See

discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/232695817

Genetic Diversity of Wild Oat (Avena Fatua)

Populations from China and the United States

Article in Weed Science · January 2009

DOI: 10.1614/WS-06-108.1

CITATIONS READS

21 108

6 authors, including:

Wang Shiwen Liusheng Duan

Northwest A & F University China Agricultural University
34 PUBLICATIONS 409 CITATIONS 54 PUBLICATIONS 944 CITATIONS

SEE PROFILE SEE PROFILE

All content following this page was uploaded by Wang Shiwen on 19 March 2015.

The user has requested enhancement of the downloaded file. All in-text references underlined in blue are added to the original document
and are linked to publications on ResearchGate, letting you access and read them immediately.
Weed Science 2007 55:95–101

Genetic Diversity of Wild Oat (Avena fatua) Populations from China and the
United States
Runzhi Li, Shiwen Wang, Liusheng Duan, Zhaohu Li, Michael J. Christoffers, and Lemma W. Mengistu*
Weed genetic diversity is important for understanding the ability of weeds to adapt to different environments and the
impact of herbicide selection on weed populations. Genetic diversity within and among six wild oat populations in China
varying in herbicide selection pressure and one population in North Dakota were surveyed using 64 polymorphic alleles
resulting from 25 microsatellite loci. Mean Nei’s gene diversity (h) for six wild oat populations from China was between
0.17 and 0.21, and total diversity (HT) was 0.23. A greater proportion of this diversity, however, was within (Hs 5 0.19)
rather than among (Gst 5 0.15) populations. For the wild oat population from the United States, h 5 0.24 and HT 5
0.24 were comparable to the values for the six populations from China. Cluster analysis divided the seven populations into
two groups, where one group was the United States population and the other group included the six Chinese populations.
The genetic relationships among six populations from China were weakly correlated with their geographic distribution (r
5 0.22) using the Mantel test. Minimal difference in gene diversity and small genetic distance (Nei’s distance 0.07 or less)
among six populations from China are consistent with wide dispersal of wild oat in the 1980s. Our results indicate that the
wild oat populations in China are genetically diverse at a level similar to North America, and the genetic diversity of wild
oat in the broad spatial scale is not substantially changed by environment, agronomic practices, or herbicide usage.
Nomenclature: Wild oat, Avena fatua L. AVEFA.
Key words: Genetic diversity, gene flow, herbicide selection, simple sequence repeat analysis.

Wild oat is one of the worst annual weeds of the temperate
cereal growing regions of the world. It also is one of the most
important agronomic weeds in China, particularly as the
principal weed in regions growing wheat (Triticum aestivum
L.). It was reported that wild oat infested about 5 million ha
of cultivated land in China, and wheat yield losses due to wild
oat interference have been conservatively estimated at 1,750
million kg of grain annually (Wang et al. 2003). The success
of wild oat as a weed depends on long-term seed viability,
sporadic emergence, production of large numbers of seeds,
and high genetic variability within populations (Naylor 1983;
Naylor and Jana 1976).
Selective herbicides that controlled wild oat, such as
barban, diallate, triallate, and difenzoquat, were introduced
for wild oat control from the early 1960s and developed into
a large group with different modes of action as reviewed by
Mengistu et al. (2003). These selective herbicides have been
used predominantly for wild oat control in North America
and Europe (Cavan et al. 1998; Mengistu et al. 2005). In
China, wild oat control practices vary among different regions
from minimal to high-intensity use of herbicides because of
different rural economic circumstances (Wang et al. 2003).
After several decades of frequent and widespread use, wild
oat has evolved resistance in many countries to several
herbicide mechanisms of action (Heap 2006). Wild oat has
developed cross- and multiple-resistance to several herbicide
mechanism-of-action groups, and some populations of wild
oat that had not been exposed to herbicides have even
exhibited substantial levels of resistance (Bourgeois et al.
1997; Friesen et al. 2000; Rashid et al. 1998; Seefeldt et al.
1994). Mengistu et al. (2003) studied the herbicide-resistance
trends among wild oat sampled 36 yr apart. They found that
the frequency of wild oat resistance was significantly greater in
DOI: 10.1614/WS-06-108.1
* First through fourth authors: Department of Agronomy, China Agricultural
University, Beijing, 100094, China; fifth and sixth authors: Department of Plant
Sciences, North Dakota State University, Fargo, ND 58105. Current address of
sixth author: Minnesota Department of Agricultures, 625 Robert St. N., St. Paul,
MN 55155. Corresponding author’s E-mail: lizhaohu@cau.edu.cn
the 2000 collection compared with populations samples in
1964. For example, resistance frequency increased for
imazamethabenz from 38% in the 1964 collection to 65%
in the 2000 populations, and for difenzoquat, from 27 to
58%. Herbicide usage has been affected because of the wild
oat resistance in North America (Mengistu et al. 2003).
There are no reports in China of herbicide-resistant
biotypes of wild oat so far. However, given the increasingly
wide and extensive use of herbicides, e.g., diclofop,
difenzoquat, fenoxaprop-P, and triallate, especially where
some of these herbicides have been used for three decades
(Zhang 1995), herbicide-resistance in wild oat may become
one of the most significant weed-management problems
facing Chinese growers and researchers in the future.
Genetic diversity is the heritable genetic variation within
and among populations of a species. Descriptive studies of
genetic diversity in weed populations can be extremely
important because they provide essential background for
further focused research, such as understanding the ability of
weeds to adapt to different environments and the impact of
herbicide selection on weed populations. It has been reported
that the genetic diversity of wild oat is very high in North
America and Europe (Cavan et al. 1998; Mengistu et al.
2005). Furthermore, Mengistu et al. (2005) indicated that
herbicide-resistant wild oat populations are genetically diverse
and similar to the herbicide-susceptible populations in North
Dakota. These results suggest that the overall adaptive
diversity for resistance to new herbicides and other changes
in the environment and agronomic practices may not have
been substantially reduced by herbicide use over the past
several decades (Mengistu et al. 2005).
A range of molecular marker systems are used to explore the
genetic diversity of weeds (Ash et al. 2003; Mengistu et al.
2004, 2005; Mengistu and Messersmith 2002; Moodie et al.
1997). Among the molecular marker options, microsatellites
are desirable for surveying weed populations because of high
levels of polymorphism and information content, selective
neutrality, high reproducibility, and wide dispersion in diverse
genomes (Amsellem et al. 2001; Danquah et al. 2002; Green

Li et al.: Genetic diversity of wild oat from China and U.S. N 95

Figure 1. Sampling locations in six Chinese provinces representing six wild oat populations, with each black dot representing the Global Positioning System coordinate
of a sample site.
et al. 2001; Mörchen et al. 1996; Senda et al. 2004). Although
there are a few reports on the development of microsatellite
markers in oat (Avena sativa L.) (Li et al. 2000; Narinder et al.
2002), this technique has not been used for analysis of genetic
structure and population differentiation in wild oat. Further-
more, there are similarities in genome organization and
nucleotide sequences of genes among grass species (Devos and
Gale 2000), and information gained during analysis of rice
(Oryza sativa L.), wheat, and barley (Hordeum vulgare L.)
should apply to the study and manipulation of genomes of
relatively less-well-studied species like wild oat.
We assume the genetic diversity of wild oat in China is high
and comparable to the genetic diversity of wild oat in North
America and Europe, as reported by Mengistu et al. (2005)
and Cavan et al. (1998). However, the genetic variation of
wild oat in China has never been investigated on a large
geographic scale, and detailed information on the genetic
structure of wild oat populations has remained unavailable.
Here, we report a study using microsatellite markers to detect
genetic diversity within and among six populations of wild oat
sampled across a large spatial range in China, where farming
systems are substantially different from winter wheat to spring
wheat production areas, and herbicide-selection intensity is
significantly different (from minimal to heavy use). One
population from North Dakota, where wild oat control is
predominantly by herbicides (Mengistu et al. 2003), is
included for comparison.
Our objectives were (1) to evaluate the usability of oat
microsatellites and validate whether barley and wheat
microsatellites could be used to study the genetic diversity
of wild oat, (2) to determine the genetic diversity and
differentiation of seven wild oat populations, and (3) to
compare the levels of genetic diversity detected with
microsatellites to those found with intersimple sequence
96 N Weed Science 55, March–April 2007
repeat (ISSR) and random amplified polymorphic DNA
(RAPD) markers (Cavan et al. 1998; Mengistu et al. 2005).
This information can improve our understanding of the
genetic diversity of wild oat from a broad spatial scale within
China and between two continents and can assist in
maintaining an effective management strategy for wild oat
control with increasing herbicide usage in China.
Materials and Methods
Material Collection and DNA Extraction. A total of 1,000
individual wild oat plants, representing six populations, were
collected in 2004 from six provinces in China, where wild oat
is one of the worst weeds of different farming systems from
winter wheat to spring wheat and where herbicide-selection
pressure differs from minimal to heavy use because of regional
economic status (Figure 1, Table 1). The sampled popula-
tions inhabited different areas within a wide geographic range
(100 to 119uE, 32 to 41uN), and each population was
separated by at least 180 km.
Wild oat samples were collected as described by Mengistu
et al. (2003). Each population was created by collecting three
to five samples per site, moving 1.5 to 2 km between
sampling sites. Seeds for each sample were from a single
mature parent plant, and the location of each plant was
documented using a hand-held Global Positioning System
(GPS). If wild oat was not present at the target sampling site,
the next occurrence of wild oat was sampled. One plant of the
three to five samples per site was randomly selected for further
study. Thus, of the 1,000 plants sampled, the analysis used
347 samples representing six populations (provinces), with
a sample size of 41 to 83 plants per population. In addition,
this study included 68 individual plants of one wild oat
population from North Dakota, where wild oat control is
Table 1. Characteristics of six wild oat populations from wheat fields in China, including sampling locations, the total number of individual plant samples in each
population, and the number of samples used in the present study.
Longitude Latitude Total number of Number of Herbicide selection Farming
Sample site (east) (north) samples collected samples studied pressure a system
Anhui 115u289 to 116u099 32u409 to 33u079 200 83 Low intensity Winter wheat
Henan 113u529 to 114u339 33u279 to 33u579 130 50 Heavy intensity Winter wheat
Jiangsu 119u199 to 119u469 32u259 to 32u269 170 60 Heavy intensity Winter wheat
Shaanxi 108u429 to 109u449 33u299 to 34u209 150 46 Low intensity Winter wheat
Qinghai 100u579 to 102u489 36u199 to 36u429 230 67 Minimal intensity Spring wheat
Inner Mongolia 111u009 to 111u409 40u589 to 41u149 120 41 Minimal intensity Spring wheat
a
Herbicide selection pressure was defined as heavy intensity when wild oat control was achieved, predominantly with herbicides every year, and low intensity when
control included herbicides in some years, but not others; minimal intensity is when herbicides were not used.

predominantly by herbicides, as described by Mengistu et al.
(2003).
Seeds from each sample were sown in the greenhouse and
grown for 3 wk. The newly expanded leaf from each plant was
frozen in liquid nitrogen and ground in a microcentrifuge
tube. DNA was extracted following a rapid one-tube
extraction (ROSE) method (Steiner et al. 1995).
Microsatellite Amplification. Optimal microsatellite primers
were selected by screening 45 oat primers (Li et al. 2000;
Narinder et al. 2002), 38 barley primers (Liu et al. 1996), and
294 wheat primers (Guyomarc’h et al. 2002). Among 377
microsatellite primers, seven oat primers (nine loci), seven
barley primers (nine loci), and six wheat primers (seven loci)
produced clear and simple reproducible fragments and were
used to amplify 415 wild oat individuals (Table 2).
The reaction proceeded on a GeneAmp PCR system 9700
(PE Biosystems).1 Microsatellite amplifications were per-
formed in a 20-ml volume, containing 40-ng template DNA,
13 polymerase chain reaction (PCR) buffer (10 mM Tris–
HCl, pH 8.5, 1.5 mM MgCl2, 50 mM KCl, 0.001%
gelatin), 200 mM of each deoxynucleoside-59-detriphosphate
(dNTP), 0.2 mM of each forward and reverse primer, and 1 U
Taq DNA polymerase.
PCR programs used for different microsatellite primers
were followed: from Li et al. (2000), for PCR program 1, 2,
and 3; from Narinder et al. (2002), for program 4; and from
Guyomarc’h et al. (2002), for program 5 (Table 2). PCR
products were separated on a sequencing gel containing 6%
polyacrylamide, 7 M urea, and 13 TBE at 85 W constant
power for 45 min (BioRad sequencing system).2 The gel was
fixed, stained, and dried using a DNA silver-staining
technique (Bassam et al. 1991).
Statistical Analysis. Microsatellites are codominant genetic
markers, which can distinguish heterozygotes from homo-
zygotes. In this study, because wild oat is predominantly self-
pollinated, with few heterozygous plants, and null alleles (i.e.,
alleles that do not give a PCR product) were observed using
barley and wheat microsatellites in our study, we viewed these
markers as dominant markers in our data analysis. Only the
number of alleles per locus was calculated. Genetic diversity
parameters were calculated using 64 alleles from 25 micro-
satellite loci.
Nei’s (1973) gene diversity (h), Shannon’s information
index (I ) (Lewontin 1972), total diversity (HT), diversity
within (HS) and among populations (GST), gene flow among
populations (Nm), and Nei’s (1978) unbiased genetic identity

Table 2. Microsatellite primer sequences, their PCR programs, and number of alleles detected.a
Primer name Primer sequence (59–39) PCR Alleles Primer name Primer sequence (59–39) PCR Alleles
Oat SSRs Barley SSRs
AM6 GGATCCTCCACGCTGTTGA 2 2 HVM4 AGAGCAACTACCAGTCCAATGGCA 1 2
CTCATCCGTATGGGCTTTA GTCGAAGGAGAAGCGGCCCTGGTA
AM11 TCGTGGCAGAGAATCAAAGACAC 1 2 HVM13 AGTAGCTATGTGTTTGGATCGC 3 2
TGGGTGGAGGCAAAAACAAAAC CATCAAGGGCATCCTCATG
AM14 GTGGTGGGCACGGTATCA 2 3/4b HVM30 AGTGGGGAATGAGAGAATGG 3 2/2
TGGGTGGCGAAGCGAATC TGCTTGTGGGTCATCACAC
AM31 GCAAAGGCCATATGGTGAGAA 2 6 HVM51 TCTAAATTACCTTCCCAGCCA 3 2
CATAGGTTTGCCATTCGTGGT AAGCAGACATGTAGGAGGTCA
AM42 GCTTCCCGCAAATCATCAT 2 3 HVM64 GATGTGAAGGCTGCCTG 3 1
GAGTAAGCAAAGGCCAAAAAGT ACACGCCCTATTACCCAGTG
AM102 TGGTCAGCAAGCATCACAAT 4 3 HVM67 GTCGGGCTCCATTGCTCT 3 2/2
TGTGCATGCATCTGTGCTTA CCGGTACCCAGTGACGAC
AM112 AGCGGTGTAGGGGAAAGAGT 4 12/1 HVM68 AGGACCGGATGTTCATAACG 3 2
TTCTTGGTTTAGATGGGAGGA CAAATCTTCCAGCGAGGCT
Wheat SSRs Wheat SSRs
Ba119 CACCCGATGATGAAAAT 5 1 Ba148 GCGCAACCACAATGTATGCT 5 2
GATGGCACAAGAAATGAT GGGGTGTTTTCCTATTTCTT
Ba120 CCCCCTCTCTTCCTCAT 5 2 CFD-8 ACCACCGTCATGTCACTGAG 5 1
ATATAGCTCCCCCATTTCCT GTGAAGACGACAAGACGCAA
Ba128 GCGGGTAGCATTTATGTTGA 5 1 CFD-13 CCACTAACCAAGCTGCCATT 5 2/2
CAAACCAGGCAAGAGTCTGA TTTTTGGCATTGATCTGCTG
a
Abbreviations: PCR, polymerase chain reaction; SSR, simple sequence repeat.
b
The number of alleles detected from two loci of one primer.

Li et al.: Genetic diversity of wild oat from China and U.S. N 97

and genetic distance among pairs of populations were Table 3. Summary of genetic diversity of six Chinese and one U.S. wild
oat populations.a
estimated using POPGENE version 1.31 (Yeh et al. 1999).
Cluster analysis and drawing of the dendrogram were made by Diversity statistics and gene flowb
Sample
using the NTSYS-PC version 2.0 (Rohlf 1992). A Mantel test Population size h I HT HS GST Nm
executed with Arlequin 3.0 (Excoffier et al. 2005) was used to Chinese populations
estimate whether there was a relationship between geographic Anhui 83 0.20 0.32
distance and genetic distance for the six wild oat populations Henan 50 0.17 0.27
from China. Jiangsu 60 0.21 0.32
Shaanxi 46 0.18 0.28
Qinghai 67 0.21 0.34
Inner Mongolia 41 0.18 0.28
Results and Discussion All Chinese populations 347 0.22 0.35 0.23 0.19 0.15 1.4
SD 0.11 0.14 0.03 0.02
Polymorphism Using Oat, Wheat, and Barley Microsat- U.S. population 68 0.24 0.36 0.24 NA NA NA
ellites. Twenty-five loci (AM14, AM112, HVM30, HVM67, SD 0.09 0.11 0.03
and CFD-13 each with two microsatellite loci) were detected a
among 415 individuals of seven wild oat populations using 20 Abbreviations: NA, not applicable; SD, standard deviation.
b
h, Nei’s (1973) gene diversity; I, Shannon’s information index (Lewontin
microsatellite primers. The total number of alleles per locus 1972); HT, total diversity; Hs , diversity within population; GST, diversity among
detected in wild oat is given in Table 2. populations (HT 2 HS)/HT ; Nm, gene flow based on GST as [0.25(1 2 GST)/
For oat microsatellites, 9 of 45 microsatellites, which were GST] (Slatkin and Barton 1989).
previously isolated and characterized for oat by Li et al. (2000)
and Narinder et al. (2002), were polymorphic across all seven reached 20%, but wheat microsatellites provided poor
wild oat populations sampled. Two microsatellites, AM1 and usability for analysis of wild oat. Thus, barley microsatellites
AM3, had high levels of polymorphism, but the sizes of their are valuable for analysis of wild oat genetic diversity and may
alleles were too close to analyze accurately from the bands and decrease the need for microsatellite isolation in wild oat.
were not included in later data analysis.
A total of 36 alleles from nine oat microsatellite loci were Genetic Diversity of Wild Oat Populations. Nei’s gene
detected, and the number of alleles per locus ranged from 2 to diversity (h) for the six wild oat populations from China
12 (Table 2). The mean number of alleles per oat averaged 0.22 and ranged from h 5 0.17 for the Henan
microsatellite locus averaged 4.0 in wild oat, even though population to 0.21 for the Jiangsu and Qinghai populations
two highly polymorphic microsatellites were not analyzed. (Table 3). The mean Shannon’s information index (I ), which
This mean of 4.0 alleles was higher than 3.8 alleles per locus is another measure of genetic diversity, was 0.35. Total
in 12 Avena species and 3.4 alleles per locus in 20 Avena sativa diversity (HT) for the six wild oat populations from China was
cultivars (Li et al. 2000), which indicates that oat micro- 0.23, and the majority of this variation (85%) existed within
satellite markers are a powerful tool for studying wild oat and populations. The remaining 15% of the variation was present
for monitoring its genetic diversity. among populations (GST 5 0.15), and gene flow among
Furthermore, two loci for oat microsatellite AM112 were populations was Nm 5 1.4.
detected, one of which was present as a single band in 68 Our results based on microsatellite markers are consistent
samples from the United States but was absent in 347 samples with others showing that wild oat populations have high
from China. Whether this microsatellite marker can be used genetic variability for adaptive quantitative traits similar to
to discriminate wild oat individuals from China and the outcrossing species (Imam and Allard 1965). The high wild
United States would require further evaluation. oat genetic diversity in the Chinese wild oat populations may
For barley and wheat microsatellites: 20% from barley (7 of result from two major factors. Our sampling over a broad
38) and 2.0% from wheat (6 of 294) possessed poly- spatial scale likely contributed to this high level of genetic
morphism, and there were a total of 17 alleles among barley diversity. For example, there are about 1,680 km between the
microsatellites and 11 among wheat microsatellites. Three of Qinghai and Jiangsu populations.
the six wheat microsatellites had one allele because of the In addition, it is well known that microsatellite loci are
presence of a single band or absence of a band. The absence of widely distributed throughout the genomes of plants and
a band can be explained by deletion of a microsatellite at animals, and average 0.001 mutations per generation (Gold-
a specified locus or polymorphism between wheat and wild stein and Pollock 1997). This rate is up to four orders of
oat at the primer binding site. magnitude higher than the mutation rate at nonmicrosatellite
Previous work has shown that microsatellite primer pairs loci (Lacy 1987). The 25 microsatellite loci used in our study
developed for one Gramineae species can be used in close may cover the basic chromosome number of wild oat (2n 5
relatives (Rôder et al. 1995). Hernândez et al. (2001) found 6x 5 42; AACCDD) and may reveal more polymorphism
a high level of transferability of microsatellite markers between than markers based on morphology or isozymes.
corn (Zea mays L.) and Miscanthus species, and thereafter, they The gene diversity statistic for the U.S. population (h 5
used barley and wheat microsatellite markers for genetic 0.24, I 5 0.36, HT 5 0.24) was comparable to the gene
analysis of Hordeum chilense and Tritordeum. They concluded diversity of any one of the six wild oat populations from
that wheat and barley microsatellite markers were a valuable China (Table 3). These values are relatively low compared
source of polymorphic markers for analyzing the relatively with surveys for wild oat in the United Sates (h 5 0.29, I 5
unknown H. chilense gene pool. 0.46, HT 5 0.29) using ISSR and RAPD markers for 36
Barley is an important economic crop, so numerous micro- populations (Mengistu et al. 2005), which included some
satellites have been developed and publicly described. In our samples in the present study. The HT 5 0.22 for wild oat in
study, cross-species transportability of barley microsatellites China is also low compared with Avena spp. in Europe, where

98 N Weed Science 55, March–April 2007

Table 4. Nei’s (1978) unbiased measures of genetic distance (below the diagonal) and genetic identity (above the diagonal) among seven wild oat populations from six
Chinese provinces and the United States.a
Location Anhui Henan
Anhui *** 0.99
Henan 0.006 (180) ***
Jiangsu 0.01 (370) 0.02 (530)
Shaanxi 0.06 (620) 0.07 (460)
Qinghai 0.03 (1,340) 0.04 (1,160)
Inner Mongolia 0.06 (990) 0.07 (850)
United States 0.10 0.12
a
The numbers in parentheses below the diagonal are the mean geographic distances in kilometers for the wild oat populations between the six Chinese provinces.
HT 5 0.36 for five wild oat populations and 0.31 for five
animated oat (Avena sterilis L.) populations (Cavan et al.
1998) but is comparable with HT values for other self-
pollinating weeds, such as 0.21 for blackgrass (Alopecurus
myosuroides Huds.) (Chauvel et al. 1994) and 0.25 for annual
bluegrass (Poa annua L.) (Mengistu et al. 2000). The reason
for this difference can partly be explained by the limited
number of samples from the United States in our study and
a limited number of suitable microsatellite markers.
Genetic Structure and Deviation of Wild Oat Populations.
Most of the total genetic diversity of wild oat in China existed
within populations (HS 5 0.19), whereas only a small amount
of genetic diversity (15%, GST 5 0.15) was present among
populations (Table 3). The level and distribution of genetic
diversity in plant species is affected by the mating system.
Compared with self-pollinated species, population differenti-
ation in cross-pollinated species is generally less apparent and
much of the variation characteristic of the species may be
found within a population (Hamrick and Godt 1990;
Loveless and Hamrick 1984). Wild oat is predominantly
self-pollinated, but the results of the present study indicate
85% of the total genetic diversity was within populations
(Table 3).
One possible explanation for the high within-population
diversity is that each population covered a relatively large area.
The samples for every population used for this study account
for just 30% of original plant samples collected. For example,
the original materials of the Qinghai population included 230
samples, but only 67 were used, and those were distributed
between the extreme west (100u579E) to extreme east
(102u489E) and the extreme north (36u429N) to extreme
south (36u199N). Thus, these samples for every population
represented specific and abundant variation that likely
remained within populations. In addition, recent evidence
has revealed high levels of intrapopulation variation in self-
pollinated plants. For example, Mengistu, et al. (2005) found
that between 9% and 16% of total diversity remained within
wild oat populations.
Based on an indirect estimate of gene flow, where Nm 5
[0.25(1 2 GST)/GST] (Slatkin and Barton 1989), gene flow
among the six Chinese wild oat populations was high (Nm 5
1.4) (Table 3). Genetic drift will result in substantial local
differentiation if Nm , 1 but not if Nm . 1 (Slatkin 1987).
The Henan, Anhui, and Jiangsu provinces are the main wheat
production areas of China, and there has been frequent wheat-
seed transport with other provinces, such as Qinghai, Inner
Mongolia, and Shaanxi. Thus, seed migration is one possible
mechanism of high gene flow among populations.
Jiangsu Shaanxi Qinghai Inner Mongolia United States
0.99 0.94 0.97 0.94 0.90
0.98 0.93 0.96 0.93 0.89
*** 0.94 0.98 0.93 0.90
0.07 (990) *** 0.96 0.95 0.88
0.02 (1,680) 0.04 (730) *** 0.95 0.91
0.07 (1,180) 0.05 (810) 0.06 (980) *** 0.87
0.10 0.12 0.09 0.14 ***
Nei’s unbiased genetic distance among six wild oat
populations from China ranged from the least at 0.006
between the Anhui and Henan populations to the largest at
0.07 between the Jiangsu and Inner Mongolia populations
(Table 4). Nei’s genetic distance between the U.S. population
and the six Chinese populations ranged from 0.09 to 0.14. Of
the six Chinese wild oat populations, the Qinghai population
shared the most genetic identity with the U.S. population,
with a Nei genetic identity of 91% and a Nei genetic distance
of 0.09.
Wild oat in the 1970s was mainly distributed in Qinghai
and Inner Mongolia provinces, and it had begun to invade the
Shaanxi, Henan, Anhui, and Jiangsu provinces by the early
1980s and has become one of the worst weeds of these
agricultural fields (Tu 1987). Broad dispersal of wild oat in
the past two decades has contributed to the small genetic
distance (0.07 or less) among populations.
The six Chinese wild oat populations formed two groups of
clusters in an unweighted pair group method with arithmetic
mean (UPGMA) dendrogram, whereas the United States
population was very different (Figure 2). One main group was
composed of the Anhui, Henan, Jiangsu, and Qinghai
populations, and the Shaanxi and Inner Mongolia populations
formed the other group. Within the first group, the Anhui
and Henan populations were one subgroup and were more
similar to each other than within clusters of the other
populations.
A Mantel test to compare matrices of genetic and
geographic distances did not show a relationship between
them (r 5 0.22). For example, the four populations in the
first cluster had two populations sampled from sites closest to
each other, Anhui and Henan (180 km), and also two
populations that were farthest from each other, Qinghai and
Jiangsu (1,680 km) (Figures 1 and 2). Interestingly, the
Henan and Anhui populations were comparatively close in
distance to the Shaanxi population (450 km and 620 km,
respectively) whereas the Inner Mongolia population was very
far from the Shaanxi population (810 km). However, the
Shaanxi and Inner Mongolia populations formed one group
and had 95% microsatellite identity, whereas the Henan and
Anhui populations belonged to another group.
Our study revealed that the genetic diversity of wild oat
populations in China was high and comparable with the status
of the U.S. population. Weed species with high levels of
genetic diversity exhibit considerable potential for weed
adaptation and, therefore, the effectiveness of frequently used
weed-control techniques may be reduced (Dekker 1997; Holt
and Hochberg 1997). However, there aren’t any reports of
herbicide-resistant biotypes of wild oat in China, whereas the
U.S. wild oat populations have evolved resistance to a wide
Li et al.: Genetic diversity of wild oat from China and U.S. N 99
Figure 2. The unweighted pair group method with arithmetic mean (UPGMA) dendrogram resulting from cluster analysis using Nei’s (1978) unbiased genetic distance
calculated from 25 microsatellite loci for six Chinese and one U.S. wild oat populations examined in this study.
range of herbicide groups. In particular, diclofop, the first
acetyl coenzyme A carboxylase (ACCase)-inhibitor herbicide,
was registered in China in 1982 and has been commonly used
to control wild oat in cereal grain crops for three decades. In
contrast, the first reported case of wild oat resistance to
ACCase-inhibitor herbicides in Canada occurred in a field
that had been repeatedly sprayed with aryloxyphenoxypro-
pionate and cyclohexanedione herbicides more than 10 yr
(Heap et al. 1993; Thai et al. 1985).
Several factors probably contribute to the lack of detection
of herbicide-resistant wild oat in China. Although herbicides
have been used increasingly in recent years in China, many
farmers do not use herbicides every year because the farm land
per capita is relatively small. Surviving wild oat individuals are
always pulled out mechanically, which limits the potential for
herbicide-resistant biotypes to reproduce and increase in
frequency within the seedbank. Furthermore, attention has
not been focused on herbicide resistance in China, and no
research on herbicide resistance in wild oat has been
conducted. Thus, it is essential that more surveys or research
be performed in the future to elucidate the status of herbicide-
resistant wild oat in China.
Sources of Materials
1 Goldstein, D. B. and D. D. Pollock. 1997. Launching microsatellites: a review of
GeneAmp PCR System 9700, Applied Biosystems, 850 Lincoln
Centre Drive, Foster City, CA 94404-9911.
2 88:335–342.
BioRad sequencing system 3000, Bio-Rad Laboratories Inc.,
2000 Alfred Nobel Drive, Hercules, CA 94547.
Acknowledgments
This work was conducted with the financial support from the
National Natural Science Foundation of China (30370940). Dr.
Calvin Messersmith, Professor of Plant Sciences, North Dakota State
University, Fargo, ND, provided recommendations for manuscript
improvement. Mr. Zhenwei Song and Dr. Wenxin Liu provided
advice for data analysis.
100 N Weed Science 55, March–April 2007
Literature Cited
Amsellem, L., C. Dutech, and N. Billotte. 2001. Isolation and characterization of
polymorphic microsatellite loci in Rubus alceifolius Poir. (Rosaceae), an
invasive weed in La Réunion island. Mol. Ecol. Notes 1:33–35.
Ash, G. J., R. Raman, and N. S. Crump. 2003. An investigation of genetic
variation in Carthamus lanatus in New South Wales, Australia, using
intersimple sequence repeats (ISSR) analysis. Weed Res. 43:208–213.
Bassam, B. J., C. A. Gustavo, and P. M. Gresshoff. 1991. Fast and sensitive silver
staining of DNA in polyacrylamide gels. Anal. Biochem. 196:80–83.
Bourgeois, L., N. C. Kenkel, and I. N. Morrison. 1997. Characterization of cross-
resistance patterns in acetyl-CoA carboxylase inhibitor resistant wild oat (Avena
fatua). Weed Sci. 45:750–755.
Cavan, G., P. Biss, and S. R. Moss. 1998. Herbicide resistance and gene flow in
wild oats (Avena fatua and Avena sterilis ssp. ludoviciana). Ann. Appl. Biol.
133:207–217.
Chauvel, B. and J. Gasquez. 1994. Relationships between genetic polymorphism
and herbicide resistance within Alopecurus myosuroides Huds. Heredity
72:336–344.
Danquah, E. Y., D. E. Johnson, C. Riches, G. M. Arnold, and A. Karp. 2002.
Genetic diversity in Echinochloa spp. from different geographic origins and
within rice fields in Côte d9lvoire. Weed Res. 42:394–405.
Dekker, J. 1997. Weed diversity and weed management. Weed Sci. 37:237–246.
Devos, K. M. and M. D. Gale. 2000. Genome relationships: the grass model in
current research. Plant Cell 12:637–646.
Excoffier, L., G. Laval, and S. Schneider. 2005. Arlequin ver. 3.0: an integrated
software package for population genetics data analysis. Evol. Bioinformatics
Online 1:47–50.
Friesen, L. F., T. L. Jones, R. C. Van Acker, and I. N. Morrison. 2000.
Identification of Avena fatua populations resistant to imazamethabenz,
flamprop, and fenoxaprop-P. Weed Sci. 48:532–540.
mutation processes and methods of phylogenetic inference. J. Hered.
Green, J. M., J. H. A. Barker, E. J. P. Marshall, R. J. Froud-Williams, N. C. B.
Peters, G. M. Arnold, K. Dawson, and A. Karp. 2001. Microsatellite
analysis of the inbreeding grass weed barren brome (Anisantha sterilis) reveals
genetic diversity at the within- and between-farm scales. Mol. Ecol. 10:
1035–1045.
Guyomarc’h, H., P. Sourdille, G. Charmet, K. J. Edwards, and M. Bernard.
2002. Characterisation of polymorphic microsatellite markers from Aegilops
tauschii and transferability to the D-genome of bread wheat. Theor. Appl.
Genet. 104:1164–1172.
Hamrick, J. L. and M. J. Godt. 1990. Allozyme diversity in plant species. Pages
43–63 in A. D. H. Brown, M. T. Clegg, A. L. Kahler, and B. S. Weir, eds.
Plant Population Genetics, Breeding and Genetic Resources. Sunderland, MA:
Sinauer Associates.
 Heap, I. M. 2006. International Survey of Herbicide Resistant Weeds. Herbicide
Resistance Action Committee and Weed Science Society of America. http://
www. weedscience.com. Accessed: October 1, 2006.
Heap, I. M., B. G. Murray, H. A. Loeppky, and I. N. Morrison. 1993. Resistance
to aryloxyphenoxypropionate and cyclohexanedione herbicides in wild oat
(Avena fatua). Weed Sci. 41:232–238.
Hernândez, P., G. Dorado, and D. A. Laurie. 2001. Microsatellites and RFLP
probes from maize are efficient sources of molecular markers for the biomass
energy crop Miscanthus. Theor. Appl. Genet. 102:616–622.
Holt, R. D. and M. E. Hochberg. 1997. When is biological control evolutionarily
stable (or is it?). Ecology 78:1673–1683.
Imam, A. G. and R. W. Allard. 1965. Population studies in predominantly
self-pollinated species, VI: genetic variability between and within natural
populations of wild oats from differing habitats in California. Genetics
51:49–62.
Lacy, R. C. 1987. Loss of genetic diversity from managed populations: interacting
effects of drift, mutation, immigration, selection, and population subdivision.
Conserv. Biol. 8:217–226.
Lewontin, R. C. 1972. The apportionment of human diversity. Evol. Biol.
6:381–398.
Li, C. D., B. G. Rossnagel, and G. J. Scoles. 2000. The development of oat
microsatellite markers and their use in identifying relationships among Avena
species and oat cultivars. Theor. Appl. Genet. 101:259–1268.
Liu, Z. W., R. M. Biyashev, and M. A. S. Maroof. 1996. Development of simple
sequence repeat markers and their integration into a barley linkage map.
Theor. Appl. Genet. 93:869–876.
Loveless, M. D. and J. L. Hamrick. 1984. Ecological determinants of genetic
structure in plant populations. Annu. Rev. Ecol. Syst. 15:65–96.
Mengistu, L. W., M. J. Christoffers, and G. O. Kegode. 2004. Genetic diversity
of biennial wormwood. Weed Sci. 52:53–60.
Mengistu, L. W. and C. G. Messersmith. 2002. Genetic diversity of kochia.
Weed Sci. 50:498–503.
Mengistu, L. W., C. G. Messersmith, and M. J. Christoffers. 2003. Diversity of
herbicide resistance among wild oat sampled 36 yr apart. Weed Sci.
51:764–773.
Mengistu, L. W., C. G. Messersmith, and M. J. Christoffers. 2005. Genetic
diversity of herbicide-resistant and -susceptible Avena fatua populations in
North Dakota and Minnesota. Weed Res. 45:413–423.
Mengistu, L. W., G. W. Mueller-Warrant, and R. E. Barker. 2000. Genetic
diversity of Poa annua in western Oregon grass seed crops. Theor. Appl.
Genet. 101:70–79.
Moodie, M., R. P. Finch, and G. Marshall. 1997. Analysis of genetic variation in
wild mustard (Sinapis arvensis) using molecular markers. Weed Sci. 45:
102–107.
Mörchen, M., J. Cuguen, G. Michaelis, C. Hanni, and P. Saumitouplaprade.
1996. Abundance and length polymorphism of microsatellite repeats in Beta
vulgaris L. Theor. Appl. Genet. 92:326–333.
Li et al.: Genetic diversity of wild oat from China and U.S.
View publication stats
Narinder, P., S. S. Jagdeep, L. D. Lesli, and L. K. Frederuc. 2002. Development
and characterization of microsatellite and RFLP-derived PCR markers in oat.
Crop Sci. 42:912–918.
Naylor, J. M. 1983. Studies on the genetic control of some physiological processes
in seeds. Can. J. Plant Sci. 60:777–784.
Naylor, J. M. and S. Jana. 1976. Genetic adaptation for seed dormancy in Avena
fatua. Can. J. Bot. 54:306–312.
Nei, M. 1973. Analysis of gene diversity in subdivided populations. Proc. Natl.
Acad. Sci. U. S. A. 70:3321–3323.
Nei, M. 1978. Estimation of average heterozygosity and genetic distance from
a small number of individuals. Genetics 89:583–590.
Rashid, A., J. T. O’Donovan, A. A. Khan, R. E. Blackshaw, K. N. Harker, and R.
P. Pharis. 1998. A possible involvement of gibberellin in the mechanism of
Avena fatua resistance to triallate and cross-resistance to difenzoquat. Weed
Res. 38:461–466.
Röder, M. S., J. Plaschke, S. U. König, and A. Börner. 1995. Abundance,
variability and chromosomal location of microsatellites in wheat. Mol. Gen.
Genet. 246:327–333.
Rohlf, F. J. 1992. NTSYS-pc: Numerical Taxonomy and Multivariate Analysis
System, Version 2.0. Stony Brook, NY: State University of New York.
Seefeldt, S. S., D. R. Gealy, B. D. Brewster, and E. P. Fuerst. 1994. Cross-
resistance of several diclofop-resistant wild oat (Avena fatua) biotypes from the
Willamette Valley of Oregon. Weed Sci. 42:430–437.
Senda, T., N. Kubo, M. Hirai, and T. Tominaga. 2004. Development of
microsatellite markers and their effectiveness in Lolium temulentum. Weed Res.
44:136–141.
Slaktin, M. 1987. Gene flow and geographic structure of natural populations.
Science 236:787–792.
Slatkin, M. and N. H. Barton. 1989. A comparison of three indirect methods for
estimating average levels of gene flow. Evolution 43:1349–1368.
Steiner, J. J., C. J. Poklemba, R. G. Fjellstrom, and L. F. Elliott. 1995. A rapid
one-tube genomic DNA extraction process for PCR and RAPD analyses.
Nucleic Acids Res. 23:2569–2570.
Thai, K. M., S. Jana, and J. M. Naylor. 1985. Variability for response to
herbicides in wild oat (Avena fatua) populations. Weed Sci. 33:829–835.
Tu, H. L. 1987. Wild oat management and control. J. Weed Sci. 1(1):44–49 [in
Chinese].
Wang, M. H., W. H. Zhang, and M. G. Jiang. 2003. A review of herbicides on
wild oat. Pesticides 42(8):6–8 [in Chinese].
Yeh, F. C., R. C. Yang, and T. Boyle. 1999. POPGENE, Microsoft Windows-
Based Freeware for Population Genetic Analysis, Release 1.31. Alberta,
Canada: University of Alberta.
Zhang, Z. J. 1995. Studies on the noxious weed wild oat (Avena fatua L.) and its
integrated management in wheat fields. M.S. thesis.. Nanjing, China: Nanjing
Agricultural University. 63 p. [in Chinese].
Received June 21, 2006, and approved November 14, 2006.
N 101