AlMomen 2018, AJMS 1(1): 1-6. DOI:10.5455/ajms.

Arabian Journal of Medical Sciences

http://www.ajms.tk

Physical activity reduces the burden and prevalence of depression

Hajer Mohammed AlMomen

Psychatric Hafouf Hospital, AlAhsa, Saudi Arabia

Abstract
Keywords:
Physical activity, Lifestyle modifications and physical activity have shown major evidence in reduc-
Exercise, ing the burden and prevalence of depression. There is still a debate about the effect
Prevention,
Management, of physical activity on depression prevention. This study aimed at reviewing the
Depression. effect of physical activity on prevention of depression. This review included 40

Received Jul 14,
Revised Aug 1,
Published Aug 2, 2018
*Corresponding author:
hajar.almomen@hotmail.com
studies out of 2300 published studies available on initial search during the last
10 years. These studies showed that exercise is a better strategy for management
of depression and its benefits are not limited to decreasing the depressive symp-
toms but also to improve the quality of life, managing and preventing depression

1. Introduction
Depression and anxiety are worldwide disorders
that could result in high economic burden on health
authorities and individuals as well (Collaborators,
2017). The effective treatment of depression is cost
effective and need various strategies which would
impact the quality of life of individuals (Chisholm
et al., 2016). There are no distinct etiological fac-
tors for depression but different factors may con-
tribute to progression of depression including
economic status, relationships, work load, family
stress and academic achievement (Lee et al., 2013).
Lifestyle and physical activity have shown ma-
jor evidence in reducing the burden and prevalence
of depression (Cleare et al., 2015). Many prospec-
tive studies also showed that there is a significant
association between depression and physical inac-
tivity and this could be postulated to that the exer-
cise could result in a number of biological changes
that affect the mental health of individuals (Carek
et al., 2011; Freitas et al., 2014; Rebar et al., 2015).
Physical activity could alter the activity of the
nervous system and increase the parasympathetic
1
vagal tone which lead to physiological changes in-
cluding the resting bradycardia. The stimulation of
autonomic nervous system was used for treatment of
depression (Hill et al., 2006; Krokstad et al., 2013).
There is still a debate about the effect of phys-
ical activity on depression prevention, however
the evidenced studies and the trend of many agen-
cies were toward benefiting from exercise and
physical activity decrease the depression rates.
This review study aimed at examining the effect
of physical activity on prevention of depression.
2. Information sources and search strat-
egy
The eligibility criteria and data collection were done
according to a literature search in the systemic re-
view conducted in 2013 (Mammen and Faulkner,
2013). The search items were ‘effect of physical
activities on prevention of depression.’ This review
included 40 studies out of 2300 published studies
available on initial search during the last 10 years.
 AlMomen 2018, AJMS 1(1): 1-6. DOI:10.5455/ajms.2
3. Results and discussion
3.1. Definition of physical activity
The definition of physical activity is the movement of
the body that could produce energy coming from the
contraction of skeletal muscles. Physical activities
are done for many purposes and could be related to
having leisure time or work related activities (Brooks
and Magnusson, 2007). Exercise and physical ac-
tivity were also defined as repetitive and structured
as well as planned exercise that could improve the
physical fitness and prevent obesity (Spencer et al.,
2015). Physical activity was associated with leisure
time in many studies and reduction of the depressive
symptoms among women as well as among older
subjects (Joshi et al., 2016; Teychenne et al., 2017).
3.2. Physical activity and depression
Depression and physical activity have a bidirection-
al relationship as each one impacts the other. Many
prospective cross sectional studies showed that
healthy subjects with lower activity levels are more
susceptible to depression than others who regularly
practice exercise. This relationship was evidenced
in many studies around the world. Brazilians who
don’t regularly practice exercise or have low lev-
els of physical activity have increased symptoms
of depression (De Mello et al., 2013). Also, in Ko-
rea, depressive symptoms are doubled among inac-
tive subjects than active population (Kremer et al.,
2014). Among children with high levels of physical
activity, the depressive symptoms were decreased
by 38% than physically inactive subjects (Kremer et
al., 2014). In addition, the levels of developing de-
pression among older subjects were increased (83%)
among population with lower activity levels in com-
parison with active equivalents (Paulo et al., 2016).
Many studies summarized that physical activity is
inversely correlated with the prevalence, prevention
and treatment of depression (Korczak et al., 2017;
Lucas et al., 2011; Mikkelsen et al., 2010; Schuch et
al., 2017a). From which it could be concluded that
regular physical activity is preventive against de-
pression among non-depressive subjects. However,
some other studies showed that the protective effect
of physical exercise is restricted to women (Carroll et
2
al., 2010; Mikkelsen et al., 2010; Wang et al., 2011).
Increasing the rate of physical activity could reduce
the future risks of depression and the more physi-
cal activity level, the more preventive outcomes
and better response to cognitive behavior therapy
(Gudmundsson et al., 2015; Hallgren et al., 2015).
Physical activity during major depressive disorder
could be difficult as those patients are usually inactive
when compared with other suffering from moderate
depression (Helgadottir et al., 2015; Wielopolski et
al., 2015). Variations are found between different
populations from different cultures, ages and genders
thus about 2 and half hours of physical exercise per
week could be effective for prevention of depression
(Correia and Ravasco, 2014; Schuch et al., 2015).
3.3. Potential neurobiological mechanisms as-
sociated with exercise
Many hypotheses were postulated to explain the
effect of exercise on depression. These hypotheses
include increasing the hormonal levels of serotonin,
epinephrine and dopamine which could increase
the levels of neurogenesis markers, reduce the oxi-
dative and pro-inflammatory markers with increas-
ing the antioxidants thus change the activity of the
cerebral cortex (Schuch et al., 2016). The chemical
imbalance between the brain and neurotransmitters
could result in depression thus exercise could pro-
mote the response on the levels of neurotransmit-
ters (Schuch et al., 2016; Szuhany et al., 2015). It
also increases the level of antioxidants as well as
decreases the inflammatory markers which impair
the activity of the brain, thereby preventing and
managing depression (Miller and Raison, 2016).
3.4. Factors influencing physical activity
among depressive subjects
Many factors could influence the physical activity
among depressive patients including low energy, no
motivation and laziness as well as low self-esteem,
efficacy, body mass index and presence of diseases
(Vancampfort et al., 2015). Physiological, emotion-
al and negative experience factors as well as lack
of knowledge about the importance of exercise are
major domains for inactivity among depressive pa-
tients (Bruins et al., 2014; Tordeurs et al., 2011).
 AlMomen 2018, AJMS 1(1): 1-6. DOI:10.5455/ajms.2
3.5. Physical activity for management of de-
pression
There is still a debate surrounding the benefits of
physical activity to depressive patients (Schuch et
al., 2017b). Including exercise for management of
depression is a recent focus of many researchers
(Augestad et al., 2008; Cleare et al., 2015; Hickey et
al., 2012; Yuan et al., 2015). Exercise could result in
treatment of depression among adolescents as well
as among adults but among older population it could
decrease the symptoms of depression (Blumenthal
et al., 2012; Dopp et al., 2012; Hughes et al., 2013;
Mikkelsen et al., 2017; Nasstasia et al., 2017).
3.6. Effect of physical exercise compared
with other treatments
The benefits of physical activity is comparable to
other treatments for depression including com-
mon psychotherapies. Regular exercise showed
similar effects to psychotherapies among many
clinical studies (Hallgren et al., 2015; Strid et
al., 2016). The best results from regular physi-
cal activity could be obtained after one year of
treatment by exercise (Hallgren et al., 2016). The
benefits of physical activity can also be com-
pared to those obtained by electroconvulsive
therapy (ECT), light and wake therapy among
depressive resistant patients (Salehi et al., 2014).
3.7. Recommendations of exercise for treat-
ment of depression
The long term effects of physical activity could re-
sult in management of depression, satisfaction and
enjoying better physical health. But different rec-
ommendations were presented for the optimal du-
ration, frequency and intensity of physical activity
for treatment of depression. A recent study showed
that a session of 1 hour for 3-5 times per week with
an intensity not exceeding 85% heart rate for at
least 10 weeks could be supportive for treatment
of depression (Rethorst and Trivedi, 2013). Also,
another study suggested that a session length of
40 minutes repeated for 4 sessions per week with
moderate intensity would result in management of
depressive disorder (Stanton and Happell, 2013).
Moreover, moderate to vigorous exercise could
3
significantly affect the depressive symptoms among
depressive patients (Meyer et al., 2016). The ses-
sions of exercise must be supervised by health and
exercise professionals for gaining great effects
and management of depression (Sui et al., 2009).
Conclusion
These studies showed that exercise is a bet-
ter strategy for management of depression and
its benefits are not limited to decreasing the de-
pressive symptoms but also to improve the quali-
ty of life, managing and preventing depression.
References
Augestad, L.B., Slettemoen, R.P., Flanders, W.D., 2008. Phys-
ical activity and depressive symptoms among Norwegian
adults aged 20-50. Public health nursing (Boston, Mass.)
25, 536-545.
Blumenthal, J.A., Smith, P.J., Hoffman, B.M., 2012. Is Exer-
cise a Viable Treatment for Depression? ACSM’s health &
fitness journal 16, 14-21.
Brooks, F., Magnusson, J., 2007. Physical activity as leisure:
the meaning of physical activity for the health and well-be-
ing of adolescent women. Health care for women interna-
tional 28, 69-87.
Bruins, J., Jorg, F., Bruggeman, R., Slooff, C., Corpeleijn, E.,
Pijnenborg, M., 2014. The effects of lifestyle interventions
on (long-term) weight management, cardiometabolic risk
and depressive symptoms in people with psychotic disor-
ders: a meta-analysis. PLoS One 9, e112276.
Carek, P.J., Laibstain, S.E., Carek, S.M., 2011. Exercise for
the treatment of depression and anxiety. International jour-
nal of psychiatry in medicine 41, 15-28.
Carroll, D.D., Blanck, H.M., Serdula, M.K., Brown, D.R.,
2010. Obesity, physical activity, and depressive symptoms
in a cohort of adults aged 51 to 61. Journal of aging and
health 22, 384-398.
Chisholm, D., Sweeny, K., Sheehan, P., Rasmussen, B., Smit,
F., Cuijpers, P., Saxena, S., 2016. Scaling-up treatment of
depression and anxiety: a global return on investment anal-
ysis. The lancet. Psychiatry 3, 415-424.
Cleare, A., Pariante, C.M., Young, A.H., Anderson, I.M.,
Christmas, D., Cowen, P.J., Dickens, C., Ferrier, I.N., Ged-
des, J., Gilbody, S., Haddad, P.M., Katona, C., Lewis, G.,
 AlMomen 2018, AJMS 1(1): 1-6. DOI:10.5455/ajms.2
Malizia, A., McAllister-Williams, R.H., Ramchandani, P.,
Scott, J., Taylor, D., Uher, R., 2015. Evidence-based guide-
lines for treating depressive disorders with antidepressants:
A revision of the 2008 British Association for Psychophar-
macology guidelines. Journal of psychopharmacology (Ox-
ford, England) 29, 459-525.
Collaborators, G.D.a.H., 2017. Global, regional, and national
disability-adjusted life-years (DALYs) for 333 diseases and
injuries and healthy life expectancy (HALE) for 195 coun-
tries and territories, 1990-2016: a systematic analysis for
the Global Burden of Disease Study 2016. Lancet (London,
England) 390, 1260-1344.
Correia, J., Ravasco, P., 2014. Weight changes in Portuguese
patients with depression: which factors are involved? Nutri-
tion journal 13, 117.
De Mello, M.T., Lemos Vde, A., Antunes, H.K., Bittencourt,
L., Santos-Silva, R., Tufik, S., 2013. Relationship between
physical activity and depression and anxiety symptoms: a
population study. Journal of affective disorders 149, 241-
246.
Dopp, R.R., Mooney, A.J., Armitage, R., King, C., 2012. Exer-
cise for adolescents with depressive disorders: a feasibility
study. Depression research and treatment 2012, 257472.
Freitas, A.R., Carneseca, E.C., Paiva, C.E., Paiva, B.S., 2014.
Impact of a physical activity program on the anxiety, de-
pression, occupational stress and burnout syndrome of nurs-
ing professionals. Revista latino-americana de enfermagem
22, 332-336.
Gudmundsson, P., Lindwall, M., Gustafson, D.R., Ostling, S.,
Hallstrom, T., Waern, M., Skoog, I., 2015. Longitudinal as-
sociations between physical activity and depression scores
in Swedish women followed 32 years. Acta psychiatrica
Scandinavica 132, 451-458.
Hallgren, M., Helgadottir, B., Herring, M.P., Zeebari, Z., Lin-
defors, N., Kaldo, V., Ojehagen, A., Forsell, Y., 2016. Ex-
ercise and internet-based cognitive-behavioural therapy for
depression: multicentre randomised controlled trial with
12-month follow-up. The British journal of psychiatry : the
journal of mental science 209, 414-420.
Hallgren, M., Kraepelien, M., Ojehagen, A., Lindefors, N., Zee-
bari, Z., Kaldo, V., Forsell, Y., 2015. Physical exercise and
internet-based cognitive-behavioural therapy in the treat-
ment of depression: randomised controlled trial. The British
journal of psychiatry : the journal of mental science 207,
4
227-234.
Helgadottir, B., Forsell, Y., Ekblom, O., 2015. Physical activ-
ity patterns of people affected by depressive and anxiety
disorders as measured by accelerometers: a cross-sectional
study. PLoS One 10, e0115894.
Hickey, M., Bryant, C., Judd, F., 2012. Evaluation and man-
agement of depressive and anxiety symptoms in midlife.
Climacteric : the journal of the International Menopause
Society 15, 3-9.
Hill, M., Weber, R., Werner, S., 2006. The heart-mind connec-
tion. Behavioral healthcare 26, 30-32.
Hughes, C.W., Barnes, S., Barnes, C., Defina, L.F., Nakon-
ezny, P., Emslie, G.J., 2013. Depressed Adolescents Treat-
ed with Exercise (DATE): A pilot randomized controlled
trial to test feasibility and establish preliminary effect sizes.
Mental health and physical activity 6.
Joshi, S., Mooney, S.J., Kennedy, G.J., Benjamin, E.O., Om-
pad, D., Rundle, A.G., Beard, J.R., Cerda, M., 2016. Be-
yond METs: types of physical activity and depression
among older adults. Age and ageing 45, 103-109.
Korczak, D.J., Madigan, S., Colasanto, M., 2017. Children’s
Physical Activity and Depression: A Meta-analysis. Pedi-
atrics 139.
Kremer, P., Elshaug, C., Leslie, E., Toumbourou, J.W., Patton,
G.C., Williams, J., 2014. Physical activity, leisure-time
screen use and depression among children and young ado-
lescents. Journal of science and medicine in sport 17, 183-
187.
Krokstad, S., Langhammer, A., Hveem, K., Holmen, T.L.,
Midthjell, K., Stene, T.R., Bratberg, G., Heggland, J., Hol-
men, J., 2013. Cohort Profile: the HUNT Study, Norway.
International journal of epidemiology 42, 968-977.
Lee, R.B., Maria, M.S., Estanislao, S., Rodriguez, C., 2013.
Factors Associated with Depressive Symptoms among Fili-
pino University Students. PLoS ONE 8, e79825.
Lucas, M., Mekary, R., Pan, A., Mirzaei, F., O’Reilly, E.J., Wil-
lett, W.C., Koenen, K., Okereke, O.I., Ascherio, A., 2011.
Relation between clinical depression risk and physical ac-
tivity and time spent watching television in older women:
a 10-year prospective follow-up study. American journal of
epidemiology 174, 1017-1027.
Mammen, G., Faulkner, G., 2013. Physical activity and the
prevention of depression: a systematic review of prospec-
tive studies. American journal of preventive medicine 45,
 AlMomen 2018, AJMS 1(1): 1-6. DOI:10.5455/ajms.2
649-657
Meyer, J.D., Ellingson, L.D., Koltyn, K.F., Stegner, A.J., Kim,
J.S., Cook, D.B., 2016. Psychobiological Responses to Pre-
ferred and Prescribed Intensity Exercise in Major Depres-
sive Disorder. Medicine and science in sports and exercise
48, 2207-2215.
Mikkelsen, K., Stojanovska, L., Polenakovic, M., Bosevski,
M., Apostolopoulos, V., 2017. Exercise and mental health.
Maturitas 106, 48-56.
Mikkelsen, S.S., Tolstrup, J.S., Flachs, E.M., Mortensen, E.L.,
Schnohr, P., Flensborg-Madsen, T., 2010. A cohort study of
leisure time physical activity and depression. Preventive
medicine 51, 471-475.
Miller, A.H., Raison, C.L., 2016. The role of inflammation in
depression: from evolutionary imperative to modern treat-
ment target. Nature reviews. Immunology 16, 22-34
Nasstasia, Y., Baker, A.L., Halpin, S.A., Lewin, T.J., Hides,
L., Kelly, B.J., Callister, R., 2017. Pilot Study of an Exer-
cise Intervention for Depressive Symptoms and Associated
Cognitive-Behavioral Factors in Young Adults With Major
Depression. The Journal of nervous and mental disease 205,
647-655.
Paulo, T.R., Tribess, S., Sasaki, J.E., Meneguci, J., Martins,
C.A., Freitas, I.F., Jr., Romo-Perez, V., Virtuoso, J.S., Jr.,
2016. A Cross-Sectional Study of the Relationship of Physi-
cal Activity with Depression and Cognitive Deficit in Older
Adults. Journal of aging and physical activity 24, 311-321.
Rebar, A.L., Stanton, R., Geard, D., Short, C., Duncan, M.J.,
Vandelanotte, C., 2015. A meta-meta-analysis of the effect
of physical activity on depression and anxiety in non-clini-
cal adult populations. Health psychology review 9, 366-378.
Rethorst, C.D., Trivedi, M.H., 2013. Evidence-based recom-
mendations for the prescription of exercise for major de-
pressive disorder. Journal of psychiatric practice 19, 204-
212.
Salehi, I., Hosseini, S.M., Haghighi, M., Jahangard, L., Bajogh-
li, H., Gerber, M., Puhse, U., Kirov, R., Holsboer-Trachsler,
E., Brand, S., 2014. Electroconvulsive therapy and aerobic
exercise training increased BDNF and ameliorated depres-
sive symptoms in patients suffering from treatment-resistant
major depressive disorder. Journal of psychiatric research
57, 117-124.
Schuch, F., Vancampfort, D., Firth, J., Rosenbaum, S., Ward,
P., Reichert, T., Bagatini, N.C., Bgeginski, R., Stubbs, B.,
2017a. Physical activity and sedentary behavior in people
5
with major depressive disorder: A systematic review and
meta-analysis. Journal of affective disorders 210, 139-150.
Schuch, F.B., Deslandes, A.C., Stubbs, B., Gosmann, N.P., Sil-
va, C.T., Fleck, M.P., 2016. Neurobiological effects of ex-
ercise on major depressive disorder: A systematic review.
Neuroscience and biobehavioral reviews 61, 1-11.
Schuch, F.B., Morres, I.D., Ekkekakis, P., Rosenbaum, S.,
Stubbs, B., 2017b. A critical review of exercise as a treat-
ment for clinically depressed adults: time to get pragmatic.
Acta neuropsychiatrica 29, 65-71.
Schuch, F.B., Vasconcelos-Moreno, M.P., Borowsky, C., Zim-
mermann, A.B., Rocha, N.S., Fleck, M.P., 2015. Exercise
and severe major depression: effect on symptom severity
and quality of life at discharge in an inpatient cohort. Jour-
nal of psychiatric research 61, 25-32.
Spencer, R.A., Rehman, L., Kirk, S.F., 2015. Understanding
gender norms, nutrition, and physical activity in adolescent
girls: a scoping review. The international journal of behav-
ioral nutrition and physical activity 12, 6.
Stanton, R., Happell, B.M., 2013. An exercise prescription
primer for people with depression. Issues in mental health
nursing 34, 626-630.
Strid, C., Andersson, C., Forsell, Y., Ojehagen, A., Lundh,
L.G., 2016. Internet-based cognitive behaviour therapy and
physical exercise - Effects studied by automated telephone
assessments in mental ill-health patients; a randomized
controlled trial. The British journal of clinical psychology
55, 414-428.
Sui, X., Laditka, J.N., Church, T.S., Hardin, J.W., Chase, N.,
Davis, K., Blair, S.N., 2009. Prospective study of cardi-
orespiratory fitness and depressive symptoms in women
and men. Journal of psychiatric research 43, 546-552.
Szuhany, K.L., Bugatti, M., Otto, M.W., 2015. A meta-analytic
review of the effects of exercise on brain-derived neuro-
trophic factor. Journal of psychiatric research 60, 56-64.
Teychenne, M., Abbott, G., Lamb, K.E., Rosenbaum, S., Ball,
K., 2017. Is the link between movement and mental health
a two-way street? Prospective associations between physi-
cal activity, sedentary behaviour and depressive symptoms
among women living in socioeconomically disadvantaged
neighbourhoods. Preventive medicine 102, 72-78.
Tordeurs, D., Janne, P., Appart, A., Zdanowicz, N., Reynaert,
C., 2011. [Effectiveness of physical exercise in psychiatry:
a therapeutic approach?]. L’Encephale 37, 345-352.
Vancampfort, D., Stubbs, B., Mitchell, A.J., De Hert, M.,
 AlMomen 2018, AJMS 1(1): 1-6. DOI:10.5455/ajms.2

Wampers, M., Ward, P.B., Rosenbaum, S., Correll, C.U.,

2015. Risk of metabolic syndrome and its components in
people with schizophrenia and related psychotic disorders,
bipolar disorder and major depressive disorder: a systematic
review and meta-analysis. World psychiatry : official journal
of the World Psychiatric Association (WPA) 14, 339-347.
Wang, F., DesMeules, M., Luo, W., Dai, S., Lagace, C., Mor-
rison, H., 2011. Leisure-time physical activity and marital
status in relation to depression between men and women:
A prospective study. Health psychology : official journal of
the Division of Health Psychology, American Psychological
Association 30, 204-211.
Wielopolski, J., Reich, K., Clepce, M., Fischer, M., Sperling,
W., Kornhuber, J., Thuerauf, N., 2015. Physical activity and
energy expenditure during depressive episodes of major de-
pression. Journal of affective disorders 174, 310-316.
Yuan, T.F., Paes, F., Arias-Carrion, O., Ferreira Rocha, N.B.,
de Sa Filho, A.S., Machado, S., 2015. Neural Mechanisms
of Exercise: Anti-Depression, Neurogenesis, and Serotonin
Signaling. CNS & neurological disorders drug targets 14,
1307-1311.

6
 El-Zarka et al., 2018, AJMS 1(1): 7-13. DOI:10.5455/ajms.1

Arabian Journal of Medical Sciences

http://www.ajms.tk

Adiponectin as a potential biomarker of diabetic nephropathy

Ayman EL-Zarkaa,*, Aida Solimanª, Sahar Bessab, Tarek Mohamedc
ªDepartment of Biochemistry, Faculty of Science, Suez Canal University, Egypt
b
Department of Internal Medicine, Faculty of Medicine, Tanta University, Egypt
c
Department of Biochemistry, Faculty of Science, Tanta University

Abstract
Diabetic nephropathy (DN) is a progressive kidney disease associated with diabetes
Keywords: mellitus that may lead to end-stage renal disease. Adiponectin (ADP) is a protein
Diabetic nephropathy; hormone produced by white adipose tissue and has vasoprotective properties. Adi-
Adiponectin;
HbA1c; ponectin level attributes to and associates with diabetic complications. Herein, we
microalbuminuria assess the potentiality of detecting ADP level as a DN marker. This study included
sixty age- and sex- matched subjects which were subdivided into three groups: twenty
healthy (control) subjects, twenty type 2 diabetes patients with nephropathy (microal-
Received Jul 12,
buminuria 30-300 mg/dL), and twenty type 2 diabetes patients without nephropathy
Revised Jul 28,
Published Aug 2, 2018 (normoalbuminuria <30 mg/dL). Mean serum ADP levels were significantly in-
creased in all patients with type 2 diabetes with or without nephropathy as compared
to the control group with higher levels in those with nephropathy. Serum ADP lev-
els were positively correlated with fasting blood glucose, glycosylated hemoglobin
(HbA1c), microalbuminuria, serum creatinine and urea.The most independent risk
*Corresponding author: factors for occurrence of microvascular complications may reflect the role of ADP
Ayman_elzarka@yahoo.com
as a predictor and prognostic marker of DN among patients with type 2 diabetes.

1. Introduction
tect against progression to macroalbuminuria.
Diabetes mellitus (DM) is a chronic metabolic
Many biologically active peptides, such as angi-
disorder which is correlated with high risk of an-
otensin II, endothelin, neuropeptide Y and uroten-
giopathy, retinopathy, nephropathy and neuropa-
sin II, are expressed in the kidney and involved
thy. Improvements in glycemic control may help
in the pathogenesis of DN (Caroccia et al., 2017).
to decrease these complications (Pradeep and
Adiponectin (ADP), a vasodilator regulatory pep-
Haranath, 2014). Diabetic nephropathy (DN) is
tide that is also expressed in the kidney and can
considered as one of the main potential cause of
prevent albuminuria and other renal disorders
end-stage renal disease worldwide (Narres et al.,
mainly through enhancing the disrupted renal en-
2016). Patients with DN have low but abnormal
dothelial function, decreasing oxidative stress,
levels of albumin in urine [this called microal-
and increasing endothelial nitric oxide synthase
buminuria, in which urinary albumin/creatinine
(eNOs) expression and peroxisome prolifera-
ratio (ACR) ranged from 30 to 300 mg/g] which
tor-activated receptor (PPAR)-α (Zha et al., 2017).
usually is accompanied with low glomerular fil-
Therefore, in the present study ADP levels were
tration rate and hypertension. Early detection of
evaluated as an early predictor and prognostic
DN are important as early intervention can pro-
marker of DN among patients with type 2 diabetes.
7
 El-Zarka et al., 2018, AJMS 1(1): 7-13. DOI:10.5455/ajms.1
2. Subjects and methods
This study included sixty subjects; of them twen-
ty apparently healthy age and sex matched sub-
jects were considered as a control group and the
remaining forty were type 2 diabetic patients (se-
lected from those admitted to Diabetes Unit, Inter-
nal Medicine Department, Tanta University Hos-
pital, Egypt) which were subdivided into twenty
patients without nephropathy normoalbuminuria
<30 mg/g), and twenty patients with nephropathy
(microalbuminuria 30-300 mg/g). Exclusion cri-
teria: type 2 diabetes mellitus with cancer, severe
renal failure, liver and heart diseases. All patients’
histories were collected from the hospital records.
Blood samples (2 mL from each subject) were
collected in EDTA tube to measure fasting blood glu-
cose (FBG) and glycosylated hemoglobin (HbA1c).
Other blood samples were collected in plain tubes
and were allowed to clot then centrifuged at 4000
rpm for 15 minutes and the obtained serum was
utilized for estimation of creatinine, urea and se-
rum adiponectin. Second morning urine samples
were collected for estimation of microalbumin.
Blood glucose, serum creatinine and urea and spot
urine microalbumin were determined using commer-
cial kits obtained from Biomed Diagnostics (Han-
nover, Germany). HbAlc level was measured accord-
ing to method described by (Karami and Baradaran,
2014) using NycoCard READER technique supplied
by (Axis-Shield, Norway). Serum adiponectin lev-
el was assessed by ELISA technique following the
manufacturer protocol (AssayMax, Cat #EA2500-1,
USA) as previously described (Tsao et al., 2002).
The statistical analysis was performed using anal-
ysis of variance (ANOVA) by SPSS version 21. Per-
son’s correlation coefficient was used to estimate the
correlation between variables. Areas under receiver
operating characteristic (ROC-AUC) curve was used
to assess the sensitivity of laboratory parameters in
diagnosis of nephropathy among patients with type 2
diabetes depending on estimating the cut off values:
(0.6-0.69) poor, (0.7-0.79) fair, (0.8-0.89) good, (0.9-
1.0) excellent values. Data was represented as mean ±
standard deviation and significance was set at p<0.05.
8
3. Results
There was no significant difference between age,
sex and disease duration among the studied groups
while diabetic patient with and without nephrop-
athy have significant higher body mass index
(BMI) compared to control subjects (Table 1).
A significant increase in serum creatinine, blood
urea and serum ADP was noticed among patients
with type 2 diabetes with or without nephropathy as
compared to control group (Table 2). Patients with
type 2 diabetes with nephropathy showed a signifi-
cant increase in fasting blood glucose (FBG), HbA1c
and albumin/creatinine ratio (ACR) as compared to
patients without nephropathy and control group.
ACR was positively correlated (P<0.05) with FBG
(r=0.587, P=0.03), HbA1c (r=0.497, P=0.04), serum
creatinine (r=0.812, P=0.0001), blood urea (r=0.642,
P=0.0001), and serum ADP (r=0.654, P=0.01) in pa-
tients with type 2 diabetes and nephropathy (Table 3).
On the other hand, serum ADP was posi-
tively correlated (P<0.05) with FBG (r=0.392,
P=0.01), HbA1c (r=0.451, P=0.01), serum cre-
atinine (r=0.364, P=0.01), blood urea (r=0.499,
P=0.001), and ACR (r=0.480, P=0.001) in patients
with type 2 diabetes and nephropathy (Table 4).
The ROC-AUC curve showed thatACR (AUC=1.000)
and serum ADP (AUC=0.981) were most sensitive pa-
rameters followed by serum creatinine (AUC=0.858),
FBG (AUC=0.761), HbA1c (AUC=0.725)
and lastly blood urea (AUC=0.703) (Fig. 1).
Multivariate regression analysis, which denoted beta
coefficient for predictors of DN among patients with
type 2 diabetes, showed that ACR (β = 0.003, p=0.026)
and ADP (β= 0.718, p= 0.0001). This indicates that
urinary ADP is an independent predictor of diabet-
ic nephropathy in type 2 diabetic patients (Table 5).
 El-Zarka et al., 2018, AJMS 1(1): 7-13. DOI:10.5455/ajms.1
Table (1): Distribution of the studied groups according to sex, age, body mass index (BMI) and
duration of diabetes.
Paramerters Control group DM without nephropa- DM with nephropathy
(n= 20) thy (n=20) n=(20)

Age(years) 56.5 ± 2 57 ± 2.6 58.2 ± 2.4

F test Scheffe test 2.651ns
Sex(M/F) 10/10 11/9 9/11
X2 1.003
P value 0.7530
BMI (Kg/m2) 23.4 ± 1.4 27.8 ± 0.94 28.8± 1.13
F test 62.028*
Scheffe test I vs II, P* = 0.001 , I vs III, P*= 0.001
DM Duration (years) 8.6± 1.4 9.2± 1.02
F test 1.965ns
Scheffe test

Data are presented as mean±SD.

Table (2): Biochemical data of the studied groups.

Paramerters Control group DM without nephropa- DM with nephropathy
(n= 20) thy (n=20) n=(20)
Fasting blood glucose (mg/dL) 91.8± 11.4 173.7 ± 17.3 198.1± 6.29
F test 165.64*
Scheffe test I vs II, P* = 0.001, I vs III, P*= 0.001, II vs III, P*= 0.001
HbA1c (%) 5.26 ± 0.32 7.4± 0.52 8.02± 0.71
F test 139.69*
Scheffe test I vs II, P* = 0.001, I vs III, P*= 0.001, II vs III, P*= 0.01
Serum creatinine (mg/dL) 0.91 ± 0.15 0.99 ± 0.19 1.69 ± 0.25
F test 31.07*
Scheffe test I vs II, P* = 0.001, I vs III, P*= 0.001
Blood Urea (mg/dL) 33.9 ± 7.3 42.1 ± 7.1 62.7 ± 12.2
F test 86.373*
Scheffe test I vs II, P* = 0.001, I vs III, P*= 0.001
ACR (mg/g) 10.8 ± 4.3 17 ± 7.9 90.4 ± 48.9
F test 47.132*
Scheffe test I vs II, P* = 0.05, I vs III, P*= 0.001, II vs III, P*= 0.001
Serum Adiponectine (ng/mL) 90 ± 8.1 107.4 ± 14.7 118.6 ± 14.7
F test 5.953*
Scheffe test I vs III, P*= 0.01, II vs III, P*= 0.05

Data are presented as mean±SD

9
 El-Zarka et al., 2018, AJMS 1(1): 7-13. DOI:10.5455/ajms.1

Table (3): The correlation between ACR and other Table (4): The correlation between ADP and other
parameters in patients with type 2 diabetes and ne- parameters in patients with type 2 diabetes and ne-
phropathy. phropathy.

Parameters r-values Parameters r-values

Age(years) 0.060 Age(years) 0.0458

BMI(kg/m2) 0.213 BMI(kg/m2) 0.023

Duration of diabetes (years) 0.190 Duration of diabe-

0.039
tes (years)
FBG(mg/dL) 0.587* FBG(mg/dL) 0.390**
HbA1c(%) 0. 497* HbA1c(%) 0.451**
Creatinine(mg/dL) 0. 812*** Creatinine(mg/dL) 0.364**
Urea(mg/dL) 0. 642*** Urea(mg/dL) 0.449***
Serum adiponectin (ng/mL) 0. 654** ACR (mg/g) 0.480***
r : Pearson’s correlation coefficient, * p < 0.05, ** p
r : Pearson’s correlation coefficient, ** p < 0.01,
< 0.01, *** p < 0.001
*** p < 0.001

Fig.1. Area under ROC curve was denoting sensitivity of different measured parame-
ters for diagnosis of nephropathy in patient with type 2 diabetes.

10
 El-Zarka et al., 2018, AJMS 1(1): 7-13. DOI:10.5455/ajms.1

Table (5) Multivariate regression analysis for pre- without nephropathy showed a significant change
dictors of DN among patients with type 2 diabetes. in HbA1c and FBG levels with fair predictive
Multivariate regression. ROC-AUC values of 0.725 and 0.761 respec-
Parameters β St.error t p-value tively. These results were consistent with Kita-
oka et al., (2016), who indicated that nephropa-
ACR 0.003 0.001 2.331 0.026* thy progressors had higher HbA1c and FBG than
nonprogressors. Microalbuminuria significantly
ADP 0.718 0.151 4.769 0.0001* correlated with HbA1c and FBG in the select-
ed patients with type 2 diabetes and nephropathy
Creatinine 0.006 0.003 1.944 0.060 which was consistent with Sheikh et al., (2009).
Herein, age factor is not associated with DN
Urea -0.005 0.003 -1.906 0.065 which was on the contrary to findings of Cheng et
al., (2013), who reported that older age is a risk fac-
HbA1C 0.201 0.265 0.757 0.454 tor of DN. Microalbuminuria in patients with type
2 diabetes and nephropathy has shown insignificant
FBS -0.005 0.008 -0.718 0.478 correlation with age factor and BMI which was sim-
ilar to the findings reported by Afkhami-Ardekani et
al., (2008). In contrast, Lim et al., (2009) and Sheikh
et al., (2009) reported a significant correlation be-
4. Discussion tween microalbminuria prevalence and both age and
There are several risk factors that make people with BMI in patients with type 2 diabetes and nephrop-
diabetes more prone to kidney disease. One is poor athy as compared to those without nephropathy.
control of blood glucose. People with hypertension Our obtained data revealed that patients with
or a family history of hypertension are more likely type 2 diabetes exhibited a significant elevation in
to develop renal disease than those without a fam- serum ADP level compared to controls. Similarly,
ily history. The time factor is also important; the Saraheimo et al., (2005) also reported higher serum
longer the duration of diabetes the higher the risk ADP level in patients with type 1 diabetic nephrop-
of renal disease (Reutens et al., 2008). The remark- athy, and this higher level was correlated with renal
able increase in number of diabetic people may insufficiency. However, (von Eynatten et al., 2009)
consequently lead to high rate of DN. Hence, it is found that when patients with nephropathy were ex-
crucial to decrease the complication of diabetes to cluded, serum ADP was significantly lower in pa-
prevent the development of DN (Fu et al., 2012). tients with type 2 diabetes than healthy individuals.
In the present study, patients with diabet- Our results showed that patients with type
ic nephropathy had a significant elevation in se- 2 diabetes and nephropathy had higher ADP lev-
rum creatinine, urea, and ACR when compared to els compared to those without nephropathy. ROC-
those without nephropathy. This was supports by AUC showed that serum ADP was (AUC=0.981)
ROC-AUC results which revealed excellent pre- near to ACR. These results were in accordance
dictive value of microalbuminuria (AUC=1.000) with the findings of (Koshimura et al., 2004) who
and good predictive values of serum creatinine found that serum ADP levels were much higher in
(AUC=0.858) and urea (AUC=0.703). These find- the patients with nephropathy than in those with-
ings were consistent with (Fiseha, 2015) who con- out nephropathy and these levels are elevated as
cluded that microalbuminuria is essential for early the severity of DN increased. The early renal ab-
detection of DN in patients with type 2 diabetes. normalities in DN include glomerular hypertension
Our results revealed that patients with type and hyperfiltration. Sustained glomerular hyperten-
2 diabetes and nephropathy as compared to those sion together with several other factors, such as ad-
11
 El-Zarka et al., 2018, AJMS 1(1): 7-13. DOI:10.5455/ajms.1
vanced glycation end-products, cytokines, hyperlipi-
demia, sorbitol, angiotensin II and growth factors,
causes thickening of glomerular basement mem-
brane and mesangial expansion eventually followed
by glomerulosclerosis. ADP has the ability to pass
through the glomerular filtration barrier to protect
against albuminuria and decrease renal endothelial
loss via preventing inflammation, fibrosis and oxida-
tive stress in kidneys (Christou and Kiortsis, 2014).
Serum ADP has insignificant correlation with
age and BMI in patients with type 2 diabetes and
nephropathy which was consistent with (Saraheimo
et al., 2005). Also, there was a significant correlation
between serum ADP level and HbA1c in the present
work. However, (Gligor et al., 2012) reported an in-
crease in the circulating ADP correlates with poor glu-
cose metabolic control in patients with type 2 diabe-
tes. Moreover the present study showed insignificant
correlation between serum ADP level and duration
of diabetes which was in contrast to the findings of
Saraheimo et al., (2005). A positive significant corre-
lation was observed in our work between serum ADP
level and FBG in patients with type 2 diabetes and
nephropathy which was in agreement with findings
of Nakamaki et al., (2011) who reported that hyperg-
lycemia causes renal damage by several mechanisms
including non-enzymatic glycation of protein, acti-
vation of hexosamine and increase intracellular ROS.
The present work demonstrated a positive sig-
nificant correlation between serum ADP and each
of serum creatinine and urea in patients with type 2
diabetes and nephropathy. These results were con-
sistent with Sangeeta et al., (2015) who suggested
that the increased serum ADP level in renal insuf-
ficiency may be partly due to decreased clearance
in the kidney. The vascular endothelial damage and
volume retention in nephropathy could be other
reasons. Taken together with the vasodilative ef-
fect in renal arteries, the production of ADP may be
augmented to preserve renal blood flow and GFR
when renal function deteriorates (Eissa et al., 2016).
References
Afkhami-Ardekani, M., Modarresi, M., Amirchaghmaghi, E.,
2008. Prevalence of microalbuminuria and its risk factors
in type 2 diabetic patients. Indian journal of nephrology ,
12
18(3): 112–117.
Caroccia, B., Menegolo, M., Seccia, T.M., Petrel-
li, L., Antonello, M., Limena, A., Porzionato,
A., Caro, R., Poglitsch, M., Rossi, G.P., 2017.
Urotensin II Exerts Pressor Effects By Stimulat-
ing Renin And Aldosterone Synthase Gene Ex-
pression. Scientific Reports, 7:13876.
Cheng, Y.-W., Malik, U., Chang, S.-L., 2013. The
risk factors of diabetic nephropathy in Taiwan,
including old age, hypertension and aspirin ther-
apy. International Journal of Diabetes in Devel-
oping Countries, 33:128-128.
Christou, G.A., Kiortsis, D.N., 2014. The role of ad-
iponectin in renal physiology and development
of albuminuria. Journal of Endocrinology, 221
R49-R61.
Eissa, S., Matboli, M., Bekhet, M.M., 2016. Clinical
verification of a novel urinary microRNA panal:
133b,-342 and-30 as biomarkers for diabetic ne-
phropathy identified by bioinformatics analysis.
Biomedicine & Pharmacotherapy, , 83:92-99.
Fiseha, T., 2015. Urinary biomarkers for early dia-
betic nephropathy in type 2 diabetic patients. Bi-
omarker research, 4;3:16-22.
Fu, W.-J., Li, B.-L., Wang, S.-B., Chen, M.-L., Deng,
R.-T., Ye, C.-Q., Liu, L., Fang, A.-J., Xiong, S.-
L., Wen, S., others, 2012. Changes of the tubular
markers in type 2 diabetes mellitus with glomer-
ular hyperfiltration. Diabetes research and clini-
cal practice, 95(1):105-109.
Gligor, R., Maria Puşchiţă, Dana Zdremţan, Ioan
Crîsnic 2012. Relationship between adiponectin
and certain metabolic parameters in diabetic and
cardiovascular disease patients. complement.
Proc. Rom. Acad., Series B, 14:101–107.
Karami, A., Baradaran, A., 2014. Comparative eval-
uation of three different methods for HbA(1c)
measurement with High-performance liquid
chromatography in diabetic patients. Advanced
Biomedical Research, 3:94-102.
Kitaoka, K., Takenouchi, A., Tsuboi, A., Fukuo, K.,
Kazumi, T., 2016. Association of Postbreakfast
Triglyceride and Visit-to-Visit Annual Variation
of Fasting Plasma Glucose with Progression of
Diabetic Nephropathy in Patients with Type 2
 El-Zarka et al., 2018, AJMS 1(1): 7-13. DOI:10.5455/ajms.1

Diabetes. Journal of diabetes research, 2016: type-2 diabetic patients in Karachi. Journal of
4351376. Ayub Medical College Abbottabad, 21(3):83-86.
Koshimura, J., Fujita, H., Narita, T., Shimotomai, Tsao, T.-S., Lodish, H.F., Fruebis, J., 2002. ACRP30,
T., Hosoba, M., Yoshioka, N., Kakei, M., Fu- a new hormone controlling fat and glucose me-
jishima, H., Ito, S., 2004. Urinary adiponectin tabolism. European journal of pharmacology,
excretion is increased in patients with overt dia- 440(2-3):213-221.
betic nephropathy. Biochemical and biophysical von Eynatten, M., Liu, D., Hock, C., Oikonomou, D.,
research communications, 26;316(1):165-169. Baumann, M., Allolio, B., Korosoglou, G., Mor-
Lim, S., Kim, D.J., Jeong, I.-K., Son, H.S., Chung, cos, M., Campean, V., Amann, K., others, 2009.
C.H., Koh, G., Lee, D.H., Won, K.C., Park, J.H., Urinary adiponectin excretion: a novel marker
Park, T.S., others, 2009. A nationwide survey for vascular damage in type 2 diabetes. Diabetes,
about the current status of glycemic control and 58(9):2093-2099.
complications in diabetic patients in 2006-The Zha, D., Wu, X., Gao, P., 2017. Adiponectin and Its
committee of the Korean diabetes association on Receptors in Diabetic Kidney Disease: Molecular
the epidemiology of diabetes mellitus. Korean Mechanisms and Clinical Potential. Endocrinolo-
Diabetes Journal, 3(1):48-57. gy, 158(7):2022-2034.
Nakamaki, S., Satoh, H., Kudoh, A., Hayashi, Y.,
Hirai, H., Watanabe, T., 2011. Adiponectin re-
duces proteinuria in streptozotocin-induced di-
abetic Wistar rats. Experimental Biology and
Medicine, 236(5):614-20.
Narres, M., Claessen, H., Droste, S., Kvitkina, T.,
Koch, M., Kuss, O., Icks, A., 2016. The inci-
dence of end-stage renal disease in the diabet-
ic (compared to the non-diabetic) population: a
systematic review. PloS one, 26;11(1):e0147329.
Pradeep, T., Haranath, C., 2014. A Review on Dia-
betes Mellitus Type II. International Journal of
Pharma Research & Review, 1(3): 12-22.
Reutens, A.T., Prentice, L., Atkins, R.C., 2008. The
epidemiology of diabetic kidney disease. The
Epidemiology of Diabetes Mellitus, Second Edi-
tion.
Sangeeta, C., Harsh, K., Pune, P., 2015. Study of
renal and lipid profile in diabetic patients. Int J
Pharm Bio Sci. 5, 2230–7605.
Saraheimo, M., Forsblom, C., Fagerudd, J., Teppo,
A.-M., Pettersson-Fernholm, K., Frystyk, J., Fly-
vbjerg, A., Groop, P.-H., 2005. Serum adiponec-
tin is increased in type 1 diabetic patients with
nephropathy. Diabetes care, 28(6):1410-1414.
Sheikh, S.A., Baig, J.A., Iqbal, T., Kazmi, T., Baig,
M., Husain, S.S., 2009. Prevalence of microal-
buminuria with relation to glycemic control in

13
 Eid et al., 2018, AJMS 1(1): 14-18 DOI:10.5455/ajms.3

Arabian Journal of Medical Sciences

http://www.ajms.tk

Effect of naringenin and hesperidin in amelioration of copper oxide

nanoparticles toxicity in rat liver
Radwa S. Eid a*, Mohamed M. Hussein b, Aida H. Soliman a
a
Chemistry Department, Faculty of Science, Suez Canal University, Egypt
b
Biochemistry Department, Faculty of Veterinary Medicine, Zagazig University, Egypt

Article Info Abstract

Background: Although copper oxide nanoparticles (CuO NPs) are used in many industrial and
Keywords:
manufacturing processes, they cause oxidative stress-induced toxicity. Objectives: Here, we in-
CuO NPs;
naringenin; vestigated the potential ameliorative effect for the two flavonoids naringenin (Nar) and hesperidin
hesperidin;
(Hes), which have a potent antioxidant activity, against CuO NPs-induced toxicity in rat liver.
antioxidant
Materials and methods: Sprague-dawly rats (n = 70, weight = 150-200g) were di-

vided into seven groups (n = 10 per group): normal control (G1), Nar (20 mg/
Received Aug 12,
Revised Aug 20, kg)-treated group (G2): Hes (15 mg/kg)-treated (G3), CuO NPs (5 mg/kg)- treat-
Published Aug 20, 2018 ed (G4), CuO NPs+ Nar-treated (G5), CuO NPs+Hes (G6), and CuO NPs+Nar+Hes (G7).

Results: A significant increase of ALT, AST and ALP enzymes activities as well as bil-

irubin content (total, direct) and MDA liver content was detected in CuO NPs (G4) ad-

ministrated group indicating liver damage. This hepatic damage was confirmed by oth-

er biochemical and molecular results which denoted a significant decrease in total protein,
*Corresponding author:
dode_beauty89@yahoo.com albumin, GSH level, SOD, CAT activities and SOD, CAT mRNA level in this group. Adminis-

tration of Nar and/or Hes alleviated this toxic effect and therefore, Nar and/or could improve the

damaged liver tissues and the associated disrupted function that induced by CuO NPs toxicity.

Conclusion: The obtained results suggest that Nar and Hes may be appropri-

ate for clinical application in the treatment of liver disorders induced by CuO toxicity.

1. Introduction
Nanotechnology is a new promising field with potential appli-
cations in domestic, industrial, and biomedical products (Per-
alta-Videa et al., 2011). However, with this growing number
of applications, the risk of human and environmental expo-
sure to nanomaterials increased thereby leading to potential
toxicological impacts (Skocaj et al., 2011). These possible
toxic effects should be evaluated to provide a scientific basis
for safe development of nanotechnologies (Song et al., 2010).
Although copper oxide nanoparticles (CuO NPs) are
used in many industrial and manufacturing processes,
such as gas sensor, batteries, solar energy converter, mi-
croelectronics, heat transfer fluids, textiles, paints, plas
tics and food containers, they cause oxidative stress-in-
duced toxicity (Delgado et al., 2011; Gomes et al., 2012).
The flavonoid naringenin (Nar), which is rich in grapefruit,
has an antioxidant, anti-inflammatory, immunomodulatory ef-
fects (Felgines et al., 2000; Kidambi et al., 2009). Another fla-
vonoid, the hesperidin (Hes) that is abundantly present in fruits
and vegetables (Garg et al., 2001) also has a potent anti-oxidant
effect that prevents oxidative damage of cells (Jung et al., 2003).
The aim of this study was to investigate the po-
tential ameliorative effect for the two flavonoids
Nar and Hes, which have a potent antioxidant activ-
ity, against CuO NPs-induced toxicities in rat liver.

14
 Eid et al., 2018, AJMS 1(1): 14-18 DOI:10.5455/ajms.3
2. Materials and methods
2.1. Chemicals
Hesperidin and naringenin were purchased from Sigma-Aldrich
Co, ST. Louis. Mo, USA, while, CuO NPs were purchased
from Beni Suef University. These NPs were black powder of
≥99.99% purity and 50 nm size as revealed by X-ray diffraction
(XRD).
2.2. Experimental animals
Sprague-Dawly rats (n = 70, weight = 150-200 g) were housed
in separate metal cages with fresh drinking water were supplied
ad-libtium. Rats were kept at constant environmental and nu-
tritional condition throughout the period of experiment. The
animals were left for 14 days for acclimatization before the
beginning of the experiment. The experimental study was ap-
proved by the Animal Ethical Committee of Faculty of Veteri-
nary Medicine, Zagazig, and was in accordance with its rules.
2.3. Experimental design
Animals were divided into the following seven groups (10 rats
per group): Group 1 (G1): Rats were given normal saline daily
for 30 days. G2: Rats were given Nar (20 mg/kg) daily for 28
days, from the 3rd to 30th day (Reddy et al., (2014). G3: Rats
were administrated Hes (15 mg/kg) daily for 28 days, from the
3rd to 30th day (Cho et al., (2009). G4: Rats were treated with
CuO NPs (5 mg/kg) for 30 days (Sandhya Rani, et al., 2013).
G5: Rats were treated with CuO NPs (5 mg/kg) for 30 days
followed by Nar (20 mg/kg) for 28 days, from the 3rd to 30th
day. G6: Rats were given (5 mg/kg) of CuO NPs for 30 days
followed by Hes (15 mg/kg) for 28 days, from the 3rd to 30th
day. G7: rats were treated with CuO NPs (5 mg/kg) for 30 days
followed by Nar (20 mg/kg) and Hes (15 mg/kg) according to
the same doses and routes of previous groups for 28 days, from
the 3rd to 30th day. All treatments were given orally by gastric
gavage.
2.4. Sampling
At the end of experimental period 30 days, rats were killed by
using cervical dislocation. Blood samples were collected by
puncturing retero-orbital venous plexus at the medial canthus
of the eye and were collected in dry, clean tubes and incubated
for 30 min at room temperature to allow clotting for serum sep-
aration. Serum was separated by centrifugation at 3000 rpm for
15 min and then collected in Eppendorf for biochemical anal-
ysis. Following sacrificing, liver samples were dissected out
and rinsed in cold physiological isotonic saline (0.9% NaCl) to
remove contaminated blood, then they were divided into three
parts. The first part was sliced and homogenized in 9 ml physio-
logical saline using electric homogenizer. The homogenate was
centrifuged at 3000 rpm for 15 min and the clear supernatant
was obtained for determination of MDA, GSH concentration,
and SOD, CAT activities. The second part was quickly stored
in -80 freezer to make snap-freezing of tissue to be used in real
time PCR. The third part was fixed in 10 % buffered neutral
formalin solution for histopathological examination.
2.5. Biochemical analysis
Serum ALT, AST, ALP, total protein, and albumin were meas-
ured using commercially available kits (Bio-Diagnostic, Egypt).
The lipid peroxidation marker MDA, and GSH levels as well as
the activities of SOD and CAT were determined in liver as pre-
viously described (Abdelhadya et al., 2017).
15
2.6. Real time PCR (qPCR)
Determination of SOD and CAT mRNA levels in rat liver was
performed using relative quantitative RT-PCR (qPCR). Total
RNA was isolated from liver tissues of experimental groups
using Trizol following the manufacturer’s instructions (Ther-
mo Scientific, Life Technology, USA). Nano-Drop was used
to assess the concentration and the purity of RNA. Total RNA
(1 μg) was used for production of cDNA using Qiagen Long
range RT-PCR kit. Relative quantitation–PCR was done us-
ing Rotor–Gene Q2 plex. The primer sequence for CAT was
F: 5’GCGAATGGAGAGGCAGTGTAC3’, R: 5’GAGT-
GACGTTGTCTTCATTAGCACTG3’; and for Cu-ZN-SOD
F: 5’GCAGAAGGCAAGCGGTGAAC3’, R: 5’ TAGCAG-
GACAGCAGATGAGT3’. The internal control β actin primer
sequences was F: 5’CCTGCTTGCTGATCCACA3’, R: 5’CT-
GACCGAGCGTGGCTAC3’.The thermal profile for PCR was
95°C for 10 min, followed by 40 cycles of 95°C for 10 s and
60°C for 30 s. Each transcript was relatively quantified in three
replicates by calculation using the 2 -ΔΔCt method.
2.7. Histopathological examination
The fixed liver samples were dehydrated in ascending series of
ethanol, cleared in xylol then embedded in paraffin wax. Sec-
tions of 6 microns thick were cut and mounted on clean glass
slides. After being dried, sections were stained with haematox-
ylin and eosin (Bancroft and Gamble, 2008).
2.8. Statistical analysis
All the data were expressed as means ±S.E. The statistical
significance was evaluated by one-way analysis of variance
(ANOVA) using SPSS, 18.0 software, 2011 and individual
comparisons were obtained by Duncan’s multiple range test
(DMRT). Values were considered statistically significant when
p<0.05.
3. Results and Discussion
Our obtained results revealed that administration of CuO NPs
(G4) led to a significant increase in the serum levels of liver
damage markers (ALT, AST and ALP) as compared to control
groups (G1-G3) (Table 1). This indicates liver damage in G4
rats and suggests possible hepatic toxicity induced by CuO
NPs. In agreement with our findings, Gülnaz Canli and Mustafa
Canli (2017) and Lee et al., (2014) also reported a similar in-
crease in these enzymes followed by loss of liver function in rat
and carp, respectively, following exposure to CuO NPs. CuO
NPs induced damage of liver cells, ultimately their enzymatic
contents of ALT, AST and ALP abundantly released into cir-
culation (Miri and Rahdari, 2015). In contrast, administration
of Nar (G5) and Hes (G6) each alone or in combination (G7)
led to a significant decrease of these liver damage markers to
a limit comparable to that of the control groups (G1-G3) (Ta-
ble 1). This suggests a possible ameliorative effect to these two
flavonoids against liver toxicity induced by CuO NPs. Hes has
been shown to decrease liver damage, prevent the escape of
liver enzymes through maintaining of cell membranes integrity
(Pradeep et al., 2008).
Total protein, with special concern to albumin, was used
as an index of liver disorder in toxicology studies. The present
study also showed that oral administration of CuO NPs (G4)
resulted in a significant decrease in serum levels of total protei
and albumin as compared to control groups (G1-G3) (Table 1).
 Eid et al., 2018, AJMS 1(1): 14-18 DOI:10.5455/ajms.3

Table 1. Effect of CuO NPs administration on biochemical parameters and possible protective effect of Nar and/or Hes.
Parameters G1 G2 G3 G4 G5 G6 G7

ALT (IU/L) 26.35±1.56c 29.0 ±1.63c 28.92±1.22c 94.70±2.09a 52.25±1.26b 52.62±1.63b 28.50±1.08c

AST (IU/L) 24.52±1.12c 26.67±1.29c 26.47±1.69c 104.77±3.94a 48.45±3.02b 46.82±3.00b 25.15±1.01c

ALP (IU/L) 170±5.6c 182±5.74c 181±4.73c 375±5.88a 277.40±3.59b 273.15±4.18b 177.55±6.23c

Albumin (g/ 3.93 ±0.04a 3.94±0.07a 3.89±0.06a 2.60±0.09c 3.44±0.05b 3.50±0.06b 3.88±0.06a
dl)

Total protein 7.30 ±0.19a 7.23 ±0.11a 7.32 ±0.22a 5.45 ±0.10c 6.22 ±0.08b 6.22 ±0.06b 7.45 ±0.18a
(g/dl)

Bilirubin 0.51± 0.01c 0.47± 0.07c 0.48± 0.06c 2.89± 0.08a 1.51± 0.11b 1.34± 0.03b 0.51± 0.03c
total (mg/dl)

Direct biliru- 0.08±0.01c 0.12± 0.01c 0.11± 0.01c 0.53± 0.02a 0.41± 0.02b 0.34± 0.02b 0.13± 0.02c
bin (mg/dl)

Data were presented as mean± standard error. Means carrying different superscript letters in the same raw are significantly different
at p< 0.05.
This also indicates liver damage and loss of function. Again
this toxic effect was reversed after giving Nar and/or Hes. In
contrast, Yang and Chen, (2003) showed insignificant change
in total protein and albumin following administration of CuO
NPs. This controversial results may be attributed to variation
in CuO NPs doses, size and route of administration. Moreover,
the notable increase in total and direct bilirubin following ad-
ministration of CuO NPs also confirm the hepatotoxic effect of
these NPs and the ability of Nar and Hes to relieve this toxic
effect (Table 1).
In the present study, rats treated by CuO NPs exhibited a
significant increase in liver content of the lipid peroxidation
marker, MDA and a significant decrease in GSH level and the
antioxidant activities of SOD and CAT as compared to control
groups (G1-G3) (Fig.1). In consistent with our data, several pre-
vious studies on toxicity of CuO NPs reported similar results in
rat liver (Boots et al., 2008; El-Nekeety et al., 2009; Patra et al.,
2001; Ercal et al., 2000; Upasani et al., 2001). This indicates
that CuO NPs may exert its hepatotoxic effect through, at least
in part, elevation of free radicals and decrease in intracellular
antioxidant activities. Subsequently, this oxidative stress-in-
duced damage cause lipid peroxidation to cell membrane and
leakage of liver enzymes. Again, this deteriorated effect was re-
versed after treatment by Nar and Hes (Fig. 1). Similarly, other
studies also showed Nar ability to decrease MDA and increase
GSH level induced by many toxins in rat liver (Renugadevi and
Prabu, 2010; Renugadevi and Prabu, 2009; Boots et al., 2008).
Nar was also reported to inhibit arsenic-induced oxidative he-
patic damage and cisplatin-induced nephrotoxicity in rats (Ba-
dary et al., 2007). Similarly, Hes has the ability to enhance en-
dogenous antioxidant status in liver (Tirkey et al., 2005).
At the molecular level, we also found a significant down-
regulation in SOD and CAT genes in liver after administration
of CuO NPs as compared to control groups (G1-G3) (Fig.2).
This declined expression was restored to level comparable to
that of control after treatment by Nar and/or Hes. Similarly,
16
exposure of hippocampal HT22 cells to CuO NPs resulted in
decreased gene expression of SOD (Niska et al., 2015). How-
ever, Hes treatment increased the expression of SOD mRNA
(Elavarasan et al., 2012).
Our histopathological examination showed normal liver ar-
chitecture in control groups (G1-G3) (Fig. 3A-C). These groups
had normal central vein and surrounding hepatocytes arranged
in cords (Fig. 3A, B) and normal hepatic portal area consisting
of a bile ductule and a portal blood vessel surrounded by normal
hepatocytes (Fig. 3C). In contrast, liver of rats administrated
CuO NPs (G4) showed congested portal blood vessels (arrows,
Fig.3D) surrounded by dissociated hepatocytes and marked
infiltration of the portal area with mononuclear inflammatory
cells (arrow, Fig.3E). This congestion (arrowheads) and cellular
infiltration (arrows) were reduced following treatment by Nar
(Fig.3F) and Hes (Fig.3G). The combined treated group showed
normal histological structures of hepatic parenchyma (Fig.3H).
In agreement with our findings, Lee et al., (2016) also report-
ed mild inflammatory cell infiltration and dilated sinusoids in
the liver of rats treated by CuO NPs. Lee et al., (2004) that
demonstrated that naringenin has in vivo hepatoprotective and
antifibrogenic effects against dimethyl nitrosamine-induced liv-
er injury.
Throughout the experiment, the combined treated group by
both Nar and Hes gave better results than each alone, indicating
the presence of a kind of synergism between Nar and Hes and
their therapeutic importance in CuO NPs-induced liver toxicity.
This may be explained on the basis that the CuO NPs caus-
es liver toxicity through induction of ROS production which
led to cellular damage, inflammation, and DNA abnormalities.
Therefore, treatment with Nar and Hes, which are well known
for their potent antioxidant and anti-inflammatory effects, can
reduce oxidative stress (by decreasing the MDA level), elevate
the levels of antioxidant status (SOD, CAT, and GSH). Thus,
this co-treatment strategy maximizes the therapeutic outputs
against CuO NPs-induced liver toxicity.
 Eid et al., 2018, AJMS 1(1): 14-18 DOI:10.5455/ajms.3
Fig.1. Effect of naringenin and/ or hesperidin on hepatic MDA, GSH
content, and SOD, CAT activities in rats with induced CuO NPs tox-
icity. Analyses were performed in triplicate. Data are the mean ±SE of
seven different liver samples in same group. Means within columns car-
rying different superscript letters are significantly different at P≤ 0.05.
Fig.2. Effect of naringenin and/ or hesperidin on relative
expression of SOD and CAT genes in liver of rats with in-
duced CuO NPs toxicity. Analyses were performed in
triplicate. Data are the mean ±SE of three different liver
samples in same group. Means within columns carrying dif-
ferent superscript letters are significantly different at P≤ 0.05.
17
Fig.3. Histopathological examination of liver exposed to
Cuo-NPs and co-administrated with naringenin and hesperi-
din. Photomicrograph of Liver tissue; A, group1; B, group
2 ; C, group 3; D and E, group 4; F, group 5 ; G, group 6;
H, group 7. H&E, in all photos X=200, except in D = 100.
Conclusion
Nar and/or Hes could improve the damaged liver tissues and the
associated disrupted function that induced by CuO NPs toxicity.
Hence, Nar and Hes could be appropriate for clinical applica-
tion in the treatment of liver disorders induced by CuO toxicity,
however, further investigation are required to clarify the exact
molecular mechanism by which Nar and Hes do this effect.
References
Abdelhadya, D.H., El-Magd, M.A., Elbialy, Z.I., Saleh, A.A., 2017.
Bromuconazole-induced hepatotoxicity is accompanied by upreg-
ulation of PXR/CYP3A1 and downregulation of CAR/CYP2B1
gene expression. Toxicol Mech Methods 27(7):544-550.
Badary, O.A., Abdel-Maksoud, S., Ahmed, W.A., Owieda, G.H.,
2005. Naringenin attenuates cisplatin nephrotoxicity in rats. Life
Sci 76:2125–2135.
 Eid et al., 2018, AJMS 1(1): 14-18 DOI:10.5455/ajms.3

Bancroft, J.D., Gamble, M., 2008. Theory and practice of Histological Pradeep K, Park SH and Ko K Ch. 2008. Hesperidin a flavanogly-
Techniques. 5th ed., Churchill Livingstone. New York, London, cone protects against γ-irradiation induced hepatocellular damage
Philadelphia. and oxidative stress in Sprague–Dawley rats. Eur. J. Pharmacol.,
Boots, A.W., Haenen, G.R., Bast, A., 2008. Health effects of quercetin: 587(1-3): 273–280.
from antioxidant to nutraceutical. Eur J Pharmaco l585:325– 337. Renugadevi J, Prabu SM, 2009. Naringenin protects against cadmiu-
Canli, E.G, Canli M., 2017. Effects of aluminum, copper, and titanium minduced oxidative renal dysfunction in rats. Toxicology 256:
nanoparticles on some blood parameters in Wistar rats. Turk J Zool 128–34.
41: 259-266. Renugadevi J, Prabu SM, 2010. Cadmium-induced hepatotoxicity in
Delgado, K., Quijada, R., Palma, R., Palza, H., 2011. Polypropylene rats and the protective effect of naringenin. Exp Toxicol Pathol
with embedded copper metal or copper oxide nanoparticles as a 62:171–181.
novel plastic antimicrobial agent. Lett Appl Microbiol 53: 50–54. Sandhya Rani V, Kishore Kumar A, Pradeep Kumar Ch, Rama Nar-
Elavarasan, J., Velusamy, P., Ganesan, T., Ramakrishnan, S.K., Rajase- simha Reddy A, 2013. Pulmonary toxicity of copper oxid (cuo)
karan, D., et al. 2012. Hesperidin-mediated expression of Nrf2 and nanoparticles in rat. J Med Sci. 13(7):571-7.
upregulation of antioxidant status in senescent rat heart. J Pharm Skocaj M, Filipic M, Petkovic J, Novak S, 2011. Titanium dioxide in
Pharmacol 64: 1472-1482. our everyday life; is it safe? Radiol Oncol 45(4):227-247.
El-Nekeety, A.A., El-Kady, A.A., Soliman, M.S. et al., 2009. Protec- Song MJ, Hwang SW, Whang D, 2010. Non-enzymatic electrochemi-
tive effect of Aquilegia vulgaris (L.) against lead acetate-induced cal CuO nanoflowers sensor for hydrogen peroxide detection. Ta-
oxidative stress in rats. Food Chem Toxicol 47:2209–2215. lanta 80: 1648–1652.
Ercal, N., Neal, R., Treeratphan, P. et al., 2000. A role for oxidative Tirkey N, Pilkhwal S, kuhad A and Chopra K. 2005. Hesperidin, a cit-
stress in suppressing serum immunoglobulin levels in lead-ex- rus bioflavonoid, decreases the oxidative stress produced by car-
posed Fisher 344 rats. Arch Environ Contam Toxicol 39:251–256. bon tetrachloride in rat liver and kidney. BMC. Pharmacology,5:2.
Felgines, C., Texier, O. Morand, C. Manach, C. Scalbert, A.; Réger- Upasani C, Khera A, Balaraman R, 2001. Effect of lead withvitamin
at, F. et al., 2000. Bioavailability of the flavanone naringenin and E, C, or Spirulina on malondialdehyde, conjugated dienes and hy-
its glycosides in rats. Amer. J. Physiol. Gastrointest. Liver Physiol droperoxides in rats. Indian J Exp Biol 39:70–74.
279: G1148-G1154. Yang JL, Chen HC., 2003. Effects of gallium on common carp (Cypri-
Garg, A. Garg, S., Zaneveld, L.J., Singla, A.K., 2001. Chemistry and nus carpio): acute test, serum biochemistry, and erythrocyte mor-
pharmacology of the Citrus bioflavonoid hesperidin. Phytother. phology. Chemosphere 53: 877–882.
Res. 15: 655-669.
Gomes, T., Pereira, C.G., Cardoso, C., Pinheiro, J.P., Cancio, I., et al.
2012. Accumulation and toxicity of copper oxide nanoparticles in
the digestive gland of Mytilus galloprovincialis. Aquatic Toxicol
118–119: 72–79.
Jung, U.J., Kim, H.J., Lee, J.S., Lee, M.K., Kim, H.O., Park, E.J. et
al., 2003. Naringin supplementation lowers plasma lipids and en-
hances erythrocyte antioxidant enzyme activities in hypercholes-
terolemicsubjects. Clin Nutr 22:561–8.
Kidambi, S., Yarmush, R.S., Novik, E., Chao, P., Yarmush, M.L., 2009.
Oxygen mediated enhancement of primary hepatocyte metabolism,
functional polarization, gene expression, and drug clearance. Proc
Natl Acad Sci. 106: 15714–15719.
Lee In-C, Ko Je-W, Park Sung-H, lim Je-O, shin In-S, Moon C, et al.,
2016. Comparative toxicity and biodistribution of copper nanopar-
ticles and cupric ions in rats. International Journal of Nanomedi-
cine 11: 2883–2900.
Lee J, Kim J, Shin Y, Ryu JE, Lee JS., 2014. Serum and ultrastructure
responses of common carp (Cyprinus carpio L.) during long-term
exposure to zinc oxide nanoparticles. Ecotoxicology Environmen-
tal Safety 104: 9-17.
Lee MH, Yoon S, Moon JO, 2004. The flavonoid naringenin inhibits
dimethylnitrosamine- induced liver damage in rats. Biol Pharm
Bull 27: 72–6.
Miri M, and Rahdari A., 2015. Sub lethal effects of copper oxide
(CuO) nanoparticles on blood parameters of common carp (Cypri-
nus Carpio). Journal of Biodiversity and Environmental Sciences
6 (6): 283-291.
Niska K, Santos-Martinez M.J , Radomski M.W, Inkielewicz-Stepni-
ak I., 2015. CuO nanoparticles induce apoptosis by impairing the
antioxidant defense and detoxification systems in the mouse hip-
pocampal HT22 cell line: Protective effect of crocetin. Toxicology
in Vitro 29:663–671.
Patra R, Swarup D, Dwivedi S., 2001. Antioxidant effects of α-tocoph-
erol, ascorbic acid and L-methionine on lead induced oxidative
stress to the liver, kidney and brain in rats. Toxicology 162:81–88.
Peralta-Videa JR, Zhao L, Lopez-Moreno ML, de la Rosa G, Hong J,
Gardea Torresdey JL, 2011. Nanomaterials and the environment: a
review for the biennium 2008- 2010. J Hazard Mater. 186(1):1-15.
18
 Kenawy et al., 2018, AJMS 1(1): 19-25 DOI:10.5455/ajms.4

Arabian Journal of Medical Sciences

http://www.ajms.tk

Synthesis and anti-microbial activities of some (aryl)-N’-benzylidene-2-hy-

droxybenzohydrazide derivatives

EL-Refaie Kenawy a*, Abd EL-Basset Shokr a, Nayera A.M. Abdel-Wahed b, Tarek M. Zied a
a
Chemistry Department, Faculty of Science, Tanta University, Tanta 31527, Egypt
b
Chemistry of Natural and Microbial Products Department, Pharmaceutical Industries Division, National
Research Centre, Giza, Egypt

Article Info Abstract

In order to study new bioactive compounds, we carried out certain chemical transformations of salicyl-
Keywords:
ic acid hydrazide through reaction with a set of aromatic aldehydes (benzaldehyde, p-chloro-benzalde-
methyl salicylate;
salicylic acid hydrazide; hyde, p-methoxy-benzaldehyde , N , N’di methyl- benzaldehyde) in boiling methanol; and in the pres-
anti-microbial activity;
ence of a catalytic amount of piperidine under reflux conditions to yield the corresponding derivatives in
thiazolidinone;
aromatic aldehydes moderately good yields. The corresponding thiazolidinone derivatives were obtained by the treatment

with thioglycolic acid under reflux conditions. The reactivity of salicyloyl hydrazide towards the reac-
Received Sep 1,
Revised Sep 16, tion with some nucleophiles was investigated by reaction with formamide, urea, acetamide and benzyl.
Published Sep 23, 2018 The produced derivatives were screened for their anti-microbial activities. Salicylic acid hy-

drazide was successfully accommodated subunits of thiazolidine-4-ones or oroxadiazin or py-

rimidin affording a set of derivatives which proved their utility in medicinal chemistry, as they

showed moderate to high antimicrobial properties proving the synthetic utility of salicyl-

ic acid hydrazide in constructing new heterocycles of possible expected therapeutic relevance.

*Corresponding author:
ekenawy@yahoo.com The same molecular hybrid template may afford more potent scaffolds upon the incorporation of

more effective substituents based on the highly biological profile of salicylic acid hydrazide itself.

1. Introduction
activity (Dachineni et al., 2016; Elshaier and Marzouk 2015).
Hydrazides and their derivatives have been described as
Also with acidic moiety, its ester as aspirin or methyl salic-
useful synthons of various heterocyclic systems (Popiołek,
ylate has analgesic activities. The synthesis of salicylic acid
2017). Full therapeutic possibilities of hydrazides were real-
hydrazide (2-hydroxy-benzohydrazide) has been successful-
ized after the discovery of isonicotinic acid hydrazide (INH).
ly done in high yield through the action of hydrazine hydrate
Hydrazides and their derivatives exhibited antifungal, psycho-
on methyl salicylate (Ermann and Henner, 1994). On the
tropic (Popiołek, 2017), anti-tuberculous (Bedia et al., 2006;
other hand, the 4-thiazolidinones have a broad spectrum
Naqvi et al., 2009), anti-parasite (Troeberg et al., 2001), bac-
of biological activities such as: anti-bacterial, anti-fungal
teriostatic (Erman and Henner, 1994; Plech et al., 2015), an-
(Lakhan and Singh, 1991), anti-inflammatory, anti-diarrhoe-
tiviral (Verma et al., 2014), insecticidal (Barbosa et al., 2011)
al, anti-HIV, anti-cancer properties (El-Feky,1993, Bingul et
and anticancer activities (Mansour, 2003 ). Furthermore, they
al., 2016 , Bondock et al., 2007) and hypnotic-sedative, an-
were used in the treatment of inflammatory and autoimmune
algesic, anti-convulsant (Gürsoy et al., 2005), anti-tubercular
diseases, osteoarthritis, respiratory diseases, tumors, cachexia,
activity against M. tuberculosis H37 Rv (Cihan-Üstündağ
cardiovascular diseases, fever, hemorrhage and sepsis (Man-
et al., 2016), and anti-type-2 diabetes (Baihua, 2004).
sour, 2003). Some hydrazides also showed analgesic activity
We reported here a rapid and efficient route for the synthe-
(Koopaei et al., 2013). The replacement of the acidic moiety of
sis of 2-(2-hydrox-benzohydrazide) -oxo -N(substituted phe-
Mefenamic acid (also known as dimethylphenylaminobenzoic
nyl)1,3-thiazolidin-4-ones (4) from its corresponding ben-
acid which is a well-known NSAID drug available worldwide
zylidene salicylic acid hydrazones (3) and also the synthesis
under many brand names) with N-arylidene hydrazides moie-
of some 2-triazine (or oxadiazin or pyrimidin) phenol de-
ty can increase the analgesic activity (Koopaei, 2013). Salicyl-
rivatives (5-9) by reacting with some nucleophiles (Fig. 1).
ic acid is another analgesic agent which also has anti-cancer

19
 Kenawy et al., 2018, AJMS 1(1): 19-25 DOI:10.5455/ajms.4
O
O
H N
N Ar
OH
O
[4a-e] Ar=Ph,p- MePh,O-OHPh, p-OMePh , p-ClPh
NHNH2
OH
N N
[2 ] Salicylic acid hydrazide
X R
OH
[5-9] ;X=O,NH,CHAr and R=S or Ph or NH2 or CH3 or H
Figure 1
Fig. 1. The preparative chemical transformations of salicylic acid hydrazide
into 4- thiazolidinones, triazine- , oxadiazin- or pyrimidin- phenol analogous.
2. Experimental
2.1. Materials
Methyl salicylate (2-Hydroxy-benzoic acid methyl es-
ter) was acquired from (Sigma chemical Co.) and was
used without purification. Thioglycolic acid [TGA] was
purchased from ( ULTIMA CHEMICALS Mumbai, In-
dia ) and hydrazine hydrate was purchased from (Innova
Corporate India ). Dimethyl formamide (DMF) was dis-
tilled prior use. MeOH and ethanol (EtOH), were bought as
spectroscopic grade materials and were used without fur-
ther purification. Carbon disulphide and the aromatic al-
dehydes were purchased from Sigma-Aldrich (St. Louis,
MO) and Acros (Geel, Belgium) Concoction Companies.
2.2. Characterization
Melting points (uncorrected) were recorded on an elec-
tro-thermal melting apparatus. IR spectra were recorded on
a Perkin-Elmer spectrometer, at Faculty of Science, Tan-
ta University. 1HNMR were recorded in DMSO-d6 on a
Bruker 400 MHz instrument using TMS as internal stand-
ard (chemical shifts in δ ppm), at Faculty of Science, Kaf-
relshiekh University. TGA analysis was recorded on Shi-
madzu 50, at Faculty of Science , Kafrelshiekh University.
Microanalytical data (C, H, N) were performed on Perkin
Elmer 240 B analyzer, at the center of micro analysis , Fac-
ulty of Science , Cairo University. Solvent evaporation was
performed under reduced pressure using Buchi Rotatory
Evaporatory unless otherwise stated. TLC was performed on
silica gel plates (60-F254, 0.2 mm), manufactured by E.M.
Sciences, Inc, and shortwave UV (254) nm was used to de-
tect the UV absorbing compounds (CHCl3, acetone 5:2).
2.3. Synthesis of 2-hydroxybenzohydrazide (salicylic acid
hydrazide ) 2
A mixture of methyl salicylate (0.01 mole ; 0.89 ml) and
hydrazine hydrate (1 ml; 0.02 mol ; 99 %) was refluxed in 50
ml methanol for about 13-15 hours. The resultant mixture
was concentrated, cooled and poured into crushed ice. The sol-
id product was separated, filtered, washed with ethanol and
recrystallized from methanol ( Pattan et al., 2009 ). White solid
, m p 142 – 145 °C as reported , yield = 77 % , IR (KBr Disc):1640
(C =O) ,1089 ( C- O ) ,1821 ( C=N) , 1244 (C-N ) ,1588
(C=C) ,3047 (C-H) aromatic ,755 (aromatic C-H); O-disub-
stituted phenyl ring, 3133 (NH),3313 (NH2), 3266 (OH).
2.4. General procedure for the Synthesis of N’-ben-
S zylidene-2-hydroxybenzohydrazides 3 a- e
A mixture of salicylic acid hydrazide 2 (1.5 g , 0.01
mol) and substituted benzaldehydes (0.015 mol) in etha-
nol (15 mL) were refluxed in boiling methanol (50 ml) for
about 2- 3 hours in the presence of a few drops of piperi-
dine. The reaction proceeding was monitored by TLC. The
solid product was separated, filtered, washed with ethanol ,
and was purified by recrystallization from suitable solvents.
N’-benzylidene-2-hydroxybenzohydrazide 3 a
Pale yellow solid, m p 249 – 252 °C, yield = 75 % , MeOH ,
IR (KBr Disc):1626 (C=O amide) ,1311 ( C-O ) ,1944 ( C=N )
, 2855 (N=C-H), 1565 (C–N amide), 1311 (C-N benzylidene),
1453 (C=C) ,3035 (C sp2-H) aromatic ,725 (aromatic C-H);
P-mono substituted phenyl ring, 3441 (NH ) , 3240 (OH).
N’-(4-methylbenzylidene)-2-hydroxybenzohydrazide 3 b
Yellowish-white solid, m p 285– 290 °C , yield =
73 % , MeOH, 1HNMR [d6-DMSO]; δ 3.35 ppm (brS,1H,
OH ), 2.5 (S,3H, CH3 ) ,6.9 –7.8 ppm (complex spectra ,
8H , aromatic protons), 8.43 ppm (S,1H , -CH) , 11.83 ppm
(S,1H , NH) 13C NMR: 165.28 ,159.68,149.32,140.7,134.32
,131.96, 129.08, 127.82,119.44,117.85, 116.44,21.6.
N’(2-hydroxybenzylidene)-2hydroxybenzohydrazide 3 c
Yellowish-white solid , m p 285– 290 °C, yield = 73 % ,
MeOH , IR(KBr Disc) :1627 (C=O amide) ,1373 (C- O) ,1940
(C=N) , 2844 (N= C-H), 1560 (C-N amide), 1303 (C-N ben-
zylidene), 1487 (C=C) ,3051(C sp2-H) aromatic ,754 (aromatic
C-H); P-mono substituted phenyl ring, 3198 (NH ) , 3443 (OH).
N’-(4-methoxybenzylidene)-2-hydroxybenzohydrazide 3 d
Pale yellowish-white solid, m p 285– 290 °C, yield = 73
% , MeOH , IR (KBr Disc) :1615 (C =O amide),1376 ( C-O
amide ),1544(C=N ) , 2845 (N= C-H) , 1560 (C-N amide),
1308 (C-N benzylidene), 1455 (C=C),3063(C sp2-H) aromat-
ic, 827 (aromatic C -H); P-mono substituted phenyl ring, 3256
(NH) , 3456 (OH ) 1HNMR [d6-DMSO]: δ2.5ppm (S,1H, OH
) , 3.80 (S,3H, CH3) ,6.95 – 7.91 ppm (complex spectra , 8H ,
aromatic protons), 8.42 ppm (S,1H , -CH) , 11.78 ppm (S,1H
, -NH) . 13C NMR: 165.28, 161.57, 159.78, 149.26, 134.32,
129.46, 128.96, 127.18, 119.44, 117.86, 116.29,114.9,55.83.
N’-(4-chlorobenzylidene)-2-hydroxybenzohydrazide 3 e
White solid ,m p 225– 229 °C, yield = 73 % , MeOH
, IR (KBr Disc):1641 (C =O amide) , 1384 ( C-O amide)
,1913 (C = N ) , 2857 (N= C-H), 1606 (C -N amide), 1298
(C - Nbenzylidene), 1455 (C = C), 3065 (C sp2-H) aromat-
ic, 748 (aromatic C -H); P-di substituted phenyl ring, 3441 (
-NH ) , 3235 (OH ). 1HNMR [d6-DMSO];δ 2.5ppm (S,1H,
OH ) ,6.9 – 7.8 ppm (complex spectra , 6H , aromatic pro-
tons), 8.46 ppm (S,1H , -CH) , 11.78 ppm (SS,1H , -NH)
2.5. Synthesis of 2-(2-Hydrox-benzohydrazide) -oxo
–N-(substituted phenyl)1,3-thiazolidin-4-ones 4a-e
N’-benzylidene-2-hydroxybenzo hydrazides 3 a-e (0.001
mole) were refluxed with thioglycolic acid [TGA] (0.001 mole
, 0.3 ml) in DMF (15 ml ) in the presence of anhydrous ZnCl2
(1.36 gm ; 0.01 mole) for 8 h. The reaction proceeding was mon-
itored by TLC. After completion of the reaction, the mixture
was cooled and poured into crushed ice, the solid product sep-
arated was filtered ,washed with water, and recrystallize from
suitable solvents (Ganesh et al., 2010; Sekhar et.al., 2010).
20
 Kenawy et al., 2018, AJMS 1(1): 19-25 DOI:10.5455/ajms.4

2-hydroxy-N-((4-oxo-2-phenylthiazolidin-3-l) methyl) Table (1). The physical properties of the synthesized prod-
benzamide 4a ucts 2-4.
Yellowish-white solid, m p 240-242 °C , yield = 65 % IR Code Molecular formula Melting Yield % Solvent
(KBr Disc):1626 , 1560 (C=O) ,1309 ( C-O) , 1232 (C-N) ,1491 (Molecular weight) Point
(C=C) , 3061 (C-H) aromatic ,752(aromatic C-H); P-mono sub- 2 C7H8N2O2 143-145 80 MeOH
stituted phenyl ring , 3239 ( -NH ) , 2415 (-OH ) ,752 ( C–S ). (152)
2-hydroxy-N-((4-oxo-2-p-tolylthiazolidin-3- yl) methyl) 3a C14H12N2O2 249 -252 75 n-Butanol
benzamide 4 b (240)
Yellowish-white solid, m p 250-252 °C , yield = 65 % 3b C14H12N2O3 285 -290 73
IR (KBr Disc):1620 , 1563 (C=O),1311 (C-O) , 1240 (C-N (256)
) ,1504 (C=C),3042 (C-H) aromatic ,809 (aromatic C-H); 3c C15H14N2O2 255 -258 68
(254)
P- di substituted phenyl ring, 3423 ( NH) , 2721 (OH ) ,745
(C–S), 2857 (CH3), 1HNMR [d6-DMSO]: δ2.504 ppm (S,1H, 3d C15H14N2O3 178 -182 68
(270)
OH), 2.35 (S,3H, CH3) ,6.9 –7.8 ppm (complex spectra , 8H
, aromatic protons), 3.34 ppm (S,1H , CH2) , 11.81 ppm 3e C14H11N2O2Cl 249 -252 75
(274.5)
(S,1H , NH). 13C NMR: 165.2 ,159.65 ,149.3 ,140.7,134.
4a C18H16N2O3S 240-242 65
35,131.95,130.04,129.04,127.7,119.4,117.8,116.4. (340)
2-hydroxy-N-((2-(2-hydroxyphenyl)-4-oxothiazolidin-3-yl)
4b C16H14N2O4S 250-252 65
methyl) benzamide 4 c (330)
Yellowish-white solid, m p 258-260 °C , yield = 65 % , 4c C17H16N2O4S 258-260 65
IR (KBr Disc):1619 , 1562 (C=O) ,1309 (C-O) ,1229 (C-N ) (344)
,1503 (C=C) ,3033 (C-H) aromatic ,807(aromatic C-H); O- di 4d C17H16N2O4S 238-240 65
substituted phenyl ring,3262 (NH) , 3440 (OH ) ,741 (C–S ). (344)
2-hydroxy-N-((2-(4-methoxyphenyl)-4-oxothiazoli- 4e C16H13N2O3SCl 255-258 65
din-3-yl)methyl)benzamide 4 d (348.5)
Yellowish-white solid, m p 238-240 °C, yield = 65 % ,
IR (KBr Disc) :1616 , 1555 (C=O) ,1308 (C- O) ,1249 (C-N ) then recrystallized from methanol. Yellowish-white solid ,
,1509 (C= C) ,3069 (C-H) aromatic ,828(aromatic C-H); P- di m p 232 -234°C , yield = 73 %, IR(KBr disc) : 1009( C- O
substituted phenyl ring, 3441 (NH), 2728 (OH ),747 (C–S ), ),1750(C=N),1230 (C-N),1607 (C = C) ,3067 (C-H) aromatic
2854 (CH3 ). 1H NMR[d6-DMSO]: δ2.504 ppm (S,1H, OH ), , 752 (aromatic C-H) ; O- di substituted phenyl ring,1481( the
3.81 (S,3H, CH3) ,6.9 –7.7 ppm (complex spectra , 8H , aromat- triazine ring ),3125 ( -NH ) , 3296 (OH ) , 2858 (-CH3). 1HNMR
ic protons), 3.36 ppm (S,1H , CH2) , 11.75 ppm (S,1H , -NH) [d6-DMSO]: δ 10.2( S , 1H,NH), 6.9 – 7.9 ppm (complex spec-
2-hydroxy N-((2-(4-chlorophenyl)-4-oxothiazolidin-3-yl) tra , 4H, aromatic protons) ,1.96 (S,3H,-CH3) ,2.5(S,1H,OH).
methyl)-2-hydroxybenzamide 4e 2.8. Synthesis of 2-(6-amino-1,4-dihydro-1,3,5-triazin-2-yl)
Yellowish-white solid, m p 255-258 °C, yield = 65 % , phenol 7
IR (KBr Disc):1620 , 1555 (C=O), 1308 (C-O),1234 (C-N) A mixture of salicylic acid hydrazide 2 (1.52 g, 0.01
, 1489 (C= C), 3060 (C-H) aromatic, 822 (aromatic C-H); mole) and Urea (0.72 g, 0.012 mole) were heated at 180 °C
P- di substituted phenyl ring,3423 (NH), 3247 (-OH), 702 in an oil bath for 2 h followed by cooling and the solid prod-
(C–S), 651 (C-Cl). 1HNMR [d6-DMSO]: δ2.504 ppm (S,1H, uct obtained was filtered, washed with ethanol and dried then
OH ), 6.9 – 7.8 ppm (complex spectra , 8H , aromatic pro- recrystallized from methanol (Shaban et al., 1990 and Yous-
tons), 3.39 ppm (S,1H , CH2), 11.92 ppm (S,1H , -NH). sif et al., 2003) light beige solid, m p 243-246°C , yield =
2.6. Synthesis of 2-(1,4-dihydro-1,3,5-triazin-2-yl) phenol 68 % , IR(KBr disc) : 1043( C- O ),1703(C=N),1243 ( C-N
5 ) ,1552 (C=C) ,3071 (C-H) aromatic ,750(aromatic C-H) ;
A mixture of salicylic acid hydrazide 2 (1.52 g, 0.01 O- di substituted phenyl ring,1490( the triazine ring ),3311
mole) and formamide (0.47 ml, 0.012 mole) were heated at (NH ) , 3206 (OH ) , 3427 (-NH2) , 1HNMR [d6-DM-
180 °C in an oil bath for 2 h followed by cooling, the solid SO]: δ 10.33( S , 1H,NH),6.11 – 7.9ppm(complex spectra
product separated was filtered, washed with ethanol, dried , 4H, aromatic protons) ,3.3(S,1H,OH) ,2.5(S,2H,NH2).
and crystallizied from methanol white solid, m p 249 -252 2.9. Synthesis of 2-(2,5-dihydro-5,6-diphenylpyrimi-
°C, yield = 75 %, IR (KBr disc) : 1041 (C- O),1673(C=N), din-4-yl)phenol 8
1231 (C-N),1607 (C = C), 2955 (C-H) aromatic, 749 (ar- A mixture of salicylic acid hydrazide 2 (1.52 g, 0.01
omatic C-H) ; O- di substituted phenyl ring,1555 (the tri- mole) and Benzil (2.52 g, 0.012 mole) in absolute ethanol and
azine ring), 3125 ( -NH ) , 32290 (OH ). 1HNMR [d6-DM- triethylamine (5 ml) were heated under reflux for 2 h fol-
SO]: δ 11.82 (S, 1H,NH),7.94 (d,1H,CH), 6.95 – 7.4 ppm lowed by cooling and the solid product obtained was filtered
(complex spectra, 4H, aromatic protons), 3.3 (S,1H,OH). ,washed with ethanol, dried and recrystallizied from metha-
2.7. Synthesis of 2-(1,4-dihydro-6-methyl-1,3,5-triazin-2- nol (Shaban et al., 1990 and Youssif et al., 2003) buff solid
yl)phenol 6 , m p198 - 200°C, yield = 68 % , IR(KBr disc) : 1090( C- O
A mixture of salicylic acid hydrazide 2 (1.52 g, 0.01 ),1673(C=N),1231 ( C-N ),1543 (C=C) ,3056 (C-H) aromatic
mole) and acetamide (0.70 g, 0.012 mole) were heated at 180 ,748(aromatic C-H) ; O- di substituted phenyl ring,1543(the
°C in an oil bath for 2 h followed by cooling , the solid triazine ring ) , 2925 (-NH ) , 3219 (OH ) , 685 (phenyl
product obtained was filtered, washed with ethanol and dried
21
 Kenawy et al., 2018, AJMS 1(1): 19-25 DOI:10.5455/ajms.4

group). 1HNMR [d6-DMSO]: δ 11.2(S, 1H,NH),6.9 –7.9 ppm hyde , p-chloro- benzaldehyde ) in boiling methanol and in the
(complex spectra , 11H, aromatic protons), 3.36 (S,1H,OH). presence of a catalytic amount of piperidine, to afford the corre-
2.10. Synthesis of 3,4-dihydro-6-(2-hydroxyphe- sponding benzylidene salicylic acid hydrazides 3a- e in good
nyl)-1,3,5-oxadiazine-2-thione 9 isolated yields. Thiazolidinones are synthesized via variety of
A solution of a mixture of salicylic acid hydrazide routes such as reaction between benzylidene-amines and mer-
2 (1.52 g, 0.01 mole) in methanol (30 ml) and carbon di- captoacetic acid (Bolognese et al., 2004) or by condensation of
sulfide (2 mL, 0.033mol), and dry DMF (2 ml) was refluxed either aliphatic or aromatic moieties containing a formyl group
for about 5 h on a water bath , a solid separated , carbon with different aminothiols (Sattigeri et al., 2005) or by reflux-
disulfide was boiled off, the mixture was cooled, filtered and ing a solution of arylhydrazones and thioglycolic acid in DMF
rinsed with small amounts of DMF and absolute ethanol, in the presence of anhydrous ZnCl2 (Cacic et al., 2009, Singh
dried then recrystallized from methanol (Smakula and Bak- et al., 1981, Troeberg et al., 2001). On the basis of such proce-
er, 1984) white solid , m p 248 – 250 °C , yield = 70 % dure, the reaction was performed and the corresponding deriv-
, IR(KBr disc) : 1057( C- O) ,1777(C=N),1253 (C-N) ,1629 atives 2-(2-Hydrox-benzohydrazide) -oxo -N(substituted phe-
(C=C) ,3072 (C-H) aromatic ,743(aromatic C-H) ; O- di sub- nyl)1,3-thiazolidin-4-one 4 (a-e) were formed (Schemes 1 and 2).
stituted phenyl ring,1594( the triazine ring ),3273 (NH) , 3240
(OH ). 1HNMR [d6-DMSO]: δ 10.73( S , 1H,NH), 6.8 – 7.3 O
O O
ppm(complex spectra , 4H, aromatic protons),3.3(S,1H,OH). OCH3
N2H4 NHNH2 Ar - C H
OH MeOH MeOH / piperidine
OH
Table (2). The physical properties of the synthesized prod- [2]
ucts 5-9.
Code Molecular formula Melting Yield % Solvent O
O Ar
(Molecular weight) Point H NH
SHCH2COOH R
N N S reflux N
5 C8H6N3O 249 -252 75 MeOH OH C
OH H
(160) O
6 C9H9N3O 232 -234 73 [ 3 a -e ] ; a ; R =H , b ;R = p- Me
(175)
[4 a - e ] ; a ; R =H , b ;R = p- Me
c ; R =O-OH ,d ;R = p-OMe
c ; R =O-OH ,d ;R = p-OMe
e ; R = p-Cl
e ; R = p-Cl
7 C8H8N4O 243-246 68
(176)
Scheme 1
8 C21H16N2O 198 - 200 68
(312)
9 C8H6N2O2S 248 - 250 70 O
O
(194) OCH3
(a) N2H4 NH N H
OH H
MeOH O H
OH + C
2.11. Antimicrobial assessment [2]

R
The activities of all synthesized compounds were tested
MeOH / piperidine
O
in vitro against the Gram-positive bacteria Bacillus subtilis,
and Staphylococcus aureus, and the Gram-negative bacteria NH
R
N
Escherichia coli using nutrient agar medium, as well as against OH C
H
Candida albicans and Aspergillus niger using Sabouraud dex- [3 a -e ]
trose agar medium. All compounds activities were screened Ar
O O O
by agar diffusion method (Cruickshank et al., 1975). In brief, N Ar
SH DMF/reflux
N
H2
N C + HO C N C
a suspension of the organisms was added to sterile nutrient (b) H C
H2 ZnCl2 H C
C H
OH H OH S
agar media at 45 °C and the mixture was transferred to ster- - H2O O
ile Petri dishes and allowed to solidify. Holes (10 mm) were [ 3 a -e]
Ar
made using a cork borer and the synthesized compounds (0.1 CH
ml) and DMSO (control) were poured inside them. The plates O
S
O
Ar
N N
were pre-incubated for 1 h at room temperature and then N CH2
C
OH
HC N
incubated at 37 °C for 24 h. The zone of inhibition diame- OH
H
H
H C
O OH
ters were measured and compared with that of the standard. S CH2

Ar
3. Results and discussion O
H
CH
3.1. Chemistry N N S
The reaction sequence leading to the formation of com- OH C
CH2
pounds 3 and its further reaction to form compounds 4 is O
[4 a - e ]
outlined in Scheme 1. Compound 2 was prepared by the ac-
tion of hydrazine hydrate on methyl salicylate 1 and as pre- Scheme 2
viously described (Vidya et al., 2014). It reacted with a set of
aromatic aldehydes (including: benzaldehyde , p-methyl-ben-
zaldehyde ,o-hydroxy- benzaldehyde, p-methoxy-benzalde-
22
 Kenawy et al., 2018, AJMS 1(1): 19-25 DOI:10.5455/ajms.4

The IR spectrum of salicylic acid hydrazide 2 showed an
absorption band at 1640 cm-1 corresponding to C=O and at
1244 cm-1due to C-N stretching vibration of the amide group
, two bands at 3266 and 3313 cm-1 appeared due to the pres-
ence of -OH and -NH2 groups respectively. The IR spectra
for compounds 3 a-e showed the characteristic bands for
such derivatives; they were all characterized by strong absorp-
tion bands at region 1680 – 1610 cm-1 due to the carbonyl
group , they showed strong absorption bands ranging from
2700 – 2600 cm-1 due to the –OH group. All compounds
showed a characteristic absorption bands at 3450 cm-1 due
to the stretching vibration of N – H bond , the disappearance
of the NH2 peak at 3313 cm-1 and the appearance of C=N
stretching vibration band for benzylidine ring at 1944 cm-1
provide an evidence for the formation of such derivatives.
The 1HNMR spectra for compounds 3 a-e showed a sig-
nificant peaks at δ (11.6 – 12.0) ppm due to the -NH proton
and a sharp singlet peaks at δ (2.5) ppm for the proton
of the OH group , and a complex spectra were noticed at
the aromatic region in the range δ (6.9 – 8.0) ppm due to
the aromatic protons. The IR spectra for compounds 4
a-e were characterized by strong absorption bands at region
1620 cm-1 due to the carbonyl group , they showed absorption
bands ranging from 3440 – 3420 cm-1 due to the –OH group,
all compounds showed a characteristic absorption bands at
3230 - 3260 cm-1 due to the stretching vibration of N – H bond
, the disappearance of the C=N stretching vibration peak and
the appearance of bands at region 1562 - 1550 cm-1 due to the
carbonyl group of the thiazolidin-4-one ring which provide an
evidence for the formation of such derivatives. The 1HNMR
spectrum of compounds 4b,d,e showed a sharp singlet peaks
at δ 2.5 ,2.97 ppm due to the OH proton . Compounds 4b,e
showed a sharp singlet peaks at δ 2.35, 3.81 ppm, respectively
due to the three protons of CH3 group . A complex spectra
appeared at δ (6.9 - 7.8) ppm due to 8 aromatic ring protons.
The sharp singlet appeared at δ 11.81 ppm due to the –NH
proton. The disappearance of the singlet peak of –N-CH and
the presence of singlet peaks at δ 3.34,3.36,3.39 ppm re-
spectively were due to the –CH2 proton of the thiazolidinone
ring, confirming the formation of the desired compounds.
Our attention was directed to extent the application of sali-
cyloyl hydrazide 2 by tethering salicylic acid with heterocyclic
ring by reacting it with some reagents to yield the correspond-
ing derivatives 5 – 8, (Scheme 3).

Table (3). Band Assignments of the IR spectrum of compounds 2 – 4.

Code C=O C-O C=N C-N C=C C-H -NH -OH Other
arm
2 1640 3266 3133 3047 1588 1244 1821 1089

3a 1626 3441 3240 3035 1453 1565 1944 1379 2855 N=C-H
1311 C-N benzylidene
3b 1627 3468 3242 3037 1457 1555 1910 1315 2854 N=C-H
1311 C-N benzylidene
3c 1627 3443 3198 3051 1487 1560 1940 1373 2844 N=C-H
1303 C-N benzylidene
3d 1615 3456 3256 3063 1455 1554 1830 1376 2845 N=C-H
1308 C-N benzylidene
2926 CH3
3e 1641 3441 3235 3065 1546 1606 1913 1384 2857 N=C-H
1298 C-N benzylidene
815 C-Cl
4a 1626,1560 3415 3239 3061 1491 1232 - 1309 752 C-S

4b 1620,1563 3423 3261 3042 1504 1240 - 1311 745 C-S

2857 CH3
4c 1619,1562 3440 3262 3033 1503 1229 - 1309 741 C-S

4d 1616,1555 3441 3256 3069 1509 1249 - 1308 747 C-S

4e 1620,1555 3423 3247 3060
The structural characteristic features for the prepared
derivatives 5–9 were confirmed by IR and 1HNMR spec-
tra, that indicates the presence of the main groups as were
proposed. The IR spectrum was characterized by the pres-
ence of absorption bands at 1560 -1510 cm-1 corresponding
to the triazole ring and bands at 1600-1700 cm-1 region due
to stretching vibration of C=N. bands at 3100-3500 cm-1
region for the stretching vibration of NH , the stretching vi-
bration of OH was located within the range 3290 -3100
cm-1 region. The 1H NMR spectrum for these derivatives
were characterized by the presence of peaks at 10.5 -12.0
2854 CH3
1489 1234 - 1308 702 C-S
651 C-Cl
ppm due to the –NH proton , the OH proton resonated at 2.5-
3.5 ppm, aromatic protons resonated at the aromatic protons
region in the range of 6.5-8.00 ppm. The IR of compound
5 is characterized by the appearance of absorption bands at
1673cm-1 due to (C=N) , 1607 ccm-1 due to (C=C) , 2955
cm-1 due to the stretching frequency of (C-H aromatic), 1555
cm-1 due to the stretching frequency of (C-H aromatic of tri-
azine ring), 142 cm-1 due to (-NH), 3290 cm-1 due to (-OH).
The 1HNMR spectrum of compound 5 showed a sharp singlet
peak at δ 3.3 ppm due to the OH proton and complex spectra
appeared at δ (6.95 - 7.4) ppm due to 4 aromatic ring protons
23
 Kenawy et al., 2018, AJMS 1(1): 19-25 DOI:10.5455/ajms.4

O
and a singlet peak was appeared at δ 11.82 ppm due to the N N

–NH proton. The IR of compound 6 is characterized by the H - C - NH2 N

H
appearance of absorption bands at 1750 cm-1 due to (C=N ), fusion OH
1607 cm-1 due to (C=C ) , 3067 cm-1 due to the stretching fre- [5]
quency of (C-H aromatic) and 1481 cm-1 due to the stretching
O
frequency of (C-H aromatic of triazine ring), 3125 cm-1 due N N
to (-NH), 3296 cm-1 due to (-OH), 2858 cm-1 due to (-CH3). CH3 - C - NH2 N CH3
The 1HNMR spectrum of compound 6 showed a sharp singlet O fusion
OH
H

peak at δ 1.96 ppm due to 3 protons of the CH3 group , δ 2.5 NHNH2 [ 6]
ppm due to the OH proton . complex spectra appeared at δ
OH
(6.9 - 7.9) ppm due to 4 aromatic ring protons and a singlet [2]
O
N N
peak was appeared at δ 10.2 ppm due to the –NH proton. H2N - C - NH2
N NH2
The IR of compound 7 is characterized by the appearance of fusion H
absorption bands at 1703 cm-1 due to (C=N ),1552 cm-1 due OH
[7]
to (C=C ), 3071 cm-1 due to the stretching frequency of (C-H N N
aromatic). 1490 cm-1 due to the stretching frequency of (C-H Ph Ph
C C
aromatic of triazine ring ), 3311 cm-1 due to (-NH), 3206 cm-1 O O
Ph
Ph

due to (-OH), 3472 cm-1 due to (-NH2). The 1HNMR spectrum EtOH/Et3N reflux OH
of compound 7 showed a sharp singlet peak at δ 2.5 ppm due [8]
to 2 protons of the amino group. and δ 3.3 ppm due to the N NH
OH proton , a complex spectra appeared at δ (6.11 - 7.44) ppm CS2 / KOH O
due to 4 aromatic ring protons, and the peak appeared at δ reflux / DMF
S

10.33 ppm is due to the NH proton. The IR of compound 8 OH

[9]
is characterized by the appearance of absorption bands at 1637 Scheme 3
cm-1 due to (C=N ) , 1543 cm-1 due to (C=C ), 3056 cm-1 due
to the stretching frequency of (C-H aromatic), 1543 cm-1 due Table (4). Band assignments of the IR spectrum of compounds 5-9.
to the stretching frequency of (C-H aromatic of triazine ring )
, 2925 cm-1 due to (NH), 3219 cm-1 due to (OH) and 685 cm-1 Code C-O C=N C-N C=C C-H -NH -OH Other
arm
due to phenyl group. The 1HNMR spectrum of compound 8
showed a sharp singlet peak at δ 3.36 ppm due to the OH 5 3290 3124 2955 1607 1231 1673 1041 1481 TR
proton, a complex spectra appeared at δ (6.9 - 7.9) ppm due
to 11 aromatic ring protons , and a singlet peak appeared at 6 3296 3125 3067 1607 1230 1750 1009 1481 TR
2858 CH3
δ 11.2 ppm due to the NH proton. The IR of compound 9 is
characterized by the appearance of absorption bands at 1777 7 3206 3311 3071 1552 1243 1703 1043 1490 TR
3427 NH2
cm-1 due to (C=N ) , 1629 cm-1 due to (C=C ) , 3072 cm-1 due
to the stretching frequency of (C-H aromatic), 1594 cm-1due 8 3219 2925 3056 1543 1231 1673 1090 1543 TR
to the stretching frequency of (C-H aromatic of triazine ring), 685 PR
3273 cm-1 due to (NH) group , 3240 cm-1 due to (OH). The 9 3240 3273 3072 1629 1253 1777 1057 1151
1HNMR spectrum of compound 9 showed a sharp singlet peak C=S
at δ 3.3 ppm due to the OH proton a complex spectra appeared TR: triazine ring; PR: phenyl ring
at δ (6.8 - 7.3) ppm are due to 4 aromatic ring protons and
the peak appeared at δ 10.73 ppm due to the NH proton . Table (5). Inhibition zone diameters (mm) of compounds 2 - 9.

Code Bacillus Staph. E. coli Candida Aspergillus

3.2. Antimicrobial assessment subtilis aureus albicans niger
Inhibition zone diameters (highly active = inhibition zone 2 21 - 21 21 18
≥ 19 mm, moderately active = inhibition zone 14 - 18 mm;
slightly active = inhibition zone 7 - 13 mm; and inactive (-ve) 3a - 13 18 - -
= no inhibition zone ( Khalil et al., 2003) of the compounds 3b - - 13 - -
against some selected microorganisms are shown in Table 5. 3c 13 13 - 13 -
Most compounds showed decreased activities than salicylic
3d - - 18 - -
acid hydrazide 2 which showed high activity profile ; that may
be due to the presence of the hydrazino group. Compounds 3e 13 15 13 11 -
3b,d and 4 d were inactive against Gram +ve bacteria strains 4a 17 13 16 16 11
,while the other derivatives showed moderate activities. Com-
pounds 3c, 4 c were inactive against Gram -ve bacteria strains. 4b 18 21 21 18 13
All compounds were inactive against Candida albicans and As- 4c 13 13 - 13 -
pergillus niger except compounds 4 a,b. The presence of chlo- 4d - - 18 - -
rine atom in the aldehydic moiety in addition to the thiazolidine
ring has not enhanced the activity as expected [compound 4 4e 15 21 11 5 -
e]. Compound 5 was inactive against Gram +ve and Gram 5 13 - - 13 -
-ve bacteria strains, while the other derivatives were slightly 6 18 13 13 13 -
active. The presence of free amino group in compound 7 may
7 18 12 18 12 -
enhance the anti-bacterial properties. Compound 9 showed the
highest activity which may be due to the presence of the mer- 8 13 13 12 11 -
capto group. 9 23 20 19 20 -

24
 Kenawy et al., 2018, AJMS 1(1): 19-25 DOI:10.5455/ajms.4
Conclusion
Salicylic acid hydrazide was successfully accommodated
subunits of thiazolidine-4-ones or oroxadiazin or pyrimi-
din affording a set of derivatives which prove their utility
in medicinal chemistry ; as they showed a moderate to high
antimicrobial properties proving the synthetic utility of sal-
icylic acid hydrazide in constructing new heterocycles of
possible expected therapeutic relevance. The same molec-
ular hybrid template may afford more potent scaffolds upon
the incorporation of more effective substituents based on the
highly biological profile of salicylic acid hydrazide itself.
References
Baihua H., 2-substituted Thiazolidinones As Beta-3 Adrener-
gic Receptor Agonists , US Pat ,US 6821991 B2, 2004.
Barbosa V. A., Formagio A. S. N., Savariz F. C., Foglio M.
A., Spindola H.M., De Carvalho J.E., Emerson Mey-
er a E., Sarragiotto M.H. , Synthesis and antitumor activi-
ty of β-carboline 3-(substituted-carbohydrazide) derivatives
, Bioorganic & Medicinal Chemistry , 2011,19 : 6400–6408.
Bedia K.K , Elçin O. , Seda U. , Fatma K. , Nathaly S. , Sevim
R. , Dimoglo A. Synthesis and characterization of novel hy-
drazide-hydrazones and the study of their structure antitu-
berculosis activity,. Eur J Med Chem ,2006 , 41:1253–1261.
Bingul M. , Tan O. , Gardner C.R. , Sutton S. K. , Arndt G. M. , Marshall
G. M. , Cheung B.B. , Kumar N. , Black D. StC. , Synthesis, Char-
acterization and Anti-Cancer Activity of Hydrazide Derivatives
Incorporating a Quinoline Moiety , Molecules , 2016, 21: 916-922.
Bolognese A. , Correale G. , Manfra M. , Lavecchia A. ,
Novellino E. , Barone V. ,Thiazolidin-4-one formation.
Mechanistic and synthetic aspects of the reaction of im-
ines and mercaptoacetic acid under microwave and conven-
tional heating , Org. Biomol. Chem., 2004, 2: 2809-2813.
Bondock S., Khalifa W., Fadda A. A. , Synthesis and antimicrobi-
al evaluation of some new thiazole, thiazolidinone and thiazo-
line derivatives starting from 1-chloro-3,4-dihydronaphtha-
lene-2-carboxaldehyde., Eur. J. Med. Chem. ,2007, 42(7):948-54.
Cacic M. , Molnar M. , Balic T., Draca N. , Rajk-
ovic V. , Design and Synthesis of Some Thiazoli-
din-4-ones Based on (7-Hydroxy-2-oxo-2H-chromen-
4-yl) Acetic Acid , Molecules ,2009, 14(7):2501-2513.
Cihan-Üstündağ G., Şatana D., Özhan G., Çapan G., ,In-
dole-based hydrazide-hydrazones and 4-thiazolidinones:
synthesis and evaluation as antitubercular and anticancer
agents. , J Enzyme Inhib Med Chem. ,2016, 31(3):369-80.
Cruickshank, R., Duguid, J.P., Marimon, B.P and Swain, R.N.A. , Medi-
cal Microbiology. 12th edn, Churchill Livingstone, London. 1975.
Dachineni R. , Ai G., Kumar DR . , Sadhu S.S. , Tumma-
la H., Bhat G.J . , Cyclin A2 and CDK2 as Novel Tar-
gets of Aspirin and Salicylic Acid: A Potential Role in Can-
cer Prevention, Mol Cancer Res. , 2016 14(3):241-52.
El-Feky S.A. , Synthesis and anticonvulsant properties of
some novel quinazolinone thiazolidine and 4-thiazo-
lidone derivatives , Pharmazie , 1993 , 48(12):894-6.
Elshaier Y. A. , Marzouk A. A , Docking and Synthetic Studies of Some
Salicylic and Indomethacin Derivatives as Potential Inhibitors of
Cyclin-Dependent Kinase 2 , J.Org Chem Ind, 2015,11(5):117
Ermann P. H. , Henner S., Heterocyclic Hydrazide Derivatives Of Mon-
ocyclic Beta -lactam Antibiotics , U.S. Pat. , US 5,318,963, 1994.
Ganesh C. K. ,Yadav D. B. & Venkatesh K. B. , synthesis and biological
evaluation of some innovative coumarine derivatives containing
thiazolidin-4-one ring , Indian J.Chem., 2010 , 49B: 1151-1154.
Gürsoy A., Terz N., Synthesis and Isolation of New Re-
gioisomeric 4-Thiazolidinones and Their Anticon-
vulsant Activity, Turk J Chem , 2005, 29 , 247 -254.
25
Khalil N. S.A.M. , Synthesis of a novel class of 1,ω-bis/(hydrazides),
(hydrazones), (1,3,4-oxadiazoles) and (1,3,4-thiadiazoles)
with potential antimicrobial activity , OCAIJ ,2011, V.7(4)
Khalil, A. A. , Abdel Hamide, S. G. ,Abd-ulrahman , M. Al-
Obaid, Hussein I. El-Subbagh ,Substituted Quinazolines,
Part 2. Synthesis and In‐Vitro Anticancer Evaluation of
New 2‐Substituted Mercapto‐3H‐quinazoline Analogs ,
Arch. Pharm. Pharm. Med. Chem., 2003 , 336, 95–103 .
Koopaei M. N., Assarzadeh M. J., Almasirad A., Ghasemi-Nir-
ib S. F., Amini M. , Kebriaeezadeh A. , Koopaei N. N. ,
Ghadimi M. , Tabei A. , Synthesis and Analgesic Activi-
ty of Novel Hydrazide and Hydrazine Derivatives , Iranian
Journal of Pharmaceutical Research ,2013, 12 (4): 721-727 .
Lakhan, R.; Singh, R. L., Synthesis and evaluation of 2-imino-3-(4-ar-
ylthiazol-2-yl)-4-thiazolidinones and their 5-arylidene derivatives
as potential fungicides , J. Agric. Food Chem. ,1991, 39: 580-585.
Mansour A., Eid M. M. , Khalil N. S. A. M . , Synthesis and Reactions of
Some New Heterocyclic Carbohydrazides and Related Compounds
as Potential Anticancer Agents , Molecules ,2003, 8: 744-755.
Naqvi A. , Shahnawaaz M., Rao A. V. , Seth D. S. , Sharma
N. K. , Synthesis of novel 3-Hydrazino-3-oxo-N-(4-sul-
famoylphenyl)-propanamide , Molbank , 2009 (1), M586.
Pattan S. R., Rabara P. A., Pattan J. S., Bukitagar, A. A., Wakale
V. S., Musmade D. S., synthesis and evaluation of some nov-
el substituted 1,3,4-oxadiazole and pyrazole derivatives for
antitubercular activity, Ind J Chem ,2009, 48B: 1453-1456.
Plech T. , Paneth A., Kapro B., Kosikowska U., Malm A., Strzelczyk
A. and Stazczek P., Structure–activity Relationship Studies of Mi-
crobiologically Active Thiosemicarbazides Derived from Hydrox-
ybenzoicAcid Hydrazides , Chem Biol Drug Des ,2015; 85: 315–325.
Popiołek Ł. , Hydrazide–hydrazones as poten-
tial antimicrobial agents: overview of the litera-
ture since 2010 , Med Chem Res , 2017,26:287–301.
Sattigeri, V. J. , Soni, A., Singhal, S., Khan, S., Pandya, M. , Bhateja, P.,
Mathur, T. , Rattan, A., Khanna, J. , Mehta, A. Synthesis and anti-
microbial activity of novel thiazolidinones , Arkovic , 2005, ii, 46.
Sekhar K. V. G. C., Rao V.S., Reddy A. S. , R.Sunandini A. S., Satu-
luri V. S. A. K. , Solvent Free Microwave Accelerated Synthesis
of Heterocyclic Thiazolidin-4-ones as Antimicrobial and Antifun-
gal Agents , Bull. Korean Chem. Soc. , 2010, 31(5): 1219-1225.
Shaban M. A. E., Nasr A. Z. , Taha M. A. M., Synthe-
sis of condensed 1,2,4-triazolo-heterocycles , Jour-
nal of Islamic Academy of Sciences , 1990,3:3,174−179.
Singh, S.P., Parmar, S.S., Raman, K., Stenberg,V.I. ,Chemistry and Biolog-
icalActivities of 1, 3-Thiazolidin-4-ones, Chem. Rev., 1981, 81,175.
Smakula E., Baker D.C . ,A definitive synthesis of 2-[(5-methyl-s-tri-
azolo[4,3-c]quinazolin-3-yl)thio]- N-benzylacetanilide and other
reactions of its precursors , CAN. J. CHEM., 1984 , 62,2570-2576.
Troeberg, L., Chen, X. , Flaherty, T.M. , Morty, R.E. , Cheng,
M. , Hua, H. , Springer, C. , Mc Kerrow, J.H. , Kenyon, G.L.,
Lonsdale-Eccles, J.D. , Coetzer, T.H.T. , Cohen, F.E. ,Chal-
cone, Acyl Hydrazide, and Related Amides Kill Cultured Tryp-
anosoma brucei brucei, Mol. Med. (N.Y.), 2000, 6, 660-669.
Verma G., Marella A., Shaquiquzzaman M., Akhtar M., Rah-
mat M.A., M. M. Alam , A review exploring biological activi-
ties of hydrazones , J. Pharm. Bioallied Sci. ,2014 ,6(2): 69–80.
Vidya V. G. , Mini S. , Synthesis, Spectroscopic Characterisa-
tion and Biological Studies of Copper (Ii) Complex De-
rived from Salycyloyl Hydrazide with Furfuraldehyde ,
Research Journal of Recent Sciences , 2014, 3: 154-156.
Youssif S., El-Bahaie S., and Nabih E., A Facile One-pot
Synthesis of Fused 2-Thiouracils: Dipyrimidinopyri-
dine, Pyrazolopyrimidine and Pyridazinopyrimidines ,
Bull . Korean Chem. Soc. , 2003, 24 (10):1429-1432.
 El-Sayed et al., 2018, AJMS 1(1): 26-30 DOI:10.5455/ajms.5

Arabian Journal of Medical Sciences

http://www.ajms.tk

Naringenin and hesperidin ameliorate iron oxide nanoparticles toxicity in rat liver
Abeer A. El-Sayeda*, Mohamed M. Husseinb, Aida H. Solimana
a
Chemistry Department, Faculty of Science, Suez Canal University, Egypt
b
Biochemistry Department, Faculty of Veterinary Medicine, Zagazig University, Egypt

Article Info Abstract

Background: Although, iron oxide nanoparticles (IONs) have some beneficial effects in medical imaging for
Keywords: disease diagnosis and drug delivery for cancer treatment, they accumulated in the hepatocytes, thereby leading to
Iron oxide nanoparticles; oxidative stress-induced liver damage. Objectives: We investigated the possible protective effect of naringenin
(Nar) and hesperidin (Hes) against IONs-induced liver toxicity in rats. Materials and methods: A total number
Naringenin;
of 70 white male Sprague-Dawley rats randomly assigned into seven groups: group 1 (normal control), group
Hesperidin;
2 (treated with 20 mg/kg Nar), group 3 (given 15 mg/kg Hes), group 4 (received 150 mg/kg IONs), group 5
Antioxidant; (IONs + Nar), group 6 (IONs + Hes), and group 7 (IONs + Nar + Hes). All treatments were given orally by
Liver toxicity stomach gavage for 30 days. The evaluated parameters included liver function markers, biochemical assays
[antioxidant markers (SOD, CAT and GSH), and lipid peroxidation (MDA)], gene expression of SOD and CAT,
Received Aug 22, and histopathology of liver tissues. Results: In IONs-treated group, serum levels of AST, ALT, total and direct
Revised Sep 20, bilirubin, and liver MDA contents were significantly increased while serum level of albumin, and mRNAs levels
Published Sep 22, 2018 and enzyme activities of SOD, CAT, and GSH levels in liver were significantly decreased comparing to the normal
control group. Moreover, administration of IONs led to hydropic degeneration with congestion of the central vein
and mononuclear cells infiltration. However, treatment with Nar and Hes restored these disrupted parameters and
improved hepatic tissues damage and function to level comparable to that of the control. Conclusion: Using high
*Corresponding author:
concentration of IONs could cause oxidative liver damage as evidenced by high ROS, less antioxidant activities,
amr4moh@gmail.com
damage to hepatocyte and elevation of liver damage enzymes and this adverse effect was reversed by Nar and Hes.

1. Introduction 2. Materials and methods

Iron oxides are found in many forms in nature, including mag-
netite (Fe3O4), maghemite (γ-Fe2O3), and hematite (α-Fe2O3)
(Chan and Ellis, 2004). During the last few years, iron oxide nano-
particles (IONs) attracted the attention of many researchers due to
their nano size, high surface area to volume ratios and super-para-
magnetism (Pan et al., 2010). However, their extensive use in many
fields was associated with some tissue toxicities. Although IONs
have some beneficial effects in medical imaging for disease diag-
nosis and drug delivery for cancer treatment, they accumulated in
the hepatocytes, thereby leading to oxidative stress-induced liver
damage (Babadi et al., 2012). This prompts researchers to look for
suitable adjuvants (agents) to reduce the site effects of these nan-
oparticles without decreasing their benifical effects. Among these
agents, the herbal plant extracts and natural products components,
with particular concern to flavonoids, come on the top for their po-
tent antioxidant effect (Kazazić, 2004). These flavonoids also have
antibacterial, antifungal, antiviral and anticancer activities (Alcerito
et al., 2002; Wen et al., 2010).
Naringenin (Nar), a flavonoid found in high concentrations in
grapefruits and citrus fruits, is a safe natural product with a wide
range of medicinal activities (Kanno et al., 2005). Hesperidin (Hes),
a flavanone glycoside found in sweet orange and lemon, has an-
ti-oxidant, anti-inflammatory, anti-microbial and anti-cancer effects
(Cho, 2006; Garg et al., 2001). We hypothesized that administration
of Nar and Hes could inhibit the IONs-induced oxidative liver dam-
age. To check this possibility, we evaluated the potential protective
effect of Nar and Hes against IONs-induced liver toxicity in rats
through investigation of liver damage markers (AST, ALT, albumin,
and bilirubin), oxidative stress/antioxidant biomarkers (MDA, GSH,
SOD, CAT) and histopathological examination of hepatic tissue.
26
2.1. Materials
IONs were obtained from Beni Suef Research Cen-
ter with the following properties: spherical, < 50 nm parti-
cle size, and ≥ 98% trace metals basis. Hes and Nan pow-
der was purchased from Sigma Co., USA, with purity ≥ 90%.
2.2. IONs Diffraction by X-Ray
The amorphous nature of IONs was determined by X-ray diffrac-
tion (XRD) at room temperature. The XRD patterns (Bragg peaks)
were recorded with a PANalytical, Netherland X’pert PRO diffrac-
tometer using a solid state detector with a monochromatized Cu Ka1
(kCu = 1.54 A˚) radiation source at 40 kV.
2.3. Animals and diet
Seventy white male Sprague-Dawley rats (4-6 weeks old and
weighting 150-200 gm) obtained from the Laboratory Animal Re-
search Center, Faculty of Veterinary Medicine, Zagazig University
were housed in metal cages at 22°C ± 3°C, 55% ± 5% humidity, 12
h dark/light cycle and supplied with the basal diet and water ad libi-
tum. The animal were left for 14 days for acclimatization before the
beginning of the experiment. This study was approved by the Animal
Ethical Committee of Faculty of Veterinary Medicine, Zagazig Uni-
versity and was in accordance with their rules.
2.4. Experimental design
The rats were randomly divided into seven groups (n = 10 per
group) as follows: G1: received 1 ml/day normal saline, G2: given
Nar (20 mg/kg body weight, bw) (Karnakar et al., 2014), G3: admin-
istrated Hes (15 mg/kg bw) (Cho et al., 2009), G4: given IONs (150
mg/kg bw) (Babadi et al., 2012), G5: received IONs (150 mg/kg bw)
 El-Sayed et al., 2018, AJMS 1(1): 26-30 DOI:10.5455/ajms.5

+ Nar (20 mg/kg bw), G6: administrated IONs (150 mg/kg bw) + Hes IONs grain size through Scherrer equation D = Kλ/ (β cos θ); where K
(15 mg/kg bw), and G7: given IONs (150 mg/kg body bw) + Nar (20 is constant (0.9), λ is the wavelength (λ = 1.54060A°) (Cu K-Alpha1),
mg/kg bw) + Hes (15 mg/kg bw). All treatments were given orally by β is the full width at the half-maximum of the line and θ is the angle of
stomach gavage for 30 days. diffraction. The estimated grain size employing the relative intensity
peak for IONs was 20 nm and the addition in sharpness of XRD peaks
2.5. Sampling
showed that particles had crystalline nature. All the various peaks in
For biochemical analysis, venous blood from the orbital sinus of figure 1 were related to IONs and linked to Joint Committee for Powder.
rat was collected and the serum was obtained by centrifugation at 3000
rpm for 15 min. After blood collection, rats were killed by cervical
decapitation and livers were dissected out from all groups then divided
into 3 parts. The first portion was rinsed in cold physiological isotonic
saline (0.9% NaCl) to remove contaminated blood where 1gm of tissue
samples was sliced and homogenized in 9 ml physiological saline us-
ing electric tissue homogenizer. The homogenate was then centrifuged
at 3000 rpm for 15 min and the clear supernatant was obtained for
determination of MDA, GSH concentration, SOD, CAT activities. The
second portion was stored in liquid nitrogen to be used in molecular
analysis using qPCR. The third portion was fixed in 10% buffered neu-
tral formalin to be used further in histopathology.

2.6. Biochemical parameters

The serum levels of alanine amino-transferase (ALT), aspartate
aminotransferase (AST), albumin and total &direct bilirubin were
estimated, as parameters of liver functional test, using commercially
available kits (Bio-Diagnostic, Egypt). The lipid peroxidation marker
MDA, and GSH levels as well as the activities of SOD and CAT were
determined in liver as previously described (Abdelhadya et al., 2017).
2.7. Molecular analysis by qPCR
Trizol (Thermo Scientific, Life Technology, USA) was used to
isolate total RNA from liver tissues. The obtained RNA was revise
transcribed into cDNA (Qiagen Long range RT-PCR kit). The prim-
er sequence for CAT gene was F: 5’GCGAATGGAGAGGCAGT-
GTAC3’, R: 5’GAGTGACGTTGTCTTCATTAGCACTG3’; for
Cu-ZN-SOD gene F: 5’GCAGAAGGCAAGCGGTGAAC3’, R: 5’
TAGCAGGACAGCAGATGAGT3’, and for the internal control β
actin F: 5’CCTGCTTGCTGATCCACA3’, R: 5’CTGACCGAGCGT-
GGCTAC3’.The thermal profile for PCR was 95°C for 10 min, fol-
lowed by 40 cycles of 95°C for 10 s and 60°C for 30 s. Each transcript
was relatively quantified in three replicates by calculation using the 2
-ΔΔCt
method.
2.8. Histopathological examination
The liver samples were dehydrated in ascending series of etha-
nol, cleared in xylol then embedded in paraffin wax, sectioned (6 µm),
mounted on clean glass slides, and stained with haematoxylin and eo-
sin.
2.9. Statistical analysis
All the data were expressed as means ±SE. The statistical signifi-
cance was evaluated by one-way analysis of variance (ANOVA) using
SPSS, 18.0 software, 2011 and individual comparisons were obtained
by Duncan’s multiple range test (DMRT). Values were considered sta-
tistically significant when p<0.05.
3. Results
3.1. IONs diffraction by X-Ray
In the XRD pattern for IONs, the absorption of diffraction peaks oc-
curred at 2θ values (Fig.1). The prominent peaks were used to estimate
27
Fig.1. Powder XRD patterns of IONs with Miller indices shows crystal fam-
ily of planes for each diffraction peak.
3.2. Effect of naringenin and/ or hesperidin treatment on
liver damage markers in IONs-intoxicated rats
The significant effects of IONs on the liver damage are shown in
Figure 2. A significant increase was observed in serum levels of ALT,
AST, total and direct bilirubin content in G4 (IONs) compared with
the three control groups (G1-G3). This elevated level of liver damage
mrkers was significantly reduced following treatment by Nar (G5),
Hes (G6) each alone or in combination (G7), with lowest level in G7.
In contrast, serum level of albumin was significantly decreased in G4
(IONS), as compared to the three control groups (G1-G3), but this
level was significantly increased following treatment by Nar and/or
Hes without significant differences between the three treated groups
(G5-G7). On the other hand, no significant difference in all measured
serum biochemical parameters was noticed between the three control
groups (G1-G3), except for ALT which was higher in G3 than G1.
3.3. Effect of naringenin and/ or hesperidin treatment on
antioxidant system
A significant increase in liver MDA level was noticed in IONs in-
toxicated group (G4) when compared to the control groups (G1-G3,
Fig. 3). This increased level was significantly decreased after treat-
ment by Nar (G5) and Hes (G6) alone or in combination (G7). On the
other hand, G4 and G5 exhibited a significant reduced activity of SOD
in liver, while in G6 and G7 the SOD level was maintained almost to
that of the control groups (Fig. 3). G4 showed a significant reduction in
the activities of CAT and GSH as compared to the control groups (G1-
G3). This alteration could, however, be prevented by using Nar and/
or Hes with best effect for the combined treated group (G7) (Fig. 3).
3.4. Effect of naringenin and/or hesperidin on gene expres-
sion of SOD and CAT
The qPCR data showed a significant downregulation of SOD and
CAT genes in livers of IONs-intoxicated group (G4) relative to the
control groups (Fig. 4). This reduction was significantly increased
after fed on Nar and/or Hes, with highest expression in G7. Notably,
the control groups (G2 and G3) showed a significant elevation in SOD
and CAT expression as compared to the normal control group (G1).
 El-Sayed et al., 2018, AJMS 1(1): 26-30 DOI:10.5455/ajms.5

Fig.4. Effect of narin-

genin and/ or hesperidin
on relative expression of
CAT and SOD genes in
liver of IONs-intoxicated
rats. Analyses were per-
formed in triplicate. Data
are the mean±SE of three
different liver samples in
same group. Means within
columns carrying differ-
ent superscript letters are
significantly different at
P≤ 0.05.

Fig.2. Effect of IONs administration on biochemical parameters and possible

protective effect of Nar and/or Hes. Analyses were performed in triplicate.
Data are the mean ±SE of seven different liver samples in same group. Means
within columns carrying different superscript letters are significantly different
at P≤ 0.05.

Fig.3. Effect of naringenin and/or hesperidin administration on oxiditive

stress/antioxidant parameters (MDA, SOD, CAT GSH) in liver of IONs-in-
toxicated rats. Data are the mean ±SE of seven different liver samples in same
group. Means within columns carrying different superscript letters are signif-
icantly different at P≤ 0.05.
3.5. Histopathological analysis
Livers of the control groups (G1-G3) showed normal structure
[hepatocytes arranged in cords radiating from the central vein (ar-
rowhead) with hepatic portal area (arrows) consisting of a bile duc-
tule and a portal blood vessel] (Fig. 5A-C). In contrast, liver of IONs Fig.5. Effect of naringenin and/or hesperidin treatment on liver histology of
IONs-intoxicated rats. Photomicrograph of liver tissue; A, group1; B, group 2 ;
group (G4) demonstrated hydropic degeneration with congestion of
C, group 3; D and E, group 4; F, group 5 ; G, group 6; H, group 7. H&E, in all
the central vein (arrow), apoptosis/necrosis of hepatocytes, marked photos X=400, except in B = 100.
by pyknotic nuclei (arrowheads, Fig. 5D), severe vacuolation (arrow- Fig. 5F and G), and few aggregated mononuclear cells in the portal
heads, Fig. 5E) with infiltration of mononuclear inflammatory cells area (arrow, Fig. 5G). Notable improvement was noticed in G7 which
in the portal area (arrow, Fig. 5E). This disrupted histology was im- exhibited normal histological structures of the hepatic parenchyma
proved after treatment by Nar or Hes with only moderate congestion with only very rare vacuolated hepatic cells (arrowheads, Fig. 5H).
of the central vein (arrow, Fig. 5F), slight vacuolation (arrowheads,
28
 El-Sayed et al., 2018, AJMS 1(1): 26-30 DOI:10.5455/ajms.5

4. Discussion enging extracellular non-lipid radicals that initiate lipid peroxidation

(Chen et al., 2010; Heffner and Repine.,1989; Tirkey et al., 2005).
The significant increased levels of AST, ALT, total and direct bili-
In the present study, IONs treated rats showed severe apoptotic/
rubin noticed in group 4 (IONs) as compared to the control groups (G1-
necrotic changes, congestion of central venous circulation, inflamma-
G3) indicates liver tissue damage by these IONs which let these liver
tory cell infiltration, fatty degeneration and vacuolization. This may be
damage markers to leak from liver into the circulation, thereby raising
due to the formation of highly reactive radicals and subsequent lipid
their levels in blood (Pratt and Kaplan, 2000). In agreement with our
peroxidation resulting from IONs. Similar liver damage induced by
findings, Babadi et al., (2012) also found that using high concentration of
IONs was also previously reported (Babadi et al., 2012; Karnakar et
IONs caused undesirable effects on liver with damage to hepatocyte and
al., 2014; Parivar et al., 2016). Again, Nar and/or Hes reduced the his-
increase in liver enzymes. In contrast, Wisse et al., (1991) showed that
tological changes raised by IONs. Taken together our findings indicate
inhalation of IONs caused a significant reduction in liver enzymes and
that the administration of Nar and/or Hes in IONs intoxicated animals
attributed this reduction to the ability of the Kupffer cells to efficiently
counteracted the oxidative hepatic dysfunction attributed by IONs.
metabolize IONs than liver endothelial cells. This difference from our
Overall, rats co-treated by Nar and Hes had better effect than
results may be due to the variation in the route of exposure and duration.
those treated by each alone. This indicates that both flavonoid can act
Unlike IONs, treatment by Nar and/or Hes led to a significant re-
synergically to relieve IONs-induced liver toxicity. This effect may
duction in serum levels of AST, ALT, total and direct bilirubin indi-
be attribute to the potent antioxidant effects of the two flavonoids
cating structural and functional improvement in liver. This suggests a
which can reduce oxidative stress (by decreasing the MDA level) in-
possible ameliorative effect to these two flavonoids against liver tox-
duced by IONs and can increase the levels of endogenous antioxi-
icity induced by IONs. These results coincided with a previous study
dant parameters (SOD, CAT, and GSH) that was inhibited by IONs.
in which Nar has been reported to restore the level of serum AST, ALT
Taken together, this co-treatment strategy maximizes the therapeutic
and bilirubin in dimethyl nitrosoamine-induced hepatotoxicity (Lee et
efficacy of the two flavonoids against IONs-induced liver toxicity.
al. 2004). Additionally, Hes has been shown to decrease liver dam-
age, prevent the escape of liver enzymes through maintaining of cell Conclusion
membranes integrity (Pradeep et al., 2008). Moreover, the notable in-
Oral administration of high dose of IONs caused structural and
crease in total and direct bilirubin and the lower albumin levels fol-
functional liver tissue damage through, at least in part, induction of
lowing administration of IONs also confirm the hepatotoxic effect of
oxidative stress. This adverse effect could be relieved by Nar and/or
these NPs and the ability of Nar and Hes to relieve this toxic effect.
Hes treatment with best effect for the combined treatment. As a result,
The toxic effect of nanoparticles mainly attributed to induction of
consumption of fruit or vegetables enriched in these flavonoids can
oxidative stress through overproduction of free radicals and disruption
protect humans against liver toxicity and help maintain healthy liver.
of the endogenous antioxidant system (Simko et al., 2010; Wan et al.,
Thus, Nar and Hes could be used in prevention and therapy of IONs-in-
2012). In consistent with this hypothesis, we also found a significant
duced liver damage, however further studies are needed to unveil
increase in the lipid peroxidation biomarker MDA and a significant
the actual underlying mechanism of action for these two flavonoids.
decrease in the activities and mRNA level of the antioxidant enzymes
(SOD and CAT) and the GSH content in the livers of rats-intoxicat- References
ed by IONs. This indicates that IONs may exert its hepatotoxic ef-
Abdelhadya, D.H., El-Magd, M.A., Elbialy, Z.I., Saleh, A.A., 2017.
fect through, at least in part, elevation of free radicals and decrease
Bromuconazole-induced hepatotoxicity is accompanied by
in intracellular antioxidant activities. Subsequently, this oxidative
upregulation of PXR/CYP3A1 and downregulation of CAR/
stress-induced damage causes lipid peroxidation to cell membrane and
CYP2B1 gene expression. Toxicol Mech Methods 27(7):544-550.
leakage of liver enzymes (Rice-Evans et al., 1993). In consistent with
Ahamed, M.; Alhadlaq, H.A.; Alam, J.; Khan, M.A.; Ali, D.;
our data, previous studies on toxicity of magnetite and IONs reported
Alarafi, S. (2013). Iron oxide nanoparticle-induced oxida-
similar results in rat liver (Ahamed et al., 2013; Könczöl et al., 2011).
tive stress and genotoxicity in human skin epithelial and
Ahamed et al., (2013) also reported induction of genotoxicity by IONs
lung epithelial cell lines. Curr Pharm Des;19: 6681–90.
with increased levels of DNA damage in skin and lung epithelial cells.
Alcerito, T.; Barbo, F.E.; Negri, G.; Santos, D. Y.A.C.; Meda, C.I.;
Antioxidant activity or inhibition of free radical generation pro-
Young, M.C.M.; Chávez, D. and Blatt, C.T.T. (2002): Foliar epi-
vides protection against hepatic damage (Shahjahan et al., 2004). In
cuticular wax of arrabidaea brachypoda: flavonoids and antifungal
support, administration of Nar and/or Hes resulted in significant im-
activity. Biochemical Systematics and Ecology; 30(7): 677 – 683.
provement in antioxidant status (as revealed by increased SOD and
Babadi, Y.V.; Najafi, Y.; Najafi, A.; Gholami, H.; Zarji, B.E.M.;
CAT activities and mRNA levels, and GSH levels in the liver) and a
Jalal Golzadeh, J.; Amraie, E.; Shirband, A. (2012): Evalua-
significant reduction in oxidative stress (as indicated by drop in MDA
tion of iron oxide nanoparticles effects on tissue and enzymes
level in the liver) as compared to IONs-intoxicated rats. Our results
of liver in rats. J Pharm Biomed Sci; 23 (04): 2230 – 7885.
agree with Mira et al., (2002) who also found a similar antioxidant
Bolarin, D.M. (1984): Serum bile acid in the evalua-
activity for Nar against apoptosis induced by oxidative damage. Nar
tion of colchicines treatment of carbon tetrachlo-
antioxidant effect was attributed to presence of 4 hydroxyl group in
ride induced liver injury. ExpMolPathol; 41: 384–389.
the B ring, which effectively inhibits free radicals production through
Chan, H.B.S; Ellis, B.L. (2004). Carbon-encapsulated ra-
electron donating and direct targeting for free radicals (Van Acker et
dioactive 99mTc nanoparticles. Adv Mater 16:144–9.
al., 2000). Nar also can protect liver from damage by oxidative stress
Chen, M.; Gu, H. and Ye, Y. (2010): Protective effects of hes-
through increasing the expression of c-glutamyl cysteine synthetase,
peridin against oxidative stress of tertbutyl hydroperox-
the rate limiting enzyme in the synthesis pathway of GSH (Bolarin,
ide in human hepatocytes. Food ChemToxicol; 48:2980–7.
1984; Chetia et al., 2012). However, Hes was reported to reduce liv-
Chetia, P.; Bala, A.; Khandelwal, B.; Haldar, P.K. (2012).
er damage induced by oxidative stress in a dose-dependent manner
Comparative in vitro free radical scavenging proper-
through terminating lipid peroxidation side chains rather than scav-
29
 El-Sayed et al., 2018, AJMS 1(1): 26-30 DOI:10.5455/ajms.5
ty of b-carotene and naringenin with respect to vita-
rus bioflavonoid, and decreases the oxidative stress produced by car-
min C and N-acetyl Cysteine. Pharmacologia; 3:724–728.
bon tetrachloride in rat liver and kidney, BMC Pharmacol; 5 (2005)2.
Cho, J. (2006): Antioxidant and neuroprotective effects of hesperi-
Van Acker, F.A.A.; Schouten, O.; Haenen, G. R.; Van der Vi-
din and its aglycone hesperetin. Arch.Pharm. Res; 29: 699-706.
jgh, W.J.F. and Bast, A. (2000): Flavonoids can replace
Choi, S.J.; Oh, J.M. and Choy J.H. (2009): Toxicological effects of
a-tocopherol as an antioxidant. FEBS Lett; 473: 145–148.
inorganic nanoparticles on human lung cancer A549 cells,” Jour-
Wan, R.; Mo, Y.; Feng, L.; Chien, S.; Tollerud, D.J. and Zhang,
nal of Inorganic Biochemistry, vol. 103, no. 3, pp. 463–471, 2009.
Q. (2012): DNA Damage Caused by Metal Nanoparti-
Garg, A.; Garg, S.; Zaneveld, L.J.; Singla, A.K. (2001).
cles: Involvement of Oxidative Stress and Activation of
Chemistry and pharmacology of the Citrus flavo-
ATM. Chemical Research in Toxicology; 25: 1402-1411.
noid hesperidin. Phytother. Res; 15 : pp. 655-669 .
Wen, J.; Liu ,B.; Yuan, E.; Ma ,Y and Zhu, Y. (2010): Preparation
Heffner, J.E. and Repine, J.E. (1989): Pulmonary strategies
and Physicochemical Properties of the Complex of Naringenin
of antioxidant defense. Am Rev Respir Dis; 140:531–54.
with Hydroxypropyl-β-Cyclodextrin Molecules; 15: 4401-4407.
Kanno, S.; Tomizawa, A.; Hiura, T.; Osanai, Y.; Shouji, A.; Ujibe, M.;
Wisse, E.; Doucet, D.; Van -Bossuyt, H.A. (1991): Transmission
Ohtake, T.; Kimura, K.; Ishikawa, M. (2005). Inhibitory effects
electron microscopic study on the uptake of AMI-25 by si-
of naringenin on tumor growth in human cancer cell lines and
nusoidal liver cells. In: Wisse E (ed) Cells of the hepatic sinu-
sarcoma S-180-implanted mice. Biol Pharm Bull 28: 527–530.
soid, Kupffer Cell Foundation, the Netherlands; 3: 534–539.
Karnakar, R.Y.; Saritha, C.h.; Sridhar, Y.; Shankaraiah, P. (2014).
Naringenin Prevents the Zinc Oxide Nanoparticles Induced Tox-
icity in Swiss Albino Mice. J Pharmacol Clin Toxicol; 2(1):1021.
Karnakar, R.Y.; Saritha, C.h.; Sridhar, Y.; Shankaraiah, P. (2014).
Naringenin Prevents the Zinc Oxide Nanoparticles Induced Tox-
icity in Swiss Albino Mice. J Pharmacol Clin Toxicol; 2(1):1021.
Kazazić, S.P. (2004): The antioxidant and anti-
radical activity of flavonoids (in Croatian). Ar-
hiva Higijene Rada Toksikologije; 55:279–290.
Könczöl, M.; Ebeling, S.; Goldenberg, E.; Treude, F.; Gminski, R..; Gieré,
R.; Grobéty, B.; Rothen-Rutishauser, B.; Merfort, I.; Mersch-Sun-
dermann, V. (2011). Cytotoxicity and genotoxicity of size-fraction-
ated Iron oxide (magnetite) in A549 human lung epithelial cells:
role of ROS, JNK, and NF-κB. Chem. Res. Toxicol. 24: 1460-1475.
Lee, M.H.; Yoon, S.; Moon, J.O. (2004): The flavonoid
naringenin inhibits dimethyl nitrosamine induced liv-
er damage in rats. Biol. Pharm. Bull; 27: 72–76.
Mira, L.; Fernandez, M. T.; Santos, M.; Rocha, R.; Floren-
cio, M. H.; Jennings, K. R. (2002). Interaction of flavo-
noids with iron and copper ions, a mechanism for their
antioxidant activity. Free Radic. Res; 36: 1199–1208.
Pan, B.J.; Qiu, H.; Pan, B.C.; Nie, G.Z.; Xiao, L.L. (2010). Highly efficient
removal of heavy metals by polymer-supported nanosized hydrated
Fe(III) oxides: behavior and XPS study. Water Res 44(3):815–24.
Parivar, K.; Fard, M.F.; Bayat, M.; Alavian, M.S.; Motavaf, M.
(2016). Evaluation of Iron Oxide Nanoparticles Toxicity on Liver
Cells of BALB/c Rats. Iran Red Crescent Med J. 18(1): e28939.
Pradeep K, Park SH and Ko K Ch. 2008. Hesperidin a flava-
noglycone protects against γ-irradiation induced hepa-
tocellular damage and oxidative stress in Sprague–
Dawley rats. Eur. J. Pharmacol., 587(1-3): 273–280.
Pratt, D.S. and Kaplan, M.M. (2000): Evalua-
tion of abnormal liver enzyme results in asymp-
tomatic patients. N Engl J Med 2000; 342: 1266-71.
Rice-Evans, C. and Burdon, R. (1993). Free Radi-
cal-Lipid Interactions and Their Pathological Con-
sequences. Progress in Lipid Research, 32: 71-110.
Shahjahan, M.; Sabitha, K.E.; Jainu, M. and Shyamala, C.S. (2004):
Effect of solanum trilobatum against carbon tetrachloride induced
hepatic damage in albino rats. Ind. J. Med. Res; 120: 194–198.
Simko, M. and Mattsson, M.O. (2010): Risks from Accidental Ex-
posures to Engineered Nanoparticles and Neurological Health
Effects: A Critical Review. Particle and Fibre. Toxicology, 7, 42.
Tirkey, N.; Pilkhwal, S.; Kuhad, A.; Chopra, K. (2005). Hesperidin, a cit-

30
 Elieba et al., 2018, AJMS 1(1): 31-34 DOI:10.5455/ajms.6

Arabian Journal of Medical Sciences

http://www.ajms.tk

Consumption of Pulicaria undulata and Salvadora persica extracts is safe and

has a growth promoter effect on broilers
Esraa M. Eliebaa*, Mohamed A. Lebdaa, Nabil M. Tahaa, Abdel-Wahab A. Mandora, Mohammed A. El-Magdb
a
Department of Biochemistry, Faculty of Veterinary Medicine, Alexandria University, Egypt
b
Department of Anatomy, Faculty of Veterinary Medicine, Kafrelsheikh University, Egypt

Article Info Abstract

Background: Pulicaria undulata and Salvadora persica (miswak or siwak) are two herbal plants that have plenty
Keywords: of metabolites that can be used as health promoters, however to the best of our knowledge the growth-stimulatory
Pulicaria undulata; effects of these herbal extracts were not addressed in broiler chickens. Aim: Our attempt here was to investigate the
Salvadora persica; in vivo growth modulatory effect of S. persica and P. undulata extracts through monitoring their effects on growth
Growth promotor; performance parameters (body weight gain and feed conversion ratio) and to check whether their consumption is
Broilers
safe or not through evaluation of biochemical damage markers of liver (ALT and AST) and kidney (creatinine and
uric acid) in broilers. Materials and methods: One day old chicks were divided into the following four groups
(20 chickens/group): group 1 (G1, normal control group) given saline, G2 received 1200 mg/kg S. persica, G3
administrated 1250 mg/kg P. undulate, and G4 treated with S. persica (1200 mg/kg) and P. undulate (1250 mg/kg).
All treatments were given orally by stomach gavage for 24 days (from the age of 13 to 37 days). Results: Admin-
Received Sep 15, istration of methanolic extracts of S. persica (G2) and P. undulate (G3) led to significant increases in the growth
Revised Sep 22, performance parameters as indicated by a significant elevation in the body weight gain and a significant decrease
Published Sep 23, 2018 in the feed conversion ratio as compared to the control group (G1). Notably, administration of these two extracts
might have no adverse effect on liver and kidney, as evidenced by insignificant change in their damage markers
between the treated (G2-G4) and the control (G1) groups. Moreover, the combined treated group (G4) exhibited
insignificant changes in growth when compared with G2 and G3 each alone, suggesting absence of synergism or
antagonism between these two plants regarding growth promotion. Conclusions: feeding chicken with P. undula-
*Corresponding author: ta and S. persica methanolic extracts significantly improved the growth performance parameters without damaging
esraaelieba511@yahoo.com the liver and kidney, thereby these two plants could be individually added to chicken food as safe growth promotors.

1. Introduction
Pulicaria undulata and Salvadora persica (miswak or siwak)
are two herbal plants that have plenty of compounds with medic-
inal importance (Abdillahi et al., 2010; Akhtar et al., 2011; Ali et
al., 2012; Liu et al., 2010b). S. persica, a shrub belonging to family
Salvadoraceae (Halawany, 2012), is abundantly cultivated in the arid
and semi-arid regions of the Middle East (especially in Saudi Arabia
and Egypt), Africa, and Asia (Ghazanfar, 2006 ). S. persica has diu-
retic, antiscorbutic, anthelmintic, and analgesic (Akhtar et al., 2011),
anti-inflammatory (Ahmad et al., 2011), anti-ulcerative (Sher et al.,
2010), antifungal (Hamza et al., 2006), anti-parasitic, and antiviral
(Ali et al., 2002) properties. Almost all parts of S. persica have been
found to be pharmaceutically important. The leaves, root bark, fruits
and seeds are used for the treatment of cough, fever, asthma and as
purgative (Darmani et al., 2006; Savithramma et al., 2007). The seed
oil is useful for the treatment of some skin diseases and joint pain
(Ahmed et al., 2008). Its fermented juice prepared from the fresh fruits
is a strong aphrodisiac agent and is also used as general body tonic
(Ahmed et al., 2008). Its leaves were used in animals to increase lac-
tation in cows and improve general body weight (Sofrata et al., 2007).
P. undulata (also known as P. crispa), an annual herb or sub-
shrub, belongs to the Asteraceae family and has small yellow
flowers (Liu et al., 2010a; Liu et al., 2010b). It is one of the most
widespread desert plants growing wild in Southern Egypt (Boulos
2009). In Egypt, it is known as “Dethdath” and can be used to treat
inflammation and as insect repellent (Maghraby et al., 2010; Ra-
vandeh et al., 2011). Also, it has antioxidant (Foudah et al., 2015),
and anticancer (Elshiekh and Abd El Moniem, 2005) properties.
The uses of herbal plants as health promoters are gaining increas-
ing attention in both consumer and scientific circles. Although, there
are few studies which have revealed the mechanism of action of the
growth-stimulatory compounds of herbal plants, the exact molecular
mechanisms of S. persica and P. undulata have not elucidated yet.
Our attempt here was to investigate the in vivo growth modula-
tory effect of S. persica and P. undulata extracts through monitor-
ing their effects on growth performance parameters (body weight
gain, feed conversion ratio) and biochemical markers of gener-
al health status, including liver function test (ALT and AST) and
kidney function test (creatinine and uric acid) in broiler chickens.

31
 Elieba et al., 2018, AJMS 1(1): 31-34 DOI:10.5455/ajms.6

2. Materials and methods (BWG) was calculated according to the following equation: BWG
2.1. Chickens and diets (g) = (FBW - IBW) / experiment duration (24 days). The feed con-
version ratio (FCR) was calculated according to the following equa-
This experiment was conducted in accordance with the guide- tion: FCR = FI/BWG.
lines of animal health and welfare of Faculty of Veterinary Medi-
2.5. Biochemical parameters
cine, Alexandria and Kafrelsheikh Universities. A total number
of 80 one-day-old unsexed broilers were housed in an electrically Blood samples were collected at the time of sacrifice in clean
heated battery brooder, and provided with water and commer- plain tubes and were centrifuged at 3000g for 5 min to obtain serum
cial starter diet [corn and soybean meal based diet containing 23% (Alzahrani et al., 2018). The serum levels of the liver injury biomark-
crude protein (CP) and metabolic energy (ME) 13.39 MJ/kg) un- ers, aspartate aminotransferase (AST) and alanine aminotransferase
til the age of 12 days. The chicks were housed in individual cag- (ALT), in addition to the serum levels of kidney function markers
es and fed the basal grower diet (Table 1) at the age from 13 to 37 (creatinine and uric acid) were measured using commercially avail-
days. All chickens had free access to food and water ad libitum. able kits and as previously described (Abdelhadya et al., 2017).
The experiment was conducted in a normal room with 14 h light: 2.6. Statistical analysis
10 h dark cycle. Room temperature was maintained at 23-25°C
with relative humidity from 50 to 70 % throughout the experiment. All the data were expressed as means ± standard error of mean
(SEM). The statistical significance was evaluated by one-way anal-
Table 1. Composition and nutrient analysis of the basal diet. ysis of variance (ANOVA) using SPSS, 18.0 software, 2011 and the
individual comparisons were obtained by Duncan’s multiple range
Ingredients g/kg
test (DMRT). Values were considered statistically significant when
p<0.05.
Corn 565.2
Soybean meal, 48% 300 3. Results
Corn gluten meal, 60% 60 3.1. Effect of S. persica and/or P. undulata extracts on
growth performance parameters
Premix* 3
Soy oil 40 Broilers fed diets containing S. persica (G2) and P. undulata
extracts (G3) alone or in combination (G4) showed significant in-
Dicalcium phosphate 18
creased growth performance parameters (as revealed by a significant
limestone 10
elevation in the body weight gain and a significant reduction in the
Salt 3.8 feed conversion ratio) as compared to the normal control group (G1)
Calculated values (Table 2). However, no significant difference was noticed between
CP, % 21.65 the three treated groups (G2-G4).
ME, M.J/Kg 13.17 3.2. Effect of S. persica and/or P. undulata extracts on liver
Crude fibre, % 3.05 and kidney function
Ether extract, % 6.6
Ca, % 0.89 Broilers fed diet supplemented with S. persica (G2) and P. un-
P, % 0.48 dulata extracts (G3) alone or in combination (G4) showed insignifi-
* Included 3.0 g/kg of vitamin and mineral mix. cant changes in the serum levels of liver damage enzymes (ALT and
2.2. Plants AST) and kidney damage markers (creatinine and uric acid) (Table
3).
S. persica stems, obtained from El Noba, Egypt, were cut into
small pieces, grinded, powdered and then 150 ml of methanol was 4. Discussion
added to 30 g powder for 24 h on a shaker with 150 rpm and 25˚C
Herein, we investigated the growth-modulatory effects of S.
(Sofrata et al., 2008). P. undulata plants were also collected from El
persica and P. undulata methanolic extracts on chickens and found
Noba, Egypt and its aerial parts (3 kg) were air-dried, powdered, and
that their separate or combined administration resulted in significant
extracted by methylene chloride-methanol (1:1) at room temperature
increases in the growth performance parameters as indicated by sig-
as previously described (Hussien et al., 2016).
nificant increase in the body weight gain and a significant decrease
2.3. Chicken groups in the feed conversion ratio as compared to the control (untreated)
Chicks were divided into four groups (20 per group): group 1 (G1, group. However, administration of these extracts might have no ad-
the normal control group) given saline, G2: received S. persica (1200 verse effect on the liver and kidney function, as evidenced by in-
mg/kg dissolved in saline), G3: administrated P. undulate (1250 mg/ significant change in liver and kidney damage markers between the
kg dissolved in saline), and G4: treated with S. persica (1200 mg/ treated (G2-G4) and the control (G1) groups.
kg) and P. undulate (1250 mg/kg). All treatments were given oral- The banning of the use of antibiotics as feed additives has ac-
ly by stomach gavage for 24 days (from the age of 13 to 37 days). celerated and leads to investigations of alternative feed additives
in animal production. As one of the alternatives, herbal extracts are
2.4. Performance parameters already being used as feed supplements to improve growth perfor-
The feed intake (FI) was daily recorded and the chickens were mance under intensive management systems (Williams and Losa,
weighed at the beginning (initial body weight, IBW) and at the end 2001). These plants improve growth performance through induction
of the experiment (final body weight, FBW). The body weight gain of appetite and feed intake, and improvement of endogenous diges-

32
 Elieba et al., 2018, AJMS 1(1): 31-34 DOI:10.5455/ajms.6

tive enzyme secretion, activation of beneficial digestive system bac-
teria. Isoprene derivatives, flavonoids, glucosinolates and other plant
metabolites improve the physiological and chemical function of the
digestive tract (Foudah et al., 2015; Hooda et al., 2014). S. persica
and P. undulata are two herbal plants that have plenty of these metab-
olites (Abdillahi et al., 2010; Akhtar et al., 2011; Ali et al., 2012; Liu
et al., 2010b). In the present study, we found a significant increase in
growth performance parameters following feeding chickens on diets
supplemented with S. persica and P. undulata extracts. In agreement
with our findings, some previous studies have proved the potential
of S. persica as a feed additive to promote growth of animals. For
instance, El-Kholy et al. (2010) found a notable improved growth
performance (daily weight gain, final body weight, and feed efficien-
cy) in rabbit after consumption of diets containing S. persica grinded
roots. Furthermore, El-Dein et al. (2014) and El-Neney et al. (2013)
also reported higher productive performance following feeding of
Dokki 4 chickens on S. persica.
The conviction that natural products are much safer than syn-

Table 2. Growth performance parameters of chickens fed on ration containing S. persica and/or P. undulata extracts.

Groups Initial weight Final weight Body weight Feed consumption Feed conversion
(g) (g) gain (g) (g) ratio
Normal control 39±0.4 2470±30 b 2431±28 b 3700±45 1.52±0.03 a
(G1)
S. persica (G2) 40±0.6 2630±29 a 2590±29 a 3760±43 1.45±0.04 b
P. undulata (G3) 39.5±0.3 2585±31 a 2545.5±27 a 3775±46 1.48±0.05 b
S. persica and P. 40.5±0.5 2600±32 a 2559.5±30 a 3720±41 1.45±0.03 b
undulata (G4)
Columns carrying different letters are significantly different at p≤ 0.05. Data expressed as mean ± standard error
of mean (SEM).

Table 3. Serum level of ALT, AT, creatinine, and uric acid of chickens fed on ration containing S. persica and P.
undulata extracts.
Groups ALT AST Creatinine Uric acid
(IU/l) (IU/l) (mg/dl) (mg/dl)
Normal control
87±0.82 10.5±0.33 1.14±0.04 6.57±0.24
(G1)
S. persica (G2) 89.5±0.75 9.5±0.33 1.26±0.03 6.15±0.21

P. undulata (G3) 88.5±0.75 9.75±0.37 1. 2±0.04 6.19±0.23

S. persica and P. un-

88.25±0.73 9.88±0.49 1.18±0.04 6.24±0.21
dulata (G4)

Columns carrying different letters are significantly different at p≤ 0.05. Data expressed as mean ± standard error
of mean (SEM).

thetic or conventional drugs has resulted in an exceptional growth
in its use by consumers as both prophylactic and for treating human
ailments. Despite plants being a rich source of bioactive compounds
with potent pharmacological properties, some of them may be tox-
ic and induce adverse effects to humans (Celik, 2012; Nondo et al.,
2015). It is therefore crucial after proving the growth-stimulatory
effect of S. persica and P. undulata methanolic extracts to check
whether they have toxic effect or not. To assess this possibility, liver
function test (ALT and AST) and kidney function test (creatinine and
uric acid) were performed. Interestingly, the two plants did not ele-
vate the serum levels of any of these damage markers. In consistent
with our results, it has been reported that extracts of S. persica lack
toxicity on normal human cell lines (Balto et al., 2014; Darmani et
al., 2006). Similarly, acute toxicity studies of S. persica in mice re-
vealed no lethality or toxic reaction of the extract at doses up to the
highest tested concentration, 1200 mg/kg body weight, orally, until
the end of the study period (48 h) (Hooda et al., 2014). On the other
hand, El-Dein et al. (2014) and El-Neney et al. (2013) reported a
significant decrease in the serum levels of uric acid following feeding
of Dokki 4 chickens on S. persica. It is important that more toxicity
studies should be carried out on the common traditional method of
33
usage of PS. persica and P. undulata including infusion, maceration,
and decoction to confirm the doses required to limit potential toxicity
and side effects. Further studies on various human cells using different
toxicity models are recommended together with in vivo toxicological
analysis in an endeavour to establish safety doses that when used me-
dicinally, would not induce side effects in humans.
There were no significant changes in growth-related parameters
among chickens treated by S. persica and P. undulata methanolic ex-
tracts when used alone or in combination. This indicates that no syn-
ergism or antagonism between growth modulatory effect of these two
plants. In other words, each plant does not inhibit or induce the growth
stimulatory effect of the other plant. This means that these plants have
potential effect on growth performance when giving to healthy birds
but no great value to use both plants together in that regard. Howev-
er, further researches can be carried out in formulating novel natural
livestock feed using S. persica and P. undulata mixed with other plant
extracts which can be more beneficial in terms of taste and growth
performance. Researches can also investigate into the potential preb-
iotic effect of S. persica and P. undulata the beneficial gut microbiota
of livestock.
 Elieba et al., 2018, AJMS 1(1): 31-34 DOI:10.5455/ajms.6

Conclusion bian Peninsula: An overview. In: Öztürk M, Waisel Y, KhanMA, Görk G

(eds) Biosaline agriculture and salinity tolerance in plants. . Springer ,Ba-
Feeding chicken with S. persica and P. undulata methanolic ex- sel, 101–108.
tracts significantly improved the growth performance parameters Halawany, H.S., 2012. A review on miswak (Salvadora persica) and its effect
without damaging the liver and kidney. This indicates that these two on various aspects of oral health. The Saudi dental journal 24, 63-69.
Hamza, O.J., van den Bout-van den Beukel, C.J., Matee, M.I., Moshi, M.J.,
plants are safe and could be individually added to chicken food as Mikx, F.H., Selemani, H.O., Mbwambo, Z.H., Van der Ven, A.J., Verweij,
growth promotors. Further detailed studies are required to explore oth- P.E., 2006. Antifungal activity of some Tanzanian plants used traditionally
er brilliant aspects for the potential uses of S. persica and P. undulata for the treatment of fungal infections. Journal of ethnopharmacology 108,
in animals food and health. 124-132.
Hooda, M.S., Pal, R., Bhandari, A., Singh, J., 2014. Antihyperglycemic and
References antihyperlipidemic effects of Salvadora persica in streptozotocin-induced
diabetic rats. Pharmaceutical biology 52, 745-749.
Abdelhadya, D.H., El-Magd, M.A., Elbialy, Z.I., Saleh, A.A., 2017. Bromu-
Hussien , T., A,, El-toumy, S.A., Hassan, H.M., Hetta, M.H., 2016. Cytotoxic
conazole-induced hepatotoxicity is accompanied by upregulation of PXR/
and antioxidant activities of secondary metabolites from Pulicaria undu-
CYP3A1 and downregulation of CAR/CYP2B1 gene expression. Toxicol
lata. International Journal of Pharmacy and Pharmaceutical Sciences 8.
Mech Methods 27, 544-550.
Liu, L., Wang, R., Yang, J., Shia, Y., 2010a. Diversity of sesquiterpenoids from
Abdillahi , H., Stafford GI, Finnie JF, JV, S., 2010. Ethnobotany,phytochemis-
Carpesium cernuum. Helv. Chim. Acta 93, 595–601.
try and pharmacology of Podocarpus sensus latissimo (S.I) South Afr. J.
Liu, L.L., Yang, J.L., Shi, Y.P., 2010b. Phytochemicals and biological activities
Bot. 76, 1-24.
of Pulicaria species. Chemistry & biodiversity 7, 327-349.
Ahmad, M., Imran, H., Yaqeen, Z., Rehman, Z.-u., FATIMA, N., SOHAIL, T.,
Maghraby, A.S., Shalaby, N., Abd-Alla, H.I., Ahmed, S.A., Khaled, H.M., Bah-
2011. Pharmacological profile of Salvadora persica. Pakistan journal of
gat, M.M., 2010. Immunostimulatory effects of extract of Pulicaria crispa
pharmaceutical sciences 24.
before and after Schistosoma mansoni infection. Acta poloniae pharma-
Ahmed, S., Soaad E, Essawy E, Mohamed EI, S, E., 2008. Preliminary phyto-
ceutica 67, 75-79.
chemical and propagation trial with Salvadora persica L. Agric. For. Res.,
Nondo, R.S.O., Moshi, M.J., Erasto, P., Zofou, D., Njouendou, A.J., Wanji,
1/2(58), 135–138.
S., Ngemenya, M.N., Kidukuli, A.W., Masimba, P.J., Titanji, V.P.K., 2015.
Akhtar, J., Siddique, K.M., Bi, S., Mujeeb, M., 2011. A review on phytochem-
Evaluation of the cytotoxic activity of extracts from medicinal plants used
ical and pharmacological investigations of miswak (Salvadora persica
for the treatment of malaria in Kagera and Lindi regions, Tanzania. . J.
Linn). Journal of pharmacy & bioallied sciences 3, 113-117.
Appl. Pharm. Sci. 5, 07–012.
Ali, H., Konig, G.M., Khalid, S.A., Wright, A.D., Kaminsky, R., 2002. Evalua-
Ravandeh, M., Valizadeh J, Noroozifar M, M., K.-M., 2011. Screening of
tion of selected Sudanese medicinal plants for their in vitro activity against
chemical composition of essential oil, mineral elementsand antioxidant
hemoflagellates, selected bacteria, HIV-1-RT and tyrosine kinase inhibito-
activity in Pulicaria undulata (L.) C. A.Mey from Iran. . J Med Plants Res.
ry, and for cytotoxicity. Ethnopharmacol 83, 219-228.
5, 2035–2040.
Ali, N.A., Sharopov, F.S., Alhaj, M., Hill, G.M., Porzel, A., Arnold, N., Set-
Savithramma, N., Sulochana, C., Rao, K.N., 2007. Ethnobotanical survey of
zer, W.N., Schmidt, J., Wessjohann, L., 2012. Chemical composition and
plants used to treat asthma in Andhra Pradesh, India. Journal of ethnophar-
biological activity of essential oil from Pulicaria undulata from Yemen.
macology 113, 54-61.
Natural product communications 7, 257-260.
Sher, H., Al-Yemeni, M., Masrahi, Y.S., Shah, A.H., 2010. Ethnomedicinal and
Alzahrani, F.A., El-Magd, M.A., Abdelfattah-Hassan, A., Saleh, A.A., Saadel-
ethnoecological evaluation of Salvadora persica L.: A threatened medic-
din, I.M., El-Shetry, E.S., Badawy, A.A., Alkarim, S., 2018. Potential
inal plant in Arabian Peninsula. Journal of Medicinal Plants Research 4,
Effect of Exosomes Derived from Cancer Stem Cells and MSCs on Pro-
1209-1215.
gression of DEN-Induced HCC in Rats. Stem Cells International 2018, 17
Sofrata, A., Lingstrom, P., Baljoon, M., Gustafsson, A., 2007. The effect of mi-
https://doi.org/10.1155/2018/8058979.
swak extract on plaque pH. An in vivo study. Caries research 41, 451-454.
Balto, H., Al-Howiriny, T., Al-Somily, A., Siddiqui, Y.M., Al-Sowygh, Z., Hal-
Sofrata, A.H., Claesson, R.L., Lingström, P.K., Gustafsson, A.K., 2008. Strong
awany, H., Shakoor, Z., Al-Hadlaq, S., 2014. Screening for the antimicro-
antibacterial effect of miswak against oral microorganisms associated with
bial activity of Salvadora persica extracts against Enterococcus faecalis
periodontitis and caries. Journal of periodontology 79, 1474-1479.
and Candida albicans. International Journal of Phytomedicine 5, 486-492.
Williams, P., Losa, R., 2001. The use of essential oils and their compounds in
Boulos , L., 2009. Flora of Egypt checklist. revised annotated edition.Cairo: Al
poultry nutrition. World’s Poultry Science Journal 17, 14-15.
Hadara Publishing.
Celik, T.A., 2012. Potential genotoxic and cytotoxic effects of plant extracts, a
compendium of essays on alternative therapy. InTech. Bhattacharya, D.A.
(Ed.), .
Darmani, H., Nusayr, T., Al‐Hiyasat, A., 2006. Effects of extracts of miswak
and derum on proliferation of Balb/C 3T3 fibroblasts and viability of cari-
ogenic bacteria. International journal of dental hygiene 4, 62-66.
El-Dein, A.K.A., Mousa, S.M.M., El-Aziz, S.A., 2014 Comparative study be-
tween miswak and neomycin on some productive, reproductive and im-
munological traits of dokki4 chickens strain. Egypt. . Poult. Sci. J. 34,
503–519.
El-Kholy, K.H., Seleem, T.S.T., El-Aasar, T.A., Hanaa Abdelharith, A., 2010.
Effect of dietary addition of arak (Salvadora persica) on growth and re-
productive performance in Black Baladi rabbit males. World Rabbit Sci
16, 21–27.
El-Neney, B.A.M., Awaden, N.B., Ramadan, N.A., Rizk, A.M., 2013. The im-
pact of useing different levels of miswak on reproductive performance and
immunity system of dokki 4 laying hens. Egypt. Poult. Sci. J. 33, 865–868.
Elshiekh , Y., Abd El Moniem, M., 2005. Gas chromatographyemass spectrom-
etry analysis of Pulicariacrispa (whole plant) petroleum ether extracts. Am
J ResCommun 3, 58e67.
Foudah , A., Alam, A., Soliman , G., Salkini, M., Ahmed , E., Yusufoglu, H.,
2015. Pharmacognostical, antioxidant and antimicrobial studies of aerial
part of Pulicaria crispa (Family:Asteraceae). . Bull Env Pharmacol Life
Sci 4, 19e27.
Ghazanfar, S., 2006 Saline and alkaline vegetation of NE Africa and the Ara-
34