Talanta 165 (2017) 442–448

Contents lists available at ScienceDirect

Talanta
journal homepage: www.elsevier.com/locate/talanta

Highly sensitive amperometric detection of cardiac troponin I using MARK

sandwich aptamers and screen-printed carbon electrodes
⁎
Hunho Joa, Jin Hera, Heehyun Leeb, Yoon-Bo Shimc, Changill Bana,
a
Department of Chemistry, Pohang University of Science and Technology, 77, Cheongam-Ro, Nam-Gu, Pohang, Gyeongbuk 790-784, South Korea
b
Department of Life Science, Pohang University of Science and Technology, 77, Cheongam-Ro, Nam-Gu, Pohang, Gyeongbuk 790-784, South Korea
c
Department of Chemistry, Pusan National University, Keumjeong-Ku, Busan 609-735, South Korea

A R T I C L E I N F O A BS T RAC T

Keywords: In this study, we developed a sandwich aptamer-based screen-printed carbon electrode (SPCE) using
Screen-printed carbon electrode chronoamperometry for the detection of cardiac troponin I (cTnI), one of the promising biomarkers for acute
Cardiac troponin I myocardial infarction (AMI). Disposable three-electrode SPCEs were manufactured using a screen printer, and
Aptamer various modifications such as electrodeposition of gold nanoparticles and electropolymerization of conductive
Chronoamperometry
polymers were performed. From the bare electrode to the aptamer-immobilized SPCE, all processes were
Hydrazine
monitored and analyzed via various techniques such as cyclic voltammetry, electrochemical impedance
Diagnosis
spectroscopy, and X-ray photoelectron spectroscopy. The quantification of cTnI was conducted based on
amperometric signals from the catalytic reaction between hydrazine and H2O2. The fabricated aptasensor in a
buffer, as well as in a serum-added solution, exhibited great analytical performance with a dynamic range of 1–
100 pM (0.024–2.4 ng/mL) and a detection limit of 1.0 pM (24 pg/mL), which is lower than the existing cutoff
values (40–700 pg/mL). Furthermore, the developed sensor showed high sensitivity to cTnI over other proteins.
It is anticipated that this potable SPCE aptasensor for cTnI will become an innovative diagnostic tool for AMI.

1. Introduction
Point-of-care testing (POCT) has been great attention because of
several advantages over traditional diagnostic techniques, such as a
broad availability to diagnosis, easy accessibility, rapid quantification,
and minimal required sample volumes [1–3]. Among diverse POCT
devices, screen-printed carbon electrodes (SPCEs), which are fabri-
cated by printing several types of inks on a specific substrate have been
considered superior because of the low cost of carbon, the good
reproducibility of the results, the rapid responses to analytes, disposa-
bility, and surface functionalizations [4,5]. Such SPCEs have been
recently employed as diagnostic tools for food poisoning, diseases, and
environmental pollutants [6–8].
A number of investigations for the early diagnosis of acute
myocardial infarction (AMI), one of the foremost causes of death, have
been carried out based on specific biomarkers [9,10]. Since cardiac
troponins (cTnI and cTnT) have shown the high sensitivity and
selectivity toward AMI, they have been targeted to many diagnostic
investigations. In particular, cTnI and cTnT are superior diagnostic
markers for early AMI presenters and late presenters, respectively [11].
To this end, on-site POCT techniques and devices have been developed
for AMI biomarkers including the isoform of creatine kinase, myoglo-
bin, and the cardiac troponins (cTnI and cTnT) [3,12,13]. However,
since all current assays are based on antibody-antigen interactions,
there are some limitations related to the antibodies, such as poor
stability, relatively high cost, and long incubation time.
Aptamers, oligonucleic acids or peptides with high sensitivity and
selectivity toward target molecules have been considered as excellent
substitutes for antibodies; they have also shown benefits compared to
antibodies, such as easy functionalization, high stability in harsh
conditions, and rapid production [14–16]. In particular, aptamer-
based electrical biosensors have been used to many clinical applica-
tions because of lots of superiorities such as relative stability of
electroactive labels, promising speed, and low cost [17–19]. We have
recently screened cTnI-specific aptamers showing high selectivity and
sensitivity toward only cTnI, which is a promising AMI biomarker
among currently available markers [20]. Among various biomarkers for
AMI such as the isoform of creatine kinase, myoglobin, and lactate
dehydrogenase, cTnI have been shown to be a valuable biomarker for
AMI because of its high specificity and long residence time [21,22].
Based on diverse advantages of cTnI-specific aptamer, the accurate and
precise diagnosis for AMI could be achieved.

⁎
Corresponding author.
E-mail addresses: jhhsst@postech.ac.kr (H. Jo), jinh0902@postech.ac.kr (J. Her), delighthyun@postech.ac.kr (H. Lee), ybshim@pusan.ac.kr (Y.-B. Shim),
ciban@postech.ac.kr (C. Ban).

http://dx.doi.org/10.1016/j.talanta.2016.12.091
Received 13 October 2016; Received in revised form 30 December 2016; Accepted 30 December 2016
Available online 31 December 2016
0039-9140/ © 2017 Elsevier B.V. All rights reserved.
H. Jo et al.
Fig. 1. Schematic illustration for the fabrication processes of the sensor and the detection of cTnI. (A) A three-electrode SPCE was manufactured using a typical printing system. AuNPs
were electrically deposited on the working electrode, and then, a TTCA monomer was electrically polymerized. After EDC/NHS activation, the amine-modified aptamer was covalently
immobilized on the SPCE. (B) Various concentrations of cTnI were incubated with the SPCE, followed by washing with DW. The hydrazine-modified aptamer was then incubated with
the electrode, and the amperometric signals were recorded in a 10 mM H2O2 solution (AuNPs: gold nanoparticles; TTCA: 5,2′:5′2′′-terthiophene-3′-carboxylic acid; Tro4 aptamer:
capture probe; Tro6 aptamer: detecting probe).
For the accurate monitoring of target molecules, the detection
techniques are exceedingly important. Numerous detection systems
based on colorimetry, fluorometry, and electrochemistry have been
carried out to measure target-probe interaction. In particular, chron-
oamperometry have been received great attention and applied in many
fields because of various superiorities like high-speed, simplicity, and
high signal to noise ratio [23–25]. In the present study, we designed
aptamer-based SPCEs for the early diagnosis of AMI using chronoam-
perometry and aptamer sandwich assays, for the first time (Fig. 1).
These SPCE sensors exhibit high sensitivity and selectivity toward cTnI
in buffer conditions as well as in a serum-supplemented solution.
2. Materials and methods
2.1. Materials
Gold (III) chloride trihydrate, human serum albumin (HSA),
human serum (human male AB plasma), bovine serum albumin
(BSA), sodium borohydride, and adipic acid dihydrazide were bought
from Sigma-Aldrich (St. Louis, MO, USA). Trisodium citrate dehydrate
was purchased from Wako Pure Chemical Industries (Osaka, Japan).
Carbon ink, silver ink, and insulation paint were obtained from Jujo
Chemical (Tokyo, Japan). The 5′-amine modified Tro4 aptamer (5′-
amine-CGTGCAGTACGCCAACCTTTCTCATGCGCTGCCCCTCTTA-3′)
and 5′-phosphate modified Tro6 aptamer (5′-phosphate-
CGCATGCCAAACGTTGCCTCATAGTTCCCTCCCCGTGTCC) were
synthesized by Cosmo Genetech (Seoul, Korea). The 5,2′:5′2′′-terthio-
phene-3′-carboxylic acid (TTCA) was newly synthesized by Shim's
group following their previous report [26]. Interleukin 13 receptor
(IL-13R), interleukin 5 receptor (IL-5R), cluster of differentiation 4
(CD4), and CD166 were acquired from Sino Biological (Beijing, China).
Lysozyme was bought from Bio Basic (Markham, Ontario, Canada).
The BL21 (DE3) Escherichia coli strain was purchased from Invitrogen
(USA). Luria Bertani (LB) was obtained from Merck (Kenilworth, NJ,
USA). Isopropyl-β-D-1-thiogalactopyranoside (IPTG) was purchased
from Calbiochem (San Diego, CA, USA).
2.2. Preparation of gold nanoparticles
Prior to the synthesis, all of the glassware was washed with a 3:1
mixture of HCl:HNO3 and rinsed with deionized water (DW). For the
synthesis of gold nanoparticles (AuNPs) having a size 5 nm, 1 mL of 1%
(w/v) gold(III) chloride solution was added to 90 mL of DW under
443
Talanta 165 (2017) 442–448
vigorous stirring [27]. After the stirring for 1 min, 2 mL of 38.8 mM
trisodium citrate was added, and the solution was incubated for 1 min.
And then, 1 mL of 0.075% (w/v) sodium borohydride was slowly
supplemented to the mixture. The concentration of the AuNPs was
measured via UV–VIS spectroscopy (Libra S22, Biochrom). The
spectroscopic and morphological characteristics were analyzed by
UV–VIS spectroscopy and transmission electron microscopy (TEM)
imaging with a JEM-1011 instrument (JEOL, Tokyo, Japan), respec-
tively.
2.3. Expression and purification of cTnI
The pET-28a plasmid containing Troponin I was transformed into
E. coli strain BL21 (DE3), and one positive clone was obtained from
independent plaques. The transformed E. coli cells were grown in LB
broth at 37 °C until the absorbance at 600 nm reached 0.6. The
expression of cTnI was induced by an addition of IPTG at a final
concentration of 0.2 mM. After incubating the cells at 18 °C overnight,
they were harvested by centrifugation at 5000 rpm at 4 °C for 20 min,
and washed once with phosphate-buffered saline (PBS). The cTnI-
expressing cells were resuspended in a lysis buffer (20 mM Tris, pH
8.0, 500 mM NaCl, 0.5 mM β-mercaptoethanol, and 0.1% Tween 20)
and disrupted by sonication on ice. After the centrifugation of the cell
lysate at 15,000 rpm for 30 min, the supernatant was filtered through a
0.45 µm membrane filter. The supernatant was applied to a Ni-NTA
column pre-equilibrated with the lysis buffer. After binding, the protein
was eluted by increasing the concentration of imidazole from 0 to
300 mM with an elution buffer (20 mM Tris, pH 8.0, 500 mM NaCl,
0.5 mM β-mercaptoethanol, 0.1% Tween 20, and 300 mM imidazole).
In addition, the eluted protein was applied to a desalting column to
remove imidazole and was further purified using a Superdex peptide
gel filtration column (GE Healthcare, USA). The purified cTnI was
stored in a final buffer (20 mM Tris, pH 8.0, 300 mM NaCl, 5 mM β-
mercaptoethanol, and 0.1% Tween 20) at a concentration of 20 μM.
2.4. Fabrication of SPCEs
All experiments were carried out in a three-electrode cell utilizing
an all-in-one SPCE. The SPCEs were manufactured on the polyethy-
lene-based film using a screen printer (BANDO industrial, Korea). First
of all, silver was coated on the film as conductor, and then carbon was
printed as working and counter electrodes. Finally, insulator was also
covered on the top of the film. The cleaning using 0.1 M HNO3 was
H. Jo et al.
Fig. 2. Analysis of each modification step. (A) Cyclic voltammograms for the modification processes. CV was carried out in PBS at scan rate of 100 mV/s. (B) Nyquist plots of the
modification processes. Impedance was measured in PBS containing 5 mM [Fe(CN)6]3-/4-. (C) XPS analysis of each surface (Bare: bare SPCE; AuNPs: AuNP-deposited SPCE; Polymer:
TTCA-deposited SPCE; Aptamer: Tro4 aptamer-immobilized SPCE).
carried out by cycling the electrode potential between +0.2 V and
+0.6 V at a 100 mV/s scan rate for 5 cycles. The performance of the
fabricated SPCEs was confirmed with the glassy carbon electrode. As
shown in Fig. 1A, it was composed of a working carbon electrode, a Ag/
AgCl reference electrode, and a carbon counter electrode [28]. To
modify the surface of the working electrode, 1 μL of 5 mM AuNPs was
dropped on each surface of SPCEs and the AuNPs were electrically
deposited on the working electrode by cycling the electrode potential
between +0.1 V and +1.6 V at a 50 mV/s scan rate for 10 cycles. After
washing with 0.5 M H2SO4 through five CV cycles, 0.4 μL of 1 mM
TTCA in a 1:1 mixture of tripropylene glycol methyl ether and
dipropylene glycol methyl ether was dropped on the electrode and
electrically polymerized via CV (0 – 1.5 V, 100 mV/s, and 3 cycles)
[29]. The 5′-amine modified Tro4 aptamer (capture probe) was
immobilized on the working electrode through 1-Ethyl-3-(3-dimethy-
laminopropyl)-carbodiimide (EDC)/ N-hydroxysuccinimide (NHS)
coupling between a carboxylic acid of polymer and amine (Fig. 1A).
Each modification step was verified via CV, electrochemical impedance
spectroscopy (EIS), and X-ray photoelectron spectroscopy (XPS).
2.5. Synthesis of hydrazine-modified Tro6 aptamer
To induce a sandwich aptamer reaction, hydrazine, which is an
electrocatalyst for the reduction of H2O2, was labeled on the Tro6
aptamer (detecting probe) via phosphoramidate linkage between the
5′-phosphate modified Tro6 aptamer and adipic acid dihydrazide [30].
The 5′-phosphate modified Tro6 aptamer (7.5 μL, 100 μM) was
incubated with 5 μL of 0.25 M adipic acid dihydrazide in 0.1 M
imidazole (pH 6.0). After vigorous shaking, 20 μL of 0.1 M imidazole
(pH 6.0) was added to the solution, and then, the reaction mixture was
incubated at room temperature (RT) for 2 h. The resulting Tro6
444
Talanta 165 (2017) 442–448
aptamer was purified by the chromatographic method using a final
buffer (10 mM sodium phosphate, 150 mM NaCl, 10 mM ethylenedia-
minetetraacetic acid, pH 7.2).
2.6. Electrochemical detection of cTnI
The detections were performed as presented in Fig. 1B. cTnI was
incubated with the Tro4 aptamer-functionalized working electrode at
RT, and then washed with DW. A hydrazine-modified aptamer was
successively treated at RT, and washed with DW, followed by the
detection of cTnI in PBS. Prior to the quantification of cTnI in buffer,
various factors such as incubation time (reaction between Tro4
aptamer and cTnI), detecting time (reaction between cTnI and Tro6
aptamer), pH, the concentration of Tro6 aptamer, and voltage of
chronoamperometry were optimized. In the buffer condition, ampero-
metric signals from hydrazine were recorded, and quantification of
cTnI was achieved based on those signals (40 points/s). For the
construction of the calibration curve, the current differences between
blank signals and sandwich detection signals were used.
2.7. Specificity test of the designed sensor
The availability of the sensor was also demonstrated using non-
target proteins. Various proteins such as BSA, HSA, IL-13R, IL-5R,
CD4, CD166, and lysozyme were applied to this platform at a
concentration of 50 pM, and the amperometric signals were obtained.
In addition, the detection of cTnI was also carried out in a human
serum-spiked solution to validate the clinical availability of the
sandwich assay.
H. Jo et al. Talanta 165 (2017) 442–448

Fig. 3. Application of the SPCE to detect cTnI. (A) Cyclic voltammograms for cTnI-treated SPCE and Tro6 aptamer-treated SPCE. (B) Optimization of the applied potential for
chronoamperometry. Incubation time for all incubations was set as 20 min.

Fig. 4. Optimization of various parameters. (A) Incubation time for interaction between capture probe (Tro4 aptamer) and cTnI. Incubation time for interaction between cTnI and
detecting probe (Tro6 aptamer) was set as 20 min. (B) Incubation time for interaction between cTnI and detecting probe (Tro6 aptamer). Incubation time for interaction between
capture probe (Tro4 aptamer) and cTnI was set as 20 min. (C) Optimization of pH. (D) Optimization of concentration of detecting probe (Tro6 aptamer).

3. Results and discussion
3.1. Design of sandwich aptamer-based detection system for cTnI
Prior to the fabrication of aptasensor, recombinant cTnI and AuNPs
were freshly prepared. cTnI was overexpressed utilizing a bacterial
expression system and purified via fast protein liquid chromatography.
As shown in Fig. S1, its purity was analyzed by SDS-PAGE and was
greater than 98%. In addition, AuNPs were synthesized using sodium
citrate and sodium borohydride, and characterized via TEM imaging,
dynamic light scattering (DLS), ultraviolet-visible spectroscopy, and
zeta potential measurements. Synthesized AuNPs exhibited quite uni-
form globular shape (Fig. S2A). The average size of particles was
demonstrated via DLS (Fig. S2B, 5.67 ± 0.36 nm). Furthermore, the
surface charge of AuNPs was measured as −3.91 ± 0.81 mV, indicating
that the AuNPs were homogeneously well synthesized. In addition, as

445
H. Jo et al. Talanta 165 (2017) 442–448

amine and the TTCA's carboxylic acid. The O1s spectra also displayed
the C–O–H bond peak at 532.1 eV and the C˭O bond peak at 530.9 eV.
In particular, the C˭O bond peak was only present in the aptamer-
modified SPCE, because of the amide bond. These results demonstrate
that consecutive modifications were successfully carried out and the
SPCE-aptasensor was well fabricated.

3.2. Various optimizations for detection of cTnI

Chronoamperometry is a valuable diagnostic tool due to its

simplicity, rapid response, and high precision. Since hydrazine has
various benefits for amperometry, such as a low molecular weight, low
cost, and high stability, it has been frequently applied to many fields as
an electrocatalyst for the reduction of H2O2 [33]. In this study, the
Fig. 5. Calibration curve for cTnI in PBS. The inset represents amperometric response amperometric detection of cTnI was achieved on the basis of electro-
for Tro6 aptamer (cTnI: cTnI-treated SPCE; Tro6 aptamer: Tro6-treated SPCE).
catalytic signals from hydrazine and H2O2. The introduction of
hydrazine to capture aptamer was validated by the hydrazine-specific
represented in Fig. S2C, AuNPs showed the maximum absorption peak
amperometric signal.
at 510.5 nm, which coincides with the previous result [27].
The cyclic voltammogram of the protein-treated SPCE exhibited a
It is well known that AuNP-deposition enables the extension of
higher current than that of the detecting aptamer-treated SPCE,
dynamic range because of large surface area. Also, TTCA is a valuable
implying that sandwich aptamer detection was accomplished via a
candidate as immobilization matrix of biomolecules since it has
specific interaction between aptamers and cTnI (Fig. 3A). Tro4 and
carboxyl acid groups and exhibits good electrical properties [31].
Tro6 aptamers exhibit bivalent binding capacity toward cTnI, indicat-
Therefore, these modifications were applied to this work, and each
ing that each aptamer is bound to different binding pockets of target
modification step was confirmed using CV, EIS, and XPS (Fig. 2). In the
molecule (data not shown). For the effective amperometric analysis, the
case of CV, whereas AuNP-deposited and TTCA-functionalized SPCEs
applied voltage for the detection was also optimized and determined as
exhibited a higher current than the bare SPCE, immobilization of the
−600 mV (Fig. 3B). Based on the amperometric signal at −600 mV,
Tro4 aptamer resulted in a CV current decrease (Fig. 2A). AuNPs and
several parameters such as incubation time, pH, and concentration of
TTCA increase the active surface and the electrical conductivity,
aptamer were optimized. First of all, incubation time for interaction
respectively; however, the aptamer inhibits electron transfer between
between capture probe (Tro4 aptamer) and cTnI was tested while
electrode and solution [32]. Similar observations are also made on the
incubation time for interaction between cTnI and detecting probe
EIS results (Fig. 2B). EIS is beneficial to monitor specific interactions
(Tro6 aptamer) was set as 20 min. As shown in Fig. 4A, there was no
between immobilized probes on the electrode and analytes in a
remarkable increase in signal after 5 min. Therefore, incubation time
solution. Changes in the electron transport are recorded as a Nyquist
for Tro4 aptamer and cTnI was determined as 5 min. Incubation time
plot and conductivity extents are expressed as charge transfer resis-
for interaction between cTnI and Tro6 aptamer was fixed as 5 min in
tance (Rct) values, the diameters of the semicircles in the Nyquist plot.
the same manner (Fig. 4B). Since pH could influence the interaction
Serial modification of AuNPs and TTCA resulted in a decrease in the Rct
between aptamers and cTnI, the detection was carried out in various
values, but the introduction of the aptamer increased the surface
pH conditions (Fig. 4C). The high current was observed around pH 7.5,
resistance slightly. Furthermore, the electrode surfaces of each mod-
suggesting that PBS buffer is appropriate for the detection of cTnI.
ification were thoroughly scrutinized by XPS (Fig. 2C). In C1s peak
Furthermore, the concentration of detecting probe (Tro6 aptamer) was
spectra, although the C–C and C–H bond peaks at 284.6 eV were
optimized. Even though there was additional increase after 300 nM, the
represented in all types of SPCEs, the C˭O bond peak at 287.8 eV
concentration of Tro6 aptamer was set as 500 nM for sufficient
appeared in only polymer-modified SPCEs. Furthermore, a new peak
incubation and good reproducibility (Fig. 4D). These optimized condi-
was shown at 285.7 eV due to the amide bond between the aptamer's
tions were applied to further detection of cTnI.

Fig. 6. (A) Specificity test for the SPCE (BSA: bovine serum albumin; HSA: human serum albumin; IL: interleukin; CD: cluster of differentiation). Each protein was applied to the sensor
at a concentration of 50 pM. (B) Calibration curve for cTnI in human serum-spiked solution.

446
H. Jo et al.
3.3. Confirmation of analytical performance of designed aptasensor
After optimizing several parameters, the quantification of cTnI was
conducted by chronoamperometry and the calibration curve for cTnI
was constructed using amperometric signals at 3 s (Fig. 5). The inset
shows the current increase caused by hydrazine. We observed a good
linear relationship between the cTnI concentration and the chronoam-
perometric signal, with a high squares of the correlation coefficients
greater than 0.98. The developed SPCE sensor demonstrated out-
standing analytical performance with a relatively wide dynamic range
of 1–100 pM (0.024–2.4 ng/mL) and a detection limit of 1.0 pM
(24 pg/mL). This detection limit is much lower than the existing cTnI
cutoff levels, which are 70 pg/mL and 400 pg/mL for the 99th
percentile and the clinical cutoff values, respectively [34,35].
Therefore, this SPCE is readily applicable to detect and quantify cTnI.
3.4. Verification of specificity and clinical applicability of developed
aptasensor
Excellent selectivity is indispensable for target-specific biosensors.
The specificity of the fabricated aptasensor toward cTnI was evaluated
using commercially available proteins, such as BSA, HSA, IL-13R, IL-
5R, CD4, CD166, and lysozyme (50 pM). Since the aptamer selectivity
was already substantiated in the previous work [20], a detail discussion
on this subject is beyond the scope of the present study. As displayed in
Fig. 6A, whereas the current increased in the case of cTnI, noticeable
current fluctuations were not observed for other control proteins. This
result suggests that the newly designed aptasensor can detect only cTnI
with great selectivity.
To prove the clinical applicability of the sensor, the SPCE was
applied to the quantification of cTnI in a human serum-added solution.
Commercially available human serum (human male AB plasma, Sigma-
Aldrich) was diluted 10-fold with PBS and various concentrations of
cTnI ranging from 1.0 to 100 pM were spiked in this solution. A linear
correlation is observed between the concentration of cTnI and the
signals (Fig. 6B) with a high squares of the correlation coefficients over
0.98, and a good linear range of 1–100 pM. This result is in accordance
with those obtained under buffer conditions, and the detection limit is
lower than the existing cutoff values. Even though this measurement
was carried in only serum-spiked solution, it is meaningful that direct
comparison of detection limit with those of other commercially
available POCT kits. Several immunoassay-based POCT kits for cTnI
have been utilized, and exhibit good detection limits toward serum
samples: 0.05 ng/mL for Cardiac Triple (NanoEnTek, Seoul, South
Korea), 1 ng/mL for Troponin I Rapid Card (NanoEnTek, South
Korea), 0.3 ng/mL for Elecsys Troponin I assay (Roche, Basel,
Switzerland), 0.1 ng/mL for ichromα™ Tn-I (boditech, Gang-won-do,
South Korea), and 1.5 ng/mL for lifeSign MI (PBM, NJ, USA). The
developed aptamer-based detections system represents pretty good
detection limit (0.024 ng/mL) compared to other kits. Above all things,
our system has superiority in cost, stability, and novelty. Consequently,
the newly designed SPCE aptasensor is considered suitable to evaluate
cTnI for the sensitive and selective diagnosis of AMI.
4. Conclusions
In this work, we have designed a sandwich aptamer-based SPCE for
a highly sensitive and selective detection of cTnI, an assuring biomar-
ker for AMI. To our knowledge, this is the first try to developing an
aptamer-based POCT sensor for AMI. Each modification process was
monitored utilizing CV, impedance, and XPS, and the fabricated
aptasensor was applied to the detection of cTnI in a buffer as well as
in a serum-supplemented solution. This sensor showed extraordinary
analytical performance and remarkable specificity toward cTnI.
Through cooperation with a company, we have made an effort to
develop a chronoamperometric POCT device for the diagnosis of AMI.
447
Talanta 165 (2017) 442–448
Although there are some problems, such as the control of homogeneous
surface modifications and mass production, the development of POCT
devices will be successfully accomplished. It is expected that the
developed SPCE-based POCT sensor using aptamer and hydrazine will
be a valuable diagnostic platform for numerous diseases including
AMI.
Acknowledgements
This research was supported by a grant from the Korea Health
Technology R & D Project through the Korea Health Industry
Development Institute (KHIDI), funded by the Ministry of Health &
Welfare, Republic of Korea (grant number: HI12C1852 and
HI15C2900).
Appendix A. Supplementary material
Supplementary data associated with this article can be found in the
online version at doi:10.1016/j.talanta.2016.12.091.
References
[1] P.B. Luppa, C. Muller, A. Schlichtiger, H. Schlebusch, Point-of-care testing (POCT):
current techniques and future perspectives, Trends Anal. Chem. 30 (6) (2011)
887–898.
[2] Y. Xia, J. Si, Z. Li, Fabrication techniques for microfluidic paper-based analytical
devices and their applications for biological testing: a review, Biosens. Bioelectron.
77 (2016) 774–789.
[3] S.K. Vashist, P.B. Luppa, L.Y. Yeo, A. Ozcan, J.H. Luong, Emerging Technologies
for Next-Generation Point-of-Care Testing, Trends Biotechnol. 33 (2015) 692–705.
[4] M. Li, Y.T. Li, D.W. Li, Y.T. Long, Recent developments and applications of screen-
printed electrodes in environmental assays–a review, Anal. Chim. Acta 734 (2012)
31–44.
[5] E. Sanchez-Tirado, G. Martinez-Garcia, A. Gonzalez-Cortes, P. Yanez-Sedeno,
J.M. Pingarron, Electrochemical immunosensor for sensitive determination of
transforming growth factor (TGF) - beta1 in urine, Biosens. Bioelectron. 88 (2017)
9–14.
[6] A.S. Afonso, C.V. Uliana, D.H. Martucci, R.C. Faria, Simple and rapid fabrication of
disposable carbon-based electrochemical cells using an electronic craft cutter for
sensor and biosensor applications, Talanta 146 (2016) 381–387.
[7] Y. Zhu, W. Choon, A. Koh, Y.B. Shim, An amperometric immunosensor for IgG
based on conducting polymer and carbon nanotube-linked hydrazine label,
Electroanalysis 22 (2010) 2908–2914.
[8] D. Talarico, F. Arduini, A. Amine, I. Cacciotti, D. Moscone, G. Palleschi, Screen-
printed electrode modified with carbon black and chitosan: a novel platform for
acetylcholinesterase biosensor development, Anal. Bioanal. Chem. 408 (2016)
7299–7309.
[9] M. Pawula, Z. Altintas, I.E. Tothill, SPR detection of cardiac troponin T for acute
myocardial infarction, Talanta 146 (2016) 823–830.
[10] D.X. Zhang, Y. Wang, S.B. Yu, H. Niu, X.J. Gong, X. Miao, Serum relaxin levels as a
novel biomarker for detection of acute myocardial infarction, Int. J. Clin. Exp. Med.
8 (2015) 16937–16940.
[11] M. Rubini Gimenez, R. Twerenbold, T. Reichlin, K. Wildi, P. Haaf, M. Schaefer,
C. Zellweger, B. Moehring, F. Stallone, S.M. Sou, M. Mueller, K. Denhaerynck,
T. Mosimann, M. Reiter, B. Meller, M. Freese, C. Stelzig, I. Klimmeck, J. Voegele,
B. Hartmann, K. Rentsch, S. Osswald, C. Mueller, Direct comparison of high-
sensitivity-cardiac troponin I vs. T for the early diagnosis of acute myocardial
infarction, Eur. Heart J. 35 (2014) 2303–2311.
[12] G.J. Kost, N.K. Tran, Point-of-Care Testing and Cardiac Biomarkers: the Standard
of Care and Vision for Chest Pain Centers, Cardiol. Clin. 23 (2005) 467–490.
[13] G. Kocak, A. Azak, B. Huddam, F. Yalcin, B. Guven, M. Can, M. Duranay, Influence
of intraperitoneal volume on QT dispersion in patients with continuous ambulatory
peritoneal dialysis: acute cardiac impact of peritoneal dialysis, Ren. Fail 33 (2011)
568–571.
[14] D. Proske, M. Blank, R. Buhmann, A. Resch, Aptamers–basic research, drug
development, and clinical applications, Appl. Microbiol. Biotechnol. 69 (2005)
367–374.
[15] K.M. Song, S. Lee, C. Ban, Aptamers and their biological applications, Sensors
(Basel) 12 (2012) 612–631.
[16] H. Jo, C. Ban, Aptamer-nanoparticle complexes as powerful diagnostic and
therapeutic tools, Exp. Mol. Med. 48 (2016) e230.
[17] R.Y. Lai, K.W. Plaxco, A.J. Heeger, Aptamer-based electrochemical detection of
picomolar platelet-derived growth factor directly in blood serum, Anal. Chem. 79
(2007) 229–233.
[18] Y. Xiao, A.A. Lubin, A.J. Heeger, K.W. Plaxco, Label-free electronic detection of
thrombin in blood serum by using an aptamer-based sensor, Angew. Chem. Int. Ed.
Engl. 44 (2005) 5456–5459.
[19] A.E. Radi, J.L. Acero Sanchez, E. Baldrich, C.K. O'Sullivan, Reagentless, reusable,
ultrasensitive electrochemical molecular beacon aptasensor, J. Am. Chem. Soc. 128
H. Jo et al.
(2006) 117–124.
[20] H. Jo, H. Gu, W. Jeon, H. Youn, J. Her, S.K. Kim, J. Lee, J.H. Shin, C. Ban,
Electrochemical aptasensor of cardiac troponin I for the early diagnosis of acute
myocardial infarction, Anal. Chem. 87 (2015) 9869–9875.
[21] K.R. Davies, A.W. Gelb, P.H. Manninen, D.R. Boughner, D. Bisnaire, Cardiac
function in aneurysmal subarachnoid haemorrhage: a study of electrocardiographic
and echocardiographic abnormalities, Br. J. Anaesth. 67 (1991) 58–63.
[22] A. Maznyczka, T. Kaier, M. Marber, Troponins and other biomarkers in the early
diagnosis of acute myocardial infarction, Postgrad. Med. J. 91 (2015) 322–330.
[23] J.W. Choi, K.W. Oh, J.H. Thomas, W.R. Heineman, H.B. Halsall, J.H. Nevin,
A.J. Helmicki, H.T. Henderson, C.H. Ahn, An integrated microfluidic biochemical
detection system for protein analysis with magnetic bead-based sampling capabil-
ities, Lab Chip 2 (2002) 27–30.
[24] R. Pallela, P. Chandra, H.B. Noh, Y.B. Shim, An amperometric nanobiosensor using
a biocompatible conjugate for early detection of metastatic cancer cells in biological
fluid, Biosens. Bioelectron. 85 (2016) 883–890.
[25] G. Bhanjana, N. Dilbaghi, S. Chaudhary, K.H. Kim, S. Kumar, Robust and direct
electrochemical sensing of arsenic using zirconia nanocubes, Analyst 141 (2016)
4211–4218.
[26] T.Y. Lee, Y.B. Shim, S.C. Shin, Simple preparation of terthiophene-3′-carboxylic
acid and characterization of its polymer, Synth. Met. 126 (2002) 105–110.
[27] S. Pramanik, P. Banerjee, A. Sarkar, S.C. Bhattacharya, Size-dependent interaction
of gold nanoparticles with transport protein: a spectroscopic study, J. Lumin. 128
448
Talanta 165 (2017) 442–448
(2008) 1969–1974.
[28] D.M. Kim, Y.B. Shim, Disposable amperometric glycated hemoglobin sensor for the
finger prick blood test, Anal. Chem. 85 (2013) 6536–6543.
[29] H.J. Kim, K.S. Lee, M.S. Won, Y.B. Shim, Characterization of protein-attached
conducting polymer monolayer, Langmuir 24 (2008) 1087–1093.
[30] G.T. Hermanson, Bioconjugate techniques, third edition, Elsevier/AP, London,
Waltham, MA, 2013.
[31] M.A. Rahman, N.H. Kwon, M.S. Won, E.S. Choe, Y.S. Shim, Functionalized
conducting polymer as an enzyme-immobilizing substrate: an amperometric
glutamate microbiosensor for in vivo measurements, Anal. Chem. 77 (2005)
4854–4860.
[32] Z. Chen, L. Li, H. Zhao, L. Guo, X. Mu, Electrochemical impedance spectroscopy
detection of lysozyme based on electrodeposited gold nanoparticles, Talanta 83
(2011) 1501–1506.
[33] M.A. Rahman, M.S. Won, Y.B. Shim, The potential use of hydrazine as an
alternative to peroxidase in a biosensor: comparison between hydrazine and HRP-
based glucose sensors, Biosens. Bioelectron. 21 (2005) 257–265.
[34] S. Altinier, M. Mion, A. Cappelletti, M. Zaninotto, M. Plebani, Rapid measurement
of cardiac markers on stratus CS, Clin. Chem. 46 (2000) 991–993.
[35] J.P. Chapelle, M.C. Aldenhoff, L. Pierard, J. Gielen, Comparison of cardiac troponin
I measurements on whole blood and plasma on the stratus CS analyzer and
comparison with AxSYM, Clin. Chem. 46 (2000) 1864–1866.