski, K. Pyta, B. Brzezinski, F. Bartl, Curr. Org. Chem. 13
(2009) 124–148.
[20] A.O. De Souza, F.C.S. Galetti, C. Silva, B. Bicalho, M.M. Parma, S.F. Fonseca,
Quim. Nova 30 (2007) 1563–1566.
[21] Z. Guo, R. Xing, S. Liu, Z. Zhong, X. Ji, L. Wang, Carbohydr. Res. 342 (2007)
1329–1332.
[22] C. Wansong, O. Weizhu, W. Liqiang, H. Yuanqiang, C. Jiashun, Li Juan, L. You-
Nian, Dalton Trans. 42 (2013) 15678–15686.
[23] M. Krátký, J. Vinsová, M. Volková, B. Vladimír, F. Trejtnar, J. Stolaríková, Eur. J.
Med. Chem. 50 (2012) 433–440.
[24] L.N. Ferguson, Chem. Rev. 38 (1946) 227–254.
[25] O. Skold, Drug Resist. Updat. 3 (2000) 155–160.
[26] G. Swedberg, C. Fermer, O. Skold, Adv. Exp. Med. Biol. 338 (1993) 555–558.
[27] L. Sundstro, P. Radstrom, G. Swedberg, O. Skold, Mol. Gen. Genet. 213 (1988)
191–201.
[28] O. Skold, Antimicrob. Agents Chemother. 9 (1976) 49–54.
[29] V. Perreten, P. Boerlin, Antimicrob. Agents Chemother. 47 (2003) 1169–1172.
[30] G.M. Sheldrick, SHELX97, Programs for Crystal Structure Analysis (release 97–
2), University of Göttingen, Göttingen, Germany, 1997.
[31] L.J. Farrugia, J. Appl. Crystallogr. 30 (1997) 565–566.
[32] A.D. Becke, J. Chem. Phys. 98 (1993) 5648–5652.
[33] M.J. Frisch, G.W. Trucks, H.B. Schlegel, G.E. Scuseria, M.A. Robb, J.R. Cheeseman,
G. Scalmani, V. Barone, B. Mennucci, G.A. Petersson, H. Nakatsuji, M. Caricato,
279
X. Li, H.P. Hratchian, A.F. Izmaylov, J. Bloino, G. Zheng, J.L. Sonnenberg, M.
Hada, M. Ehara, K. Toyota, R. Fukuda, J. Hasegawa, M. Ishida, T. Nakajima, Y.
Honda, O. Kitao, H. Nakai, T. Vreven Jr., J.A. Montgomery, J.E. Peralta, F.M.
Ogliaro, J. Bearpark, J. Heyd, E. Brothers, K.N. Kudin, V.N. Staroverov, R.
Kobayashi, J. Normand, K. Raghavachari, A. Rendell, J.C. Burant, S.S. Iyengar, J.
Tomasi, M. Cossi, N. Rega, J.M. Millam, M. Klene, O. Yazyev, A.J. Austin, R.
Cammi, C. Pomelli, J.W. Ochterski, R.L. Martin, K. Morokuma, V.G. Zakrzewski,
G.A.P. Salvador, J.J. Dannenberg, S. Dapprich, A.D. Daniels, Ö. Farkas, J.B.
Foresman, J.V. Ortiz, J. Cioslowski, D.J. Fox, Gaussian Inc., CT, Wallingford,
2009.
[34] Twentieth Informational Supplement, CLSI document M100-S20-U, CLSI,
Wayne, 2010.
[35] T. Samanta, G. Roymahapatra, W.F. Porto, S. SethGhorai, S. Saha, J. Sengupta,
O.L. Franco, J. Dinda, S.M. Mandal, PLoS One 8 (2013) 58346–583457.
[36] G. Orhan, A. Bayram, Y. Zer, I. Balchi, J. Clin. Microbiol. 43 (2005) 140–143.
[37] M.G. Botelho, J. Dent. 28 (2000) 565–570.
[38] J. Sambrook, E.F. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual,
second ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New
York, USA, 1989.
[39] K.G. Byrne-Bailey, W.H. Gaze, P. Kay, A.B. Boxall, P.M. Hawkey, E.M.
Wellington, Antimicrob. Agents Chemother. 53 (2009) 696–702.
[40] D. Banerjee, S.M. Mandal, A. Das, M.L. Hegde, K.K. Bhakat, J. Biol. Chem. 286
(2011) 6006–6016.
[41] P. Kirkpatrick, Nat. Rev. Drug Discov. 3 (2004) 294–299.
[42] Discovery Studio 3.5 is A Product of Accelrys Inc., San Diego, CA, USA.
[43] C.A. Lipinski, F. Lombardo, B.W. Dominy, P.J. Feeney, Adv. Drug Deliv. Rev. 46
(2001) 3–26.
[44] C.A. Lipinski, Drug Discov. Today 1 (2004) 337–341.