Protoplasma

DOI 10.1007/s00709-015-0771-z

ORIGINAL ARTICLE

Physiological performance, secondary metabolite and expression

profiling of genes associated with drought tolerance in Withania
somnifera
Sanchita & Ruchi Singh & Anand Mishra & Sunita S. Dhawan &
Pramod A. Shirke & Madan M. Gupta & Ashok Sharma

Received: 24 November 2014 / Accepted: 26 January 2015

# Springer-Verlag Wien 2015

Abstract Physiological, biochemical, and gene expression
responses under drought stress were studied in Withania
somnifera. Photosynthesis rate, stomatal conductance, transpi-
ration rate, relative water content, chlorophyll content, and
quantum yield of photosystems I and II (PSI and PSII) de-
creased in response to drought stress. Comparative expression
of genes involved in osmoregulation, detoxification, signal
transduction, metabolism, and transcription factor was ana-
lyzed through quantitative RT–PCR. The genes encoding
1-pyrroline-5-carboxylate synthetase (P5CS), glutathione
S-transferase (GST), superoxide dismutase (SOD), serine
threonine-protein kinase (STK), serine threonine protein
phosphatase (PSP), aldehyde dehydrogenase (AD),
leucoanthocyanidin dioxygenase/anthocyanin synthase
(LD/AS), HSP, MYB, and WRKY have shown upregu-
lation in response to drought stress condition in leaf tissues.
Enhanced detoxification and osmoregulation along with in-
creased withanolides production were also observed under
drought stress. The results of this study will be helpful in
developing stress-tolerant and high secondary metabolite
yielding genotypes.
Handling Editor: Bhumi Nath Tripathi
Sanchita : A. Mishra : S. S. Dhawan : A. Sharma (*)
Biotechnology Division, CSIR–Central Institute of Medicinal and
Aromatic Plants, Lucknow, India
e-mail: ashoksharma@cimap.res.in
R. Singh : P. A. Shirke
Plant Physiology Division, CSIR–National Botanical Research
Institute, Lucknow, India
M. M. Gupta
Chemical Sciences Division, CSIR–Central Institute of Medicinal
and Aromatic Plants, Lucknow, India
Keywords Withanolides . Water stress . Withania somnifera .
Gene expression . Photosynthesis rate
Introduction
Withania somnifera (Ashwagandha) is an important medicinal
plant of Indian origin. The plant is well known to be effective
in immunomodulation, hematopoiesis, anti-aging, chronic
stress, cardiovascular protection, hypothyroidism, anxiety,
and depression (Verma and Kumar 2011). Secondary metab-
olites play an important role in plants for adaptation and de-
fense against adverse environmental conditions (Ramakrishna
and Ravishankar 2011). These metabolites are useful for
humans as pharmaceutical agents. Withanolides are a class
of secondary metabolites synthesized in W. somnifera.
Withanolide biosynthesis starts with Acetyl Co A, a byproduct
of glycolysis, followed by terpenoid and steroid biosynthetic
pathways. Generally, secondary metabolite content increases
under stress conditions in plants. Drought stress generates
reactive oxygen species (ROS) such as singlet oxygen, su-
peroxide anion radicals, hydroxyl ions, and hydrogen
peroxide (Cruz de Carvalho 2008). These ROS are con-
sidered as markers of initiation of stress, serving as signal-
ing molecules to activate the cell response against stress
(Shulaev and Oliver 2006). Osmolytes are organic molecules
of low molecular weight which play a prominent role as
osmoprotectant. The osmolytes such as glycine betaine and
proline accumulate in cells and balance the osmotic difference
between cytosol and surrounding of the cell. The accumula-
tion of these molecules results in the enhancement of stress
tolerance (Agarwal et al. 2013). The leaf and soil water con-
tent decreases with the increase in drought stress. Due to loss
of relative water content (RWC), leaves lose their turgidity
and stomata get closed. CO2 concentration decreases in

the intercellular spaces and photosynthesis rate decreases un-
der water stress (Singh 2014a). Oxidative stress is one of the
most deleterious consequences of water deprivation.
Oxidative stress generated due to enhanced production of re-
active oxygen species (ROS) is minimized by controlled shut-
down of photosynthesis and by degradation of photosynthetic
structures like chlorophyll (Dinakar et al. 2012). Several en-
zymes, viz., superoxide dismutase (SOD), catalase, glutathi-
one peroxidase, ascorbate peroxidase, glutathione S-transfer-
ase (GST), and glutathione reductase are reported to be in-
volved in the detoxification of these substances (Gill and
Tuteja 2010). These genes have been reported earlier for their
involvement in the regulation as well as tolerance against
drought stress in different plants (Chen et al. 2012; Faize
et al. 2011). We undertook this study to show the role of these
genes in W. somnifera under drought stress. Leaf physiologi-
cal and biochemical responses to different degrees of drought
stress and re-watering were observed. A comprehensive study
of gene expression profiling, physiological performance under
drought stress along with withanolide content of W. somnifera
were performed. The genes undertaken for the study belonged
to different categories, viz., osmoregulation (Δ1P5CS), detox-
ification (GST and SOD), signal transduction (STK and PSP),
metabolism (AD and LD), and transcription regulation (HSP,
MYB, and WRKY). The expression analysis of these genes
was carried out for studying the variation in produced metab-
olites to justify their roles in drought stress. The expressions of
drought-inducible genes were also analyzed through their ex-
pression in leaf tissue of W. somnifera. With the increase in
drought stress RWC, osmotic potential (OP) and chlorophyll
(Chl) content decrease. However, leaf electrolyte leakage and
proline and malondialdehyde (MDA) content increase and
cannot be recovered after re-watering (Makbul et al. 2011).
Efforts are further required for the identification of the
enzymes/genes for specific steroidal lactones, viz.,
withaferin-A, withanolide-A, etc. The expression profiling of
genes involved in biosynthetic pathway may provide a better
understanding of secondary metabolism under drought stress.
The results from this study would provide an insight into
signaling cascade and biosynthesis of secondary metabolites
and indicate that there may be a crosstalk among various
pathways.
Materials and methods
Plant material
The seeds of W. somnifera variety Poshita were obtained from
CIMAP Experimental Farms, CIMAP, Lucknow. One-week-
old plantlets of W. somnifera were transferred in 10-L pots
(filled with garden soil) and regularly irrigated with 500 mL
of tap water and weekly with Hogland solution. Plants were
Sanchita et al.
kept in a growth chamber (PGC-105 HID; Percival Scientific,
Inc., 505 Research Drive, Perry, IA 5022D, USA) for the
study. The photosynthetic photon flux density (PPFD)
was increased gradually from 6:00 to 12:00 h (50–
1300 μmol m−2 s−1) and after that decreased in a sim-
ilar way till 20:00 h to maintain 14 h light/10 h dark
cycle. Temperature varied between 28 and 33 °C with
variation in light intensity. Relative humidity was 50–70 %.
One-and-half-month-old plants were used for the drought ex-
periment. During drought, watering was stopped and the pot
was covered with a thick plastic sheet so that vaporization of
the water through the pot was minimized. The potted plants
were subjected to drought for 7 days followed by 5 days of
recovery. The physiological and biochemical parameters were
assessed periodically during the drought treatment and on the
fifth day of rewatering. At the end of drought (seventh day),
samples for gene expression and secondary metabolite estima-
tion were taken (Fig. 1).
Proline estimation
Proline was determined according to a modified method of
Bates et al. (1973). Approximately, 0.5 g fresh leaf sample
was homogenized in 1 mL of 3 % (w/v) aqueous sulfosalicylic
acid. To the aliquots, 96 % acetic acid/3 % sulfosalicylic acid
in the ratio 2:1 was added followed by ninhydrin reagent. The
mixture was incubated at 96 °C in a water bath for 1 h. The
mixture was cooled to room temperature, toluene was added,
and the absorbance of fraction with toluene aspired from liq-
uid phase was read at a wavelength of 520 nm. Proline con-
centration was determined using a calibration curve and
expressed as micromoles of proline per gram FW.
Lipid peroxidation estimation
Two hundred milligrams of plant tissue was extracted with
1 mL of 0.25 % TBA soluble in 10 % TCA. This mixture
Fig. 1 Image of watering and 7-day drought-treated plants of
W. somnifera
Study of drought tolerance in Withania somnifera
was heated at 95 °C for 30 min and then cooled in ice to stop
the color change. Then the extract was centrifuged at 10,
000 rpm and 4 °C for 10 min. The supernatant was taken
and OD measured at 532 and 600 nm. Corrected OD was
calculated as A532 −A600 and lipid peroxidation is expressed
as micromoles of MDA formed using an extinction coefficient
of 155 mM cm−1 (Heath and Packer 1968).
Measurement of gas exchange parameters
Photosynthetic rate (A), stomatal conductance (gs), transpira-
tion rate (E), and WUE were measured with an LI-6400 por-
table photosynthesis system (Li-Cor, Lincoln, NE) with red
and blue LED light sources. All measurements were taken
between 8 and 10 h on five leaves per treatment on different
plants. Measurements were taken at 400 μmol CO2 mol−1 air,
constant leaf temperature (Tleaf =33±2 °C), and constant vapor
pressure deficit (VPD=2.5±0.2 kPa) after the attainment of
steady-state photosynthetic rates. The ratio of (A) to (E) was
taken as the intrinsic photosynthetic water use efficiency
(WUE).
Determination of leaf water states
Measurements of water potential and relative water content
(RWC) were made at predawn condition (before exposure of
light on plants) of fully expanded leaves (third forth leaf from
the terminal bud of twig). Water potential (Ψ) was measured
with a plant water status console (Soilmoisture, Santa Barbara,
CA). The fresh weight was recorded just after harvesting the
leaves and wrapped in aluminum foil. These leaves were kept
in water through their petiole for 5–6 h to attain full turgidity,
and turgid weight was taken. After that, leaves were dried for
72 h at 70 °C in an oven and dry weight was recorded. The
RWC of the leaf was calculated as 100×(fresh weight−dry
weight)/(turgid weight−dry weight) (Boyer et al. 2008).
Pigments estimation
Twenty to twenty-five milligrams of leaf tissue was extracted
with 1 mL of 80 % acetone and chlorophyll, and carotenoids
was extracted in 80 % acetone and calculated according to
Wellburn (1994). All samples were kept in dark during extrac-
tion. For anthocyanin estimation, 30–35 mg of sample was
extracted with 1 % acidified methanol. Absorbance of the
supernatant was taken at 530 and 650 nm, and corrected
values were calculated as AA=A530 −(0.288×A650), where
AA is corrected anthocyanin absorbance. Total anthocyanin
content was then calculated by using the corrected OD and a
molar absorbance coefficient for anthocyanin at 530 nm
of 30,000 L mol−1 cm−1 (Murray and Hackett 1991).
RNA isolation and cDNA synthesis
Total RNA was isolated from approximately 100 mg of leaf
tissues using Trireagent (Sigma, USA), according to the man-
ufacturer’s instructions. Any genomic contamination was re-
moved before cDNA synthesis by the treatment with RNase
free DNaseI (Sigma, USA). The glasswares used for RNA
isolation was autoclaved and treated with 0.1 % DEPC to
make it RNase free. The RNA was isolated from root and leaf
tissue on day 0 (taken as control), day 4, and day 8. The
nucleic acid quality was estimated by visual analysis on
1.2 % agarose gel electrophoresis. The purity and concentra-
tion of RNA were checked by using a Nanodrop ND-1000
spectrophotometer (Nanodrop Technologies, Rockland, DE,
USA). The A260/A280 ratio of each RNA sample was kept to
be in the range 1.8–2.0 to minimize the effects of PCR inhib-
itors. All RNA samples were stored at −80 °C. The first strand
of cDNA was synthesized from 3 μg of total RNA with
MultiScribe™ Reverse Transcriptase and random primer
(ABI, USA) according to user instructions. Total RNA sam-
ples were denatured at 65 °C for 5 min and then quickly
cooled on ice. Reverse transcriptase and other reaction com-
ponents were added to the samples. These were then incubated
for 10 min at 25 °C (primer annealing), followed by 120 min
at 37 °C and finally 10 min at 85 °C to inactivate the enzyme.
Reverse transcription (RT) negative controls, without the in-
clusion of the reverse transcriptase enzyme, were performed in
parallel to test for the presence of genomic DNA contamina-
tion in RNA samples. 18S ribosomal gene of W. somnifera
was considered as the endogenous gene to check the quality of
cDNA on 1.5 % agarose gel.
Primers for qRT–PCR
For all genes, qRT–PCR primers were designed using the
Primer Express 2.0 software. To ensure maximum speci-
ficity and efficiency during PCR amplification, a stringent
set of criteria was used for primer designing. These in-
cluded predicted annealing temperatures (Tm) of 58–60 °C,
primer lengths of 18–24 nucleotides, GC contents of 50–
60 %, and PCR amplicon length of 100–120 bp. All
primers were customized from a commercial supplier
Integrated DNA Technology (IDT) India Ltd. In order to
investigate the expression profiles, the primers for the
genes were designed based on previously identified genes
in Solanum tuberosum. The genes of S. tuberosum were
considered for the similarity search against transcriptome
data of W. somnifera present in SRA database of NCBI.
The primer designed from 18S ribosomal RNA gene,
DQ438948, was considered as internal control. The de-
signed primers with default parameters have been listed
(Table 1).
 Sanchita et al.

Table 1 Oligonucleotide sequences of forward and reverse primer pairs from genes considered for the study

Sr. no. Known pathway genes of withanolide biosynthesis Forward primer (5′→3′) Reverse primer (3′→ 5′)

1 1-Pyrroline-5-carboxylate synthetase (Δ1P5CS) GCTGAGCTGAGGTTACATCCAA GCAGACCTTCAAAAGCCTCAA

2 Glutathione S-transferase (GST) TGATGCCTTCGGATCCTTACA GCTGTTTCGTGTTCTTCCACTTT
3 Superoxide dismutase (SOD) CAGCCGCTCCGATGAAACT GAAATGCAGGCGGAAGGATT
4 Serine threonine-protein kinase (STK) GAAGTGGCGGTGTCACATTG TTTGGTAGCTCGCTCTTGCTT
5 Serine threonine protein phosphatase (PSP) GAAGCTAGCAAAAACCCCATGA TTGCATCAACCCCTGGACTT
6 Aldehyde dehydrogenase (AD) TCTGAAAGTAACAGCCCGACAGA CCACCCCAACGAGCAATAAG
7 Leucoanthocyanidin dioxygenase (LD) CCTGCAAGTAATGGGAAGCAA GTATGGAAGCAGACTAGGAGTGGAA
8 Heat shock protein (HSP70) CCGATAACCAACCTGGAGTATTG GGGAATACCGGAAAGCTCAAA
9 MYB transcription factor AGGCAACGAACTTACCGATCA TGAAATGGAAACCCGAAACC
10 WRKY transcription factor CAGTCAGATGGGAACTCATTCTTG CTGGCGTTTTTGGTATTAAGTGAA

The primers were used for expression profiling study through real-time PCR analysis in W. somnifera under drought stress

Quantitative real-time PCR Srivastava et al. 2008). A spherisorbs C18 (250×4.6 mm

qRT–PCR was performed in 384-well plates using the
ABI 7900HT RT–PCR detection system. Three different
biological replicates for each treatment were used. Each
reaction mixture consist of 2 μL cDNA, 15 μL SYBR
green mix (2×) (TaKaRa), 2 μL (5 pmol/μL) of both
forward and reverse primers, and 11 μL PCR-grade wa-
ter equating to a final volume of 30 μL. This reaction
mix was dispensed in a 396-well PCR plate in tripli-
cates. The thermal profile of the reaction was an initial
denaturation at 95 °C for 2 min, followed by 40 cycles
at 95 °C for 10 s and 60 °C for 10 s. This was follow-
ed by fluorescence acquisition after each cycle. All sam-
ples for each reference gene were run on the same plate
to avoid between-run variations. Baseline and Ct values
were automatically calculated by the Sequence Detection
Systems (SDS) software version 2.2.1 (Applied
Biosystems). The relative quantification of transcript
abundance was done using the ΔΔCT method with de-
fault parameters. The relative quantity was calculated as
RQ=2−ΔΔCT (Livak and Schmittgen 2001; Pfaffl 2001).
18S gene allowed us to calibrate the signal output and
correct for sample-to-sample variability.
Chemical analysis for estimation of withanolides
during drought stress
Four grams of dried leaf tissues were powdered for
withanolide extraction and analysis. The protocol for extrac-
tion was followed as described previously (Chaurasiya et al.
2008). The powder was extracted with 10 mL warm (50 °C)
menthol for 4 h and filtered through Whatman filter paper no.
1. This process was repeated three times and the combined
methanol extracts were concentrated under vacuum for high-
performance liquid chromatography (HPLC) analysis using
the conditions reported earlier (Scartezzini et al. 2007;
i.d.) 10 μm particle size ODS2 column (Waters, Milford,
MA, USA) was used with a 40:60 (v/v) mix of acetonitrile/
0.1 % (v/v) trifluoroacetic acid in water as the mobile phase.
The flow rate was 1.0 mL min−1, and the detector wavelength
was 220 nm. The standard samples of withaferin A, 12
Deoxywithanostramonoside, Withanolides-A were purchased
from ChromaDex (Irvine, CA, USA).
Data analysis
To study the level of significance, ANOVA was performed
between watered and drought treated samples at each time
point for all physiological and biochemical data. Level of
significance was shown as *p <0.05, **p <0.001, and
***p <0.0001.
Results
Water status of the plants
Relative water content (RWC) of the leaf was measured to
determine the stage of drought. On the second, fifth, and sev-
enth day of drought, leaf water content decreased by 5.3, 31,
and 51 %, respectively (Fig. 2a). On re-watering of the plants,
the RWC again increased. Osmotic potential (ψ) of the leaf
was measured during drought and recovery. Ψ varied between
−1.5 and −2 MPa under watering condition while it reached
up to −5 MPa on the seventh day of drought (Fig. 2b). The
membrane damage also increased as drought increased which
was measured as the percent conductivity. Relative conductiv-
ity increased by 1.6, 2, and 2.5 times, respectively, on the
second, fifth, and seventh day of drought as compared to their
watered plants (Fig. 2c).
Study of drought tolerance in Withania somnifera
Fig. 2 Relative water content of leaf (a), osmotic potential (b), and
relative conductivity (c) of the control (blue bar) and drought-treated
(red bar) samples of W. somnifera. Data represents the mean±SD of four
Photosynthetic parameters and pigment content
As the drought progressed, leaves lost their turgidity (de-
creased RWC and ψ) due to which internal CO2 and photo-
synthesis rate of the leaf decreased (Fig. 3a). Photosynthesis
rate decreased by 19 and 80 % on the second and fifth day of
drought and remained constant on further continuation of
drought. Along with photosynthesis rate, stomatal conduc-
tance and transpiration also decreased (Fig. 3b, c). Water use
efficiency (WUE), which is calculated as the ratio of photo-
synthesis and transpiration rates, decreased on the second and
fifth day of drought. However, WUE increased by 1.2-fold on
the seventh day of drought as compared to the control
plants (Fig. 3d). All the aforementioned gas exchange
parameters showed almost 100 % recovery after 5 days
of withdrawal of drought stress except in the stomatal conduc-
tance (Fig. 3a–c). Chlorophyll pigments are the major light
harvesting compounds present in the leaf. Under water stress,
chl a degraded along with chl b with progress of drought. Chl
b degraded more while chl a/b ratio increased up to the fifth
day of drought. On the seventh day of drought, chl a increased
marginally and chl b decreased. During recovery, chl a and b
recovered by 74 and 50 %, respectively, in 5 days (Fig. 4a, b).
Total chl content also decreased progressively during the sec-
ond to seventh day of drought and increased under recovery
condition (Fig. 4a–d). Chl a/b ratio increased up to the fifth
separate measurements. Level of significance showed as *p <0.05, **p
<0.001, and ***p <0.0001 at the top of each bar according to ANOVA
day of drought and decreased on the seventh day due to mar-
ginal increase in chl a. At recovery, there was no difference in
a/b ratio (Fig. 4d). Similarly, carotenoids and anthocyanin
pigments play an important role in the protection of leaf from
high light under water stress condition. Carotenoid content
decreased during the second to seventh day of drought stress
and did not recover during rewatering (Fig. 5a, b).
Anthocyanin pigment showed an increasing trend with
drought. It increased by 2.2, 2.4, and 5.4 times as compared
to control plants on the second, fifth, and seventh day of
drought, respectively. MDA and proline contents reflect the
grades of cellular damage. The level of MDA showed an
increasing trend with drought responses. It increased by 34,
41, 80, and 31 % on the second, fifth, and seventh day and
recovery, respectively, as compared to the control (Fig. 5c, d).
The proline content increased significantly (p≤0.05) during
every time period of drought stress as compared to control.
The proline content increased 2.2 times on the second day, 3.1
times on the fifth and seventh day of drought stress. On re-
covery, the proline content showed marginal variation
(Fig. 5d). Some ROS scavengers were also measured during
drought stress. Cellular content of SOD showed a 1.2-fold in-
crease at the second day and 3-fold increase at the fifth and
seventh day of drought (Fig. 6a). However, the cellular GST
content increased 1.1, 1.4, and 1.7 times at the second, fifth, and
seventh day of drought as compared to control plants (Fig. 6b).
 Sanchita et al.

Fig. 3 Net photosynthesis rate (a), stomatal conductance (b), represents the mean±SD of four replicates. Level of significance calcu-
transpiration rate (c), and water use efficiency (d) of the control (blue lated by ANOVA and showed as *p <0.05 and **p <0
bar) and drought-treated (red bar) samples of W. somnifera. Data

Fig. 4 Chlorophyll a (a), chlorophyll b (b), chlorophyll a+b (c), and chlorophyll a/b (d) of the control (blue bar) and drought-treated (red bar) leaves of
W. somnifera. Data represents the mean±SD of four samples and level of significance shown as *p <0.05, **p <0.001, and ***p <0.0001
Study of drought tolerance in Withania somnifera
Fig. 5 Carotenoid content (a), anthocyanin (b), lipid peroxidation
expressed in terms of MDA concentration (c), and cellular content of
proline (d) of the control (blue bar) and drought-treated (red bar) samples
Energy distribution between photosynthesis and quenching
of PSI and PSII in W. somnifera under severe (seventh day)
drought stress
Photochemical quantum yield of PSI and PSII [Y(I) and
Y(II)] decreased at different light intensity under drought
stress (Fig. 7a, b). Y(I) marginally increased at low light
intensity (0 to 75 μmol m−2 s−1) and decreased by 50
and 75 % at moderate and high light intensity (300–400
and 1800 μmol m−2 s−1), respectively (Fig. 7a). Similarly,
Y(II) decreased by 10, 50, and 70 % at low, moderate, and
high light intensity, respectively (Fig. 7b). The fraction of
overall P700 that is oxidized in a given state, Y(ND), increased
Fig. 6 Cellular level of SOD (a) and glutathione S-transferase and GST
activity (b) of the control (blue bar) and drought-treated (red bar) samples
of W. somnifera. Data represents the mean ± SD of six separate
of W. somnifera. Data represents the mean±SD of six separate measure-
ments. Level of significance considered as *p <0.05, **p <0.001, and
***p <0.0001
at different light intensity under drought stress (Fig. 7c).
Y(NA) represents the fraction of overall P700 that cannot be
oxidized by a saturation pulse in a given state due to a lack of
oxidized acceptors. Y(NA) did not show any change at any
light intensity under drought stress (Fig. 7d). This may be due
to degradation of the chlorophyll and reduction in PQ pool
size. The fraction of energy that is passively dissipated in the
form of heat and fluorescence in PSII, Y(NO), i.e., the quan-
tum yield of non-regulated energy dissipation, also increased
by 1.5 times as compared to watered plants at different light
intensity under drought stress (Fig. 7e). The fraction of energy
dissipated as heat via the regulated non-photochemical
quenching mechanism Y(NPQ) strongly increased under
measurements. Level of significance shown as *p <0.05, **p <0.001,
and ***p <0.0001 according to ANOVA
 Sanchita et al.

Fig. 7 Calculated parameters for

the PSI and PSII at the seventh
day of drought at different light
intensities (light response curve).
Photochemical quantum yield of
PSI, Y(I) (a), photochemical
quantum yield of PSII, Y(II) (b),
quantum yield of non-
photochemical energy dissipation
due to donor side limitation,
Y(ND) (c), quantum yield of non-
photochemical energy dissipation
due to acceptor side limitation,
Y(NA) (d), quantum yield of non-
regulated energy dissipation,
Y(NO) (e), quantum yield of reg-
ulated energy dissipation,
Y(NPQ) (f), electron transfer rate
through the PSI, ETR(I) (g), and
electron transfer rate through the
PSII, ETR(II) (h). Data represents
the mean±SD of six separate
measurements

severe drought stress at different light intensity (Fig. 7f). ETR
through PSI and PSII also decreased under water stress con-
dition at different light intensity under water stress condition.
ETR followed the same trend as Y(I) and Y(II) (Fig. 7g, h).
Relative expression analysis in leaf tissues of W. somnifera
Chemical profiling of secondary metabolites
Variation in secondary metabolites were studied under effect of
drought stress conditions. The extent of variation of accumula-
tion of secondary metabolites in plants also depends upon spe-
cies, growth condition, and tissues (Martin et al. 2003; Kannan

The expression profiling of key genes of different categories

have been performed using leaf tissues for control and drought
stress samples of W. somnifera. The modulation of secondary
metabolites due to stress response involves changes in expres-
sion of responsible genes. The up and down expression of
different genes might be involved in the alteration of produc-
tion of different secondary metabolic compounds. All the
genes considered in this study were overexpressed as com-
pared to control sample. Under drought condition, the expres-
sion of osmoregulatory genes, Δ1P5CS, increased 12.3 times.
GST and SOD, the detoxifying genes, have shown 9 and 69
times increased expression, respectively. The genes
responding to signaling pathways, STK and PSP, were
overexpressed 14.4 and 12 times, respectively, and the genes
Fig. 8 Comparative expression profiling of genes associated with
of metabolic pathways, AD and LD, were overexpressed 30
drought tolerance in leaf tissue of W. somnifera at the seventh day of
and 9.3 times, respectively. The transcription factor coding water stress. Relative fold change calculated as compared to watering
genes HSP, MYB, and WRKY have shown 8.3, 27.7, and control plants. Data represents the mean ± SD of three separate
28.5 times overexpression, respectively (Fig. 8). measurements
Study of drought tolerance in Withania somnifera
Fig. 9 Comparative analysis of
withanolide contents in control
and seventh-day drought-treated
samples of leaf tissues of
W. somnifera. Data represents the
mean±SD of three separate
measurements
and Kulandaivelu 2011). The assays were successfully used to
quantify major compounds of the secondary metabolism of
W. somnifera, such as withaferin-A, 12-withastromonolides,
and withanolide-A. The quantity of withaferin-A increased by
42.7 %, whereas 12-withastromonolides and withanolide-A
showed a decrease of 78 and 71 %, respectively (Fig. 9).
Discussion
Drought is a well-characterized abiotic stress in which water
supply is a major limitation along with high temperature, low
humidity, and intense light. Primarily leaf water content is
reported to be reduced due to stomatal closure, CO2 supply
limitation, and photosynthetic rate to an extent of 60–80 %
during drought condition (Marchese et al. 2010; Silva
et al. 2009; Singh et al. 2014a). Decreased photosynthesis
fully copes with degradation of chlorophyll (Chl) and ca-
rotenoid content. Carotenoid content decreases more
rapidly as compared to Chl content and Chl/
carotenoids ratio increases during drought stress. The
distinctive yellow color of light-harvesting carotenoids
becomes more apparent in leaves during drought when chlo-
rophyll degrades. Carotenoids are required for the correct as-
sembly and functioning of photosystems to maintain CO2 as-
similation (Li et al. 2009; Pogson et al. 2005). They absorb
light across a broader range of sun irradiance and transfer the
energy to chlorophyll, thus performing photochemical events
of photosynthesis (Polivka and Frank 2010). In plants, carot-
enoids are bound in discrete pigment–protein complexes re-
ferred to as the LHCII trimeric complex, which typically ben-
efits from lutein, neoxanthin, as well as violaxanthin to trans-
fer energy to chlorophyll and protect the plant from
photoinhibition (Dall’Osto et al. 2010; Demmig-Adams and
Adams 2006; Pogson et al. 2005). Anthocyanin is another
pigment, which increases under drought stress. They act as
light attenuators, protecting photosynthetic machinery from
high light stress by absorption of high-energy from blue-
green wavelengths of the solar spectrum (Ranjan et al. 2014;
Chalker-Scott 1999). The anthocyanin pigments do not trans-
fer the absorbed light energy to the photosynthetic apparatus
and protect photosystems from photoinhibition (Hogewoning
et al. 2012). The gene coding for leucocyanidin dioxygenase
(LD) is involved in anthocyanin biosynthesis (Petrussa et al.
2013). Anthocyanin is the pigment synthesized via flavonoids
biosynthesis. The production of anthocyanin in plants is a
clear visible marker for plant response to unfavorable growth
conditions (Chalker-Scott 1999). Our study revealed that the
higher expression of LD leads to increase in the synthesis of
anthocyanin (Figs. 5b and 8). The variations of carotenoids
content were in accordance with an earlier report on drought
stress experiment in tobacco (Mackova et al. 2013). The
drought stress leads to a high level of malondialdehyde
(MDA) content. The MDA are synthesized in plant cells
through lipid peroxidation. The up expression of aldehyde
dehydrogenase (AD) level of MDA through catalyzing the
oxidation process of aldehydes formed during stress can be
correlated to high MDA accumulation. Several reports are
available on development of transgenics through overexpres-
sion of AD gene conferring the tolerance against abiotic stress
as well as reducing the level of MDA derived from cellular
lipid peroxidation (Huang et al. 2008; Kotchoni et al. 2006).
Increased MDA content and AD gene expression fully corre-
lates with increased electrolyte leakage (in terms of percent
conductivity) under water stress in W. somnifera (Figs. 2c, 5c,
and 8). It is reported that in stress condition, proline act as both
metabolite as well as signal molecule (Szabados and Savoure
2010). Proline is synthesized via two pathways, i.e., glutamine

and ornithine pathways. However, it is mainly synthesized
through glutamine pathway. Δ1P5CS enzyme of this pathway
belonging to aldehyde dehydrogenase family is a novel bi-
functional enzyme that catalyzes the first two steps of proline
biosynthesis in plants (Kavi-Kishor et al. 2005). The relation-
ship among proline content, expression of Δ1-pyroline-5-car-
boxylate synthetase (Δ1P5CS), and drought tolerance justifies
the higher accumulation of proline (Denga et al. 2013). In our
study, proline accumulation with increased expression of
Δ1P5CS under drought stress was observed (Figs. 5d and 8).
The role of up-regulation of Δ1P5CS leading to proline accu-
mulation has earlier been studied in Arabidopsis thaliana un-
der osmotic stress condition (Yoshiba et al. 1995). The proline
content is reported to be enhanced significantly with the in-
crease in drought stress, suggesting to maintain the plant cell’s
water potential more negative and enhance active absorption
of water (Fan et al. 2011). The reactive oxygen species (ROS)
production is related to normal functioning of the cell-like
aerobic metabolism (Moller 2001) and photosynthesis
(Asada 1999). The excess ROS are detoxified through antiox-
idant enzymes to make a balance in the formation and elimi-
nation of ROS (Alvarez et al. 2009). It has been reported that
the overexpression of antioxidant enzymes is the indication of
mechanism of plant tolerance against ROS (Gill and Tuteja
2010). In our analysis, the expression of genes coding for
antioxidant enzymes, glutathione S-transferase (GST), and su-
peroxide dismutase (SOD) have shown increased expression.
SOD converts superoxide to H2O2, which is further scavenged
by catalase. So, the antioxidant genes as well as compounds
have proven to be a good mode for reducing the cell toxicity
caused due to ROS. The gene manipulation study through
antioxidant genes for developing transgenic plants may be a
good approach for reducing the level of ROS. The role of
overexpression of GST and SOD genes in stress tolerance
has also been justified in earlier reports (Alscher et al. 2002;
Liu et al. 2013; Sharma et al. 2014; Tsang et al. 1991). In our
study, the cellular content of SOD and GST fully correlates
with gene expression data. The anthocyanins are also reported
as non-enzymatic antioxidant agents scavenging the accumu-
lated ROS (Johnson et al. 2003). The increased GST content
along with GST gene expression under water stress in
Gossypium sp. is also available in an earlier report (Singh
et al. 2014b). Our results revealed an increase in the levels
of anthocyanin with the increase in duration of drought stress
for detoxification of ROS. Serine/threonine specific protein
kinase (STK) is a group of kinase proteins having the role in
phosphorylation of the OH group of serine or threonine
(Sanchita et al. 2014). STK group consists of different types
of kinase proteins, viz., mitogen-activated protein kinase
(MAPK), calmodulin-dependent protein kinases (CaM), pro-
tein kinase A (PKA) and C (PKC), and phosphorylase kinase
(PhK). In this study, MAPK was selected for the expression
analysis under drought stress and showed the overexpression.
Sanchita et al.
MAPKs are involved in signaling pathway phosphorylating
the specific serine/threonine residues on the target protein and
regulate a variety of cellular activities against different types
of stress conditions (Zhu 2002). In contrast to STK, phospho-
protein phosphatase (PSP) is a group of protein that dephos-
phorylates the substrate proteins. Although PSPs are involved
in a wide range of cellular processes, including meiosis and
cell division, apoptosis, protein synthesis, metabolism, cyto-
skeleton reorganization, and the regulation of membrane re-
ceptors and channels (Ceulemans and Bollen 2004), they are
mainly the negative regulator for ABA signaling. They are
also known to be involved in providing resistance against
drought stress in A. thaliana (Bhaskara et al. 2012; Pizzio
et al. 2013). The transgenic studies based on PSP have also
been done for drought stress resistance in different plants
(Zhang et al. 2013; Xu et al. 2007). HSPs are small protein
molecules translated by HSP genes which accumulate in re-
sponse to heat shock. In expression analysis of leaf tissue of
W. somnifera, we found high HSPs expression in drought-
treated samples. HSPs function as H2O2 sensors and help to
maintain the level of H2O2 scavengers like antioxidant en-
zymes (Miller and Miller 2006). The increased level of
HSPs expression or HSPs content in cotton (Burke et al.
1985), A. thaliana (Mu et al. 2013), and Nicotiana tabacum
(Rizhsky et al. 2002) has already been reported under water
stress condition. The enhanced tolerance to drought/osmotic
stress has been studied in transgenic A. thaliana showing
overexpression of heat shock protein (Mu et al. 2013). Thus,
HSPs may play a key role in imparting tolerance to
W. somnifera against drought. WRKY is a transcription factor
protein family, which is highly induced by abiotic stresses
(Ulker and Somssich 2004). It modulates jasmonic acid-,
abscisic acid-, and salicylic acid-induced signaling events dur-
ing pathogen attack (Li et al. 2006) and osmotic stress (Chen
et al. 2010). In our study, the overexpression of WRKY cod-
ing gene showed its role in drought tolerance mechanism.
Another transcription factor, MYB, has also shown the over-
expression in W. somnifera for its response against drought
stress. MYB is reported to be involved in various processes of
plant growth, development, and stress response. It has been
reported to show its role in drought stress tolerance in
A. thaliana (Zhang et al. 2012), rice (Xiong et al. 2014), and
potato (Shin et al. 2011) through transgenic approach. The
drought stress tolerance in any medicinal plants leads to the
increase in the level of secondary metabolism. An earlier
study has reported a 5 % increase in withaferin-A content
under water stress as compared to control (Kannan and
Kulandaivelu 2011). In the present study, under stress condi-
tion, the genes responsible for withaferin-A biosynthesis may
possibly be overexpressed, but the reverse phenomena was
observed in the case of 12-deoxy-withastromonolides and
withanolide-A (Fig. 9). The down expression of genes respon-
sible for the synthesis of these two withanolides might exist.
Study of drought tolerance in Withania somnifera
The results are in accordance with the earlier study reported on
the effect of drought stress on reduction of 12-deoxy-
withastromonolides and withanolide-A contents (Shah
et al. 2010).
Acknowledgments The authors S, RS, and AM are thankful to CSIR,
New Delhi, India for CSIR-SRF fellowship.
Conflict of interest The authors declare that no conflicting interests
exist.
References
Agarwal PK, Shukla PS, Gupta K, Jha B (2013) Bioengineering for
salinity tolerance in plants: state of the art. Mol Biotechnol 54(1):
102–123
Alscher RG, Erturk N, Heath LS (2002) Role of superoxide dismutases
(SODs) in controlling oxidative stress in plants. J Exp Bot 53(372):
1331–1341
Alvarez S, Zhu M, Chen S (2009) Proteomics of Arabidopsis redox
proteins in response to methyl jasmonate. J Proteomics 73(1):30–40
Asada K (1999) The water-water cycle in chloroplasts: scavenging of
active oxygens and dissipation of excess photons. Annu Rev Plant
Physiol Plant Mol Biol 50:601–639
Bates LS, Waldren RP, Teare ID (1973) Rapid determination of free
proline for water-stress studies. Plant Soil 39(1):205–207
Bhaskara GB, Nguyen TT, Verslues PE (2012) Unique drought resistance
functions of the highly ABA-induced clade A protein phosphatase
2Cs. Plant Physiol 160(1):379–395
Boyer JS, James RA, Munns R, Condon T, Passioura JB (2008) Osmotic
adjustment leads to anomalously low estimates of relative water
content in wheat and barley. Funct Plant Biol 35(11):1172–1182
Burke JJ, Hatfield JL, Klein RR, Mullet JE (1985) Accumulation of heat
shock proteins in field-grown cotton. Plant Physiol 78(2):394–398
Ceulemans H, Bollen M (2004) Functional diversity of protein
phosphatase-1, a cellular economizer and reset button.
Physiol Rev 84(1):1–39
Chalker-Scott L (1999) Environmental significance of anthocyanins in
plant stress responses. J Photochem Photobiol 70(1):1–9
Chaurasiya ND, Uniyal GC, Lal P, Misra L, Sangwan NS, Tuli R,
Sangwan RS (2008) Analysis of withanolides in root and leaf of
Withania somnifera by HPLC with photodiode array and evapora-
tive light scattering detection. Phytochem Anal 19(2):148–154
Chen H, Lai Z, Shi J, Xiao Y, Chen Z, Xu X (2010) Roles of Arabidopsis
WRKY18, WRKY40 and WRKY60 transcription factors in plant
responses to abscisic acid and abiotic stress. BMC Plant Biol 10:281
Chen JH, Jiang HW, Hsieh EJ, Chen HY, Chien CT, Hsieh HL, Lin TP
(2012) Drought and salt stress tolerance of an Arabidopsis glutathi-
one S-transferase U17 knockout mutant are attributed to the com-
bined effect of glutathione and abscisic acid. Plant Physiol 158(1):
340–351
Cruz de Carvalho MH (2008) Drought stress and reactive oxygen species:
production, scavenging and signaling. Plant Signal Behav 3(3):156–
165
Dall'Osto L, Cazzaniga S, Havaux M, Bassi R (2010) Enhanced
photoprotection by protein-bound vs free xanthophyll pools: a com-
parative analysis of chlorophyll b and xanthophyll biosynthesis mu-
tants. Mol Plant 3(3):576–593
Demmig-Adams B, Adams WW 3rd (2006) Photoprotection in an eco-
logical context: the remarkable complexity of thermal energy dissi-
pation. New Phytol 172(1):11–21
Denga G, Lianga J, Xua D, Longa H, Pana ZH, Yua M (2013) The
relationship between proline content, the expression level of P5CS
(Δ1-pyrroline-5-carboxylate synthetase), and drought tolerance in
Tibetan hulless barley (Hordeum vulgare var. nudum). Russ J Plant
Physl 60(5):693–700
Dinakar C, Djilianov D, Bartels D (2012) Photosynthesis in desiccation
tolerant plants: energy metabolism and antioxidative stress defense.
Plant Sci 182:29–41
Faize M, Burgos L, Faize L, Piqueras A, Nicolas E, Barba-Espin G,
Clemente-Moreno MJ, Alcobendas R, Artlip T, Hernandez JA
(2011) Involvement of cytosolic ascorbate peroxidase and Cu/Zn-
superoxide dismutase for improved tolerance against drought stress.
J Exp Bot 62(8):2599–2613
Fan SL, Yuan ZH, Feng LJ, Wang XH, Ding XM, Zhen HL (2011)
Effects of drought stress on physiological and biochemical parame-
ters of Dahlia pinnata. Ying Yong Sheng Tai Xue Bao 22(3):651–
657
Gill SS, Tuteja N (2010) Reactive oxygen species and antioxidant ma-
chinery in abiotic stress tolerance in crop plants. Plant Physiol Bioch
48(12):909–930
Heath RL, Packer L (1968) Photoperoxidation in isolated chloroplasts. I.
Kinetics and stoichiometry of fatty acid peroxidation. Arch Biochem
Biophys 125(1):189–198
Hogewoning SW, Wientjes E, Douwstra P, Trouwborst G, van Ieperen W,
Croce R, Harbinson J (2012) Photosynthetic quantum yield dynam-
ics: from photosystems to leaves. Plant Cell 24(5):1921–1935
Huang W, Ma X, Wang Q, Gao Y, Xue Y, Niu X, Yu G, Liu Y (2008)
Significant improvement of stress tolerance in tobacco plants by
overexpressing a stress-responsive aldehyde dehydrogenase gene
from maize (Zea mays). Plant Mol Biol 68(4–5):451–463
Johnson SM, Doherty SJ, Croy RRD (2003) Biphasic superoxide gener-
ation in potato tubers. A self-amplifying response to stress. Plant
Physiol 131(3):1440–1449
Kannan ND, Kulandaivelu G (2011) Drought induced changes in phys-
iological, biochemical and phytochemical properties of Withania
somnifera Dun. J Med Plants Res 5(16):3929–3935
Kavi-Kishor PB, Sangam S, Amrutha RN, Sri Laxmi P, Naidu KR, Rao
KRSS, Rao S, Reddy KJ, Theriappan P, Sreenivasulu N (2005)
Regulation of proline biosynthesis, degradation, uptake and trans-
port in higher plants: its implications in plant growth and abiotic
stress tolerance. Curr Sci 88(3):424–438
Kotchoni SO, Kuhns C, Ditzer A, Kirch HH, Bartels D (2006) Over-
expression of different aldehyde dehydrogenase genes in
Arabidopsis thaliana confers tolerance to abiotic stress and protects
plants against lipid peroxidation and oxidative stress. Plant Cell
Environ 29(6):1033–1048
Li J, Brader G, Kariola T, Palva ET (2006) WRKY70 modulates the
selection of signaling pathways in plant defense. Plant J 46(3):
477–491
Li Z, Wakao S, Fischer BB, Niyogi KK (2009) Sensing and responding to
excess light. Annu Rev Plant Biol 60:239–260
Liu D, Liu Y, Rao J, Wang G, Li H, Ge F, Chen C (2013) Overexpression
of the glutathione S-transferase gene from Pyrus pyrifolia fruit im-
proves tolerance to abiotic stress in transgenic tobacco plants. Mol
Biol (Mosk) 47(4):591–601
Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression
data using RealTime quantitative PCR and the 2−ΔΔCT method.
Methods 25(4):402–408
Mackova H, Hronkova M, Dobra J, Tureckova V, Novak O, Lubovska Z,
Motyka V, Haisel D, Hajek T, Prasil IT, Gaudinova A, Storchova H,
Ge E, Werner T, Schmulling T, Vankova R (2013) Enhanced
drought and heat stress tolerance of tobacco plants with ectopically
enhanced cytokinin oxidase/dehydrogenase gene expression. J Exp
Bot 64(10):2805–2815

Makbul S, Guler NS, Durmus N, Guven S (2011) Changes in anatomical
and physiological parameters of soybean under drought stress. Turk
J Bot 35(4):369–377
Marchese JA, Ferreira JFS, Rehder VLG, Rodrigues O (2010) Water
deficit effect on the accumulation of biomass and artemisinin in
annual wormwood (Artemisia annua L., Asteraceae). Braz J Plant
Physiol 22(1):1–9
Martin DM, Gershenzon J, Bohlmann J (2003) Induction of volatile ter-
pene biosynthesis and diurnal emission by methyl jasmonate in fo-
liage of Norway spruce. Plant Physiol 132(3):1586–1599
Miller G, Miller R (2006) Could heat shock transcription factors function
as hydrogen peroxide sensors in plants? Ann Bot 98:279–288
Moller IM (2001) Plant mitochondria and oxidative stress: electron trans-
port, NADPH turnover, and metabolism of reactive oxygen species.
Annu Rev Plant Physiol Plant Mol Biol 52:561–591
Mu C, Zhang S, Yu G, Chen N, Li X, Liu H (2013) Overexpression of
small heat shock protein LimHSP16.45 in Arabidopsis enhances
tolerance to abiotic stresses. PLoS One 8(12):e82264
Murray JR, Hackett WP (1991) Dihydroflavonol reductase activity in
relation to differential anthocyanin accumulation in juvenile and
mature phase Hedera helix L. Plant Physiol 97(1):343–351
Petrussa E, Braidot E, Zancani M, Peresson C, Bertolini A, Patui S,
Vianello A (2013) Plant flavonoids—biosynthesis, transport and
involvement in stress responses. Int J Mol Sci 14(7):14950–14973
Pizzio GA, Rodriguez L, Antoni R, Gonzalez-Guzman M, Yunta C,
Merilo E, Kollist H, Albert A, Rodriguez PL (2013) The PYL4
A194T mutant uncovers a key role of PYR1-LIKE4/protein phos-
phatase 2CA interaction for abscisic acid signaling and plant
drought resistance. Plant Physiol 163(1):441–455
Pfaffl MW (2001) A new mathematical model for relative quantification
in real-time RT–PCR. Nucleic Acids Res 29(9):1–6
Pogson BJ, Rissler HM, Frank HA (2005) The roles of carotenoids in
photosystem II of higher plants. In: Wydrzynski KS T (ed)
Photosystem II: the light-driven water: plastoquinone oxidoreduc-
tase. Springer, Dordrecht, pp 515–537
Polivka T, Frank HA (2010) Molecular factors controlling photosynthetic
light harvesting by carotenoids. Acc Chem Res 43(8):1125–1134
Ramakrishna A, Ravishankar GA (2011) Influence of abiotic stress sig-
nals on secondary metabolites in plants. Plant Signal Behav 6(11):
1720–1731
Ranjan S, Singh R, Singh M, Pathre UV, Shirke PA (2014) Characterizing
photoinhibition and photosynthesis in juvenile-red versus mature-
green leaves of Jatropha curcas L. Plant Physiol Biochem 79:48–59
Rizhsky L, Liang H, Mittler R (2002) The combined effect of drought
stress and heat shock on gene expression in tobacco. Plant Physiol
130(3):1143–1151
Sanchita, Dhawan SS, Sharma A (2014) Analysis of differentially
expressed genes in abiotic stress response and their role in signal
transduction pathways. Protplasma 251(1):81–91
Scartezzini P, Antognoni F, Conte L, Maxia A, Troia A, Poli F (2007)
Genetic and phytochemical difference between some Indian and
Italian plants of Withania somnifera (L.) Dunal. Nat Prod Res
21(10):923–932
Shah S, Saravanan R, Gajbhiye NA (2010) Phytochemical and physio-
logical changes in Ashwagandha (Withania somnifera Dunal) under
soil moisture stress. Braz J Plant Physiol 22(4):255–261
Sharma R, Sahoo A, Devendran R, Jain M (2014) Over-expression of a
rice tau class glutathione s-transferase gene improves tolerance to
salinity and oxidative stresses in Arabidopsis. PLoS One 9(3):
e92900
Sanchita et al.
Shin D, Moon SJ, Han S, Kim BG, Park SR, Lee SK, Yoon HJ, Lee HE,
Kwon HB, Baek D, Yi BY, Byun MO (2011) Expression of
StMYB1R-1, a novel potato single MYB-like domain transcription
factor, increases drought tolerance. Plant Physiol 155(1):421–432
Shulaev V, Oliver DJ (2006) Metabolic and proteomic markers for oxi-
dative stress. New tools for reactive oxygen species research. Plant
Physiol 141(2):367–372
Silva EC, Nogueira RJMC, Vale FHA, Melo NF, Araujo FP (2009) Water
relations and organic solutes production in four umbu tree (Spondias
tuberosa) genotypes under intermittent drought. Braz J Plant Physiol
21(1):43–53
Singh R, Naskar J, Pathre UV, Shirke PA (2014a) Reflectance and cyclic
electron flow as an indicator of drought stress in cotton (Gossypium
hirsutum). Photochem Photobiol 90(3):544–551
Singh R, Pandey N, Naskar J, Shirke PA (2014b) Physiological perfor-
mance and differential expression profiling of genes associated with
drought tolerance in contrasting varieties of two Gossypium species.
Protoplasma. doi:10.1007/s00709-014-0686-0
Srivastava P, Tiwari N, Yadav AK, Kumar V, Shanker K, Verma RK,
Gupta MM, Gupta AK, Khanuja SPS (2008) Simultaneous quanti-
fication of withanolides in Withania somnifera by a validated high-
performance thin-layer chromatographic method. J Aoac Int 91(5):
1154–1161
Szabados L, Savoure A (2010) Proline: a multifunctional amino acid.
Trends Plant Sci 15(2):89–97
Tsang EWT, Bowler C, Herouart D, Vancamp W, Villarroel R, Genetello
C, Vanmontagu M, Inze D (1991) Differential regulation of super-
oxide dismutases in plants exposed to environmental-stress. Plant
Cell 3(8):783–792
Ulker B, Somssich IE (2004) WRKY transcription factors: from
DNA binding towards biological function. Curr Opin Plant
Biol 7(5):491–498
Verma SK, Kumar A (2011) Therapeutic uses of Withania somnifera
(ashwagandha) with a note on withanolides and its pharmacological
actions. Asian J Pharm Clin Res 4:1–4
Wellburn AR (1994) The spectral determination of chlorophylls a and b,
as well as total carotenoids, using various solvents with spectropho-
tometers of different resolution. J Plant Physiol 144:307–313
Xiong H, Li J, Liu P, Duan J, Zhao Y, Guo X, Li Y, Zhang H, Ali J, Li Z
(2014) Overexpression of OsMYB48-1, a novel MYB-related tran-
scription factor, enhances drought and salinity tolerance in rice.
PLoS One 9(3):e92913
Xu C, Jing R, Mao X, Jia X, Chang X (2007) Awheat (Triticum aestivum)
protein phosphatase 2A catalytic subunit gene provides enhanced
drought tolerance in tobacco. Ann Bot 99(3):439–450
Yoshiba Y, Kiyosue T, Katagiri T, Ueda H, Mizoguchi T, Yamaguchi-
Shinozaki K, Wada K, Harada Y, Shinozaki K (1995) Correlation
between the induction of a gene for Δ1-pyrroline-5-carboxylate
synthetase and the accumulation of proline in Arabidopsis thaliana
under osmotic stress. Plant J 7(5):751–760
Zhang J, Li X, He Z, Zhao X, Wang Q, Zhou B, Yu D, Huang X, Tang D,
Guo X, Liu X (2013) Molecular character of a phosphatase 2C
(PP2C) gene relation to stress tolerance in Arabidopsis thaliana.
Mol Biol Rep 40(3):2633–2644
Zhang L, Zhao G, Xia C, Jia J, Liu X, Kong X (2012) A wheat R2R3-
MYB gene, TaMYB30-B, improves drought stress tolerance in
transgenic Arabidopsis. J Exp Bot 63(16):5873–5885
Zhu JK (2002) Salt and drought stress signal transduction in plants. Annu
Rev Plant Biol 53:247–273