Anda di halaman 1dari 101

IITCUP CIENCIA VOL1 No1 (2013) 1

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
2 IITCUP CIENCIA VOL1 No1 (2013)

IITCUP
CIENCIA
PUBLICACIÓN CIENTÍFICA DE LA POLICÍA BOLIVIANA

VOL1 No1 DICIEMBRE 2013

DIRECTOR IITCUP: TCNL. DEAP. IVÁN ROJAS DEL CARPIO, UNIPOL


EDITOR: LIC. ESP. RUDDY LUNA BARRÓN, DIC, UNIPOL

COMITÉ REVISOR: CNL. DESP. GARY GONZALO OMONTE VERA, P. B.


PhD. DRA. MARÍA TERESA ÁLVAREZ ALIAGA, UMSA
DR. GONZÁLO TABOADA LÓPEZ, UMSA
DR. BERNARDO TORRICO ARZADY, UMSA
DRA. BEATRIZ LUNA BARRÓN, UMSA
DRA. JACQUELINE CORTEZ G., UMSA
LIC. ÁLVARO ROMERO VALENZUELA, CEDES

DERECHOS RESERVADOS IITCUP © 2013

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No1 (2013) 3

ÍNDICE

AGRADECIMIENTO.............................................................................................................................................................. 5
PRESENTACIÓN DEL COMANDO GENERAL ......................................................................................................................... 7
PRESENTACIÓN DEL VICEMINISTRO DE SEGURIDAD CIUDADANA..................................................................................... 9
PRÓLOGO DEL RECTOR DE LA UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” .......................................... 11
PRESENTACIÓN DEL IITCUP .............................................................................................................................................. 13
EDITORIAL ......................................................................................................................................................................... 15
SIMBOLOGÍA DEL EMBLEMA DEL INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS DE LA UNIVERSIDAD
POLICIAL............................................................................................................................................................................ 17
ARTÍCULOS ORIGINALES
CARACTERIZACIÓN DEL MINI-YSTR DYS-481 EN TRES SUBPOBLACIONES DE BOLIVIA .................................................... 19
HAPLOTIPOS DE ADN MITOCONDRIAL REVELAN POSIBLE RUTA MIGRATORIA ANCESTRAL DE LOS PUEBLOS URU Y
AYOREO DE BOLIVIA ......................................................................................................................................................... 27
HAPLOTIPOS DE ND4 EN Aedes aegypti (VECTOR DEL DENGUE) DE SAN BORJA Y CARANAVI (BOLIVIA) ....................... 43
CARACTERIZACIÓN DE MICROSATÉLITES PARA PRUEBAS DE PARENTESCO EN CAMÉLIDOS DEL ALTIPLANO BOLIVIANO
.......................................................................................................................................................................................... 49
NOTAS TÉCNICAS
PRIMER ESTUDIO TAXONÓMICO MOLECULAR DEL ORDEN TRICHOPTERA EN LA REGIÓN ALTOANDINA DE BOLIVIA ... 57
TIPIFICACIÓN MOLECULAR DE MIRU-VNTR’S PARA ESTUDIOS EPIDEMIOLÓGICOS DE TUBERCULOSIS EN BOLIVIA ...... 63
DETECCIÓN DEL GEN “INTERFERÓN-GAMMA” POR PCR DE RETRO-TRANSCRIPCIÓN EN CÉLULAS MURINAS ............... 67
REVISIÓN CORTA
ESTRUCTURA Y CARACTERÍSTICAS GENERALES DE LOS INDICIOS PILOSOS ..................................................................... 71
ENFERMEDADES INFECCIOSAS EMERGENTES (EIE´S) Y SU RELACIÓN CON EL TRÁFICO DE FAUNA SILVESTRE .............. 75
ESTUDIOS DE CASO
PLANIMETRIA OPERATIVA DE CAMPO Y DE GABINETE EN UN CASO DE DESLIZAMIENTO DE TERRENO ........................ 79
ACCIDENTES DE TRÁNSITO: CASO “BOCA DE SAPO” ........................................................................................................ 89
INSTRUCCIONES PARA LOS AUTORES............................................................................................................................... 95

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
4 IITCUP CIENCIA VOL1 No1 (2013)

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No1 (2013) 5

AGRADECIMIENTO

A finales del año 2010 la Policía Boliviana dio inicio a uno de sus proyectos más
ambiciosos y preciados, la instalación de un Instituto de Investigaciones. El
resultado fue el actual Instituto de Investigaciones Técnico Científicas de la
Universidad Policial (IITCUP), creado sobre la cimiente del ex Dpto. Nal. de Policía
Técnica Científica (DNPTC) dependiente entonces de la Fuerza Especial de Lucha
Contra el Crimen (FELCC), con el esfuerzo de profesionales que decidieron creer
en la Institución Policial para llenar alguno de los vacíos en el campo técnico-
científico, pero especialmente con el impulso generoso de la Universidad Mayor
de San Andrés y sus autoridades.

Las primeras señales del surgimiento de este proyecto institucional ocurrieron en octubre de 2006
con la acertada disposición del Comando General para incorporar nuevos laboratorios y capacidades
en el DNPTC. Su activación en octubre de 2007 dio pie a un proceso en cascada que culminó con la
creación, tres años después, del IITCUP (diciembre de 2010). Sin embargo, un paso fundamental y
condicionante para lograr este objetivo fue dado entre diciembre de 2007 y abril de 2008 al
gestionarse y firmarse el Convenio de Cooperación Técnica y Científica entre la Universidad Mayor
de San Andrés y la Policía Boliviana, con la participación de las entonces autoridades máximas Dra.
Teresa Rescala Nemtala (Rectora) y Gral. Miguel Gemio Urrutia (Comandante General).

El abierto, sincero, honesto y generoso soporte que brindó la UMSA al naciente IITCUP desde
entonces es simplemente superlativo e invalorable, y obliga la gratitud leal y comprometida de la
Policía Boliviana y su personal. Cientos de personas desde estudiantes y administrativos hasta las
propias máximas autoridades universitarias contribuyeron con el surgimiento y desarrollo del
espíritu científico en las filas del verde olivo, todas ellas bajo la sincera y estoica guía de
personalidades como el Dr. Enrique Udaeta Velásquez (Decano FCFB 2008 – 2012) o el Dr. Tito
Estévez Martini (Decano FCFB 2012…), a la sombra de quienes hoy nos excusamos humildemente
por no presentar la extensa nómina de todos aquellos a quienes representan, pero que forman parte
esencial del plantel docente investigador, estudiantil y administrativo de la UMSA que extendieron
mano firme y dadivosa al IITCUP y sus aspiraciones.

A todos aquellos insignes participantes de esta singular aventura: la “alianza


estratégica UMSA – Policía Boliviana”: estudiantes, docentes, administrativos de
la UMSA, entregados a luchar por el progreso de nuestra amada Bolivia y que
portan en el corazón la satisfacción de haberle puesto fe sin medida a este sueño,
gracias..!

Septiembre 2013.

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
6 IITCUP CIENCIA VOL1 No1 (2013)

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No1 (2013) 7

PRESENTACIÓN DEL COMANDO GENERAL

L
a Policía Boliviana se ha colocado entre las instituciones sobresalientes del Continente Americano,
caminando a paso firme en el accionar científico. El uso de la ciencia y tecnología es considerado vital
para la investigación actual, logrando resultados altamente positivos. Los efectivos del orden de
diferentes grados y rangos tienen una formación permanente, convirtiéndose en profesionales expertos,
liderizando, ejecutando y desarrollando procesos investigativos apegados a los preceptos de la ciencia y los
conceptos descrifrables de la tecnología.

El avance de la tecnología y la modernización de los sistemas, han permitido a las Instituciones Policiales del
mundo, abrir sus puertas hacia la Investigación Científica, ingresando a una nueva era en la historia universal.
Nuestros peritos son uniformados y profesionales altamente capacitados que diariamente enfrentan los retos
más acentajados, logrando poner al descubierto, con pericia estricta, acciones delincuenciales que impactan
negativamente al desarrollo de las naciones y la tranquilidad de los pueblos.

La ciencia y tecnología nos lleva a la verdad hitórica del delito, convirtiéndose en la esencia de la investigación
y el fundamento de la existencia. La investigación científica policial debe ser fortalecida, perdurando en el
tiempo y espacio, ubicando a la Policía Boliviana como una institución hitórica con una visión basada en el
uso de la ciencia, siendo parte fundamental de la política de transformación del Estado Plurinacional de
Bolivia.

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
8 IITCUP CIENCIA VOL1 No1 (2013)

El Instituto de Investigaciones Técnico Científicas de la Universidad Policial, IITCUP, es el ícono institucional


que refleja una policía que definitivamente está inserta en el nuevo mundo, con procesos modernos de alta
capacidad tecnológica y cánones científicos, llevando a los efectivos del orden por un camino naciente, que
brinde las armas necesarias para el descubrimiento real y probatorio de acciones criminales y delincuenciales,
cristalizándose como barrera infranqueable contra actos ilegales que destrozan y lastiman al estante y
habitante de nuestra Patria Bolivia.

La Universidad Policial “Mcal. Antonio José de Sucre” tiene como misión la capacitación constante de los
cuadros policiales, permitiendo vigorizar y fortalecer a hombres y mujeres del verde olivo, que vinculados a
los avances científicos mundiales, cumplen con un trabajo eficiente, inmersos en un mundo tecnológico que
les facilita los procesos investigativos, obteniendo resultados pertinentes que se manifiestan en directo
beneficio de la sociedad a la que nos debemos.

El accionar científico es la propia vida de la Instituticón Policial.

Gral. Cmdte. WALTER JONNY VILLARPANDO MOYA


COMANDANTE GENERAL
POLICÍA BOLIVIANA

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No1 (2013) 9

PRESENTACIÓN DEL VICEMINISTRO DE SEGURIDAD


CIUDADANA

La institución policial enfrenta el desafío de ingresar de manera cognoscitiva en el campo de la investigación


presentando modestamente a consideración de la sociedad a la que se debe, el primer número de la revista
de divulgación científica IITCUP CIENCIA, nombre originado en el Instituto de Investigaciones Técnico
Científicas de la Universidad Policial y que es parte fundamental e indiscutible de la Policía Boliviana, con el
objetivo específico de lograr el desarrollo, gestión y ejecución de proyectos investigativos y de desarrollo
tecnológico, que permitan abrir nuevos derroteros para mostrar la luz al final del túnel dentro de las ciencias
policiales, porque la generación de ciencia es puntal de apoyo y sustento de la labor en las Unidades Policiales
inmersas en la lucha contra el delito.

Esta publicación se hace a la luz pública con el ansia incontrolable del recién nacido que trata de dar su primer
hálito de vida para un día poder formar parte activa de los sueños y realidades del pueblo que es su cuna.
Así, el contenito de IITCUP CIENCIA se plantea como un desafío multidisciplinario y de amplio contenido
temático para explorar nuevas formas de pensar, sentir y actuar, rompiendo el miedo a lo trascendental y
generar incluso conocimiento sobre el origen y la interculturalidad de nuestras Naciones Originarias (como
cita uno de los artículos del presente número).

De esta forma, la institución policial presenta con mucho esfuerzo y humildad el primer resultado de este
singular emprendimiento investigativo científico, por el que guardo la esperanza de un soñador de fé
inclaudicable, para que sea la semilla de una nueva Policía Boliviana.

Gral. Cmdte. (r) ALBERTO JORGE ARACENA MARTÍNEZ


EX COMANDANTE GENERAL
VICEMINISTRO DE SEGURIDAD CIUDADANA

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
10 IITCUP CIENCIA VOL1 No1 (2013)

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No1 (2013) 11

PRÓLOGO DEL RECTOR DE LA UNIVERSIDAD POLICIAL


“MCAL. ANTONIO JOSÉ DE SUCRE”

H
a transcurrido casi medio siglo de experiencia policial en el
campo pericial y de laboratorio criminalístico. El fruto
esencial de este trabajo cotidiano es de interés para cada
ciudadano boliviano, pues influye significativamente en el destino y
desenvolvimiento de nuestra sociedad en el tiempo. Sin embargo, ese
valioso fruto puede ser olvidado y su fundamental enseñanza para el
futuro puede perderse si no encontramos la forma de grabar su
existencia y significado en la mente y corazón de todos quienes
conformamos el espíritu mismo de la Institución Policial y del progreso
nacional.

IITCUP CIENCIA, es la propuesta que hacemos hoy para compartir con nuestros hermanos
bolivianos el sincero deseo que tiene la Policía Boliviana de progresar con su pueblo y aportar al
progreso nacional mediante la producción científica y el desarrollo tecnológico. Muchas razones
existen para entregar a la luz pública un proyecto como éste y promover el desarrollo sistemático de
más producción intelectual, pero una sola motiva su existencia: evolucionar institucionalmente como
Universidad y como Policía, para crear nuevas herramientas científicas en la lucha eterna “contra el
mal, por el bien de todos”, y así proyectar una nueva visión de desempeño policial, sirviendo con
devoción y leal doctrina a nuestra amada Bolivia.

Gral. Sup. Guido Arroyo Arce


DIRECTOR NAL. DE INSTRUCCIÓN Y ENSEÑANZA
RECTOR DE LA UNIPOL

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
12 IITCUP CIENCIA VOL1 No1 (2013)

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No1 (2013) 13

PRESENTACIÓN DEL IITCUP

D
ar el primer paso es lo más difícil… pero no imposible, de esto
depende el éxito o fracaso de la actividad que se inicia.

La filosofía del IITCUP, que parte de la trilogía: Formación,


Servicio y Ciencia, reza en nuestro emblema institucional como un
desafío que exige una respuesta por parte de todos quienes somos parte
de nuestro instituto, que se traduce desde nuestro punto de vista en los
siguiente: el aporte en los procesos de formación que busca la
cualificación del talento humano de nuestro instituto, de la Universidad
Policial y de la Institución Policial; la prestación de servicios a la sociedad en su conjunto, no solo en
el área forense sino de manera integral multidisciplinaria; y los resultados de investigación científica
para la generación de conocimiento propio.

La validación de nuevos métodos y su aplicación de manera integral busca beneficiar no solo a


quienes la aplican en el área forense o la investigación criminal, sino a la sociedad boliviana al lograr
costos operativos acorde a la realidad nacional, prestando servicios multi e interdisciplinarios de
calidad.

La presentación de la revista IITCUP CIENCIA es la oportunidad de plasmar los resultados de este


trabajo sobre las líneas de investigación de nuestro instituto, como un aporte al desarrollo
institucional y nacional, de donde la sociedad en su conjunto resulta beneficiada con la generación
de nuevo conocimiento, fruto del trabajo llevado adelante por personal que ha trabajado de manera
silenciosa y desinteresada.

Esta publicación es parte del resultado de más de cinco años del esfuerzo de más de treinta personas
en un contexto cooperativo interinstitucional y que representa un pequeño aporte a quienes esperan
mucho de nosotros y con los que esperamos contar como autores en un futuro próximo.

Soy consciente de las limitaciones y dificultades que atravesamos para hacer realidad este primer
número, cuya sincera intención es hacer un pequeño aporte a las aspiraciones de progreso científico
y tecnológico de la “Universidad Policial Mcal. Antonio José de Sucre” y de la sociedad boliviana en
su conjunto.

Tcnl. DEAP. E. Iván Rojas del Carpio


DIRECTOR IITCUP

Enero 2014.

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
14 IITCUP CIENCIA VOL1 No1 (2013)

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No1 (2013) 15

EDITORIAL

L
a Ley Orgánica de la Policía Boliviana (Art. 8) describe a esta fundamental institución del
Estado Plurinacional de Bolivia como esencialmente “Técnico Científica”, que exhorta y
manda proyectar y desarrollar una institución de envergadura nacional, normada y
certificada por procedimientos basados en un enfoque objetivo, práctico, válido, preciso, ético, de
calidad certificada y con amplio desenvolvimiento en la comunidad policial mundial; por tanto,
como es lógico, la Institución Policial debe hacerse con las herramientas apropiadas para plasmar
esta visión.

El trabajo de laboratorio técnico-científico en la Policía Boliviana tiene más de 50 años de historia


institucional, llena de aciertos y desaciertos en un proceso evolutivo permanente de creación y
destrucción, experiencia y desafío, crítica y mérito, innovación y retroceso, emprendimiento y
abandono, frustración y fe. Parte de esta historia, rematada en diciembre de 2010 con la creación del
Instituto de Investigaciones Técnico Científicas de la Universidad Policial (IITCUP), se gestó
primicialmente con el proyecto de implementación de un laboratorio moderno para el ex DNPTC
(Dpto. Nal. de Policía Técnica Científica) en octubre de 2006, bajo iniciativa de su entonces sub-jefe
Tcnl. DEAP. Gualberto Condori Tapia, posteriormente y bajo dirección del Cnl. DESP. Jorge Toro
Álvarez, se gestionaron y adquirieron en 2007 equipos, se adecuó la infraestructura y se convocó al
plantel de profesionales. El resultado de este período inicial fue la incorporación de un nuevo
laboratorio con capacidad de servicio e investigación en genética forense.

En abril de 2008 se firmó el convenio marco de cooperación técnico-científica con la UMSA y en 2009
se establecieron nexos con instituciones académicas nacionales e internacionales, dando inicio al
proceso de validación de nuevas técnicas de laboratorio, así como a la incorporación de estudiantes
universitarios externos como tesistas de pre y post grado. Con los resultados alcanzados, en 2010 se
presenta el proyecto de creación del IITCUP y en 2011, bajo dirección del Cnl. DESP. Freddy
Machicado Villegas, se consolidan las líneas principales de investigación y servicios del nuevo
instituto policial. En 2012 se extienden los nexos interinstitucionales bajo la dirección del Cnl. DESP.
Gary Gonzalo Omonte Vera y en 2013, bajo dirección del Tcnl. DEAP. Iván Rojas del Carpio, se da
impulso al proceso de socialización del potencial de investigación, formación y de servicio pericial
del instituto, proceso que continúa a la fecha, que poco a poco demuestra la importancia de apoyar
seriamente la investigación científica y tecnológica de jerarquía policial, y ha dado origen a esta
primera publicación de divulgación científica.

El IITCUP tiene como función principal la definición y aplicación de políticas institucionales de


desarrollo científico y tecnológico con relevancia social, mediante el trabajo sinérgico de y la gestión
de cinco departamentos: Técnico y de Servicios, Académico, de Investigación Científica, de Recursos
Humanos y Administrativo, bajo los que se organizan 12 centros y Divisiones Operativas que
incluyen las áreas de Balística, Biología, Documentología, Genética, Huellografía, Informática,

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
16 IITCUP CIENCIA VOL1 No1 (2013)

Medicina Legal, Planimetría, Psicología, Química, Seguridad


Vial, y Toxicología; así, la organización sinérgica holística del
IITCUP se dinamiza sobre las premisas de Servicio, Formación
y Ciencia.

La responsabilidad natural de la labor policial obliga a la


búsqueda incesante y precisa de conocimiento para la
comprensión de aquellos los elementos y fenómenos sociales
y naturales que producen, coadyuvan o siembran el desorden
social y la inseguridad en la población y el Estado Boliviano.
Esto solo puede enfrentarse recurriendo a un amplio espectro
temático de investigación que incluya múltiples campos del
conocimiento humano, y que genere soluciones prácticas, reales, efectivas y sobre todo sensibles a la
realidad de nuestra sociedad, tomando solo como modelo a otras sociedades o instituciones, pero
fundamentalmente mostrando sensibilidad e identidad con la nuestra.

La producción científica enfocada a la comprensión y solución de los problemas y desafíos de la vida


en sociedad, es el mecanismo que proveerá las herramientas para que nuestra institución responda
a un mundo competitivo en constante progreso y evolución, a través de la generación prioritaria de
ciencia y tecnología propias y adaptadas a la realidad nacional. Pero solamente es posible si el talento
humano gestor en las instituciones del Estado, son capaces de encontrar el valor y coraje para
establecer nexos, alianzas, convenios y pactos de cooperación científica, uniendo sus capacidades,
potencialidad y recursos en bien de la sociedad, dejando de lado el individualismo instintivo y el
egoísmo importado, para dar espacio al enorme potencial que guarda nuestra cultura, nuestra
identidad boliviana y nuestro carácter histórico.

DEPARTAMENTO DE INVESTIGACIÓN CIENTÍFICA


IITCUP – UNIPOL
POLICÍA BOLIVIANA

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No1 (2013) 17

SIMBOLOGÍA DEL EMBLEMA DEL INSTITUTO DE


INVESTIGACIONES TÉCNICO CIENTÍFICAS DE LA UNIVERSIDAD
POLICIAL
(28 de diciembre de 2010)

La corona de ocho puntas representa los ocho departamentos del interior del país y su vínculo dependiente
directo con la oficina central del IITCUP en La Paz, representado por la esfera verde olivo al centro, del que
nace el haz fulgurante de energía. El fondo dorado, sobre el que se inscribe Policía Boliviana, alude a la
importancia y valor que debe darse al desarrollo de la investigación técnica, científica y académica.

Los colores de la bandera tricolor a la izquierda aluden al compromiso del instituto con el progreso nacional
y la honra de la soberanía. Los colores de la whipala a la derecha aluden al compromiso con la visión de
cambio y de identidad.

Las carabinas cruzadas en madera, símbolo de orden, fuerza, la responsabilidad y compromiso que tiene la
Institución Policial con el pueblo boliviano, escoltan el disco de granito azul.
UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
18 IITCUP CIENCIA VOL1 No1 (2013)

El disco de granito azul refulgente constituye con solidez, firmeza y peso la base sobre la que descansan el
nombre de la Universidad Policial, el nombre del Instituto y, en su parte central, el triángulo de los pilares
fundamentales de la doctrina de desarrollo institucional.

Las pequeñas carabinas en negro sostienen el vínculo circular infinito indisoluble entre el Instituto con la
UNIPOL.

El triángulo azul exterior en el centro del disco contiene la trilogía doctrinaria de Servicio, Formación y
Ciencia, con el fondo azul refulgente como alusión al progreso científico, la independencia tecnológica.

Las manos talladas en vidrio esmerilado simbolizan la claridad en pensamiento y obra de la humanidad y del
pueblo boliviano (mano derecha cerca de la whipala) en busca de la claridad del conocimiento y sabiduría
(mano izquierda cerca de la bandera boliviana).

El haz fulgurante de energía entre los dedos de ambas manos sobre el haz verde refulgente, representa la
motivación, la potencia e ímpetu del pueblo boliviano (mano derecha) en busca del conocimiento y sabiduría
(mano izquierda) necesarias para el progreso nacional y el bien común.

(Extracto del proyecto de creación del emblema IITCUP, 2010).

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No1 (2013) 19

ARTÍCULO ORIGINAL

CARACTERIZACIÓN DEL MINI-YSTR DYS-481 EN TRES


SUBPOBLACIONES DE BOLIVIA

Sbtte. Adm. Torres, E.1,2, & Sbtte. Adm. Salazar, K.2

1 Facultad de Ciencias Farmacéuticas y Bioquímicas. Universidad Mayor de San Andrés. La Paz, Bolivia.
2 Centro de Investigación Genética, IITCUP, Universidad Policial. La Paz, Bolivia. cingen.ptc@gmail.com

RESUMEN

Los polimorfismos en longitud de simples repeticiones en tándem o STRs del cromosoma-Y son de especial interés forense ya que
coadyuvan a la identificación de material genético masculino en evidencias biológicas principalmente vinculadas a casos de agresión
sexual. El presente estudio caracterizó el mini-YSTR DYS481 en 102 individuos de sexo masculino, no emparentados y tomados al
azar de tres subpoblaciones (ciudades) del Estado Plurinacional de Bolivia (La Paz, Sucre y Santa Cruz), infiriendo la variabilidad
genética mediante sus frecuencias alélicas. La diversidad génica obtenida fue 0.65 para las tres subpoblaciones y el análisis
comparativo de linajes con otras regiones del mundo presentó diferencias en la estructura génica de este marcador entre Caucásicos,
Afroamericanos, Alemanes, Árabes, Chinos y Bolivianos. Se ha probado estadísticamente que el marcador DYS481 es altamente
informativo ya que su poder de discriminación (0.8175) lo hace idóneo para el análisis de evidencias biológicas en casos forenses, de
genealogía y de estudios evolutivos, por lo que se recomienda su inclusión y uso en los laboratorios de Bolivia.

PALABRAS CLAVE: Mini-microsatélite, DYS481, variabilidad, Y-STR, poder de discriminación.

JUCH’URIMANCHANA

Chay polimorfismos en longitud de simples repeticiones tandempi (STRs del cromosoma-Y) minku allinkasqa yachanapax
forensemanta; yanapanku. Tariyta ADN qharixpata maypachachus warmi wallikun lluqhuska warmi willakun llukhusqa karkanta.
Kay llank`ay mini YSTR DYS-481 minku ruwakurqa pachaqiskayniuk qharispi, mana ñawarmasin kaskancuchu kimsa llajtasmanta
kay Boliviamanta, kay llajtas qharkanku La Paz kawachispa machkhachus ujjinataxkanku genéticamente ruwaspa frecuencias alelicas
minku. Chay wajina alelica minku qharqa 0,65 chay kimsa llajtaspax. Chay kawakuskan uj llajtasmantapacha riqhuchrqa uj laya
kaskanta genéticamente kay marcadorpi. Yachakun yanapaywan estadística minku kay marcador YSTR DYS-481 allin kasqa
imaraycuchus atin riqhuchiyta iskay runaspi ujina kaskankuta (0,8175). Chayrayku sumaj kasqa forensespax sachas genealógicos,
estudios evolutivos minku, chayrayku siminchanku ruwanankuta kay laboratorios Boliviamanta.

RIMANAS: Mini-microsatélite, DYS481, variabilidad, Y-STR, poder de discriminación

ABSTRACT

Single tandem repeats (STRs) of human Y-chromosome are of special interest in forensic issues due to its ability to detect male genetic
material commonly found in biological evidence of sexual assault cases. This study characterized the mini Y-STR DYS481 in 102 male
suspects, non-related and randomly taken from three principal cities of the Plurinational State of Bolivia (La Paz, Sucre and Santa
Cruz), inferring its genetic variability upon allelic frequencies. Calculated genetic diversity was 0.65 for all cities and the comparative
analysis with other world lineages showed differences in structure between Caucasians, Afro-Americans, Germans, Arabs, Chinese
and Bolivians. It was proved that DYS481 is highly informative because the discrimination power (0.8175) made it appropriate for
forensic applications, genealogy and evolutive studies, and it use in Bolivian forensic laboratories is recommended.

KEYWORDS: Mini-microsatellite, DYS481, variability, Y-STR, discrimination power.

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
20 IITCUP CIENCIA VOL1 No1 (2013)

INTRODUCCIÓN (AppliedBiosystems), ambos de 16 loci, llegan a ser


insuficientes al enfrentar casos que desafían las
La identificación certera en el ámbito civil y penal es capacidades de los laboratorios del país.
una de las mayores preocupaciones de las ciencias
forenses en nuestro país. Si bien existen diversos Pese a la diversidad genética encontrada en los locus
métodos de identificación e individualización de de los sistemas existentes, los resultados obtenidos
personas, uno de los que ostenta mayor certeza con evidencias de baja calidad (las más comunes en
estadística es el de ADN, especialmente porque no criminalística) ostentan pérdida de señal en varios
puede alterarse o cambiarse. El análisis de ADN está marcadores (Roewer, 2009), por lo que se hace
basado en marcadores específicos del genoma urgente la introducción y validación de nuevos STRs
humano de ADN no codificante del tipo microsatélite para cada población humana estructurada. La
autosómico (STR) y sexual (YSTR) (De Knijff et al., presente investigación caracterizó los polimorfismos
1997). Los mini-YSTRs corresponden a la categoría de del mini-YSTR DYS481 (Tabla 1 y Figura 1) en tres
subpoblaciones (ciudades) de Bolivia, para establecer
Tabla 1. Características del marcador su utilidad como marcador forense de identidad de
mini-YSTR DYS481. linajes masculinos pues ha mostrado ser altamente
diverso en otras poblaciones del mundo, además que
Accesión Motivo de # Tamaño Promedio su peso molecular (entre 109-159 pb) facilita su
GDB repetición alelos (pb) “Stutter” detección en contraste a los YSTRs convencionales
(De Knijff et al, 1997; Geppert et al, 2009).
11503780 CTT 18-31 109-159 10-15.5

MATERIALES Y MÉTODOS.
mini-microsatélites del cromosoma Y por su
reducido tamaño son de especial interés forense
Muestreo
criminalístico. La validación de nuevos de estos
marcadores de elevado polimorfismo y reducido
Se estudiaron al azar 102 individuos varones
tamaño, es necesaria para incrementar la capacidad
mayores de edad, no emparentados, provenientes de
de respuesta de los laboratorios forenses en la
tres subpoblaciones de Bolivia (31 de La Paz, 35 de
resolución de casos criminales, donde están
Chuquisaca y 36 de Santa Cruz), de quienes se
especialmente implicadas mezclas biológicas
obtuvieron muestras de hisopado bucal por
complejas, trazas biológicas o muestras en deficiente
duplicado en dependencias de la Fuerza Especial de
estado de conservación y almacenamiento, más aún
Lucha Contra el Crimen (FELCC) de La Paz, Sucre y
si se toma en cuenta que el cromosoma Y permite la
Santa Cruz.
caracterización específica de la fracción masculina de
ADN en una mezcla (Hanson & Ballantyne, 2007;
Obtención del Material Genético
Roewer, 2009).

El ADN total se obtuvo por lisis química,


La comunidad forense ha recomendado al menos
precipitación salina y purificación alcohólica
nueve loci de Y-STRs para un haplotipo mínimo que
optimizada del sistema comercial “DNA Isolation
pueda discernir entre 76 a 95% de los linajes
Kit” (MoBio).
masculinos en varias poblaciones del mundo (Kayser
et al., 2004). Sin embargo, el frecuente uso
Caracterización por PCR y electroforesis capilar
criminalístico de estos marcadores ha demostrado
que es necesario incrementar la habilidad de
La amplificación de alelos de DYS481 (Tabla 1) se
distinguir linajes y aumentar el poder de
realizó empleando los cebadores de Hanson et al.
discriminación entre linajes durante un cotejo
(2007), uno de ellos marcado con el fluoróforo 6-
genético forense complejo (De Knijff et al, 1997;
FAM. La mezcla de amplificación se preparó con
Djelloul & Sarafian, 2008). Sistemas comerciales
AmpliTaq 5 u/µL (Applied Biosystems), BSA 0.8
como PowerPlex-Y (Promega) y Y-Filer

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No1 (2013) 21

ug/mL y los cebadores combinados a 0.6 µM. La población La Paz se encontraron 5 alelos, en la Sucre
amplificación se realizó en un “Thermocycler 9800 6 y en Santa Cruz 8. En La Paz y Sucre el alelo
Fast” (Applied Biosystems) con el programa: 94 °C 5 predominante fue el 23, mientras que en Santa Cruz
min; 30 ciclos de 94 °C 30 s, 58 °C 35 s y 72 °C 35 s; 72 el 20. El alelo 24 es el menos frecuente en las tres
°C 10 min). Los productos amplificados fueron (Tabla 2 y Figura 2).
caracterizados por electroforesis capilar en un
Analizador Genético AB3130 (Applied Biosystems). Tabla 2. Distribución alélica y frecuencias de DYS481
Para evaluar la aplicabilidad del marcador se realizó en La Paz, Sucre y Santa Cruz.
una simulación empleando una evidencia biológica N = número muestral; DG = Diversidad Génica;
DAr = Diversidad Alélica Relativa.
de un caso real, la cual se analizó con el sistema
FRECUENCIAS
La Paz Sucre Santa Cruz
ALELO (N=31) (N=35) (N=36)
19 --- 0.1429 0.0556
20 0.1613 0.2000 0.3889
21 0.1613 0.1714 0.1667
22 0.2903 0.1714 0.1667
23 0.3226 0.2857 0.0833
24 0.0645 0.0286 0.0278
25 --- --- 0.0556
26 --- --- 0.0556
Figura 1. Estructura primaria de DYS481.
DG 0.7807 0.8219 0.7984
DAr 0.625 0.75 1
comercial AmpFiSTR® Y-Filer y con el DYS481.
La DG obtenida para La Paz fue de 0.7807, lo que
Análisis estadístico indica que las 5 variantes alélicas se hallan
ampliamente distribuidas en 78 de 100 individuos. La
La valoración estadística se compiló con el programa DG para La Paz, Sucre y Santa Cruz fue de 0.7807,
Arlequín v.2.000 (Schneider et al., 2000). A partir de 0.8219 y 0.7984. La DA relativa fue de 0.625, 0.75 y 1
las frecuencias alélicas se obtuvo la diversidad génica respectivamente (Tabla 2).
(DG) según Nei (1973), siendo que n es el número de
individuos analizados y pi la frecuencia alélica (1). La Tabla 3 resume la distribución en las tres sub-
poblaciones, donde el alelo 20 es el más frecuente y,
25 y 26 los más dispersos. La DG grupal es de 81.5%
(1)
y la DA relativa de 66.67% en relación a la diversidad
mundial. La PC grupal fue de 19.39%, es decir que 2
de cada 19 comparten el mismo alelo. El PD fue de
La diversidad alélica (DAr) relativa se obtuvo 81.75%, indicando que 2 individuos de cada 80 no
dividiendo el número parcial de alelos detectados comparten el mismo alelo.
entre el número total de alelos de la población. Se
calculó también el poder de discriminación (PD) y la La Figura 3 muestra el electroferograma de la
probabilidad de coincidencia (PC) según Fisher evidencia forense empleada en la prueba y validación
(1951) y Jones (1972). de DYS841. Nótese que no son detectables los alelos
de los marcadores DYS390, DYS389 II, DYS19,
RESULTADOS DYS385, DYS439, YGATAH4 y DYS438, solo los
marcadores de menor peso molecular fueron
La distribución de las frecuencias alélicas, la detectados (Figura 3a) más DYS481 (Figura 3b).
diversidad génica y la alélica del locus DYS481 para Nueve Y-STRs se detectaron: 8 de 16 del sistema
las 102 muestras, se detalla en la Tabla 2. En la sub-

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
22 IITCUP CIENCIA VOL1 No1 (2013)

AmpFiSTR® Y-Filer, más DYS481 del presente Según trabajos previos, el marcador DYS481 ha
artículo. mostrado ser uno de los más polimórficos e
informativos para la identificación humana (De
Tabla 3. Distribución de alelos, frecuencia alélica Knijff et al., 1997; Geppert et al., 2009; D' Amato et al.,
ascendente (f), razón de verosimilitud acumulativa (RV) y 2010). No obstante, a la fecha no se habían hecho
probabilidad de correspondencia (PC) de 8 marcadores estudios en las poblaciones latinoamericanas.
(a) y más DYS481 (b).
(a)
(a)
LOCUS A f RV PC (%)
Y-GATAH4 10 0.0270 37 97.3684
DYS456 13 0.2703 136.900 99.2748
DYS635 23 0.3784 3.618.071 99.7244
DYS389I 13 0.4054 8.924.572 99.8881
DYS458 16 0.4054 22.013.954 99.9546
DYS391 10 0.6216 35.413.753 99.9718
DYS393 13 0.6216 56.969.995 99.9824
DYS437 14 0.6216 91.647.311 99.9891

(b)
LOCUS AL f RV PC (%)
Y-GATAH4 10 0.0270 37 97.3684 (b)
DYS481 24 0.0645 573.643 99.8260
DYS456 13 0.2703 2.122.480 99.9529
DYS635 23 0.3784 5.609.413 99.9822
DYS389I 13 0.4054 13.836.552 99.9928
DYS458 16 0.4054 34.130.162 99.9971
DYS391 10 0.6216 54.905.043 99.9982 Figura 3. Electroferograma del sistema YFiler (a) y
DYS481 (b) de la evidencia forense de ensayo.
DYS393 13 0.6216 88.325.504 99.9989
DYS437 14 0.6216 142.088.855 99.9993
La distribución alélica del DYS481 en las
subpoblaciones de La Paz, Sucre y Santa Cruz
evidencia que cada una de ellas posee estructura
DISCUSIÓN
genética distinta (Figura 2). La distribución alélica de
las subpoblaciones de La Paz y Santa Cruz podría
explicarse a través del modelo “paso a paso”, donde
la mutación influye linealmente en el número de
repeticiones del mini-microsatélite (Gómez et al.,
2008), con una pendiente única y diferente
distribución unimodal.

La subpoblación de Sucre posee distribución


bimodal, lo que sugiere migraciones combinadas
relativamente recientes o, alternativamente, el efecto
de no haber detectado aún todos los alelos de este
marcador (Gómez et al., 2008).

Figura 2. Frecuencias alélicas de DYS481 en las sub- Calabrese et al., (2001) sugiere considerar que la
poblaciones estudiadas. evolución de los STRs se inicia con un alelo ancestral
(Burgarella & Navascués, 2011), lo cual es más

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No1 (2013) 23

evidente para las subpoblaciones de La Paz y Santa 0.8079 y la boliviana de 0.8150, pese que esta última
Cruz en torno al alelo 20. Tómese en cuenta que los tiene menor número de alelos (Tabla 4).
alelos ganan o pierden una unidad de repetición en
cada evento mutacional, en un fenómeno generado Tanto la diversidad alélica como la génica influyen
por el deslizamiento de la ADN-polimerasa durante sustancialmente en la variación genética, siendo
la replicación (Kimura & Ohta, 1978). Los alelos dependientes de la asociación no aleatoria de los

Tabla 4. Distribución alélica, DG, DA relativa, PC, PD de las diferentes regiones del mundo
(Hanson et al., 2007; Geppertet al., 2009; Cloeteet al., 2010; Xuet al., 2010).

Caucásicos Afro- Alemania- Arabia- China Bolivia


ALELOS (n=98) americanos Leipzig muslime (n=174) (n=102)
(n=100) (n=244) (n=105)
18 0.0100
19 0.0100 0.0080 0.0290 0.0662
20 0.0250 0.0052 0.2501
21 0.0400 0.0300 0.0780 0.0290 0.0344 0.1665
22 0.4700 0.1200 0.3160 0.2950 0.0958 0.2095
23 0.2100 0.0900 0.1840 0.2290 0.3348 0.2305
24 0.0400 0.1000 0.0900 0.1810 0.2142 0.0403
25 0.0700 0.2700 0.2090 0.1050 0.1178 0.0185
26 0.0600 0.1400 0.0530 0.0860 0.0890 0.0185
27 0.0600 0.1100 0.0120 0.0290 0.0434
28 0,0200 0.1000 0.0120 0.0190 0.0428
29 0.0400 0.0080 0.0170
# de alelos 10 9 12 9 11 8
DAr 0.8333 0.7500 1.0000 0.7500 0.9166 0.6667
DG 0.7246 0.8590 0.8079 0.8145 0.8124 0.8150
PC 0.2827 0.1496 0.1954 0.1932 0.1923 0.1825
PD 0.7172 0.8504 0.8045 0.8067 0.8077 0.8175

DA: Diversidad Alélica relativa. PC: Probabilidad de Coincidencia.


DG: Diversidad Génica. PD: Poder de Discriminación.

ancestrales suelen sufrir con mayor frecuencia la alelos del locus en las diferentes poblaciones (Jarve et
adición de una unidad de repetición que la deleción al., 2009). Asimismo la diversidad está relacionada
(Zhivotovsky et al., 2004). con los procesos de mutación y con la diversidad
El análisis estadístico global mostró que los linajes alélica de una población, influenciada por el flujo
masculinos de las poblaciones del mundo, incluida la génico y/o la migración (Gómez et al., 2008).
de Bolivia, presentan diferencias en la estructura
génica de DYS481, lo que sugiere un patrón evolutivo Se ha visto también, que mientras la distribución de
independiente de este marcador (Tabla 4) (De Knijff las frecuencias alélicas sea amplia, el poder de
et al., 1997; Geppert et al., 2009; Cloete et al., 2010; Xu discriminación (PD) aumenta y la probabilidad de
et al., 2010). coincidencia (PC) disminuye. En el presente caso el
DYS481 alcanza el 0.8175 de PD y 0.1825 de PC,
La DG de la población Alemana es la más polimórfica encontrándose dentro del rango de 0.7172 a 0.8504 y
(12 alelos), seguida por las poblaciones China, de 0.1496 a 0.2827 respectivamente de otras
Caucásica, Africana, Arábica y Boliviana. Por tanto, poblaciones del mundo (Tabla 4).
las poblaciones con más alelos tienden a presentar
mayor DG cuando éstos están desigualmente En el presente estudio el DYS481 fue evaluado en
distribuidos De Knijff et al., 1997; Geppert et al., combinación con 17 marcadores del sistema genético
2009; Cloete et al., 2010; Xu et al., 2010). Por ejemplo, AmpFiSTR® Y-Filer y con el haplotipo mínimo
la población de Leipzig (Alemania) muestra DG de
UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
24 IITCUP CIENCIA VOL1 No1 (2013)

constituido por 9 marcadores, observándose que, a En el perfil genético de la muestra de ensayo se


medida que se incrementa el número de Y-STRs, la detectaron 8 de los 16 marcadores esperados del
diversidad haplotípica y la PD se incrementan, lo que sistema Y-Filer (Tabla 3) y su análisis bayesiano
a su vez hace que la PC entre dos individuos tomados muestra RV de 91.647.311, que no es suficiente para
al azar disminuya. arribar a conclusiones en un contexto jurídico. Al
incluir al nuevo DYS481 la RV se incrementa a
Si se reduce el número de marcadores analizados, 142.088.855. Es importante notar que la RV se
estadísticamente se incrementará el número de interpreta como el número de veces más probable de
linajes que estarían emparentados. Si se utiliza solo el que la evidencia corresponda al sospechoso que a
haplotipo mínimo (9 marcadores) el incremento es otro individuo tomado al azar de la “misma”
más notorio, lo que podría llevar a falsas población (Tabla 3 y Figura 5).
coincidencias de linaje. En síntesis, la utilización de
un número reducido de marcadores hace que la
probabilidad de coincidencia sea mayor, lo que eleva
la probabilidad de encontrar ese haplotipo en la
población y resta certeza a las conclusiones del
análisis, mucho más si el estudio no puede
complementarse con otros marcadores, como los
STRs autosómicos. Nótese que la diversidad
haplotípica de la subpoblación de La Paz obtenida
incluyendo a DYS481 fue del 99.6%, superior al
obtenido solo con el sistema AmpFiSTR® Y-Filer de
99.25% (Tabla 5). Figura 5. Incremento acumulativo exponencial de la
Razón de Verosimilitud (RV) con (rojo) y sin (azul)
DYS481.

Tabla 5.Diversidad Haplotípica (DH), Poder de


Discriminación (PD) y la Probabilidad de Coincidencia
Más aún, los 8 marcadores otorgan una probabilidad
para el Haplotipo Extendido, sistema Y-Filer y Haplotipo de correspondencia del 99,9891%. La adición del
mínimo (HM). Subpoblación de La Paz con un n=33. DYS481 incrementa la misma a 99,9993%, que
representa 1 en 100000 linajes masculinos de
SISTEMA DH PD PC correspondencia positiva. En el dictamen pericial la
Haplotipo Mínimo 94.72% 70.27% 29.7% conclusión presentada al Juez diría: “la evidencia
Y-Filer® 99.25% 95.00% 5.00% colectada en la escena del crimen y la muestra del
Haplotipo Extendido 99.60% 97.00% 3.10% sospechoso comparten 9 marcadores Y-STR con
probabilidad de correspondencia del 99,999 por
ciento”.
Por otro lado, para el análisis de polimorfismos
genéticos en muestras biológicas degradadas, se Este pequeño ensayo demuestra que los sistemas
evalúa la correspondencia de la muestra de comerciales pueden ser insuficientes para arribar a
referencia con la evidencia en duda. Este cotejo conclusiones y que la adición de un mini-STRs
permite tres posibles resultados: que no coincida suficientemente polimórfico puede incrementar la
ningún marcador, que coincida uno o más o que certeza del resultado (Figura 5), especialmente si se
coincidan todos. En cualquier caso, las conclusiones consideran Y-STRs de tamaño reducido y, por tanto,
se basarán en el teorema de Bayes (inferencia de la detectables en muestras biológicas muy complejas.
probabilidad final de un suceso a partir de la Tómese en cuenta también que, en todos los casos, el
conjunción de las probabilidades parciales). El proceso de validación lleva implícita la tipificación
resultado presentado al juez se conoce como “Razón del marcador en la población en cuestión ya que el
de Verosimilitud” (RV) o "razón bayesiana de análisis estadístico será siempre diferente entre
probabilidad”. poblaciones.
UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No1 (2013) 25

CONCLUSIÓN Roewer, L.. 1997. Chromosome Y


microsatellites: population genetic and
Se ha demostrado que el mini-YSTR DYS481 es útil evolutionary aspects. Int. J. Legal. Med., 110:
para identificar linajes e incrementar el valor de los 134–140.
índices estadísticos de los actuales sistemas Hanson, E. K. & Ballantyne, J.. 2007. An ultra-high
comerciales, ampliando la certeza de los resultados discrimination Y-chromosome short tandem
con evidencias biológicas complejas. repeat multiplex DNA typing system. Plos
One, 2(8): e688.
La adición del mini-YSTR DYS481 incrementa de Kayser, M., Kittler, R., Ralf A, Hedman, M., Lee, A.
forma acumulativa y significativa el valor de la razón C., Mohyuddin, A, Mehdi, S.Q., Rosser, Z.,
de verosimilitud y disminuye el número de Stoneking, M., Jobling, M.A., Sajantila, A. &
marcadores no detectados durante una prueba de Tyler-Smith, C.. 2004.. A comprehensive
ADN, por lo tanto es especialmente útil para el survey of human Y-chromosomal
análisis estadístico de indicios forenses complejos microsatellites, 74(6): 1183-1197.
donde la tipificación es comúnmente incompleta. Roewer, L.. 2009. Y chromosome STR typing in crime
casework. Forensic Sci Med Pathol, 5: 77–84.
Las tres subpoblaciones estudiadas presentan una Romero, R. E., Briceño, I., Lizarazo, R., Sascha, W.,
DG superior a 0.65 y la diversidad alélica demostró Roewer, L. & Gómez, A.. 2008. A Colombian
ser independiente para cada sub-población. El PD de caribbean population study of 16 Y-
este mini-YSTR es de 0.8175, por encima del chromosome STR loci. Forensic Science
promedio mundial de 0.65, por tanto el locus International: Genetics, 2: e5–e8.
analizado es apto para su aplicación como marcador Djelloul, S. & Sarafian, V.. 2008. Validation of a 17
forense de identidad humana en linajes masculinos locus Y-STR multiplex system. Forensic
de las subpoblaciones de La Paz, Sucre y Santa Cruz. Science International: Genetics Supplement
Series, 1: 198–199.
AGRADECIMIENTOS Geppert, M., Edelmann, J. & Lessig R.. 2009. The Y-
chromosomal STRs DYS481, DYS570, DYS576
Los autores desean reconocer y agradecer al Centro and DYS643. Legal Medicine, 11: S109–S110.
de Investigación Genética del Instituto de Schneider, S., Roessli, D. & Excoffier, L.. 2000.
Investigación Técnico Científicas de la Universidad Arlequin: A software for population genetics
Policial por su apoyo a este proyecto. Especial data analysis, v2.000. Laboratorio de Genética
agradecimiento a las FELCC de La Paz, Sucre y Santa y Biometría, Departamento de Antropología,
Cruz por haber proporcionado las muestras de las Universidad de Geneva, Suiza.
subpoblaciones en estudio y a la Facultad de Ciencias Nei, M.. 1973. Analysis of gene diversity in
Farmacéuticas y Bioquímicas de la Universidad subdivided populations. Proc. Nat. Acad. Sci.
Mayor de San Andrés. USA. 70, 12: 3321-3323.
Jones, D. A.. 1972. Blood samples: probability of
REFERENCIAS discrimination. J. Forensic Sci. Soc., 12: 355-
359.
De Knijff, P., Kayser, M., Caglià, A., Corach, D., Fisher, R. A.. 1951. Standart calculations for
Fretwell, N., Gehrig, C., Graziosi, G., evaluating a blood-group systems. Heredity,
Heidorn, F., Herrmann, S., Herzog, B., 5: 95-102.
Hidding, M., Honda, K., Jobling, M., D' Amato, M. E., Ehrenreich, L., Cloete, K.,
Krawczak, M., Leim, K., Meuser, S., Meyer, E., Benjeddou, M. & Davison, S.. 2010.
Oesterreich, W., Pandya, A., Parson, W., Characterization of the highly discriminatory
Penacino, G., Perez-Lezaun, A., Piccinini, A., loci DYS449, DYS481, DYS518, DYS612,
Prinz, M., Schmitt, C., Schneider, P. M., DYS626, DYS644 and DYS710. Forensic
Szibor, R., Teifel-Greding, J., Weichhold, G., Science International: Genetics, 4: 104–110.

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
26 IITCUP CIENCIA VOL1 No1 (2013)

Calabrese, P. P., Durrett, R. T. & Aquadro, C. F.. rate at Y-Chromosome short tandem repeats,
2001. Dynamics of microsatellite divergence with Application to Human Population-
under stepwise mutation and proportional Divergence Time. Am. J. Hum. Genet., 74: 50–
slippage/point mutation models. Genetics, 61, 2004
159: 839–852. Cloete, K., Ehrenreich, L., D’Amato, M. E., Leat, N.,
Gómez, A., Ávila, S. J. & Briceño, I.. 2008. De Davison, S., Benjeddou, M.. 2010. Analysis of
genotipos e isonimias: análisis de correlación seventeen Y-chromosome STR loci in the
entre el apellido y el patrimonio genético Cape Muslim population of South Africa.
heredado en el cromosoma Y en la población Legal Medicine, 12: 42–45.
de tres departamentos del suroccidente Xu, Z., Sun, H., Yu, Y., Jin, Y., Meng, X., Sun, D., Bai,
colombiano. Biomédica, 28(3). J., Chen, F. & Fu, S.. 2010. Diversity of five
Burgarella, C. & Navascués, M.. 2011. Mutation rate novel Y-STR loci and their application in
estimates for 110 Y-chromosome STRs studies of north Chinese populations. J.
combining population and father–son pair Genet., 89: 29–36.
data. European Journal of Human Genetics, Järve, M., Zhivotovsky, L. V., Rootsi, S., Help, H.,
19: 70–75. Rogaev, E. I., Khusnutdinova, E. K., Kivisild,
Kimura & Ohta, T.. 1978. Stepwise mutation model T., Sanchez, J. J. 2009. Decreased rate of
and distribution of allelic frequencies in a evolution in Y Chromosome STR loci of
finite population. Proc. Nati. Acad. Sc., 75(6): increased size of the repeat unit. Unit. PLoS
2868-2872. ONE, 4(9): e7276.
Zhivotovsky, L. A., Underhill, P. A., Cinniog, C., Fung, W.K. and Hu, Y.Q. 2008. Statistical DNA
Kayser, M., Morar, B., Kivisild, T., Scozzari, forensics: theory, methods and computation.
R., Cruciani, F., Destro-Bisol, G., Spedini, G., Wiley, Hoboken, NJ.
Chambers, G. K., Herrera, R. J., Yong, K., Carralero, Y.J. 2006. Matemáticas aplicadas a la
Gresham, D., Tournev, I., Feldman, M. & genética forense. Venezuela: Secretaria
Kalaydjieva, L.. 2004. The effective mutation General Técnica. p.48-58.

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No1 (2013) 27

ARTÍCULO ORIGINAL

HAPLOTIPOS DE ADN MITOCONDRIAL REVELAN POSIBLE RUTA


MIGRATORIA ANCESTRAL DE LOS PUEBLOS URU Y AYOREO DE
BOLIVIA

Villarroel, W.1, Sbtte. Adm. Arteaga, D.2 & Sosa, L.1

1 Facultad de Ciencias Farmacéuticas y Bioquímicas. Universidad Mayor de San Andrés. La Paz-Bolivia.


2 Centro de Investigación Genética, IITCUP, Universidad Policial. La Paz, Bolivia. cingen.ptc@gmail.com

RESUMEN

El poblamiento de América producido a través de distintas rutas migratorias desde el continente africano constituye uno de los
eventos más importantes de la historia evolutiva del ser humano pues dio origen a los distintos pueblos y tribus del planeta. Diversos
estudios antropológicos, lingüísticos, sociales y religiosos se han desarrollado en el pasado. Sin embargo, la reciente inclusión del
ADN mitocondrial (ADNm) ha suministrado nuevos elementos para reconstruir y comprender mejor la historia de las migraciones
humanas. El presente trabajo estudió los pueblos indígena–originarios bolivianos “Uru” del departamento de Oruro y “Ayoreo” de
Santa Cruz, secuenciando la región hipervariable del ADNm y encontrando haplotipos únicos y diferentes para ambos pueblos. El
análisis filogeográfico sugiere que el pueblo “Uru” llegó al continente americano a través de la India y las islas de la Polinesia, mientras
que el “Ayoreo” a través de Istmo de Beringia al estar emparentado con pueblos de norte, centro y Sudamérica. El linaje ancestral de
los haplotipos “Uru” parece ser el más antiguo de ambos dada su relación con los linajes africanos nativos. La inclusión de más
pueblos indígena–originarios es fundamental para comprender mejor el origen e historia del Estado Plurinacional de Bolivia.

PALABRAS CLAVE: Filogeografía, haplotipo, ADN mitocondrial, Uru, Ayoreo.

JUCH’URIMANCHANA

Ancha rumas chaymurqanku Americaman llajtachakuy Africamanta kay wakikux yachanpay imaynata ñawpariqhusqa runas
imaytin. Chaymanpacha miraskanku ancha runas kay jallp`achispi planeta miska. Tukuylaya yachaykuna ruwaqhorqa
ñawparumasmanta, tullusminqhuta kawarqanku yachamankupax imaynachus karkanku, mana tukuy runas jukllatachu
parlanqanku, janaxpachatatanchismanta yachaykuna ruwakullantay kay wax yachakuna hastawan suticharkuska kay ADN
mitocondrial minku chaywan yachakunanpax maymanta runas chaymurkanku kay jall`pacnshidman. Chayrayku ruwakun llankày
kay llaxtanchispi paqarisqamanta “Uru” Oruromanta, “Ayoreo” Santa Cruzmanta riqhuchispa kay yachakana yachanapay
maymantachus jamunku kay llaxtas richuchin kay llajta Urusman chaymuskankuta India nixta, Islas Polinesia tawan, chanta llajta
Ayoreo jamusqa Itsmo Beringiamanta imaxtin ñawarman kanku chncha chawpi americamanta, Ñawpaxwaskas llajta Urusmanta
kanku astawan mawkas imaray cuchus ñawarmasi kanku Africanoswan.

RIMANAS: Maymantata, haplotipo, ADN mitocondrial, Uru, Ayoreo.

ABSTRACT

El poblamiento de América producido a través de distintas rutas migratorias desde el continente africano constituye uno de los
eventos más importantes de la historia evolutiva del ser humano pues dio origen a los distintos pueblos y tribus del planeta. Diversos
estudios antropológicos, lingüísticos, sociales y religiosos se han desarrollado en el pasado. Sin embargo, la reciente inclusión del
ADN mitocondrial (ADNm) ha suministrado nuevos elementos para reconstruir y comprender mejor la historia de las migraciones
humanas. El presente trabajo estudió los pueblos indígena–originarios bolivianos “Uru” del departamento de Oruro y “Ayoreo” de
Santa Cruz, secuenciando la región hipervariable del ADNm y encontrando haplotipos únicos y diferentes para ambos pueblos. El
análisis filogeográfico sugiere que el pueblo “Uru” llegó al continente americano a través de la India y las islas de la Polinesia, mientras
que el “Ayoreo” a través de Istmo de Beringia al estar emparentado con pueblos de norte, centro y Sudamérica. El linaje ancestral de
los haplotipos “Uru” parece ser el más antiguo de ambos dada su relación con los linajes africanos nativos. La inclusión de más
pueblos indígena–originarios es fundamental para comprender mejor el origen e historia del Estado Plurinacional de Bolivia.

KEY WORDS: Filogeografía, haplotipo, ADN mitocondrial, Uru, Ayoreo.

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
28 IITCUP CIENCIA VOL1 No1 (2013)

INTRODUCCIÓN de Asia y atravesaron las islas del Pacífico,


navegando, hasta llegar al continente Americano
La antropología y otras ramas afines estudian las (Rivet, 1947).
poblaciones indígenas con el fin de conocer el patrón
de la migración humana (Sutcliffe, 1998), que persiste Por su antigüedad y relevancia histórica, las
en su religión, cultura, tradiciones y en su estructura poblaciones indígenas bolivianas Uru y Ayoreo han
genética, creando gradualmente una imagen de sido protagonistas de varias publicaciones basadas
cuándo y dónde se movieron los humanos antiguos en estudios antropo-socio-culturales (Badani, 2006;
en el mundo (National Geographic Society, 2010). Ministerio de Educación, 2008; Koop & Díez, 2009).

CONCEPCIÓN

ZAPOCÓ

LLAPALLAPANI

CHIPAYA

Figura 1. Puntos de muestreo en comunidades Uru (rojo) y Ayoreo (amarillo).

Se han postulado distintas rutas migratorias para el Investigaciones lingüísticas compararon el Puquina
poblamiento de América, entre ellas la del Istmo de con lenguas de las islas de la Polinesia del Pacífico,
Beringia, la formación de un puente de hielo hace proponiendo un vínculo entre Urus y Polinesios.
40.000 a 50.000 años, permitiendo la migración desde Estos vínculos deben estudiarse detalladamente y el
el norte de Asia. Otra ruta, postulada por Paul Rivet, ADN ha demostrado ser una fuente de información
sugiere que grupos humanos partieron desde el Este insustituible pues las secuencias genéticas han
UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No1 (2013) 29

acompañado a los seres humanos a través del tiempo I y II del ADN mitocondrial fueron amplificados
y el espacio, y puede atestiguar la hazaña migratoria usando los cebadores específicos L15997, H16391,
de pueblos como los Uru o los Ayoreo. L48 y H408. Los productos purificados fueron
secuenciados con el sistema comercial “BigDye
La antropología genética ofrece una nueva Terminator v 3.1” en un Analizador Genético
herramienta para estudiar las migraciones humanas, AB3130 (Applied Biosystems) según
otorgando una mejor idea de los procesos de recomendaciones del fabricante.
evolución para la reconstrucción de los patrones
migratorios que pueden rastrearse en el tiempo (Bert Análisis de Datos
et al., 2004; Dornelles et al., 2004; Costa et al., 2008),
demostrando así que cada población nativa guarda Las secuencias fueron verificadas por
una gran riqueza genética para las naciones del complementariedad desde la posición 16024 a 16365
mundo. en HVI, y 73 a 340 en HVII. Se observó heteroplasmía
de longitud en HVI para la población Uru. Las
La región control hipervariable del ADN secuencias fueron alineadas y comparadas con la
mitocondrial (HV) es especialmente útil para estos Referencia Revisada Cambridge (rCRS) en el
estudios, donde el análisis de haplotipos, la programa Bioedit (www.mbio.ncsu.edu). Se
identificación de haplogrupos y la filogeografía identificarón los haplotipos propios para cada
combinada, permiten relacionar poblaciones población y se los clasificó en haplogrupos según la
geográficamente separadas, rastreando y base de datos “Mitomap” (www.mitomap.org).
reconstruyendo su historia evolutiva (Bailliet et al.,
1994; Fernández, 2000; Bert et al., 2004; Álvarez, et al., La construcción de los árboles filogenéticos y las
2007). redes de haplotipos se realizó con los programas
MEGA 4.1 (Tamura et al., 2003) y TCS 1.21, ambos
Por los antecedentes vertidos este trabajo ha tratado basados en el método Neighbor-Joining (Bandelt et
de obtener información para las siguientes al., 2006), con nivel de consistencia de 1000 réplicas y
cuestiones: ¿los haplotipos HV de los Uru y Ayoreo utilizando como grupos externos un ancestro
son únicos y diferentes entre sí?, ¿cuál es la relación africano, el homínido neandertal y el Pan troglodytes.
filogenética de éstos con respecto al resto del mundo?
y ¿cuál es la relación filogeográfica de estas Adicionalmente se efectuó un análisis filogenético de
poblaciones? las poblaciones Uru y Ayoreo en una base de datos
separada de 13 secuencias de poblaciones indígenas
MATERIALES Y MÉTODOS del mundo obtenidas del Genebank.

Población de Estudio RESULTADOS Y DISCUSIÓN

Se colectaron 53 muestras de hisopado bucal de Se identificaron seis haplotipos: URU1, URU2, URU3,
personas mayores de edad no emparentadas, URU4 en las muestras de origen Uru (Figrua 1),
pertenecientes a los pueblos Uru (comunidades identificándolas con el Haplogrupo Universal B, y
Llapallapani y Santa Ana de Chipaya, Oruro) y AYO1 y AYOE para las muestras de origen Ayoreo,
Ayoreo (comunidades Concepción y Zapocó, Santa identificadas con el Haplogrupo Universal C
Cruz). (Dornelles et al., 2004).

Amplificación por PCR En el árbol filogenético resultante (Figura 2) se


observa la formación de dos clados propios para cada
Se obtuvo ADN total con el sistema “Wizard pueblo. Por la topología en contraste a la secuencia
Genomic DNA Purification” (Promega) optimizado del ancestro africano, es muy posible que estas dos
(Miller et al., 1988). Las regiones Hipervariables (HV) poblaciones provengan de linajes remotamente

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
30 IITCUP CIENCIA VOL1 No1 (2013)

emparentados. marítima por las islas del pacífico centro y sur.

Las investigaciones antropológicas sustentan que la


población indígena Uru posee amplios
conocimientos sobre navegación ya que incluso se
autodenominan Jas–shoni “Hombres del Agua”,
conocimiento o memoria transmitida por
generaciones. Por otro lado, a orillas del lago Titicaca
existen poblaciones Aymara que navegan el lago con
conocimientos adquiridos por de Uru, ya que estos
pueblos Aymara en principio fueron exclusivamente
agricultores (Gisbert & Gisbert, 1998; Fisher et al.,
Figura 1. Árbol Filogenético de secuencias Uru y Ayoreo 2008; Cáceres, 2009; Kopp, & Díez, 2009).
de la región hipervariable mitocondrial con el método
Neighbor-Joining (Bootstrap 1000) (Bandelt et al., 1995) Varios investigadores antropólogos étnicos
siguiendo el modelo de sustitución de Tamura & Nei reconocen que el pueblo Uru es uno de los pocos que
(1993) El grupo externo corresponde al primate Pan ha mantenido su antigüedad e identidad por siglos.
troglodytes (chimpancé).
Esta antigüedad está comprobada por la familia
lingüística a la pertenece el idioma Puquina, que
La Figura 3 muestra la relación filogenética de los
tiene raíces con dialectos de la Polinesia (Fisher et al.,
Uru y Ayoreo bolivianos estudiados con otras
2008; Cáceres, 2009; Kopp, & Díez, 2009).
poblaciones del mundo. El árbol muestra 2 clados, el
de poblaciones amerindias emparentadas con los
En contraste a los Uru no existen aún investigaciones
Ayoreo, y el segundo de otras poblaciones bolivianas
antropológicas profundas de los Ayoreo, quienes en
(artículo en preparación) junto la población Uru, pero
entrevista reconocen su reciente asentamiento y que
a su vez emparentado con poblaciones nativas de las
antiguamente eran nómadas. El presente estudio
Islas de la Polinesia (Oceanía). Asimismo los Uru y
provee por primera vez información genética
Ayoroa forman independientemente un único clado
detallada sobre la población Ayorea, con resultados
respecto a las demás poblaciones bolivianas, lo que
que deben impulsar investigaciones antropológicas
podría indicar que han preservado mejor su linaje
serias.
materno ancestral.
Correlacionando los datos obtenidos con los del
Estos resultados llevaron a estructurar un árbol
Haplogrupo Universal C para los Ayoreo y del
filogenético compuesto por solamente las
Haplogrupo B para los Uru, además de los datos de
poblaciones Uru, Ayoreo, Polinesia y algunas nativas
relación filogenética y la red de haplotipos, es factible
de Norteamérica. La Figura 4 muestra el resultado,
proponer que el territorio boliviano fue colonizado
donde se aprecia el clado de los Ayoreo acompañado
antiguamente a través de distintas rutas migratorias
por pueblos indígenas de Norte, Centro y
(Figura 5), planteando a su vez que la Población
Sudamérica, y el clado Uru acompañado de
Indígena Ayorea recorrió la ruta migratoria terrestre
poblaciones indígenas de la Polinesia, Australia e
desde el Istmo de Beringia, atravesando Norte,
India. El subsecuente análisis de la red haplotipos
Centro y Sudamérica.
(artículo en preparación) mostró los pasos
mutacionales con respecto al ancestro africano,
Asimismo, la Población Indígena Uru tomó la ruta
sugiriendo que la población indígena Ayorea
migratoria marítima, atravesando las islas del
atravesó un proceso evolutivo más largo que el Uru.
Océano Pacífico hasta llegar a las costas de
Considerando que el tiempo generacional de una
Sudamérica de donde migraron gradualmente al
migración por tierra (de norte a sud américa) es
norte, estableciéndose en los cuerpos de agua
mucho mayor que por mar, es posible vincular la
continentales como el Lago Titicaca y el Poopó.
corta evolución genética de los Uru a una migración
UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No1 (2013) 31

Figura 4. Filogenia de los Uru, los Ayoreo y pueblos


nativos de América y Polinesia.

AYOREO

Figura 2. Árbol Filogenético de algunos pueblos URU


indígenas de Bolivia y varios pueblos del mundo, basado
en los polimorfismos HVI y II con el método Neighbor-
Joining (Bootstrap 1000) (Bandelt et al., 1995) y el modelo
de sustitución de Tamura & Nei (1993). Quechua,
Aymara, Moseten y Chimane (Bolivia), Yanomama y
Warao (Venezuela), Mataco (Argentina), Bella Coola
(Colombia), Guaraní (Paraguay), Maya (México), Ojibwa Figura 5. Ruta migratoria propuesta para los pueblos
(USA), Evenk (Siberia), Polinesia, Australia e India indígenas originarios Uru y Ayoreo del territorio
(Torroni et al., 1993a; Torroni et al., 1993b; Bert et al., boliviano (crédito de Jesús Mourín, 2013).
2004; Matallana & Cruzado, 2010).

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
32 IITCUP CIENCIA VOL1 No1 (2013)

CONCLUSIONES Corte- Real, F.. 2008. Mitochondrial sequence


analysis of native Bolivians population.
La región HVI y II del ADN mitocondrial ha Forensic Science international. Genetics
demostrado ser altamente informativa para estudios Supllement. 1:250-261.
antropológicos de las poblaciones Uru y Ayoreo del Dornelles, C., Battilana, J, Fagundes, N. J., Freitas, L.,
territorio boliviano. Ambos poseen haplotipos Bonatto, S., & Salzano, F.. 2004. Mitochondrial
mitocondriales de distinto linaje ancestral y de ADN and Alu insertions in a genetically
evolución convergente. peculiar population: The Ayoreo Indians of
Bolivia and Paraguay. American Journal of
Inclusión de otros grupos nativos y correlación con Human Biology 16:479–488.
otras disciplinas científicas es necesaria para evaluar Fabre, A. Los pueblos del Gran Chaco y sus lenguas,
las hipótesis propuestas y para consolidar la cuarta parte: Los zamuco. Actualizado: 2007-
importancia de preservar la existencia y proteger la 03-11. Consultado: 2009-07-04.
historia de estas poblaciones. www.butler.cc.tut.fi.
Fariñas, M. Diversidad Étnica e Inclusión Social en
BIBLIOGRAFIA Bolivia. Actualizado: 2008-11-01. Consultado:
2010-02-02. www.fundacioncarolina.es
Álvarez, V., Jaime, J.C., Carracedo, Á., & Salas, A.. Fisher, J., Patrick, D., & Tovías, B.. 2008. De la
2007. Coding region mitochondrial ADN etnohistoria a la historia en los Andes: 51o
SNPs: Targeting East Asian and Native Congreso Internacional de Americanistas.
American haplogroups. Forensic Science 1ra. Edición. Editorial Abya Yala. Quito
International: Genetics, 1: 44–55. Ecuador p. 309.
Badani, J.. 2006. Los Urus reviven de la mano de sus Fernández, E.. 2000. Polimorfismos de ADN
niños. La Razón. Consultado 2009 – 02-18. mitocondrial en Poblaciones Antiguas de la
http://www.larazon.com/versiones/20061224 Cuenca Mediterránea. Departamento de
_005765/nota_277_371572.htm Biología Animal de la Universidad de
Bailliet, G., Rothhammer, F., Carnese, F., Bravi, C., & Barcelona, p.643.
Bianchi, N.. 1994. Founder Mitochondrial Freed, S., & Freed, R.. 1967. El Hombre desde su
Haplogroups in Amerindian Populations. Comienzo. C.I. – Jhon W. Clute, S.A.. México,
American Journal of Human Genetics 55: 27- D.F. p 144.
33. Gisbert, J., & Gisbert, C.. 1998. Historia de Bolivia.
Bandelt, H., Macaulay, V., & Richards, M.. 2006. Segunda Edición. Editorial Gisbert y Cía. La
Human mitochondrial ADN and the Paz – Bolivia. p 731.
evolution of Homo sapiens. Springer- Verlag Izaguirre, N., & De La Rúa, C.. 2000. Aportación de
Berlin Hiedelberg. p 271. la biología molecular al estudio antropológico
Bert, F., Corella, A., Gené, M., Pérez, A., & Turbón, de las poblaciones humanas del pasado:
D.. 2004. Mitocondrial ADN Diversity in the análisis del ADN mitocondrial. Revista
Llanos de Moxos: Moxo, Movima and Española de Antropología Biológica. 21: 1-10.
Yuracare Amerindian populations from Kopp, A., & Díez, A.. 2009. Uru Chipaya y Chullpa.
Bolivia Lowlands. Annals of human Biology. Soberanía Alimentaria y Gestión Teritorial en
1: 9-28. dos culturas andinas. Primera Edición.
Cáceres, X.. 2009. Los Urus y un proyecto común de Bolivia. p 150.
Pueblo. Memoria de los Encuentros Matallana, M., & Cruzado J.. 2010. Estudios sobre
educativos, culturales y deportivos de la ADN mitocondrial sugieren un linaje
Niñez de la Nación Uru. Editorial Catacora. predominante en la cordillera Oriental de
La Paz- Bolivia. p 72. Colombia y un vínculo suramericano para los
Costa, H., Lopes, V., Balsa, F., Bento, A., Pantoja, S., arcaicos de Puerto Rico. Universidad Médica.
Anjos, M., Carvalho, M., Vide M.,Vieira, D., & Bogotá, Colombia, 51(3): 241-272.

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No1 (2013) 33

MINISTERIO DE EDUCACIÓN. 2008. Saberes y Tamura, K., & Nei, M.. 1993. Estimation of the
conocimientos del pueblo ayoreo. number of nucleotide substitutions in the
Viceministerio de Educación Escolarizada control region of mitochondrial DNA in
Alternativa y Alfabetización. Programa de humans and chimpanzees. Molecular Biology
Educación Intercultural Bilingüe de Tierras and Evolution 10:512-526.
Bajas. Santa Cruz, Bolivia. Torroni, A., Schurr T., Cabell M., Brown M., Neel J.,
Miller, S., Dykes, D., & Polesky, F. 1988 A simple Larsen M., Smith D., Vullo C., & Wallace D..
salting out procedure for extracting DNA 1993a. Asian Affinities and Continental
from human nucleated cells. Nucleic Acids Radiation of the Four Founding Native
Research 16: 3. American mtADNs. The American Journal of
National Geographic Society. 2010. Genographic Human Genetics. 53:563-590.
Project. Actualizado: 2010-06-10. Consultado: Torroni, A., Sukernik R., Schurr T., Sarikovskaya Y.,
2010- 06- 12. Cabell M., Crawford M., Comuzzie A., &
www.genographic.nationalgeographic.com Wallace D.. 1993b. mtADN Variation of
Rivet, P.. 1947. Les Origines de l’homme américain. Aboriginal Siberians Reveals Distinct Genetic
Montreal: les Éditions de l’Arbre. Affinities with Native Americans. The
Sutcliffe, B.. 1998. NACIDO EN OTRA PARTE: UN American Journal of Human Genetics. 53:591-
ENSAYO SOBRE LA MIGRACION 608.
INTERNACIONAL, EL DESARROLLO Y LA
EQUIDAD. Volumen 1. Hegoa. Bilbao –
España. p 186.

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
34 IITCUP CIENCIA VOL1 No1 (2013)

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No1 (2013) 35

ARTÍCULO ORIGINAL

ESTRATEGIA DE FORRAJEO Y TAXONOMÍA MOLECULAR DE


CUATRO PICAFLORES EN LA CEJA DE MONTE YUNGUEÑA DE
LA PAZ
Sbtte. Adm. Serrudo, V., Abtte. Adm. Arteaga, D., Ninahuanca, A. & Sbtte. Adm. Salazar, K.

Grupo de Investigación Tantasarañani, IITCUP, Universidad Policial. cingen.ptc@gmail.com

RESUMEN

La estrategia de forrajeo es una parte importante del comportamiento relacionado con la obtención del requerimiento
energético y ha demostrado ser un carácter taxonómico apto a nivel de subfamilia, ya que la mayoría de las especies de
la subfamilia más antigua de picaflores adopta el ruterismo, mientras que la más reciente el territorialismo. Durante seis
se estudió éste carácter comportamental a nivel taxonómico en contraste al marcador mitocondrial Cyt-B (362 pb) en
cuatro especies de picaflores de ceja de monte yungueña: Heliangelus amethysticollis, Coeligena violifer, Pterophanes
cyanopterus y Metallura tyrianthina. Las dos primeras tienden al territorialismo y las últimas al ruterismo, agrupación que
no concuerda con la taxonomía molecular. El carácter estrategia de forrajeo no es adecuado para la identificación
taxonómica de estas cuatro especies en el hábitat estudiado.

PALABRAS CLAVE: Estrategia de forrajeo, citocromo-b, ceja de monte yungueña, taxonomía molecular.

JUCH’URIMANCHANA

Imayna mikhuna mask`anku q`intis anchamunayku yachayta imaynatiyanku yachanapax mayka kallapatian chantapis
sumaj carácter taxonómico chhklay suballyukama imaxtin ashqa astawan ñaxpax suballyupaxta imajtin ancha q`intis
suballyu ñaxpax tiyarqanku maynata makanakunku, maymanta mask`anku mikhunankuta qayta tinkuchirqanku
maynata makanakunku, imaynata mask`anku mikhunakuta qayta tinkuchirqanku uj yachaqanwan marcador
mitocondrial citocromo b (362 pb) nispatawa jamu q`intispi Ceja de Monte Yungueñamanta; kay tawa jamu kanku.
Heliangelus amethysticollis, Coeligena violifer, Pterophanes cyanopterus, Metallura tyrianthina. Iskay H.
amethysticollis, C. violifer mana mikhuna mask`anakuna, nixta P. cyanopterus, M. tyrianthina ari. Chaymanta kay
caracter mana allinchu taxonomía molecularpax.

RIMANAS: Imayna mikhuna mask´ay, citocromo-b, ceja de monte yungueña, taxonomía molecular.

ABSTRACT

Foraging strategy is a keystone of the hummingbird behavior related with obtaining energetic requirement and, at
subfamily level, have demonstrated been a good taxonomic character because most of the species belong to the most
antique subfamily are trapliners instead most recent are territorialists. Along six months it has been evaluated this
comportamental character at taxonomic level in four hummingbirds species from “ceja de monte yungueña” Heliangelus
amethysticollis, Coeligena violifer, Pterophanes cyanopterus and Metallura tyrianthina and contrasted the findings with the
mitochondrial molecular marker Cyt-B (362 pb) showing that the first two species tend to territorialism and two last
ones tend to behave as trapliners, cluster that doesn’t agree with taxonomic one obtained with Cyt-b. These results show
that the foraging strategy character by itself is not due for taxonomic works in this habitat and with these four species.

KEYWORDS: Foraging strategy, cytochrome b, ceja de monte yungueña, molecular taxonomy.

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
36 IITCUP CIENCIA VOL1 No1 (2013)

INTRODUCCIÓN Con ese enfoque, el presente trabajo ha estudiado una


región del gen citocromo-b mitocondrial, altamente
La estrategia de búsqueda de alimento (estrategia de informativo, y lo ha contrastado con el carácter
forrajeo) está fuertemente influenciada por las comportamental de forrajeo, para determinar si la
presiones selectivas que favorecen la maximización estrategia de forrajeo puede ser empleada como
de la eficiencia de consumo energético (Begon et al., carácter taxonómico en este hábitat en estas cuatro
2006) como lo refleja el teorema del valor marginal especies.
aplicable a picaflores (Charnov, 1976; Pyke, 1978;
Carmel & Ben-Haim, 2005). Una estrategia implica MATERIALES Y MÉTODOS
un grado de decisión sobre un evento para llegar a un
fin el cual, en este caso, es alimentarse, una de las dos Área de estudio.
funciones básicas de todo organismo vivo. En el
mundo de los picaflores se presentan dos estrategias Los picaflores se observaron en los primeros cuatro
antagónicas entre sí, la rutera y territorialista kilómetros de la senda “Sillutinkara” en el Parque
(Feisinger & Colwell, 1978), de las cuales surgen otras Nacional y Área Natural de Manejo Integrado (PN-
que solo son modificaciones de estas dos. ANMI) Cotapata (SERNAP 2001), entre 2.980 y 3.460
metros de altitud, en cuatro parches florales
Al ser sistemas de alto consumo energético debido a utilizados por los picaflores y separados por más de
su forma de vuelo y tamaño (Pearson, 1950; 150 m.
Hainsworth, 1972; Chai, 1997; Suárez, 1998; Gass &
Garrison, 1999) se esperaría que la adopción de una Estrategias de forrajeo.
estrategia de forrajeo de los picaflores influya
significativamente en su supervivencia y, Se estudió la estrategia de forrajeo considerando dos
ulteriormente, en su evolución, como evidencia la tipos: el ruterista (vuelo a lo largo parches florales) y
organización taxonómica a nivel de subfamilia de el territorialista (defensa de parches), bajo las
estas aves, donde la mayoría de las especies dentro variables de respuesta: 1) persecuciones x hora x
de la subfamilia más antigua, Phaethornitinae, parche; 2) estadía en el parche x hora; y 3) presencia
adoptan la estrategia rutera de forrajeo, ocurriendo lo o ausencia en el parche, entendiéndose la
contrario con la subfamilia más reciente, Trochilinae, persecución cuando un espécimen persigue a otro
que se inclina por el territorialismo (Schuchmann, (intra o interespecífico) para proteger un parche de
2001). uno a tres puntos de percheo.

De ahí la inquietud de evaluar la estrategia de Se observaron los siguientes especímenes y


forrajeo como un carácter taxonómico en cuatro cantidades: Coeligena violifer (CBF-2450) seis,
especies cuyo hábitat, la ceja de monte yungueña, Metallura tyrianthina (CBF-2470) ocho, Pterophanes
representa un escenario óptimo debido a sus bajas cyanopterus (CBF-2440) cinco y Heliangelus
temperaturas y lluvias constantes, condiciones amethysticollis (CBF-2405) cinco, identificados por
extremas para estas aves cuyo mayor desafío es marcaje con pintura no tóxica (Acrilex) en la espalda
mantenerse a 40oC, lo que haría que el y pecho después de ser capturados con redes niebla.
comportamiento de búsqueda de combustible para
mantener el calor resalte, poniendo de manifiesto la Para definir matemáticamente ruterismo,
importancia evolutiva de elegir entre ruterismo o la territorialismo, agresividad y movilidad, se
territorialismo. Esta evaluación requiere un análisis emplearon los índices descritos en la Tesis de Grado
integral comportamental-genético (Sánchez, 2003) y de Serrudo (2012) y el artículo consecuente (Serrudo
genético (Bleiweiss et al., 1997; Schuchmann, 2001; et al., 2012). Los factores de territorialidad (T),
Sánchez, 2003; Altshuler et al., 2004; McGuire et al., agresividad (A) y movilidad (M) se registraron desde
2007) dadas las implicancias de la evolución biológica las 8:00 a 09:00 y desde 17:00 a 18:00, durante cuatro
de estas aves. días y 33 horas en total, de enero a mayo de 2010

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No1 (2013) 37

porque en estos meses se aprecia mayor floración y b= Valor de T para la segunda especie.
estas especies no defienden territorios destinados a la
reproducción (Schuchmann, 2001). Con la matriz de distancias de este índice se hizo un
análisis multivariado jerárquico en SYSTAT v.11.
Análisis del genético.
Finalmente se compararon las topologías del
El ADN total fue extraído de las plumas rectrices de dendrograma derivado de las secuencias del gen
cada espécimen, colectadas en sobres manila a citocromo-b y del elaborado en base a la estrategia de
temperatura ambiente y procesadas con el sistema forrajeo observada.
comercial “Wizard DNA Purification Kit” (Promega)
optimizado con proteinasa K 10mg/ml y DTT 100mM RESULTADOS
en la etapa de lisis.
Comportamiento.
Luego se amplificó y secuenció un fragmento
polimórfico de 263 pb del gen citocromo-b con los Evaluando el comportamiento separadamente (Tabla
cebadores L15302 y H15709 (Lee et al. 1996) 1) se observa la tendencia al ruterismo de Metallura
empleando los sistemas comerciales “GoTaq tyrianthina y Pterophanes cyanopterus, por la ausencia
Colorless Master Mix” (Promega) y BigDye de persecuciones en ambas especies. Más aún, el
Terminator v3.1 (Applied Biosystems), revelando los tiempo de vigilancia de estas dos especies se asemeja,
productos finales por electroforesis capilar en el diferenciándose de Heliangelus amethysticollis y
Analizador Genético AB3130 de la Universidad Coeligena violifer, de entre las cuales la primera
Mayor de San Andrés. La secuencias se verificaron muestra mayor tendencia al percheo y la segunda es
con los programas “Sequencing Analysis 5.2” y más agresiva (Tabla 1). Los índices calculados
“Sequence Scanner v 1.0”, para posteriormente posteriormente mostraron la misma tendencia que
editarlas con el programa BioEdit los datos crudos (Tabla 2).
(www.mbio.ncsu.edu) y alinearlas con el algoritmo
ClustalW del programa MEGA 4.0. (Kumar et al. Tabla 1. Comportamiento observado.
2004). N = No. de especímenes observados;
H = sumatoria de horas de observación;
P = promedio de persecuciones x hora x parche;
Las distancias genéticas se obtuvieron con el modelo
E = promedio de estadía en parche por horas parche.
de sustitución de Tamura & Nei (1993). El árbol se
(± = error estándar)
construyó con el método Neighbor-Joining (1987) de
Picaflor N H P E
500 réplicas “bootstraping”, empleando todas las
Metallura 0,00 ± 0,78 ±
posiciones codónicas. 8 4,17
tyrianthina 0,24 1,30
Heliangelus 1,10 ± 8,95 ±
Dendogramas de comportamiento. 5 4,4
amethysticollis 0,52 7,38
Coeligena 1,72 ± 7,22 ±
Con el Índice de Territorialismo (T) por especie se 6 4,16
violifer 3,17 11,36
construyó un dendrograma calculando el índice de
Pterophanes 0,00 ± 0,28 ±
similitud por suma de cuadrados en base al índice de 5 4,25
cyanopterus 0,00 0,55
Morisita–Horn (Moreno, 2000).

2a * b  En el caso de H. amethysticollis se observó a dos


d 2
 
especímenes en un mismo territorio con promedio de
(5)
a  b2 permanencia de 19,3 min x hr y 0,27 min x hr, lo que
Donde: demuestra la variabilidad del comportamiento entre
d = Distancia entre Ts individuos.
a= Valor de T para la primera especie.

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
38 IITCUP CIENCIA VOL1 No1 (2013)

Tabla 2. Índices de agresividad (A), movilidad (M) y comparación de las distancias genéticas al momento
territorialismo (T). (Serrudo et al., 2012). de hacer un análisis taxonómico.
(A) (M) (T) La estrategia de forrajeo como carácter taxonómico.
Picaflor
0…∞ 0…∞ 0…1
M. tyrianthina El dendograma construido con el índice de
0,5 7,8 0.1
(METY) territorialismo (T) confirma la similitud entre C.
H. violifer y H. amethysticollis y posiciona a Metallura
amethysticollis 0,5 0,6 0.8 tyrianthina en un clado intermedio, siendo
(HEAM) Pterophanes cyanopterus (rutero) el más distante y
C. violifer sugestivamente más primitivo. La topología genética
2,0 2,8 0.7
(COVI) y la del comportamiento estudiado (estrategia de
P. cyanopterus forrajeo) son discordantes.
0,0 8,1 0.0
(PTCY)
DISCUSIÓN
Análisis del Citocromo-b.
Una probable explicación del porqué M. tyrianthina,
La distancia genética obtenida con el modelo de la especie más pequeña de las cuatro evaluadas
sustitución de Tamura & Nei (1993) dio como demostró la mayor tendencia al ruterismo puede
resultado la topología de la Figura 1, que es estar relacionada a las condiciones desfavorables
concordante con otros trabajos (McGuire et al. 2007). para la termorregulación de esta especie, ya que en
Metallura tyrianthina y Heliangelus amethysticollis (el ceja de monte yungueña la humedad relativa es alta
primero rutero y el segundo propenso al y, por tanto, las temperaturas bajas (Ribera, 1995;
territorialismo según los índices), ocupan un mismo Navarro & Maldonado, 2002; Armonía, 2010).
clado, mientras que Pterophanes cyanopterus y López-Calleja & Bozinovic (2003), en su trabajo con
Coeligena violifer (el primero rutero y el segundo el Sephanoides sephanoides, observaron que a bajas
más agresivo), ocupan otro, más emparentado al temperaturas se reducen las tasas de movimiento y
grupo control externo Aerodramus fuciphagus, una se gasta mayor energía calentando el néctar frío (Lotz
salangana asiática insectívora Apódida, empleada et al. 2003), por cuanto es muy probable que los
como grupo externo por pertenecer a otra familia, lo picaflores reduzcan actividades como la persecución,
cual ofrece mayor definición y precisión en la las que según Ewald & Carpenter (1978) en Calypte

Figura 2. Árbol de similitud Neighbor-Joinig con el modelo de Morisita–Horn (Moreno, 2000) modificado y el índice
de territorialismo de las cuatro especies observadas de picaflor.
UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No1 (2013) 39

91 Heliangelus amethysticollis
Metallura tyrianthina
Pterophanes cyanopterus
48 Coeligena violifer
Aerodramus fuciphagus (HM626165.1)

0.02
Figura 1. Árbol de similitud Neighbor-Joinig con el modelo de Tamura & Nei (1983) y las secuencias del gen
mitocondrial citocromo-b (263 pb) de las cuatro especies observadas de picaflor.

anna representan casi el 30% de la energía citosina (Stanley & Harrison, 1999) contra guanina,
consumida. como indica Krajewski & King (1996). Los resultados
obtenidos con el producto de PCR utilizado
La tendencia de H. amethysticollis al territorialismo demuestran características comunes en relación a
coincide con los resultados hallados por Altshuler otras familias de aves.
(2006) con picaflores peruanos en la localidad de
Pillahuata (2650 m). El autor determinó que las Finalmente, respecto a las diferencias halladas entre
especies ruteras son aquellas que realizan de dos a el dendograma obtenido con la información genética
ninguna persecución y se encuentran en el parche un y la información comportamental; según el trabajo de
tiempo menor a diez minutos, mientras que las Serrudo 2011, las estrategias de forrajeo de cada
territorialistas un tiempo mayor o igual y llevan a especie pueden cambiar en función de la disposición
cabo persecuciones, lo cual demuestra que a pesar de espacial del alimento, por cuanto mientras más
utilizar diferentes métodos de análisis, los resultados disperso el mismo, mayor éxito adoptando la
son los mismos. estrategia de forrajeo rutera. Por el contrario,
mientras más concentrado el alimento, los adoptarán
Las diferencias del tiempo de estadía por parche la estrategia territorialista; esto fue observado en C.
entre especímenes de H. amethysticollis podrían violifer. Se esperaba que esta especie se agrupara con
deberse a diferencias de edad y por tanto de P. cyanopterus, pero por el contrario se agrupo con H.
experiencia, como el caso de Calypte anna (Ewald & amethysticollis, ya que los recursos alimenticios de
Rohwer, 1980) donde los adultos producen mayor Coeligena se hallaban concentrados en el primer,
número de encuentros agresivos que los juveniles. segundo y tercer parche, por lo que para los
Podría influir también la diferencia en el estatus de individuos de esta especie el adoptar esta estrategia
dominancia, demostrado a nivel interespecífico por era conveniente ya que no tenían que gastar energía
Ewald & Bransfield (1987), donde Archilocus alexandri en establecer rutas, sino en cuidar sus territorios.
está subordinado a Calypte anna.
CONCLUSIONES.
Por otro lado, los resultados moleculares del
citocromo-b son corroborados por los trabajos de La topología caldística derivada del estudio genético
Sánchez (2003), Altshuler et al. (2004) y McGuire et del cutocromo-b y la derivada del comportamiento
al. (2007 y 2008), tanto para el sesgo de la tercera “estrategia de forrajeo” son independientes y por
posición codónica, característico de los marcadores tanto esta última no es apta como carácter
mitocondriales, como para la mayor cantidad de taxonómico para éstas cuatro especies de picaflor.

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
40 IITCUP CIENCIA VOL1 No1 (2013)

AGRADECIMIENTOS. Ewald, P. W. & S. Rohwer. 1980. Age, coloration and


dominance in nonbreeding Hummingbirds:
Al Instituto de Ecología de la Universidad Mayor de A Test of the Asymmetry Hypothesis. Beh.
San Andrés bajo el Convenio UMSA-Policía Eco. Soc. 7: 273-279.
Boliviana por el apoyo financiero, Colección Feinsinger, P. & R. K. Colwell. 1978. Community
Boliviana de Fauna y Herbario Nacional de Bolivia Organization Among Neotropical Nectar-
por préstamo de muestras y equipo, Facultad de Feeding Birds. Am. Zool. 18:779-795.
Ciencias Farmacéuticas y Bioquímicas por el Gass, C. L. & J. S. E. Garrison. 1999. Energy regulation
préstamo de instalaciones y equipo, Peter Feinsinger by traplining hummingbirds. Funct. Eco. 13:
& Sandra Rojas por su colaboración en las revisiones 483-492.
del documento, equipo de trabajo Tantasarañani por Hainsworth, F. R. & L. L. Wolf. 1972. Power of
su apoyo en el trabajo de campo. hovering flight in relation to body size in
hummingbirds. Am. Nat. 106 (951): 589-595.
REFERENCIAS. Krajewski, C. & D. King. 1996. Molecular divergence
and phylogeny: rates and patterns of
Altshuler, D. 2006. Flight performance and cytochrome b evolution in cranes.
competition displacement of hummingbirds Mol.Bio.Evo. 13 (1): 21-30.
across elevational gradients. Am. Nat. 167: Kumar, S., Tamura, K. & M. Nei. 2004. MEGA 3:
216-239. Integrated software for Molecular
Altshuler, D. Dudley, R. & J. Mcguire. 2004. Evolutionary Genetics Analysis and sequence
Resolution of a paradox: Hummingbird flight alignment. Briefing in Bioinformatics. 5 (2):
at high elevation does not come without a 150-163.
cost. PNAS. 101:17731–17736. Lee, P., Clayton, H., Griffiths, R. & R. Paget. 1996.
Armonía. 2010. Bosques secos y nublados del Does behavior reflect phylogeny in swiftlets
municipio de Independencia. La Paz, Bolivia. (Aves: Apodidae)? A test using cytochrome b
Begon, M., Townsend, C. & J. L. Harper. 2006. mitochondrial DNA sequences. PNAS.
ECOLOGY: From individuals to Ecosystems. 93:7091-7096.
4th Ed. Blackwell Publishing. USA. Lopez-Calleja, M. & F. Bozinovic. 2003. Dynamic
Bleiweiss, R., Kirsch, J. A. W. & C. Matheus 1997. energy and time budgets in hummingbirds: a
DNA hibridation evidence for the principal study in Sephanoides sephaniodes. Comp. Bioch.
linages of hummingbirds (Aves: Trochilidae). and Phy. 134: 283–295.
Mol. Bio. & Evo. 14: 325-343. Lotz, A. N., Martinez del Río, C. & S. W. Nicolson.
Carmel, Y. & Y. Ben-Haim. 2005. Info-Gap Robust- 2003. Hummingbirds pay a high cost for a
Satisficing model of foraging behaviour: Do warm drink. J. of Comp. Phy. Bio. 173: 455-
foragers optimize or satisfice? Am. Nat. 166: 462.
633-641. McGuire, J.A., Witt, C.C., Altshuler, D.L. & J.V.
Chai, P. 1997. Hummingbird hovering energetics Remsen. 2007. Phylogenetic systematics and
during moult of primary flight feathers. J. biogeography of hummingbirds: Bayesian
Exp. Biol. 200: 1527-1536. and maximum likelihood analyses of
Charnov, E. 1976. Optimal Foraging, the marginal partitioned data and selection of an
value theorem. PNAS. 9: 129-136. appropriate partitioning strategy. Sys. Bio.
Ewald, P. W. & F. L. Carpenter. 1978. Territorial 56(5): 837-856.
Responses to Energy Manipulations in the McGuire, J., Wiit, C., Remsen, J. V., Dudley, R. & D.
Anna Hummingbird. Oecologia. 31: 277-292. Altshuler. 2008. A higher-level taxonomy for
Ewald, P.W. & R. J. Bransfield. 1987. Territory quality hummingbirds. J. Orn. 150: 155-165.
and territorial behavior in two sympatric Moreno, C. 2000. Métodos para medir la
species of hummingbirds. Beh. Eco. Soc. 20: Biodiversidad. M&T – Manuales y Tesis SEA,
285-293. vol. 1. Zaragosa.

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No1 (2013) 41

Navarro, G. & M. Maldonado. 2002. Provincia Paz, Bolivia). Ecología en Bolivia. 47(2):143-
Biogeográfica de los Yungas, p. 293-294. In G. 147.
Navarro & M. Maldonado (eds). Geografía Serrudo, V. 2011. Estrategias de forrajeo de cuatro
Ecológica de Bolivia: Vegetación y ambientes especies de picaflores en ceja de monte
acuáticos: Santa Cruz, Bolivia, Difusión yungueña. Tesis para obtener el grado de
Centro Simón I. Patiño. Bolivia licenciatura. Universidad Mayor de San
Pearson, O. 1950. The metabolism of hummingbirds. Andrés. Carrera de Biología. La Paz. Bolivia.
Condor 52: 145-152. Servicio Nacional de Áreas Protegidas (SERNAP).
Pyke, G. 1978. Optimal foraging in hummingbirds 2001. Ministerio de Desarrollo Sostenible y
testing the marginal value theorem. Ame. Planificación. 2da edición. La Paz, Bolivia.
Zool. 18: 739-752. 218p.
Ribera, M. A. 1995. Aspectos Ecológicos, del uso de la Schuchmann, K. 2001. Hummingbirds, Vol 4. In Del
tierra y conservación en el Parque Nacional y Hoyo, J., Elliott, A. & Sargatal J. (eds.).
Área Natural de Manejo Integrado Cotapata, Handbook of the birds of the World.
p. 12-14. In C. B. de Morales (ed). Caminos de Barcelona, España.
Cotapata: Instituto de Ecología. La Paz, Stanley, S. E. & R.G. Harrison. 1999. Cytochrome b
Bolivia. Evolution in Birds and Mammals: An
Sánchez, C. 2003. Taxonomy, Phylogeny, and Evaluation of the Avian Constraint
Biogeography of the Andean Hummingbird Hypothesis. Mol. Bio. Evo. 16(11): 1575–1585.
Genera Coeligena LESSON, 1832; Pterophanes Suarez, R. 1998. Oxygen and the upper limits to
GOULD, 1849; Ensifera LESSON 1843; and animal design and performance. J. Exp. Bio.
Patagona GRAY, 1840 (Aves: Trochiliformes). 201: 1065-1072.
Mathematisch-Naturwissenschaftlichen Tamura, K. & M. Nei. 1993. Estimation of the
Fakultät der. Alemania. numbers of nucleotide substitutions in the
Serrudo, V., Arteaga, D., Fuentes, S., García, E. & control region of mitochondrial DNA in
Luna, R. 2012. Estrategias de forrajeo de humans and chimpanzees. Mol. Biol. Evo.
cuatro especies de picaflores (Aves, 10(3): 512-526.
Trochilidae) en la ceja de monte yungueña (La

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
42 IITCUP CIENCIA VOL1 No1 (2013)

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No 1 (2013) 43

ARTÍCULO ORIGINAL

HAPLOTIPOS DE ND4 EN Aedes aegypti (VECTOR DEL DENGUE)


DE SAN BORJA Y CARANAVI (BOLIVIA)
Heredia, C.1 & Sbtte. Adm. Arteaga, D. 3

1Facultad de Ciencias Farmacéuticas y Bioquímicas, Universidad Mayor de San Andrés. La Paz, Bolivia,
2Centro de Investigación Genética, IITCUP, Universidad Policial. La Paz, Bolivia. solcita_dav@yahoo.es

RESUMEN

El dengue es una de las enfermedades con mayor incidencia de morbilidad y mortalidad en las regiones tropicales y subtropicales del
mundo, siendo su principal transmisor el mosquito Aedes aegypti. El uso de marcadores moleculares permite describir su estructura
genética y aportar información para la elaboración de planes de control acorde a las características de cada población. El presente
trabajo caracterizó haplotipos del gen mitocondrial ND4 en poblaciones de A. aegypti de dos comunidades endémicas de dengue en
Bolivia: Caranavi (CAR) y San Borja (SB), hallándose seis haplotipos a partir de una muestra de diez individuos: CAR1, CAR2, CAR3,
SB1, SB2 y SB3. El análisis mostró una diversidad nucleotídica de 0,0265, mostrando que el fragmento estudiado de ND4 es apto para
estudiar A. aegypti a nivel poblacional y filogenético en la región. Se identificaron dos clados (incluyendo a CAR1 en SB1) proponiendo
la hipótesis de migración pasiva a nivel continental (Asia, África, América). Los tres haplotipos SB pertenecen a un clado
independiente, constituyéndose en una población diferente y única. Mayor número de muestras deben ser analizadas.

PALABRAS CLAVE: Aedes aegypti, dengue, ND4, ADN mitocondrial.

JIS’KA-ARSUÑANAKA

Dengueta, uj jatun unquy sinchiutiñay q`uñillaxtaspi, pisiq`uñupi tukuy pachapi kay unquyta churawsunchis uj ch`uspisitu sutin
Aedes aegypti, kay marcadores moleculares sutiyuymiuj chay kunawan atinchis rixsiyta ukhunta, chaymanta willanchin ruwanapax
allinta kawanapax kay ruwasqanchista kanan tiyan imayrachus kaskanta sapa llajtapax kay llank`ay samasayqa haplotipos DN4
mitocondrial genmanta minku llajtasminkupi kay Aedes aegyptimanta iskay aylluspi Boliviamanta qankuna kanku 1. Caranavi, 2.
San Borja tarispa suxta haplotipos minku chunka Aedes aegyptipi CAR1, CAR2, CAR3, SB1, SB2, SB3. Kay k`uski riqhuchin uj
diversidad nucleotídica 0,0265 minku, kawachispa kay ND4 allin kanka yachanapax llaxtasminkuta chaymantapis maymanta
jamunku kay Aedes aegypti. Rixsikun iskay clados minku, kimsa haplotipos kanku uj clado kacharisqamanta uj llajtachama uj jina
chaymantapis sapalla. Kay llank`anapi siminchanku astawan yapakumantian kay Aedes aegypti minku yachaqanapax.

RIMANAS: Aedes aegypti, dengue, DN4, ADN mitocondrial.

ABSTRACT

Dengue is one of the diseases with high morbidity and mortality in tropical and subtropical regions of the world, being Aedes aegypti
the most important mosquito vector. The use of molecular markers for genetic structure studies bring information to support strategies
of control and monitoring of the disease according each human and vector populations. The present study used sequences of the
mitochondrial ND4 gene of A. aegypti populations in two endemic human communities of Bolivian yungas: Caranavi (CAR) y San
Borja SB), finding sex haplotypes: CAR1, CAR2, CAR3, SB1, SB2 and SB3. Subsequent analysis showed 0.0265 of nucleotide diversity,
establishing the ND4 marker as useful for characterizing this mosquito vector at phylogenetic level in the region. The CAR1 and SB1
identified clades suggest a possible passive migration of continental spectra (Asia, Africa and Americas). The three SB haplotypes
conform an independent clade, suggesting a unique population. More samples must be analyzed.

PALABRAS CLAVE: Aedes aegypti, dengue, ND4, mitochondrial DNA.

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
44 IITCUP CIENCIA VOL1 No1 (2013)

INTRODUCCIÓN MATERIALES Y MÉTODOS

El dengue es una de las enfermedades virales con Colecta de muestras


mayor incidencia de morbilidad y mortalidad en las
regiones tropicales y subtropicales del mundo Se colectaron 10 larvas y mosquitos adultos de Aedes
(Martínez, 2005) y ha ido incrementándose a nivel aegypti en las comunidades de San Borja y Caranavi.
mundial y nacional a partir de 1980 (OMS, 2009). En Las larvas se colectaron en criaderos que se
Bolivia, entre Enero a Julio del 2012, se reportaron encontraron en cercanías de las casas, en llanterías,
7373 casos confirmados de dengue (Ministerio de cementerios, cucharones de plástico y goteros, en
Salud y Deportes, 2012) y no existen vacunas o etanol al 70%. Los mosquitos adultos se capturaron
tratamiento específico para combatir esta con la técnica de colecta en reposo (Lardeux, 2011;
enfermedad, por lo que su mitigación se concentra en Gualdron, 2007).
el control del vector transmisor del virus: Aedes
aegypti (Gubler, 1998). Extracción de material genético

La metodología tradicional empleada para el control El material genético se obtuvo de la cabeza de las
del dengue se basa en insecticidas y la eliminación de larvas y las patas de los adultos empleando el sistema
criaderos potenciales. Sin embargo, estudios basados comercial “Wizard” (Promega) modificado,
en marcadores moleculares que describen la agregando DTT (0,5 M) y Proteinasa K (100 mg/l) en
estructura genética de este mosquito vector, han la lisis e incrementando el tiempo de precipitación
aportado información muy útil para la elaboración de con isopropanol.
planes de control acorde a las características de cada
población (Hu, 2009). Uno de los más empleados es Amplificación del gen mitocondrial ND4
el ADN mitocondrial, fácilmente caracterizable, sin
intrones, con regiones intergénicas cortas, altamente Se amplifico un fragmento de 376 pb del gen ND4 con
variable y no sufre recombinación, lo que hace de esta los cebadores: ND4F (5'–TCGTCTTCCTATTCGT
molécula un marcador apto para estudios de TCAT-3') y ND4R (5'-ACTACCAAAGGCTCATG
filogenia, taxonomía y genética poblacional (Rai, TAG-3') de Bossio (2005), en volumen final de 20ul
1991; Galtier, 2009; Guedes, 2006). con el sistema comercial “Colorless Master Mix”
(Promega) y el siguiente programa: 94 °C 5 min, 35x
La subunidad 4 del gen de la “Nicotin-Adenin- 94°C 1 min, 50 °C 1 min y 72 °C 1 min, extensión final
Deshidrogenasa (ND4)”, ha demostrado ser de gran de 72°C 5 min.
utilidad para estudios poblacionales (Nuñez, 2004;
Grisales, 2010) coadyuvando a la identificación de la Secuenciación
estructura y diversidad genética en varias especies de
insectos, incluido el Aedes aegypti (Gorrochotegui, Los productos de PCR se purificaron con la técnica
2000; Bossio, 2005; Bracco, 2007). alcohólica. La secuenciación se realizó con el kit “Big
Dye Terminator 3.1” (Applied Biosystems) y los
El uso de marcadores como ND4 es importantes para productos finales se revelaron en un el Analizador
la prevención del dengue ya que permite la Genético ABI 3130. Los datos se analizaron con el
caracterización inter e intrapoblacional, la inferencia programa Sequencing Analysis v.5.2 y se editaron
de posibles rutas de colonización y los patrones de con BioEdit (www.mbio.ncsu.edu), empleando la
distribución de estas poblaciones. El presente trabajo secuencia ND4 de Aedes aegypti 5848251 del GenBank
describe de forma preliminar las características como referencia. La alineación se hizo con la
genéticas de los haplotipos del gen mitocondrial ND4 aplicación ClustalW (www.clustal.org).
de poblaciones de Aedes aegypti en dos comunidades
endémicas afectadas por el dengue del país: Caranavi Análisis estadístico
(La Paz) y San Borja (Beni).

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No 1 (2013) 45

El análisis de secuencias se realizó en las tres y Perú (Figura 2). Nótese que el haplotipo CAR1 de
posiciones de cada codón con el programa DnaSP Caranavi es el mismo que el de México y Brasil,
(www.ub.edu), con el modelo de distancias de aunque los CAR2 y CAR3 están asimismo
Tamura-3-parámetros y la topología Neighbor- emparentados con los de México. El haplotipo CAR2
Joining (Saitou & Nei, 1987) del programa MEGA5. constituye la rama más reciente del árbol y los
Anopheles darlingi fue el grupos externo. hallados en San Borja (SB1, SB2 y SB3) forman una
rama separada, sugiriendo secuencias propias de
RESULTADOS poblaciones bolivianas del mosquito.

Se obtuvieron y analizaron 10 secuencias de 5


individuos de Caranavi y 5 individuos de San Borja. 78 AEA-SB1
47 AEA-SB2
La composición de nucleótidos (Tabla 1) fue de alto
41 AEA-SB3
contenido AT (72,7%), observándose 259 sitios
AEA-CAR1
conservados y 17 sitios variables, de los cuáles 16
AEA-CAR2
fueron sitios parsimónicos informativos y uno fue de
43 AEA-CAR3
sustitución única.
Anopheles darlingi

Tabla 1. Composición nucleotídica en las poblaciones de


0.02
estudio expresada en porcentaje
C G A T AT GC Figura 1. Árbol filogenético de los haplotipos del gen
(%) (%) (%) (%) (%) (%) mitocondrial ND4 de Aedes aegypti basado en el modelo
Promedio 7,4 19,9 30,3 42,4 72,7 27,3 Neighbor-Joining (Satiou & Nei, 1987), con distancias de
Tamura-3-parametros (Tamura, 1987) y un valor
Caranavi 7,6 19,9 29,9 42,5 72,4 27,5
bootstrap de 500 réplicas.
San Borja 7,4 20,1 30,1 42,5 72,5 27,5

DISCUSIÓN
Tabla 2. Valores de diversidad nucleotídica hallada en ambas
comunidades y por comunidad. El presente trabajo se basó en un fragmento del gen
Corrección Ќ mitocondrial ND4, el cuál ha sido ampliamente
Jukes& utilizado alrededor del mundo en poblaciones de
Cantor Aedes aegypti (Gorrochotegui-Escalante, 2002; Bosio,
Ambas 0,0265 0,02736 6,4222 2005; Bracco, 2004; Lima, 2007; Herrera, 2006; Paupy,
comunidades 2012). Los resultados encontrados por diferentes
San Borja 0,0166 0,01685 5,4000 autores, y corroborados en el presente trabajo, han
Caranavi 0,0224 0,02295 4,0000 mostrado que ND$ es apto para estudios
poblacionales y filogenéticos para esta especie de
La diversidad nucleotídica para ambas comunidades insecto. Hu (2009) determinó que el contenido total
fue de 0,0265. Aplicando la corrección de “Jukes y de Adenina – Timina (AT) del genoma mitocondrial
Cantor” se obtiene 0,02736. La media de la diferencia en insectos oscila entre el 63 al 88%, los resultados
nucleotídica fue de 6,4222 (Tabla 2). obtenidos en este estudio se muestran dentro de este
rango (72,7%) (Bracco, 2004; Ribeiro, 2006; Trinidade,
Se hallaron seis haplotipos para la construcción del 2008; Lima, 2009).
árbol filogenético en el que se observan dos clados:
uno exclusivo de Caranavi (CAR2 y CAR3) y el otro El comportamiento del fragmento ND4 analizado
que incluye individuos de Caranavi (CAR1) y San podría estar influenciado por varios factores, entre
Borja (SB1, SB2 Y SB3) (Figura 1). los que figura la naturaleza misma de la comunidad
humana de comercio para la región (que es de gran
El segundo árbol muestra la relación existente entre densidad demográfica) y, por ende, del flujo de
estos haplotipos y los reportados para México, Brasil
UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
46 IITCUP CIENCIA VOL1 No1 (2013)

AEA-AMZ BRAZIL-H11
AEA-AMZ BRAZIL-H12
AEA - CAR1
AEA-BRAZIL-11
11
AEA-MEX-46b
AEA-AMZ BRAZIL-H08
15 AEA-MEX-25
AEA - CAR2
46 AEA - CAR3

18 AEA-MEX-24

44 AEA-MEX-18
AEA-MEX-26
AEA-MEX-21

30
AEA-PERU-01
AEA-BRAZIL-10
34
AEA-AMZ BRAZIL-H10
38
AEA-16-BRAZIL
AEA-MEX-20
AEA-MEX-22
AEA - SB3

37 AEA - SB1
72 AEA - SB2
AEA-AMZ BRAZIL-H04
AEA-MEX-14
74 AEA-MEX-07
64
AEA-MEX-15
49
AEA-AMZ BRAZIL-H03

37
AEA-BRAZIL-013
AEA-AMZ BRAZIL-H01
AEA-BRAZIL-07
23
AEA-PERU-02
AEA-BRAZIL-12
AEA-MEX-05
Anopheles darlingi

0.02

Figura 2. Árbol filogenético de los haplotipos del gen mitocondrial ND4 de Aedes aegypti entre las comunidades Caranaci
(CAR) y San Borja (SB) basado en el modelo Neighbor Joining (Satiou & Nei, 1987), con el método de distancia de Tamura-
3-parametros (Tamura, 1987) y un valor de bootstrap de 500 réplicas.

transporte constante que sugiere una interesante Brasil (Figura 2) es indicador de un fenómeno similar
fuente de contribución a la tasa de migración pasiva. a mayor escala, aunque para México esta afirmación
Por otro lado, la aplicación de insecticidas en esta para menos probable por la distancia. Sin embargo el
población aumentó a partir del año 2009 debido a la estudio de Ayres (2003) en la Amazonia del Brasil
epidemia de dengue registrada, lo que podría haber demostró también que algunos haplotipos hallados
favorecido el incremento polimórfico de Aedes aegypti en este país tienen sus ancestros en México.
a nivel genético (Santibañez, 2007; PLAGBOL).
Los resultados muestran la existencia de dos linajes
El haplotipo CAR1 presente en el clado de San Borja mitocondriales para ND4 de la misma forma que
(Figura 1) refuerza la hipótesis de la migración pasiva reporta Paupy (2012), quien describió un linaje al sur
más que la inducida por cambio climático o del país y otro en las regiones del norte. Algo muy
migración natural del mosquito. Más aún, la particular observado es que los haplotipos de San
presencia de un haplotipo compartido con México y

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No 1 (2013) 47

Borja forman un clado único, lo que podría indicar Costa-da-Silva, A., Capurro, M. & Bracco, J.. 2005.
que son propios de esta región. Genetic lineages in the yellow fever mosquito
Aedes (Stegomyia) aegypti (Diptera: Culicidae)
CONCLUSIÓN from Peru. Memorias do Instituto Oswaldo
Cruz, Rio de Janeiro, 100(6): 539-544.
Las características descritas suministran una pauta Galtier,N., Nabholz, B., Glemin, S. & Hurst, G.. 2009.
sobre la diversidad de ND4 de Aedes aegypti en Mitochondrial DNA as a marker of molecular
Caranavi y San Borja. La presencia de dos linajes diversity: a reappraisal. Molecular Ecology,
mitocondriales del gen ND4 conformados por seis 18: 4541-4550.
haplotipos emparentados con poblaciones de México Gibbons, R. & Vaughn, D.. 2002. Dengue: an
y Brasil, además de los haplotipos SB1, SB2 y SB3 que escalating problem. Biology Molecular
parecen propios de San Borja, instan a continuar este Journal, 324: 1563- 1566.
trabajo investigativo por lo que se hace necesario Gonzales, C., Jercica, M., Reyess, C., Mejias, G.,
extender el estudio con mayor número de Plavetics, C. & Parras, A.. 2008. Clave
especímenes y en diferentes regiones del territorio pictórica para la identificación de géneros de
boliviano con este marcador molecular. Culícidae (Díptera) de Chile con impacto en
la Salud Publica. Acta Entomológica de Chile,
AGRADECIMIENTOS 32(12): 35-42.
Gorrochotegui-Escalante, N., De Lourdes, M.,
Al grupo de investigación Tanta Sariñani del Centro Fernandez, I., Beaty, B. & Black, W.. 2000.
de Investigación Genética – IITCUP de la Genetic isolation by distance among Aedes
Universidad Policial. A los responsables y aegypti populations along the northeastern
coordinadores de proyecto “Relación Filogenética de coast of Mexico. American Journal of Tropical
Culícidos” del Instituto de Ecología - UMSA: Lic. Medical and Hygiene, 62(2): 200–209.
Rubén Marín Pantoja, Ph.D. Carlos Molina, Ing. Gorrochotegui-Escalante, N., Gomez, C., Lozano, S.,
Jaime Chincheros. Al Laboratorio de Entomología Fernández, I., Muñoz, M., Farfan, J., Garcia, J.,
del Instituto de Laboratorios en Salud – INLASA: Beaty, B. & Black, W.. 2002. Breeding
Dra. Tamara Chávez, Dr. Frederique Lardeux. structure of Aedes aegypti population in
Mexico varies by region. American Journal of
BIBLIOGRAFIA Tropical Medicine and Hygiene, 66(2): 213–
222.
Ayres, C., Melo-santos, M., Solé-Cava, A. & Furtado, Grisales, N., Triana, O., Angulo, V. Jamarillo, N.,
A.. 2003. Genetic differentiation of Aedes Parra, G., Panzera, F. & Gomez, A.. 2010.
aegypti (Diptera: Culicidae), the major dengue Diferenciación genética de tres poblaciones
vector in Brazil. Journal of Medical colombianas de Triatoma dimidiata (Latreille,
Entomology, 40(4): 430-435. 1811) mediante análisis molecular del gen
Bosio, C., Harrington, L., Jones, J., Sithiprasasna, R., mitocondrial ND4. Biomédica, 30: 207-214.
Norris, D. & Scott, T.. 2005. Genetic structure Gualdron, L.. 2007. Manual de vigilancia
of Aedes aegypti populations in Thailand using entomológica de dengue, leishmaniasis,
mitochondrial DNA. American Journal of chagas, malaria y fiebre amarilla. Unidad
Tropical Medicine and Hygiene, 72(4): 434– Básica de Entomología. Subdirección de
442. Salud Pública – Colombia. En:
Bracco, J., Capurro, M., Lourenço-de-Oliveira, R. & www.orasconhu.org.
Sallum, M.. 2007. Genetic variability of Aedes Gubler, D.. 1998. Dengue and dengue hemorrhagic
aegypti in the Americas using a mitochondrial fever. Clininical Microbiology Reviews, 11
gene: evidence of multiple introductions. (3): 480-496.
Memorias do Instuto Oswaldo Cruz, Rio de Herrera, F., Urdaneta, L., Rivero, J., Zoghbi, N., Ruiz,
Janeiro, 102(5): 573-580. J., Carrasquel, G., Martínez, J., Pernalete, J.,

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
48 IITCUP CIENCIA VOL1 No1 (2013)

Villegas, P., Montoya, A., Rubio-Palis, Y. & internos transcritos del ADN ribosomal y del
Rojas, E. 2006. Population genetic structure of gen ND4 mitocondrial. Instituto Politécnico
the dengue mosquito Aedes aegypti in Nacional. Centro de Biotecnología Genómica,
Venezuela. Memorias do Instituto Oswaldo Reynosa Tamaulipas, México.
Cruz, Rio de Janeiro, 101(6): 625-633. Organización Mundial de la Salud (OMS). 2009.
Hu, L., Jianyu, G., Haiyu, L. & Wanzhi, C.. 2009. Actualización: Programa regional Dengue.
Progress in the Researches on Insect En: www.paho.org.
Mitochondrial Genome and Analysis of Gene Paupy, C., Le Goff, G., Brengues, C., Guerra, M.,
Order. IOPscience, 17(2): 39-45. Revollo, J., Simon, Z., Hervé, J. & Fontenille,
Lima, R. & Scarpassa, V.. 2009. Evidence of two D. 2012. Genetic structure and
lineages of the dengue vector Aedes aegypti in phylogeography of Aedes aegypti, the dengue
the Brazilian Amazon, based on and yellow-fever mosquito vector in Bolivia.
mitochondrial DNA ND4 gene sequences. Infection, genetics and evolution, 12: 1260-
Genetics and Molecular Biology, 32(2): 414- 1269.
422. PLAGBOL. Intoxicacion aguda por plaguicidads en
Martinez, R., Diaz, F. & Villar, L.. 2005. Evaluación de pequeños agricultores del departamento de
la definición clínica de dengue sugerida por La Paz – Bolivia. En: www.plagbol.org.bo.
la Organización Mundial de la Salud. Ribeiro, D.. 2006. Epidemiologia Molecular do Aedes
Biomédica, 25: 412-16 albopictus (Díptera: Culicidae). Centro de
Ministerio de Salud y Deportes. 2009. Situación del Pesquisas Aggeu Magalhaes, Departamento
dengue en Bolivia: vigilancia de la morbi y de Saude Coleticva. Fundacao Oswaldo Cruz,
mortalidad del dengue. En: Recife, Brasil.
www.reliefweb.int. Santibañez, T.. 2007. Plaguicidas de clase Ia y Ib en
Nei, M.. 1987. Molecular Evolutionary Genetics. Bolivia. Red de Acción en Plaguicidas y sus
Oxford University Press, New York, USA. alternativas para América Latina en Bolivia.
Núñez, C.. 2004. Análisis molecular de Simulium
ochraceum sensu lato de los espaciadores

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No 1 (2013) 49

ARTÍCULO ORIGINAL

CARACTERIZACIÓN DE MICROSATÉLITES PARA PRUEBAS DE


PARENTESCO EN CAMÉLIDOS DEL ALTIPLANO BOLIVIANO

Huanca M., P.1, & Sbtte. Adm. Arteaga V., D.2

1Universidad Católica Boliviana San Pablo, Unidad Académica Campesina Tiahuanaco,


Carrera de Ingeniería Zootécnica. La Paz, Bolivia.
2 Centro de Investigación Genética, IITCUP, Universidad Policial. La Paz, Bolivia. cingen.ptc@gmail.com

RESUMEN

Las vicuñas (Vicugna vicugna) habitan en los altos Andes del sur de Perú, oeste de Bolivia, noreste de Chile y noreste de Argentina y
son explotadas por su apreciada fibra. Recientes legislaciones para su protección y uso sostenible permitieron la recuperación de sus
grupos familiares. A pesar de la importancia de este camélido en la economía de las comunidades locales y en el ámbito ecológico, no
existen registros o evaluaciones sobre el estado genético de sus poblaciones, del que depende su éxito reproductivo y la calidad de su
fibra. El empleo de microsatélites (STR) permite establecer las relaciones de parentesco, el grado de consanguinidad y la variabilidad
genética de una población. La presente investigación ha caracterizado tres STR: LCA19, LCA5 y YLLW08 en dos grupos familiares de
vicuñas de la provincia Pacajes (La Paz). Los resultados sugieren baja variabilidad y diversidad genética. El índice de parentesco
calculado permitió identificar una familia (99,0662%) entre los 27 especímenes. Los estadísticos F mostraron diferenciación poco
significativa entre los dos grupos y alto grado de consanguinidad (FIS). Se recomienda extender la base de datos de frecuencias
alélicas.

PALABRAS CLAVE: Camélidos, Vicugna vicugna, microsatélites, parentesco.

JIS’KA-ARSUÑANAKA

Waris kawsanku janaxpata Andes kulla Perú suyupi, intiyaykuna Bolivia suyupi, intilluxsina Chile suyupi, intiyuxsina Argentina
suyupi. Willasmanta urukunku sumaj kawsarqayku kunan qan kamachis mana wañuchimankupax, sumaj qanrayku waris ancha
qulqita jap`inchu, ancha munasqa kawsana; mana yachakunchu imaynachus kashan chay genes minku llajtasminkupi. Chay
microsatelites STRs nin yapan riqhuchiyta pichus kanku tatas, turas, ñañas sapa warimanta, allyullajtachus nin mamachus kanku
chay genespi. Kay llank`ay yachanchis imaynachus kanku kay kimsa STRs LCA19, LCA5, YLLW08 iskay ñawarmasispi llajtayllu
Pacajespi (La Paz). Kay llank`aypi riqhukun pisi wakchana qan genespi, kay llank`aywan rixsukun uj ñañarmasi kaskankuta kay
iskay chunka kanchis mikhuy warismanta. Chay estadìsticos F mana riqhuchinkuchu ancha ujina kaskankuta aylluspi warismanta,
chantapis ancha ñawarasmasi. Astawan yapakumantyan chay base de datos de frecuencias alélicas minku wax llank`anapax.

RIMANAS: wari, Vicugna vicugna, microsatélites, ñawarman.

INTRODUCCIÓN En Bolivia se distribuyen en la región altiplánica alto


andina de los departamentos de La Paz, Oruro,
Los camélidos sudamericanos se encuentran en Potosí, Cochabamba, y Tarija (Alzerreca, 1982). Se
diferentes pisos ecológicos, desde los 150 a los 5000 distribuyen en grupos familiares cuya organización
metros de altura, con una población mundial de 7900 social está basada en el patriarcado, un macho posee
millones, de los cuales 90% son llamas y alpacas, 7% de 5 a 8 hembras, de las que el 80% llegan a ser
son guanacos y 3% son vicuñas (Rivera, 1992). Estas gestantes y solo 50% llegan a concebir. Cuando el
últimas (Vicugna vicugna) habitan en los altos Andes macho envejece o enferma, uno más joven y sano se
del sur de Perú, oeste de Bolivia, noreste de Chile y apodera del grupo familiar, lo que induce a
noreste de Argentina (San Martín, 1999). consanguinidad que, con el tiempo, puede producir

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
50 IITCUP CIENCIA VOL1 No1 (2013)

bajo porcentaje de natalidad y afecta características aprovechamiento sostenible, lo que sólo puede
genéticas de interés industrial. lograrse generando conocimiento profundo sobre el
estado actual de sus poblaciones.
Este camélido, protegido por las normas de la Unión
Internacional para la Conservación de la Naturaleza Existe una cantidad importante de información sobre
(UICN) en 1968, constituye hoy en día una fuente de la vicuña y sus poblaciones (ISA-Bolivia, 2009),

CHOCOROSI

ACHIRA

Figura 1. Puntos de muestreo de los 27 camélidos analizados.

ingresos adicionales importante a los pobladores de generada principalmente cuando las poblaciones
las regiones en que habitan, generalmente pobres en comenzaron a reducirse. Sin embargo, existe muy
flora y fauna, por lo que es necesario aportar con poco acerca del estado genético de las poblaciones, al
herramientas que coadyuven a su mejor manejo y menos en nuestro país.

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No 1 (2013) 51

El análisis genético de las poblaciones está basado en sido ampliamente usados para la identificación de
el estudio de marcadores moleculares. Los datos individuos en pruebas de paternidad, para establecer
moleculares, constituyen una aproximación la compatibilidad en trasplante de órganos, para el
adecuada para determinar los procesos que estudio de poblaciones silvestres o de las migraciones
configuran la estructura genética de una especie, ya de humanas en la prehistoria, y otros similares,
que proporcionan información tanto sobre la principalmente porque muestran mayor variabilidad
distribución actual de la diversidad genética y los génica en su estructura primaria de repetición y
procesos que actúan sobre el flujo génico, la deriva y diferente grado de recombinación debido a la
la endogamia, además de las tendencias evolutivas a inestabilidad del locus (Shlotterer, 1998).
largo plazo, a diferencia de los parámetros
demográficos que señalan evolución a corto plazo. Entre los primeros trabajos para camélidos, Lang et
De este modo, es posible comparar las tendencias al. (1996) evaluó 15 loci microsatélite YWLL en una
actuales con las históricas y comprobar si se están población de 50 camélidos sudamericanos
produciendo desviaciones que puedan comprometer domésticos no relacionados (llamas y alpacas) y
la supervivencia de la población o la especie (Moritz, encontró un número promedio de alelos por locus de
1994). 6.87, con promedio de heterocigosidad entre 0.42 y
0.86. Penedo et al. (1998), analizó 12 microsatélites
En los camélidos sudamericanos se han aislado, LCA en una población de 102 camélidos
identificado y caracterizado más de 50 marcadores sudamericanos (en dos especies domésticas y en
genéticos, la mayoría de ellos del tipo microsatélite. guanaco), observando 9.16 alelos por locus y con
Existen 101 microsatélites publicados, cuyos loci heterocigosidad de 0.23 a 0.85.
presentan una gran diversidad en cuanto al número
de alelos en los distintos taxa de camélidos Lang (1996) describió diez loci microsatélite (LCA19,
sudamericanos (Bustamante, 2002). Estos LCA22, LCA5, LCA23, YWLL08, YWLL29, YWLL36,
marcadores son comúnmente empleados para YWLL40, YWLL43, YWLL46) para Lama glama y
estudios de parentesco y consanguineidad. alpaca, mismos que fueron utilizados por Penedo et
al. (1998) y otro autores. Rodríguez et al. (2004)
El parentesco es el vínculo o relación de demostraron su utilidad para estudiar índices de
consanguinidad dentro de las especies o de un parentesco en poblaciones de camélidos (alpacas) en
individuo con un ascendente en común, unidas por Perú y establecieron que tres STR son suficientes para
comunidad de sangre. Por muchos años, los métodos establecer el parentesco en grupos familiares:
convencionales como la tipificación de grupos YWLL43, LCA5 y YWLL08. Asimismo Sasse (1999)
sanguíneos y polimorfismos bioquímicos han sido las demostró la factibilidad de realizar pruebas de
únicas herramientas utilizadas para la determinación paternidad en camellos (Camelus dromedarius) y
de parentesco. Sin embargo, durante la pasada Kadwell (2001), en base a estudios realizados con
década se han desarrollado técnicas basadas en ADN ADN mitocondrial (citocromo b) y cuatro
como la reacción en cadena de la polimerasa (PCR), microsatélites (YWLL 38, 43, 46 y LCA 19), identificó
que nos permite la detección de marcadores los ancestros salvajes de la llama y la alpaca.
específicos como los microsatélites o STR (Rodríguez,
2004). En los Camélidos Sudamericanos, los microsatelites
han sido una herramienta útil para la tipificación
Los STR son fragmentos de ADN constituidos por poblacional, la identificación de individuos y la
secuencias cortas (6 pb máx.) que se repiten en serie detección de diferencias tanto intra como inter
y cuyos alelos pueden ser observados por medio de poblacional (Romero, 2007). Andrade (2009)
electroforesis en gel o electroforesis capilar (Hancock, determinó la variabilidad genética en vicuñas
1991). Su distribución al azar y su alto nivel de (Apolobamba – Bolivia), con 10 Loci microsatelites
polimorfismo facilita la construcción de mapas entre LCA y YWLL, mostrando alto polimorfismo en
genéticos en estudios de parentesco (Dib, 1996). Han los microsatélites YWLL 08 y YWLL 36.

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
52 IITCUP CIENCIA VOL1 No1 (2013)

El presente trabajo evaluó la aplicabilidad de tres amplificados con el sistema comercial “GoTaq
STRs (LCA05, LCA09 y YWLL08) en un grupo de Master Mix” de Promega con BSA y se revelaron por
vicuñas para establecer parámetros útiles en pruebas electroforesis capilar en un Analizador Genético
de parentesco genético. AB3130 (Applied Biosystems), caracterizando los
alelos con el programa “GeneMapper 3.7”.
MATERIALES Y MÉTODOS
Tabla 1. STRs y cebadores utilizados
El presente trabajo se realizó en las comunidades de (Lang et al., 1996 y Penedo et al., 1998).
"Achiri y Villa Chocorosi" de la provincia Pacajes, a STR pb Secuencia 5’-3’
120 km de la ciudad de La Paz. La identificación de TAAGTCCAGCCCCACACTCA
LCA19 84 - 125
GGTGAAGGGGCTTGATCTTC
los sitios de captura de las vicuñas fue realizada con
GTGGTTTTGCCCAAGCTC
la ayuda de los comunarios quienes viven y conocen LCA05 180 - 243
ACCTCCAGTCTTGGGGATTTC
la región (Figura 1). ATCAAGTTTGAGGTGCTTTCC
YWLL08 127 - 195
CAATGGCATTGTGTTGAAGAC

Finalmente con las frecuencias alélicas se calculó: las


“frecuencias genotípicas”, la “probabilidad de
coincidencia (PC)” y el “poder de discriminación
(PD)”, indicadores de la capacidad de un sistema de
STRs para realizar pruebas de parentesco genético.

RESULTADOS Y DISCUSIÓN

El presente constituye un estudio preliminar para la


determinación del parentesco en grupos familiares
de vicuñas en la provincia Pacajes y el primero que
utiliza electroforesis capilar para la detección de
Figura 1. Captura de especímenes con redes. alelos de STRs.

Los especímenes se capturaron con mallas o redes


instaladas uno o dos días antes de la captura con 180
callapos de 3 a 4 metros de altura y 1500 metros de
largo. La forma del sistema de redes en “V” con un
coral en la arista se emplea normalmente para
capturar y esquilar a las vicuñas.

Muestras de cartílago de oreja se obtuvieron al


momento identificar a los animales con hojas de
bisturí estériles para cada animal y se almacenaron
en frascos de etanol 70%. Los hisopados de sangre se
Figura 2. Electroforesis en gel de agarosa (1%) de los
obtuvieron en el momento de la esquila del tejido
microsatélites LCA 19, LCA 05 y YWLL 08, obtenidos con
muscular de las extremidades posteriores del animal ADN de Vicugna vicugna (aprox. 200 pb).
empleando una lanceta. Se colectaron 27 muestras
pertenecientes a 2 grupos familiares de vicuñas. Los tres microsatélites analizados fueron
amplificados y verificados en gel de agarosa previo a
El ADN se obtuvo con el sistema comercial “Wizard la electroforesis capilar (Figura 2), observándose la
Genomic DNA Purification” (Promega) optimizado alta calidad del producto, indicio de que los extractos
para las muestras. Los STRs (Tabla 1) (Rodríguez,
2004; Andrade, 2009 y Romero, 2007) fueron
UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No 1 (2013) 53

(a) (b) (c)

Figura 3. Electroforesis capilar de los STRs LCA 19 (a, heterocigoto), LCA 05 (b, homocigoto) y YWLL 08 (c, homocigoto) del
espécimen VIC-122. Los alelos son caracterizados por peso molecular mediante la detección precisa de los cebadores
etiquetados con los fluoróforos según la siguiente relación: LCA19 = TET, LCA05 = FAM; YWLL08 = HEX.
sz = peso molecular (pb), ht = intensidad de la señal (cantidad relativa de ADNc).

de ADN de cartílago auricular e hisopo de sangre muestra que todas las crías están emparentadas. Sin
tuvieron la cantidad y calidad suficientes. embargo, la familia caracterizada más probable para
los tres loci fue la del espécimen macho P1 (VIC-119),
En la caracterización de STRs, los loci LCA19 y con una relación de parentesco de 99.0662 % para la
LCA05 presentaron de uno a cinco alelos, el locus cría C4 (VIC-423) de la madre M4 (VIC-125) (Tabla 5).
YWLL08 presentó de uno a ocho, resultados
comparables a los descritos por Lang et al. (1996) y
Penedo et al. (1998). Un ejemplo del resultado de la Tabla 2. Caracterización y frecuencias alélicas de los STR
electroforesis capilar puede verse en la Figura 3. utilizados para las dos poblaciones estudiadas.
LCA19
Los extractos obtenidos permitieron la identificación Alelo Pobl.1 Pobl.2
de alelos entre 90 a 167 bp para LCA19, 187 a 202 bp 1 0,067 0,069
para LCA5 y 133 a 164 bp para YWLL08. En relación 2 0,033 0,034
a la estructura genética (Tabla 2), LCA5 presentó la 3 0,033 0,034
mayor frecuencia alélica (0,692) y los alelos 3 y 4 de 4 0,567 0,480
YLLW08 comparten la menor (0,021). La población 1 5 0,300 0,315
presenta mayores frecuencias alélicas que la LCA05
población 2 (Tabla 2), esto puede explicarse por la
Alelo Pobl.1 Pobl.2
fijación de alelos a través de varias generaciones,
1 0,115 0,058
mostrando menor diversidad debido a una
2 0,077 0,029
disminución de individuos en este grupo familiar,
3 0,077 0,029
razón por la que esta baja frecuencia no podría
4 0,692 0,340
deberse a una mayor diversidad alélica enmascarada.
5 0,039 0,029
Se encontraron dos individuos heterocigotos para el YWLL08
locus LCA19, tres para LCA5 y nueve para YWLL08, Alelo Pobl.1 Pobl.2
lo que lo hace el más polimórfico. Las frecuencias 1 0,225 0,159
genotípicas de los alelos no superan el 50%, excepto 2 0,150 0,088
para el alelo 4 de LCA19 y LCA5. El poder de 3 0,025 0,021
discriminación calculado de cada uno de los tres 4 0,050 0,021
STRs es supera el 0,6 (Tabla 3), que es el valor mínimo 5 0,300 0,135
de un STR para pruebas de parentesco. 6 0,075 0,043
Como es natural, la prueba de parentesco se realizó 7 0,125 0,088
solamente con aquéllos especímenes que compartían
8 0,050 0,042
alelos en los tres STRs. El índice de parentesco (W)

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
54 IITCUP CIENCIA VOL1 No1 (2013)

Finalmente, en cuanto a la estructura poblacional de parentesco en las poblaciones seleccionadas de


ambos grupos familiares evaluada a través de los Vicugna vicugna de la provincia Pacajes de La Paz,
estadísticos F de Wright 1965 (datos no mostrados), pese que los estadísticos F de Wright mostraron alto
las subpoblaciones tienen un grado de diferenciación grado de consanguinidad entre ambas poblaciones.
poco significativo. FIT muestra una reducción
significativa de la heterocigosidad sugiriendo una Tabla 5. Índice de Parentesco (W) de los especímenes con los
tres STRs. P = padre; M = madre.
elevada consanguinidad, algo esperado dada la
biología reproductiva por clanes y patriarcal de estos
Progenitor Cría W W%
animales. C4 (VIC-423) 0,9240 92,3993
P1 (VIC-119)
C6 (VIC-430) 0,9240 92,3993
CONCLUSIONES
M3 (VIC-110) C6 (VIC-430) 0,9753 97,5346
C4 (VIC-423) 0,9907 99,0662
La extracción de ADN a partir de cartílago auricular
M4 (VIC-125) C5 (VIC-428) 0,9564 95,6363
e hisopado de sangre es efectiva para la obtención de
C6 (VIC-430) 0,9240 92,3993
material genético para la amplificación de los STRs
estudiados.
Es necesario ampliar el número de STRs, el número
Tabla 3. Frecuencias genotípicas, probabilidad de coincidencia poblacional y los grupos familiares para estructurar
(PC) y poder de discriminación (PD) de los tres STRs una tabla de frecuencias alélicas para calcular los
estudiados. índices de parentesco con mayor significancia
estadística.
Frec.
STR Al 1 Al 2 PC PD
Genot.
Se recomienda incluir en los libros de registro de las
LCA19 1 1 0,1333 poblaciones de vicuña y de otros camélidos,
LCA19 1 4 0,0667 caracteres genéticos que permitan realizar un
LCA19 3 5 0,0667 0,3511 0,6489 seguimiento del estado y viabilidad biológica de las
LCA19 4 4 0,5333 poblaciones.
LCA19 5 5 0,2000
LCA05 1 1 0,1667 BIBLIOGRAFIA
LCA05 1 4 0,0833
LCA05 2 2 0,0833 0,3889 0,6111 Alzerreca, H.. 1982. Aéreas de distribución y centros
LCA05 4 4 0,5833 de protección de Vicuñas en Bolivia.
LCA05 4 5 0,0833 Comunidades de Vicuña. La Paz, Bolivia, 4:
YWLL08 1 1 0,1000 13-16p.
YWLL08 1 3 0,0500 Andrade, S. N.. 2009. Variabilidad genética de
YWLL08 1 6 0,0500 vicuñas dentro del ANMIN – Apolobamba.
YWLL08 1 7 0,1500 La Paz, Bolivia. Tesis de grado Universidad
YWLL08 1 8 0,0500 Mayor de San Andrés Facultad de Ciencias
Puras y Naturales Carrera de Biología. 101p.
YWLL08 2 2 0,1000
Bassam, B.J., Caetano-Anolles, G. & Gresshoff, P.M..
YWLL08 2 7 0,0500 0,1500 0,8500
1991. Fast and sensitive silver staining of
YWLL08 4 4 0,0500
DNA in polyacrilamide gels. Ann. Biochem,
YWLL08 5 5 0,3000
19: 680-683p.
YWLL08 6 6 0,0500
Brak, A.. 2003. Vicuña (Vicugna vicugna). En:
YWLL08 7 7 0,0500
www.peruecologico.com.pe.
Bustamante, A. V., Zzambelli, A., De Lamo, D., von
Los STRs estudiados LCA05, LCA19 y YWLL08) han
Thungen, J. & Vidal-Rioja, L.. 2002. Genetic
mostrado polimorfismo y poder de discriminación
variability of guanaco and llama populations
suficiente para la realización de pruebas de
in Argentina. Small Ruminant Research, 44:

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No 1 (2013) 55

97-101. Manejo y Aprovechamiento Sustentable de la


Cardozo, A.. 1954. Auquénidos. Editorial Centenario. Vicuña. La Paz, Bolivia.
Universidad Mayor de San Andrés, La Paz, MMAyA, 2010. Estado Poblacional de la Vicuña en
Bolivia, 284p. Bolivia – 2009. Ministerio de Medio Ambiente
Cardozo, A.. 1975. Origen y filogenia de los y Agua. Viceministerio de Medio Ambiente,
camélidos sudamericanos. Academia Biodiversidad, Cambio Climáticos y de
Nacional de Ciencias de Bolivia, La Paz, Gestión de Desarrollo Forestal. La Paz,
Bolivia, 125p. Bolivia 80 p.
Gonzáles, V.. 2005. Manual de juzgamiento y Penedo, C.; R. Caetano; I. Cordova. 1998.
calificación del ganado camélido. Microsatellite markers for South American
Universidad Católica Boliviana, Unidad camelids. Animal Genetics. 29: 398-413p.
Académica Campesina Tiahuanaco, Bolivia, PDM del municipio de Caquiaviri, 2001.
6-10p. Planificación de desarrollo municipal del
Excoffier, L.. 2001. Analysis of population municipio de Caquiaviri, La Paz – Bolivia.
subdivision en Baldwin, D. J., Cannings, C. & Rivera, M. 1992. Regiones ecológicas. En Marconi, M.
Bishop, M.. Handbook of Statistical Genetics. (Editor). Comservacion de la diversidad
John Wiley. Nueva York. 271 – 308p. biológica en Bolivia, La Paz, Bolivia. Capítulo
Fulton, T.. 2004. Tecnologías de marcadores II. 9-71p.
moleculares para el estudio de diversidad Robertis, E.D.P. 1991. Biología Celular y Molecular.
genética de plantas. IPGRI y Cormell Ed. “El Ateneo”. Undécima Edición. Buenos
University. Aires, Argentina.628p.
Hancock, J.. 1991. Microsatellites and other simple Rodríguez, J. 2004. Determinación de parentesco en
sequences: genomic context and mutational alpacas (Vicugna pacos) por medio de análisis
mechanisms. En: Microsatellites. Evolution de ADN microsatélites. Revista de
and Applications. 1-9p. Investigaciones Veterinarias del Perú. 15(2):
Hofmann, R.. 1983. El manejo de la vicuña Silvestre. 113-119p.
Tomo II. Deusche gesllchaft fus technische Romero, A. 2007. Análisis preliminares de la
zusammenarbut (GTZ). Eschborn, Alemania. aplicación de marcadores de loci de
118p. microsatélites en muestra no invasivas de
ISA-BOLIVIA (Instituto Socio Ambiental Bolivia). Guanacos de la provincia Cordillera (Santa
2010. Informe gestión 2009 “Proyecto Manejo Cruz, Bolivia). Tesis de grado Universidad
y Aprovechamiento Sostenible de la Vicuña Mayor de San Andrés Facultad de Ciencias
en la Marka de San Andrés de Machaca”. Puras y Naturales Carrera de Biología. La
Programa de Pequeñas Donaciones de las Paz, Bolivia. 87p.
Naciones Unidas (PPD-PNUD). La Paz, San Martín, F. 1999. Nutrición y alimentación de
Bolivia. 29p. camélidos sudamericanos. EMI UNEPCA.
INE – MDSP. 1999. Informe del Instituto Nacional de Editorial Latina. La Paz, Bolivia. 37-53p.
Estadística - Ministerio de desarrollo Solís, R. 2000. Producción de camélidos
sostenible. Bolivia, 248p. sudamericanos. Editorial Ríos S.A. 1ª Edición.
Lang, K.; Y. Yang; Y. Plante. 1996. Fifteen Cerro de Pasco – Huancayo, Perú
polymorphic dinucleotide microsatellites in Torres, H. 1983. Informe especial Nº 1. Distribución y
llamas and alpacas. Animal Genetics. 27: 285- conservación de la Vicuña (Vicugna vicugna)
294p. grupo especialista en camélidos silvestres
Marza, F. 2007. I congreso internacional de ingenieros sudamericanos. Comisión de sobre vivencia
del sector agrario, Puno – Perú de especie – Unión Internacional para la
MMAyA (Ministerio de Medio Ambiente y Agua). conservación de la naturaleza y de sus
2009. Decreto Supremo Nº 0385 del 16 recursos. Julio de 1983. Arica, Chile.
Diciembre. Reglamento de Conservación,

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
56 IITCUP CIENCIA VOL1 No1 (2013)

Wheeler, J. 2001. Diversidad genética y manejo de Zúñiga, M. 2003. Crecimiento vegetativo de la


poblaciones de Vicuñas en el Perú. Arequipa, población de Vicuñas en la regios Puno –
Perú. 1-21p. Moquegua – Tacna (1986-1995). Tesis
Wheeler, J. 2007. Implicancias del cruzamiento de Medicina Veterinaria Zootecnia. Universidad
alpacas y vicuñas. Puno – Perú. Nacional del Altiplano. Puno, Perú. 73-74p.

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No1 (2013) 57

NOTA TÉCNICA

PRIMER ESTUDIO TAXONÓMICO MOLECULAR DEL ORDEN


TRICHOPTERA EN LA REGIÓN ALTOANDINA DE BOLIVIA

Ninahuanca, A.1 & Sbtte. Adm. Arteaga, D.2

1 Facultad de Ciencias Farmacéuticas y Bioquímicas, Universidad Mayor de San Andrés. La Paz, Bolivia.
aninahuancat@gmail.com
2 Centro de Investigación Genética, IITCUP, Universidad Policial. La Paz, Bolivia. cingen.ptc@gmail.com

INTRODUCCIÓN Y MÉTODOS. parte de la bomba de protones y unir grupos Hemo


al metal Cu++ (Holm et al.,1987; Gennis, 1992; Farrel,
En las pasadas décadas los estudios morfo- 2001). Si bien las restantes tienen diversa aplicación
anatómicos de identificación y clasificación en estudios taxonómicos y filogenéticos, debe
taxonómica de insectos se han beneficiado tomarse en cuenta la importancia de investigar las
ampliamente con la genética (Giribet et al., 1999; propiedades de sustitución nucleotídica del grupo
Manuel, et al., 2006; Budd & Telford, 2009). Puesto taxonómico investigado, determinando la utilidad de
que muchos grupos aún no tienen claves disponibles la secuencia nucleotídica en filogenia y otro tipo de
para su identificación desde huevos, la identificación estudios antes de utilizar un rango de taxa (Muraji et
morfo-anatómica no resulta clara. La genética resulta al. 2000).
ser una efectiva herramienta para resolver
ambigüedades, no obstante también ha sido motivo En el presente trabajo el gen CO-I (DNA-barcode) fue
de revisiones taxonómicas (Álvarez et al., 2005; empleado para estudiar especímenes del orden
Edgecombe & Giribet, 2007). Trichoptera del altiplano boliviano de las familias
Limnephilidae e Hydrobiosidae y los géneros
Anomalocosmoecus, Antarctoecia y Cailloma.
Aunque la medición de la tasa de evolución en
insectos es compleja a causa de sus diversas
El ADN fue obtenido de las extremidades y cabezas
estrategias reproductivas (Crozier et al., 1989), el gen
de larvas optimizando el sistema comercial Wizard
mitocondrial de la citocromo-oxidasa-I (CO-I), que
Genomic DNA Purification Kit (Promega), de lisis
junto a CO-II y CO-III participa en la obtención de
química y precipitación salina. Para amplificar el
energía celular en organismos aerobios (Nelson &
fragmento de interés del gen CO-I se emplearon los
Cox, 2000), ha sido extensamente empleado para
cebadores universales LCO1490 (5’GGTCAACAAA
estudios taxonómicos, poblacionales y
TCATAAAGATATTGG-3’) y HCO2198 (5’-TAAAC
filogeográficos de artrópodos, pues contiene sitios
TTCAGGGTGACCAAAAAATCA-3’) descritos por
que han permanecido inalterados durante más de
Hebert et al. (2003) a concentración final de 0.355 uM
1.500 millones de años (Saraste, 1990). De acuerdo a
y amplificados con el sistema GoTaq Colorless de
Muraji et al. (2000), al ser específico en su función,
Promega. Se amplificó un fragmento de 709 pb
CO-I presenta estrictas diferencias de secuencia entre
previamente caracterizado in silico con otras
taxones y, en comparación con otros marcadores
secuencias CO-I de artrópodos disponibles en NCBI-
como ITS1 y 16S, posee asimismo mayor evolución y
GenBank. El programa empleado fue: 5 min 94°C; 30x
variabilidad debido a su tasa media de mutación
1 min 94°C, 110 seg 51°C; 110 seg 72°C y extensión de
(Álvarez et al., 2005).
10 min 72°C. Luego de una purificación alcohólica se
realizó la PCR de secuenciación con el cebador
Para su uso a nivel genético Lunt et al. (1996)
LCO1490 y el sistema BigDye Terminator v3.1
proponen la división del gen CO-I en 25 regiones
(Applied Biosystems), con las siguientes condiciones:
(Figura 1) de las que diez son poco variables al formar

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
58 IITCUP CIENCIA VOL1 No1 (2013)

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No1 (2013) 59

Figura 2. Filograma taxonómico molecular basado en CO-I (439 pb) del orden Trichoptera según el
modelo de Tamura & Nei (1993). HM01, HM02 = Mururata; HI03, HI04, HI05, HI06 = Illimani; HL07,
HL08 = Larancagua. HP09 = Altiplano peruano.

1 min 96°C; 24x 10 seg 96°C, 5 seg 56°C, 4 min 60°C, intrínsecas del CO-I mostraron relación T+A global
sin extensión final. Tras una segunda purificación de 63.04% y por sitios de codones de 20.38%, 6.16% y
alcohólica se secuenció el producto final en el AB3130 73.46% respectivamente.
de la Universidad Mayor de San Andrés.
Aunque se detectaron 211 sitios variables en 636 pb
Los datos se almacenaron en el programa Sequence de los especímenes bolivianos, la composición
Analysis (Applied Biosystems) y los aminoacídica de la traducción in silico no sufrió
electroferogramas fueron editados manualmente con cambios, salvo el caso del haplotipo HI03 de
los programas BioEdit y SeqA 5.2. Empleando un Antarctoecia sp. del glaciar Illimani, que mostró dos
tricóptero asiático como grupo externo, se alinearon aminoácidos distintos (Figura 2). La relación
las secuencias con ClustalW del programa Mega 4 y transiciones y transversiones fue de 1.26. El marcador
los filogramas se construyeron bajo las distancias de mostró un comportamiento monofilético para los
Tamura & Nei (1993) y el modelo Neighbor-Joining géneros de la familia Limnephilidae.
(NJ) de Saitou & Nei (1987), con consistencia de 1.000
réplicas. El análisis subsecuente se realizó En los 45 especímenes colectados en el altiplano
observando el comportamiento del marcador por boliviano se identificaron ocho haplotipos de CO-I:
posición de codón y por regiones proteicas en seis emparentados con el género Antarctoecia, uno
especímenes de los glaciares Mururata, Illimani y con Anomalocosmoecus y uno con Cailloma. La
Larancagua del altiplano boliviano (disponibles a diversidad nucleotídica, diversidad génica y
solicitud o en www.iitcup.org). Las propiedades
UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
60 IITCUP CIENCIA VOL1 No1 (2013)

distancia genética fueron de 0.027, 0.775 y 0.138, geológica, lo que induce a una fragmentación
respectivamente. genética y, a la larga, la extinción, perdiéndose con
ello la historia evolutiva que albergan estos
El filograma taxonómico molecular muestra un clado organismos en su código genético.
del género de tricópteros Cailloma acompañado de
otros órdenes de insectos, otro conformado por los REFERENCIAS
géneros Antarctoecia y Anomalocosmoecus y un
tercero con tricópteros Limnephilidae, este a su vez Álvarez, J. M., Menalled, F. H. & Marjorie, A.. 2005.
presenta tres subclados: 1) Limnephilus, Goerita, Las herramientas moleculares en el control
Neophylax, Asynarchus y Pycnopsyche, 2) biológico. Manejo Integrado de Plagas y
Antarctoecia y 3) Anomalocosmoecus. El Agroecología (Costa Rica), 7: 4-11.
posicionamiento del haplotipo Antarctoecia HI03 es Budd, G. & Telford, M.. 2009. The origin and
claramente distinta a los haplotipos HL07, HL08, evolution of arthropods. Nature, 457: 812-817.
HM01, HM02 y HM04, especialmente si se considera Crozier, R. H., Y. C. Crozier & M. G. Mackinlay. 1989.
comparativamente la posición de The CO-I and CO-II region of honeybee
Anomalocosmoecus y se toma en cuenta el cambio de mitochondrial DNA: evidence for variation in
dos aminoácidos en las posiciones 92 y 161 del insect mitochondria. Molecular Biology
haplotipo HI03 y los restantes de Antarctoecia, donde Evolution, 6(4):399-4 11.
se observan mutaciones de serina a arginina y alanina Edgecombe, G. & Giribet, G.. 2007. Evolutionary
a treonina, de forma análoga a los trabajos de Pauls biology of centipedes (Myriapoda:
(2004) y Smith (2005). Chilopoda). Annual Review of Entomology
52: 151-170.
Farrel, B.. 2001. Evolutionary assembly of the
milkweed fauna: cytochrome oxidase I and
the age of Tetraopes beetles. Molecular
Phylogenetics and Evolution, 18(3): 467–478.
Gennis, R. B.. 1992. Site-directed mutagenesis studies
on subunit I of the a3-type cytochrome c
oxidase of Rhodobacter sphaeroides: a brief
review of progress to date. Biochemestry
Biophysical Acta, 1101: 184-187.
Giribet, G., Edgecombe, G. & Wheeler, W.. 1999.
Sistemática y filogenia de artrópodos: estado
de la cuestión con énfasis en análisis de datos
moleculares. Bol. S.E.A., 26: 197—212.
Un análisis más detallado (artículo en preparación)
Hebert, P., Cywinska, A. & Ball, S.. 2003. Biological
demuestra que el marcador mitocondrial CO-I, en los
identifications through DNA barcodes. Proc.
especímenes estudiados, es diferencialmente
R. Soc. Lond. B., 270: 313-321.
informativo según la región y sitio de secuencia, tal
Holm, L., Saraste, M. & Wilkstrom, M.. 1987..
como resume la Tabla 1. Sin embargo, CO-I no solo
Structural models of the redox centers in
es útil para la taxonomía molecular sino también para
cytochrome-oxidase. Journal of European
estudios filogeográficos, por lo que se recomienda
Molecular Biology Organization, 6: 2819-
extender la investigación con este grupo de
2823.
artrópodos. Los estudios moleculares de la
Lunt, D. H., Zhang, X., Szymura, J. M. & Hewitt, G.
entomofauna glaciar, más allá de otorgar datos sobre
M.. 1996. The insect cytochrome oxidase I
clasificación, dispersión o historia evolutiva de los
gene: evolutionary patterns and conserved
ecosistemas acuáticos, puede proveer información
primers for phylogenetic studies. Insect
acerca de la amenaza para su supervivencia tras la
Molecular Biology, 5 (3): 153–165.
pérdida gradual de su hábitat y fragmentación

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No1 (2013) 61

Manuel, M., Jager, M., Murienne, J., Clabaut, C., Le Biologie und Geografiean der Universität,
Guyader, H.. 2006. Hox genes in sea spiders Duisburg-Essen, 175p.
(Pycnogonida) and the homology of Saitou, N. & Nei, M.. 1987. The neighbor-joining
arthropod head segments. Dev. Genes Evol., method: a new method for reconstructing
216: 481-491. phylogenetic trees. Molecular Biology
Muraji, M., Kawasaki, K. & Shimizu, T.. 2000. Evolution, 4(4): 406-425.
Nucleotide sequence variation and Saraste, M.. 1990. Structural features of cytochrome
phylogenetic utility of the mitochondrial COI oxidase. Revision Biophysical, 23: 331-366.
fragment in anthocorid bugs (Hemiptera: Smith, P.. 2005. Mitochondrial DNA variation among
Anthocoridae). Applied Entomology and populations of the glassy-winged
Zoology, 35 (3): 301-307. sharpshooter Homalodisca coagulata. Journal of
Nelson, D. & Cox, M.. 2000. Lehninger: principios de Insect Science, 5(41):1-8.
bioquímica. 3ra. Edic. Ediciones OMEGA, Tamura, K. & Nei, M.. 1993. Estimation of the
Barcelona, 1222p. number of nucleotide substitutions in the
Pauls, S.. 2004. Phylogeny and phylogeography of control region of mitochondrial DNA in
the montane caddisfly Drusus discolor humans and chimpanzees. Molecular Biology
(RAMBUR, 1842) (Trichoptera: and Evolution, 10:512-526.
Limnephilidae, Drusinae). Tesis doctoral,

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
62 IITCUP CIENCIA VOL1 No1 (2013)

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No1 (2013) 63

NOTA TÉCNICA

TIPIFICACIÓN MOLECULAR DE MIRU-VNTR’S PARA ESTUDIOS


EPIDEMIOLÓGICOS DE TUBERCULOSIS EN BOLIVIA

Vásquez, A.1,2 & Sbtte. Adm. Torres, E.2

1 Facultad de Ciencias Farmacéuticas y Bioquímicas, I-SELADIS, Universidad Mayor de San Andrés.

2 Centro de Investigación Genética, IITCUP, Universidad Policial. La Paz, Bolivia. cingen.ptc@gmail.com

PALABRAS CLAVE: Mycobacterium tuberculosis, MIRU-VNTR, epidemiología molecular.

INTRODUCCION Selección de Cepas

La tuberculosis (TB) es una enfermedad infecto- El estudio se realizó en 85 cepas aisladas en medio de
contagiosa causada por diversas especies del género Lowenstein-Jensen de muestras clínicas enviadas por
Mycobacterium, la mayoría del complejo la Red Nacional de Laboratorios de Tuberculosis-
Mycobacterium tuberculosis. La Organización Mundial INLASA desde de ocho departamentos de Bolivia.
de la Salud (OMS) estima que un tercio de la
población mundial está infectada por este agente. Purificación de ADN genómico
Bolivia es el tercer país más afectado por la
tuberculosis en el continente americano después de Alícuotas de los cultivos de M. tuberculosis se
Haití y el Perú. Según datos de la gestión 2004, la sometieron a ebullición y posterior purificaron con el
incidencia de tuberculosis clasifica a Bolivia entre los sistema comercial “Wizard Genomic DNA
países con alta carga de 100 o más por cada 100.000 Purification” (Promega) optimizado para las
habitantes, compartiendo esta situación con países muestras.
del continente africano (W.H.O., 2009).
Se amplificaron 6 MIRU-VNTRs en multiplex de los
Por su importancia la tuberculosis requiere sistemas A (loci 4, 26, 40) y B (loci 10, 16, 31) de
constantemente nuevos y optimizados métodos para acuerdo al protocolo y cebadores descritos por
la detección y tipificación de la bacteria que la causa Supply et al. (2006), pero etiquetando a 4 y 10 con el
(Van Embden et al., 1993; Cohn, 1998). Este estudio fluoróforo 6-FAM, 26 y 16 con 5-TET y a 40 y 31 con
propone incluir el uso de marcadores moleculares del 5-TIE.
tipo MIRU-VNTR (Mycobacterial Interspersed
Repetitive Units of Variable Number of Tandem Electroforesis capilar y análisis filogenético
Repeats: Unidades Repetitivas Mycobacteriales
Intrínsecas con Número Variable de Repeticiones en Los productos de MIRU-VNTRs obtenidos fueron
Tándem) por electroforesis capilar (Supply, 2001) en sometidos a electroforesis capilar en un Analizador
nuestro medio. Los genotipos de MIRU-VNTRs Genético AB3130 (FCFB, UMSA). Y analizados con el
proveerán información no solo de la presencia programa informático GeneMapper (Applied
específica de la bacteria sino también, y más Biosystems), caracterizando y tipificando los alelos
importante aún, de la diversidad de las cepas respectivos para cada marcador en cada cepa. Los
circulantes, su tendencia evolutiva y su relación con filogramas fueron ensamblados con el programa
la virulencia de esta bacteria en el territorio boliviano. PowerMarker v3.25 (www.statgen.ncsu.edu),
empleando el modelo Neighbor-Joinig (Saitou y Nei,
MATERIALES Y MÉTODOS 1987), las distancias de Slatkin (1989) y la cepa H37Rv
como control externo.

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
64 IITCUP CIENCIA VOL1 No1 (2013)

RESULTADOS Y DISCUSIÓN

Tipificación de MIRU-VNTRs

Se amplificaron los complejos A y B propuestos por


Supply (2001) con tamaños diferentes entre cepas
(Fig. 1).

En los 4 MIRU-VNTRs se detectaron 18 alelos con al


menos 2 en cada uno (Tabla 1). La menor frecuencia
corresponde al alelo 3 y la mayor al 1 del locus 4.

Los seis loci estudiados son informativos para la


identificación filogenética de linajes de M.
Figura 1. Corrida electroforética de los 6 fragmentos de MIRU
tuberculosis, aunque en 4 y 31 parece existir una tasa VNTRs obtenidos a partir del protocolo desarrollado por
evolutiva baja o reciente. El estudio combinado de al Supply y colaboradores (2001).
menos estos seis loci parece, por tanto, condicionante
al momento de arribar a conclusiones sobre
diversidad, tendencia evolutiva o filogenia. Tabla 1. Frecuencias alélicas de los
MIRU-VNTR´S caracterizados.
MIRU ALELO FREC.
Análisis de la estructura genética de los MIRU-VNTRs
LOCUS10 1 0,305085
La estructura de alelos muestra que los seis loci LOCUS10 2 0,694915
presentan suficiente variabilidad para tipificar y LOCUS16 1 0,237288
distinguir cepas no emparentadas. El filograma LOCUS16 2 0,762712
muestra que las cepas provenientes de Oruro están LOCUS31 1 0,152542
emparentadas con la cepa control (Figura 2), que es LOCUS31 2 0,847458
sensible al espectro de antibióticos para el LOCUS4 1 0,949152
tratamiento de la tuberculosis. LOCUS4 2 0,033898
LOCUS4 3 0,016949
La estructura genética de la cepa “Oruro” es única y LOCUS26 1 0,245614
no muestra relación con otras cepas del país, lo que LOCUS26 2 0,175438
sugiere que esta población de M. tuberculosis no está LOCUS26 3 0,508772
influenciada por flujo génico. Por otro lado, las cepas LOCUS26 4 0,052632
La Paz, Santa Cruz, Potosí, Chuquisaca, Beni, LOCUS26 5 0,017544
Cochabamba y Tarija, se posicionan en un clado LOCUS40 1 0,258621
independiente más diverso, siendo Tarija la más
LOCUS40 2 0,482759
distante. Las de Beni y Cochabamba se muestran
LOCUS40 3 0,155172
estrechamente relacionadas, lo que sugiere un fuerte
LOCUS40 4 0,103448
proceso migratorio entre estos departamentos.
Asimismo es posible identificar a las cepas de La Paz
CONCLUSION
en un clado distinto al de los restantes
departamentos. Finalmente se ha visto que los
El estudio molecular de MIRU-VNTRs con cepas de
resultados son coherentes con la creencia de que los
Mycobacterium tuberculosis provenientes de ocho
MIRU tienen una evolución convergente
departamentos del país ha permitido su
(Frothingham y Meeker-O’Connell, 1998; Mazars et
identificación y tipificación inicial, estableciendo
al., 2001; Supply et al., 2006).
linajes que podrían ser útiles para estudiar las
UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No1 (2013) 65

TARIJA
tendencias evolutivas de estas bacterias que, para su
diversificación, dependen en gran medida de sus
hospederos humanos. Los resultados demuestran
que la técnica desarrollada por Supply y ND

colaboradores en 2006 puede proveer útil


información para el estudio integral de la
tuberculosis en Bolivia, coadyuvando al CBBA

establecimiento de políticas de control y lucha contra


esta enfermedad (Wright et al., 2007). Se recomienda
la continuación de la estandarización de los demás BENI
MIRU del sistema multiplex y la inclusión
permanente de nuevas muestras y cultivos.
CHUQUISACA
AGRADECIMIENTOS

Agradecemos la colaboración del Dr. Antonio Flores


POTOSI
Serna, coordinador administrativo del proyecto; a
Silvana Limache Valderrama, Julia Molina Orihuela,
Dina Quispe Mamani y Daniela Arteaga Voigt,
SANTA CRUZ
quienes coadyuvaron al desarrollo del trabajo de
laboratorio y al análisis y revisión de esta
investigación.
LA PAZ

Asimismo expresamos nuestra gratitud a las


autoridades de la Facultad de Cs. Farmacéuticas y
Bioquímicas (UMSA) y del Convenio UMSA – Policía ORURO

Boliviana por el apoyo prestado.

REFERENCIAS H37RV
0.1

Cohn, L.. 1998. The use of restriction fragment length


polymorphism (RFLP) analysis for Figura 2. Árbol filogenético con 6 MIRU- VNTRs de 84 cepas de
M. tuberculosis de 8 departamentos de Bolivia, de acuerdo al
epidemiological studies of tuberculosis in modelo de Slatkin (1989) con H37Rv como grupo externo.
developing countries. Int. J. Tuber. Lung. Dis.,
2:16-26. Saitou, N. & Nei, M.. 1987. The Neighbor-joining
Frothingham, R. & Meeker-O’Connell, W.A.. 1998. method: A new method for reconstructing
Genetic diversity in the Mycobacterium phylogenetic trees. Mol. Biol. Evol., 4(4): 406-
tuberculosis complex based on variable 425.
numbers of tandem DNA repeats. Slatkin, M. & Barton, N.M.. 1989. Comparision of
Microbiology, 144: 1189-96. three indirect methods for estimating average
Mazars, E., Lesjean, S. & Banuls, A.L.. 2001. High- levels of gene flow. Evolution, 43: 1349–1360.
resolution minisatellite-based typing as a Supply, P., Allix, C., Lesjean, S., Cardoso-Oelemann,
portable approach to global analysis of M.,Ru¨sch-Gerdes, S., Willery, E., Savine, E.,
Mycobacterium tuberculosis molecular Haas, P., van Deutekom, H., Roring, S., Bifani,
epidemiology. Proc. Natl. Acad. Sci., 98: 1901- P., Kurepina, N., Kreiswirth, B., Sola, C.,
1906. Rastogi, N., Vatin, V., Gutierrez, M., Fauville,
M., Niemann, S., Skuce, R., Kremer, K., Locht,
C. & van Soolingen, D. 2006. Proposal for

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
66 IITCUP CIENCIA VOL1 No1 (2013)

standardization of optimized mycobacterial DNA fingerprinting: recommendations for a


interspersed repetitive unit–variable-number standardized methodology. J. Clin.
tandem repeat typing of Mycobacterium Microbiol., 31:406-409.
tuberculosis. Journal of Clinical Microbiology, World Health Organization. Global tuberculosis
44(12): 4498–4510. control: surveillance, planning, financing.
Supply, P., Allix, C., Lesjean, S., Savine, E., Kremer, WHO report 2009. WHO/HTM/TB/2009.411.
K. & Locht, C.. 2001. Automated high- Geneva, Switzerland.
throughput genotyping for study of global Wright, A., Zignol, M. & Van Deun, A.. 2009.
epidemiology of Mycobacterium tuberculosis Epidemiology of antituberculosis drug
based on Mycobacterial Interspersed resistance 2002-07: an updated analysis of the
Repetitive Units. Journal of Clinical Global Project on anti-tuberculosis drug
Microbiology, 39(10): 3563–3571. resistance surveillance. Lancet, 373: 1861-
Van Embden, J., Cave, M. & Crawford, J.. 1993. Strain 1873.
identification of Mycobaterium tuberculosis by

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No1 (2013) 67

NOTA TÉCNICA

DETECCIÓN DEL GEN “INTERFERÓN-GAMMA” POR PCR DE


RETRO-TRANSCRIPCIÓN EN CÉLULAS MURINAS

Limache, S. & Calla, J.1

1Instituto SELADIS, FCFB, UMSA. La Paz, Bolivia.

PALABRAS CLAVE: RT-PCR, interferón-gamma.

INTRODUCCIÓN La leishmaniosis es una enfermedad infecciosa


endémica en muchas regiones tropicales y
La biología molecular para el estudio de la expresión subtropicales del mundo. En total la prevalencia
génica en biomedicina se ha convertido en una mundial estimada es de 12 millones de casos y 38
poderosa herramienta para comprender muchas países endémicos entre los cuales se encuentra
enfermedades humanas en modelos animales, lo que Bolivia (Lydyard et al 2010).
requiere extensa experimentación para dilucidar los
mecanismos involucrados. A mediados del 2002 se Por estas razones la mayoría de los estudios se
pudo observar que el genoma completo de Mus enfocan en la evaluación de nuevas alternativas de
musculus, tenía una similitud del 90% con el humano, tratamiento que permitan su administración oral y
lo explica en parte porqué el ratón es el animal de dérmica para mayor facilidad de los pacientes.
experimentación más utilizado en los laboratorios. Extractos de diversas plantas actúan como agentes
leishmanicidas y al mismo tiempo sobre los
Este animal ha sido especialmente empleado en la componentes del sistema inmune. Entre las plantas
relación salud, enfermedad y tratamiento, más estudiadas en la actualidad tenemos: Wedelia
especialmente porque bioquímica e trilobata, Clivadium remotiflorum “huaca”, Lepidium
inmunológicamente la similitud con el ser humano es peruvianum, Galipea longiflora “evanta”, Clivadium
del 75%. Los genes del ratón tienen sus homólogos en remotiflorum “huaca”, Lepidium peruvianum (Giménez
el hombre y esto facilita la identificación de genes que et al 2005).
predisponen a diferentes tipos de enfermedades
inmunológicas, virales y oncológicas por aislamiento Estudios in vivo han mostrado que los alcaloides
celular y células in vitro (Waterston et al., 2002; encontrados en la Evanta exhiben un efecto
Karlin et al., 1985). leishmanicida, mostrado por una reducción en el
tamaño de las lesiones cuando alcaloides purificados
En las enfermedades infecciosas producidas por son administrados a ratones infectados con L.
parásitos intracelulares como Leishmania sp., la donovani, L. braziliensis, L. amazonensis y L.
producción de algunas citoquinas de líneas celulares venezuelensis, pero a su vez parece ejercer un efecto a
de Linfocitos-T-Cooperadores-1, que son activadas nivel del INFg (Giménez et al 2005).
en respuesta a infecciones parasitarias, produciendo
citoquinas como el Interferón-gamma (INFg), la La expresión génica puede estudiarse a nivel de pre
Interleucina-2 (IL-2) y el Factor de Necrosis Tumoral y post transcripcional, mediante retro-transcripción,
Beta (FNT-B). La detección de estas citoquinas en para la semicuantificación de los ARNm, este tipo de
sangre o tejido son ampliamente utilizadas para el
estudio es muy utilizado para la evaluación
diagnóstico (Pérez et al 2011).
toxicológica de medicamentos y químicos en general.

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
68 IITCUP CIENCIA VOL1 No1 (2013)

El presente trabajo estudió la expresión del gen INFg la posible estimulación no es significativa, siendo
mediante RT-PCR en cultivos de células esplénicas necesaria una cuantificación con valores absolutos,
de ratón tratadas con extractos de alcaloides totales que permitan corroborar los datos obtenido en este
de Galipea longiflora (Evanta). trabajo, mediante el PCR en tiempo real. Sin
embargo, la técnica ha mostrado ser útil para una
MATERIALES Y MÉTODOS caracterización previa de la expresión génica en
cultivos celulares.
Cultivo celular
60
Las células de Mus musculus se cultivaron en medio 49,2
50 42,3 45,3
40,5 3840,4

Expresión (ng)
RPMI a 37 °C.
40
30 30
30 23 23,5
La Tabla 1 muestra el diseño de los ensayos
20
administrados in vivo a los ratones de
experimentación. 10
0
Tabla 1. Tratamiento de Mus musculus
Concanavalina A (CONA), Extracto de alcaloides totales de
Evanta (EAE), Antígeno purificado de Leishmania sp (Ag).
VARIABLE CONA
CONA Ag Ag + EAE
IN VITRO + EAE BETA IFNg
ug/ml 5 5 10 20 20 10
horas 48 48 24 48 48 24 Gráfica 1. Semicuantificación de la expresión de INFg en
cultivos celulares (C-) estimulados (CONA) con extractos de
RT-PCR evanta (EAE) y antígeno purificado de Leishmania sp. (AG).

El ARN total de los cultivos celulares fue obtenido BIBLIOGRAFIA


empleando el sistema comercial RNA Maxwell cell
extraction kit y el equipo Maxwell 16 (Promega). La Czechowski, T., Stitt, M., Altmann, T., Udvardi, M.K.,
purificación de ARNm se realizó a partir del ARNt and Scheible, W.R. (2005). Genome-wide
por el método de captura magnética del sistema identification and testing of superior
comercial Poly-A-Tract (Promega) según reference genes for transcript normalization
recomendaciones del fabricante. in Arabidopsis. Plant Physiol. V.139: 5–17.
De La Barreda.N.2008. Biomarcadores epigenéticos.
Los extractos de ARNm se emplearon para la retro- Departamento de Biología Celular y Genética.
transcripción (RT-PCR) de ADNc total y Universidad de Alcalá. p.85-112.
simultáneamente la amplificación del INFg y del gen De la Barreda N.2008. Explorando los genes. Del big-
beta-2-microglobulina, empleado posteriormente bang a la nueva Biología. 1ed. Madrid. p425.
como control de normalización. La retro- Derewenda Z. et al.1989. The structure of the
transcripción se realizó con el siguiente protocolo: 35 saccharide-binding site of concanavalin A.
°C 45 min; 94 °C 2 min; 40x 94° C 30 seg, 57 °C 1min, The EMBO Journal. 8(8):2189-2193.
68 °C 2 min y extensión final de 68 °C 7min. Devlin, T. 2004. Bioquímica. 4ed. Barcelona. Cap.I
Dwyer et al.1981. The use of concanavalin A to study
RESULTADOS Y DISCUSIÓN the immunoregulation of human T
cells.Clin.exp.Immunol. 46(2):237–249.
En la Grafica 1 y 2 se pueden observar los Falcoff, E; Gimenez, L 1994. A; Bernabo, J. G;
histogramas de la semicuantificación elaborada con Bottasso, O. The interferon gamma as
el empleo del programa LabImage, donde se puede animmunological strategy for the human
observar claramente el efecto estimulador de EAE leishmaniosis treatment. Medicina (B.Aires).
sobre la expresión del ARN m del INF-g. Sin embargo 54(3):265-72

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No1 (2013) 69

Fournet et al. 1994. The activity of 2-substituted O’Connell J.2002. RT-PCR Protocols.1ed. United
quinoline alkaloids in BALB/c mice infected States of America.Cap.1,2,3.
with Leishmania donovani. Journal Passarge, MD 2010. Eberhard, MD.2010. Genetica
Antimicrobial Chemoterapy.v.33: 537-544 Texto y Atlas.3ed.España.Cap.2,3.
Galindo. M, Solano J. 1983. Interferón: mecanismos Pérez.C.et al.2011. Expresión de citocinas en células
bioquímicos de formación y acción. Anales de de sangre periférica de pacientes con
Biología.v.5:3-15. trasplante hepático ortotópico: resultados
Giménez et al.2005.Estudios Químicos, Biológicos Y preliminares. Revista de Gastroenterología.
Farmacológicos De Galipea longiflora, 76(2):108-112
krause. Rev. Bol. Quim.v.22 (1): 94-107. Pirmez Claude et al.1993. Cytokine Patterns in the
Guevara et al. 2002. El Sistema Inmune en los Estados Pathogenesis of Human Leishmaniasis J. Clin.
de Salud y Enfermedad. MEDISAN.v.6 (1):60- Invest. C The American Society for Clinical
68. Investigation.v.91: 1390-1395.
Hernández A. et al 1995.Análisis del ARN: Estudio Radoni¢, A., Thulke, S., Mackay, I., Landt, O.,
de la expresión génica. NEFROLOGIA.v.15 Siegert,W. & Nitsche, A. 2004. Biochemical
(2):67-84. and Biophysical Research Communications.
Ijzermans J., Marquet, R., 1989. Inhibition of duck 313: 856-862.
hepatitis B virus replication by interferon- Rappolee.et al.1988. Wound macrophages express
γ.Immunobioly.v.179 (1-2): 456-476. TGF-a and other growth factors in vivo:
Karlin S, Ghandour Ghassan, Foulser D.1985. ADN analysis by mRNA
Sequence Comparisons of the Human, Mouse phenotyping.Science.v.241:708-712.
and Rabbit Immunoglobulin Kappa Gene. Rogmanani S.1995. Biology of human Th1 and Th2
Mol. Biol. Evol.v. 2(1):35-52. cells. ClinImmunol. 15: l 21-129.
Kemp.K.2000. Review Cytokine-Producing T Cell Schroder K. et al. 2004. Interferon-γ: an overview of
Subsets in Human Leishmaniasis. Archivum signals, mechanisms and functions. Journal of
Immunologiae et Therapiae Experimentalis. Leukocyte Biology.v.75:163-189
48:173-176. Stürzenbaum et al., 2001. Comparative Biochemistry
Lenhninger A. 2005. Principios de Bioquimica. and Physiology, Part B.v.130: 281-289.
2ed.T.I.Cap.21. Thellin O. et al. 1999. Housekeeping genes as
Lewin B. 2008. Genes IX. 9ed. México. Cap.5, 7, 10,11. internal standards: use and limits. Journal of
Lydyard P. Et al.2010. Case Studies In Infectious Biotechnology. V. 75: 291–295
Disease. New York.Case9.p 249-256. Waterston Robert H.2002.Initial Sequencing and
Mogensen et al.1987. The interferon-macrophage Comparative Analysis of the Mouse Genome.
Alliance.Interferón.v.8:55-84. NATURE.v.422: 520-562.
Murray Robert. et al.2007. Bioquimica Ilustrada.17ed.
México Cap34.

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
70 IITCUP CIENCIA VOL1 No1 (2013)

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No1 (2013) 71

REVISIÓN CORTA

ESTRUCTURA Y CARACTERÍSTICAS GENERALES DE LOS


INDICIOS PILOSOS

Sbtte. Adm. Vanesa Serrudo Gonzáles1

1Instituto de Investigaciones Técnico Científicas de la Universidad Policial (IITCUP), División Biología, La Paz, Bolivia.

ANTECEDENTES información acerca de la posición de los pasajeros y


su presencia en los parachoques establece una
El pelo es una estructura derivada de la epidermis y conexión entre los atropellados y el vehículo,
característico de los mamíferos. Su estructura básica también se los ha empleado en resolución de delitos
consta de un tallo externo y una raíz (Figura 1). El sexuales, donde la presencia de vellos púbicos de la
tallo contiene tres capas: 1) la médula, en la parte víctima en la ropa interior del sospechoso
central del pelo, consiste de células queratinizadas constituyen potenciales pruebas de implicancia
laxamente unidas, está presente solo en pelos gruesos (Molina 2004).
y puede contener espacios de aire; 2) la corteza,
componente principal del tallo que rodea la médula,
sus células están compactadas, queratinizadas,
fuertemente adheridas entre sí y concentran la
mayoría de los gránulos de pigmento, y 3) la
superficie o cutícula, parte externa del tallo
conformada por escamas cuticulares (Harada 2009,
Baca & Sánchez-Cordero 2004).

La cutícula de los pelos está formada por un conjunto


ininterrumpido de células planas con diferentes
formas que, a medida que van siendo empujadas
hacia la superficie, conforman una serie de patrones
que pueden variar dependiendo de la raza o la
especie. Por lo general, el patrón cuticular es de dos
tipos: imbricado, donde las escamas se hallan
sobrepuestas y es típico de humanos; y coronal, en el
que las escamas tienen forma de corona envolvente
sobrepuesta. Los demás patrones encontrados en los
diferentes grupos de mamíferos son variaciones de
estos dos tipos principales (Vázquez et al. 2000).

Aplicación en Criminalística

Puesto que los apéndices pilosos representan uno de


los indicios más comunes encontrados en la escena
del hecho y que se preservan durante largos períodos
de tiempo, son un indicio útil al momento de
desarrollar investigaciones. Han demostrado su Figura 1. Corte transversal (arriba) y longitudinal (abajo) de las
utilidad en hechos de tránsito, generando partes de un apéndice piloso humano (Hausman, 1924).

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
72 IITCUP CIENCIA VOL1 No1 (2013)

La ciencia que estudia estos indicios con fines legales responsables de la alta electronegatividad de los
es la tricología forense, definiéndose como indicios pelos.
tricológicos “Todos aquellos elementos pilosos que
sean encontrados en el lugar donde ocurrió el hecho
punible o recolectados de las prendas u objetos, tanto
como de ofendidos como de imputados y revisados
en el laboratorio forense” (Molina 2004). Dicha
revisión se debe realizar con procedimientos
validados que demuestren ser idóneos para el
procesamiento de evidencias y su posterior uso en
casos legales.

Aunque en una escena criminal se pueden identificar


fibras sintéticas y pelo animal utilizado en la
fabricación de ropa (lanas, pieles, etc.), la Figura 2. Puentes de hidrógeno causantes de la
identificación de los apéndices pilosos presentes electronegatividad del pelo (Federación de Enseñanza de
puede guiar a la identificación de un sospechoso. CCOO, 2010).
Hausman (1925) citado en Juáres-Sanches et al. 2007,
encontró que al analizar pelos provenientes de todas La consecuencia de generar electrostática durante el
las razas humanas, no existen diferencias en la forma almacenamiento y transporte de los indicios pilosos
de las escamas ni la médula y la variación está incluye la descamación y eliminación de los patrones
únicamente relacionada con el grosor del pelo, que cuticulares típicos (imbricado cuticular en humanos).
puede variar dentro del mismo individuo e incluso
dentro del mismo pelo. Características higroscópicas

Características electroestáticas Según Guzmán (2011), al sumergir un pelo en agua


durante 24 h este incrementa su peso en 30 %, lo que
La fricción entre dos superficies induce la formación significa que se incrementa también su diámetro,
de energía electrostática. El pelo presenta alta pudiendo generar un serio factor de error.
electronegatividad, ya que está químicamente
constituido por largas cadenas de queratina y esta a El Instituto de Investigaciones Forenses (IDIF) del
su vez de aminoácidos, donde predomina la cisteína Ministerio Público ha preparado una eficiente “Guía
con un átomo de azufre. Las cadenas de queratina se de Recomendaciones para la Colección, Envío de
acomodan de forma paralela, como los hilos de un Muestras, Evidencias y Exámenes Forenses”, en la
cable, y se mantienen unidas por medio de tres tipos que recomienda utilizar sobres de papel libres de
de enlaces químicos: humedad. Sin embargo, el proceso de validación de
estas recomendaciones ha quedado pendiente, por lo
- Puentes de hidrógeno, que se dan entre un que surge el objetivo de verificar científicamente los
átomo de hidrógeno y otro átomo muy aspectos relevantes para la selección del “medio
electronegativo como el oxígeno. apropiado” de transporte y almacenamiento de
- Puentes salinos entre un ácido y una base, que se muestras pilosas, bajo la hipótesis de que este medio
dan por la atracción de dos sustancias con cargas puede influir sensiblemente la morfología de las
eléctricas opuestas. muestras pilosas remitidas a un estudio pericial.
- Puentes di-sulfuro: enlaces covalentes entre los
átomos de azufre de las cadenas vecinas. REFERENCIAS

La Figura 2 muestra los puentes de hidrógeno como Baca, I. & Sánchez-Cordero, V., 2004 Catálogo de
enlaces químicos más externos y por lo tanto los pelos de guardia dorsal en mamíferos del

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No1 (2013) 73

estado de Oaxaca, México Anales del Instituto Molina, M., 2004. Biología Forense. Laboratorio de
de Biología, Universidad Nacional Autónoma criminalistica. 1ra edición. Editorial
de México. Serie Zoología 75(2): 383-437. Universidad Estatal a distancia. San José,
Federación de Enseñanza de CCOO. 2010. El cabello: Costa Rica. 4-16.
Estructura, propiedades, composición Quadros, J. & Monteiro-Filho, E., 2006. Colecta e
química, ciclo, tipos y clases de cabellos, preparacao de pelos de mamiferos para
pautas para la determinación de: distribución, identificacao em microscopia optica. Revista
longitud, calidad, color, forma e brasileira de Zoologia. 23(1): 274-278.
implantación. Andalucía. 1-11. Vázquez, D., Perovic, P. & Olsen, A. 2000. Patrones
Harada, M., 2009. A valiaçao de características cuticulares y medulares de los pelos de
morfológicas e morfométricas dos pelos de mamíferos del noroeste argentino (Carnivora
roedores de Mata Atlántica do Estado de Sao y Artiodactyla). Mastozoología Neotropical.
Paolo. Programa de pos graduacao em 7(2):131-147.
ciencias biológicas (zoología). Universidad
Estadual Paulista.

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
74 IITCUP CIENCIA VOL1 No1 (2013)

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No1 (2013) 75

REVISIÓN CORTA

ENFERMEDADES INFECCIOSAS EMERGENTES (EIE´S) Y SU


RELACIÓN CON EL TRÁFICO DE FAUNA SILVESTRE

Fabiola Suarez Guzmán1,2

1 Programa de Veterinarios para la Conservación, Wildlife Conservation Society (WCS). La Paz, Bolivia.
2 Centro de Investigación Genética, IITCUP, Universidad Policial. La Paz, Bolivia. cingen.ptc@gmail.com

RESUMEN

El tráfico y comercio de fauna silvestre constituye una importante ruta para la introducción de patógenos zoonóticos y el surgimiento
de Enfermedades Infecciosas Emergentes (EIE´s), que son un riesgo para la salud de poblaciones humanas y animales domésticos, y
puede poner en riesgo de extinción a poblaciones naturales de animales silvestres. La psitacosis o enfermedad del loro es una
enfermedad zoonótica que puede ser transmitida a partir de loros decomisados al tráfico y comercio de fauna, actividad que debe ser
monitoreada y controlada como un sistema de alerta temprana para la detección de esta enfermedad y otras enfermedades emergentes
con posible incidencia pandémica.

PALABRAS CLAVE: Tráfico de fauna silvestre, enfermedades zoonóticas, psitacosis, enfermedad del loro.

Uywaqaxpata apaktinku ranqhay sallqa uj allin ñan yaykunanpax unquykunas, mana allinkananpax uywaspata runaswasi, atin
churayta chhikipi chinka manpax llajtas uywasmanta sallqasmanta. Psitacicosis uj unquy k’allamanta, atin chimpachiyta chay k`allas
jap`inku ranqhanamanta chay uyutakax sallqa. Mana chimpachinankupax kay unquyta ñawpaxta jark`ana chay ranqhana uywaqax
sallqa. Mana kay unquykuman ni uj unquykunapiwan chimpananpax wax kunaman.

RIMANAS: Uywaqaxpata apaktinku ranqhay sallqa, uywa unquy, psitacosis.

Resulta evidente que para el surgimiento de la crisis patógenos zoonóticos, debido al estrecho contacto de
ambiental de nuestro siglo, varias son las causas que la fauna con las personas durante la captura,
han coadyuvado a poner en riesgo de extinción a transporte y comercialización, en particular aquel
numerosas especies de animales y plantas. Entre realizado de forma ilegal donde los controles
estas figuran la destrucción y fragmentación del sanitarios son casi inexistentes. Además de este
hábitat, la cacería indiscriminada, la introducción de riesgo, la fauna silvestre comercializada entra en
especies exóticas y el tráfico y comercio insostenible contacto con diversidad de animales domésticos.
de fauna silvestre. A esto se suma el surgimiento de Cook (2005) describe los mercados donde se venden
patógenos zoonóticos a causa de un aumento en el
contacto entre poblaciones naturales de animales
silvestres, animales domésticos y personas, que es un
factor más para la desaparición de poblaciones de
fauna silvestre, altas pérdidas económicas en
producciones pecuarias y brote de epidemias que
han cobrado la vida de muchas personas en varias
partes del mundo.

Ninguno de estos factores causales es tan fácilmente


controlable como el tráfico y comercio de fauna
silvestre (Karesh 2005), y esta es sin duda una de las
más importantes rutas para la introducción de Figura 1. Tráfico de especies animales.

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
76 IITCUP CIENCIA VOL1 No1 (2013)

animales vivos como “una mezcla de animales de transmitirse de persona a persona y no pudieron
domésticos, animales silvestres y personas donde no ser tratadas o prevenidas.
existen medidas higiénico-sanitarias apropiadas y
donde la manipulación de los animales se realiza sin Los animales silvestres constituyen un reservorio de
equipos de protección personal adecuados”. Este patógenos, muchos de los cuales pueden permanecer
hecho, junto con el estrés de cautiverio que “escondidos” en el hospedero silvestre (Williams et
disminuye las defensas inmunológicas de los al. 2002) pero afectar a otras especies. Un análisis
animales, hace del tráfico y comercio de fauna sobre los agentes infecciosos que afectan a los
silvestre una causa importante para la emergencia de humanos, a los animales domésticos y los de
enfermedades infecciosas. compañía ha revelado que de los 1415 agentes
Por definición, se entiende a las Enfermedades patógenos conocidos, 62% tienen su origen en
Infecciosas Emergentes (EIE´s) como aquellas que animales silvestres (Dehesa-Santisteban 2007), a esto
aparecen en una población por primera vez o que ya se sume que el 75% de las enfermedades emergentes
existían pero que rápidamente han incrementado su acontecidas los últimos años tiene características
prevalencia en un área geográfica determinada zoonóticas (Brown 2004).
(Williams 2002). Tal como lo muestra la Figura 2, la
relación entre la salud de la fauna silvestre, los El comercio interno y externo de fauna se ha
animales domésticos y la salud humana, confluye en triplicado los últimos años (Brown 2004), originando
un conjunto actualmente entendido como el “nuevo un movimiento global de patógenos y una
concepto de salud” (Arrivillaga & Caraballo 2009), interacción de poblaciones domésticas, silvestres y
que estudiado bajo el nuevo enfoque de la Medicina humanas sin precedentes. Como se ha demostrado a
lo largo de la historia, este contacto puede generar
serias epidemias, siendo el más reciente ejemplo la
emergencia de la primera infección respiratoria
identificada en el siglo XXI en China: el Síndrome
Respiratorio Agudo Severo (SARS) (Bell et al. 2004),
cuyo agente causal fue un coronavirus mutado
(SARS-CoV) de origen animal. Estudios posteriores
confirmaron que muchos de los pacientes infectados
con SARS tenían directa relación con vendedores o
cocineros en un mercado de fauna silvestre. El virus
fue aislado en seis civetas de palmera (Paguma
larvata) y un mapache (Nyctereutes procyonides),
evidenciando que el comercio y tráfico de fauna
Figura 2. Relación entre la salud de los animales
silvestre es un factor importante no para la
domésticos, silvestres y poblaciones humanas y su
diseminación de enfermedades en humanos y que el
confluencia en la salud del medio ambiente
(Daszak 2008). grado de virulencia puede verse acentuada por este
fenómeno.
de la Conservación, que busca analizar y entender la
emergencia de nuevos patógenos desde un enfoque Otros patógenos asociados con el tráfico de fauna
ecosistémico. silvestre en mamíferos incluyen la “encefalitis equina
La Organización Mundial de Epizootias (OIE) venezolana”, la rabia, la cryptosporidiosis, la
considera a las EIE´s como uno de los más grandes leishmania, la fiebre amarilla, tuberculosis y hepatitis
enemigos que amenaza la humanidad en la B, entre otras. En reptiles, la zoonosis más importante
actualidad (Brown 2004). Esta visión apocalíptica la constituye la salmonelosis, causada por bacterias
nace del concepto de las más recientes epidemias del género Salmonella, habitante normal de la flora
acontecidas en los últimos años, las cuales gastrointestinal de estos animales. En aves, la
aparecieron repentinamente, tuvieron la capacidad “encefalitis equina del este y del oeste”, la

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No1 (2013) 77

colibacilosis, la candidiosis, la toxoplasmosis, animales, tanto domésticos como silvestres, y la


salmonelosis y, de especial importancia, la psitacosis salud del ecosistema. Entre las acciones propuestas
(Varela 2002). para lograr estos objetivos, se plantea focalizar los
esfuerzos en los mercados de comercio de animales
La psitacosis o enfermedad del loro, merece atención vivos y de esta forma reducir el contacto entre
debido al marcado interés por las aves psitácidas especies. Proponer reglamentos estrictos que
permitan llenar los vacíos operativos que tiene
actualmente la Ley del Medio Ambiente (1333) para
el control en el tráfico y comercio de fauna silvestre
en el país. Desarrollar no sólo un método que
identifique a los microorganismos involucrados en el
manejo con fauna silvestre, tanto los conocidos como
los desconocidos, sino además, junto con la
capacitación de profesionales en la temática,
desarrollar a futuro un sistema de alerta temprana,
mejorándose la vigilancia a nivel mundial para poder
Figura 3. Tráfico de fauna silvestre. detectar enfermedades y de este modo optimizar el
tiempo de respuesta y reducir los costos que puedan
para ser adquiridas como mascotas en nuestro medio generar nuevas epidemias.
(Suarez & Alandia 2011). Es transmitida por
Chlamydophila pssitaci, una bacteria intracelular de las REFERENCIAS
aves que puede infectar al hombre de forma
accidental por vía aerógena (Acha & Szyfres, 2003) y Acha P. y B. Szyfres. 2003. Zoonosis y enfermedades
se considera una enfermedad ocupacional de transmisibles comunes al hombre y a los
criadores de aves, trabajadores de granjas avícolas, animales. Publicación Científica y Técnica No.
trabajadores de laboratorio, comerciantes de aves y 580. Organización Panamericana de la Salud.
veterinarios. Volumen III: Clamidiosis, rickettsiosis y
Aunque la psitacosis es esporádica en humanos, virosis.
varios brotes se han registrado en África, Argentina, Arrivillaga J, V. Caraballo. 2009. Medicina de la
Estados Unidos y gran parte de Europa (1000 casos Conservación. Rev. Biomed 2009; 20:55-67
reportados y entre 200 a 300 fallecimientos), Bell D., S. Roberton and P.R. Hunter. 2004. Animal
originados por la importación de psitácidos desde origins of SARS coronavirus: possible links
varios países de América del Sur. Psitacosis se ha with the international trade in small
reportado también en Brasil (Raso et al., 2008), carnivores. Philosophical Transactions of the
Argentina (Acha y Szyfres, 2001.) y Chile (Jara et al. Royal Society Biological Sciences 359:1104-
2001). En Bolivia esta enfermedad no ha sido descrita 1114
en aves o humanos, probablemente debido al Brown C. 2004. Emerging zoonoses and pathogens of
parecido de sus síntomas con un resfriado común, public health significance – an overview. Rev.
confundiendo el diagnóstico. sci. tech. Off. int. Epiz 23(2):435-442.
Cook R. 2005. Emerging Diseases at the Interface of
Limitados esfuerzos se hacen actualmente para People, Domestic Animals and Wildlife. The
explorar científicamente este fenómeno a nivel Role of Wildlife in our Understanding of
nacional. Como se puso en evidencia, existen varios Highly Pathogenic Avian Influenza. Yale
activadores y varias consecuencias para el actual Journal of Biology and Medicine 78, pp. 339-
problema de las enfermedades emergentes y por lo 349
mismo se plantean también diversas soluciones. Es Daszak P., A.A. Cunningham and A.D. Hyatt. 2008.
esencial conocer la intrínseca relación que existe entre Emerging Infectious Diseases of Wildlife-
la salud de las poblaciones humanas, la salud de los

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
78 IITCUP CIENCIA VOL1 No1 (2013)

Threats to Biodiversity and Human Health. Raso T.F, O.T Carrasco, J.C.R Silva, M.F.V Marvulo
Science 287:443-449 and A.A Pinto. Seroprevalence of Antibodies
Dehesa-Santiesteban F.L. 2007. Zoonosis Emergentes. to Chlamydophila psittaci en Zoo Workers in
Un Reto Interdisciplinar. Gac Med Bilbao Brazil. 2008. Zoonoses and Public Health.57
107:7-10. (2010) 411-416.
Jara, M., C. Borie and M. Martínez. 2001. Psitacosis y Suárez, F. and E. Alandia. 2010. Monitoreo sanitario
clamidiosis aviar: Chlamydophila psittaci en aves silvestres decomisadas en la Feria “16
Monografías de Medicina Veterinaria, de Julio” de la ciudad de El Alto. (Informe
Norteamérica, Vol. 21 (1). Consultado dic 7, técnico no publicado). WCS-Bolivia. 21 pp.
2010, de Williams E.S, T. Yuill, M. Artois, J. Fischer and S.A
http://www.revistas.uchile.cl/index.php/MM Haigh. 2002. Emerging Infectious Diseases in
V/article/viewArticle/5023/4907 Wildlife. Rev. sci. tech. Off. Int. Epiz 21(1):139-
Karesh W.B., R.A. Cook, E.L. Bennett and J. 157.
Newcomb. 2005. Wildlife Trade and Global
Disease Emergence. Emerging Infectious
Diseases 11(7):1000-1002

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No1 (2013) 79

ESTUDIO DE CASO

PLANIMETRIA OPERATIVA DE CAMPO Y DE GABINETE EN UN


CASO DE DESLIZAMIENTO DE TERRENO

Cbo. Adm. Arq. Wilton Omar Huayta Alcón

División Planimetría, IITCUP, Universidad Policial. La Paz, Bolivia.

RESUMEN

Este es un artículo que indaga la labor del planimetrista forense en caso de deslizamientos de terreno en la ciudad de La Paz durante
la actuación de los organismos investigativos de la Policía Boliviana, en este caso la Fuerza Especial de Lucha Contra el Crimen
(FELCC) y otras, dentro de un proceso penal a denuncia de parte, pudiendo existir victimas trágicas o pérdidas materiales y daños
simples o daños calificados. Más allá del análisis arquitectónico, topográfico y urbanístico, se presenta como ejemplo un caso suscitado
en la gestión 2012 en la ciudad de La Paz.

PALABRAS CLAVE: Deslizamientos, planimetría demostrativa, planimetría reconstructiva.

Kay qilqarak`ina tapun llank`ana forense siq`xpata wasismanta lluqlla La Paz llajtapi llank`asanku yachaymask`ana Policía
Bolivianamanta, chay Fuerza Especial de Lucha Contra el Crimen minku yuxkuna taripay chatanapi runamanta, atispa arpaskanku
was imayra chinkachispa chirqa. Astawan jaqaymanta pirqayachaqana, jallpa yachaqana, llajtayachaqana, ñuqa manani rikhuchiyta
uj llank`ana ñawpax 2012 nispha La Paz llajtapi.

RIMANAS: Lluqlla, siq´ita.

ABSTRACT

This document inquire and outline a soil and ground glide case in La Paz city during the intervention of the special police units like
the “Fuerza Especial de Lucha Contra el Crimen (FELCC)” and others, inside a penal process by part demand, allowing the possibility
for tragic victims, material loss, and simple or classified damages. Beyond architectural, topographic or urbanistic analysis, the case
is presented as a description of a real one dated in 2012 in La Paz city.

KEY WORDS: Ground glide, forensic topography.

INTRODUCCION El deslizamiento, es el movimiento hacia abajo de


una ladera, un desplazamiento de una masa de suelo
o roca el cual ocurre principalmente sobre una
superficie de ruptura o falla (debilidad del terreno) o
por una pendiente en forma súbita o lenta. Los
deslizamientos o derrumbes de tierra, también
conocidos como deslaves de lodo y aludes, y pueden
ser causados por una variedad de factores que
incluyen los terremotos, tormentas e incendios. Si
bien la gravedad que actúa sobre las laderas es la
principal causa de un deslizamiento, su ocurrencia
también depende de las siguientes variables:

Figura 1. Esquema de deslizamiento de terreno.


•Clase de rocas y suelos.

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
80 IITCUP CIENCIA VOL1 No1 (2013)

•Topografía (lugares montañosos con pendientes


fuertes). CAIDA: Una caída se inicia con el desprendimiento
•Orientación de las fracturas o grietas en la tierra. de suelo o roca en una ladera muy inclinada. El
•Cantidad de lluvia en el área. material desciende principalmente a través del aire
•Actividad sísmica. por caída, rebotando o rolando. Ocurre en forma
•Actividad humana (cortes en ladera, falta de rápida sin dar tiempo a eludirlas.
canalización de aguas, etc.).
•Erosión (por actividad humana y de la naturaleza). VOLCAMIENTO: Consiste en el giro hacia delante
Existen dos tipos de deslizamientos o derrumbes: de una masa de suelo o roca respecto a un punto o eje
debajo del centro de gravedad del material
Deslizamientos lentos.- Son aquellos donde la desplazado, ya sea por acción de la gravedad o
velocidad del movimiento es tan lento que no se presiones ejercidas por el agua.
percibe. Este tipo de deslizamiento genera unos
pocos centímetros de material al año. Se identifican Estos fenómenos geológicos, que se repiten
por medio de una serie de características marcadas anualmente en la ciudad de La Paz, debido a los
en el terreno. fenómenos naturales y provocados que sufre la
topografía de las laderas de la ciudad que hacen que
Deslizamientos rápidos.- Son aquellos donde la un mayor porcentaje del área urbana sea zona
velocidad del movimiento es tal que la caída de todo riesgosa, a pesar de que existen normas
el material puede darse en pocos minutos o notificándonos de los riesgos naturales, tal como lo
segundos. Son frecuentes durante las épocas de muestra el USPA en el art. 30 “Son las Áreas en las
lluvias o actividades sísmicas intensas. Como son que la edificación está prohibida por riesgos
difíciles de identificar, ocasionan importantes naturales tales como malas características geológicas
pérdidas materiales y personales. del suelo, la pendiente excesiva y la exposición a
Los deslizamientos o movimientos de masa no son derrumbes e inundaciones. El plano del USPA las
iguales en todos los casos, y para poder evitarlos o delimita el Plano de Riesgos de los suelos del área de
mitigarlos es indispensable saber las causas y la La Paz. Se definen terrenos de pendiente excesiva los
forma como se originan. que tengan más de 45º de pendiente. El objetivo que
Estas son algunas de las formas más frecuentes: se persigue en estas áreas es de no comprometer los

Figura 2. Zonas y áreas de una superficie de terreno que sufrió deslizamiento.

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No1 (2013) 81

suelos de mala calidad y no alterar su proceso natural deslizamientos de tierra. Es mostrar el Estado
de transformación y su equilibrio precario con obras Anterior al Hecho y el estado Posterior al Hecho, en
de edificación de cualquier tipo”. Muchos infografías, planos que muestran superficies,
ciudadanos siguen construyendo y edificando, volúmenes y lugares exactos; para poder de alguna
poniendo en riesgo la pérdida de vidas humanas que manera manifestar las causas, los factores que
pudieran ser calificadas e investigadas dentro la podrían haber ocasionado tal fenómeno topográfico.
división de homicidios y otros divisiones En tal método es imprescindible un trabajo operativo
investigativas de la FELCC. de campo que pueda reflejar un relevamiento y una
mensura adecuada del terreno y la fijación
METODOLOGÍA planimétrica y fotográfica lo más desarrollada
posible.
El propósito del método que se desarrollará en este
procedimiento de la planimetría forense relativo a los

Figura 3. Zonas de la ciudad de La Paz con riesgo muy alto.

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
82 IITCUP CIENCIA VOL1 No1 (2013)

Figura 4. Vista panorámica del lugar del hecho.

Los resultados de este método puede ser utilizado Se medirá todo cuanto esté dentro el área del
tanto para los investigadores, fiscales y peritos como deslizamiento, desde las pendientes, el volumen
por los técnicos especialistas en deslizamientos. El de masa deslizada, el área afectada, los diferentes
planimetrista logrará un conocimiento operativo de volúmenes desde la posición inicial hasta la
los conceptos y consideraciones para incorporar la posición final.
evaluación de los daños y el peligro de
deslizamientos al proceso de investigación criminal, Se utilizará diferentes equipos de medición
usando un nivel adecuado de evaluación para cada topográfica, geológica, además de realizar la
etapa del proceso y preparar los términos de memoria fotográfica y de video.
referencia que aseguren que se ha de obtener la
información necesaria que estará expresada en la Técnicas e instrumentos: planimetría de campo.
planimetría. El planimetrista encontrará una revisión
de los temas sobre el peligro y sus consecuencias  ESTACION TOTAL
funestas de deslizamientos y lineamientos para  GPS Garmin.
realizar la planimetría e infografía forense.  Odómetro digital.
 Telémetro Laser.
El método presentado de fijación planimétrica, uno  Brújula
de varios que están disponibles, tiene las siguientes  Huincha de 50 Mts.
características de desarrollo:  Cámara fotográfica.
 Mapas Cartográficos.
Se hace uso de diversos mapas temáticos e  Flexómetro.
información de percepción remota, generalmente  Tablero de dibujo.
disponible para un estudio de desarrollo.  Lápices y bolígrafos de colores.

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No1 (2013) 83

Gabinete planimétrico. Nº 1332 de la zona de Achachicala, tomando como


hito de referencia a 200 m. aproximados de distancia
La utilización de Software como: al noreste de la Universidad Salesiana. Cuyas
colindancias son: al este con la Calle Tte. Delgadillo,
 AutoCAD. al oeste con Vecino del fondo del inmueble en un
 Poser 9. nivel de piso inferior, al sur con Vecino y norte
 Google SketchUp 8. colinda con Vecino. La Calle Teniente Delgadillo
 Google Earth. presentaba una plataforma vehicular con una acera
 Adobe Photoshop CS 5. en voladizo todo esto soportado por muros de
contención, el ingreso principal del inmueble se
Exposición del caso. encuentra por debajo de esa plataforma en un nivel
inferior de 5.70 m. acera oeste, por un Callejón de un
El presente trabajo se llevó a cabo en el inmueble ancho de 2.18 m.
ubicado en la calle Tte. Delgadillo Nº 1332, entre calle
Antonio de Calancha y calle José Ortíz, de la zona Características topográficas del terreno.
Achachicala (lugar del hecho), cuyo acto se inició a
horas 16:00, del día Jueves 12 de Abril de 2012, Según fijación planimétrica se tiene referencia que es
concluyendo a horas 18:00 del mismo día, en el un terreno regular de aproximadamente 210 m2. Con
mismo utilizando las herramientas idóneos para este un frente menor a 12 m., en un terreno accidentado
tipo de pericias se ha procedido a: por la pendiente elevada que presenta, se observa en
el domicilio un deslizamiento de terreno y del muro
de contención de hormigón ciclópeo que habría
afectado dos habitaciones: una pequeña cocina y el
dormitorio donde perdieron la vida las tres víctimas
por este hecho. Se pudo determinar que hay una gran
diferencia del nivel de piso, +/- 0.00 en el frente del
terreno (callejón); -7.20 m. en la parte de la habitación
Dormitorio (Lugar del hecho) y el nivel -12.20 m. en
el fondo del terreno (Vecino Oeste). El ingreso
principal al domicilio estaba dado por un pasillo
callejón con un espacio de 2.18 m de ancho; limitado
esto por un muro de contención con una altura por
encima del callejón de 3.20 m., asimismo un segundo
muro de contención a una distancia horizontal de
2.93 m. y situado a un nivel superior donde en su
parte más alta presentaba una acera en voladizo de
hormigón armado y con barandas metálicas que
resistía el peso de la calzada empedrada en un nivel
superior de +5.70 m.

Características arquitectónicas del inmueble.

Figura 5. Medición del frente del domicilio. En la inspección se observa un inmueble afectado por
el deslizamiento de terreno que ha sido afectado a las
Localización. habitaciones que se encuentran construidos en una
plataforma en un nivel de piso menor a -7.20 m.
El lugar del hecho (inmueble) se encuentra ubicado donde se observa lo siguiente: La habitación del
en la calle Tte. Delgadillo acera oeste, asignado con el dormitorio (lugar del hecho) de aproximadamente 9

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
84 IITCUP CIENCIA VOL1 No1 (2013)

Figura 6. Uno de los croquis planimétricos levantados en el lugar.

m2, solo 2 paredes y sin la cubierta de calamina, un


piso de vaciado de cemento, en cuyo interior se
advierte la masa deslizada del terreno invadiendo
gran parte del área de la habitación; no se advierte el
área de la cocina pequeña que estaría contigua al
dormitorio; tampoco se observa las gradas de ingreso
principal al domicilio. Además de estos ambientes
mencionado al oeste del dormitorio del lugar del
hecho se tiene una habitación denominado
“Dormitorio 2” de aproximadamente 15.10 m2 con
piso de machihembrado; contigua a esta una cocina
improvisada con muros de madera en un área de
menor a 5m2.; un patio central con piso de vaciado
de cemento menor a 20 m2., y el sector sur una
habitación denominada “Dormitorio 3” de
aproximadamente 21.50 m2.; todos las habitaciones como calaminas, maderas y otros en el domicilio y
mencionadas tienen cubierta de calamina y muros de sobre las cubiertas en las otras habitaciones.
adobe.
En el exterior del domicilio, un cerco de obra de
Así también, en la inspección se observa la presencia puntales de madera y malla de alambre, además de
de la masa del terreno deslizado, volúmenes del obras civiles por varios obreros realizando trabajos
muro de contención colapsado, algunos escombros de excavaciones, apuntalamientos de madera,
demoliciones de muros para la estabilización y

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No1 (2013) 85

reconstrucción de la plataforma de la calle Tcnl.


Delgadillo.

Figura 7. Bosquejo realizado por el denunciante.

Elaboración de la planimetría del estado anterior al hecho


suscitado del inmueble.

La elaboración del croquis del Escenario del Hecho


mediante dibujo a mano alzada nos permitirá
representar la escena donde se produjo la muerte de
tres personas, en cuyo trabajo se realizó toda la
planimetría de campo que permitirán tener la escena
escala e infografía forense. Asimismo se practicó la
fijación planimétrica conforme a las referencias
obtenidas del investigador asignado al caso y del
denunciante, los mismo que se plasmó con las
mediciones reales en un bosquejo con referencias y
orientado con leyendas explicativas necesarias en la
planimetría de campo; como un suplemento de otros
métodos de registro proveyendo información precisa
de la distancia de las longitudes, ángulos, superficies
y volúmenes en el lugar del hecho, además teniendo
presente la posición de las víctimas en el
levantamiento legal del cadáver el 15 de febrero de
2012 y la revisión de las fotografías presentes en el
cuaderno de investigaciones.

Figura 8. Medición de la distancia diagonal y la


pendiente del terreno.

Confección de la pendiente del terreno y el plano de la


sección.

En la inspección del lugar del hecho, el denunciante


(familiar de las victimas del hecho), realizó un
bosquejo dando referencia de la ubicación de los
ambientes sepultados y del ingreso de la puerta
principal y el acceso mediante unas gradas, y la
posición probable donde estaban las víctimas y la
ubicación de los muebles en el interior de la
habitación del lugar del hecho.

Tomando en cuenta los datos obtenidos durante la


inspección se determinó la altura obtenida desde la
calzada, el ángulo respecto al derrumbe y
deslizamiento del terreno y de un volumen del muro

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
86 IITCUP CIENCIA VOL1 No1 (2013)

Figura 9. Confección de la pendiente del


terreno.

de contención hacia el inmueble, además del lugar entre el muro de la casa y el dormitorio DH, el ángulo
específico donde se verifico el hecho (dormitorio), de inclinación(αI) es equivalente a 44º,de PP a DLH
asimismo; tomando en cuenta la distancia es la hipotenusa, de PP a B es el cateto opuesto, de B
longitudinal diagonal que hay entre los muros de a DLH es el cateo adyacente. Por medio de la Ley de
contención, la pared del inmueble a la altura del piso
de la habitación y los restos del mismo, tenemos: Senos de Triángulos rectángulos determinaremos la
altura y el nivel de piso del dormitorio al callejón y la
La distancia diagonal desde la base del dormitorio distancia del dormitorio hacia el muro del domicilio
afectado del inmueble hacia la línea del límite en el horizonte.
municipal es de 10.35 m.; el ángulo de inclinación de
dicha distancia con respecto al horizonte del DATOS.
inmueble es de 44°.
DLH = DORMITORIO
La confección del triángulo rectángulo, para el PP = PUERTA PRINCIPAL
cálculo de la altura y la distancia entre el dormitorio B = BASE DEL INMUEBLE
y el callejón de entrada, desde el dormitorio (DLH) a α = ÁNGULO DE INCLINACION
la puerta principal (PP) es DO equivalente a D1, D2 Y D3 = DISTANCIAS
10.32mts., de la puerta principal (PP) al horizonte del
inmueble(B) con 90º es la altura DV, del horizonte del Sen αI = Cat. Op. => Cat. Op. = Sen αI x Hip.
inmueble (B) a el dormitorio (DLH) es la distancia
UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No1 (2013) 87

D2 = 0.69 X 10.35 = 7.20 m => D2 = 7.20 m =>


ALTURA

a²+b²=c² => b²=a²c² => b²= 51.84 X 107.122 =>


b=√55.2825

b= 7.45 => D3 = 7.45mts.

DE DONDE PODEMOS DEMOSTRAR LA


DISTANCIA DEL DORMITORIO DEL LUGAR DEL
HECHO HACIA EL MURO DE LA VIVIENDA Y LA
ALTURA DESDE EL BORDE INTERIOR DEL
DORMITORIO DEL LUGAR DEL HECHO HACIA
LA BASE DE LA PUERTA PRINCIPAL (Figuras 9 y
10).

El volumen aproximado de terreno deslizado es de


43.21 m3.

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
88 IITCUP CIENCIA VOL1 No1 (2013)

Figura 9. Infografía del estado inicial del lugar del hecho (volumen deslizado en magenta).

Figura 10. Infografía del estado final del lugar del hecho (volumen deslizado en magenta).

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No1 (2013) 89

ESTUDIO DE CASO

ACCIDENTES DE TRÁNSITO: CASO “BOCA DE SAPO”


Cap. Ramón F. Salazar E. & Cap. Huáscar Coca 1

1 Centro de Investigación y Capacitación en Seguridad Vial, IITCUP. La Paz, Bolivia.

INTRODUCIÓN. policial; se debe considerar, que a veces no se dispone


de testigos o participantes porque estos resultaron
El Accidente de Tránsito es todo: “SUCESO
muertos o fueron trasladados a centros hospitalarios
EVENTUAL PRODUCIDO COMO
y no están en condiciones de entrevistarlos o el
CONSECUENCIA O CON OCASIÓN DEL
escenario ha sido alterado al retirarse uno o más
TRÁNSITO, EN EL QUE INTERVIENEN AL
vehículos involucrados o algún tipo de evidencia
MENOS UN VEHÍCULO GOBERNADO O NO, Y
material ha sido destruido.
COMO RESULTADO DEL MISMO SE PRODUCEN
MUERTES, LESIONES EN LAS PERSONAS Y/O Cuando el servidor policial, reunió todas las causas
DAÑOS EN LAS COSAS” posibles de un accidente y llega a la conclusión de
que esto no se habría producido de no haber existido
Entonces, para que exista un accidente en el tránsito,
alguna de ellas, es probable que el investigador haya
necesariamente tiene que darse:
identificado la combinación de factores que causaron
- Un suceso eventual. el accidente.
- Debe intervenir una unidad de transito
Cuando dos o más unidades de transito intervienen
dinámica.
en un accidente, los hechos concerniente a cada uno
- El evento debe ser producido como
de ellos se estudian por separado ya que cada uno de
consecuencia o con ocasión del movimiento.
ellos presenta e identifica su propia “evolución” que
- Como resultado debe haber muerte o lesiones
contribuyo y genero a crear la situación en el cómo
en las personas y/o daño en las cosas.
ocurrió el accidente.
Desde un punto de vista simple y limitado se puede
Se debe considerar, que todo esto inicia con una
indicar que dentro del sistema vial, toda falla en él, se
conducta inicial del elemento humano (conductor,
denomina accidente, en el que necesariamente deben
pasajero, peatón) donde se identifica el movimiento,
interactuar:
posición o todo lo que crea una situación susceptible
- Humano (conductor, pasajero, peatón) de causar un accidente y que se caracteriza por un
- Circundantes o entorno (Vehículo y vía) comportamiento anormal, ilegal, indebido o
Por lo que, el accidente sobreviene cuando las peligroso. La peligrosidad de este tipo de actos, es de
demandas del entorno presentan ante el conductor importancia primordial, por ejemplo, un conductor
una situación que excede su capacidad de reacción. realiza un giro sin señal previa o en sitio autorizado
o cuando está en carril indebido; o cuando un
Según Baker J. Stannard un accidente se define como
vehículo supera la velocidad critica en una curva,
un suceso, acontecimiento u ocurrencia inesperada o
puede saltar fuera del camino o provocar un vuelco
impremeditada, que tiene un elemento de azar o
de tonel; un vehículo que se aproxima a un tramo de
probabilidad y cuyos resultados son indeseables o
carretera en construcción por la superficie irregular y
infortunados. Por lo general, todo evento que vaya a
áspera puede provocar una pérdida de control; en
ocurrir en nuestras vías, merece una investigación, en
resumen, cualquier velocidad que sea demasiada alta
el cual se puede desnudar cual es la verdadera
para las condiciones relacionadas con las
anatomía de ese accidente, pese que haya pasado
características físicas del camino, no dan tiempo
hace mucho tiempo, todo esto en función a las
investigaciones que vaya a realizar el servidor
UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
90 IITCUP CIENCIA VOL1 No1 (2013)

suficiente para tomar decisiones respecto a una Sufrir un accidente grave provoca un fuerte trastorno
acción evasiva, por lo cual resulta peligrosa. emocional; los individuos involucrados se
comportan de un modo extraño, sombrío; porque
Las acciones de un conductor que conduce a un
repentinamente su convencimiento de que saben
accidente, en situaciones optimas es observada por
manejar y que a otros les ocurran accidentes pero a
testigos o participantes; o caso contrario se pueden
ellos no, se ha visto destruido. No saben que decir,
reconstruir partiendo de evidencias materiales
pero dirán la verdad desnuda y si se les interroga
descubiertas en el lugar de los hechos, lógicamente,
adecuadamente. Tal vez declaraciones, pueden
considerando que este es un proceso físico
señalar directamente el porqué de los accidentes.
matemático, que pese al paso de los años,
inclemencias del tiempo, existe un gran porcentaje En función a ello se les presenta un caso denominado
para que se lo recree no exactamente igual sino con Boca de Sapo:
cierto grado de confiabilidad y certeza. Por lo
En fecha 31 de diciembre del 2011 un grupo de
general, el descuido del conductor es el término que
amigos (Marcelo Rollano Soraide, Luisa Rojas
define la causa del accidente que se origina en la
Morales, Danilo Choquevillca Conde, Álvaro Molina
conducta de este y está relacionada con el
Cardozo y Víctor Quispe Alanoca) circulaban por la
acercamiento al lugar de los hechos, la percepción del
carreta La Paz Yungas en la vagoneta Nissan Murano
peligro, las decisiones y la acción del conductor
con placa de control 2250 HAD, de debe considerar
instantes que precedieron al evento en sí.
que de acuerdo a las investigaciones y pesquisas
Finalmente para investigar plenamente el descuido realizadas se llegó a establecer que el conductor era
del conductor como circunstancia coadyuvante en un M. Rollano S. y que los mismos se encontraban en
accidente, es necesario socavar primeramente la estado de ebriedad ya que noche antes se habrían
confianza que tiene en si todo conductor. La mayoría reunido junto a otras personas y hubieron consumido
de los conductores no se reconocen culpables, ya que bebidas alcohólicas en locales públicos de la ciudad
que generalmente indican “soy conductor viejo y en de La Paz.
20 años no tuve accidentes”. “si, manejo a gran
velocidad, pero no tengo accidentes”. “yo, hago el
tramo La Paz - Oruro en 2 horas y 30 minutos…”
Cuando se investiga un accidente, el investigador
debe tener en cuenta que este convencimiento
profundo les impide a los conductores involucrados
hacer el relato honrado del accidente. La mayoría de
los individuos se resisten a reconocer que ellos han
sido los causantes del accidente, pero cuando
finalmente se convence a uno de ellos, el investigador
disfruta de una excelente oportunidad de
comprender más a fondo el comportamiento humano
y apreciar su importancia como causa de accidente.
Entonces los conductores “se resignan, abriendo su
corazón y contestan sus preguntas” pero, demás
Después de casi 8 días de búsqueda e intensos
encontramos un grupo de conductores en los que se
trabajos de rastrillaje efectuados por la Policía,
identifica ciertos comportamientos que merecen una
movilizando alrededor de un centenar de efectivos
adecuada valoración clínica psicológica: “no me
de diferentes áreas como la policía caminera,
importaba matarme, estoy harto de mi vida, no
bomberos, tránsito, inteligencia entre otros, es que se
encuentro sentido a mi vida”. Otro dijo “si, he estado
los llega a encontrar a los fallecidos en fecha 8 de
bebiendo y mucho; bebo todo el tiempo. Beber y
enero del 2012.
manejar rápido, eso hago yo, y me siento feliz y
completo cuando corro.”

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No1 (2013) 91

Los cuerpos fueron encontrados a D. Choquevillaca a • Se establece la velocidad del vehículo


120 mts., L. Rojas a 130 mts., V. Quispe 150 mts, A. protagonista en 40 Km/h al momento que
Molina a 155 mts. y M. Rollano 160 mts. de abandona la plataforma embarrancándose y
de 121 Km/h con que llega a impactar en el
primer punto.

profundidad, mientras que el vehículo fue a


descansar al fondo del precipicio de 300 metros,
completamente destruido.
En cumplimiento al rol constitucional de la Policía
Boliviana a través de sus organismos especializados
y bajo requerimiento fiscal se dispone que se realice
la correspondiente pericia accidentológica del
presente accidente de tránsito donde se establece, la
evolución del accidente a través de sus diferentes
fases (percepción, decisión y conflictos) y puntos,
para así determinar la velocidad del vehículo y
realizar la planimetría e infografía forense.
Por lo anteriormente expuesto y en atención los
puntos de pericia establecidos por el Representante
del Ministerio Publico, se llegó a las siguientes
conclusiones:
Figura 1: Trayectoria de la Vagoneta Nissan Murano con
• De acuerdo a la evolución del accidente, la
placa de control 2250 HAD antes de abandonar la
causa más probable es que el conductor
plataforma vial.
hubiera quedado Inerte por la condición
Psicosomática en el que se encontraba de • Teniendo en cuenta que los resultados tienen
acuerdo a antecedentes, pericias que se precisión y no exactitud debido a un hecho
realizaron en otras áreas. De acuerdo al que sucede no se repite dos veces, los datos
análisis accidentológico, abandona la calzada son aproximados con un porcentaje de
de la Vía, para posteriormente variación de 10 % de acuerdo a fundamentos
embarrancarse. En su trayectoria solo se físicos.
encuentra la Huella de Sueño (Huella de En lo que refiere al cálculo de la velocidad del
Trayectoria de acuerdo al terreno), y no existe vehículo Vagoneta Nissan Murano con placa de
ningún tipo de elemento o indicio que el control 2250 HAD, se lo establece a través de
conductor hubiera realizado alguna cálculos físicos matemáticos de acuerdo a la Figura
maniobra de evasión simple o compleja para 5.
volver a la calzada, y maniobrar para lograr la
estabilidad del vehículo o para detener la
marcha.
UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
92 IITCUP CIENCIA VOL1 No1 (2013)

Figura 2: Esquema aéreo de la trayectoria de la Vagoneta Murano al abandonar la plataforma vial.

Figura 3: Esquema lateral de la trayectoria de la Vagoneta Murano al abandonar la plataforma vial.

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No1 (2013) 93

Figura 4: Esquema aéreo de la trayectoria de la Vagoneta Murano y posición de los cuerpos.

Figura 5: Cálculos para la velocidad de impacto.

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
94 IITCUP CIENCIA VOL1 No1 (2013)

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No1 (2013) 95

INSTRUCCIONES PARA LOS AUTORES

IITCUP
Desarrollar herramientas para generar políticas y estrategias
institucionales que permitan mejorar la seguridad ciudadana y
prever o apoyar la lucha contra el crimen, el narcotráfico y el

CIENCIA
contrabando, requiere con urgencia de investigación científica
básica, pura y/o aplicada de nuestra realidad, para construir con
solidez la base que permita la toma de decisiones y la creación
PUBLICACIÓN CIENTÍFICA u optimización de tecnología diseñada específicamente para
DE LA POLICÍA BOLIVIANA alcanzar estos objetivos, que son de eminente interés nacional.

La responsabilidad de la Institución Policial abarca y requiere de la participación de todas las áreas del
conocimiento humano, pues los retos y desafíos que enfrenta surgen de un amplio y denso espectro de presión
social, cultural, ética y humana que se alimenta de las aspiraciones, la historia y el tiempo vividos, inexorables
e impertérritos en su avance y evolución. He aquí la razón de condensar en un solo título el abanico de temas,
líneas de investigación y ramas del conocimiento al que puede y debe llegar la sociedad para superarse a sí
misma.

IITCUP CIENCIA está dedicada a la publicación y divulgación de trabajos de investigación científica y


tecnológica principalmente proyectados, desarrollados o realizados en el territorio boliviano, con énfasis en
aquellos trabajos cuyo objetivo sea proporcionar conocimiento para el desarrollo de tecnología propia
adaptada a la realidad nacional, que persigan mejorar la calidad de vida de nuestra sociedad, que conciban
proyectar un futuro visionario y ambicioso de desarrollo técnico científico boliviano y provean soluciones a
los problemas y desafíos que enfrenta la institución policial y la sociedad en su conjunto.

Áreas temáticas sugeridas:

- ARQUITECTURA - ECOLOGÍA Y MEDIO AMBIENTE


- ARTES - ELECTRÓNICA
- BALÍSTICA - ENTOMOLOGÍA
- BIOLOGÍA - GENÉTICA
- BIOQUÍMICA - HUELLOGRAFÍA
- BOTÁNICA - MECÁNICA
- CIENCIAS DE LA SALUD - MEDICINA FORENSE
- CIENCIAS POLICIALES - QUÍMICA
- DERECHO - TOXICOLOGÍA
- DOCUMENTOLOGÍA - OTRAS CIENCIAS Y DISCIPLINAS CTF.

IITCUP CIENCIA recibe y publica artículos de divulgación o investigación científica y tecnológica, revisiones
(monografías), estudios de caso, sinopsis de tesis y notas técnicas. El formato y contenido de los textos se
describe a continuación según tipo:

A) ARTÍCULOS DE DIVULGACIÓN O INVESTIGACIÓN CIENTÍFICA Y TECNOLÓGICA: Dos copias


en papel bond tamaño carta (21,59 x 27,94 cm) de una plana, tipo de letra “Arial 12”, márgenes de 1
cm y contenido estándar siguiente: TÍTULO, AUTORES, RESUMEN (español), ABSTRACT (inglés),
JUCH’URIMANCHANA (aymara), PALABRAS CLAVE, INTRODUCCIÓN, MATERIALES Y

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
96 IITCUP CIENCIA VOL1 No1 (2013)

MÉTODOS, RESULTADOS, DISCUSIÓN, CONCLUSIONES, AGRADECIMIENTOS Y


BIBLIOGRAFÍA.

B) REVISIONES O MONOGRAFÍAS: Dos copias en papel bond tamaño carta (21,59 x 27,94 cm) de una
plana, tipo de letra “Arial 12”, márgenes de 1 cm y el contenido a discreción del autor, aunque se
sugiere el siguiente: TÍTULO, AUTORES, RESUMEN (español), ABSTRACT (inglés),
JUCH’URIMANCHANA (aymara), INTRODUCCIÓN, DESARROLLO (a discreción),
CONCLUSIONES, RECOMENDACIONES, AGRADECIMIENTOS Y BIBLIOGRAFÍA.

C) ESTUDIO DE CASO: Dos copias en papel bond tamaño carta (21,59 x 27,94 cm) de una plana, tipo de
letra “Arial 12”, márgenes de 1 cm y el contenido a discreción del autor, aunque se sugiere el siguiente:
TÍTULO, AUTORES, RESUMEN (español), ABSTRACT (inglés), JUCH’URIMANCHANA (aymara),
INTRODUCCIÓN, DESARROLLO (a discreción), CONCLUSIONES, RECOMENDACIONES,
AGRADECIMIENTOS Y BIBLIOGRAFÍA.

D) SINOPSIS DE TESIS: Dos copias en papel bond tamaño carta (21,59 x 27,94 cm) de una plana, tipo de
letra “Arial 12”, márgenes de 1 cm y el contenido a discreción del autor, aunque se sugiere el siguiente:
TÍTULO, AUTOR, RESUMEN (español), ABSTRACT (inglés), JUCH’URIMANCHANA (aymara),
DESARROLLO (a discreción), CONCLUSIONES, RECOMENDACIONES, AGRADECIMIENTOS Y
BIBLIOGRAFÍA.

E) NOTAS TÉCNICAS: Dos copias en papel bond tamaño carta (21,59 x 27,94 cm) de una plana, tipo de
letra “Arial 12”, márgenes de 1 cm y contenido estándar siguiente: TÍTULO, AUTORES, RESUMEN
(español), ABSTRACT (inglés), JUCH’URIMANCHANA (aymara), PALABRAS CLAVE,
INTRODUCCIÓN, MATERIALES Y MÉTODOS, RESULTADOS, AGRADECIMIENTOS Y
BIBLIOGRAFÍA.

Las figuras, gráficas, esquemas, citas y bibliografía serán presentadas en el formato de la American
Psychological Association (APA), insertos dentro del documento principal.

Para aplicar tres impresos originales deberán ser enviados por correo en sobre manila a la siguiente
dirección:

IITCUP – UNIPOL
Av. Hugo Ernst 7404
Bajo Seguencoma
La Paz - Bolivia
Tel: 2-2786977

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No1 (2013) 97

BIOLOGÍA MOLECULAR

Termociclador Mastercycler
Nexus Gradient

Tapa Flexlid
Thermomixer Comfort
Programación Grafica intuitiva
Agitador de tubos con Gradente
temperaturas
en 12 columnas
controladas , -13ºC a 99ºC

Micro – Macro Centrifugas


Centrifugas
Rotores Micro – Macro
de Aluminio.
Diseñados para la emisión baja de sonido.
Con o sin refrigeración.

Micropipetas Research
Volumen variable fijas y multicanal

La Paz—Bolivia Zona Cota Cota Av. J. Muñoz Reyes Esq. Calle 27 Edif. LE 27;
Nº377 ; Of. 7
Telf.2793210 / 2777226 fax (591-2) 2793038 /2772411
www.oberonsrl.com

oberonsrl
UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
98 IITCUP CIENCIA VOL1 No1 (2013)

INVESTIGACIÓN FORENSE

Equipo Buscador de trayectoria


con laser Herramienta versátil que le
permite al investigador visualizar la
trayectoria de una bala .

Polvo Vulcanizado Hi-Fi para Impresiones


Latentes

Kit de Recolección de evidencia de


ADN/Biologico

Kit para el levantamiento de muestras


como sangre, semen, cabello, saliva,
piel, sudor, orina, uñas, etc.

EQUIPO DE REVISIÓN DE DISPOSITIVOS DIGITALES

EQUIPO DE DISPOSITIVOS MÓVILES DIGITALES

CAPTURA DE TARJETAS SIM

EQUIPO DE ANÁLISIS DE COMPUTADORAS PARA


EXÁMENES FORENSES DE DISPOSITIVOS DIGITALES

La Paz—Bolivia Zona Cota Cota Av. J. Muñoz Reyes Esq. Calle 27 Edif. LE 27;
Nº377 ; Of. 7
Telf.2793210 / 2777226 fax (591-2) 2793038 /2772411
www.oberonsrl.com
Oberon srl
UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No1 (2013) 99

INVESTIGACIÓN FORENSE

Comparador óptico de huellas


digitales

Programa de Composición Facial

COMPHOTOFIT

Software capaz de crear miles


de rostros únicos , distorsión
creativa, cambio de color ,
progresión de edad , etc.

La Paz—Bolivia Zona Cota Cota Av. J. Muñoz Reyes Esq. Calle 27 Edif. LE 27;
Nº377 ; Of. 7
Telf.2793210 / 2777226 fax (591-2) 2793038 /2772411
www.oberonsrl.com Oberon srl

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
100 IITCUP CIENCIA VOL1 No1 (2013)

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS
IITCUP CIENCIA VOL1 No1 (2013) 101

CONTENIDO
AGRADECIMIENTO.............................................................................................................................................. 5
PRESENTACIÓN DEL COMANDO GENERAL ......................................................................................................... 7
PRESENTACIÓN DEL VICEMINISTRO DE SEGURIDAD CIUDADANA..................................................................... 9
PRÓLOGO DEL RECTOR DE LA UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” .......................... 11
PRESENTACIÓN DEL IITCUP .............................................................................................................................. 13
EDITORIAL ......................................................................................................................................................... 15
SIMBOLOGÍA DEL EMBLEMA DEL INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS DE LA
UNIVERSIDAD POLICIAL .................................................................................................................................... 17
ARTÍCULOS ORIGINALES
CARACTERIZACIÓN DEL MINI-YSTR DYS-481 EN TRES SUBPOBLACIONES DE BOLIVIA .................................... 19
HAPLOTIPOS DE ADN MITOCONDRIAL REVELAN POSIBLE RUTA MIGRATORIA ANCESTRAL DE LOS PUEBLOS
URU Y AYOREO DE BOLIVIA .............................................................................................................................. 27
HAPLOTIPOS DE ND4 EN Aedes aegypti (VECTOR DEL DENGUE) DE SAN BORJA Y CARANAVI (BOLIVIA) ....... 43
CARACTERIZACIÓN DE MICROSATÉLITES PARA PRUEBAS DE PARENTESCO EN CAMÉLIDOS DEL ALTIPLANO
BOLIVIANO........................................................................................................................................................ 49
NOTAS TÉCNICAS
PRIMER ESTUDIO TAXONÓMICO MOLECULAR DEL ORDEN TRICHOPTERA EN LA REGIÓN ALTOANDINA DE
BOLIVIA ............................................................................................................................................................. 57
TIPIFICACIÓN MOLECULAR DE MIRU-VNTR’S PARA ESTUDIOS EPIDEMIOLÓGICOS DE TUBERCULOSIS EN
BOLIVIA ............................................................................................................................................................. 63
DETECCIÓN DEL GEN “INTERFERÓN-GAMMA” POR PCR DE RETRO-TRANSCRIPCIÓN EN CÉLULAS
MURINAS .......................................................................................................................................................... 67
REVISIÓN CORTA
ESTRUCTURA Y CARACTERÍSTICAS GENERALES DE LOS INDICIOS PILOSOS ..................................................... 71
ENFERMEDADES INFECCIOSAS EMERGENTES (EIE´S) Y SU RELACIÓN CON EL TRÁFICO DE FAUNA
SILVESTRE ......................................................................................................................................................... 75
ESTUDIOS DE CASO
PLANIMETRIA OPERATIVA DE CAMPO Y DE GABINETE EN UN CASO DE DESLIZAMIENTO DE TERRENO ........ 79
ACCIDENTES DE TRÁNSITO: CASO “BOCA DE SAPO” ........................................................................................ 89
INSTRUCCIONES PARA LOS AUTORES............................................................................................................... 95

POLICÍA BOLIVIANA
UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSE´DE SUCRE”
INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS

Bajo Seguencoma, Av. Hugo Ernst 7404 ANAPOL


La Paz – Bolivia
2014

UNIVERSIDAD POLICIAL “MCAL. ANTONIO JOSÉ DE SUCRE” – INSTITUTO DE INVESTIGACIONES TÉCNICO CIENTÍFICAS