Anda di halaman 1dari 10

Aplikasi Teknologi DNA Rekombinan pada Rekayasa Genetik

Kentang Tahan Penyakit Late Blight

Edy. F. Lengkong

(Staf Pengajar jur.Budidaya Fak. Pertanian Universitas Sam Ratulangi-Manado)


E-mail: edylengkong@yahoo.com

ABSTRAK
Lengkong, E.F. 2008. Application of Recombinan DNA Technology on potato
genetic engineering resistance to late blight disease. J. Formas
Potato (Solanum tuberosum) is one of the important crop besides wheat, rice and
maize. Cultivate this crop is most influenced by late blight disease that is caused
of Phytophthora infestans fungi. This disease can decrease the potato productivity
15 % until 100 %. Farmers usually used chemical fungicide spraying to protect
their plant from this disease, but this application are costly and give bad impact to
environment. Development of Recombinant DNA technology in plant
improvement is useful to produce potato plant that resistance to late blight
disease attack. By recombinant DNA technology be able to create a new
transgenic potato plant containing particular gene that can stimulate resistant to
late blight. This article explain briefly how the application of Recombinant DNA
technology to get the transgenic potato resistance to late blight disease.
Keywords : Solanum tuberosum, Phytophthora infestans, Recombinan DNA
technology,

PENDAHULUAN
Kentang merupakan tanaman pangan penting di dunia selain gandum, padi
dan jagung. Sebagai tanaman pangan, kentang merupakan sumber pangan
dengan kandungan nutrisi tinggi, yang menyediakan banyak vitamin penting,
mineral, dan asam amino dan merupakan sumber tambahan nutrisi dan kalori
yang penting pada masyarakat yang dalam kebutuhan pangan hariannya
didominasi beras (Anonim, 2004)
Usaha budidaya kentang saat ini sangat dipengaruhi oleh adanya penyakit
late blight yang disebabkan oleh patogen jamur Phytophthora infestans. Patogen
ini menyerang baik daun dan umbi kentang, terutama pada musim hujan, yang
kalau tidak dikendalikan sejak dini dapat menyebabkan kehancuran/gagal panen
pada satu hamparan pertanaman. Rata-rata kehilangan hasil akibat serangan
peyakit ini diseluruh dunia sebasar 15 %. Di Indonesia dengan luas penanaman
kentang sebesar 65.000 ha, rata-rata biaya penanggulangan penyakit late blight
dengan menggunakan fungisida mencapai 224 US$/ha (ABSP-II, 2008)
Mempertimbangkan seriusnya tingkat serangan penyakit late blight
terhadap kehilangan hasil kentang, biaya penanggulangan dengan fungsida yang
tinggi serta dampaknya terhadap lingkungan dan kesehatan produk, maka
dianggap perlu segera dilakukan upaya penanggulangan terhadap penyakit ini
melalui pemuliaan tanaman kentang tahan penyakit late blight.
Pemuliaan kentang tahan late blight dapat dilakukan secara konvensional,
yaitu dengan persilangan antara tanaman kentang budidaya yang peka penyakit
late blight dengan tanaman kentang tipe liar yang memiliki sifat/gen ketahanan
terhadap penyakit late blight. Metode lainnya yang dapat digunakan adalah
melalui teknologi DNA rekombinan atau rekayasa genetika, yaitu dilakukan
dengan cara memasukan konstruksi gen tertentu yang tahan terhadap penyakit
late blight ke tanaman peka sehingga tanaman tersebut menjadi tahan terhadap
penyakit late blight (Litbang Deptan, 2007; Glick and Pasternak, 1991; )
Melalui tulisan ini akan coba dijelaskan secara singkat bagaimana
penerapan teknologi DNA rekombinan untuk mendapatkan tanaman kentang
transgenik yang tahan penyakit late blight mulai dari isolasi gen ketahanan,
konstruksi gen dan perbanyakan pada plasmid rekombinan, transformasi
ketanaman kentang yang dimediasi oleh agrobacterium tumefaciens, deteksi dini
keberhasilan transformasi.

REKAYASA GENETIK KENTANG TAHAN PENYAKIT LATE BLIGHT


Secara garis besar upaya rekayasa genetik dengan teknologi DNA Rekombinan
untuk mendapat suatu tanaman kentang yang tahan terhadap penyakit late blight
meliputi 4 (empat) kegiatan pokok, yaitu identifikasi dan isolasi gen ketahanan;
Konstruksi gen ketahanan pada plasmid vektor tertentu dan perbanyakan
konstruksi gen tersebut pada sel inang; Transformasi konstruksi gen ke tanaman
kentang dan; Deteksi hasil transformasi pada tanaman transgenik (Sambrook,
et.al. 1989 ; Stiekema and Visser, 1991)

Isolasi gen ketahanan late blight.


Awal dari suatu kegiatan rekayasa genetika adalah bagaimana gen target
yang dibutuhkan diidentifikasi dan diisolasi, gen-gen tersebut dapat berasal dari
berbagai sumber baik dari jenis tanaman kentang budidaya, kentang non
budidaya (tipe liar), jenis tanaman lain maupun dari mikroorganisme. Gen
ketahanan terhadap penyakit late blight yang telah berhasil diidentifikasi antara
lain gen endo-1-3 β-glucanase, gen Chitinase yang berasal dari jamur
Trichoderma, gen penyandi glucose oxidase, dan gen RB yang diisolasi dari
tanaman kentang tipe liar Solanum bulbocastanum (Jones, R.W., et al. 2006;
Budiani , et al. 2000; Bisaria, V..S., et al. 1990; Martín-Cuadrado, et al. 2003;
Colton, et al. 2006)
Gen ketahanan dari genom donor dapat diperoleh dengan cara mengisolasi
DNA total genom atau dari RNA total. Selanjutnya untuk mendapatkan klon cDNA
gen target yang berasal dari RNA dapat dilakukan dengan RT-PCR, menggunakan
primer spesifik tertentu. Misalnya untuk gen ketahanan xyloglucan specifik
endoglucanase inhibitor (XEIP) menggunakan primer dengan urutan sekuens 5’
CTCGAGATGGCTTCTTCTTATTGT 3’(AXF) dan
5’CTCGAGAGCAATTGAAGTGAAATT 3’ (AXR). Sintesis cDNA tersebut dilakukan
dengan menggunakan Superscript III one Step RT-PCR System kit protokol
(Johansen and Carrington, 2001) . Gen glukanase dapat menggunakan primer
spesifik βglu-F 5’ GCCAACCIGTCTCCGATACA 3’ dan primer βglu-R 5’
GCAGTTGGAAATGAAGTCAG 3’. Untuk gen Khitinase menggunakan primer
Chi-F 5’ GGCCAGACACCAGAATTGA-3’ dan primer Chi-R 5’
TCCACTTGATATGAAAGTC -3’ (Budiani, dkk. 2004). Sedangkan untuk isolasi
gen RB menggunakan primer dengan sekuens 5’ CACGAGTGCCCTTTTCTGAC
3’ dan primer 5’ACAATTGAATTTTTAGACTT 3’ (Colton, et al. 2006). cDNA
yang berasal DNA total dapat diperoleh dengan cara menggandakan fragmen gen
target menggunakan jenis primer yang sama. Hasil PCR tersebut selanjutnya
dielektroforesis pada gel agarose dan pita DNA target dikeluarkan dari gel,
dipurifikasi dan diklon pada vektor plasmid tertentu menjadi pustaka cDNA untuk
gen ketahanan penyakit late blight.

Konstruksi dan penggandaan gen ketahanan

Gen ketahanan yang telah berhasil diisolasi sebelum dimasukkan ke


tanaman kentang yang peka penyakit late blight harus dikonstruksi terlebih dahulu
pada plasmid vektor tertentu yang memiliki marker/penanda seleksi antibiotik
tertentu. Salah satu plasmid vektor yang dapat digunakan misalnya plasmid
pCambia 1302. Plasmid ini pada open reading frame (ORF) dari T-DNA selain
memiliki marker seleksi hygromycin dan canamycin, juga memiliki gen green
fluorecens protein (GFP) yang dapat menjadi agen seleksi dini keberhasilan
transformasi (Johansen and Carrington, 2001)
Konstruksi gen ketahanan pada plasmid vektor dilakukan denga mula-mula
mengeluarkan fragmen gen target pada klon cDNA meggunakan jenis enzim
restriksi tertentu yang situs pemotongannya juga terdapat pada ORF plasmid
pCambia, misalnya enzim restriksi Xho. Pemotongan enzim restriksi yang sama
juga dilakukan pada plasmid vektor, sehingga plasmid vektor tersebut menjadi
linear dengan ujung-ujung memiliki urutan basa nitrogen yang saling
komplementer dengan ujung fragmen klon cDNA. Penyatuan/konstruksi antara
plasmid vektor dan klon cDNA disambungkan dengan menggunakan Quick Ligase
(Promega) sehingga menghasilkan konstruksi plasmid rekombinan yang
mengandung gen ketahanan late blight. DNA ini dapat disimpan pada suhu -20 0C
sebelum digunakan.

Gambar 1. Topologi Plasmid Vektor pCambia 1302

Konstruksi plasmid rekombinan ini sebelum digunakan terlebih dahulu


diperbanyak dan periksa ada tidaknya fragmen DNA (gen) yang telah disisipkan
dengan cara memasukan konstruksi plasmid tersebut pada bakteri Escherichia
coli, dan untuk tujuan transformasi gen spesifik ke dalam genom tanaman
digunakan Agrobacterium tumfaciens yang bertindak sebagai inang sekaligus
transporter gen spesifik tersebut. Bakteri-bakteri ini ditumbuhkn pada media Luria
Berthani (LB) yang ditambahkan antibiotik tertentu sesuai dengan agen seleksi
yang dimiliki oleh plasmid vektor tersebut, dan hanya koloni bakteri yang hidup
yang dapat ditransformasikan karena koloni tersebut merupakan kumpulan
bakteri yang membawa gen ketahanan yang telah disisipkan tersebut. Koloni
bakteri ini yang mengandung konstruksi gen ketahanan, bila belum akan
digunakan dapat disimpan pada suhu 40C dan dapat diremajakan setiap 1 bulan

Transformasi gen ketahanan ke tanaman kentang

Transformasi gen pada dasarnya dapat dilakukan dengan beberapa


metode seperti dengan menggunakan bakteri Agrobacterium tumefaciens,
mikroinjeksi, elektroporasi, penembakan partikel, DNA virus/fage lamda. Khusus
untuk transformasi pada tanaman kentang metode yang biasa digunakan dan
memberikan hasil transformasi yang memuaskan yaitu menggunakan
Agrobacterium tumefaciens (Stiekema and Visser, 1991)
Transformasi dengan diperantaraan Agrobacterium tumefaciens dilakukan
dengan cara mula-mula agrobacterium yang didalamnya mengandung gen
ketahanan pada plasmid vektor ditumbuhkan selama 1-2 hari pada media LB cair
yang ditambahkan antibiotik tertentu, kemudian disentrifugasi dan pelet yang
terbentuk ditambahkan dengan media feeding layer yang mengandung nutrisi
makro-mikro, vitamin, hormon tumbuh dan acetosyringone. Suspensi bakteri ini
dipakai untuk merendam eksplan kentang (bagian nodus atau internodus) yang
sebelumnya telah 2 hari ditumbuhkan diatas kertas saring whatman pada media
feeding layer. Selanjutnya eksplan tersebut di kokultivasi selama 2 hari kemudian
dipindahkan ke media regenerasi sampai menghasilkan tunas dan planlet.
Metode transformasi lain yang dapat digunakan adalah secara agroinfiltrasi.
Metode ini dilakukan dengan cara membasahi permukaan eksplan (bagian
permukaan daun) dengan suspensi agrobacterium, dimana sebelumnya
permukaan daun tersebut telah diberi tekanan secukupnya dengan ujung syring
untuk memudahkan penetrasi agrobacterium ke bagian dalam jaringan (Johansen
and Carrington. 2001; Jones, el.al. 2006);
Transformasi agrobacterium baik melalui agroinfiltrasi dan co-cultivation
dalam waktu 3-4 minggu akan menghasilkan tanaman transforman yang masih
membutuhkan pengujian keberhasilan transformasi untuk memastikan apakah
tanaman transgenik yang diperoleh benar-benar mengandung gen ketahanan
yang diinsersikan serta mampu mengekspresikan sifat ketahanan terhadap
penyakit late blight..

Deteksi keberhasilan transformasi

Deteksi keberhasilan transformasi dapat dilakukan secara dini yaitu


beberapa jam setelah inokulasi atau setelah tanaman transforman tumbuh
menjadi tanaman transforman beberapa minggu kemudian. Deteksi dini hasil
transformasi bertujuan untuk mengetahui apakah gen target yang
disisipkan/transformasikan berhasil masuk ketanaman resipien, Sedangkan
deteksi tingkat lanjutan bertujuan untuk mengetahui apakah tanaman dapat
mengekspresikan gen tersebut melalui penampilan ketahanan terhadap penyakit
dilapang
Deteksi dini dapat dilakukan secara visual melalui ekspresi gen GFP, yaitu
dengan melihat signal fluoresens menggunakan mikroskop UV pada daun
tanaman yang ditansformasi atau dengan pemotretan menggunakan kamera
digital tertentu yang mampu mendeteksi pendaran fluoresens pada bagian daun
yang ditransformasi (metode agroinfiltrasi). Pendaran fluoresens tersebut
merupakan ekspresi dari gen GFP yang terdapat pada plasmid rekombinan yang
telah ditranformasikan tersebut (Jones, el.al. 2006);
Deteksi dini keberhasilan transformasi juga dapat dilakukan
menggunakan metode Southern Blot. Melalui metode ini DNA tanaman
transforman diisolasi dan gen ketahanan yang telah disisipan tersebut dideteksi
dengan menggunakan klon cDNA yang telah didapatkan pada tahap awal
kegiatan isolasi gen sebagai probe/pelacak. Pelacakan terhadap gen ketahanan
tersebut dapat dilakukan karena probe tersebut telah diberikan penanda yang bisa
berbahan radioaktif atau non radioaktif. Tanaman transforman yang mengandung
gen ketahanan DNAnya dielektroforesis pada gel agarose, kemudian ditransfer
ke membran nilon. Pada tanaman transgenik yang membawa gen
ketahananan, maka bila DNA pada membran nilon tersebut dihibridisasikan
dengan klon cDNA probe akan memberikan signal pada lembaran film setelah
diautoradiografi pada ruang gelap (Wiendi, 2005; Sambrook, et al.1989)
Bentuk deteksi dini lainnya yang juga dapat digunakan yaitu dengan
menggunakan PCR untuk menggandakan segmen DNA tanaman transforman
yang mengandung gen ketahanan tersebut dengan menggunakan primer spesifik
seperti yang dipakai pada isolasi gen ketahanan sebelumnya. Bila transforman
memiliki gen tanaman tersebut maka penggandaan dengan PCR terhadap DNA
total tanaman akan menghasilkan pita DNA yang ukurannya sesuai dwngan
ukuran gen yang disisipkan. Demikian sebaliknya, bila tanaman tidak
mengandung gen target maka penggandaan dengan PCR tidak akan
menghasilkan pita DNA pada gel elektroforesis . (Wiendi, 2005; Budiani, dkk. 2004
dan Siswanto, dkk. 2003)
Tanaman-tanaman transforman mengandung gen ketahanan berdasarkan
hasil seleksi dini selanjutnya harus diuji ekspresi gen ketahanannya secara
bioassay . Bioassay dilakukan dengan cara menginokulasikan suspensi sporagia
dari patogen Phytophthora infestans langsung ke daun tanaman transforman
maupun pada tanaman yang tidak ditransformasi sebagai kontrol. 6 hari Setelah
inokulasi akan terlihat apakah tanaman transforman tahan atau tidak tahan
tehadap patogen tersebut melalui gejala serangan pada luasan permukaan daun
yang terinfeksi yang dibandingkan dengan tanaman kontrol.
Tanaman yang tahan tehadap patogen late blight merupakan tanaman
transgenik yang nanti setelah melalui tahapan skrining yang ketat dan sosialisasi
pada masyarakat dan memenuhi persyarakatan keamanan pangan, pada suatu
saat dapat dilepas untuk dibudidayakan sebagai jenis kentang baru yang tahan
terhadap penyakit late blight.

KESIMPULAN

Penyakit late blight yang menyerang tanaman kentang dapat


menurunkan produksi tanaman, dapat dikendalikan dengan menggunakan
tanaman kentang tahan late blight yang dihasilkan baik dengan pemuliaan
konvensional maupun nonkonvensional dengan teknologi DNA rekombinan
melalui proses rekayasa genetika
Rekayasa genetika untuk menghasilkan tanaman transgenik yang tahan
penyakit late blight dapat dilakukan karena didukung oleh tersedianya teknologi
DNA rekombinan yang terus berkembang sehingga memungkinkan peneliti
mengidentifikasi, mengisolasi, menggandakan, memasukan gen ketahanan
tersebut pada tanaman kentang budidaya yang peka penyakit late blight, bahkan
dapat mendeteksi keberhasilan transformasi gen tersebut pada tingkat dini
sehingga dapat mempersingkat waktu pengujian hasil transformasi.
Keberhasilan transformasi gen pada akhirnya ditentukan oleh apakah gen
yang diinsersikan/disisipkan ke genom tanaman dapat diekspresikan oleh
tanaman tersebut bilamana tanaman tersebut dipaparkan langsung dengan
patogen penyakit, serta apakah gen ketahanan ini tetap dapat diekspresikan pada
generasi-generasi selanjutnya. Untuk menjawab ini maka uji bioassay mutlak
dilakukan.
Akhirnya, bagaimanapun hebatnya teknologi yang sudah dikembangkan
untuk menghasilkan tanaman tanaman transgenik yang mampu mengatasi
kendala-kendala dibidang pertanian, semuanya tidak akan banyak berarti atau
hanya akan sampai pada tataran eksperimen dilaboratorium kalau masyarakat
yang merupakan muara akhir dari produk transgenik tidak dapat memahami,
menerima dan menggunakan produk ini, oleh karena proses sosialisasi yang
menyeluruh perlu terus dilakukan pada semua lapisan masyarakat baik oleh
pemerintah sebagai pemegang otoritas maupun oleh peneliti sebagai perekayasa
produk tanaman transgenik.

DAFTAR PUSTAKA

Anonimous, 2004. Indonesia late blight profile. http://gilb.cip.cgiar.org. 13 Januari


2008

ABSP II, 2008. Late blight, Single-project report.


http://www.absp2.cornel.edu/project, 13 Januari 2008

Bisaria, S., P. S. R. Babu and T. Panda, Madras , 1990. Endoglucanase from the
mixed culture of Trichoderma reesei and Aspergillus wentii. Bioprocess
Engineering, 5 : 119-121
Budiani, A, I. Susanti, S. Mawardi, D.A. Santoso, dan Siswanto. 2004. Ekspresi β-
glukanase dan Kitinase pada tanaman kopi arabika (Coffea arabica L.) tahan
dan rentan karat daun. Menara Perkebunan 72(2):55-68.

Colton, L.M, H.I.Groza, S.M.Wielgus, and J.Jiang. 2006. Marker-assisted selection


for the broard-spectrum potat late blight resistance conferred by gene RB
dirived from a wild potato species. Crop Science 46 (2):589-594

Glick,B.R, J.J.Pasternak. 1994. Molecuar Biothecnology: Principles and


application of recombinant DNA. ASM press, Washington DC.

Jones, R.W., M. Ospina-Giraldo, and K. Dealh. 2006. Gene silencing indicates a


role for endoglucanase inhiitor protein in germplasm reistance to late blight.
Amer J. of Potato Res. 81:41-46

Johansen, L.K and J.C.Carrington. 2001. Silencing on the spot induction and
supression of RNA silencing in the Agrobacterium-mediated transient
expression system. Plant pysiol. 126:930-938

Litbang Deptan. 2007. Kentang transgenic tahan hawar daun. http://


www.litbang.deptan.go.id . 13 januari 2008

Martín-Cuadrado1, A. B., E. Dueñas, M. Sipiczki, C. R. V. de Aldana1, and F. del


Rey1. 2003. The endo-b-1,3-glucanase eng1p is required for dissolution
of the primary septum during cell separation in Schizosaccharomyces
pombe

Sambrook,J, E.F,Fritsch, T.Maniatis. 1989. Molecular cloning; A laboratory


manual 2nd (ed). Cold Spring Harbor Laboratory Press

Siswanto, F. Oktavia, A. Budiani, Sudarsono, Priyono, dan S. Mawardi. 2003.


Transformasi kopi robusta (Coffea canephora) dengan gen kitinase melalui
Agrobacterium tumefaciens LBA4404. Menara Perkebunan 71(2):56-69

Stiekema,W.J and L. Visser. 1991.Gene transfer and gene to be transfered. in


Biotechnological Innovations in Crop Improvement. Butterworth-Heineman
Ltd.

Wiendi, Ni Made Armini. 2005. Konstruksi fusi transkripsi gen kitinase asal
Aeromonas caviae WS7b dan ekspresinya pada tanaman kentang kultivar
Desiree. Disertasi. Sekolah Pascasarjana IPB.