* vcampos@udec.cl
OPEN ACCESS
Competing interests: The authors have declared (54%), whereas arsC genes were present in almost all isolates from all three sediments,
that no competing interests exist. suggesting that bacterial communities play an important role in the arsenic biogeochemical
cycle and detoxification of arsenical compounds. Overall, results provide further knowledge
on the microbial diversity of arsenic contaminated fresh-water sediments.
Introduction
Arsenic (As) is one of the most prevalent toxic metalloids on Earth, occurring primarily as the
inorganic species oxyanion arsenate (H3AsO4) [As(V)] and arsenite (H3AsO3) [As(III)]. Arse-
nates are the predominant species in soil and oxygenated surface water, whereas arsenite pre-
dominates under anoxic or reduced conditions [1] and it is 100 times more toxic and 4 to 10
times more soluble than As(V) [2, 3]. Arsenic present in the environment originates from both
natural and anthropogenic sources. There is also a growing concern of As contamination from
agricultural and other anthropogenic sources, such as copper and sodium-based arsenicals
from herbicides and pesticides [4].
Microorganisms in As-rich environments have evolved mechanisms to utilize arsenic for
metabolic processes or to detoxify the cell. Therefore, they influence the biochemical cycle of
As, bio-transforming As-species varying in solubility, mobility, bioavailability and toxicity [5–
7]. While many heavy metals are essential elements at low concentrations, they can exert toxic
effects at high concentrations, such as those present in polluted environments. In response to
toxic concentrations of heavy metals, many aquatic organisms, including microorganisms, can
develop tolerance. Some bacteria, representing different phylogenetic groups involved in As-
transformation use processes such as reduction, oxidation and methylation mechanism to tol-
erate arsenic [8–11]. In general, two metabolic pathways are known for arsenate reduction,
one serving for detoxification purposes while the other, respiratory pathway can be used for
energy production. The detoxification pathway has been well studied and characterized. In
brief, the ars system confers resistance to arsenic in prokaryotes, it is composed of up to 5
genes, arsRDABC, but at least three are required: arsR, encoding a transcriptional repressor,
arsB, a transmembrane efflux pump, and arsC, an arsenate reductase. When present, the pro-
teins encoded by arsA and arsD help the efflux pump encoded by arsB [12–15]. In the respira-
tory pathway, sometimes called dissimilatory arsenate respiration, a respiratory arsenate
reductase consisting of two subunits (ArrA and ArrB) is responsible for the reduction of arse-
nate. The reductase is encoded by the arr operon, which always includes the arrA and arrB
genes, with some strains containing an additional membrane subunit ArrC [13].
On the other hand, microbial arsenite oxidation is a well-known process and many micro-
organisms are able to do it by means of an arsenite oxidase protein, encoded by the aio system
[16–21]. aio genes have been identified in bacteria isolated from various arsenic-rich environ-
ments [22]. Arsenite-oxidizing bacteria include chemolithoautotrophic and heterotrophic
microorganisms, such as Acidiphilium acidophilum, Acidithiobacillus ferrooxidans, Cenibacter-
ium arsenoxidans, Alcaligenes faecalis, Cupriavidus necator, Hydrogenophaga sp., Sinorhizo-
bium sp., Stenotrophomonas sp. MM-7, Ancylobacter dichloromethanicus As3-1b [23–27] and
some Pseudomonas spp. [28–30], as well as the thermophiles Thermus aquaticus, Thermus ther-
mophilus, Anoxybacillus flavithermus TCC9-4 [31–33]. In addition, a novel arsenite oxidase
gene, arxA, was identified in the genome of the Mono Lake (California, USA) isolate Alkalilim-
nicola ehrlichii MLHE-1, a chemolithoautotroph that couples arsenite oxidation to nitrate
reduction [18].
Fig 1. Map of the Chilean Arica y Parinacota region and location of M1, M2 and M3 sampling sites along the Camarones River.
https://doi.org/10.1371/journal.pone.0195080.g001
Carbon and nitrogen analyses were performed in duplicates and the results expressed as % in
the sample.
Heavy metals concentration. Concentrations of copper (Cu), zinc (Zn), lead (Pb) and
cadmium (Cd) were quantified using atomic absorption spectrophotometry, after microwave
digestion of samples. Briefly, 0.5 g of sieved and dried sediment was added into 9 ml concen-
trated nitric acid plus 3 ml concentrated hydrochloric acid at 175˚C for 10 min (US EPA
2007). After cooling down, the extracts were centrifuged at 3000 rpm for 5 min. Supernatant
was analysed using an AA800 atomic absorption spectrophotometer (PerkinElmer).
Total As was determined in each sample using high performance liquid chromatography
(HPLC). HPLC was coupled to a system of gaseous arsine formation and the As detection was
achieved by atomic absorption in a quartz bucket (HPLC/HG/QAAS) [41].
according to the manufacturer’s direction. The extracts were subsequently purified. Quality
and concentration of DNA were checked by UV/Vis spectroscopy (NanoDrop ND-1000, Peq-
lab, Erlangen, Germany). DNA was used as template for the high-throughput sequencing.
16S rRNA gene massive sequencing (Illumina MiSeq). The V1-V2 region of the 16S
rRNA genes was amplified using the modified universal primers 27f (5'-AGAGTTTGATC
CTGGCTCAG-3 ') and 338r (5'-GCTGCCTCCCGTAGGAGT-3'), at the “The Gree-
hey Children’s Cancer Research Institute” (Greehey CCRI). The Illumina MiSeq Platform was
used to generate V1-V2 amplicon reads in a paired-end sequencing run with a read length of
300 bp, at the UT Health Science Center in San Antonio (USA). All sequences were submitted
to GenBank with the following numbers MG545618 to MG545646 (SUB3227168).
Analyses of bacterial communities. The raw data were analysed using the bioinformatics
analysis software Mothur (version 1.35.1) with the default options, unless otherwise stated.
Reads shorter than 200 bp were discarded. Reads were denoised using the “pre.cluster” com-
mand in Mothur platform to remove sequences that were likely due to errors and assemble
reads which differed only by 2bp [42]. Chimeric sequences were identified and removed using
UCHIME algorithm, and the remaining sequences classified against the SILVA database [43].
Alpha diversity measures (richness for observed species and Shannon diversity) were calcu-
lated on the OTU table obtained from all high-quality sequences. OTUs defined at 97% simi-
larity level were selected and their relative abundance was normalized using the subsampling-
based method described in Mothur (http://www.mothur.org/wiki/Normalize.shared) prior to
comparative analyses. To compare the bacterial community compositions across groups of
samples, Bray–Curtis similarity analyses were performed and similarity matrices were used to
obtain CLUSTER graph, by using PRIMER 6.1.18 (Primer-E, Ltd).
As-resistant strains
Bacterial isolation and tolerance levels to arsenic. For the isolation of As-tolerant
bacteria, homogenized sediment (1 g) was added to a sterile solution of 10 mL 0.85% NaCl and
agitated at 100 rpm for 5 min. Serial dilutions (0.1 mL aliquots) were cultured on R2A supple-
mented with 0.5 mM As(III) (as sodium arsenite) or 0.5 mM As(V) (as sodium arsenate) and
incubated during 48 h at 25˚C [44]. Colonies were randomly isolated from As-amended R2A
and then screened for As-tolerance, as follows. As-tolerance of each isolate was determined
using the agar dilution technique on plates of Luria Bertani (LB) agar containing from 0.5 to
100 mM sodium arsenite or sodium arsenate. Plates were inoculated with approximately
3×107 CFU mL-1 cells obtained from each As tolerant strain and cultured at 25˚C for 24 h.
Agar plates containing bacteria but no metalloid were used as controls [45]. According to Rok-
bani et al. [46], isolates able to grow in the presence of at least 7 mM As (III) (arsenite) or 20
mM As (V) (arsenate) were considered as resistant.
As oxidation and reduction rate. The strains were grown in chemically defined medium
(CDM) [44] supplemented with 0.5 mM arsenite or arsenate. Cultures were incubated at 30˚C
for 48 h and samples taken every 12 h to monitor As-conversion and bacterial growth (mea-
sured by absorbance at 600 nm). Oxidation of As(III) to As(V) and reduction of As(V) to As
(III) were determined from supernatants of cultures filtered using sterile 0.22 μm filters (Milli-
pore). As(III) and As(V) were measured by HPLC/HG/QAAS [41]. Samples (500 μL) were
introduced to the HG system by means of an automatic injection valve. Samples were trans-
ported to the T-joint manifold using 10% hydrochloric acid as carrier and there continuously
mixed with a solution of sodium borohydride to obtain AsH3. Gaseous arsine was separated
from the liquid waste in a gas–liquid separator and carried, by a continuous flow of argon,
to the atomizer. Atomic absorption signals were processed using commercial AA Winlab
software (PerkinElmer). Quantification limit was 0.5 μg L−1 with a linear response up to 20 μg
L−1 [28, 47].
Identification of As-resistant strains. Genomic DNA from isolates was obtained using
UltraClean Microbial DNA Isolation Kit, following the manufacturer’s instructions (Mobio
Laboratories, Inc.). The 16S rRNA genes were amplified by PCR using universal bacterial
primers GM3 and GM4 (AGAG TTTG ATCM TGGC and TACC TTGT TACG ACTT,
respectively) according to Brito-Echeverrı́a et al. [48]. Amplified fragments were sequenced
using the Dyenamic ET terminator kit (General Electric), in a 3100 Avant genetic Analyser
(Applied Biosystem), following the manufacturer’s instructions. A nucleotide BLAST search
(http://www.ncbi.nlm.nih.gov/BLAST) was performed to obtain sequences with the greatest
significant alignment.
Detection of detoxifying arsenate reductase arsC gene. To detect the arsC gene, isolates
were cultured for 12 to 18 h at 25˚C in LB supplemented with 0.5 mM NaH2AsO5 until reach-
ing 108 CFU mL-1. The genomic DNA of each isolate was extracted using the UltraClean
Microbial DNA Isolation Kit (Mobio Laboratories, Inc.) to serve as template for PCR amplifi-
cation. Primers used for the PCR technique were arsC-1-F (5' GTAATACGCTGGAGAT
GATCCG 3’) and arsC-1-R (5’ TTTTCCTGCTTCATCAACGAC 3'), which corre-
spond to the ars operon of Escherichia coli [49]; and arsC-1-F (5' AGTCCTGTTCATGT
GYAC 3’) and arsC-1-R (5' TGGCGTSGAAYGCCG 3') described for the ars operon
of Pseudomonas aeruginosa and Pseudomonas putida [10, 49]. PCR products were separated by
electrophoresis in a 1.2% agarose gel and visualized in an UV transilluminator after staining
with ethidium bromide [23].
Detection of arsenite oxidation aio gene. Strains were cultured in LB supplemented with
0.5 mM NaH2AsO3, and DNA was extracted as described above. PCR was performed using
the primers 69F (TGYA TYGT NGGN TGYG GNTA YMA) and 1374R (TANC CYTC
YTGR TGNC CNCC) according to Valenzuela et al. [37]. E. coli S17-1 was used as positive
control [50], while E. coli K-12 was used as negative control. Separation of amplified products
was achieved by 0.8% agarose gel electrophoresis followed by ethidium bromide (0.5 μg mL-1)
staining and the bands were observed on an UV transilluminator. The QIA quick PCR purifi-
cation kit (Qiagen), following the manufacturer’s instructions, was used to purify the products
obtained by PCR and these PCR products were sequencing by Macrogen (Korea). A homology
search of 16S rRNA gene sequences was performed using the NCBI Basic Local Alignments
Search Tool (BLAST) using the algorithm of the Nucleotide Blast program.
Results
Physical and chemical parameters
The pH, TOM, TOC, TN, As and others heavy metals (Cu, Zn, Pb and Cd) measured at each
sampling site (M1, M2 and M3) along the Camarones river are reported in Table 1. Total
organic matter (TOM), total organic carbon (TOC) and total nitrogen (TN) values were
Table 1. Physical and chemical properties, metal composition and total prokaryotic cells (TC) in M1, M2 and M3 samples collected from Camarones River. TOM:
total organic matter; TOC: total organic carbon; TN: total nitrogen; As: arsenic; Cu; copper; Cd: cadmium; Zn: zinc; Pb: lead.
Physical-chemical properties Metal composition TC
Site pH TOM (%) TOC (%) TN (%) As (mg/kg) Cu (mg/kg) Cd (mg/kg) Zn (mg/kg) Pb (mg/kg) (cells g-1 × 108)
M1 7.18±0.3 2.1 0.6 0.08 498±0.9 56.6±0.4 1.27±0.03 167.9 ± 1.7 47.6±4.2 8.1±1.0
M2 7.44±0.2 2.4 0.7 0.09 245±0.7 37.7±0.5 1.13±0.01 136.5±1.6 45.1±2.7 8.9±2.1
M3 7.49±0.1 3.9 1.3 0.14 128±0.6 45.0±0.4 0.82±0.14 87.6±1.9 32.6±3.2 8.8±1.2
https://doi.org/10.1371/journal.pone.0195080.t001
increased (ANOVA, p<0.001) at site M3 (>2.5%, >0.8% and >0.1%, respectively) and were
significantly higher than those of M1 (p<0.001) and M2 (p<0.001) sites.
The total As concentration in the sediment samples, measured by HPLC/HG/QAAS,
decreased as the Camarones river approached the Pacific Ocean. Total As was 498 mg kg-1 at
the Camarones rhithron zone (M1), it was 245 mg kg-1 at the medial zone (M2), and 128 mg
kg-1 at the mouth of the river (M3) (Table 1). Total As at M1 site was significantly higher than
M2 site (p = 0.0001) and M3 site (p<0.001), whereas M2 and M3 sites not presented signifi-
cantly differences (p = 0.1038) (Table 1).
Bacterial diversity
Retrieved OTUs were classified in a total of 31 different bacterial phyla, of which 26 were com-
mon to all samples. Sediment at the upper river site (M1) was, at phylum level, less rich (27
Table 2. Sequencing information, diversity index (H’), estimator of richness (Chao1 and ACE) obtained by Ilu-
mina sequencing from sediment samples (M1, M2 and M3) collected from Camarones River. OTUs: operation tax-
onomic units.
M1 M2 M3
Number of reads 1,170,450 767,028 1,113,638
Number of high quality reads 1,163,206 763,126 1,106,566
Unique reads 138,797 127,315 157,358
% Unique reads 11.93 16.68 14.22
Shannon (H´) 3.82 6.13 6.10
OTUs at 97% genetic similarity 20,742 22,350 26,512
Chao 1 184,996 146,951 197,054
ACE 183,660 142,632 196,356
https://doi.org/10.1371/journal.pone.0195080.t002
groups) than the other two sites, since four taxa were absent at M1 (Deferribacteres, Elusimicro-
bia, Thermotogae and SR1) (S1 Table).
Overall, sequences of the dominant taxonomic groups (abundances 1%) across all sedi-
ment samples were affiliated with Proteobacteria (range 40.3–47.2% of total bacterial
sequences), Firmicutes (8.4–24.8%), Acidobacteria (10.4–17.1%), Actinobacteria (5.4–8.1%),
Chloroflexi (3.9–7.5%), Planctomycetes (1.2–5.3%), Gemmatimonadetes (1.2–1.5%), and Nitros-
pirae (1.1–1.2%). However, the relative abundance at phylum level varied considerably across
samples, and changes in abundance of phylotypes determined different bacterial assemblages
(Fig 2).
The composition of the bacterial communities of the different sediments varied because
sequences affiliated to Proteobacteria (40.3%), Firmicutes (24.82%) and Acidobacteria (12.02%)
accounted for more than 77% of identified bacterial sequences in M1. On the other hand, Acid-
obacteria (17.12%) were predominant in M2 while Bacteroidetes (2.09%), Chlorobi (3.94%),
Aquificae (1.09%) and Deferribacteres (1.02%) were the dominant groups in M3, representing
only minor components in M1 and M2.
Although Deltaproteobacteria (range 17.6–20.0%) represented the most abundant proteo-
bacterial class, differences in relative abundance were also observed for sequences affiliated to
the other classes: Alphaproteobacteria (12.41%-11.57%) was the second most abundant sub-
class in M1 and M2, while Gammaproteobacteria (13.91%) was the second most abundant sub-
class in M3. Sequences referred to Epsilonproteobacteria and Zetaproteobacteria represented
minor components in all samples.
Relatively high abundant phyla in M1 and M2 included also Thermodesulfobacteria (1.64%
and 1.89, respectively), but it constituted a minor component in M3 (0.18%). Lentisphaerae
was dominant in M2 and M3, but not in M1, and finally Verrucomicrobia (1.32%) was domi-
nant only in M2.
Among phyla whose abundance was 1%, sequences affiliated to BRC1, Armatimonadetes,
Cyanobacteria/Chloroplast, Fusobacteria, Deinococcus-Thermus, Caldiserica, Spirochaetes,
Chlamydiae, OD1, Synergistetes, TM7 and WS3 occurred across all sediments, even if at
different relative abundances. Sequences related to Tenericutes were retrieved in M1 and M3,
whereas those of Eleusina and Thermotogae were recovered in M2 and M3, but not in M1.
Sequences affiliated with SR1 were found only in M3 (S1 Table).
A cluster diagram, representing similarities in the bacterial community composition (at
phyla and proteobacterial classes level) of the studied sediments was done. This diagram
showed that bacterial communities present at M2 and M3 sites grouped together, whereas the
bacterial community at M1 site did not clustered with them (Fig 2).
From all samples, 934 genera were retrieved. The highest number of genera was observed in
M3 (716), when compared to M2 (646) and M1 (436). The dominant bacterial genera (40),
present in 1% of the total bacterial sequences at least in one of the three samples, are shown
in Table 3. Richness at genus level slightly increased from M1 to M3 sites. A total number of
20 dominant genera were retrieved for M1, 19 for M2, and 25 for M3. A minor part of domi-
nant bacterial genera (8/40) was ubiquitous in all samples: Anaeromyxobacter, Desulfobacca,
Hippea (within Deltaproteobacteria), Bacillus (Firmicutes), Gp6 (Acidobacteria), Sphaerobacter
(Chloroflexi), Gemmatimonas (Gemmatimonadetes) and Nitrospira (Nitrospirae). However, dif-
ferent abundant genera were unique for each site.
The most abundant genus in M1 was Bacillus, whereas Paenibacillus, Tumebacillus and Vul-
canibacillus were unique genera within Firmicutes for M1. Moreover, Byssovorax, Desulfovirga
and Sorangium (Deltaproteobacteria), and Gp3 (Acidobacteria) were retrieved as unique domi-
nant genera in M1. Four dominant genera were unique in M2: Beggiatoa
Fig 2. Cluster diagram and relative abundance of sequences (percentage) assigned to bacterial phylogenetic groups and
proteobacterial subclasses from sediment samples (M1, M2 and M3) collected from Camarones River. H’: Shannon diversity
index, E: Evenness index.
https://doi.org/10.1371/journal.pone.0195080.g002
Table 3. Bacterial genera retrieved in sediment samples (M1, M2 and M3) from Camarones River.
Phylum Class Genus M1 M2 M3
Proteobacteria Alpha- Afifella
Bauldia
Dongia
Pelagibius
Gamma- Beggiatoa 8%
Ectothiorhodosinus
Methylohalomonas 5%
Thiococcus
Delta- Anaeromyxobacter 3%
Byssovorax
Desulfarculus 2%
Desulfobacca
Desulfocurvus 1%
Desulfovirga
Geothermobacter <1%
Hippea
Smithella
Sorangium
Syntrophorhabdus
Firmicutes Bacillus
Paenibacillus
Tumebacillus
Vulcanibacillus
Acidobacteria Gp2
Gp3
Gp4
Gp6
Gp10
Gp21
Gp22
Chloroflexi Caldilinea
Sphaerobacter
Actinobacteria Actinotalea
Planctomycetes Phycisphaera
Singulisphaera
Chlorobi Ignavibacterium
Gemmatimonadetes Gemmatimonas
Lentisphaerae Victivallis
Nitrospirae Nitrospira
Thermodesulfobacteria Caldimicrobium
https://doi.org/10.1371/journal.pone.0195080.t003
Finally, dominant genera affiliated with Planctomycetes and Lentisphaerae were retrieved in
M2 and M3.
Arsenic-resistant isolates
Strains isolation and identification. Based on their ability to grow at increasing concen-
trations of arsenic, from 0.5mM to 100mM of As(III) or As(V), a total of 150 bacterial strains
were isolated from M1, M2 and M3 sediments. As-resistant strains were defined as able to
grow on agar containing 7 mM As(III) or 20 mM As(V) [52]. Of the total bacterial strains, 13
As-resistant strains were obtained from M1, 15 from M2, and 23 from M3 (Table 4). Overall,
the 51 strains were capable to grow at concentrations of arsenite greater than 7mM (from 8 to
64 mM). Additionally, all the strains were capable of growth at the maximum concentration of
arsenate tested (100 mM).
Seventeen out of 51 As-resistant strains (33.3%) were able to oxidize As(III), 47 strains
(90.2%) were able to reduce As(V), and 10 strains (19.6%) were able to both oxidize and reduce
arsenic. All the 51 As-resistant strains were able to grow at the highest As(V) tested concentra-
tion (100mM) and 22 strains (43%) were able to grow up to 64 mM As(III).
The percentage of As(III)-oxidation was highest (90–100%) in strains from M1, ranged
from 68 to 84% in strains from M2, and varied from 80% to 93% in strains from M3 (Table 4).
The highest percentage of As(V) reduction was observed in strains from M1 (55–95%), and
the lowest percentage in strains from M3 (10–40%) (Table 4). Pearson’s analysis showed a sig-
nificant positive correlation (r = 1) between total As concentration and the capacity of strains
from each sediment to oxidize or reduce the metalloid.
The levels of 16S rRNA sequence identity (99.1–100%) of As-resistant strains isolated from
Camarones river to the most closely related species are reported in S2 Table. As-resistant
strains were mainly identified as members of Proteobacteria (49 strains), including Alpha-(4
strains), Beta-(8 strains) and Gammaproteobacteria (37 strains), and Firmicutes (2 strains) (S2
Table).
Detection of aio and arsC genes. The presence of genes codifying for the enzymes arse-
nite oxidase (aio) and arsenate reductase (arsC) was investigated in all 51 As-resistant strains,
via PCR. As(III)-oxidizing strains (17/51) presented a PCR product of approximately 1,200
bp, as expected size fragment corresponding to arsenite oxidase genes. The aio gene was more
frequently detected in isolates from site M1 (41.2%) than from those of M2 (23.5%) or M3
(35.3%) (Table 4). In addition, As(V)-reducing strains (50/51) presented different PCR prod-
ucts, in relation to the presence of different arsenate reductases. The arsC gene was detected in
all As-resistant strains, with the only exception of strain VC-17 from M1.
Discussion
The northern Region of Chile, especially the Atacama Desert area, has been described as a nat-
urally arsenic-rich environment. Minerals of metallic sulphides containing arsenic are dis-
solved in the Andes Mountains, affecting superficial and ground waters that cross the Atacama
Desert which are used as drinking water sources. Since 1970, drinking water is treated to
remove arsenic in all the large cities of the Atacama Desert, such as the city of Antofagasta.
However, inhabitants of several small rural villages remain still exposed to arsenic in drinking
water.
The inhabitants of the towns of Camarones and Illapata (Atacama Desert, Chile) use mainly
natural water from the Camarones river for both human consumption and agricultural activi-
ties. Waters of Camarones river contain a total As concentration exceeding 1.0 mg L-1, mainly
Table 4. As-resistant strains isolated from M1, M2 and M3 samples collected from Camarones River.
Strain As3+ ( ) As5+ ( ) arsC (#) aio (€) O/R (&) Strain As3+ ( ) As5+ ( ) arsC (#) aio (€) O/R (&)
Sediment M1 VC-65 >40 >100 + + 79/64
VC-02 40 >100 + - 0/80 VC-68 10 >100 + - 0/68
VC-05 10 >100 + - 0/70 VC-71 >40 >100 + + 84/65
VC-07 40 >100 + + 90/95 Sediment M3
VC-08 10 >100 + - 0/75 VC-72 10 >100 + - 0/25
VC-11 10 >100 + - 0/98 VC-73 10 >100 + - 0/36
VC-17 >40 >100 - + 100/0 VC-74 10 >100 + - 0/40
VC-19 >40 >100 + + 96/95 VC-77 10 >100 + - 0/32
VC-21 >40 >100 + + 95/0 VC-79 10 >100 + - 0/28
VC-23 >40 >100 + + 93/75 VC-81 >40 >100 + + 80/25
VC-29 10 >100 + - 0/65 VC-86 10 >100 + - 0/15
VC-33 >40 >100 + - 0/70 VC-87 >40 >100 + + 93/0
VC-39 >40 >100 + + 95/55 VC-88 10 >100 + - 0/25
VC-41 >40 >100 + + 90/70 VC-89 >40 >100 + - 0/30
Sediment M2 VC-90 10 >100 + - 0/11
VC-42 10 >100 + - 0/58 VC-95 >40 >100 + + 87/10
VC-44 10 >100 + - 0/55 VC-97 >40 >100 + + 85/0
VC-45 >40 >100 + - 0/60 VC-102 >40 >100 + - 0/20
VC-48 >40 >100 + + 75/63 VC-114 >40 >100 + - 0/28
VC-50 >40 >100 + - 0/53 VC-119 >40 >100 + + 91/0
VC-51 10 >100 + - 0/67 VC-123 >40 >100 + + 85/20
VC-52 10 >100 + - 0/64 VC-131 10 >100 + - 0/20
VC-53 10 >100 + - 0/60 VC-139 10 >100 + - 0/22
VC-56 >40 >100 + + 68/65 VC-141 10 >100 + - 0/28
VC-57 10 >100 + - 0/68 VC-143 10 >100 + - 0/13
VC-59 10 >100 + - 0/63 VC-145 10 >100 + - 0/30
VC-61 10 >100 + - 0/60 VC-146 10 >100 + - 0/10
https://doi.org/10.1371/journal.pone.0195080.t004
in the form of arsenate (As [V]). This contamination has chronically affected the rural popula-
tions living near the river, generating a variety of health problems [33, 53].
In this study, sediments (M1, M2 and M3) collected from Camarones river showed high
total arsenic concentration which decreased (from 498 to 128 mg kg-1) as the river approached
to the Pacific Ocean, since several inputs of springs and groundwater lacking As input into the
lower zone of river (M3) [41]. Other authors reported similar total arsenic levels for this same
river [33, 41]. Low values of total organic matter (TOM) were measured in M1 and M2 and
may be due to the slopes and fast-flowing pattern of the Camarones river at these sites, drag-
ging the organic matter. M1 and M2 showed also the highest concentrations of heavy metals
Cu, Cd, Zn and Pb, attributed to the lithogenic characteristics of the river.
Metal-contaminated sediments are inhabited by extremely complex and well-adapted
microbial communities, which play a fundamental role in degrading organic matter and in
biogeochemical cycles [54–56]. Microbial diversity, here investigated by a massive parallel
sequencing (Illumina), revealed a great diversity of bacterial communities, detecting also bac-
teria occurring at very low abundance (0.01%), that would have been masked by dominant
populations if techniques with lower resolution had been applied. As evaluated by diversity
indices, bacterial communities associated with sediments from the Camarones River possessed
moderate diversity that increased along the course of the river from east (M1) to west (M3).
The increase in bacterial diversity in sediment samples was associated with an increase in TOC
and a decrease in As concentration. As generally accepted, moderately disturbed conditions,
as lowering arsenic concentration on groundwater and sediments sample, often result in
higher diversity of microbial communities [54–56], like those occurring at the mouth of
Camarones river (site M3). Although adaptation of a community can take a long time (years),
microorganisms present in metal contaminated soils may be selected in short periods of time
(weeks or months) and after a period of time, microorganisms autochthonous of contaminated
areas will be adapted to predominant conditions [57–58].
Sequences of the dominant taxonomic groups (abundances 1%) across all sediment sam-
ples were affiliated to Proteobacteria (mainly represented by Delta-, Alfa- and Gamma-proteo-
bacteria) followed by Firmicutes, Acidobacteria, Actinobacteria, Chloroflexi, Planctomycetes,
Gemmatimonadetes and Nitrospirae, but their relative abundances differed in each sample,
resulting in different bacterial assemblages. The bacterial community from M2 and M3 sites
showed no significant differences between each other (p = 0.9753). Nevertheless, they were sig-
nificantly more diverse than M1 (p<0.001 and p<0.001, respectively) because sequences affili-
ated with Proteobacteria, Firmicutes, Acidobacteria, Chloroflexi and Actinobacteria covered
more than 89% of the total classified bacterial sequences present in M1 but these phyla were
present in a lesser proportion in M2 and M3 sites. The increase in diversity along the course of
the river from east (M1) to west (M3) was associated with an increase in TOC and a decrease
in As concentration. Concordantly, other authors described that moderately disturbed condi-
tions, as a higher arsenic concentration in groundwater and sediment samples, often result in
low diversity of microbial communities [56, 59], like those occurring at the origin of Camar-
ones river (site M1). Gu et al. [60] reported that the structure of a bacterial community varied
depending on the levels of arsenic contamination, showing an increase in the diversity of arse-
nic functional genes and 16S RNA genes as arsenic levels increased. Sheik et al. [61] had previ-
ously reported that arsenic affected the structure, abundance and diversity of microorganisms
present in a community. Our work showed that communities of the sediment from Camar-
ones river also varied depending arsenic concentration. Quéméneur et al. [62], studying arse-
nic pollution of water caused by old mines in France, determined that arsenic levels affected
the structure of the bacteria possessing the aioA gene, increasing the number of copies of this
gene in the most polluted places.
Previous studies on prokaryotic diversity in metal-contaminated sediments from eutrophic
environments reported the presence of Proteobacteria as predominant phylum being Beta-pro-
teobacteria the dominant subclass, followed by Bacteroidetes, mainly involved in the transfor-
mation of nutrients [59,63]. On the contrary, bacterial sequences recovered in the present
study were mainly related to the Deltaproteobacteria subclass and Firmicutes, which could be
attributed to the oligotrophic condition of the sediments collected at M1 and M2 sites of
Camarones river [64].
Members of Firmicutes, mainly represented by Bacillus genus, were the most abundant in
M1. To date, several Bacillus spp. have been isolated as dissimilatory As (V)-reducing bacteria,
and B. selenatarsenatis was reported to be able to release As from contaminated soils [13]. A
great diversity was found within Deltaproteobacteria, mainly represented by anaerobic mem-
bers involved in the metal reduction, and particularly in respiring arsenate through a detoxifi-
cation pathway encoded by ars operon [65]. Sulphate-reducing bacteria are key mediators of
anaerobic carbon cycling in sediments and some genera, such as those related to Anaeromyxo-
bacter, Desulfobacca and Geothermobacter, have been reported to play an important role in
arsenate reduction [66].
High abundances of Acidobacteria and particularly those of GP6, retrieved across all sam-
ples, and of GP2, the most abundant in M2 site, may be related to their high metal resistance
capability [56]. Sequences related to the genus Caldimicrobium (Thermodesulfobacteria),
grouping extremely thermophilic, strictly anaerobic, sulphur-oxidizing bacteria, widely dis-
tributed in other hot environments [31], were dominant in the upper sites (M1 and M2) of
Camarones river.
Differently to the other sites, genera identified in M3 were characteristically related to Gam-
maproteobacteria, and principally to Ectothiorhodosinus, an anoxygenic phototroph that may
contribute to the primary production in halophilic conditions.
A total of 51 heterotrophic As-resistant strains able to survive under high arsenic concen-
trations, by means of genetic As resistance mechanisms, such as oxidation of As(III) or
reduction of As(V), were isolated and identified as member of Alpha-, Beta- and Gammapro-
teobacteria, and Firmicutes. All arsenite resistant strains (17) possessing the aio gene were
able to oxidize As(III) present in the culture medium into As(V) with values ranging from 68
to 100%. Particularly, arsenite oxidizing strains present at M1 showed the highest As(III) oxi-
dizing percentages (90–100%), where the highest concentration of total arsenic was regis-
tered, confirming data previously reported in the same riverine zone [37, 38]. Pseudomonas
arsenicoxydans, isolated from M1 and firstly described from sediment of the same area,
represents and indigenous species in Camarones river with the highest ability to oxidize As
(III)[37].
Costa et al. (2015) [67], isolated 123 arsenic resistant bacteria from sediments affected by
gold mining activity and their 16S rRNA gene analyses showed the presence of 20 genera
belonging to Proteobacteria, Firmicutes and Actinobacteria. They reported that the predomi-
nant gene was arsC (85%), which was also the predominant gene in our study (present in 50
of 51 strains), followed by aioA (20%), which accounted for 33% in our study. Escalante et al.
(2008) [38] also reported that the major part of As-resistant strains isolated from Camarones
river were able to the reduce arsenic. Overall, a significant correlation was observed between
the environmental As distribution and the capacity to oxidize or reduce the metalloid present
in the sediments of Camarones river.
The diversity of strains possessing arsC gene greatly increased as the total As concentration
decreased in the river. As(V)-resistant strains isolated from M1 presenting the highest arsenic
reducing capacity were identified as species of the following genera: Pantoea (98%), Pseudomo-
nas (95%) Sphingomonas (80%), Aeromonas (75%) and Acinetobacter (70%), all of them that
have been previously isolated from samples collected from the same riverine zone [36]. In con-
trast, Fusibacter paucivorans, isolated from M2, a thiosulfate-reducing bacterium, has not been
described before as a As(V)-reducing bacterium.
Moreover, the co-presence of aio and arsC genes could confer higher resistance to arsenic
than bearing arsC alone [21]. As-resistant strains possessing both genes in the sediments of
Camarones river were: Aquabacterium sp., Alcaligenes sp., Burkholderia cepacia, Pseudomonas
marginalis, P. stutzeri, P. vancouverensis, P. putida, Xanthomonas sp. and Shewanella sp. Of
them, Burkholderia cepacia and P. marginalis were previously isolated from a natural biofilm
associated to volcanic rocks of the Atacama Desert [36–38]. Aquabacterium sp., a well-known
biofilm forming bacterium, Bacillus sp. AS-38 and Xanthomonas sp. are here reported for the
first time as able to oxidize and also reduce arsenic. Moreover, this is the first report describing
the presence of arsC gene and As(V)-reducing capability in P. marginalis, P. stutzeri, and P.
vancouverensis.
Arsenate reduction and arsenite oxidation under aerobic conditions have been reported as
detoxification mechanisms in several aerobic bacteria isolated from different As-contaminated
sites [68, 69], suggesting that As (As[V]/As[III]) resistance plays an important role in the bio-
geochemical cycling of this element in nature [70]. Microbial species that bio-transform arse-
nic between oxidation states with differing environmental behaviours are able to control the
release of adsorbed arsenic from sediments into water and therefore they may be potentially
utilized for bioremediation purposes. Resistant strains able to transform As(III) into As(V)
with a high rate of efficiency, such as P. arsenicoxydans strain VC-17, will be further investi-
gated for its biotechnological potential, to detoxify waters from the Camarones river.
Supporting information
S1 Table. Relative abundances of bacterial phylogenetic group from sediment samples
(M1, M2 and M3) collected from Camarones River. Dominant phylogenetic groups (1% of
total classified sequences) common to sediments (M1, M2 and M3) are represented in bold.
(DOCX)
S2 Table. Closest GenBank match to the relative sequences of the strains isolated from the
three samples (M1, M2 and M3) collected from the Camarones river.
(DOCX)
Acknowledgments
This research was supported by Grant FONDECYT No 11130383 CONICYT, Chile; Grant
VRID-UdeC (213.036.040.1.0) and CONICYT-PCHA/ Doctorado Nacional/ 2013–21130371
Author Contributions
Conceptualization: Qunfeng Dong, Ramon Rossello-Mora, Victor L. Campos.
Data curation: Concetta Gugliandolo, Maria Papale, Claudia Vilo.
Formal analysis: Carla G. Leon, Cristian Valenzuela, Concetta Gugliandolo, Angelina Lo Giu-
dice, Maria Papale, Claudia Vilo, Carlos T. Smith, Victor L. Campos.
Funding acquisition: Victor L. Campos.
Investigation: Carla G. Leon, Ruben Moraga, Concetta Gugliandolo, Victor L. Campos.
Methodology: Carla G. Leon, Ruben Moraga, Cristian Valenzuela, Angelina Lo Giudice, Car-
los T. Smith, Jorge Yañez, Victor L. Campos.
Project administration: Carla G. Leon, Victor L. Campos.
Resources: Victor L. Campos.
Supervision: Ramon Rossello-Mora, Victor L. Campos.
Validation: Qunfeng Dong, Victor L. Campos.
Writing – original draft: Carla G. Leon, Cristian Valenzuela, Maria Papale, Carlos T. Smith,
Victor L. Campos.
Writing – review & editing: Carla G. Leon, Cristian Valenzuela, Angelina Lo Giudice, Carlos
T. Smith, Victor L. Campos.
References
1. Shafiquzzaman M, Azam MS, Nakajima J, Bari QH. Investigation of arsenic removal performance by a
simple iron removal ceramic filter in rural households of Bangladesh. Desalin. 2011; 265: 60–66.
2. Al-Abed SR, Jegadeesan G, Purandare J, Allen D. Arsenic release from iron rich mineral processing
waste: influence of pH and redox potential. Chemosphere. 2007; 66: 775–782. https://doi.org/10.1016/
j.chemosphere.2006.07.045 PMID: 16949129
3. Domingo JL. Prevention by chelating agents of metal-induced developmental toxicity. Reprod Toxicol.
1995; 9: 105–13. PMID: 7795320
4. Leist M, Casey RJ, Caridi D. The management of arsenic wastes: problems and prospects. J Hazard
Mater. 2000; 76: 125–138. PMID: 10863019
5. Wang S, Mulligan CN. Natural attenuation processes for remediation of arsenic contaminated soils and
groundwater. J Hazard Mater. 2006; 138: 459–470. https://doi.org/10.1016/j.jhazmat.2006.09.048
PMID: 17049728
6. Borch T, Kretzschmar R, Kappler A, Cappellen PV, Ginder-Vogel M, Voegelin, et al. Biogeochemical
redox processes and their impact on contaminant dynamics. Environ Sci Technol. 2010; 44: 15–23.
https://doi.org/10.1021/es9026248 PMID: 20000681
7. Stolz JF, Oremland RS. Bacterial respiration of arsenic and selenium. FEMS Microbiol Rev. 1999; 23:
615–627. PMID: 10525169
8. Oremland RS, Stolz JF. Arsenic, microbes and contaminated aquifers. Trends Microbiol. 2005; 13: 45–
49. https://doi.org/10.1016/j.tim.2004.12.002 PMID: 15680760
9. Yamamura S, Watanabe M, Yamamoto N, Sei K, Ike M. Potential for microbially mediated redox trans-
formations and mobilization of arsenic in uncontaminated soils. Chemosphere. 2009; 77: 169–174.
https://doi.org/10.1016/j.chemosphere.2009.07.071 PMID: 19716583
10. Macur RE, Jackson CR, Botero LM, Mcdermott TR, Inskeep WP. Bacterial populations associated with
the Oxidation and Reduction of Arsenic in an Unsaturated Soil. Environ Sci Technol. 2004; 38: 104–
111. PMID: 14740724
11. Stolz JF, Basu P, Santini JM, Oremland RS. Arsenic and selenium in microbial metabolism. Annu Rev
Microbiol. 2006; 60: 107–130. https://doi.org/10.1146/annurev.micro.60.080805.142053 PMID: 16704340
12. Paez-Espino D, Tamames J, De Lorenzo V, Canovas D. Microbial responses to environmental arsenic.
Biometals. 2009; 22: 117–130. https://doi.org/10.1007/s10534-008-9195-y PMID: 19130261
13. Yamamura S, Amachi S. Microbiology of inorganic arsenic: From metabolism to bioremediation. J
Biosci Bioeng. 2014; 118: 1–9. https://doi.org/10.1016/j.jbiosc.2013.12.011 PMID: 24507904
14. Lièvremont D, Bertin PN, Lett MC. Arsenic in contaminated waters: biogeochemical cycle, microbial
metabolism and biotreatment processes. Biochimie. 2009; 91: 1229–1237. https://doi.org/10.1016/j.
biochi.2009.06.016 PMID: 19567262
15. Muller D, Simeonova DD, Riegel P, Mangenot S, Koechler S, Lièvremont D, et al. Herminiimonas
arsenicoxydans sp. nov., a metalloresistant bacterium. Int J Syst Evol Microbiol. 2006; 56: 1765–1769.
https://doi.org/10.1099/ijs.0.64308-0 PMID: 16902005
16. Inskeep WP, Macur RE, Hamamura N, Warelow TP, Ward SA, Santini JM. Detection, diversity and
expression of aerobic bacterial arsenite oxidase genes. Environ Microbiol. 2007; 9: 934–943. https://
doi.org/10.1111/j.1462-2920.2006.01215.x PMID: 17359265
17. Quéméneur M, Heinrich-Salmeron A, Muller D, Lièvremont D, Jauzein M, Bertin PN, et al. Diversity sur-
veys and evolutionary relationships of aoxB genes in aerobic arsenite-oxidizing bacteria. Appl Environ
Microbiol. 2008; 74: 4567–73. https://doi.org/10.1128/AEM.02851-07 PMID: 18502920
18. Zargar K, Hoeft S, Oremland R, Saltikov CW. Identification of a Novel Arsenite Oxidase Gene, arxA, in
the Haloalkaliphilic, Arsenite-Oxidizing Bacterium Alkalilimnicola ehrlichii Strain MLHE-1 J Bacteriol.
2010; 192: 3755–3762. https://doi.org/10.1128/JB.00244-10 PMID: 20453090
19. Lett MC, Muller D, Lièvremont D, Silver S, Santini J. Unified nomenclature for genes involved in prokary-
otic aerobic arsenite oxidation. J Bacteriol. 2012; 194: 207–208. https://doi.org/10.1128/JB.06391-11
PMID: 22056935
20. Warelow TP, Oke M, Schoepp-Cothenet B, Dahl JU, Bruselat N, Sivalingam GN, et al. The respiratory
arsenite oxidase: structure and the role of residues surrounding the rieske cluster. PLoS One. 2013; 8:
e72535. https://doi.org/10.1371/journal.pone.0072535 PMID: 24023621
21. Cai L, Liu G, Rensing C, Wang G. Genes involved in arsenic transformation and resistance associated
with different levels of arsenic-contaminated soils. BMC Microbiol. 2009; 9: 1–11.
22. Muller D, Lièvremont D, Simeonova DD, Hubert JC, Lett MC. Arsenite oxidase aox genes from a metal
resistant beta-proteobacterium. J Bacteriol. 2003; 185: 135–141. https://doi.org/10.1128/JB.185.1.
135-141.2003 PMID: 12486049
23. Anderson G, Williams J, Hille R. The purification and characterization of arsenite oxidase from Alcali-
genes faecalis: a molybdenum containing hydroxylase. J Biol Chem. 1992; 267: 23674–23682. PMID:
1331097
24. Andreoni V, Zanchi R, Cavalca L, Corsini A, Romagnoli C, Canzi E. Arsenite oxidation in Ancylobacter
dichloromethanicus As3-1b strain: detection of genes involved in arsenite oxidation and CO2 fixation.
Curr Microbiol. 2012; 65: 212–218. https://doi.org/10.1007/s00284-012-0149-9 PMID: 22638843
25. Bahar MM, Megharaj M, Naidu R. Arsenic bioremediation potential of a new arsenite-oxidizing bacte-
rium Stenotrophomonas sp. MM-7 isolated from soil. Biodegradation. 2012; 23: 803–812. https://doi.
org/10.1007/s10532-012-9567-4 PMID: 22760225
26. Dong D, Ohtsuka T, Dong DT, Amachi S. Arsenite oxidation by a facultative chemolithoautotrophic
Sinorhizobium sp. KGO-5 isolated from arsenic-contaminated soil. Biosci Biotechnol Biochem. 2014;
78: 1963–70. https://doi.org/10.1080/09168451.2014.940276 PMID: 25051896
27. Campos VL, León C, Mondaca MA, Yañez J, Zaror C. Arsenic mobilization by epilithic bacterial com-
munities associated with volcanic rocks from Camarones river, Atacama desert, northern Chile. Arch
Environ Contam Toxicol. 2011; 61: 185–92. https://doi.org/10.1007/s00244-010-9601-7 PMID:
20859623
28. Rehman A, Butt SA, Hasnain S. Isolation and characterization of arsenite oxidizing Pseudomonas lubri-
cans and its potential use in bioremediation of wastewater. Afr J Biotechnol. 2010; 9: 1493–1498.
29. Li X, Gong J, Hu Y, Cai L, Johnstone L, Grass G, et al. Genome sequence of the moderately halotoler-
ant, arsenite-oxidizing bacterium Pseudomonas stutzeri TS44. J Bacteriol. 2012; 194: 4473–4. https://
doi.org/10.1128/JB.00907-12 PMID: 22843599
30. Vanden Hoven RN, Santini JM. Arsenite oxidation by the heterotroph Hydrogenophaga sp. str. NT-14:
the arsenite oxidase and its physiological electron acceptor. BBA-Bioenergetics. 2004; 1656: 148–155.
https://doi.org/10.1016/j.bbabio.2004.03.001 PMID: 15178476
31. Gihring TM, Druschel GK, McCleskey RB, Hamers RJ, Banfield JF. Rapid arsenite oxidation by Ther-
mus aquaticus and Thermus thermophilus: field and laboratory investigations. Environ Sci Technol.
2001; 35: 3857–3862. PMID: 11642444
32. Jiang D, Li P, Jiang Z, Dai X, Zhang R, Wang Y, et al. Chemolithoautotrophic arsenite oxidation by a
thermophilic Anoxybacillus flavithermus strain TCC9-4 from a hot spring in Tengchong of Yunnan,
China. Front Microbiol. 2015; 6: 360–368. https://doi.org/10.3389/fmicb.2015.00360 PMID:
25999920
33. Yañez J, Fierro V, Mansilla H, Figueroa L, Cornejo L, Barnes R. Arsenic speciation in human hair: a
new perspective for epidemiological assessment in chronic arsenicism. J Environ Monit. 2005; 7:
1335–1341. https://doi.org/10.1039/b506313b PMID: 16307093
34. Steely S, Amarasiriwardena D, Jones J, Yañez J. A rapid approach for assessment of arsenic exposure
by elemental analysis of single strand of hair using laser ablation-inductively coupled plasma-mass
spectrometry. Microchem J. 2007; 86: 235–240.
35. Arriaza B, Amarasiriwardena D, Cornejo L, Standen V, Byrne S, Bartkus L, et al. Exploring chronic arse-
nic poisoning in pre-Columbian Chilean mummies. J Archaeol Sci. 2010; 37: 1274–8.
36. Campos VL, Escalante G, Yañez J, Zaror CA, Mondaca MA. Isolation of arsenite-oxidizing bacteria
from a natural biofilm associated to volcanic rocks of Atacama Desert, Chile. J Basic Microbiol. 2009;
49: S93–S97. https://doi.org/10.1002/jobm.200900028 PMID: 19718679
37. Valenzuela C, Campos VL, Yañez J, Zaror CA, Mondaca MA. Isolation of arsenite-oxidizing bacteria
from arsenic-enriched sediments from Camarones river, Northern Chile. Bull Environ Contam Toxicol.
2009; 82: 593–6. https://doi.org/10.1007/s00128-009-9659-y PMID: 19190837
38. Escalante G, Campos VL, Valenzuela C, Yañez J, Zaror C, Mondaca MA. Arsenic resistant bacteria iso-
lated from arsenic contaminated river in the Atacama Desert (Chile). Bull Environ Contam Toxicol.
2009; 83: 657–61. https://doi.org/10.1007/s00128-009-9868-4 PMID: 19779656
39. Byers S, Mills CE, Steward RL. A comparison of methods of determining organic carbon in marine sedi-
ments with suggestions for a standard method. Hydrobiologia. 1978; 58: 43–47.
40. Walton HF. Principios y métodos de análisis quı́mico. Reverté Mexicana. 1970. 225.
41. Yañez J, Mansilla HD, Santander IP, Fierro V, Cornejo L, Barnes RM, et al. Urinary arsenic speciation
profile in ethnic group of the Atacama desert (Chile) exposed to variable arsenic levels in drinking water.
J Environ Sci Health A Tox Hazard Subst Environ Eng. 2015; 50: 1–8. https://doi.org/10.1080/
10934529.2015.964594 PMID: 25438126
42. Edgar RC, Haas BJ, Clemente JC, Quince C, Knight R (2011) UCHIME improves sensitivity and speed
of chimera detection. Bioinformatics 27: 2194–2200. RC Edgar BJ Haas JC Clemente C. Quince R.
Knight2011UCHIME improves sensitivity and speed of chimera detection.Bioinformatics2721942200).
https://doi.org/10.1093/bioinformatics/btr381 PMID: 21700674
43. Quast C, Pruesse E, Yilmaz P, Gerken J, Schweer T, Yarza P, et al. The SILVA ribosomal RNA gene
database project: improved data processing and web-based tools. Nucleic Acids Research. 2013; 41
(Database issue): D590–D596. https://doi.org/10.1093/nar/gks1219 PMID: 23193283
44. Battaglia-Brunet F, Dictor MC, Garrido F, Crouzet C, Morin D, Dekeyser K, et al. An arsenic(III)-oxidiz-
ing bacterial population: selection, characterization, and performance in reactors. J Appl Microbiol.
2002; 93: 656–67. PMID: 12234349
45. Krumova K, Nikolovska M, Groudeva. Isolation and identification of arsenic-transforming bacteria from
arsenic contaminated sites in Bulgaria. Biotechnol EQ. 2008; 22: 721–728.
46. Rokbani A, Bauda P, Billard P. Diversity of arsenite transporter genes from arsenic-resistant soil bacte-
ria. Res Microbiol. 2007; 158: 128–137. https://doi.org/10.1016/j.resmic.2006.11.006 PMID: 17258434
47. Kumaresan M, Riyazuddin P. Overview of speciation chemistry of arsenic. Current Science. 2001; 80:
837–846.
48. Brito-Echeverria J, Lopez-Lopez A, Yarza P, Anton J, Rosello-Mora R. Occurrence of Halococcus spp
in the nostrils salt glands of the seabird Calonectris diomedea. Extremophiles. 2009; 13: 557–565.
https://doi.org/10.1007/s00792-009-0238-2 PMID: 19363644
49. Saltikov CW, Olson BH. Homology of Escherichia coli R773 arsA, arsB, arsC genes in arsenic-resistant
bacteria isolated from raw sewage and arsenic-enriched creek waters. Appl Environ Microbiol. 2002;
68: 280–288. https://doi.org/10.1128/AEM.68.1.280-288.2002 PMID: 11772637
50. Kashyap DR, Botero LM, Franck WL, Hassett DJ, McDermott TR. Complex regulation of arsenite oxida-
tion in Agrobacterium tumefaciens. J Bacteriol. 2006; 188: 1081–1088. https://doi.org/10.1128/JB.188.
3.1081-1088.2006 PMID: 16428412
51. Guzmán-Fierro V, Moraga R, León CG, Campos VL, Smith C, Mondaca M. Isolation and characteriza-
tion of an aerobic bacterial consortium able to degrade roxarsone. Int J Environ Sci Technol. 2015; 12:
1353–1362.
52. R Core Team. Foreign: read data stored by Minitab, S, SAS, SPSS, Stata, Systat, Weka, dBase, R
package version 0.8–61. 2014. http://CRAN.R-project.org/package=foreign.
53. Silva-Pinto V, Arriaza B, Standen V. Evaluación de la frecuencia de espina bı́fida oculta y su posible
relación con el arsénico ambiental en una muestra prehispánica de la Quebrada de Camarones, norte
de Chile. Rev. méd. Chile. 2010; 138: 461–469.
54. Wang Y, Li P, Jiang Z, Sinkkonen A, Wang S, Tu J, et al. Microbial Community of High Arsenic Ground-
water in Agricultural Irrigation Area of Hetao Plain, Inner Mongolia. Front Microbiol. 2016; 7. https://doi.
org/10.3389/fmicb.2016.01917 PMID: 27999565
55. Luo J, Bai Y, Liang J, Qu J. Metagenomic Approach Reveals Variation of Microbes with Arsenic and
Antimony Metabolism Genes from Highly Contaminated Soil. Parkinson J, ed. PLoS One. 2014; 9(10):
e108185. https://doi.org/10.1371/journal.pone.0108185 PMID: 25299175
56. Ye H, Yang Z, Wu Z, Wang J, Du D, Cai J, et al. Sediment biomarker, bacterial community characteriza-
tion of high arsenic aquifers in Jianghan Plain, China. Sci Rep. 2017; 7: 42037. https://doi.org/10.1038/
srep42037 PMID: 28165031
57. McLaughlin MJ, Smolders MJ. Background zinc concentrations in soil affect the zinc sensitivity of soil
microbial processes—a rationale for a metalloregion approach to risk assessments. Environ Toxicol
Chem. 2001; 20: 2639–2643. PMID: 11699792
58. Azarbad H, Niklińska M, Nikiel K, van Straalen NM, Röling WFM. Functional and compositional
responses in soil microbial communities along two metal pollution gradients: does the level of historical
pollution affect resistance against secondary stress? Biol Fertil Soils. 2015; 51: 879–890. https://doi.
org/10.1007/s00374-015-1033-0
59. Gillan DC, Roosa S, Kunath B, Billon G, Wattiez R. The long-term adaptation of bacterial communities
in metal-contaminated sediments: a metaproteogenomic study. Environ Microbiol. 2014; 17: 1991–
2005. https://doi.org/10.1111/1462-2920.12627 PMID: 25244307
60. Gu Y, Nostrand JDV, Wu L, He Z, Qin Y, Zhao F-J, et al. Bacterial community and arsenic functional
genes diversity in arsenic contaminated soils from different geographic locations. PLOS ONE. 2017;
12: e0176696. https://doi.org/10.1371/journal.pone.0176696 PMID: 28475654
61. Sheik CS, Mitchell TW, Rizvi FZ, Rehman Y, Faisal M, Hasnain S, McInerney MJ, Krumholz LR. Expo-
sure of soil microbial communities to chromium and arsenic alters their diversity and structure. PLoS
One. 2012; 7(6):e40059. https://doi.org/10.1371/journal.pone.0040059 Epub 2012 Jun 29. PMID:
22768219
62. Quéméneur M, Cébron A, Billard P, Battaglia-Brunet F, Garrido F, Leyval C, et al. Population Structure
and Abundance of Arsenite-Oxidizing Bacteria along an Arsenic Pollution Gradient in Waters of the
Upper Isle River Basin, France. Appl Environ Microbiol. 2010; 76: 4566–4570. https://doi.org/10.1128/
AEM.03104-09 PMID: 20453153
63. Costa PS, Reis MP, Ávila MP, Leite LR, De Araújo FM, Salim AC, et al. Metagenome of a microbial
community inhabiting a metal-rich tropical stream sediment. PLoS One. 2015; 10: e0119465. https://
doi.org/10.1371/journal.pone.0119465 eCollection 2015. PMID: 25742617
64. Leon C, Campos V, Urrutia R, Mondaca M. Metabolic and molecular characterization of bacterial com-
munity associated to Patagonian Chilean oligotrophic-lakes of quaternary glacial origin. World J Micro-
biol Biotechnol. 2012; 28:1511–1521 https://doi.org/10.1007/s11274-011-0953-6 PMID: 22805933
65. Rosen BP, Weigel U, Monticello RA, Edwards BP. Molecular analysis of an anion pump: purification of
the ArsC protein. Arch. Biochem. Biophys. 1991; 284: 381–385. PMID: 1703401
66. Li P, Li B, Webster G, Wang Y, Jiang D, Dai X, et al. Abundance and Diversity of Sulfate-Reducing Bac-
teria in High Arsenic Shallow Aquifers. Geomicrobiol J. 2014; 31: 802–812.
67. Costa PS, Scholte LLS, Reis MP, Chaves AV, Oliveira PL, Itabayana LB, et al. Bacteria and genes
involved in arsenic speciation in sediment impacted by long-term gold mining. PloS One. 2014; 9:
e95655. https://doi.org/10.1371/journal.pone.0095655 PMID: 24755825
68. Jones C, Langner H, Anderson K, McDermott T, Inskeep W. Rates of microbially mediated arsenate
reduction and solubilization. Soil Sci Soc Am J. 2000; 64: 600–608.
69. Macur RE, Wheeler JT, McDermott TR, Inskeep WP. Microbial populations associated with the reduc-
tion and enhanced mobilization of arsenic in mine tailings. Environ Sci Technol. 2001; 35: 3676–3682.
PMID: 11783644
70. Inskeep WP, McDermott TR, Fendorf S. Arsenic (V)/(III) cycling in soils and natural waters: chemical
and microbiological processes Frankenberger W.T. (Ed.), Environmental chemistry of arsenic, Marcel
Dekker, New York; 2002. pp. 183–215.