Anda di halaman 1dari 3

PCR DAN PURIFIKASI

1. Dalam tahapan PCR terdapat 3 reaksi utama, sebutkan dan jelaskan reaksi yang terjadi pada
setiap tahapnya! (3.5 poin)

2. Lengkapi tabel komposisi reagen PCR di bawah ini serta sebutkan fungsi dari setiap
komponen tersebut! (7.5 poin)
Initial Final Volume added
Component Function
Concentration Concentration to mixture
Nuclease Free
- -
Water ........ µL ..............
PCR Buffer 10x 1x ........ µL ..............
dNTP ...... µM 200 µM 1 µL ..............
Forward primer 10 µM 0,5 µM ........ µL ..............
Reverse primer 10 µM 0,5 µM ........ µL ...............
Taq DNA
........ µL 0.05 units/µL 0.5 µL
Polymerase ..............
Template DNA 50 µg/mL 250 ng ........ µL ..............
MgCl2 25 mM 0,5 mM ........ µL ..............
50 µL ...............

3. Setelah anda melakukan PCR, anda melakukan elektroforesis. Kemudian pita yang
dihasilkan: (5 poin)
a. Pita yang dihasilkan melengkung (curved). Apa yang dapa menyebabkan hal tersebut
bisa terjadi dan apakah solusi yang dapat dilakukan (minimal 3)?
b. Pita yang dihasilkan tipis pada keseluruhan (termasuk ladder. Apa yang dapat
menyebabkan hal tersebut bisa terjadi dan apa solusi yang dapat dilakukan (minimal 3)?

4. Jelaskan prinsip dari purifikasi gel beserta reagen yang digunakan! (4 poin)
ANALISIS SEKUENSING

1. Anda adalah peneliti muda kebanggaan indonesia yang diminta untuk melakukan kloning
gen coaD dari Escherichia coli yang dapat mengkode phosphopantetheine
adenylyltransferase (PPAT). PPAT adalah enzim yang terlibat dalam biosintesis koenzim A.
Urutan sekuens dari gen coaD sebagai berikut :

TTTGGCGCCACTCGTTGATGCAAAAACGGGCGATTTATCCGGGTACTTTCGATCCCATTACCAAT
GGTCATATCGATATCGTGACGCGCGCCACGCAGATGTTCGATCACGTTATTCTGGCGATTGCCGC
CAGCCCCAGTAAAAAACCGATGTTTACCCTGGAAGAGCGTGTGGCACTGGCACAGCAGGCAACC
GCGCATCTGGGGAACGTGGAAGTGGTCGGGTTTAGTGATTTAATGGCGAACTTCGCCCGTAATC
AACACGCTACGGTGCTGATTCGTGGCCTGCGTGCGGTGGCAGATTTTGAATATGAAATGCAGCT
GGCGCATATGAATCGCCACTTAATGCCGGAACTGGAAAGTGTGTTTCTGATGCCGTCGAAAGAG
TGGTCGTTTATCTCTTCATCGTTGGTGAAAGAGGTGGCGCGCCATCAGGGCGATGTCACCCATTT
CCTGCCGGAGAATGTCCATCAGGCGCTGATGGCGAAGTTAGCGTACGGGTGCTA

Untuk memudahkan penelitian anda, anda diminta untuk terlebih dahulu melakukan
amplifikasi terhadap gen tersebut. Rancanglah primer yang dapat mengamplifikasi full
length gen tersebut dan sertakan alasan memilih primer tersebut! (10 poin)
Hands On

Bagaimana cara melakukan elektroforesis hasil isolasi DNA? (lakukan mulai dari langkah
pertama hingga selesai)