Industrial Crops and Products 98 (2017) 108–115

Contents lists available at ScienceDirect

Industrial Crops and Products

journal homepage: www.elsevier.com/locate/indcrop

Citrus species essential oils and their components can inhibit or

stimulate fungal growth in fruit
Daniel L.R. Simas a , Silésia H.B.M. de Amorim a , Fatima R.V. Goulart b , Celuta S. Alviano b ,
Daniela S. Alviano b , Antonio Jorge R. da Silva a,∗
a
Instituto de Pesquisas de Produtos Naturais Walter B. Mors, Universidade Federal do Rio de Janeiro, Rio de Janeiro, RJ, Brazil
b
Instituto de Microbiologia Paulo de Goes, Universidade Federal do Rio de Janeiro, Rio de Janeiro, RJ, Brazil

a r t i c l e i n f o a b s t r a c t

Article history: Penicillium digitatum Pers., Trichoderma viride Pers. and Botrytis cinerea Pers. are typical post-harvested
Received 25 August 2016 fruits pathogens. The use of essential oils to control fruit fungal diseases is an alternative to syn-
Received in revised form 9 January 2017 thetic fungicides. The objective of this research was to evaluate the in vitro antifungal activity of the
Accepted 16 January 2017
hydrodistilled fruit peel essential oils of Citrus limon (L.) Burm. f., C. latifolia Tanaka ex Q. Jimenez, C.
aurantifolia (Christm.) Swingle and C. limonia Osbeck extracts against the mentioned phytopathogenic
Keywords:
fungi. The essential oils were analyzed by gas chromatography-flame ionization detection (GC/FID),
Citrus
gas chromatography-mass spectrometry (GC/MS) and their compositions were determined. Minimum
Post harversting
Fungal pathogens
inhibitory concentration assay confirmed only modest antifungal activity for all essential oils, with best
Essential oils results against B. cinerea (C. limonia and C. limon = 312 ␮g/mL; C. aurantifolia and C. latifolia = 625 ␮g/mL).
However, according to a volatile activity experiment, which was developed to evaluate the effects of
citrus volatiles, citral and other pure chiral components, the essential oils and their main volatile com-
ponents displayed a differential influence on the growth of the three fungal species tested. While all oils
inhibited growth of B. cinerea and T. viride, the opposite was observed for P. digitatum, in which fungal
growth was stimulated. A prevalence of inhibitory effects was observed for pure chiral components when
tested against B. cinerea and T. viride. However, with exception to citral, (+)-␣-pinene and (+)-␤-pinene,
all pure chiral volatile compounds stimulated P. digitatum growth.
© 2017 Elsevier B.V. All rights reserved.

1. Introduction conventional synthetic fungicides. Success of these strategies will

The losses caused by fruits fungal diseases during storage and
transportation are significant. In general, infections may occur
throughout all the stages in the field and during harvest, storage
and transportation, being caused by injuries which allow entry
of pathogens. Diseases such as brown rot, septoria spot, anthrac-
nose, clear rot, green/blue mold, sour rot caused by, respectively,
Phytophthora spp., Septoria citri, Colletotrichum gloeosporioides,
Penicillium spp and Galactomyces citri-aurantii, for example, emerge
as a result of wounding caused by handling in the field or in the
subsequent stages after harvesting.
Alternative strategies for the control of post-harvest diseases
seek the integration of low-risk treatments to reduce the use of
∗ Corresponding author at: Instituto de Pesquisas de Produtos Naturais Walter B.
Mors, Avenida Carlos Chagas Filho, 373 – Bloco H, Centro de Ciências da Saúde –
UFRJ, 21941 220, Rio de Janeiro, Brazil.
E-mail address: antonio jrs@hotmail.com (A.J.R. da Silva).
minimize health and environmental risks (Caccioni et al., 1998;
Viuda-Martos et al., 2008). Study of plant/pathogen interaction may
provide sustainable and environmentally friend solutions for the
control of plant disease in agricultural crops.
Essential Oils (EO) have shown satisfactory results in con-
trolling postharvest diseases by providing fungitoxic action. For
example, the oils of Mentha arvensis L., Ocimum canum Sims. and
Zingiber officinale Roscoe were found to exhibit absolute fungi-
toxic activity against P. italicum (Tripathi et al., 2004). The essential
oils from two clonal types of Thymus vulgaris L. were character-
ized and tested as antifungal against Botrytis cinerea and Rhizopus
stolonifera, being highly effective in reducing gray mould and soft
rot incidence in strawberry fruits caused by, respectively, B. cinerea
and R. stolonifera (Reddy et al., 1998). Viuda-Martos et al. (2008)
demonstrated that citrus essential oils can be considered suitable
alternatives in the food industry to control the growth of moulds
commonly associated with food spoilage as Aspergillus flavus and
Penicillium verrucosum, amongst others.

http://dx.doi.org/10.1016/j.indcrop.2017.01.026
0926-6690/© 2017 Elsevier B.V. All rights reserved.
 D.L.R. Simas et al. / Industrial Crops and Products 98 (2017) 108–115
Citrus fruits are produced and consumed in large scale around
the world, either in natura or as juices (Brown, 1989; Davidson and
Harrison, 2002). The fruit peel essential oils are by products of the
citrus juice industry and are of great interest as raw materials for
pharmaceutical, cosmetics and food industries due to their aro-
matic properties and antimicrobial activities (Cristani et al., 2007;
Viuda-Martos et al., 2008). Moreover, these EO are generally consid-
ered safe to use in foods and beverages and are known as generally
recognized as safe (GRAS) (Kabara, 1991; Viuda-Martos et al., 2007).
As part of our systematic study on the role of the secondary
metabolites of citrus fruits in the chemical defence against their
pathogens, the effect of citrus essential oils on cultivated plant
pathogenic fungi was evaluated. The results of such evaluation,
made with essential oils from four citrus species (limes and lemons)
against one pathogenic fungus in citrus fruits (Penicillium digita-
tum), one endophytic fungus in citrus fruits (Trichoderma viride)
and one general pathogen of fruits (Botrytis cinerea) are reported. T.
viride is an extensively studied saprophytic fungus due to its poten-
tial uses in biocontrol (Smitha et al., 2014). It is known to produce
enzymes (mainly hydrolytic enzymes) with antagonistic proper-
ties against other fungi (Smitha et al., 2014), including P. digitatum
(Borras and Aguilar, 1990) and B. cinerea (Bogumił et al., 2013; Talla
et al., 2015).
The effect of some components of these oils, on fungus growth
was also evaluated.
2. Material and methods
2.1. Material
Fruits of Citrus limon (L.) Burm. f., “siciliano” lemon, C. latifo-
lia Tanaka ex Q. Jimenez, “tahiti” lime, C. aurantifolia (Christm.)
Swingle, “mirim” lime and C. limonia Osbeck, “cravo” lime were
collected in local markets in Rio de Janeiro, Brazil. The botani-
cal identification was provided by Dr. Rosana Conrado Lopes, and
voucher specimens were deposited in the RFA Herbarium, Federal
University of Rio de Janeiro/Brazil under the following registration
numbers: C. limonia (RFA-39493), C. aurantifolia (RFA-39492), C.
limon (RFA-39494) and C. latifolia (RFA-39491).
2.2. Sample preparation
Fruit peels (150.0 g) were removed and homogenized in 1 L of
distilled water using a laboratory blender. The resulting mixture
was immediately subjected to hydro distillation for 2 h in a Cle-
venger apparatus. Once extracted, the oils were dried over Na2 SO4
and stored at −18 ◦ C. The average extraction yield was calculated
as the mass percentage of oil obtained relative to the mass of peel
extracted.
2.3. Pure compounds
All pure compounds used in bioassays or on identifica-
tion of volatiles were obtained from Sigma-Aldrich Co (Brazil):
(+)-␣-pinene (99%), (+)-␤-pinene (99%), (−)-␣-pinene (99%), (+)-
␤-pinene (99%), citral (neral + geranial − 99%), ␥-terpinene (99%),
(+)-limonene (99%) and (−)-limonene (99%).
2.4. GC–MS
Analyses were made on a Shimadzu QP2010 Plus (Tokyo,
Japan) system using a DB5-MS fused silica capillary column (30 m,
0.25 mm I.D., 0.25 ␮m film thickness). The oven temperature was
programmed to rise from 60 ◦ C to 246 ◦ C at 3 ◦ C/min and then hold
at this temperature for 20 min. The carrier gas was He (99.999%)
109
with a flow rate of 1.03 mL/min and injector and interface tem-
peratures were maintained at 250 ◦ C and 200 ◦ C, respectively. Oil
samples were diluted in CHCl3 and 1 ␮L aliquots were injected in
split mode (split ratio 1:50). Mass spectra were obtained under
electron ionization at 70 eV with a mass range m/z of 40–1000 D.
2.5. Quantitative analysis by GC/FID
A Shimadzu GC 2010 (Tokyo, Japan) equipped with a flame
ionization detector on an Agilent DB5 fused silica capillary col-
umn (30 m, 0.25 mm i.d., film thickness 0.25 ␮m) was utilized. The
oven temperature was programmed to rise from 60 ◦ C to 246 ◦ C
at 3 ◦ C/min, then hold at 246 ◦ C for 20 min. Injector and detector
temperatures were maintained at 220 ◦ C and 290 ◦ C, respectively.
The oil samples were dissolved in CHCl3 , and 1 ␮L aliquots were
injected in split mode with split ratio of 1:50 using H2 as the carrier
gas (1.44 mL/min). Kovats retention indices (KI) of the compounds
were determined relative to the retention times of a series of n-
alkanes (C7 –C30 ) with linear interpolation. The relative amounts of
the components were calculated based on GC peak areas without
correction factors.
2.6. Analysis by HS/SPME-GC/FID (Headspace solid/phase micro
extraction-gas chromatography with flame ionization detector)
A divinylbenzene/carboxen/polydimethylsiloxane
(DVB/CAR/PDMS) fiber was used for sampling. Before and after use,
the fiber was conditioned by heating on the gas chromatograph
injector (300 ◦ C) for 30 min to remove possible contaminants. In
addition, prior to each analysis one blank injection was made to
confirm absence of contamination. An aliquot of 5 ␮L of Citrus fruit
oil was added to a filter paper circle (diameter: 5.0 mm – Whatman
(New Jersey, United States)) and the filter paper was placed in an
18 mL amber vial. The vial was tightly closed and, after a 10 min
waiting at 23 ◦ C to promote equilibration, the fiber was inserted
into the vial and kept in headspace for 20 min. After this time,
the fiber was retired and then taken to chromatograph injector
where it remained for 60 s to desorption before chromatographic
analysis. Chromatographic analysis was performed on a Shimadzu
GC 2010 (Tokyo, Japan) equipped with a flame ionization detector.
A DB5 silica capillary column (30 m, 0.25 mm i.d., film thickness
0.25 ␮m) was used. The oven temperature program was: 50 ◦ C
(3 min), 50–240 ◦ C at 5 ◦ C/min and then the temperature was
maintained at 240 ◦ C for 10 min. Injector and detector temper-
atures were maintained at 250 ◦ C and 290 ◦ C, respectively. The
relative amounts of the components were calculated based on GC
peak areas without correction factors.
2.7. HS/SPME-GC/MS
The chemical composition profiles of the substances present
in the headspace were obtained GC/MS on a Shimadzu 2010
Plus GC/MS system (Tokyo, Japan). The substances were sepa-
rated in a fused silica Agilent DB5 capillary column (30m, 0.25 mm
id, 0.25 ␮m.). The oven temperature program was: 50 ◦ C (3 min),
50–240 ◦ C at 5 ◦ C/min and then maintained at 240 ◦ C for 10 min. The
mass spectrometer was operated under the following conditions:
Interface temperature: 275 ◦ C, electron ionization at 70 eV and scan
range from 40 to 1000 Da. Injector and interface temperatures were
maintained at 250 ◦ C and 200 ◦ C, respectively. The carrier gas used
was He (99.999%) under a flow rate of 1 mL/min.
2.8. HS/SPME-GC/FID enantiomer characterization
The same chromatographic system above was used for chiral
analysis. The chromatographic column was replaced by a Restek
110 D.L.R. Simas et al. / Industrial Crops and Products 98 (2017) 108–115
RTX-5MS (15m, 0:32 mm id, 0.5 um. (Pennsylvania, United States)).
Injector and detector temperatures were maintained at 250 ◦ C. The
oven temperature was programmed from 50 to 230 ◦ C at 3 ◦ C/min
and then maintained at 230 ◦ C for 30 min.
2.9. Fungal cultivation
Penicillium. digitatum Pers. and Botrytis cinerea Pers. strains were
obtained from Filamentous Fungi Culture Collection (CCFF – Insti-
tuto Oswaldo Cruz/FIOCRUZ, Rio de Janeiro, Brazil) and Trichoderma
viride Pers. was the unknown strain isolated from a C. limonia spec-
imen collected at Itaboraí (22◦ 38 18.0“S and 42◦ 58 58.3“W), Rio
de Janeiro, Brazil which was identified on this work as described
below.
All three fungi were cultivated in Petri dishes containing potato
dextrose agar (PDA) for 1 week at 37 ◦ C. Spores suspensions
were obtained in distilled water, sedimented by centrifuga-
tion at 3000 × g for 5.0 min and resuspended and adjusted to
1 × 103 spores/ml using a hemocytometer.
2.10. Identification of the unknown fungal strain
The fungal strain, isolated from a fruit specimen of C. limonia
collected at Itaboraí, Rio de Janeiro, Brazil, was grown in Sabouraud
liquid medium for 1 week at 37 ◦ C. Its genomic DNA was obtained
using the ZR Fungal/Bacterial DNA MiniPrepTM kit (Zymo Research
Corporation, Irvine, CA, USA) according to the manufacturer’s
instructions. The DNA obtained was used for the PCR amplification
of the internal transcribed spacer (ITS) region using the primers
ITS1f (5 CTTGGTCATTTAGAGGAAGTAA3 ) (Gardes and Bruns, 1993)
and ITS4 (5 TCCTCCGCTTATTGATATGC 3 ) (White et al., 1990).
The 25 ␮L reaction mix contained 0.5 ␮L of the template DNA
(50–100 ng), 2.5 mM MgCl2 , 0.5 mM of each dNTPs, 1 U of Taq DNA
®
polymerase, 1 x GoTaq Flexi Buffer (Promega, Madison, WI, USA)
and 0.2 ␮M of each primer. The amplification conditions were:
1x (5 min, 94 ◦ C), 30x (30 s, 94 ◦ C; 30 s, 57 ◦ C; 1 min, 30 s, 72 ◦ C),
and a final 5 min extension at 72 ◦ C. Negative controls (without
DNA) were run in all amplifications. The PCR products were visu-
alized by agarose gel electrophoresis (1.4%) followed by staining
with ethidium bromide. The fragments obtained were sequenced
in an ABI Prism 3100 automatic sequencer (Applied Biosystems
Inc., Carlsbad, CA, USA) using Macrogen facilities (Geumcheon-Gu,
Seoul, Korea). The partial ITS sequences were compared with the
sequences deposited in the GenBank database using the BLAST-N
tool (Altschul et al., 1997).
2.11. Minimum inhibitory concentration (MIC) assays
Isolated fungi were grown in PDA at room temperature for 7–10
days. The determination of essential oils MIC was based on the
international standard methodology (M38-A2) of Clinical and Lab-
oratory Standards Institute (CLSI, 2008). The procedure consists on
serial dilutions of essential oil and their components in RPMI cul-
ture medium in 96 wells microtiter plates. In each well 100 ␮L of
the inoculum was inoculated (1 × 106 CFU/mL) in a final volume
of 200 ␮L of culture media, supplemented with oil in their respec-
tive dilutions (2500 ␮g/mL; 1250 ␮g/mL; 625 ␮g/mL; 312 ␮g/mL;
158 ␮g/mL; 79 ␮g/mL; 64 ␮g/mL and 32 ␮g/mL), obtaining the sus-
pension of 5 × 105 CFU/mL. The Minimum Inhibitory Concentration
(MIC) was visually obtained by turbidity and by the addition of a
cell viability indicator (Resazurin 0.005% (Sigma-Aldrich, Brazil) in
Phosphate-Buffered Saline (PBS) pH = 7.2).
2.12. Volatile activity experiment
A bioassay method was developed to evaluate the effects of cit-
rus volatiles and pure compounds on growth of fungal pathogens.
First, 15 mL of PDA culture was spread in the bottom of Petri
dishes (diameter 6 cm) and then a fungus conidia suspension
was inoculated in Petri dish contained a filter paper circle stuck
with double-sided tape. Five different amounts of citrus oils
(0.65 ␮L, 1.25 ␮L, 2.50 ␮L, 5 ␮L and 10 ␮L) were added to the filters.
Pure (+)-␣-pinene, (+)-␤-pinene, (−)-␣-pinene, (+)-␤-pinene, cit-
ral (neral + geranial), ␥-terpinene, (+)-limonene and (−)-limonene
were assayed at concentrations of 1.25 ␮L and 5 ␮L of each com-
pound. The control sample was prepared without oil and blank
replicates were obtained without fungi inoculation. After oil inser-
tion on the filter paper, the plates were sealed with PVC tape and
incubated at 25 ◦ C for 72 h. The percentages of fungal growth were
evaluated as follows: photographic images of all plates were taken
with a Nikon Coolpix L830 camera in darkroom (150 mm away
from the plates). The images were evaluated using the software
®
ImageJ (Abramoff et al., 2004), to calculate the pixel count of each
image. To the seeded but not developed plates and to the plates
where mycelial growth occupied the whole plate surface, values
of, respectively, 0 and 100% were attributed. The pixel counts of
plates with intermediate growth were interpolated between the
two previous values. All experiments were conducted in a com-
pletely randomized block design with three replicates. Each plate
sample was photographed in triplicate. GraphPad Prism 5 software
was used for the construction of graphics.
2.13. Statistical analysis
To compare different samples, data were subjected to statistical
analysis of variance (one way ANOVA) with Tukey’s test (5% sig-
nificance). Results were considered significant when p < 0.05. The
GraphPad Prism 5 software was used to perform the analysis.
3. Results and discussion
Table 1 shows the chemical compositions of the four citrus
essential oils. All oils analyzed contain limonene as the major com-
pound. C. limonia sample displayed the highest limonene content
(65.7%) followed by C. limon (53.9%), C. latifolia (35.4%) and C. auran-
tifolia (31.1%). Other compounds such as ␤-pinene, ␥-terpinene,
geranial, ␣-pinene and terpineol contribute significantly to oil final
composition, which were comparable to the typical compositions
reported in literature (Dugo et al., 2011)
The essential oils of the four citrus species were tested against
three fungi typically found in post harvested fruits: B. cinerea (post-
harvest pathogen in fruits such as strawberry and mango, but not
in citrus fruits), T. viride (fungus present in citrus fruits but not
causing serious problems to the plant) and P. digitatum (fungus
causing serious problems in postharvest citrus and other fruits)
were chosen for the tests. To assess the activity of the essential
oils against the three fungal strains, the minimum inhibitory con-
centration (MIC) methodology according to CLSI was applied. The
results of this test (Table 3) showed that there was no growth
inhibition of P. digitatum and T. viride by the oils studied, while
B. cinerea growth was inhibited by all oils, being C. limonia and C.
limon (312 ␮g/mL) more active than C. aurantifolia and C. latifo-
lia (625 ␮g/mL). Although disappointing, these first results may be
explained: The MIC methodology is a standard in the evaluation of
antimicrobial activity. Nevertheless, the high hydrophobicity and
volatility of the essential oils may introduce many experimental
problems. For example: in diffusion assays, where the EO com-
ponents are partitioned through the agar according to their water
 D.L.R. Simas et al. / Industrial Crops and Products 98 (2017) 108–115 111

Table 1
Chemical profiles of the citrus essential oils.

Compound KI KI lit. C. limon % C. aurantifolia % C. limonia % C. latifolia %

␣-thujene 932 932 0.7 0.1 0.4 0.2

␣-pinene 940 939 0.7 0.6 2.0 1.5
camphene 955 954 0.1 0.3
sabinene 978 978 3.4 1.3 1.2
␤-pinene 982 982 13.1 8.5 9.0 5.1
myrcene 992 992 2.7 1.0 1.9 1.6
␣-phellandrene 1005 1004 0.2
␣-terpinene 1020 1019 0.5 0.3 0.4 0.6
r-cymene 1028 1028 0.3 0.5 0.7 0.1
limonene 1037 1033 53.9 31.1 65.7 35.4
␤-cymene 1051 1051 0.1 0.2
y-terpinene 1064 1062 12.2 10.8 12.3 12.1
terpinolene 1090 1090 0.8 0.8 0.7 1.4
linalool 1099 1099 0.3 1.1 0.2 1.7
nonanal 1103 – 0.2
citronelal 1154 1153 0.3
terpinen-4-ol 1178 1178 0.5 1.6 1.0 2.3
␣-terpineol 1190 1190 0.8 1.6 1.7 6.5
n-decanal 1204 1204 0.9 0.1
nerol 1229 1229 0.2 1.1 1.1
neral 1242 1238 1.7 7.1 2.6
geraniol 1256 1256 0.3 1.8 1.3
geranial 1271 1271 2.2 9.6 3.6
␦-elemene 1340 1339 0.5 0.2
neryl acetate 1365 1365 0.8 0.2 2.3
geranyl acetate 1384 1381 0.4 0.8
␤-elemene 1392 1392 0.3
cis-␣-bergamotene 1415 1415 0.2
␤-caroyophyllene 1420 1420 0.3 2.4 0.2 2.0
trans-␣-bergamotene 1438 1437 0.4 2.1 0.4 3.4
␣-humulene 1454 1454 0.3 0.2
(E)-␤-farnesene 1458 1458 0.2
germacrene D 1481 1481 0.8 0.2
␣-bisabolene 1504 1506 0.6
␤-bisabolene 1509 1509 0.6 6.8 0.7 6.5
␦-cadinene 1522 1523 0.6 0.1
germacrene B 1557 1557 1.8 0.6
␣-bisabolol 1685 1682 0.3
Total 97.2 95.7 99.4 94.8

KI: Kovats Index; KI lit.: Kovats Index from literature.

solubility, and in dilution methods where low water solubility has
to be overcome by addition of emulsifiers or solvents (Nedorostova
et al., 2009). Thus, the vapour phase activity should be checked.
There is no standardized method available to test the antimicro-
bial activity in the vapour phase. In general, a seeded agar plate is
placed onto a reservoir containing a certain amount of volatile oil
in such a way that only the vapour is in contact with the tested
microbes. The generated inhibition zone is, thus, a measure of
the antimicrobial activity (Lang and Buchbauer, 2012). In order to
identify and to determine the relative concentration of the oil com-
ponents in vapor phase a dynamic headspace analysis was made
by HS/SPME-GC/MS. The results showed a less complex composi-
tion, as expected (Table 2). The headspace vapor phase is composed
almost exclusively by the more volatile monoterpenes, the hydro-
carbons (limonene, ␣-pinene, ␤-pinene, ␥-terpinene, sabinene and
␤-mircene) comprising more than 80% of the composition of all

Table 2
Headspace composition of the citrus essential oils.

Compound C. latifolia % C. aurantifolia % C. limonia % C. limon %

␣-thujene 1.0 0.4 1.2 1.1

␣-pinene 5.0 2.7 4.4 5
sabinene 4.8 4.1 3.7 6.4
␤-pinene 14.8 18.0 11.8 16.9
␤-mircene 3.6 2.4 4.3 4.7
4-carene 0.4 0.3
limonene 50.5 64.4 61.8 51.1
1,3,4-octriene,3,7-dimethyl 0.2
␥-terpinene 13.3 0.5 8.7 9.6
terpinolene 1.1 0.8 0.8
linalool 0.4 0.7 0.3 0.4
cis-limonene oxide 0.6
trans-limonene oxide 0.6 0.3
terpinen-4-ol 0.3 0.6 0.5 0.3
␣-terpineol 0.5 0.5 0.8 0.4
neral 1.0 1.8 0.8
geranial 0.9 1.6 0.7
Total 99.2 99.0 98.7 98.8
112 D.L.R. Simas et al. / Industrial Crops and Products 98 (2017) 108–115

Table 3 Table 4
Minimum Inhibitory Concentration (␮g/mL) of the citrus essential oils against B. HS-SPME profiles of the volatiles from the citrus essential oils (Chiral analysis).
cinerea, T. viride and P. digitatum.
Compound C. latifolia % C. aurantifolia % C. limonia % C. limon %
Essential Oil Minimum Inhibitory Concentration
(+)-␣-thujene 0.9 0.2 0.5 0.5
␮g/mL
(−)-␣-pinene 2.0 1.2 1.4 1.6
B. cinerea T. viride P. digitatum (+)-␣-pinene 0.9 0.4 1.9 0.7
␤-myrcene 2.4 1.6 3.5 2.5
C. limonia 312 >2500 >2500 (+)-␤-pinene 1.5 0.7 0.8 0.6
C. aurantifolia 625 >2500 >2500 (+/−)-sabinene 2.2 2.7 1.4 3.2
C. limon 312 >2500 >2500 (−)-␤-pinene 12.8 17.2 8.9 13.6
C. latifolia 625 >2500 >2500 ␣-terpinene 0.6 – 0.3 0.2
(−)-limonene 1.9 2.1 1.5 1.4
(+)-limonene 54.1 70.0 69.6 66.6
undentified – – 1.2 –
four oils. Considering the headspace analysis result, which con- ␥-terpinene 15.7 – 7.6 6.9
terpinolene 0.9 – 0.5 0.4
firmed that more than 80% of the compositions of all four oils were
linalool 0.2 0.2 – 0.1
exclusively of volatile monoterpenes, an alternative methodology neral 1.3 1.0 0.4 0.6
to evaluate the antifungal potential of the vapor phase of these geranial 1.1 0.9 – 0.4
citrus essential oils was developed, a bioassay vapor method to Total 98.4 98.2 99.6 99.2
evaluate the effects of citrus essential oil volatiles and standard HS-SPME: Headspace solid phase microextraction.
compounds on proliferation of B. cinerea, P. digitatum and T. viride.
The results of the exposition of B. cinerea, T. viride and P. digita-
tum to volatiles of the oils from C.limonia, C. limon, C. latifolia and is a trend of slight increase in growth inhibition with increasing
C. aurantifolia are presented in Fig. 1. Overall, it may be observed a concentrations of the oils.
trend of growth inhibition caused by all four essential oil volatiles, The reverse trend was observed for P. digitatum: a fungal growth
being the results for B. cinerea more pronounced. The volatiles of stimulatory effect was caused by all the volatile fractions. At the
the four oils also inhibited the growth of T. viride, and showed a concentration of 10 ␮L/plate C. latifolia, C. limonia and C. auran-
positive correlation of the inhibition with the amount of oil used tifolia volatiles exhibited significant stimulating activity (p < 0.05),
but the observed growth inhibition was less intense. with a positive correlation with concentration while the volatiles
B. cinerea promotes decay in many fruits, but is not specific to of C. limon displayed a less pronounced effect. P. digitatum is rec-
citrus. B. cinerea growth was inhibited by the volatile fractions of ognized as the most problematic post-harvest pathogen in citrus
oils from all four cultivars. Some of the compounds present in the fruits, being considered a pathogen specific to this culture. Droby
chemical profile of the volatile fraction of those oils are known et al. (2008) reported that the growth of this microorganism was
to have antifungal action against B. cinerea (Jing et al., 2014). The stimulated in presence of substances produced by the host citrus
growth inhibition of B. cinerea by C. sinensis and C. limon was already plant. However, no effect was observed in growth of this fungus
reported (Jing et al., 2014). when it comes in contact with the main volatiles produced by other
T. viride is commonly found in citrus fruits, but do not impair fruits such as apple, pear, tomato, pepper, avocado and strawberry
their commercial value (Borras and Aguilar, 1990). The assays with (Eckert et al., 1992; Droby et al., 2008).
T. viride did not show significant growth inhibition when compared Limonene was the major component in the headspace of all four
with control (p < 0.05). However, it is possible to note that, there essential oils tested with the volatile activity experiment, followed

C. limonia C. aurantifolia C. limon C. latifolia

160 160 160 160
140 140 140 140
Fungal growth (%)

Fungal growth (%)

Fungal growth (%)

Fungal growth (%)

120 120 120 120

* * * * * * * * * * * * * *
100 100 100 100
80 80 80 80 Botritis
60 60 60 60
cinerea
40 40 40 40
20 20 20 20
0 0 0 0
00

65

25

50

00

00

65

25

50

00

00

65

25

50

00

00

65

25

50

00
0

0
.0

.0

.0

.0
0.

0.

1.

2.

5.

0.

0.

1.

2.

5.

0.

0.

1.

2.

5.

0.

0.

1.

2.

5.
10

10

10

10

µL/plate µL/plate µL/plate µL/plate

C. limonia C. aurantifolia C. limon C. latifolia

160 160 160 160
140 140 140 140
Fungal growth (%)

Fungal growth (%)

Fungal growth (%)

Fungal growth (%)

120 120 120 120

100 100 100 100
80 80 80 80 Trichoderma
60 60 60 60
viride
40 40 40 40
20 20 20 20
0 0 0 0
0

65

50

00

25

25

50

0
00

65

25

50

00

.0

.0

.0
.0

0.

0.

1.

2.

5.

0.

0.

1.

2.

5.

0.

0.

1.

2.

5.
0.

0.

1.

2.

5.

10

10

10
10

µL/plate µL/plate µL/plate µL/plate

C. limonia C. aurantifolia C. limon C. latifolia

160 * 160 160
*
160
140 140 140 140
Fungal growth (%)

Fungal growth (%)

Fungal growth (%)

Fungal growth (%)

120 120 120

120 *
100 100 100 100
80 80 80 80
Penicillium
60 60 60 60
40 40 40
digitatum
40
20 20 20 20
0 0 0 0
00

65

25

50

00

00

65

25

00

0
00

65

25

50

00

00

65

25

50

.0

.0
.0

.0

0.

0.

1.

2.

5.

0.

0.

1.

2.

5.
0.

0.

1.

2.

5.

10

10
10

0.

0.

1.

2.

5.

10

µL/plate µL/plate µL/plate µL/plate

Fig 1. Effect of citrus oils on percent of B. cinerea, T. viride and P. digitatum growth. Mean ± S.E (n = 3). Treatments with * are significantly different from control at p < 0.05.
 D.L.R. Simas et al. / Industrial Crops and Products 98 (2017) 108–115 113

Botritis cinerea

(+)-α-pinene (+)-β-pinene (-)-α -pinene (-)-β-pinene

160 160 160 160
140 140 140 140
Fungal growth (%)

Fungal growth (%)

Fungal growth (%)

Fungal growth (%)

120 120 120 120
*
100 100 100 100
80 80 80 80
60 60 60 60
40 40 40 40
20 20 20 20
0 0 0 0
25

00

25

00

25

00

25

00
l

l
ro

ro

ro

ro
1.

5.

1.

5.

1.

5.

1.

5.
nt

nt

nt

nt
co

co

co

co
µL/plate µL/plate µL/plate µL/plate

citral γ -terpinene (+)-limonene (-)-limonene

160 160 160 160
140 140 140 140
Fungal growth (%)

Fungal growth (%)

Fungal growth (%)

Fungal growth (%)

120 120 120 * 120
100 100 100 100
80 80 80 80
60 60 60 60
40 40 40 40
20 20 20 20
0 0 0 0
25

00

25

00

25

00

25

00
l

l
ro

ro

ro

ro
1.

5.

1.

5.

1.

5.

1.

5.
nt

nt

nt

nt
co

co

co

co
µL/plate µL/plate µL/plate µL/plate

Fig. 2. Effect of (+)-␣-pinene, (+)-␤-pinene, (−)-␣ −pinene, (−)-␤-pinene, citral (neral + geranial), ␥-terpinene, (+)-limonene and (−)-limonene on percent of B. cinerea growth.
Mean ± S.E (n = 3). Treatments with * are significantly different from control at p < 0.05.

by ␣-pinene, ␤-pinene, ␥-terpinene, sabinene and ␤-myrcene. Ter- in the headspace, due to its recognized antimicrobial effect (Tao
penoid components of essential oils may contain one or more et al., 2014).
stereogenic centers, conferring chirality to these compounds. These The results of the volatile activity experiment with pure chi-
chiral compounds (monoterpenes and sesquiterpenes) are found in ral components for B. cinerea are shown in Fig. 2. All compounds
characteristic enantiomeric distributions as dictated by enzymatic (with exception of (+)-␣-pinene), irrespective of their chirality,
control during their biosynthesis. Table 4 displays the headspace inhibited the growth of B. cinerea, especially (+)-limonene, which
enantiomeric composition of the four essential oils. Differences caused the most extensive inhibition. As shown in Fig. 3 cit-
in bioactivity between the enantiomers of some monoterpenes ral (neral + geranial) completely inhibited the growth of T. viride.
have been reported (Lahlou, 2004). The availability of (+)-limonene The other components showed moderate inhibition except (+)-
and (−)-limonene, (+)-␣-pinene, (−)-␣-pinene, (+)-␤-pinene, (−)- limonene and (−)-limonene.
␤-pinene, and ␥-terpinene led us to test their individual volatile Regarding the results with P. digitatum, Fig. 4, the volatile
activity against the pathogens studied. Citral was also included in active assays displayed a strong inhibition to fungal growth
the experiment although not present in significant concentration caused by citral while (−)-␣-pinene, (−)-␤-pinene, ␥-terpinene,

Fig. 3. Effect of (+)-␣-pinene, (+)-␤-pinene, (−)-␣ −pinene, (−)-␤-pinene, citral (neral + geranial), ␥-terpinene, (+)-limonene and (−)-limonene on percent of T. viride growth.
Mean ± S.E (n = 3). Treatments with * are significantly different from control at p < 0.05.
114 D.L.R. Simas et al. / Industrial Crops and Products 98 (2017) 108–115
Fig. 4. Effect of (+)-␣-pinene, (+)-␤-pinene, (−)-␣-pinene, (−)-␤-pinene, citral (neral + geranial), ␥-terpinene, (+)-limonene and (−)-limonene on percent of P. digitatum
growth. Mean ± S.E (n = 3). Treatments with * are significantly different from control at p < 0.05.
(+)-limonene and (−)-limonene displayed significant growth stim-
ulation. The remaining compounds ((+)-␣-pinene, (+)-␤-pinene)
displayed stimulatory effects at low concentrations and a reverse
effect with increased concentrations.
The results of the present study showed differences on the
effects of the four essential oils on the three fungal species. While all
the EO induced growth inhibition on B. cinerea, the reverse effect
was observed with P. digitatum. The results observed for T. viride
were of moderate inhibition. Regarding the individual compounds,
a prevalence of inhibitory effects was observed with B. cinerea and
T. viride, highlighting the effect of citral on T. viride and P. digita-
tum and (+)-limonene and (−)-limonene on B. cinerea. On the other
hand, with exception to citral, (+)-␣-pinene and (+)-␤-pinene, all
compounds displayed stimulatory effect on P. digitatum growth. It
was noticed that (+)-␣-pinene and (+)-␤-pinene displayed a reverse
trend and not a net stimulatory effect. Droby et al. (2008) reported
that limonene, ␣-pinene, ␤-pinene and myrcene were stimulatory
to P. digitatum and P. italicum but his evaluation did not include the
individual enantiomers. Additionally, his results were observed at
higher doses than the ones used in our experiments.
Essential oils of citrus fruits are part of a chemical defense
set commonly found in this genus, comprising lignins, flavonoids,
coumarins and limonoids (Soares et al., 2015), being a bar-
rier in fighting against infection by microorganisms and against
herbivores (Caccioni et al., 1998). Their mechanism of action
against fungi is yet not fully understood, but it is speculated to
involve membrane disruption, as indicated by Tao et al. (2014),
who demonstrated that citral inhibits mycelial growth of Peni-
cillium italicum by a membrane damage mechanism. However,
our results suggest that a complex system composed of stimu-
latory and inhibitory substances present in the essential oils is
acting on the plant/pathogen interaction. Droby et al. (2008) sug-
gested that monoterpene volatiles, particularly limonene, serve
as the main signaling molecules in host recognition by P. digita-
tum and P. italicum. These observations are in agreement with the
results reported by Rodrıguez et al. (2011), who demonstrated that
transgenic limonene depleted C. sinensis showed resistance to P.
digitatum.
What is the role of chirality in the antifungal activity? We have
demonstrated that (+)-␣ and (+)-␤ − pinenes are active against
human pathogenic fungi but not their enantiomers. These results
were putatively related to the significant inhibition of C. neoformans
phospholipase and esterase activities by the pinenes (Da Silva et al.,
2012).
Additionally, the inhibitory effects displayed by the citrus EO
against B. cinerea may indicate that the oils from citrus fruits peels of
C. latifolia, C. aurantifolia and C. limonia can be used as an alternative
for controlling this fungus in fruits like strawberries. Post-harvest
decay off strawberries caused by B. cinerea represents major loss
during storage and shipment (Reddy et al., 1998). However, field
studies are necessary to confirm the applicability of this suggestion.
Acknowledgements
The authors wish to acknowledge the support from Fundação
de Amparo à Pesquisa do Estado do Rio de Janeiro-FAPERJ, Con-
selho Nacional de Desenvolvimento Científico e Tecnológico-CNPq
and Coordenação de Aperfeiçoamento de Pessoal de Nível Superior-
CAPES.
References
Abramoff, M.D., Magalhaes, P.J., Ram, S.J., 2004. Image processing with image. J.
Biophoton. Int. 11, 36–42.
Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W., Lipman,
D.J., 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database
search programs. Nucleic Acids Res. 25, 3389–3402.
Bogumił, A., Paszt, L.S., Lisek, A., Trzciński, P., Harbuzov, A., 2013. Identification of
new Trichoderma strains with antagonistic activity against Botrytis cinerea.
Folia Hortic. 25, 123–132.
Borras, A.D., Aguilar, R.V., 1990. Biological control of Penicillium digitatum by
Trichoderma viride on postharvest citrus fruits. Int. J. Food Microbiol. 11,
179–183.
Brown, E.G., 1989. Host defenses at the wound site on harvested crops.
Phytopathology 79, 1381–1384.
Clinical and Laboratory Standards Institutes (CLSI), Reference Method for Broth
Dilution Antifungal Susceptibility Testing of Filamentous Fungi, Approved
Standard, Norm M38-A2, vol.28 No.16, CLSI, Wayne, Pa, USA, 2th edition, 2008’.
Caccioni, D.R.L., Guizzardi, M., Biondi, D.M., Renda, A., Ruberto, G., 1998.
Relationship between volatile components of citrus fruit essential oils and
antimicrobial action on Penicillium digitatum and Penicillium italicum. Int. J.
Food Microbiol. 43, 73–79.
Cristani, M., d’Arrigo, M., Mandalari, G., Castelli, F., Sarpietro, M.G., Micieli, D.,
Venuti, V., Bisignano, G., Saija, A., Trombetta, D., 2007. Interaction of four
monoterpenes contained in essential oils with model membranes: implications
for their antibacterial activity. J. Agric. Food Chem. 55 (15), 6300–6308.
 D.L.R. Simas et al. / Industrial Crops and Products 98 (2017) 108–115
Da Silva, A.C.R., Lopes, P.M.L., Azevedo, M.M.B., Costa, D.C.M., Alviano, C.S., Alviano,
D.S., 2012. Biological activities of ␣-pinene and ␤-pinene enantiomers.
Molecules 17, 6305–6316.
Davidson, P.M., Harrison, M.A., 2002. Resistance and adaptation to food
antimicrobials sanitizers, and other process controls. Food Technol. 56, 69–78.
Droby, S., Eick, A., Macarisin, D., Cohen, L., Rafael, G., Stange, R., McColum, G.,
Dudai, N., Nasser, A., Wisniewski, M., 2008. Role of citrus volatiles in host
recognition, growth and growth of Penicillium digitatum and Penicillium
italicum. Postharvest Biol. Technol. 49, 386–396.
Dugo, G., Cotroneo, A., Bonaccorsi, I., Trozzi, A., 2011. Composition of the volatile
fraction of citrus peel oils. In: Dugo, Giovanni, Mondello, Luigi (Eds.), Advanced
Analytical Techniques, Contaminants, and Biological Activity. Taylor and
Francis, Boca Raton, pp. 433–618.
Eckert, J.W., Ratnayake, M., Wolfner, A.L., 1992. Effects of volatile compounds from
citrus fruit and other plant materials upon fungus spore growth. Proc. Int. Soc.
Citric. 3, 1049–1052.
Gardes, M., Bruns, T.D., 1993. ITS primers with enhanced specificity for
basidiomycetes – application to the identification of mycorrhizae and rusts.
Mol. Ecol. 2, 113–118.
Jing, L., Lei, Z., Li, L., Xie, R., Xi, W., Guan, Y., Sumner, L.W., Zhou, Z., 2014. Antifungal
activity of citrus essential oils. J. Agric. Food Chem. 62, 3011–3033.
Kabara, J.J., 1991. Phenols and chelators. In: Russell, N.J., Gould, G.W. (Eds.), Food
Preservatives. Blackie, Glasgow, Scotland, pp. 200–214.
Lahlou, M., 2004. Essential oils and fragrance compounds: bioactivity and
mechanisms of action. Flavour Frag. J. 19, 159–165.
Lang, G., Buchbauer, G., 2012. A review on recent research results (2008–2010) on
essential oils as antimicrobials and antifungals. Flavour Fragr. J. 27, 13–39.
Nedorostova, L., Kloucek, P., Kokoska, L., Stolcova, M., Pulkrabek, J., 2009.
Antimicrobial properties of selected essential oils in vapour phase against
foodborne bacteria. Food Control 20, 157–160.
Reddy, B.M.V., Angers, P., Gosselin, A., Joseph, A., 1998. Characterization and use of
essential oil from Thymus Vulgaris against Botrytis Cinerea and Rhizopus
Stolonifer in strawberry fruits. Phytochemistry 47, 1515–1520.
115
Rodrıguez, A., San Andres, V., Cervera, M., Redondo, A., Alquezar, B., Shimada, T.,
Gadea, J., Rodrigo, M.J., Zacarıas, L., Palou, L., Lopez, M.M., Castanera, P., Pena, L.,
2011. Terpene down-regulation in orange reveals the role of fruit aromas in
mediating interactions with insect herbivores and pathogens. Plant Physiol.
156, 793–802.
Smitha, C., Finosh, G.T., Rajesh, R., Abraham, P.K., 2014. Induction of hydrolytic
enzymes of phytopathogenic fungi in response to Trichoderma viride influence
biocontrol activity. Int. J. Curr. Microbiol. Appl. Sci. 3, 1207–1217.
Soares, M.S., da Silva, D.F., Forim, M.R., da Silva, M.F., Fernandes, J.B., Vieira, P.C.,
Silva, D.B., Lopes, N.P., de Carvalho, S.A., de Souza, A.A., Machado, M.A., 2015.
Quantification and localization of hesperidin and rutin in Citrus sinensis grafted
on C. limonia after Xylella fastidiosa infection by HPLC-UV and MALDI imaging
mass spectrometry. Phytochemistry 115, 161–170.
Talla, S.G., Raju, A.S.R., Karri, S., Kumar, Y.S., 2015. Production and antagonistic
effect of Trichoderma spp. on pathogenic microorganisms (Botrytis cinerea,
Fusarium oxysporium, Macrophomina phasealina and Rhizoctonia solani). Afr. J.
Biotechnol. 14, 668–675.
Tao, N., Ou Yang, Q., Jia, L., 2014. Citral inhibits mycelial growth of Penicillium
italicum by a membrane damage mechanism. Food Control 41, 116–121.
Tripathi, P., Dubey, N., Banerji, R., Chansouria, J., 2004. Evaluation of some essential
oils as botanical fungitoxicants in management of post-harvest rotting of citrus
fruits. World J. Microbiol. Biotechnol. 20, 317–321.
Viuda-Martos, M., Ruiz-Navajas, Y., Fernández-López, J., Pérez- Alvarez, J.A., 2007.
Antifungal activities of thyme: clove and oregano essential oils. J. Food Saf. 27,
91–101.
Viuda-Martos, M., Ruiz-Navajas, Y., Fernandez-Lopez, J., Perez-Alvarez, J., 2008.
Antifungal activity of lemon (Citrus lemon L.), mandarin (Citrus reticulata L.),
Grapefruit (Citrus paradisi L.) and orange (Citrus sinensis L.) essential oils). Food
Control 19, 1130–1138.
White, T.J., Bruns, T.D., Lee, S., Taylor, J., 1990. Analysis of phylogenetic
relationships by amplification and direct sequencing of ribosomal RNA genes.
In: Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.H. (Eds.), PCR Protocols: a
Guide to Methods and Applications. Academic Press, New York, pp. 315–322.